#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
BMP8A	353500	broad.mit.edu	37	1	39957981	39957981	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:39957981G>C	ENST00000331593.5	+	1	664	c.318G>C	c.(316-318)atG>atC	p.M106I		NM_181809.3	NP_861525.2	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8a	106					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|diet induced thermogenesis (GO:0002024)|growth (GO:0040007)|negative regulation of insulin secretion (GO:0046676)|ossification (GO:0001503)|regulation of energy homeostasis (GO:2000505)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(1)|skin(1)	5	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACCTGGTCATGAGCTTCGTCA	0.741																																							uc001cdi.2		NA																	0					0						c.(316-318)ATG>ATC		bone morphogenetic protein 8A precursor							9.0	12.0	11.0					1																	39957981		1664	3353	5017	SO:0001583	missense	353500				cartilage development|cell differentiation|growth|ossification	extracellular space	cytokine activity|growth factor activity	g.chr1:39957981G>C	AY303954	CCDS437.1	1p35-p32	2014-01-30			ENSG00000183682	ENSG00000183682		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	21650	protein-coding gene	gene with protein product							Standard	NM_181809		Approved		uc001cdi.3	Q7Z5Y6	OTTHUMG00000008394	ENST00000331593.5:c.318G>C	1.37:g.39957981G>C	ENSP00000327440:p.Met106Ile						p.M106I	NM_181809	NP_861525	Q7Z5Y6	BMP8A_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		1	664	+	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	106					Q5T3A5	Missense_Mutation	SNP	ENST00000331593.5	37	c.318G>C	CCDS437.1	.	.	.	.	.	.	.	.	.	.	g	18.75	3.690725	0.68271	.	.	ENSG00000183682	ENST00000331593	T	0.66099	-0.19	3.24	3.24	0.37175	Transforming growth factor-beta, N-terminal (1);	0.048338	0.85682	U	0.000000	T	0.70509	0.3232	M	0.88640	2.97	0.54753	D	0.999989	P	0.49358	0.923	P	0.46796	0.527	T	0.76932	-0.2776	9	.	.	.	.	11.7074	0.51605	0.0:0.1803:0.8197:0.0	.	106	Q7Z5Y6	BMP8A_HUMAN	I	106	ENSP00000327440:M106I	.	M	+	3	0	BMP8A	39730568	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	2.722000	0.47269	1.556000	0.49512	0.298000	0.19748	ATG		0.741	BMP8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023079.1	NM_181809		6	15	0	0	0	0.001984	0	6	15				
HEYL	26508	broad.mit.edu	37	1	40092420	40092420	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:40092420C>T	ENST00000372852.3	-	5	1065	c.746G>A	c.(745-747)cGc>cAc	p.R249H	HEYL_ENST00000535435.1_Missense_Mutation_p.R221H	NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	249	Pro-rich.				atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CTCTAGGGGGCGGGCCCTCCG	0.692																																							uc001cdp.2		NA																	0				ovary(1)	1						c.(745-747)CGC>CAC		hairy/enhancer-of-split related with YRPW							6.0	8.0	7.0					1																	40092420		2137	4186	6323	SO:0001583	missense	26508				multicellular organismal development|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr1:40092420C>T	BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.746G>A	1.37:g.40092420C>T	ENSP00000361943:p.Arg249His					HEYL_uc010oiw.1_Missense_Mutation_p.R221H	p.R249H	NM_014571	NP_055386	Q9NQ87	HEYL_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		5	797	-	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	249			Pro-rich.		Q5TG99	Missense_Mutation	SNP	ENST00000372852.3	37	c.746G>A	CCDS439.1	.	.	.	.	.	.	.	.	.	.	C	11.88	1.770184	0.31320	.	.	ENSG00000163909	ENST00000372852;ENST00000535435	T;T	0.58506	0.33;0.33	5.19	3.22	0.36961	.	1.524060	0.03519	N	0.220641	T	0.48314	0.1493	L	0.41710	1.295	0.23089	N	0.998318	B	0.11235	0.004	B	0.06405	0.002	T	0.20806	-1.0264	10	0.27082	T	0.32	-3.04	4.5929	0.12315	0.1713:0.6386:0.0:0.1902	.	249	Q9NQ87	HEYL_HUMAN	H	249;221	ENSP00000361943:R249H;ENSP00000439071:R221H	ENSP00000361943:R249H	R	-	2	0	HEYL	39865007	0.170000	0.23016	0.466000	0.27168	0.803000	0.45373	0.373000	0.20484	0.504000	0.28082	0.462000	0.41574	CGC		0.692	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001179.2	NM_014571		4	3	0	0	0	0.000602	0	4	3				
C8A	731	broad.mit.edu	37	1	57349288	57349288	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:57349288G>T	ENST00000361249.3	+	6	885	c.789G>T	c.(787-789)gtG>gtT	p.V263V		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	263	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)		p.V263V(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						CTTTATTGGTGGGTGTAGGTG	0.403																																							uc001cyo.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(787-789)GTG>GTT		complement component 8, alpha polypeptide							72.0	71.0	71.0					1																	57349288		2203	4300	6503	SO:0001819	synonymous_variant	731				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex		g.chr1:57349288G>T	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.789G>T	1.37:g.57349288G>T							p.V263V	NM_000562	NP_000553	P07357	CO8A_HUMAN			6	921	+			263			MACPF.		A2RUI4|A2RUI5|Q13668|Q9H130	Silent	SNP	ENST00000361249.3	37	c.789G>T	CCDS606.1																																																																																				0.403	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562		19	54	1	0	3.62473e-10	0.012319	4.03281e-10	19	54				
TGFBR3	7049	broad.mit.edu	37	1	92187533	92187533	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:92187533G>A	ENST00000525962.1	-	7	1115	c.1054C>T	c.(1054-1056)Cat>Tat	p.H352Y	TGFBR3_ENST00000212355.4_Missense_Mutation_p.H352Y|TGFBR3_ENST00000370399.2_Missense_Mutation_p.H352Y			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	352					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		AGCCGAAGATGAAATCTATTA	0.388																																							uc001doh.2		NA																	0				ovary(3)	3						c.(1054-1056)CAT>TAT		transforming growth factor, beta receptor III							89.0	81.0	83.0					1																	92187533		2203	4300	6503	SO:0001583	missense	7049				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding	g.chr1:92187533G>A	L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.1054C>T	1.37:g.92187533G>A	ENSP00000436127:p.His352Tyr					TGFBR3_uc009wde.2_Missense_Mutation_p.H130Y|TGFBR3_uc010osy.1_Missense_Mutation_p.H310Y|TGFBR3_uc001doi.2_Missense_Mutation_p.H352Y|TGFBR3_uc001doj.2_Missense_Mutation_p.H352Y	p.H352Y	NM_003243	NP_003234	Q03167	TGBR3_HUMAN		all cancers(265;0.0108)|Epithelial(280;0.0825)	8	1520	-		all_lung(203;0.00719)|Lung NSC(277;0.0268)	352			Extracellular (Potential).		A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	ENST00000525962.1	37	c.1054C>T	CCDS30770.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894125	0.72639	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	T;T;T;T	0.32272	1.46;1.47;1.46;1.47	5.25	5.25	0.73442	.	0.137510	0.64402	D	0.000002	T	0.48429	0.1499	M	0.62723	1.935	0.48830	D	0.999716	D;D;D	0.89917	0.994;1.0;0.998	P;D;P	0.85130	0.854;0.997;0.854	T	0.47182	-0.9137	10	0.62326	D	0.03	-15.7272	19.1995	0.93707	0.0:0.0:1.0:0.0	.	352;352;352	A8K5N0;Q03167-2;Q03167	.;.;TGBR3_HUMAN	Y	352	ENSP00000212355:H352Y;ENSP00000359426:H352Y;ENSP00000436127:H352Y;ENSP00000432638:H352Y	ENSP00000212355:H352Y	H	-	1	0	TGFBR3	91960121	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.245000	0.72398	2.634000	0.89283	0.561000	0.74099	CAT		0.388	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243		4	39	0	0	0	0.009096	0	4	39				
PYGO2	90780	broad.mit.edu	37	1	154931673	154931673	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:154931673G>A	ENST00000368457.2	-	3	974	c.803C>T	c.(802-804)tCt>tTt	p.S268F	RP11-307C12.12_ENST00000605085.1_RNA|PYGO2_ENST00000368456.1_Missense_Mutation_p.S231F|PYGO2_ENST00000483463.1_5'Flank	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	268	Pro-rich.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AAAAGCAGTAGAAGCAGGTGG	0.647																																					NSCLC(87;357 1460 1955 21029 23522)	NSCLC(87;357 1460 1955 21029 23522)	uc001fft.2		NA																	0				skin(1)	1						c.(802-804)TCT>TTT		pygopus homolog 2							11.0	11.0	11.0					1																	154931673		2200	4299	6499	SO:0001583	missense	90780				Wnt receptor signaling pathway	nucleus	protein binding|zinc ion binding	g.chr1:154931673G>A	BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.803C>T	1.37:g.154931673G>A	ENSP00000357442:p.Ser268Phe						p.S268F	NM_138300	NP_612157	Q9BRQ0	PYGO2_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		3	1009	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		268			Pro-rich.		Q8WYZ4|Q96CY2	Missense_Mutation	SNP	ENST00000368457.2	37	c.803C>T	CCDS1075.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.851437	0.32699	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.47528	0.84;0.85	4.72	4.72	0.59763	.	0.340382	0.26203	N	0.025733	T	0.15349	0.0370	N	0.08118	0	0.26870	N	0.967768	B	0.06786	0.001	B	0.04013	0.001	T	0.16958	-1.0385	10	0.62326	D	0.03	-0.0568	14.7378	0.69430	0.0:0.0:1.0:0.0	.	268	Q9BRQ0	PYGO2_HUMAN	F	268;231	ENSP00000357442:S268F;ENSP00000357441:S231F	ENSP00000357441:S231F	S	-	2	0	PYGO2	153198297	0.995000	0.38212	0.993000	0.49108	0.708000	0.40852	3.194000	0.51005	2.454000	0.82982	0.462000	0.41574	TCT		0.647	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090949.1	NM_138300		6	27	0	0	0	0.001984	0	6	27				
SH2D2A	9047	broad.mit.edu	37	1	156779054	156779054	+	Missense_Mutation	SNP	C	C	T	rs147765972		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:156779054C>T	ENST00000368199.3	-	7	1096	c.943G>A	c.(943-945)Gcc>Acc	p.A315T	SH2D2A_ENST00000368198.3_Missense_Mutation_p.A297T|SH2D2A_ENST00000392306.2_Missense_Mutation_p.A325T	NM_001161443.1|NM_001161444.1|NM_003975.3	NP_001154915.1|NP_001154916.1|NP_003966.2	Q9NP31	SH22A_HUMAN	SH2 domain containing 2A	315	Pro-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	SH3/SH2 adaptor activity (GO:0005070)	p.A325T(2)|p.A315T(2)		endometrium(1)|large_intestine(2)|lung(15)	18	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCAAGGGTGGCGGGTAGGCCC	0.597																																							uc001fqd.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(943-945)GCC>ACC		SH2 domain protein 2A isoform 2							134.0	134.0	134.0					1																	156779054		2203	4300	6503	SO:0001583	missense	9047				angiogenesis|cell differentiation|signal transduction	cytoplasm|soluble fraction	SH3 domain binding|SH3/SH2 adaptor activity	g.chr1:156779054C>T	AJ000553	CCDS1159.1, CCDS53380.1, CCDS53381.1	1q21	2013-02-14	2010-04-21		ENSG00000027869	ENSG00000027869		"""SH2 domain containing"""	10821	protein-coding gene	gene with protein product	"""T lymphocyte specific adaptor protein"", ""T cell specific adapter protein TSAd"", ""T cell specific adpater protein TSAd"""	604514	"""SH2 domain protein 2A"""			9468509	Standard	NM_003975		Approved	TSAd, F2771	uc009wsh.2	Q9NP31	OTTHUMG00000041305	ENST00000368199.3:c.943G>A	1.37:g.156779054C>T	ENSP00000357182:p.Ala315Thr					SH2D2A_uc001fqc.1_Missense_Mutation_p.A287T|SH2D2A_uc009wsh.2_Missense_Mutation_p.A325T|SH2D2A_uc001fqe.2_Missense_Mutation_p.A297T|SH2D2A_uc010phs.1_Missense_Mutation_p.A315T	p.A315T	NM_003975	NP_003966	Q9NP31	SH22A_HUMAN			7	1083	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		315			Pro-rich.		O43817|Q5UBZ1|Q5VZS4|Q5VZS5|Q9UPA7	Missense_Mutation	SNP	ENST00000368199.3	37	c.943G>A	CCDS1159.1	.	.	.	.	.	.	.	.	.	.	C	9.856	1.194870	0.22037	.	.	ENSG00000027869	ENST00000368199;ENST00000368198;ENST00000392306	T;T;T	0.55760	0.51;0.5;0.93	3.31	-5.24	0.02789	.	2.531020	0.01777	N	0.031519	T	0.08088	0.0202	N	0.12182	0.205	0.09310	N	1	P;P;B	0.38280	0.625;0.491;0.342	B;B;B	0.25614	0.062;0.028;0.028	T	0.06391	-1.0829	10	0.38643	T	0.18	4.5267	0.4351	0.00478	0.3964:0.2061:0.177:0.2205	.	325;297;315	Q9NP31-2;Q5VZS4;Q9NP31	.;.;SH22A_HUMAN	T	315;297;325	ENSP00000357182:A315T;ENSP00000357181:A297T;ENSP00000376123:A325T	ENSP00000357181:A297T	A	-	1	0	SH2D2A	155045678	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.359000	0.07632	-0.908000	0.03857	-0.314000	0.08810	GCC		0.597	SH2D2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098982.1	NM_003975		119	418	0	0	0	0.01441	0	119	418				
SPTA1	6708	broad.mit.edu	37	1	158590009	158590009	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:158590009G>T	ENST00000368147.4	-	44	6548	c.6368C>A	c.(6367-6369)aCa>aAa	p.T2123K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2123					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.T2123K(2)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CACCTCCACTGTTAACCAGGT	0.498																																							uc001fst.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(6367-6369)ACA>AAA		spectrin, alpha, erythrocytic 1							89.0	89.0	89.0					1																	158590009		1900	4118	6018	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158590009G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6368C>A	1.37:g.158590009G>T	ENSP00000357129:p.Thr2123Lys						p.T2123K	NM_003126	NP_003117	P02549	SPTA1_HUMAN			44	6567	-	all_hematologic(112;0.0378)		2123			Spectrin 20.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.6368C>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289305	0.80914	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.43688	0.94;0.94	5.05	4.13	0.48395	.	0.000000	0.33127	N	0.005242	T	0.48114	0.1482	M	0.82716	2.605	0.52501	D	0.999955	D	0.89917	1.0	D	0.85130	0.997	T	0.64296	-0.6441	10	0.02654	T	1	.	14.3527	0.66713	0.0:0.1494:0.8506:0.0	.	2123	P02549	SPTA1_HUMAN	K	2123;2120	ENSP00000357130:T2123K;ENSP00000357129:T2120K	ENSP00000357129:T2120K	T	-	2	0	SPTA1	156856633	1.000000	0.71417	0.491000	0.27477	0.986000	0.74619	7.182000	0.77689	1.343000	0.45638	0.585000	0.79938	ACA		0.498	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		85	98	1	0	2.22156e-40	0.01441	3.08448e-40	85	98				
ADAMTS4	9507	broad.mit.edu	37	1	161166644	161166644	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:161166644C>T	ENST00000367996.5	-	2	1088	c.660G>A	c.(658-660)gtG>gtA	p.V220V	NDUFS2_ENST00000367993.3_5'Flank|ADAMTS4_ENST00000367995.3_Silent_p.V220V|ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	220	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)	p.V220V(4)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	CCAGTGTCTCCACAAATCTAC	0.537																																							uc001fyt.3		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(4)|central_nervous_system(1)	5						c.(658-660)GTG>GTA		ADAM metallopeptidase with thrombospondin type 1							167.0	169.0	168.0					1																	161166644		2203	4300	6503	SO:0001819	synonymous_variant	9507				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding	g.chr1:161166644C>T	AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.660G>A	1.37:g.161166644C>T						ADAMTS4_uc001fyu.2_Silent_p.V220V|NDUFS2_uc001fyv.2_5'Flank	p.V220V	NM_005099	NP_005090	O75173	ATS4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00275)		2	1088	-	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		220			Peptidase M12B.		Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Silent	SNP	ENST00000367996.5	37	c.660G>A	CCDS1223.1																																																																																				0.537	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099		222	279	0	0	0	0.01441	0	222	279				
SELP	6403	broad.mit.edu	37	1	169580746	169580746	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:169580746G>T	ENST00000263686.6	-	7	1168	c.1131C>A	c.(1129-1131)ccC>ccA	p.P377P	SELP_ENST00000367792.2_Intron|SELP_ENST00000367791.2_Intron|SELP_ENST00000367788.2_Silent_p.P315P|SELP_ENST00000367786.2_Intron|SELP_ENST00000458599.2_Intron|SELP_ENST00000367793.2_Silent_p.P315P|SELP_ENST00000367794.2_Intron	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	377	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.P377P(2)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	AGGTTGGCAAGGGTGCAGACC	0.542																																							uc001ggi.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)	4						c.(1129-1131)CCC>CCA		selectin P precursor	Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)						83.0	81.0	81.0					1																	169580746		2203	4300	6503	SO:0001819	synonymous_variant	6403				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding	g.chr1:169580746G>T	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.1131C>A	1.37:g.169580746G>T						SELP_uc001ggh.2_Silent_p.P212P|SELP_uc009wvr.2_Silent_p.P377P	p.P377P	NM_003005	NP_002996	P16109	LYAM3_HUMAN			7	1196	-	all_hematologic(923;0.208)		377			Sushi 3.|Extracellular (Potential).		Q5R344|Q8IVD1	Silent	SNP	ENST00000263686.6	37	c.1131C>A	CCDS1282.1																																																																																				0.542	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005		33	155	1	0	2.46105e-21	0.010818	3.0855e-21	33	155				
PAPPA2	60676	broad.mit.edu	37	1	176526072	176526072	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:176526072G>C	ENST00000367662.3	+	2	1778	c.614G>C	c.(613-615)cGg>cCg	p.R205P	PAPPA2_ENST00000367661.3_Missense_Mutation_p.R205P	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	205					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R205P(4)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGGAAGAGGCGGGCGGAAGAT	0.562																																							uc001gkz.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(613-615)CGG>CCG		pappalysin 2 isoform 1							95.0	104.0	101.0					1																	176526072		1989	4139	6128	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176526072G>C	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.614G>C	1.37:g.176526072G>C	ENSP00000356634:p.Arg205Pro					PAPPA2_uc001gky.1_Missense_Mutation_p.R205P|PAPPA2_uc009www.2_RNA	p.R205P	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			2	1778	+			205					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.614G>C	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	7.338	0.620243	0.14193	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.30714	4.75;1.52	3.71	0.888	0.19206	.	1.808090	0.03483	U	0.215405	T	0.16514	0.0397	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21793	-1.0235	10	0.52906	T	0.07	.	3.1772	0.06572	0.6723:0.0:0.1229:0.2048	.	205;205	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	P	205	ENSP00000356634:R205P;ENSP00000356633:R205P	ENSP00000356633:R205P	R	+	2	0	PAPPA2	174792695	0.904000	0.30761	0.519000	0.27824	0.067000	0.16453	0.440000	0.21592	0.002000	0.14630	-0.657000	0.03884	CGG		0.562	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			139	141	0	0	0	0.01441	0	139	141				
CACNA1E	777	broad.mit.edu	37	1	181708376	181708376	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:181708376G>T	ENST00000367573.2	+	25	3706	c.3706G>T	c.(3706-3708)Gcc>Tcc	p.A1236S	CACNA1E_ENST00000358338.5_Missense_Mutation_p.A1168S|CACNA1E_ENST00000360108.3_Missense_Mutation_p.A1217S|CACNA1E_ENST00000357570.5_Missense_Mutation_p.A1187S|CACNA1E_ENST00000367567.4_Missense_Mutation_p.A843S|CACNA1E_ENST00000367570.1_Missense_Mutation_p.A1236S|CACNA1E_ENST00000526775.1_Missense_Mutation_p.A1217S	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1236					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.A1236S(4)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CGCATTGGTGGCCTTTGCTCT	0.498																																							uc001gow.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(3706-3708)GCC>TCC		calcium channel, voltage-dependent, R type,							348.0	359.0	355.0					1																	181708376		2125	4235	6360	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181708376G>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3706G>T	1.37:g.181708376G>T	ENSP00000356545:p.Ala1236Ser					CACNA1E_uc009wxs.2_Missense_Mutation_p.A1124S|CACNA1E_uc001gox.1_Missense_Mutation_p.A462S|CACNA1E_uc009wxt.2_Missense_Mutation_p.A462S	p.A1236S	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			25	3871	+			1236			III.|Helical; Name=S3 of repeat III.		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.3706G>T	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446676	0.84101	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98249	-4.82;-4.82;-4.82;-4.82;-4.82;-4.82;-4.82	5.01	5.01	0.66863	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96546	0.8873	N	0.02539	-0.55	0.80722	D	1	B;D;D	0.67145	0.282;0.966;0.996	B;D;D	0.77557	0.226;0.911;0.99	D	0.97214	0.9873	10	0.33940	T	0.23	.	18.2808	0.90097	0.0:0.0:1.0:0.0	.	1217;1236;1236	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	S	1236;1217;1187;1168;843;1217;1236	ENSP00000356542:A1236S;ENSP00000434814:A1217S;ENSP00000350183:A1187S;ENSP00000351101:A1168S;ENSP00000356539:A843S;ENSP00000353222:A1217S;ENSP00000356545:A1236S	ENSP00000350183:A1187S	A	+	1	0	CACNA1E	179974999	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.675000	0.98638	2.475000	0.83589	0.561000	0.74099	GCC		0.498	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		146	184	1	0	2.23826e-62	0.01441	3.13356e-62	146	184				
ZNF648	127665	broad.mit.edu	37	1	182026337	182026337	+	Missense_Mutation	SNP	T	T	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:182026337T>C	ENST00000339948.3	-	2	1016	c.809A>G	c.(808-810)gAg>gGg	p.E270G		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E270G(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						GCCGCGCGTCTCCGCGGGGCT	0.756																																					NSCLC(71;908 1374 5429 20458 35642)	NSCLC(71;908 1374 5429 20458 35642)	uc001goz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(808-810)GAG>GGG		zinc finger protein 648							7.0	8.0	8.0					1																	182026337		2141	4120	6261	SO:0001583	missense	127665				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:182026337T>C	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.809A>G	1.37:g.182026337T>C	ENSP00000344129:p.Glu270Gly						p.E270G	NM_001009992	NP_001009992	Q5T619	ZN648_HUMAN			2	1017	-			270					B2RP16	Missense_Mutation	SNP	ENST00000339948.3	37	c.809A>G	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	T	11.01	1.513152	0.27123	.	.	ENSG00000179930	ENST00000339948	T	0.08008	3.14	2.34	-0.238	0.13055	.	.	.	.	.	T	0.03695	0.0105	N	0.04994	-0.135	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40440	-0.9563	9	0.87932	D	0	.	3.6837	0.08320	0.0:0.1406:0.2242:0.6352	.	270	Q5T619	ZN648_HUMAN	G	270	ENSP00000344129:E270G	ENSP00000344129:E270G	E	-	2	0	ZNF648	180292960	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.088000	0.01359	-0.059000	0.13154	-0.250000	0.11733	GAG		0.756	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597		2	13	0	0	0	0.009096	0	2	13				
PTGS2	5743	broad.mit.edu	37	1	186643668	186643668	+	Silent	SNP	G	G	A	rs139087930		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:186643668G>A	ENST00000367468.5	-	10	1768	c.1632C>T	c.(1630-1632)atC>atT	p.I544I	PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	544					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.I544I(4)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	CAGTGTTGATGATTTGAAAAC	0.433																																							uc001gsb.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(1)|central_nervous_system(1)	2						c.(1630-1632)ATC>ATT		prostaglandin-endoperoxide synthase 2 precursor	Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Carprofen(DB00821)|Celecoxib(DB00482)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Epoprostenol(DB01240)|Etodolac(DB00749)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Valdecoxib(DB00580)	G		0,4406		0,0,2203	191.0	169.0	176.0		1632	3.1	1.0	1	dbSNP_134	176	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PTGS2	NM_000963.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		544/605	186643668	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5743				cellular component movement|cyclooxygenase pathway|hormone biosynthetic process|positive regulation of brown fat cell differentiation|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of fever generation|positive regulation of fibroblast growth factor production|positive regulation of nitric oxide biosynthetic process|positive regulation of platelet-derived growth factor production|positive regulation of prostaglandin biosynthetic process|positive regulation of transforming growth factor-beta production|positive regulation vascular endothelial growth factor production|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome|neuron projection|nucleus	enzyme binding|heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity	g.chr1:186643668G>A	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.1632C>T	1.37:g.186643668G>A						PTGS2_uc009wyo.2_Silent_p.I391I	p.I544I	NM_000963	NP_000954	P35354	PGH2_HUMAN			10	1769	-			544					A8K802|Q16876	Silent	SNP	ENST00000367468.5	37	c.1632C>T	CCDS1371.1																																																																																				0.433	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963		46	152	0	0	0	0.011902	0	46	152				
LRRN2	10446	broad.mit.edu	37	1	204589053	204589053	+	Missense_Mutation	SNP	A	A	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:204589053A>G	ENST00000367175.1	-	1	2280	c.68T>C	c.(67-69)gTa>gCa	p.V23A	LRRN2_ENST00000496057.1_5'UTR|LRRN2_ENST00000367177.3_Missense_Mutation_p.V23A|LRRN2_ENST00000367176.3_Missense_Mutation_p.V23A			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	23	LRRNT.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.V23A(2)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			ATGCCAGGGTACCACGGGCAC	0.647																																							uc001hbe.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)	2						c.(67-69)GTA>GCA		leucine rich repeat neuronal 2 precursor							22.0	24.0	24.0					1																	204589053		2202	4300	6502	SO:0001583	missense	10446				cell adhesion	integral to membrane	receptor activity	g.chr1:204589053A>G	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.68T>C	1.37:g.204589053A>G	ENSP00000356143:p.Val23Ala					MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Missense_Mutation_p.V23A|LRRN2_uc009xbf.1_Missense_Mutation_p.V23A|MDM4_uc001hbc.2_Intron	p.V23A	NM_006338	NP_006329	O75325	LRRN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)		3	456	-	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		23			Extracellular (Potential).|LRRNT.		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	ENST00000367175.1	37	c.68T>C	CCDS1448.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.569058	0.45798	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.59638	0.25;0.25;0.25	5.79	5.79	0.91817	.	0.000000	0.38548	N	0.001650	T	0.43277	0.1240	L	0.38531	1.155	0.34898	D	0.746205	B	0.32781	0.384	B	0.26517	0.07	T	0.51741	-0.8667	10	0.09338	T	0.73	.	14.4072	0.67090	1.0:0.0:0.0:0.0	.	23	O75325	LRRN2_HUMAN	A	23	ENSP00000356144:V23A;ENSP00000356145:V23A;ENSP00000356143:V23A	ENSP00000356143:V23A	V	-	2	0	LRRN2	202855676	1.000000	0.71417	0.991000	0.47740	0.938000	0.57974	6.742000	0.74843	2.216000	0.71823	0.529000	0.55759	GTA		0.647	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338		15	25	0	0	0	0.003163	0	15	25				
C1orf116	79098	broad.mit.edu	37	1	207200842	207200842	+	Silent	SNP	T	T	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:207200842T>A	ENST00000359470.5	-	2	351	c.102A>T	c.(100-102)ggA>ggT	p.G34G	C1orf116_ENST00000461135.2_Intron	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	34						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.G34G(2)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					TACGTACAGATCCAGAGCGGG	0.637																																							uc001hfd.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(100-102)GGA>GGT		specifically androgen-regulated protein isoform							99.0	87.0	91.0					1																	207200842		2203	4300	6503	SO:0001819	synonymous_variant	79098					cytoplasm|plasma membrane	receptor activity	g.chr1:207200842T>A		CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.102A>T	1.37:g.207200842T>A						C1orf116_uc009xcb.1_Intron	p.G34G	NM_023938	NP_076427	Q9BW04	SARG_HUMAN			2	361	-	Prostate(682;0.19)		34					C9JV41|Q658X3	Silent	SNP	ENST00000359470.5	37	c.102A>T	CCDS1475.1																																																																																				0.637	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088973.1	NM_024115		39	157	0	0	0	0.005524	0	39	157				
USH2A	7399	broad.mit.edu	37	1	215807951	215807951	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:215807951C>T	ENST00000307340.3	-	70	15533	c.15147G>A	c.(15145-15147)atG>atA	p.M5049I	USH2A_ENST00000366943.2_Missense_Mutation_p.M5049I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	5049					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.M5049I(2)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCAAGCCCAGCATCGCCATTA	0.463										HNSCC(13;0.011)																													uc001hku.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(15145-15147)ATG>ATA		usherin isoform B							137.0	129.0	131.0					1																	215807951		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215807951C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.15147G>A	1.37:g.215807951C>T	ENSP00000305941:p.Met5049Ile	HNSCC(13;0.011)					p.M5049I	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	70	15534	-			5049			Helical; (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.15147G>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	8.153	0.787750	0.16258	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.10668	2.85;2.85	5.88	-2.07	0.07276	.	1.710450	0.03451	N	0.210638	T	0.07728	0.0194	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39643	-0.9604	10	0.11794	T	0.64	.	10.1762	0.42939	0.3875:0.2799:0.3327:0.0	.	5049	O75445	USH2A_HUMAN	I	5049	ENSP00000305941:M5049I;ENSP00000355910:M5049I	ENSP00000305941:M5049I	M	-	3	0	USH2A	213874574	0.005000	0.15991	0.016000	0.15963	0.520000	0.34377	-1.167000	0.03126	-0.446000	0.07149	-0.808000	0.03180	ATG		0.463	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		42	173	0	0	0	0.006999	0	42	173				
HLX	3142	broad.mit.edu	37	1	221055574	221055574	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:221055574G>T	ENST00000366903.6	+	3	2342	c.841G>T	c.(841-843)Gct>Tct	p.A281S	HLA-AS1_ENST00000552026.1_RNA|HLX_ENST00000549319.1_Missense_Mutation_p.A67S	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	281					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A281S(2)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		ATGGTCGCGCGCTGTGTTCTC	0.577																																							uc001hmv.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(841-843)GCT>TCT		H2.0-like homeobox							77.0	62.0	67.0					1																	221055574		2203	4300	6503	SO:0001583	missense	3142				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:221055574G>T	BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.841G>T	1.37:g.221055574G>T	ENSP00000355870:p.Ala281Ser						p.A281S	NM_021958	NP_068777	Q14774	HLX_HUMAN		GBM - Glioblastoma multiforme(131;0.00914)	3	1298	+			281			Homeobox.		B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	37	c.841G>T	CCDS1527.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.331662	0.81690	.	.	ENSG00000136630	ENST00000366903;ENST00000427693;ENST00000549319	D;D;D	0.96041	-3.89;-3.89;-3.89	5.84	5.84	0.93424	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000017	D	0.96015	0.8702	N	0.25201	0.72	0.80722	D	1	D	0.64830	0.994	D	0.79108	0.992	D	0.96610	0.9451	10	0.66056	D	0.02	-15.9979	20.1278	0.97990	0.0:0.0:1.0:0.0	.	281	Q14774	HLX_HUMAN	S	281;14;67	ENSP00000355870:A281S;ENSP00000408248:A14S;ENSP00000449882:A67S	ENSP00000355870:A281S	A	+	1	0	HLX	219122197	1.000000	0.71417	0.186000	0.23195	0.162000	0.22319	9.866000	0.99616	2.768000	0.95171	0.561000	0.74099	GCT		0.577	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3	NM_021958		35	68	1	0	9.17885e-22	0.003271	1.15943e-21	35	68				
FMN2	56776	broad.mit.edu	37	1	240421306	240421306	+	Missense_Mutation	SNP	A	A	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:240421306A>G	ENST00000319653.9	+	7	4357	c.4127A>G	c.(4126-4128)cAt>cGt	p.H1376R	FMN2_ENST00000545751.1_Intron	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1376	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.H1519R(2)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCTAGCCTTCATTTAGATATG	0.323																																							uc010pyd.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(4126-4128)CAT>CGT		formin 2							90.0	90.0	90.0					1																	240421306		2203	4298	6501	SO:0001583	missense	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240421306A>G	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4127A>G	1.37:g.240421306A>G	ENSP00000318884:p.His1376Arg					FMN2_uc010pye.1_Missense_Mutation_p.H1380R|FMN2_uc010pyf.1_Missense_Mutation_p.H22R|FMN2_uc010pyg.1_Intron	p.H1376R	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		7	4352	+	Ovarian(103;0.127)	all_cancers(173;0.013)	1376			FH2.		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	c.4127A>G	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	A	20.8	4.055253	0.75960	.	.	ENSG00000155816	ENST00000319653;ENST00000441342	T;T	0.62232	1.03;0.04	5.42	5.42	0.78866	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000005	T	0.72867	0.3514	L	0.45285	1.41	0.80722	D	1	P;D;P	0.89917	0.951;1.0;0.935	P;D;D	0.87578	0.886;0.998;0.923	T	0.73241	-0.4045	10	0.46703	T	0.11	.	15.7561	0.78025	1.0:0.0:0.0:0.0	.	22;5;1376	F5H2C1;B4DN09;Q9NZ56	.;.;FMN2_HUMAN	R	1376;22	ENSP00000318884:H1376R;ENSP00000388922:H22R	ENSP00000318884:H1376R	H	+	2	0	FMN2	238487929	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.445000	0.80570	2.186000	0.69663	0.459000	0.35465	CAT		0.323	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		18	93	0	0	0	0.006122	0	18	93				
OR2W3	343171	broad.mit.edu	37	1	248059823	248059823	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:248059823G>T	ENST00000360358.3	+	1	935	c.935G>T	c.(934-936)gGa>gTa	p.G312V	OR2W3_ENST00000537741.1_Missense_Mutation_p.G312V	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G312V(2)		breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGAGAGCTAGGAAAGGAGTAA	0.537																																							uc001idp.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|pancreas(1)	3						c.(934-936)GGA>GTA		olfactory receptor, family 2, subfamily W,							26.0	27.0	27.0					1																	248059823		2202	4300	6502	SO:0001583	missense	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248059823G>T	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.935G>T	1.37:g.248059823G>T	ENSP00000353516:p.Gly312Val					OR2W3_uc010pzb.1_Missense_Mutation_p.G312V	p.G312V	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	1204	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		312			Cytoplasmic (Potential).		Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	c.935G>T	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.928471	0.34002	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.00365	7.8;7.8	4.86	-0.359	0.12571	.	1.083490	0.07186	N	0.854788	T	0.00241	0.0007	L	0.29908	0.895	0.09310	N	0.999992	B	0.06786	0.001	B	0.06405	0.002	T	0.32107	-0.9919	10	0.52906	T	0.07	.	4.3889	0.11330	0.3619:0.0:0.4473:0.1908	.	312	Q7Z3T1	OR2W3_HUMAN	V	312	ENSP00000445853:G312V;ENSP00000353516:G312V	ENSP00000353516:G312V	G	+	2	0	OR2W3	246126446	0.000000	0.05858	0.000000	0.03702	0.151000	0.21798	0.179000	0.16840	0.132000	0.18615	0.609000	0.83330	GGA		0.537	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		40	43	1	0	9.85521e-28	0.00623	1.30368e-27	40	43				
OR2T4	127074	broad.mit.edu	37	1	248525231	248525231	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:248525231C>A	ENST00000366475.1	+	1	349	c.349C>A	c.(349-351)Cag>Aag	p.Q117K		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q117K(2)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTCCTGGACCAGGTCATGGG	0.493																																							uc001ieh.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(349-351)CAG>AAG		olfactory receptor, family 2, subfamily T,							252.0	191.0	212.0					1																	248525231		2203	4300	6503	SO:0001583	missense	127074				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248525231C>A	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.349C>A	1.37:g.248525231C>A	ENSP00000355431:p.Gln117Lys						p.Q117K	NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	349	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		117			Extracellular (Potential).		Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	c.349C>A	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	C	2.478	-0.320327	0.05386	.	.	ENSG00000196944	ENST00000366475	T	0.79141	-1.24	3.48	0.396	0.16309	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000455	T	0.65913	0.2737	L	0.50333	1.59	0.09310	N	1	B	0.14012	0.009	B	0.18561	0.022	T	0.57734	-0.7760	10	0.59425	D	0.04	.	4.0596	0.09832	0.0:0.3388:0.1815:0.4797	.	117	Q8NH00	OR2T4_HUMAN	K	117	ENSP00000355431:Q117K	ENSP00000355431:Q117K	Q	+	1	0	OR2T4	246591854	0.000000	0.05858	0.133000	0.22050	0.067000	0.16453	-1.045000	0.03528	0.435000	0.26365	0.485000	0.47835	CAG		0.493	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696		202	205	1	0	1.51991e-96	0.01441	2.16394e-96	202	205				
FAM188A	80013	broad.mit.edu	37	10	15902236	15902236	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:15902236G>A	ENST00000277632.3	-	1	283	c.63C>T	c.(61-63)ctC>ctT	p.L21L	FAM188A_ENST00000477891.1_5'UTR	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A	21					apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.L21L(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						TGGTGTCCGAGAGACCGGGGC	0.617																																					Pancreas(159;946 1953 2111 4475 22008)	Pancreas(159;946 1953 2111 4475 22008)	uc001iod.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(61-63)CTC>CTT		chromosome 10 open reading frame 97							40.0	39.0	39.0					10																	15902236		2203	4300	6503	SO:0001819	synonymous_variant	80013				apoptosis	nucleus	calcium ion binding	g.chr10:15902236G>A	AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.63C>T	10.37:g.15902236G>A						FAM188A_uc001ioe.1_5'UTR|FAM188A_uc001iof.1_Silent_p.L21L	p.L21L	NM_024948	NP_079224	Q9H8M7	F188A_HUMAN			1	284	-			21					Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Silent	SNP	ENST00000277632.3	37	c.63C>T	CCDS7110.1																																																																																				0.617	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046990.2	NM_024948		4	22	0	0	0	0.009096	0	4	22				
ANKRD30A	91074	broad.mit.edu	37	10	37430689	37430689	+	Silent	SNP	G	G	T	rs369194109		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:37430689G>T	ENST00000602533.1	+	7	795	c.696G>T	c.(694-696)gcG>gcT	p.A232A	ANKRD30A_ENST00000361713.1_Silent_p.A232A|ANKRD30A_ENST00000374660.1_Silent_p.A232A			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	288					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A232A(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CACCCTTGGCGGAAAGAACAC	0.483																																							uc001iza.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|breast(1)|skin(1)	9						c.(694-696)GCG>GCT		ankyrin repeat domain 30A							34.0	36.0	36.0					10																	37430689		1880	4103	5983	SO:0001819	synonymous_variant	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37430689G>T	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.696G>T	10.37:g.37430689G>T							p.A232A	NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN			7	795	+			288					Q5W025	Silent	SNP	ENST00000602533.1	37	c.696G>T																																																																																					0.483	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		8	36	1	0	0.000978159	0.010729	0.00100202	8	36				
TMEM72	643236	broad.mit.edu	37	10	45429161	45429161	+	5'UTR	SNP	T	T	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:45429161T>A	ENST00000544540.1	+	0	416				TMEM72-AS1_ENST00000450287.2_RNA			A0PK05	TMM72_HUMAN	transmembrane protein 72							integral component of membrane (GO:0016021)		p.Y96N(4)		breast(2)|kidney(1)|large_intestine(2)|lung(10)	15						GTTCCTGGCCTACCTGCTGCT	0.617																																							uc001jbn.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(286-288)TAC>AAC		transmembrane protein 72							51.0	55.0	54.0					10																	45429161		1568	3582	5150	SO:0001623	5_prime_UTR_variant	643236					integral to membrane		g.chr10:45429161T>A	AB235418	CCDS41504.1	10q11.21	2008-10-24	2008-08-21	2008-08-21	ENSG00000187783	ENSG00000187783			31658	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 127"""	C10orf127			Standard	NM_001123376		Approved	bA285G1.3, KSP37	uc001jbn.2	A0PK05	OTTHUMG00000018067	ENST00000544540.1:c.-69T>A	10.37:g.45429161T>A						uc001jbk.1_Intron|uc001jbl.2_Intron|TMEM72_uc009xmm.1_5'UTR	p.Y96N	NM_001123376	NP_001116848	A0PK05	TMM72_HUMAN			4	483	+			96			Helical; (Potential).		A1L181|Q5T740	Missense_Mutation	SNP	ENST00000544540.1	37	c.286T>A		.	.	.	.	.	.	.	.	.	.	T	22.4	4.283408	0.80803	.	.	ENSG00000187783	ENST00000389583	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.77785	0.4182	M	0.75264	2.295	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.80425	-0.1388	9	0.87932	D	0	-3.6554	12.4511	0.55677	0.0:0.0:0.0:1.0	.	96	A0PK05	TMM72_HUMAN	N	96	.	ENSP00000374234:Y96N	Y	+	1	0	TMEM72	44749167	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.714000	0.68422	2.254000	0.74563	0.533000	0.62120	TAC		0.617	TMEM72-201	KNOWN	basic	protein_coding	protein_coding		NM_001123376		17	59	0	0	0	0.004007	0	17	59				
PCDH15	65217	broad.mit.edu	37	10	55996691	55996691	+	Splice_Site	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:55996691C>A	ENST00000320301.6	-	9	1271	c.877G>T	c.(877-879)Gaa>Taa	p.E293*	PCDH15_ENST00000373955.1_Splice_Site_p.E293*|PCDH15_ENST00000395445.1_Splice_Site_p.E293*|PCDH15_ENST00000395442.1_Splice_Site_p.E293*|PCDH15_ENST00000395438.1_Splice_Site_p.E293*|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000373957.3_Splice_Site_p.E271*|PCDH15_ENST00000437009.1_Splice_Site_p.E293*|PCDH15_ENST00000395433.1_Splice_Site_p.E271*|PCDH15_ENST00000414778.1_Splice_Site_p.E298*|PCDH15_ENST00000395440.1_Splice_Site_p.E293*|PCDH15_ENST00000395432.2_Splice_Site_p.E256*|PCDH15_ENST00000373965.2_Splice_Site_p.E293*|PCDH15_ENST00000395446.1_Splice_Site_p.E293*|PCDH15_ENST00000395430.1_Splice_Site_p.E293*|PCDH15_ENST00000361849.3_Splice_Site_p.E293*	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	293	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.E293*(4)|p.E298*(4)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TTCAGTTCTTCCTGAAAAAAA	0.398										HNSCC(58;0.16)																													uc001jju.1		NA																	8	Substitution - Nonsense(8)		lung(8)	pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(877-879)GAA>TAA		protocadherin 15 isoform CD1-4 precursor							133.0	130.0	131.0					10																	55996691		2203	4300	6503	SO:0001630	splice_region_variant	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:55996691C>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.877-1G>T	10.37:g.55996691C>A		HNSCC(58;0.16)				PCDH15_uc010qhq.1_Nonsense_Mutation_p.E298*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.E298*|PCDH15_uc010qht.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.E293*|PCDH15_uc001jjv.1_Nonsense_Mutation_p.E271*|PCDH15_uc010qhv.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.E256*|PCDH15_uc010qhx.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qhy.1_Nonsense_Mutation_p.E298*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qia.1_Nonsense_Mutation_p.E271*|PCDH15_uc010qib.1_Nonsense_Mutation_p.E271*|PCDH15_uc001jjw.2_Nonsense_Mutation_p.E293*	p.E293*	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN			9	1272	-		Melanoma(3;0.117)|Lung SC(717;0.238)	293			Cadherin 3.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Nonsense_Mutation	SNP	ENST00000320301.6	37	c.877G>T	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	40	8.078723	0.98643	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	.	.	.	5.19	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	9.0928	0.36621	0.0:0.7692:0.1483:0.0825	.	.	.	.	X	293;298;293;293;293;293;293;293;256;293;271;271;293;293;298;293;293	.	ENSP00000322604:E293X	E	-	1	0	PCDH15	55666697	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	2.003000	0.40844	1.189000	0.43028	0.650000	0.86243	GAA		0.398	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	Nonsense_Mutation	37	90	1	0	4.65686e-17	0.003755	5.66923e-17	37	90				
ANK3	288	broad.mit.edu	37	10	61844435	61844435	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:61844435C>T	ENST00000280772.2	-	32	4190	c.3999G>A	c.(3997-3999)atG>atA	p.M1333I	ANK3_ENST00000503366.1_Missense_Mutation_p.M1334I|Y_RNA_ENST00000365320.1_RNA|ANK3_ENST00000373827.2_Missense_Mutation_p.M1327I|ANK3_ENST00000355288.2_Missense_Mutation_p.M467I	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1333	UPA domain. {ECO:0000250}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.M1333I(1)|p.M968I(1)|p.M467I(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TGTCATCTGTCATGCAGAAAC	0.373																																							uc001jky.2		NA																	3	Substitution - Missense(3)		lung(3)	skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						c.(3997-3999)ATG>ATA		ankyrin 3 isoform 1							146.0	142.0	144.0					10																	61844435		2203	4300	6503	SO:0001583	missense	288				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding	g.chr10:61844435C>T	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.3999G>A	10.37:g.61844435C>T	ENSP00000280772:p.Met1333Ile					ANK3_uc001jkw.2_Missense_Mutation_p.M467I|ANK3_uc009xpa.2_Missense_Mutation_p.M467I|ANK3_uc001jkx.2_Missense_Mutation_p.M511I|ANK3_uc010qih.1_Missense_Mutation_p.M1334I|ANK3_uc001jkz.3_Missense_Mutation_p.M1327I|ANK3_uc001jla.1_Missense_Mutation_p.M399I|ANK3_uc001jlb.1_Missense_Mutation_p.M851I|ANK3_uc001jkv.2_5'Flank	p.M1333I	NM_020987	NP_066267	Q12955	ANK3_HUMAN			32	4191	-			1333					B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	c.3999G>A	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	34	5.338011	0.95758	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789;ENST00000536348	T;T;T;T	0.28454	1.61;1.61;1.61;1.61	6.04	6.04	0.98038	.	0.000000	0.51477	D	0.000096	T	0.55465	0.1922	M	0.66939	2.045	0.80722	D	1	P;D;P;P;D;B;P	0.60160	0.672;0.987;0.666;0.901;0.969;0.34;0.936	B;P;B;B;D;B;P	0.63381	0.206;0.625;0.197;0.407;0.914;0.343;0.885	T	0.53570	-0.8420	10	0.87932	D	0	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	1334;467;866;1327;1333;568;467	E9PE32;A8KA62;Q59G01;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;.;ANK3_HUMAN;.;.	I	1333;1327;467;467;1334;1313;568;968;968;466;866	ENSP00000280772:M1333I;ENSP00000362933:M1327I;ENSP00000347436:M467I;ENSP00000425236:M1334I	ENSP00000280772:M1333I	M	-	3	0	ANK3	61514441	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.873000	0.98535	0.561000	0.74099	ATG		0.373	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		9	156	0	0	0	0.004482	0	9	156				
DYDC2	84332	broad.mit.edu	37	10	82126540	82126540	+	Missense_Mutation	SNP	C	C	G	rs200376642		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:82126540C>G	ENST00000372199.1	+	6	965	c.367C>G	c.(367-369)Cca>Gca	p.P123A	DYDC2_ENST00000372198.1_Missense_Mutation_p.P137A|DYDC2_ENST00000256039.2_Missense_Mutation_p.P123A|DYDC2_ENST00000444807.2_Missense_Mutation_p.P123A|DYDC2_ENST00000372197.1_Missense_Mutation_p.P123A			Q96IM9	DYDC2_HUMAN	DPY30 domain containing 2	123								p.P123A(2)		breast(1)|large_intestine(3)|lung(6)|skin(1)	11			Colorectal(32;0.229)			GGAATTCCTGCCAGGTACTTC	0.468																																							uc001kca.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(367-369)CCA>GCA		DPY30 domain containing 2							109.0	111.0	110.0					10																	82126540		2203	4300	6503	SO:0001583	missense	84332						protein binding	g.chr10:82126540C>G	BC018606	CCDS7367.1, CCDS58088.1	10q23.1	2006-06-16			ENSG00000133665	ENSG00000133665			23468	protein-coding gene	gene with protein product						12477932	Standard	NM_032372		Approved	bA36D19.6, MGC16186	uc031pwk.1	Q96IM9	OTTHUMG00000018610	ENST00000372199.1:c.367C>G	10.37:g.82126540C>G	ENSP00000361273:p.Pro123Ala					DYDC2_uc001kbz.1_RNA|DYDC2_uc001kcb.1_Missense_Mutation_p.P123A	p.P123A	NM_032372	NP_115748	Q96IM9	DYDC2_HUMAN	Colorectal(32;0.229)		5	747	+			123					D3DWD6|Q5QP07|Q5QP11	Missense_Mutation	SNP	ENST00000372199.1	37	c.367C>G	CCDS7367.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463705	0.26335	.	.	ENSG00000133665	ENST00000372199;ENST00000372198;ENST00000372197;ENST00000444807;ENST00000411538;ENST00000256039	T;T;T;T;T	0.66995	-0.13;-0.24;-0.13;-0.13;-0.13	4.68	2.81	0.32909	.	0.122835	0.37623	N	0.002007	T	0.55081	0.1898	L	0.32530	0.975	0.09310	N	1	P	0.52463	0.953	P	0.45037	0.467	T	0.47195	-0.9136	10	0.33141	T	0.24	-9.1269	10.1785	0.42952	0.3624:0.6376:0.0:0.0	.	123	Q96IM9	DYDC2_HUMAN	A	123;137;123;123;123;123	ENSP00000361273:P123A;ENSP00000361272:P137A;ENSP00000361271:P123A;ENSP00000410285:P123A;ENSP00000256039:P123A	ENSP00000256039:P123A	P	+	1	0	DYDC2	82116520	0.005000	0.15991	0.013000	0.15412	0.001000	0.01503	0.832000	0.27490	0.882000	0.36016	-0.953000	0.02652	CCA		0.468	DYDC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049063.1	NM_032372		50	130	0	0	0	0.01441	0	50	130				
CYP17A1	1586	broad.mit.edu	37	10	104594740	104594740	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:104594740C>A	ENST00000369887.3	-	3	639	c.468G>T	c.(466-468)atG>atT	p.M156I	CYP17A1_ENST00000489268.1_5'UTR|CYP17A1-AS1_ENST00000369884.4_RNA	NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	156					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|biphenyl metabolic process (GO:0018879)|cellular response to antibiotic (GO:0071236)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to lipopolysaccharide (GO:0071222)|dibenzo-p-dioxin metabolic process (GO:0018894)|glucocorticoid biosynthetic process (GO:0006704)|hippocampus development (GO:0021766)|hormone biosynthetic process (GO:0042446)|Leydig cell differentiation (GO:0033327)|ovulation (GO:0030728)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|progesterone metabolic process (GO:0042448)|response to acetate (GO:0010034)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to insecticide (GO:0017085)|response to ionizing radiation (GO:0010212)|response to methylmercury (GO:0051597)|response to nutrient levels (GO:0031667)|response to retinoic acid (GO:0032526)|response to steroid hormone (GO:0048545)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	axon (GO:0030424)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)	17-alpha-hydroxyprogesterone aldolase activity (GO:0047442)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|steroid 17-alpha-monooxygenase activity (GO:0004508)	p.M156I(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	Abiraterone(DB05812)|Aminophenazone(DB01424)|Dexamethasone(DB01234)|Metoclopramide(DB01233)|Progesterone(DB00396)	GGGTGGCCAGCATATCACACA	0.502											OREG0020487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001kwg.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(466-468)ATG>ATT		cytochrome P450, family 17	NADH(DB00157)|Progesterone(DB00396)						147.0	123.0	131.0					10																	104594740		2203	4300	6503	SO:0001583	missense	1586				androgen biosynthetic process|glucocorticoid biosynthetic process|sex differentiation|xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|oxygen binding|steroid 17-alpha-monooxygenase activity	g.chr10:104594740C>A	M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	1.14.99.9	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17		1347802	Standard	NM_000102		Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.468G>T	10.37:g.104594740C>A	ENSP00000358903:p.Met156Ile		OREG0020487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	172		p.M156I	NM_000102	NP_000093	P05093	CP17A_HUMAN		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	3	640	-		Colorectal(252;0.122)|all_hematologic(284;0.152)	156					Q5TZV7	Missense_Mutation	SNP	ENST00000369887.3	37	c.468G>T	CCDS7541.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412523	0.25465	.	.	ENSG00000148795	ENST00000369887	T	0.68025	-0.3	5.8	-0.209	0.13180	.	1.399780	0.04273	N	0.342364	T	0.41743	0.1172	N	0.05078	-0.115	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.18398	-1.0338	10	0.31617	T	0.26	.	2.9941	0.05993	0.1777:0.4888:0.1475:0.1859	.	156	P05093	CP17A_HUMAN	I	156	ENSP00000358903:M156I	ENSP00000358903:M156I	M	-	3	0	CYP17A1	104584730	0.000000	0.05858	0.041000	0.18516	0.164000	0.22412	-1.131000	0.03238	-0.021000	0.14009	0.462000	0.41574	ATG		0.502	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050101.1	NM_000102		40	123	1	0	2.87052e-16	0.005524	3.44462e-16	40	123				
MUC6	4588	broad.mit.edu	37	11	1018143	1018143	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:1018143C>T	ENST00000421673.2	-	31	4708	c.4658G>A	c.(4657-4659)cGc>cAc	p.R1553H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1553	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.R1553H(4)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTTCTGGTGCGTGTACTAGT	0.562																																							uc001lsw.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(1)	1						c.(4657-4659)CGC>CAC		mucin 6, gastric							236.0	245.0	242.0					11																	1018143		2165	4246	6411	SO:0001583	missense	4588				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent	g.chr11:1018143C>T	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4658G>A	11.37:g.1018143C>T	ENSP00000406861:p.Arg1553His						p.R1553H	NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	31	4709	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	1553			Pro-rich.|Thr-rich.		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	c.4658G>A	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	5.231	0.228181	0.09916	.	.	ENSG00000184956	ENST00000421673	T	0.18502	2.21	1.9	-3.79	0.04320	.	.	.	.	.	T	0.07279	0.0184	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.25363	-1.0134	9	0.38643	T	0.18	.	1.6966	0.02863	0.1299:0.1489:0.2733:0.4479	.	1553	Q6W4X9	MUC6_HUMAN	H	1553	ENSP00000406861:R1553H	ENSP00000406861:R1553H	R	-	2	0	MUC6	1008143	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.915000	0.01578	-2.351000	0.00617	0.313000	0.20887	CGC		0.562	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		75	256	0	0	0	0.01441	0	75	256				
CARS	833	broad.mit.edu	37	11	3041474	3041474	+	Silent	SNP	C	C	A	rs375833170		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:3041474C>A	ENST00000397111.5	-	10	1238	c.993G>T	c.(991-993)ccG>ccT	p.P331P	CARS_ENST00000397114.3_Silent_p.P321P|CARS_ENST00000278224.9_Silent_p.P331P|CARS_ENST00000380525.4_Silent_p.P414P|CARS_ENST00000401769.3_Silent_p.P344P			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	331					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.P331P(2)|p.P414P(2)	CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	ACGGCCAGGACGGTTCTCCGG	0.622			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)	Ovarian(61;932 1157 5961 20446 52152)	uc001lxh.2		NA		Dom	yes		11	11p15.5	833	T	cysteinyl-tRNA synthetase			L	ALK		ALCL	CARS/ALK(5)	4	Substitution - coding silent(4)		lung(4)	soft_tissue(5)|ovary(2)	7						c.(991-993)CCG>CCT		cysteinyl-tRNA synthetase isoform b	L-Cysteine(DB00151)						116.0	93.0	101.0					11																	3041474		2202	4298	6500	SO:0001819	synonymous_variant	833				cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding	g.chr11:3041474C>A	AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.993G>T	11.37:g.3041474C>A						CARS_uc001lxe.2_Silent_p.P321P|CARS_uc001lxf.2_Silent_p.P414P|CARS_uc001lxg.2_Silent_p.P331P|CARS_uc010qxo.1_Silent_p.P414P|CARS_uc010qxp.1_Silent_p.P344P	p.P331P	NM_001751	NP_001742	P49589	SYCC_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	10	1067	-		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)	331					Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Silent	SNP	ENST00000397111.5	37	c.993G>T	CCDS7742.1																																																																																				0.622	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4	NM_001751		47	178	1	0	2.47907e-22	0.01441	3.15517e-22	47	178				
OR52I1	390037	broad.mit.edu	37	11	4615507	4615507	+	Missense_Mutation	SNP	C	C	T	rs181769683		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:4615507C>T	ENST00000530443.2	+	1	239	c.239C>T	c.(238-240)tCc>tTc	p.S80F	OR52I1_ENST00000450052.2_Missense_Mutation_p.S104F	NM_001005169.1	NP_001005169.1	Q8NGK6	O52I1_HUMAN	olfactory receptor, family 52, subfamily I, member 1	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S105F(2)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	15		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;7.98e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGGCCTCCTCCGTGGTACCC	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		21190	0.0		0.001	False		,,,				2504	0.0						uc010qyi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(238-240)TCC>TTC		olfactory receptor, family 52, subfamily I,							165.0	139.0	148.0					11																	4615507		2201	4296	6497	SO:0001583	missense	390037				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4615507C>T	BK004371	CCDS59223.1	11p15.4	2012-08-09				ENSG00000232268		"""GPCR / Class A : Olfactory receptors"""	15220	protein-coding gene	gene with protein product							Standard	NM_001005169		Approved		uc010qyi.2	Q8NGK6		ENST00000530443.2:c.239C>T	11.37:g.4615507C>T	ENSP00000436453:p.Ser80Phe						p.S80F	NM_001005169	NP_001005169	Q8NGK6	O52I1_HUMAN		Epithelial(150;7.98e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	239	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	80			Extracellular (Potential).		Q6IF91	Missense_Mutation	SNP	ENST00000530443.2	37	c.239C>T	CCDS59223.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	8.351	0.830828	0.16820	.	.	ENSG00000232268	ENST00000450052;ENST00000530443	T;T	0.00406	7.55;7.55	4.92	3.06	0.35304	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43747	D	0.000533	T	0.01124	0.0037	M	0.83953	2.67	0.36402	D	0.863174	D	0.89917	1.0	D	0.87578	0.998	T	0.47222	-0.9134	9	0.87932	D	0	-5.9992	10.4703	0.44633	0.0:0.8365:0.0:0.1635	.	80	Q8NGK6	O52I1_HUMAN	F	104;80	ENSP00000409094:S104F;ENSP00000436453:S80F	ENSP00000409094:S104F	S	+	2	0	OR52I1	4572083	0.000000	0.05858	0.216000	0.23742	0.011000	0.07611	-0.300000	0.08243	0.778000	0.33520	-0.368000	0.07277	TCC		0.502	OR52I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385947.2	NM_001005169		58	144	0	0	0	0.01441	0	58	144				
OR52N4	390072	broad.mit.edu	37	11	5776193	5776193	+	Missense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:5776193A>T	ENST00000317254.3	+	1	271	c.223A>T	c.(223-225)Atg>Ttg	p.M75L	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M75L(2)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		TGACCTTGTTATGTGCTCTAG	0.458																																							uc001mbu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(223-225)ATG>TTG		olfactory receptor, family 52, subfamily N,							147.0	152.0	150.0					11																	5776193		2191	4295	6486	SO:0001583	missense	390072				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5776193A>T	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.223A>T	11.37:g.5776193A>T	ENSP00000323224:p.Met75Leu					TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.M75L	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)	1	271	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	75			Helical; Name=2; (Potential).		B2RNP8|Q6IF77	Missense_Mutation	SNP	ENST00000317254.3	37	c.223A>T	CCDS44528.1	.	.	.	.	.	.	.	.	.	.	A	3.911	-0.020070	0.07634	.	.	ENSG00000181074	ENST00000317254	T	0.02812	4.15	5.93	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	0.098344	0.44483	D	0.000451	T	0.00754	0.0025	N	0.00465	-1.465	0.21675	N	0.999592	B	0.02656	0.0	B	0.04013	0.001	T	0.49744	-0.8907	10	0.02654	T	1	.	6.9339	0.24457	0.6435:0.2744:0.0822:0.0	.	75	Q8NGI2	O52N4_HUMAN	L	75	ENSP00000323224:M75L	ENSP00000323224:M75L	M	+	1	0	OR52N4	5732769	0.000000	0.05858	1.000000	0.80357	0.953000	0.61014	0.303000	0.19210	2.282000	0.76494	0.451000	0.29950	ATG		0.458	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175		34	60	0	0	0	0.003271	0	34	60				
NLRP14	338323	broad.mit.edu	37	11	7064233	7064233	+	Missense_Mutation	SNP	G	G	C	rs577444777		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:7064233G>C	ENST00000299481.4	+	4	1322	c.976G>C	c.(976-978)Gag>Cag	p.E326Q		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	326	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.E326Q(2)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		CCATTATGTAGAGCTACTAGG	0.403																																							uc001mfb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8						c.(976-978)GAG>CAG		NLR family, pyrin domain containing 14							105.0	106.0	106.0					11																	7064233		2201	4296	6497	SO:0001583	missense	338323				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding	g.chr11:7064233G>C	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.976G>C	11.37:g.7064233G>C	ENSP00000299481:p.Glu326Gln						p.E326Q	NM_176822	NP_789792	Q86W24	NAL14_HUMAN		Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)	4	1299	+			326			NACHT.		Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	c.976G>C	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.707707	0.30322	.	.	ENSG00000158077	ENST00000299481	T	0.79940	-1.32	4.51	0.732	0.18283	NACHT nucleoside triphosphatase (1);	0.713063	0.12709	N	0.445645	T	0.66096	0.2755	L	0.28740	0.885	0.26958	N	0.965885	B	0.30870	0.298	B	0.33750	0.169	T	0.51671	-0.8676	10	0.13108	T	0.6	.	6.9653	0.24619	0.1379:0.5272:0.335:0.0	.	326	Q86W24	NAL14_HUMAN	Q	326	ENSP00000299481:E326Q	ENSP00000299481:E326Q	E	+	1	0	NLRP14	7020809	0.966000	0.33281	0.154000	0.22540	0.711000	0.40976	1.556000	0.36288	0.049000	0.15920	0.655000	0.94253	GAG		0.403	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		27	121	0	0	0	0.009535	0	27	121				
OR5B3	441608	broad.mit.edu	37	11	58170746	58170746	+	Nonsense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:58170746A>T	ENST00000309403.2	-	1	136	c.137T>A	c.(136-138)tTg>tAg	p.L46*		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L46*(2)|p.L46W(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CCAGAATATCAATACAATAAT	0.423																																							uc010rkf.1		NA																	3	Substitution - Nonsense(2)|Substitution - Missense(1)		lung(3)		0						c.(136-138)TTG>TAG		olfactory receptor, family 5, subfamily B,							89.0	88.0	89.0					11																	58170746		2201	4295	6496	SO:0001587	stop_gained	441608				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58170746A>T	AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.137T>A	11.37:g.58170746A>T	ENSP00000308270:p.Leu46*						p.L46*	NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN			1	137	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	46			Cytoplasmic (Potential).		Q6IEV6	Nonsense_Mutation	SNP	ENST00000309403.2	37	c.137T>A	CCDS31549.1	.	.	.	.	.	.	.	.	.	.	a	7.500	0.652423	0.14580	.	.	ENSG00000172769	ENST00000309403	.	.	.	4.19	4.19	0.49359	.	0.614281	0.12060	N	0.503259	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.6561	8.0168	0.30385	0.9005:0.0:0.0995:0.0	.	.	.	.	X	46	.	ENSP00000308270:L46X	L	-	2	0	OR5B3	57927322	0.001000	0.12720	0.004000	0.12327	0.001000	0.01503	1.535000	0.36061	1.893000	0.54813	0.477000	0.44152	TTG		0.423	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1	NM_001005469		45	96	0	0	0	0.009718	0	45	96				
JRKL	8690	broad.mit.edu	37	11	96124962	96124962	+	Missense_Mutation	SNP	A	A	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:96124962A>C	ENST00000332349.4	+	2	1396	c.1149A>C	c.(1147-1149)agA>agC	p.R383S	JRKL_ENST00000546177.1_Intron|CCDC82_ENST00000542662.1_5'Flank|JRKL_ENST00000458427.1_Missense_Mutation_p.R383S|CCDC82_ENST00000525786.1_5'Flank	NM_001261833.1	NP_001248762.1	Q9Y4A0	JERKL_HUMAN	JRK-like	383	DDE.				central nervous system development (GO:0007417)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R383S(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		BRCA - Breast invasive adenocarcinoma(274;0.148)		CCATTAGCAGAGCATGGAAGA	0.408																																							uc009ywu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1147-1149)AGA>AGC		jerky homolog-like							134.0	131.0	132.0					11																	96124962		2201	4298	6499	SO:0001583	missense	8690				central nervous system development|regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding	g.chr11:96124962A>C	AF004715	CCDS8308.1	11q21	2014-03-28	2014-03-28		ENSG00000183340	ENSG00000183340			6200	protein-coding gene	gene with protein product		603211	"""erky (mouse) homolog-like"", ""jerky homolog-like (mouse)"""			9240447	Standard	NM_003772		Approved	HHMJG	uc009ywu.4	Q9Y4A0	OTTHUMG00000154950	ENST00000332349.4:c.1149A>C	11.37:g.96124962A>C	ENSP00000333350:p.Arg383Ser					CCDC82_uc001pfx.3_5'Flank|CCDC82_uc009ywr.2_5'Flank|CCDC82_uc009ywt.1_5'Flank|JRKL_uc001pfy.2_Missense_Mutation_p.R383S	p.R383S	NM_003772	NP_003763	Q9Y4A0	JERKL_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.148)	2	1401	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	383			DDE.		A8K3G4|B2RAJ3|Q32MC2	Missense_Mutation	SNP	ENST00000332349.4	37	c.1149A>C	CCDS8308.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.092458	0.55968	.	.	ENSG00000183340	ENST00000332349;ENST00000458427	T;T	0.25912	1.77;1.77	4.57	2.06	0.26882	.	0.000000	0.43747	D	0.000534	T	0.15609	0.0376	L	0.43923	1.385	0.33473	D	0.586441	P	0.34864	0.473	B	0.34301	0.179	T	0.14587	-1.0467	10	0.12766	T	0.61	-2.9448	4.078	0.09912	0.6763:0.2122:0.1115:0.0	.	383	Q9Y4A0	JERKL_HUMAN	S	383	ENSP00000333350:R383S;ENSP00000389989:R383S	ENSP00000333350:R383S	R	+	3	2	JRKL	95764610	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.574000	0.36482	0.726000	0.32339	0.379000	0.24179	AGA		0.408	JRKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337775.2	NM_003772		7	167	0	0	0	0.00308	0	7	167				
ZC3H12C	85463	broad.mit.edu	37	11	110007729	110007729	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:110007729C>T	ENST00000278590.3	+	2	414	c.363C>T	c.(361-363)tgC>tgT	p.C121C	ZC3H12C_ENST00000453089.2_Silent_p.C90C|ZC3H12C_ENST00000528673.1_Silent_p.C122C	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	121							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.C121C(2)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		GACAGCTCTGCAGGTCTCCCT	0.428																																							uc009yxw.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(361-363)TGC>TGT		zinc finger CCCH-type containing 12C							48.0	46.0	46.0					11																	110007729		1871	4111	5982	SO:0001819	synonymous_variant	85463						endonuclease activity|nucleic acid binding|zinc ion binding	g.chr11:110007729C>T		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.363C>T	11.37:g.110007729C>T						ZC3H12C_uc010rwc.1_Silent_p.C122C|ZC3H12C_uc010rwd.1_Silent_p.C122C|ZC3H12C_uc001pkr.3_Silent_p.C90C|ZC3H12C_uc001pkq.2_Silent_p.C90C	p.C121C	NM_033390	NP_203748	Q9C0D7	ZC12C_HUMAN		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)	2	414	+		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	121					B4DI65|B4DR47	Silent	SNP	ENST00000278590.3	37	c.363C>T	CCDS44727.1																																																																																				0.428	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390		10	27	0	0	0	0.008291	0	10	27				
ABCG4	64137	broad.mit.edu	37	11	119024780	119024780	+	Silent	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:119024780C>A	ENST00000449422.2	+	3	471	c.283C>A	c.(283-285)Cgg>Agg	p.R95R	ABCG4_ENST00000307417.3_Silent_p.R95R|ABCG4_ENST00000531739.1_Silent_p.R95R	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	95	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.R95R(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		ATTCTGCCGCCGGGAGCTGAT	0.532																																							uc001pvs.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(283-285)CGG>AGG		ATP-binding cassette, subfamily G, member 4							91.0	100.0	97.0					11																	119024780		2200	4295	6495	SO:0001819	synonymous_variant	64137				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:119024780C>A	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.283C>A	11.37:g.119024780C>A						ABCG4_uc009zar.2_Silent_p.R95R|ABCG4_uc001pvt.1_RNA	p.R95R	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)	3	619	+	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	95			Cytoplasmic (Potential).|ABC transporter.		A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Silent	SNP	ENST00000449422.2	37	c.283C>A	CCDS8415.1																																																																																				0.532	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169		41	109	1	0	1.96642e-18	0.006999	2.4471e-18	41	109				
OR10G9	219870	broad.mit.edu	37	11	123894107	123894107	+	Missense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:123894107A>T	ENST00000375024.1	+	1	388	c.388A>T	c.(388-390)Agg>Tgg	p.R130W		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R130W(2)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TTACCCGCTCAGGTACACCAG	0.537																																							uc010sad.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)	2						c.(388-390)AGG>TGG		olfactory receptor, family 10, subfamily G,							55.0	52.0	53.0					11																	123894107		2201	4285	6486	SO:0001583	missense	219870				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123894107A>T	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.388A>T	11.37:g.123894107A>T	ENSP00000364164:p.Arg130Trp						p.R130W	NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	388	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	130			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000375024.1	37	c.388A>T	CCDS31703.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.298803	0.60195	.	.	ENSG00000236981	ENST00000375024	T	0.02280	4.36	3.48	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000276	T	0.10252	0.0251	M	0.89353	3.025	0.30952	N	0.724625	D	0.60575	0.988	P	0.56788	0.806	T	0.02917	-1.1094	10	0.87932	D	0	.	9.9998	0.41922	0.4323:0.5677:0.0:0.0	.	130	Q8NGN4	O10G9_HUMAN	W	130	ENSP00000364164:R130W	ENSP00000364164:R130W	R	+	1	2	OR10G9	123399317	0.438000	0.25602	0.999000	0.59377	0.827000	0.46813	1.601000	0.36773	0.492000	0.27815	0.533000	0.62120	AGG		0.537	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953		71	122	0	0	0	0.01441	0	71	122				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		9	25	1	0	1.12685e-05	0.004482	1.2058e-05	9	25				
ADAMTS20	80070	broad.mit.edu	37	12	43777759	43777759	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:43777759C>T	ENST00000389420.3	-	30	4473	c.4474G>A	c.(4474-4476)Gga>Aga	p.G1492R		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1492	TSP type-1 12. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G1492R(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TGCTGAACTCCAGAGCCACAG	0.438																																							uc010skx.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(4474-4476)GGA>AGA		a disintegrin-like and metalloprotease with							74.0	62.0	66.0					12																	43777759		2203	4300	6503	SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43777759C>T	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4474G>A	12.37:g.43777759C>T	ENSP00000374071:p.Gly1492Arg						p.G1492R	NM_025003	NP_079279	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	30	4474	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	1492			TSP type-1 12.		A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	c.4474G>A	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202000	0.79127	.	.	ENSG00000173157	ENST00000389420	D	0.83673	-1.75	4.25	4.25	0.50352	.	0.132559	0.34067	N	0.004290	D	0.94095	0.8107	H	0.97852	4.09	0.80722	D	1	D	0.56287	0.975	P	0.61940	0.896	D	0.96247	0.9180	10	0.87932	D	0	.	17.9573	0.89073	0.0:1.0:0.0:0.0	.	1492	P59510	ATS20_HUMAN	R	1492	ENSP00000374071:G1492R	ENSP00000374071:G1492R	G	-	1	0	ADAMTS20	42064026	0.999000	0.42202	0.997000	0.53966	0.985000	0.73830	6.073000	0.71245	2.650000	0.89964	0.655000	0.94253	GGA		0.438	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		16	41	0	0	0	0.006122	0	16	41				
ARID2	196528	broad.mit.edu	37	12	46244361	46244361	+	Nonsense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:46244361C>T	ENST00000334344.6	+	15	2627	c.2455C>T	c.(2455-2457)Caa>Taa	p.Q819*	ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Nonsense_Mutation_p.Q670*|ARID2_ENST00000444670.1_Nonsense_Mutation_p.Q429*	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	819	Gln-rich.				chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q819*(3)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTCACAGGGTCAACAGTTAAT	0.453			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					3	Substitution - Nonsense(3)		lung(2)|breast(1)	ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.(2455-2457)CAA>TAA		AT rich interactive domain 2 (ARID, RFX-like)							144.0	120.0	128.0					12																	46244361		2203	4300	6503	SO:0001587	stop_gained	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46244361C>T		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2455C>T	12.37:g.46244361C>T	ENSP00000335044:p.Gln819*					ARID2_uc001ror.2_Nonsense_Mutation_p.Q819*|ARID2_uc009zkg.1_Nonsense_Mutation_p.Q275*|ARID2_uc009zkh.1_Nonsense_Mutation_p.Q446*|ARID2_uc001rou.1_Nonsense_Mutation_p.Q153*	p.Q819*	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	15	2455	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	819			Gln-rich.		Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	ENST00000334344.6	37	c.2455C>T	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	C	41	8.589716	0.98875	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	.	.	.	5.83	5.83	0.93111	.	0.143302	0.50627	D	0.000110	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-5.2974	20.1152	0.97926	0.0:1.0:0.0:0.0	.	.	.	.	X	819;670;429	.	ENSP00000335044:Q819X	Q	+	1	0	ARID2	44530628	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.677000	0.68142	2.750000	0.94351	0.655000	0.94253	CAA		0.453	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		18	28	0	0	0	0.006122	0	18	28				
CALCOCO1	57658	broad.mit.edu	37	12	54109766	54109766	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:54109766C>T	ENST00000550804.1	-	9	1131	c.1071G>A	c.(1069-1071)caG>caA	p.Q357Q	CALCOCO1_ENST00000262059.4_Silent_p.Q357Q|CALCOCO1_ENST00000430117.2_Silent_p.Q272Q|CALCOCO1_ENST00000548263.1_Silent_p.Q357Q			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	357					intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.Q357Q(2)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						GGGTGGCTTTCTGCTGGCTTG	0.612																																							uc001sef.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1069-1071)CAG>CAA		coiled-coil transcriptional coactivator isoform							43.0	46.0	45.0					12																	54109766		2203	4300	6503	SO:0001819	synonymous_variant	57658				steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding	g.chr12:54109766C>T	AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.1071G>A	12.37:g.54109766C>T						CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Silent_p.Q272Q|CALCOCO1_uc010son.1_Silent_p.Q234Q|CALCOCO1_uc001seh.2_Silent_p.Q357Q|CALCOCO1_uc009znd.2_Silent_p.Q357Q|CALCOCO1_uc001seg.2_Silent_p.Q182Q|CALCOCO1_uc010soo.1_Silent_p.Q350Q	p.Q357Q	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN			9	1215	-			357					B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Silent	SNP	ENST00000550804.1	37	c.1071G>A	CCDS8864.1																																																																																				0.612	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898		29	28	0	0	0	0.003271	0	29	28				
HSD17B6	8630	broad.mit.edu	37	12	57178691	57178691	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:57178691C>G	ENST00000554643.1	+	5	976	c.627C>G	c.(625-627)ttC>ttG	p.F209L	HSD17B6_ENST00000322165.1_Missense_Mutation_p.F209L|HSD17B6_ENST00000555805.1_Missense_Mutation_p.F209L|HSD17B6_ENST00000554150.1_Missense_Mutation_p.F209L|HSD17B6_ENST00000555159.1_Missense_Mutation_p.F209L			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	209					androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)	p.F209L(3)		endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	CTGGCTACTTCAGAACGGGAA	0.423																																							uc001smg.1		NA																	3	Substitution - Missense(3)		lung(3)	upper_aerodigestive_tract(1)|pancreas(1)	2						c.(625-627)TTC>TTG		hydroxysteroid (17-beta) dehydrogenase 6	Succinic acid(DB00139)						178.0	171.0	173.0					12																	57178691		2203	4300	6503	SO:0001583	missense	8630				androgen biosynthetic process|androgen catabolic process	early endosome membrane|endoplasmic reticulum|microsome	binding|electron carrier activity|estradiol 17-beta-dehydrogenase activity|retinol dehydrogenase activity|testosterone 17-beta-dehydrogenase (NAD+) activity	g.chr12:57178691C>G	AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.627C>G	12.37:g.57178691C>G	ENSP00000451406:p.Phe209Leu						p.F209L	NM_003725	NP_003716	O14756	H17B6_HUMAN			4	737	+			209					O43275	Missense_Mutation	SNP	ENST00000554643.1	37	c.627C>G	CCDS8925.1	.	.	.	.	.	.	.	.	.	.	c	36	5.796372	0.96952	.	.	ENSG00000025423	ENST00000555159;ENST00000555805;ENST00000554643;ENST00000554150;ENST00000322165	D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23	4.42	3.53	0.40419	NAD(P)-binding domain (1);	0.000000	0.56097	D	0.000035	D	0.93906	0.8050	H	0.95539	3.685	0.39559	D	0.969101	D	0.63880	0.993	P	0.59012	0.85	D	0.94953	0.8101	10	0.87932	D	0	.	11.3473	0.49567	0.0:0.9086:0.0:0.0914	.	209	O14756	H17B6_HUMAN	L	209	ENSP00000450698:F209L;ENSP00000451753:F209L;ENSP00000451406:F209L;ENSP00000452273:F209L;ENSP00000318631:F209L	ENSP00000318631:F209L	F	+	3	2	HSD17B6	55464958	0.902000	0.30710	0.130000	0.21974	0.920000	0.55202	0.799000	0.27028	1.065000	0.40693	0.651000	0.88453	TTC		0.423	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410714.1	NM_003725		68	138	0	0	0	0.01441	0	68	138				
MIPEP	4285	broad.mit.edu	37	13	24444289	24444289	+	Missense_Mutation	SNP	T	T	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:24444289T>C	ENST00000382172.3	-	6	747	c.649A>G	c.(649-651)Agt>Ggt	p.S217G		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	217					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.S217G(2)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		AGAAATGTACTACTCAAATCC	0.363																																							uc001uox.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(649-651)AGT>GGT		mitochondrial intermediate peptidase precursor							110.0	97.0	102.0					13																	24444289		2203	4300	6503	SO:0001583	missense	4285				protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity	g.chr13:24444289T>C		CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.649A>G	13.37:g.24444289T>C	ENSP00000371607:p.Ser217Gly						p.S217G	NM_005932	NP_005923	Q99797	MIPEP_HUMAN		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)	6	749	-		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)	217					Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	ENST00000382172.3	37	c.649A>G	CCDS9303.1	.	.	.	.	.	.	.	.	.	.	T	15.57	2.872100	0.51695	.	.	ENSG00000027001	ENST00000382172	T	0.08984	3.03	5.92	5.92	0.95590	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.212476	0.56097	D	0.000026	T	0.13756	0.0333	M	0.61703	1.905	0.35557	D	0.804337	B	0.27932	0.194	B	0.29524	0.103	T	0.04635	-1.0937	10	0.62326	D	0.03	.	16.3678	0.83341	0.0:0.0:0.0:1.0	.	217	Q99797	MIPEP_HUMAN	G	217	ENSP00000371607:S217G	ENSP00000371607:S217G	S	-	1	0	MIPEP	23342289	1.000000	0.71417	0.172000	0.22920	0.966000	0.64601	7.432000	0.80349	2.254000	0.74563	0.528000	0.53228	AGT		0.363	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044169.1			20	41	0	0	0	0.008871	0	20	41				
ATP8A2	51761	broad.mit.edu	37	13	26129181	26129181	+	Nonsense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:26129181C>A	ENST00000381655.2	+	13	1380	c.1238C>A	c.(1237-1239)tCa>tAa	p.S413*	ATP8A2_ENST00000255283.8_Nonsense_Mutation_p.S373*	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	373					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S413*(2)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GCCAGGACATCAAACCTTAAT	0.428																																							uc001uqk.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|large_intestine(1)|skin(1)	4						c.(1237-1239)TCA>TAA		ATPase, aminophospholipid transporter-like,							102.0	99.0	100.0					13																	26129181		1843	4097	5940	SO:0001587	stop_gained	51761				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:26129181C>A	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1238C>A	13.37:g.26129181C>A	ENSP00000371070:p.Ser413*					ATP8A2_uc010tdi.1_Nonsense_Mutation_p.S373*|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc001uql.1_Nonsense_Mutation_p.S373*	p.S413*	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)	13	1380	+		Breast(139;0.0201)|Lung SC(185;0.0225)	373			Cytoplasmic (Potential).		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Nonsense_Mutation	SNP	ENST00000381655.2	37	c.1238C>A	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	C	42	9.613193	0.99219	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.6643	0.91483	0.0:1.0:0.0:0.0	.	.	.	.	X	413;373;193	.	ENSP00000255283:S373X	S	+	2	0	ATP8A2	25027181	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.526000	0.81920	2.656000	0.90262	0.637000	0.83480	TCA		0.428	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529		36	78	1	0	1.59361e-14	0.006999	1.84639e-14	36	78				
AKAP11	11215	broad.mit.edu	37	13	42876365	42876365	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:42876365G>T	ENST00000025301.2	+	8	3658	c.3483G>T	c.(3481-3483)gaG>gaT	p.E1161D		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1161					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)	p.E1161D(2)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AAAAAGAAGAGTTCATGTTGA	0.428																																							uc001uys.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(3481-3483)GAG>GAT		A-kinase anchor protein 11							75.0	80.0	79.0					13																	42876365		2202	4300	6502	SO:0001583	missense	11215				intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding	g.chr13:42876365G>T	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3483G>T	13.37:g.42876365G>T	ENSP00000025301:p.Glu1161Asp						p.E1161D	NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)	8	3658	+		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)	1161					O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	c.3483G>T	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.322369	0.41096	.	.	ENSG00000023516	ENST00000025301	T	0.17691	2.26	5.67	1.74	0.24563	.	0.067253	0.56097	D	0.000025	T	0.12902	0.0313	L	0.48642	1.525	0.34157	D	0.6682	P	0.40619	0.724	B	0.40782	0.34	T	0.23440	-1.0188	10	0.23891	T	0.37	.	4.1018	0.10017	0.4658:0.0:0.3758:0.1585	.	1161	Q9UKA4	AKA11_HUMAN	D	1161	ENSP00000025301:E1161D	ENSP00000025301:E1161D	E	+	3	2	AKAP11	41774365	0.918000	0.31147	1.000000	0.80357	0.997000	0.91878	0.002000	0.13061	0.243000	0.21327	0.561000	0.74099	GAG		0.428	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248		33	77	1	0	7.63505e-26	0.012213	1.0021e-25	33	77				
DCT	1638	broad.mit.edu	37	13	95114416	95114416	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:95114416G>T	ENST00000377028.5	-	5	1304	c.891C>A	c.(889-891)acC>acA	p.T297T	DCT_ENST00000446125.1_Silent_p.T297T|DCT_ENST00000490854.1_5'UTR	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	297					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)	p.T297T(4)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		CATTGCACAAGGTGACCAGGT	0.413																																							uc001vlv.3		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(889-891)ACC>ACA		dopachrome tautomerase isoform 1							117.0	101.0	106.0					13																	95114416		2203	4300	6503	SO:0001819	synonymous_variant	1638				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity	g.chr13:95114416G>T	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.891C>A	13.37:g.95114416G>T						DCT_uc010afh.2_Silent_p.T297T	p.T297T	NM_001922	NP_001913	P40126	TYRP2_HUMAN		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)	5	1318	-	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)	297			Lumenal, melanosome (Potential).		Q09GT4	Silent	SNP	ENST00000377028.5	37	c.891C>A	CCDS9470.1																																																																																				0.413	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3			13	63	1	0	4.36969e-10	0.001855	4.82966e-10	13	63				
MYO16	23026	broad.mit.edu	37	13	109777480	109777480	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:109777480C>A	ENST00000357550.2	+	29	3531	c.3490C>A	c.(3490-3492)Cgc>Agc	p.R1164S	MYO16_ENST00000457511.2_Missense_Mutation_p.R676S|MYO16_ENST00000356711.2_Missense_Mutation_p.R1164S	NM_001198950.1	NP_001185879.1			myosin XVI									p.R1164S(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ATTTTTAGCACGCCAGCACCT	0.393																																							uc001vqt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(3490-3492)CGC>AGC		myosin heavy chain Myr 8							56.0	55.0	55.0					13																	109777480		2203	4300	6503	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109777480C>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3490C>A	13.37:g.109777480C>A	ENSP00000350160:p.Arg1164Ser					MYO16_uc010agk.1_Missense_Mutation_p.R1186S|MYO16_uc010tjh.1_Missense_Mutation_p.R676S	p.R1164S	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		30	3616	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		1164			IQ.			Missense_Mutation	SNP	ENST00000357550.2	37	c.3490C>A	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018134	0.54576	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	D;D;D	0.96619	-4.07;-4.07;-4.07	5.75	5.75	0.90469	.	0.000000	0.41500	U	0.000862	D	0.96642	0.8904	L	0.29908	0.895	0.53688	D	0.999975	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95881	0.8899	9	.	.	.	.	18.948	0.92628	0.0:1.0:0.0:0.0	.	676;1164	F8W883;Q9Y6X6	.;MYO16_HUMAN	S	1164;1164;676	ENSP00000349145:R1164S;ENSP00000350160:R1164S;ENSP00000401633:R676S	.	R	+	1	0	MYO16	108575481	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.626000	0.46460	2.716000	0.92895	0.655000	0.94253	CGC		0.393	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		10	38	1	0	3.86212e-05	0.008291	4.08073e-05	10	38				
ADPRHL1	113622	broad.mit.edu	37	13	114107634	114107634	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:114107634G>A	ENST00000375418.3	-	1	205	c.119C>T	c.(118-120)tCc>tTc	p.S40F		NM_138430.3	NP_612439.2	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1	40					protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)	p.S40F(2)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	11	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			CAGGCCCCCGGAACGTTGCAG	0.597																																							uc001vtq.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(118-120)TCC>TTC		ADP-ribosylhydrolase like 1 isoform 1							129.0	120.0	123.0					13																	114107634		2203	4300	6503	SO:0001583	missense	113622				protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding	g.chr13:114107634G>A	AJ313429	CCDS9535.1, CCDS9536.1	13q34	2003-06-19			ENSG00000153531	ENSG00000153531			21303	protein-coding gene	gene with protein product		610620				12070318	Standard	NM_138430		Approved	ARH2	uc001vtq.1	Q8NDY3	OTTHUMG00000017386	ENST00000375418.3:c.119C>T	13.37:g.114107634G>A	ENSP00000364567:p.Ser40Phe						p.S40F	NM_138430	NP_612439	Q8NDY3	ARHL1_HUMAN	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)		1	206	-	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	40					Q5JUG2|Q96GD1	Missense_Mutation	SNP	ENST00000375418.3	37	c.119C>T	CCDS9535.1	.	.	.	.	.	.	.	.	.	.	G	6.062	0.379812	0.11466	.	.	ENSG00000153531	ENST00000375418	T	0.28666	1.6	4.89	-8.48	0.00935	.	10.981300	0.00695	N	0.000755	T	0.19208	0.0461	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.16424	-1.0403	10	0.10377	T	0.69	2.9227	8.0955	0.30826	0.2761:0.4968:0.2271:0.0	.	40	Q8NDY3	ARHL1_HUMAN	F	40	ENSP00000364567:S40F	ENSP00000364567:S40F	S	-	2	0	ADPRHL1	113155635	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.937000	0.28951	-2.106000	0.00841	-0.304000	0.09214	TCC		0.597	ADPRHL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045915.2	NM_138430		23	106	0	0	0	0.00333	0	23	106				
KIF26A	26153	broad.mit.edu	37	14	104642378	104642378	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr14:104642378G>T	ENST00000423312.2	+	12	3253	c.3253G>T	c.(3253-3255)Gcc>Tcc	p.A1085S	KIF26A_ENST00000315264.7_Missense_Mutation_p.A946S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1085					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)	p.A1085S(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		TGAGTTTGACGCCTACACCTC	0.672																																							uc001yos.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(3253-3255)GCC>TCC		kinesin family member 26A							7.0	9.0	8.0					14																	104642378		1930	4120	6050	SO:0001583	missense	26153				blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity	g.chr14:104642378G>T	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.3253G>T	14.37:g.104642378G>T	ENSP00000388241:p.Ala1085Ser						p.A1085S	NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	Epithelial(46;0.152)	Epithelial(152;0.161)	12	3253	+		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	1085					Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	ENST00000423312.2	37	c.3253G>T	CCDS45171.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.696121	0.48202	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	D;D	0.82081	-1.57;-1.56	4.29	4.29	0.51040	.	.	.	.	.	D	0.87629	0.6225	L	0.47716	1.5	0.51767	D	0.999937	D	0.89917	1.0	D	0.78314	0.991	D	0.86331	0.1698	9	0.31617	T	0.26	.	16.7296	0.85431	0.0:0.0:1.0:0.0	.	1085	Q9ULI4	KI26A_HUMAN	S	1085;946	ENSP00000388241:A1085S;ENSP00000325452:A946S	ENSP00000325452:A946S	A	+	1	0	KIF26A	103712131	1.000000	0.71417	0.065000	0.19835	0.200000	0.23975	7.590000	0.82653	1.942000	0.56320	0.313000	0.20887	GCC		0.672	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1			5	11	1	0	0.000602214	0.000602	0.000620687	5	11				
ZNF770	54989	broad.mit.edu	37	15	35274098	35274098	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:35274098C>T	ENST00000356321.4	-	3	1882	c.1538G>A	c.(1537-1539)aGa>aAa	p.R513K		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	513					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R513K(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		AGCTGACTGTCTAAAAGATTT	0.348																																							uc001ziw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1537-1539)AGA>AAA		zinc finger protein 770							55.0	57.0	56.0					15																	35274098		2200	4298	6498	SO:0001583	missense	54989				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:35274098C>T	BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.1538G>A	15.37:g.35274098C>T	ENSP00000348673:p.Arg513Lys						p.R513K	NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)	3	1849	-		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)	513			C2H2-type 9.		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	ENST00000356321.4	37	c.1538G>A	CCDS10042.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.709129	0.48517	.	.	ENSG00000198146	ENST00000356321	T	0.46451	0.87	5.1	5.1	0.69264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000002	T	0.37046	0.0989	N	0.05414	-0.055	0.23168	N	0.998189	P	0.43788	0.817	P	0.50825	0.651	T	0.31364	-0.9946	10	0.33141	T	0.24	-11.2503	18.6985	0.91611	0.0:1.0:0.0:0.0	.	513	Q6IQ21	ZN770_HUMAN	K	513	ENSP00000348673:R513K	ENSP00000348673:R513K	R	-	2	0	ZNF770	33061390	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.881000	0.48538	2.646000	0.89796	0.467000	0.42956	AGA		0.348	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251896.2	NM_014106		21	54	0	0	0	0.010504	0	21	54				
ZNF770	54989	broad.mit.edu	37	15	35274816	35274816	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:35274816C>T	ENST00000356321.4	-	3	1164	c.820G>A	c.(820-822)Gag>Aag	p.E274K		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	274					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.E274K(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TCACCAATCTCACCATTTTCA	0.388																																							uc001ziw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(820-822)GAG>AAG		zinc finger protein 770							46.0	48.0	47.0					15																	35274816		2201	4296	6497	SO:0001583	missense	54989				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:35274816C>T	BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.820G>A	15.37:g.35274816C>T	ENSP00000348673:p.Glu274Lys						p.E274K	NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)	3	1131	-		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)	274					Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	ENST00000356321.4	37	c.820G>A	CCDS10042.1	.	.	.	.	.	.	.	.	.	.	C	9.125	1.010046	0.19277	.	.	ENSG00000198146	ENST00000356321	T	0.08458	3.09	5.17	1.2	0.21068	.	0.544155	0.16373	U	0.217251	T	0.03959	0.0111	N	0.08118	0	0.18873	N	0.999988	B	0.21520	0.057	B	0.16722	0.016	T	0.38585	-0.9654	10	0.51188	T	0.08	-0.1844	6.0377	0.19716	0.1328:0.6518:0.0:0.2154	.	274	Q6IQ21	ZN770_HUMAN	K	274	ENSP00000348673:E274K	ENSP00000348673:E274K	E	-	1	0	ZNF770	33062108	0.002000	0.14202	0.761000	0.31378	0.738000	0.42128	0.196000	0.17176	0.067000	0.16545	-0.140000	0.14226	GAG		0.388	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251896.2	NM_014106		10	48	0	0	0	0.006214	0	10	48				
CASC5	57082	broad.mit.edu	37	15	40917230	40917231	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:40917230_40917231GG>TT	ENST00000346991.5	+	11	5236_5237	c.4846_4847GG>TT	c.(4846-4848)GGa>TTa	p.G1616L	CASC5_ENST00000399668.2_Missense_Mutation_p.G1590L			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	1616					acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G1616L(4)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		ACTTGAATTAGGAAATAAGGCA	0.332																																							uc010bbs.1		NA																	4	Substitution - Missense(4)		lung(4)	breast(3)|central_nervous_system(1)|skin(1)	5						c.(4846-4848)GGA>TTA		cancer susceptibility candidate 5 isoform 1																																				SO:0001583	missense	57082				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding	g.chr15:40917230_40917231GG>TT	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	Exception_encountered	15.37:g.40917230_40917231delinsTT	ENSP00000335463:p.Gly1616Leu					CASC5_uc010ucq.1_Missense_Mutation_p.G1440L|CASC5_uc001zme.2_Missense_Mutation_p.G1590L|CASC5_uc010bbt.1_Missense_Mutation_p.G1590L	p.G1616L	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)	11	5007_5008	+		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)	1616					Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	DNP	ENST00000346991.5	37	c.4846_4847GG>TT	CCDS42023.1																																																																																				0.332	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508		15	63	0	0	0	0.004672	0	15	63				
SPPL2A	84888	broad.mit.edu	37	15	51032016	51032016	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:51032016C>T	ENST00000261854.5	-	6	868	c.594G>A	c.(592-594)ttG>ttA	p.L198L		NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	198					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)	p.L198L(4)		endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		TCACTGCTTTCAAGTTTTCCC	0.323																																					Melanoma(50;790 1209 4069 22965 33125)	Melanoma(50;790 1209 4069 22965 33125)	uc001zyv.2		NA																	4	Substitution - coding silent(4)		lung(4)		0						c.(592-594)TTG>TTA		signal peptide peptidase-like 2A							84.0	85.0	84.0					15																	51032016		2196	4291	6487	SO:0001819	synonymous_variant	84888					integral to membrane	aspartic-type endopeptidase activity	g.chr15:51032016C>T		CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.594G>A	15.37:g.51032016C>T							p.L198L	NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN		all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)	6	774	-			198					B2RDS0|Q8TAW1|Q96SZ8	Silent	SNP	ENST00000261854.5	37	c.594G>A	CCDS10138.1																																																																																				0.323	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254543.3	NM_032802		9	29	0	0	0	0.006214	0	9	29				
TLN2	83660	broad.mit.edu	37	15	63063322	63063322	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:63063322G>A	ENST00000561311.1	+	41	5586	c.5356G>A	c.(5356-5358)Gga>Aga	p.G1786R	TLN2_ENST00000306829.6_Missense_Mutation_p.G1786R|TLN2_ENST00000472902.1_Missense_Mutation_p.G179R			Q9Y4G6	TLN2_HUMAN	talin 2	1786					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AGAAGGTGGCGGAAACCCCAA	0.507																																							uc002alb.3		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						c.(5356-5358)GGA>AGA		talin 2							97.0	90.0	93.0					15																	63063322		2203	4300	6503	SO:0001583	missense	83660				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	g.chr15:63063322G>A	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5356G>A	15.37:g.63063322G>A	ENSP00000453508:p.Gly1786Arg					TLN2_uc002alc.3_Missense_Mutation_p.G179R|TLN2_uc002ald.2_Missense_Mutation_p.G179R	p.G1786R	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN			39	5356	+			1786					A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	c.5356G>A	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.842564	0.91197	.	.	ENSG00000171914	ENST00000306829	T	0.13778	2.56	5.39	5.39	0.77823	.	0.094954	0.64402	D	0.000001	T	0.43055	0.1230	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.34129	-0.9841	10	0.72032	D	0.01	-20.6628	19.3562	0.94414	0.0:0.0:1.0:0.0	.	830;1786	G1UI21;Q9Y4G6	.;TLN2_HUMAN	R	1786	ENSP00000303476:G1786R	ENSP00000303476:G1786R	G	+	1	0	TLN2	60850614	1.000000	0.71417	0.740000	0.30986	0.841000	0.47740	9.601000	0.98297	2.804000	0.96469	0.655000	0.94253	GGA		0.507	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2			3	101	0	0	0	0.004672	0	3	101				
BNC1	646	broad.mit.edu	37	15	83932641	83932641	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:83932641G>A	ENST00000345382.2	-	4	1447	c.1362C>T	c.(1360-1362)ccC>ccT	p.P454P	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Silent_p.P447P	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	454					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P454P(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						CAGGGTAGCTGGGAGGAGGCC	0.547																																							uc002bjt.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(1360-1362)CCC>CCT		basonuclin 1							98.0	90.0	93.0					15																	83932641		2203	4300	6503	SO:0001819	synonymous_variant	646				epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr15:83932641G>A	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1362C>T	15.37:g.83932641G>A						BNC1_uc010uos.1_Silent_p.P442P	p.P454P	NM_001717	NP_001708	Q01954	BNC1_HUMAN			4	1450	-			454					Q15840	Silent	SNP	ENST00000345382.2	37	c.1362C>T	CCDS10324.1																																																																																				0.547	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717		40	100	0	0	0	0.004878	0	40	100				
ECI1	1632	broad.mit.edu	37	16	2293439	2293439	+	Splice_Site	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:2293439C>T	ENST00000301729.4	-	5	490	c.443G>A	c.(442-444)gGa>gAa	p.G148E	ECI1_ENST00000562238.1_Splice_Site_p.G148E|ECI1_ENST00000570258.1_Splice_Site_p.G89E|RP11-304L19.11_ENST00000565709.1_RNA	NM_001919.3	NP_001910.2	P42126	ECI1_HUMAN	enoyl-CoA delta isomerase 1	148					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|intramolecular oxidoreductase activity (GO:0016860)	p.G148E(2)		endometrium(1)|large_intestine(2)|lung(6)	9						GGGGCAGGCTCCCTGCAGGGA	0.652																																							uc002cpr.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(442-444)GGA>GAA		dodecenoyl-Coenzyme A delta isomerase precursor							52.0	51.0	51.0					16																	2293439		2198	4300	6498	SO:0001630	splice_region_variant	1632				fatty acid beta-oxidation	mitochondrial matrix	dodecenoyl-CoA delta-isomerase activity	g.chr16:2293439C>T		CCDS10464.1, CCDS58410.1	16p13.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000167969	ENSG00000167969	5.3.3.8		2703	protein-coding gene	gene with protein product	"""3,2 trans-enoyl-CoA isomerase"""	600305	"""dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)"", ""dodecenoyl-CoA isomerase"""	DCI		7829074	Standard	NM_001178029		Approved		uc002cpr.3	P42126	OTTHUMG00000128830	ENST00000301729.4:c.442-1G>A	16.37:g.2293439C>T						DCI_uc002cps.2_Missense_Mutation_p.G148E	p.G148E	NM_001919	NP_001910	P42126	ECI1_HUMAN			5	479	-			148					A8K512|Q13290|Q7Z2L6|Q7Z2L7|Q9BUB8|Q9BW05|Q9UDG6	Missense_Mutation	SNP	ENST00000301729.4	37	c.443G>A	CCDS10464.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308054	0.60305	.	.	ENSG00000167969	ENST00000301729	D	0.98978	-5.29	4.32	4.32	0.51571	Enoyl-CoA hydratase/isomerase, conserved site (1);Crotonase, core (1);	0.000000	0.85682	D	0.000000	D	0.99492	0.9819	H	0.96269	3.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98048	1.0386	10	0.87932	D	0	-13.802	14.3613	0.66773	0.0:1.0:0.0:0.0	.	148;148	P42126-2;P42126	.;ECI1_HUMAN	E	148	ENSP00000301729:G148E	ENSP00000301729:G148E	G	-	2	0	ECI1	2233440	1.000000	0.71417	0.916000	0.36221	0.104000	0.19210	7.540000	0.82074	2.242000	0.73789	0.591000	0.81541	GGA		0.652	ECI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250768.1		Missense_Mutation	26	100	0	0	0	0.008361	0	26	100				
C16orf90	646174	broad.mit.edu	37	16	3544576	3544576	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:3544576G>A	ENST00000437192.3	-	2	350	c.348C>T	c.(346-348)ctC>ctT	p.L116L	LA16c-306E5.3_ENST00000574423.2_RNA	NM_001080524.1	NP_001073993.1	A8MZG2	CP090_HUMAN	chromosome 16 open reading frame 90	106										large_intestine(1)	1						GGGCTGAACAGAGGCTGTTAC	0.672																																							uc002cvi.2		NA																	0					0						c.(346-348)CTC>CTT		hypothetical protein LOC646174							30.0	31.0	31.0					16																	3544576		1965	4138	6103	SO:0001819	synonymous_variant	646174							g.chr16:3544576G>A		CCDS45397.1	16p13.3	2009-01-29			ENSG00000215131	ENSG00000215131			34455	protein-coding gene	gene with protein product							Standard	NM_001080524		Approved	LOC646174	uc002cvi.3	A8MZG2	OTTHUMG00000154627	ENST00000437192.3:c.348C>T	16.37:g.3544576G>A							p.L116L	NM_001080524	NP_001073993	A8MZG2	CP090_HUMAN			2	348	-			106						Silent	SNP	ENST00000437192.3	37	c.348C>T	CCDS45397.1																																																																																				0.672	C16orf90-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346319.2	NM_001080524		14	40	0	0	0	0.014323	0	14	40				
XYLT1	64131	broad.mit.edu	37	16	17202725	17202725	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:17202725C>G	ENST00000261381.6	-	12	2791	c.2707G>C	c.(2707-2709)Gag>Cag	p.E903Q		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	903					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.E903Q(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AGCCATCCCTCCAGCGCTGTG	0.667																																							uc002dfa.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(2707-2709)GAG>CAG		xylosyltransferase I							71.0	63.0	66.0					16																	17202725		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17202725C>G	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2707G>C	16.37:g.17202725C>G	ENSP00000261381:p.Glu903Gln						p.E903Q	NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN			12	2792	-			903			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.2707G>C	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.283230	0.59867	.	.	ENSG00000103489	ENST00000261381	T	0.04970	3.52	5.7	5.7	0.88788	.	0.042979	0.85682	D	0.000000	T	0.12475	0.0303	L	0.48642	1.525	0.58432	D	0.999993	P	0.48911	0.917	P	0.48627	0.584	T	0.02064	-1.1220	10	0.33940	T	0.23	-47.0445	18.8196	0.92090	0.0:1.0:0.0:0.0	.	903	Q86Y38	XYLT1_HUMAN	Q	903	ENSP00000261381:E903Q	ENSP00000261381:E903Q	E	-	1	0	XYLT1	17110226	1.000000	0.71417	0.995000	0.50966	0.811000	0.45836	5.784000	0.68990	2.675000	0.91044	0.655000	0.94253	GAG		0.667	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		24	99	0	0	0	0.00632	0	24	99				
TAOK2	9344	broad.mit.edu	37	16	29997963	29997963	+	Silent	SNP	C	C	T	rs565889860		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:29997963C>T	ENST00000308893.4	+	16	3413	c.2370C>T	c.(2368-2370)ggC>ggT	p.G790G	TAOK2_ENST00000279394.3_Intron|TAOK2_ENST00000416441.2_Silent_p.G617G|TAOK2_ENST00000543033.1_Intron	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	790					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)	p.G790G(2)		breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						GAATGCTTGGCGAGGAGGAGG	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		17829	0.001		0.0	False		,,,				2504	0.0						uc002dva.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2368-2370)GGC>GGT		TAO kinase 2 isoform 2							53.0	59.0	57.0					16																	29997963		2197	4300	6497	SO:0001819	synonymous_variant	9344				actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity	g.chr16:29997963C>T	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.2370C>T	16.37:g.29997963C>T						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Intron|TAOK2_uc002dvc.1_Intron|TAOK2_uc010bzm.1_Silent_p.G797G|TAOK2_uc002dvd.1_Silent_p.G617G	p.G790G	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN			16	3153	+			790					A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Silent	SNP	ENST00000308893.4	37	c.2370C>T	CCDS10663.1																																																																																				0.597	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	NM_016151		55	146	0	0	0	0.01441	0	55	146				
SALL1	6299	broad.mit.edu	37	16	51173710	51173710	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:51173710G>T	ENST00000251020.4	-	2	2456	c.2423C>A	c.(2422-2424)tCt>tAt	p.S808Y	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.S711Y	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	808					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S808Y(2)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ACCTGTGTCAGACTCCATGGA	0.507																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)|ovary(3)	8						c.(2422-2424)TCT>TAT		sal-like 1 isoform a							117.0	124.0	121.0					16																	51173710		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51173710G>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2423C>A	16.37:g.51173710G>T	ENSP00000251020:p.Ser808Tyr					SALL1_uc010vgr.1_Missense_Mutation_p.S711Y|SALL1_uc010cbv.2_Intron	p.S808Y	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	2454	-		all_cancers(37;0.0322)	808					Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.2423C>A	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960018	0.34565	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.08102	3.13;3.13	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.19005	0.0456	M	0.63843	1.955	0.80722	D	1	D	0.69078	0.997	P	0.56278	0.795	T	0.06661	-1.0814	10	0.06099	T	0.92	.	19.0945	0.93244	0.0:0.0:1.0:0.0	.	808	Q9NSC2	SALL1_HUMAN	Y	808;711;772	ENSP00000251020:S808Y;ENSP00000407914:S711Y	ENSP00000251020:S808Y	S	-	2	0	SALL1	49731211	1.000000	0.71417	0.923000	0.36655	0.001000	0.01503	9.869000	0.99810	2.511000	0.84671	0.454000	0.30748	TCT		0.507	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		58	162	1	0	1.0442e-30	0.01441	1.41472e-30	58	162				
COX4I1	1327	broad.mit.edu	37	16	85838571	85838571	+	Silent	SNP	G	G	A	rs377678815		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:85838571G>A	ENST00000562336.1	+	3	295	c.102G>A	c.(100-102)tcG>tcA	p.S34S	COX4I1_ENST00000253452.2_Silent_p.S34S|COX4I1_ENST00000561569.1_Silent_p.S34S|COX4I1_ENST00000570123.1_3'UTR|COX4I1_ENST00000564903.1_Silent_p.S34S|COX4I1_ENST00000568794.1_Silent_p.S34S			P13073	COX41_HUMAN	cytochrome c oxidase subunit IV isoform 1	34					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-c oxidase activity (GO:0004129)	p.S34S(2)		endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9		Renal(780;0.228)				AAGACTTTTCGCTCCCAGCTT	0.473																																							uc002fje.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(1)	1						c.(100-102)TCG>TCA		cytochrome c oxidase subunit IV isoform 1		G		0,4396		0,0,2198	61.0	63.0	62.0		102	-1.5	0.3	16		62	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	COX4I1	NM_001861.3		0,1,6497	AA,AG,GG		0.0116,0.0,0.0077		34/170	85838571	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	1327				respiratory electron transport chain	mitochondrial inner membrane|nucleus	cytochrome-c oxidase activity|protein binding	g.chr16:85838571G>A	AF005889	CCDS10955.1	16q24.1	2012-10-02	2001-11-30	2001-12-07	ENSG00000131143	ENSG00000131143	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2265	protein-coding gene	gene with protein product		123864	"""cytochrome c oxidase subunit IV"""	COX4		2444497, 2157630	Standard	NM_001861		Approved	COX4-1	uc002fje.3	P13073	OTTHUMG00000137649	ENST00000562336.1:c.102G>A	16.37:g.85838571G>A						COX4I1_uc002fjf.2_Silent_p.S34S|COX4I1_uc002fjg.1_Silent_p.S34S|COX4I1_uc010vom.1_5'UTR	p.S34S	NM_001861	NP_001852	P13073	COX41_HUMAN			3	266	+		Renal(780;0.228)	34					B2R4J2|D3DUM7|Q6P666	Silent	SNP	ENST00000562336.1	37	c.102G>A	CCDS10955.1																																																																																				0.473	COX4I1-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430873.1	NM_001861		29	65	0	0	0	0.006999	0	29	65				
VPS53	55275	broad.mit.edu	37	17	534814	534814	+	Missense_Mutation	SNP	T	T	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:534814T>A	ENST00000571805.1	-	8	799	c.663A>T	c.(661-663)gaA>gaT	p.E221D	VPS53_ENST00000401468.3_Intron|VPS53_ENST00000446250.2_Missense_Mutation_p.E23D|VPS53_ENST00000576149.1_5'UTR|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000291074.5_Missense_Mutation_p.E192D|VPS53_ENST00000437048.2_Missense_Mutation_p.E221D			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	221					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)		p.E192D(2)|p.E221D(2)		breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		AAGGAAACGCTTCTTCAAAAT	0.498																																							uc002frn.2		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(661-663)GAA>GAT		vacuolar protein sorting 53 isoform 2							152.0	116.0	129.0					17																	534814		2203	4300	6503	SO:0001583	missense	55275				protein transport	endosome membrane|Golgi apparatus		g.chr17:534814T>A		CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.663A>T	17.37:g.534814T>A	ENSP00000459312:p.Glu221Asp					VPS53_uc002frk.2_Translation_Start_Site|VPS53_uc010cjo.1_Missense_Mutation_p.E221D|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Missense_Mutation_p.E192D|VPS53_uc002fro.2_Missense_Mutation_p.E23D|VPS53_uc010cjp.1_Intron	p.E221D	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)	8	810	-			221					A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	ENST00000571805.1	37	c.663A>T		.	.	.	.	.	.	.	.	.	.	T	18.63	3.665825	0.67700	.	.	ENSG00000141252	ENST00000437048;ENST00000446250;ENST00000291074;ENST00000389040	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.82	4.75	0.60458	Vps53-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.24044	0.0582	L	0.27944	0.81	0.80722	D	1	B;B;B;B	0.27351	0.047;0.176;0.027;0.047	B;B;B;B	0.32342	0.068;0.144;0.143;0.088	T	0.04522	-1.0945	10	0.45353	T	0.12	-27.5605	11.0282	0.47757	0.0:0.0723:0.0:0.9277	.	221;23;221;192	Q5VIR6-4;G3V0H8;Q5VIR6;Q5VIR6-2	.;.;VPS53_HUMAN;.	D	221;23;192;221	ENSP00000401435:E221D;ENSP00000394386:E23D;ENSP00000291074:E192D;ENSP00000373692:E221D	ENSP00000291074:E192D	E	-	3	2	VPS53	481564	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.954000	0.40362	1.042000	0.40150	0.460000	0.39030	GAA		0.498	VPS53-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000436940.2	NM_018289		30	74	0	0	0	0.013726	0	30	74				
SLFN12	55106	broad.mit.edu	37	17	33749265	33749265	+	Missense_Mutation	SNP	T	T	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:33749265T>A	ENST00000394562.1	-	4	1306	c.783A>T	c.(781-783)gaA>gaT	p.E261D	SLFN12_ENST00000460530.1_5'Flank|SLFN12_ENST00000304905.5_Missense_Mutation_p.E261D|SLFN12_ENST00000452764.3_Missense_Mutation_p.E261D			Q8IYM2	SLN12_HUMAN	schlafen family member 12	261							ATP binding (GO:0005524)	p.E261D(2)		breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CGATTTCTCTTTCTAAGTCAT	0.338																																							uc002hji.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(781-783)GAA>GAT		schlafen family member 12							82.0	86.0	85.0					17																	33749265		2203	4300	6503	SO:0001583	missense	55106						ATP binding	g.chr17:33749265T>A	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.783A>T	17.37:g.33749265T>A	ENSP00000378063:p.Glu261Asp					SLFN12_uc002hjj.3_Missense_Mutation_p.E261D|SLFN12_uc010cts.2_Missense_Mutation_p.E261D	p.E261D	NM_018042	NP_060512	Q8IYM2	SLN12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	2	1160	-		Ovarian(249;0.17)	261					A8K711|Q9NP47	Missense_Mutation	SNP	ENST00000394562.1	37	c.783A>T	CCDS11295.1	.	.	.	.	.	.	.	.	.	.	T	10.45	1.353597	0.24512	.	.	ENSG00000172123	ENST00000394562;ENST00000304905;ENST00000452764	T;T;T	0.59638	0.25;0.25;0.25	3.49	1.02	0.19986	.	.	.	.	.	T	0.50137	0.1598	M	0.64997	1.995	0.09310	N	1	P	0.44139	0.827	B	0.42087	0.375	T	0.42982	-0.9419	9	0.49607	T	0.09	.	3.0452	0.06151	0.2099:0.1243:0.0:0.6658	.	261	Q8IYM2	SLN12_HUMAN	D	261	ENSP00000378063:E261D;ENSP00000302077:E261D;ENSP00000394903:E261D	ENSP00000302077:E261D	E	-	3	2	SLFN12	30773378	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	-0.479000	0.06567	0.039000	0.15632	0.358000	0.22013	GAA		0.338	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256491.1	NM_018042		29	73	0	0	0	0.013726	0	29	73				
MED1	5469	broad.mit.edu	37	17	37564758	37564758	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:37564758G>A	ENST00000300651.6	-	17	3939	c.3716C>T	c.(3715-3717)tCa>tTa	p.S1239L	MED1_ENST00000394287.3_Intron|CTB-131K11.1_ENST00000582842.1_RNA	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.S1239L(2)		NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GCCAGAGCTTGAACTAGTTCC	0.502										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	Pancreas(21;279 768 2492 4877 24026)	uc002hrv.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8						c.(3715-3717)TCA>TTA		mediator complex subunit 1							87.0	85.0	86.0					17																	37564758		2203	4300	6503	SO:0001583	missense	5469				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:37564758G>A	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.3716C>T	17.37:g.37564758G>A	ENSP00000300651:p.Ser1239Leu	HNSCC(31;0.082)				MED1_uc010wee.1_Missense_Mutation_p.S1067L|MED1_uc002hru.2_Intron	p.S1239L	NM_004774	NP_004765	Q15648	MED1_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)	17	3928	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	1239			Ser-rich.		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	37	c.3716C>T	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.703327	0.68501	.	.	ENSG00000125686	ENST00000300651	T	0.58797	0.31	5.35	5.35	0.76521	.	.	.	.	.	T	0.63283	0.2498	N	0.14661	0.345	0.58432	D	0.999999	D	0.57899	0.981	D	0.69824	0.966	T	0.68123	-0.5492	9	0.66056	D	0.02	-8.618	19.6142	0.95626	0.0:0.0:1.0:0.0	.	1239	Q15648	MED1_HUMAN	L	1239	ENSP00000300651:S1239L	ENSP00000300651:S1239L	S	-	2	0	MED1	34818284	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.580000	0.82523	2.941000	0.99782	0.655000	0.94253	TCA		0.502	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774		37	79	0	0	0	0.003755	0	37	79				
TMEM99	147184	broad.mit.edu	37	17	38991095	38991095	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:38991095C>T	ENST00000301665.3	+	3	631	c.327C>T	c.(325-327)ttC>ttT	p.F109F		NM_001195386.1|NM_001195387.1|NM_145274.3	NP_001182315.1|NP_001182316.1|NP_660317.2	Q8N816	TMM99_HUMAN	transmembrane protein 99	109						integral component of membrane (GO:0016021)		p.F109F(2)		cervix(1)|large_intestine(1)|lung(5)|skin(2)|urinary_tract(1)	10		Breast(137;0.000301)				GGTTGCTCTTCAACAACTGGA	0.493																																							uc002hvj.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(1)	1						c.(325-327)TTC>TTT		transmembrane protein 99 precursor							145.0	143.0	144.0					17																	38991095		1927	4145	6072	SO:0001819	synonymous_variant	147184					integral to membrane		g.chr17:38991095C>T	AK097454	CCDS42319.1	17q21.2	2008-11-06			ENSG00000167920	ENSG00000167920			28305	protein-coding gene	gene with protein product						12477932	Standard	NM_001195386		Approved	MGC21518	uc021txc.1	Q8N816	OTTHUMG00000133579	ENST00000301665.3:c.327C>T	17.37:g.38991095C>T							p.F109F	NM_145274	NP_660317	Q8N816	TMM99_HUMAN			3	634	+		Breast(137;0.000301)	109			Helical; (Potential).		B4DQ34|Q96BP9	Silent	SNP	ENST00000301665.3	37	c.327C>T	CCDS42319.1																																																																																				0.493	TMEM99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257681.1	NM_145274		54	106	0	0	0	0.01441	0	54	106				
MMD	23531	broad.mit.edu	37	17	53485149	53485149	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:53485149C>G	ENST00000262065.3	-	4	598	c.302G>C	c.(301-303)aGa>aCa	p.R101T		NM_012329.2	NP_036461.2	Q15546	PAQRB_HUMAN	monocyte to macrophage differentiation-associated	101					cytolysis (GO:0019835)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|large_intestine(1)|lung(4)|prostate(1)	7						GATAACCATTCTATCACACAT	0.383																																							uc002iui.2		NA																	0					0						c.(301-303)AGA>ACA		monocyte to macrophage							123.0	100.0	108.0					17																	53485149		2203	4300	6503	SO:0001583	missense	23531				cytolysis	integral to plasma membrane|late endosome membrane|lysosomal membrane|membrane fraction	receptor activity	g.chr17:53485149C>G	X85750	CCDS11586.1	17q	2008-05-02				ENSG00000108960			7153	protein-coding gene	gene with protein product		604467				7503749, 16044242	Standard	NM_012329		Approved	MMA, PAQR11	uc002iui.3	Q15546		ENST00000262065.3:c.302G>C	17.37:g.53485149C>G	ENSP00000262065:p.Arg101Thr						p.R101T	NM_012329	NP_036461	Q15546	PAQRB_HUMAN			4	587	-			101			Cytoplasmic (Potential).		B2R6X9|D3DTY6|Q8TAN7	Missense_Mutation	SNP	ENST00000262065.3	37	c.302G>C	CCDS11586.1	.	.	.	.	.	.	.	.	.	.	C	30	5.056021	0.93793	.	.	ENSG00000108960	ENST00000262065	T	0.30182	1.54	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.64789	0.2630	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69752	-0.5060	10	0.72032	D	0.01	-37.1283	19.2069	0.93734	0.0:1.0:0.0:0.0	.	101	Q15546	PAQRB_HUMAN	T	101	ENSP00000262065:R101T	ENSP00000262065:R101T	R	-	2	0	MMD	50840148	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.480000	0.81109	2.780000	0.95670	0.655000	0.94253	AGA		0.383	MMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439214.1			5	69	0	0	0	0.001984	0	5	69				
C17orf70	80233	broad.mit.edu	37	17	79517503	79517503	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:79517503C>T	ENST00000327787.8	-	3	1063	c.1017G>A	c.(1015-1017)cgG>cgA	p.R339R	C17orf70_ENST00000537152.1_Silent_p.R188R|C17orf70_ENST00000425898.2_5'Flank			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	339					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R339R(1)|p.R188R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GGCAGTACTCCCGCAGCTCGG	0.657																																							uc002kaq.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(1015-1017)CGG>CGA		Fanconi anemia core complex 100 kDa subunit							33.0	37.0	36.0					17																	79517503		2202	4298	6500	SO:0001819	synonymous_variant	80233				DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding	g.chr17:79517503C>T	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.1017G>A	17.37:g.79517503C>T						C17orf70_uc002kao.1_5'Flank|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Silent_p.R188R	p.R339R	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)		3	1072	-	all_neural(118;0.0878)|Melanoma(429;0.242)		339					A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Silent	SNP	ENST00000327787.8	37	c.1017G>A	CCDS32765.2																																																																																				0.657	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161		32	73	0	0	0	0.005524	0	32	73				
RAB31	11031	broad.mit.edu	37	18	9814045	9814045	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr18:9814045G>A	ENST00000578921.1	+	4	471	c.230G>A	c.(229-231)cGa>cAa	p.R77Q		NM_006868.3	NP_006859.2	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family	76					cellular response to insulin stimulus (GO:0032869)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|phagosome maturation (GO:0090382)|receptor internalization (GO:0031623)|regulated secretory pathway (GO:0045055)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R77Q(2)		breast(2)|endometrium(2)|large_intestine(2)|lung(3)|skin(1)	10						ATGTACTATCGAGGCTCAGCT	0.378																																							uc002kog.2		NA																	2	Substitution - Missense(2)	p.R77*(1)	lung(2)	skin(1)	1						c.(229-231)CGA>CAA		RAB31, member RAS oncogene family							98.0	92.0	94.0					18																	9814045		1897	4140	6037	SO:0001583	missense	11031				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr18:9814045G>A	U59877	CCDS45826.1	18p11.22	2014-03-18			ENSG00000168461	ENSG00000168461		"""RAB, member RAS oncogene"""	9771	protein-coding gene	gene with protein product		605694				8863739	Standard	NM_006868		Approved	Rab22B	uc002kog.2	Q13636	OTTHUMG00000178513	ENST00000578921.1:c.230G>A	18.37:g.9814045G>A	ENSP00000461945:p.Arg77Gln						p.R77Q	NM_006868	NP_006859	Q13636	RAB31_HUMAN			4	405	+			76					B2RBT7|Q15770|Q9HC00	Missense_Mutation	SNP	ENST00000578921.1	37	c.230G>A	CCDS45826.1	.	.	.	.	.	.	.	.	.	.	G	35	5.425386	0.96131	.	.	ENSG00000168461	ENST00000306096;ENST00000435762	.	.	.	5.78	5.78	0.91487	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84433	0.5471	M	0.89287	3.02	0.80722	D	1	D	0.76494	0.999	D	0.66602	0.945	D	0.86218	0.1629	8	.	.	.	-9.3241	18.7918	0.91976	0.0:0.0:1.0:0.0	.	76	Q13636	RAB31_HUMAN	Q	77;68	.	.	R	+	2	0	RAB31	9804045	1.000000	0.71417	0.975000	0.42487	0.909000	0.53808	8.902000	0.92568	2.730000	0.93505	0.655000	0.94253	CGA		0.378	RAB31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442280.3			5	5	0	0	0	0.001168	0	5	5				
STK11	6794	broad.mit.edu	37	19	1220717	1220717	+	Splice_Site	SNP	G	G	T	rs587782018		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:1220717G>T	ENST00000326873.7	+	5	1907		c.e5+1			NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11						activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(6)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGTCACCCTGTAAGTGCCCC	0.711		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		26	Whole gene deletion(20)|Unknown(6)	p.0?(19)|p.?(4)	cervix(14)|lung(8)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CS012227	STK11	S		c.e5+1		serine/threonine protein kinase 11							21.0	27.0	25.0					19																	1220717		1995	4135	6130	SO:0001630	splice_region_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220717G>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.734+1G>T	19.37:g.1220717G>T		TSP Lung(3;<1E-08)					p.L245_splice	NM_000455	NP_000446	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1849	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)						B2RBX7|E7EW76	Splice_Site	SNP	ENST00000326873.7	37	c.734_splice	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851118	0.91277	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5988	0.91240	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STK11	1171717	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	9.729000	0.98795	2.644000	0.89710	0.561000	0.74099	.		0.711	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	Intron	25	19	1	0	9.39395e-14	0.00632	1.08095e-13	25	19				
PLIN4	729359	broad.mit.edu	37	19	4512261	4512261	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:4512261C>G	ENST00000301286.3	-	3	1668	c.1669G>C	c.(1669-1671)Ggg>Cgg	p.G557R		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	557	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.G557R(2)|p.G485R(2)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						CCCGTGAGCCCAGTGGACATC	0.612																																							uc002mar.1		NA																	4	Substitution - Missense(4)		lung(4)		0						c.(1669-1671)GGG>CGG		plasma membrane associated protein, S3-12							117.0	129.0	125.0					19																	4512261		2045	4186	6231	SO:0001583	missense	729359					lipid particle|plasma membrane		g.chr19:4512261C>G	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1669G>C	19.37:g.4512261C>G	ENSP00000301286:p.Gly557Arg					PLIN4_uc010dub.1_5'Flank	p.G557R	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN			3	1669	-			557			27 X 33 AA approximate tandem repeat.|15.		A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	c.1669G>C	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.298321	0.60195	.	.	ENSG00000167676	ENST00000301286	T	0.15603	2.41	5.15	5.15	0.70609	.	0.000000	0.51477	D	0.000089	T	0.47340	0.1440	M	0.85197	2.74	0.20074	N	0.999932	D	0.89917	1.0	D	0.97110	1.0	T	0.46219	-0.9207	10	0.72032	D	0.01	-18.547	16.1138	0.81283	0.0:1.0:0.0:0.0	.	557	Q96Q06	PLIN4_HUMAN	R	557	ENSP00000301286:G557R	ENSP00000301286:G557R	G	-	1	0	PLIN4	4463261	0.007000	0.16637	0.066000	0.19879	0.002000	0.02628	1.164000	0.31810	2.390000	0.81377	0.555000	0.69702	GGG		0.612	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901		89	193	0	0	0	0.01441	0	89	193				
OR1M1	125963	broad.mit.edu	37	19	9203982	9203982	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:9203982C>A	ENST00000429566.3	+	1	128	c.62C>A	c.(61-63)cCa>cAa	p.P21Q		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P21Q(2)		breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						TCAGAAAAGCCAGAGCAGGAG	0.507																																							uc010xkj.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)	3						c.(61-63)CCA>CAA		olfactory receptor, family 1, subfamily M,							108.0	94.0	99.0					19																	9203982		2203	4300	6503	SO:0001583	missense	125963				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9203982C>A		CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.62C>A	19.37:g.9203982C>A	ENSP00000401966:p.Pro21Gln						p.P21Q	NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN			1	62	+			21			Extracellular (Potential).		B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	ENST00000429566.3	37	c.62C>A	CCDS32896.1	.	.	.	.	.	.	.	.	.	.	t	7.902	0.734710	0.15574	.	.	ENSG00000170929	ENST00000305465;ENST00000429566	T	0.00428	7.44	3.49	1.27	0.21489	.	0.658638	0.14125	N	0.339745	T	0.00328	0.0010	L	0.45285	1.41	0.09310	N	1	B	0.22909	0.077	B	0.28709	0.093	T	0.40059	-0.9583	10	0.62326	D	0.03	.	6.8988	0.24271	0.0:0.7184:0.1474:0.1342	.	21	Q8NGA1	OR1M1_HUMAN	Q	24;21	ENSP00000401966:P21Q	ENSP00000303195:P24Q	P	+	2	0	OR1M1	9064982	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.934000	0.03955	0.297000	0.22615	-2.275000	0.00273	CCA		0.507	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448993.1			53	23	1	0	2.47907e-22	0.01441	3.15517e-22	53	23				
KEAP1	9817	broad.mit.edu	37	19	10600510	10600510	+	Nonsense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:10600510C>A	ENST00000171111.5	-	4	1892	c.1345G>T	c.(1345-1347)Gag>Tag	p.E449*	KEAP1_ENST00000588024.1_5'Flank|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000393623.2_Nonsense_Mutation_p.E449*	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	449					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.E449*(2)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	AAGTGCCACTCATCCCGCTCT	0.537																																							uc002moq.1		NA																	2	Substitution - Nonsense(2)		lung(2)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(1345-1347)GAG>TAG		kelch-like ECH-associated protein 1							46.0	40.0	42.0					19																	10600510		2203	4300	6503	SO:0001587	stop_gained	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10600510C>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1345G>T	19.37:g.10600510C>A	ENSP00000171111:p.Glu449*					KEAP1_uc002mop.1_Nonsense_Mutation_p.E167*|KEAP1_uc002mor.1_Nonsense_Mutation_p.E449*	p.E449*	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		4	1501	-			449			Kelch 3.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Nonsense_Mutation	SNP	ENST00000171111.5	37	c.1345G>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	38	7.180174	0.98118	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	.	.	.	5.79	4.76	0.60689	.	0.123768	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6728	0.56876	0.0:0.9204:0.0:0.0796	.	.	.	.	X	449	.	ENSP00000171111:E449X	E	-	1	0	KEAP1	10461510	0.793000	0.28825	0.974000	0.42286	0.839000	0.47603	1.303000	0.33470	1.469000	0.48083	0.558000	0.71614	GAG		0.537	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		18	14	1	0	9.7654e-05	0.007413	0.0001019	18	14				
S1PR5	53637	broad.mit.edu	37	19	10624671	10624671	+	Silent	SNP	C	C	T	rs544961723		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:10624671C>T	ENST00000439028.3	-	2	1142	c.1017G>A	c.(1015-1017)gcG>gcA	p.A339A	S1PR5_ENST00000333430.4_Silent_p.A339A	NM_001166215.1	NP_001159687.1	Q9H228	S1PR5_HUMAN	sphingosine-1-phosphate receptor 5	339					regulation of neuron differentiation (GO:0045664)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	12					Fingolimod(DB08868)	CAGCCGCGCTCGCCGACTGCT	0.746													C|||	1	0.000199681	0.0	0.0014	5008	,	,		12446	0.0		0.0	False		,,,				2504	0.0						uc002mot.1		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(1015-1017)GCG>GCA		endothelial differentiation, sphingolipid							6.0	9.0	8.0					19																	10624671		2040	4020	6060	SO:0001819	synonymous_variant	53637					integral to membrane|plasma membrane	lysosphingolipid and lysophosphatidic acid receptor activity	g.chr19:10624671C>T	AK074661	CCDS12240.1	19p13.2	2012-08-08	2008-04-30	2008-04-30		ENSG00000180739		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	14299	protein-coding gene	gene with protein product		605146	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 8"""	EDG8		10799507	Standard	NM_030760		Approved	Edg-8	uc002mou.2	Q9H228		ENST00000439028.3:c.1017G>A	19.37:g.10624671C>T						S1PR5_uc002mou.1_Silent_p.A339A	p.A339A	NM_030760	NP_110387	Q9H228	S1PR5_HUMAN			2	1074	-			339			Cytoplasmic (By similarity).		Q6NW11	Silent	SNP	ENST00000439028.3	37	c.1017G>A	CCDS12240.1	.	.	.	.	.	.	.	.	.	.	C	7.386	0.629829	0.14257	.	.	ENSG00000180739	ENST00000359134	.	.	.	4.66	-4.1	0.03940	.	.	.	.	.	T	0.37019	0.0988	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47484	-0.9114	5	0.87932	D	0	.	6.5438	0.22394	0.0:0.4131:0.2608:0.3261	.	.	.	.	K	308	.	ENSP00000352045:E308K	E	-	1	0	S1PR5	10485671	0.824000	0.29247	0.000000	0.03702	0.000000	0.00434	0.571000	0.23669	-0.862000	0.04089	-1.579000	0.00862	GAG		0.746	S1PR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452015.1	NM_030760		11	2	0	0	0	0.004007	0	11	2				
PSG3	5671	broad.mit.edu	37	19	43236960	43236960	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:43236960C>T	ENST00000327495.5	-	3	869	c.685G>A	c.(685-687)Gac>Aac	p.D229N	PSG3_ENST00000595140.1_Missense_Mutation_p.D229N|PSG3_ENST00000490592.1_5'Flank	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	229	Ig-like C2-type 1.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.D229N(2)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				GTGACTGGGTCACTGCGGCTG	0.527																																							uc002oue.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(685-687)GAC>AAC		pregnancy specific beta-1-glycoprotein 3							220.0	224.0	223.0					19																	43236960		2203	4297	6500	SO:0001583	missense	5671				defense response|female pregnancy	extracellular region		g.chr19:43236960C>T		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.685G>A	19.37:g.43236960C>T	ENSP00000332215:p.Asp229Asn					PSG3_uc002ouf.2_RNA|PSG1_uc002oug.1_Intron|PSG3_uc010eil.2_Missense_Mutation_p.D251N	p.D229N	NM_021016	NP_066296	Q16557	PSG3_HUMAN			3	817	-		Prostate(69;0.00682)	229			Ig-like C2-type 1.		Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	c.685G>A	CCDS12611.1	.	.	.	.	.	.	.	.	.	.	-	15.19	2.760908	0.49468	.	.	ENSG00000221826	ENST00000327495	T	0.10763	2.84	1.59	1.59	0.23543	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.28101	0.0693	M	0.74258	2.255	0.22050	N	0.999392	D;P	0.89917	1.0;0.771	D;P	0.91635	0.999;0.549	T	0.03268	-1.1054	9	0.72032	D	0.01	.	6.5812	0.22596	0.0:1.0:0.0:0.0	.	207;229	Q08266;Q16557	.;PSG3_HUMAN	N	229	ENSP00000332215:D229N	ENSP00000332215:D229N	D	-	1	0	PSG3	47928800	0.829000	0.29322	0.257000	0.24404	0.031000	0.12232	1.942000	0.40243	0.871000	0.35750	0.393000	0.25936	GAC		0.527	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016		103	434	0	0	0	0.01441	0	103	434				
NLRP5	126206	broad.mit.edu	37	19	56539676	56539676	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:56539676G>A	ENST00000390649.3	+	7	2077	c.2077G>A	c.(2077-2079)Gag>Aag	p.E693K		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	693					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.E693K(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CTGTCTTTTCGAGACTCAAGA	0.517																																							uc002qmj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7						c.(2077-2079)GAG>AAG		NACHT, LRR and PYD containing protein 5							103.0	106.0	105.0					19																	56539676		1948	4155	6103	SO:0001583	missense	126206					mitochondrion|nucleolus	ATP binding	g.chr19:56539676G>A	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.2077G>A	19.37:g.56539676G>A	ENSP00000375063:p.Glu693Lys					NLRP5_uc002qmi.2_Missense_Mutation_p.E674K	p.E693K	NM_153447	NP_703148	P59047	NALP5_HUMAN		GBM - Glioblastoma multiforme(193;0.0326)	7	2077	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	693					A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	c.2077G>A	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595204	0.46318	.	.	ENSG00000171487	ENST00000390649	D	0.89415	-2.51	3.26	3.26	0.37387	.	0.000000	0.37483	N	0.002067	D	0.94023	0.8085	M	0.87827	2.91	0.30140	N	0.804007	D	0.89917	1.0	D	0.91635	0.999	D	0.90047	0.4146	10	0.87932	D	0	.	10.267	0.43460	0.0:0.0:1.0:0.0	.	693	P59047	NALP5_HUMAN	K	693	ENSP00000375063:E693K	ENSP00000375063:E693K	E	+	1	0	NLRP5	61231488	1.000000	0.71417	0.924000	0.36721	0.116000	0.19942	4.940000	0.63533	2.116000	0.64780	0.561000	0.74099	GAG		0.517	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		83	159	0	0	0	0.01441	0	83	159				
ZNF304	57343	broad.mit.edu	37	19	57868090	57868090	+	Nonsense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:57868090G>T	ENST00000282286.5	+	3	1026	c.853G>T	c.(853-855)Gga>Tga	p.G285*	ZNF304_ENST00000443917.2_Nonsense_Mutation_p.G332*|ZNF304_ENST00000391705.3_Nonsense_Mutation_p.G285*|ZNF304_ENST00000598744.1_Nonsense_Mutation_p.G243*			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	285					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G285*(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		TAAGGAGTGTGGAAAAGCCTT	0.418																																							uc010ygw.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(853-855)GGA>TGA		zinc finger protein 304							98.0	97.0	97.0					19																	57868090		2203	4300	6503	SO:0001587	stop_gained	57343				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57868090G>T	AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.853G>T	19.37:g.57868090G>T	ENSP00000282286:p.Gly285*					ZNF304_uc010etw.2_Nonsense_Mutation_p.G332*|ZNF304_uc010etx.2_Nonsense_Mutation_p.G243*	p.G285*	NM_020657	NP_065708	Q9HCX3	ZN304_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)	3	1241	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	285			C2H2-type 4.			Nonsense_Mutation	SNP	ENST00000282286.5	37	c.853G>T	CCDS12950.1	.	.	.	.	.	.	.	.	.	.	g	39	7.807084	0.98501	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	.	.	.	3.55	3.55	0.40652	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	15.0914	0.72198	0.0:0.0:1.0:0.0	.	.	.	.	X	285;285;332	.	ENSP00000282286:G285X	G	+	1	0	ZNF304	62559902	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	1.904000	0.39868	2.296000	0.77279	0.454000	0.30748	GGA		0.418	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1			23	64	1	0	2.32416e-17	0.014323	2.85006e-17	23	64				
GREB1	9687	broad.mit.edu	37	2	11720872	11720872	+	Missense_Mutation	SNP	C	C	T	rs148901217		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:11720872C>T	ENST00000381486.2	+	7	1115	c.815C>T	c.(814-816)cCg>cTg	p.P272L	GREB1_ENST00000381483.2_Missense_Mutation_p.P272L|GREB1_ENST00000263834.5_Missense_Mutation_p.P272L|GREB1_ENST00000389825.3_Missense_Mutation_p.P162L|GREB1_ENST00000234142.5_Missense_Mutation_p.P272L	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	272						integral component of membrane (GO:0016021)		p.P272L(6)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GCAATGGGTCCGGCTGTTTTC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		20932	0.0		0.0	False		,,,				2504	0.001				Ovarian(39;850 945 2785 23371 33093)	Ovarian(39;850 945 2785 23371 33093)	uc002rbk.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(1)	1						c.(814-816)CCG>CTG		growth regulation by estrogen in breast cancer 1		C	LEU/PRO,LEU/PRO,LEU/PRO	0,4406		0,0,2203	100.0	97.0	98.0		815,815,815	3.8	0.0	2	dbSNP_134	98	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	GREB1	NM_014668.3,NM_033090.2,NM_148903.2	98,98,98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	272/1950,272/458,272/410	11720872	1,13005	2203	4300	6503	SO:0001583	missense	9687					integral to membrane		g.chr2:11720872C>T		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.815C>T	2.37:g.11720872C>T	ENSP00000370896:p.Pro272Leu					GREB1_uc002rbl.2_Missense_Mutation_p.P272L|GREB1_uc002rbm.2_Missense_Mutation_p.P162L|GREB1_uc002rbn.1_Missense_Mutation_p.P272L	p.P272L	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	7	1115	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		272					A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	c.815C>T	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	C	8.981	0.975347	0.18736	0.0	1.16E-4	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	T;T;T;T;T	0.47177	3.29;2.27;0.85;2.28;3.29	5.57	3.79	0.43588	.	0.731850	0.13147	N	0.410141	T	0.31327	0.0793	L	0.29908	0.895	0.20926	N	0.99983	B;B;B;B	0.31174	0.021;0.311;0.035;0.032	B;B;B;B	0.18263	0.007;0.021;0.009;0.012	T	0.09378	-1.0677	10	0.18276	T	0.48	-36.3853	10.8115	0.46549	0.0:0.8807:0.0:0.1193	.	272;162;272;272	Q4ZG55-2;F8W6E5;Q4ZG55-3;Q4ZG55	.;.;.;GREB1_HUMAN	L	272;272;162;272;272	ENSP00000370896:P272L;ENSP00000263834:P272L;ENSP00000374475:P162L;ENSP00000370892:P272L;ENSP00000234142:P272L	ENSP00000234142:P272L	P	+	2	0	GREB1	11638323	0.008000	0.16893	0.001000	0.08648	0.140000	0.21249	2.338000	0.43957	0.735000	0.32537	0.561000	0.74099	CCG		0.532	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		52	104	0	0	0	0.01441	0	52	104				
DNMT3A	1788	broad.mit.edu	37	2	25459873	25459873	+	Splice_Site	SNP	G	G	A	rs35824014		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:25459873G>A	ENST00000264709.3	-	21	2747	c.2410C>T	c.(2410-2412)Ccg>Tcg	p.P804S	DNMT3A_ENST00000380746.4_Splice_Site_p.P615S|DNMT3A_ENST00000321117.5_Splice_Site_p.P804S|DNMT3A_ENST00000402667.1_Splice_Site_p.P581S|DNMT3A_ENST00000474887.1_Intron	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	804	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.R803fs*5(3)|p.P804S(2)|p.P615S(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATGCCAACGGCCTAGGAGGC	0.582			"""Mis, F, N, S"""		AML																																		uc002rgc.2		NA		Rec	yes		2	2p23	1788	Mis|F|N|S	DNA (cytosine-5-)-methyltransferase 3 alpha			L			AML		7	Substitution - Missense(4)|Deletion - Frameshift(3)		lung(4)|haematopoietic_and_lymphoid_tissue(3)	haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140						c.(2410-2412)CCG>TCG		DNA cytosine methyltransferase 3 alpha isoform							47.0	44.0	45.0					2																	25459873		2203	4300	6503	SO:0001630	splice_region_variant	1788				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding	g.chr2:25459873G>A		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2409-1C>T	2.37:g.25459873G>A						DNMT3A_uc002rgd.2_Missense_Mutation_p.P804S|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.P615S	p.P804S	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN			21	2667	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		804					E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	37	c.2410C>T	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511478	0.85389	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3	5.62	4.72	0.59763	.	0.047584	0.85682	D	0.000000	D	0.98391	0.9465	M	0.86651	2.83	0.80722	D	1	P;D	0.89917	0.729;1.0	B;D	0.75020	0.274;0.985	D	0.98630	1.0671	10	0.49607	T	0.09	-7.2591	14.0893	0.64980	0.0:0.1518:0.8482:0.0	.	804;615	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	S	615;804;804;581	ENSP00000370122:P615S;ENSP00000324375:P804S;ENSP00000264709:P804S;ENSP00000384237:P581S	ENSP00000264709:P804S	P	-	1	0	DNMT3A	25313377	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.624000	0.98398	1.325000	0.45301	0.655000	0.94253	CCG		0.582	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	Missense_Mutation	13	29	0	0	0	0.001855	0	13	29				
REG1B	5968	broad.mit.edu	37	2	79314691	79314691	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:79314691G>C	ENST00000305089.3	-	2	128	c.48C>G	c.(46-48)ttC>ttG	p.F16L		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	16					cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)	p.F16L(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						TCAGAGACAGGAACATCAGGG	0.473																																							uc002sny.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)|skin(1)	2						c.(46-48)TTC>TTG		regenerating islet-derived 1 beta precursor							141.0	115.0	124.0					2																	79314691		2203	4300	6503	SO:0001583	missense	5968				cell proliferation	extracellular region	sugar binding	g.chr2:79314691G>C		CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.48C>G	2.37:g.79314691G>C	ENSP00000303206:p.Phe16Leu					REG1B_uc010ffv.1_Missense_Mutation_p.F16L|REG1B_uc010ffw.2_Missense_Mutation_p.F16L	p.F16L	NM_006507	NP_006498	P48304	REG1B_HUMAN			2	160	-			16						Missense_Mutation	SNP	ENST00000305089.3	37	c.48C>G	CCDS1963.1	.	.	.	.	.	.	.	.	.	.	g	2.819	-0.245164	0.05906	.	.	ENSG00000172023	ENST00000305089	T	0.03663	3.85	2.71	1.82	0.25136	.	0.736056	0.11138	N	0.595622	T	0.01905	0.0060	N	0.10645	0.015	0.09310	N	0.999991	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.49244	-0.8960	10	0.17369	T	0.5	.	5.4048	0.16316	0.1605:0.0:0.8395:0.0	.	16;16	Q6ICS1;P48304	.;REG1B_HUMAN	L	16	ENSP00000303206:F16L	ENSP00000303206:F16L	F	-	3	2	REG1B	79168199	0.013000	0.17824	0.495000	0.27527	0.617000	0.37484	0.491000	0.22419	0.702000	0.31825	0.555000	0.69702	TTC		0.473	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252292.2	NM_006507		13	44	0	0	0	0.001855	0	13	44				
IL1R2	7850	broad.mit.edu	37	2	102641036	102641036	+	Missense_Mutation	SNP	G	G	A	rs369088604		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:102641036G>A	ENST00000332549.3	+	7	1022	c.793G>A	c.(793-795)Ggc>Agc	p.G265S	IL1R2_ENST00000441002.1_Missense_Mutation_p.G265S|IL1R2_ENST00000485335.1_3'UTR|IL1R2_ENST00000393414.2_Missense_Mutation_p.G265S	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	265	Ig-like C2-type 3.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.G265S(2)		breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						TCTGGGAACCGGCACACCCTT	0.607																																					Pancreas(106;189 1628 2302 5133 12295)	Pancreas(106;189 1628 2302 5133 12295)	uc002tbm.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(793-795)GGC>AGC		interleukin 1 receptor, type II precursor	Anakinra(DB00026)						78.0	76.0	77.0					2																	102641036		2203	4300	6503	SO:0001583	missense	7850				immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity	g.chr2:102641036G>A	X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.793G>A	2.37:g.102641036G>A	ENSP00000330959:p.Gly265Ser					IL1R2_uc002tbn.2_Missense_Mutation_p.G265S|IL1R2_uc002tbo.1_Missense_Mutation_p.G265S	p.G265S	NM_004633	NP_004624	P27930	IL1R2_HUMAN			7	1022	+			265			Extracellular (Potential).|Ig-like C2-type 3.		D3DVJ5|Q6LCE6|Q9UE68	Missense_Mutation	SNP	ENST00000332549.3	37	c.793G>A	CCDS2054.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196370	0.78902	.	.	ENSG00000115590	ENST00000332549;ENST00000393414;ENST00000441002	T;T;T	0.20738	2.05;2.05;2.05	5.87	3.14	0.36123	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.427955	0.26324	N	0.025021	T	0.19248	0.0462	L	0.46741	1.465	0.09310	N	1	D	0.55172	0.97	P	0.46825	0.528	T	0.10823	-1.0613	10	0.15499	T	0.54	.	7.7635	0.28965	0.3221:0.0:0.6779:0.0	.	265	P27930	IL1R2_HUMAN	S	265	ENSP00000330959:G265S;ENSP00000377066:G265S;ENSP00000414611:G265S	ENSP00000330959:G265S	G	+	1	0	IL1R2	102007468	0.097000	0.21791	0.001000	0.08648	0.535000	0.34838	1.501000	0.35693	0.410000	0.25675	-0.150000	0.13652	GGC		0.607	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253191.1	NM_004633		27	58	0	0	0	0.005443	0	27	58				
SULT1C3	442038	broad.mit.edu	37	2	108881397	108881397	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:108881397G>T	ENST00000329106.2	+	6	738	c.738G>T	c.(736-738)atG>atT	p.M246I		NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3	246					sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)	p.M246I(2)		breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						AAAACCCAATGACCAACTATA	0.383																																							uc010ywo.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(736-738)ATG>ATT		sulfotransferase family, cytosolic, 1C, member							166.0	145.0	152.0					2																	108881397		2203	4300	6503	SO:0001583	missense	442038					cytoplasm	alcohol sulfotransferase activity	g.chr2:108881397G>T	BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.738G>T	2.37:g.108881397G>T	ENSP00000333310:p.Met246Ile						p.M246I	NM_001008743	NP_001008743	Q6IMI6	ST1C3_HUMAN			6	738	+			246					Q6IMI5	Missense_Mutation	SNP	ENST00000329106.2	37	c.738G>T	CCDS33267.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363903	0.82353	.	.	ENSG00000196228	ENST00000329106	D	0.82081	-1.57	4.9	4.9	0.64082	Sulfotransferase domain (1);	0.000000	0.64402	D	0.000001	D	0.89588	0.6758	M	0.82630	2.6	0.80722	D	1	P	0.46277	0.875	P	0.53593	0.73	D	0.91178	0.4974	10	0.72032	D	0.01	.	17.2242	0.86965	0.0:0.0:1.0:0.0	.	246	Q6IMI6	ST1C3_HUMAN	I	246	ENSP00000333310:M246I	ENSP00000333310:M246I	M	+	3	0	SULT1C3	108247829	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.311000	0.51919	2.534000	0.85438	0.655000	0.94253	ATG		0.383	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330255.1	NM_001008743		40	85	1	0	6.48837e-15	0.010771	7.6227e-15	40	85				
RGPD8	727851	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	G	C	rs370761877		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:113127775G>C	ENST00000302558.3	-	23	5469	c.5278C>G	c.(5278-5280)Cct>Gct	p.P1760A	RGPD8_ENST00000409750.1_Missense_Mutation_p.P1620A	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	1760				P -> A (in Ref. 3; CAI56757). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)	p.P1760A(12)		endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						GAACGGGAAGGATTTTCTTCC	0.308																																							uc002ths.1		NA																	12	Substitution - Missense(12)		prostate(6)|urinary_tract(2)|endometrium(2)|kidney(2)		0						c.(5278-5280)CCT>GCT		RANBP2-like and GRIP domain containing 5 isoform							235.0	168.0	189.0					2																	113127775		686	1558	2244	SO:0001583	missense	84220				intracellular transport	cytoplasm	binding	g.chr2:113127775G>C	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.5278C>G	2.37:g.113127775G>C	ENSP00000306637:p.Pro1760Ala					RGPD8_uc010fkk.1_Missense_Mutation_p.P1620A	p.P1760A	NM_005054	NP_005045	Q99666	RGPD5_HUMAN			23	5355	-			1760					Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	c.5278C>G	CCDS46394.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.892319	0.00522	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.36520	1.25;1.25	0.719	0.719	0.18208	.	.	.	.	.	T	0.11239	0.0274	N	0.02011	-0.69	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.18650	-1.0330	9	0.10902	T	0.67	-6.3628	6.3935	0.21599	0.0:0.6881:0.3119:0.0	.	1760	O14715	RGPD8_HUMAN	A	1760;1620	ENSP00000306637:P1760A;ENSP00000386511:P1620A	ENSP00000306637:P1760A	P	-	1	0	RGPD8	112844246	0.746000	0.28272	0.842000	0.33263	0.015000	0.08874	0.243000	0.18106	-0.105000	0.12132	-1.123000	0.02005	CCT		0.308	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279		5	56	0	0	0	0.000602	0	5	56				
DPP10	57628	broad.mit.edu	37	2	116497337	116497337	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:116497337C>G	ENST00000410059.1	+	9	1200	c.720C>G	c.(718-720)atC>atG	p.I240M	DPP10_ENST00000310323.8_Missense_Mutation_p.I233M|DPP10_ENST00000393147.2_Missense_Mutation_p.I244M|DPP10_ENST00000488208.1_3'UTR|DPP10_ENST00000409163.1_Missense_Mutation_p.I190M	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	240						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.I233M(2)|p.I240M(2)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						ATTCTCACATCGCCCACTGGT	0.463																																							uc002tla.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						c.(718-720)ATC>ATG		dipeptidyl peptidase 10 isoform long							149.0	135.0	140.0					2																	116497337		2203	4300	6503	SO:0001583	missense	57628				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity	g.chr2:116497337C>G	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.720C>G	2.37:g.116497337C>G	ENSP00000386565:p.Ile240Met					DPP10_uc002tlb.1_Missense_Mutation_p.I190M|DPP10_uc002tlc.1_Missense_Mutation_p.I236M|DPP10_uc002tle.2_Missense_Mutation_p.I244M|DPP10_uc002tlf.1_Missense_Mutation_p.I233M	p.I240M	NM_020868	NP_065919	Q8N608	DPP10_HUMAN			9	1177	+			240			Extracellular (Potential).		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	c.720C>G	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207964	0.58343	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	5.1	-1.12	0.09808	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.129829	0.53938	D	0.000055	T	0.44222	0.1283	M	0.72894	2.215	0.37817	D	0.928249	D;D;D;D	0.58268	0.978;0.972;0.982;0.982	P;P;D;D	0.65684	0.895;0.776;0.937;0.937	T	0.43294	-0.9400	10	0.56958	D	0.05	-33.0747	6.5824	0.22602	0.0:0.2866:0.1391:0.5743	.	233;244;236;240	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	M	240;190;236;244;233;190	ENSP00000386565:I240M;ENSP00000387038:I190M;ENSP00000376854:I236M;ENSP00000376855:I244M;ENSP00000309066:I233M	ENSP00000309066:I233M	I	+	3	3	DPP10	116213807	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	0.675000	0.25232	-0.107000	0.12088	-0.251000	0.11542	ATC		0.463	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		38	86	0	0	0	0.004878	0	38	86				
AMER3	205147	broad.mit.edu	37	2	131519842	131519842	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:131519842C>A	ENST00000423981.1	+	2	307	c.197C>A	c.(196-198)cCc>cAc	p.P66H	AMER3_ENST00000321420.4_Missense_Mutation_p.P66H	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	66					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										GACAGATGCCCCAACAAAGGG	0.632																																							uc002trw.2		NA																	0				pancreas(2)|ovary(1)	3						c.(196-198)CCC>CAC		hypothetical protein LOC205147							19.0	31.0	27.0					2																	131519842		2194	4291	6485	SO:0001583	missense	205147							g.chr2:131519842C>A	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.197C>A	2.37:g.131519842C>A	ENSP00000392700:p.Pro66His					FAM123C_uc010fmv.2_Missense_Mutation_p.P66H|FAM123C_uc010fms.1_Missense_Mutation_p.P66H|FAM123C_uc010fmt.1_Missense_Mutation_p.P66H|FAM123C_uc010fmu.1_Missense_Mutation_p.P66H	p.P66H	NM_152698	NP_689911	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	387	+	Colorectal(110;0.1)		66					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.197C>A	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566436	0.65651	.	.	ENSG00000178171	ENST00000321420;ENST00000431758;ENST00000458606;ENST00000423981	T;T	0.47528	0.84;0.84	5.39	4.52	0.55395	.	0.704371	0.13277	N	0.400039	T	0.44871	0.1314	N	0.24115	0.695	0.09310	N	1	D	0.63046	0.992	P	0.52710	0.707	T	0.25152	-1.0140	10	0.49607	T	0.09	.	10.3665	0.44026	0.0:0.9092:0.0:0.0908	.	66	Q8N944	F123C_HUMAN	H	66	ENSP00000314914:P66H;ENSP00000392700:P66H	ENSP00000314914:P66H	P	+	2	0	FAM123C	131236312	0.010000	0.17322	0.002000	0.10522	0.216000	0.24613	1.922000	0.40045	1.427000	0.47276	0.561000	0.74099	CCC		0.632	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		3	7	1	0	6.4e-05	0.004672	6.72e-05	3	7				
LRP1B	53353	broad.mit.edu	37	2	141055419	141055419	+	Missense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:141055419A>T	ENST00000389484.3	-	84	13896	c.12925T>A	c.(12925-12927)Tgc>Agc	p.C4309S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4309	EGF-like 19. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.C4309S(2)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGGCAGTGGCAGTAAGGCTGG	0.468										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(12925-12927)TGC>AGC		low density lipoprotein-related protein 1B							161.0	166.0	164.0					2																	141055419		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141055419A>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12925T>A	2.37:g.141055419A>T	ENSP00000374135:p.Cys4309Ser	TSP Lung(27;0.18)					p.C4309S	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	84	13897	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4309			Extracellular (Potential).|EGF-like 12.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.12925T>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.426535	0.83667	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.99005	-5.32	6.08	6.08	0.98989	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99600	0.9855	H	0.97806	4.08	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.97730	1.0202	10	0.72032	D	0.01	.	16.6438	0.85155	1.0:0.0:0.0:0.0	.	4309	Q9NZR2	LRP1B_HUMAN	S	4309;4247	ENSP00000374135:C4309S	ENSP00000374135:C4309S	C	-	1	0	LRP1B	140771889	1.000000	0.71417	0.994000	0.49952	0.972000	0.66771	9.298000	0.96132	2.333000	0.79357	0.533000	0.62120	TGC		0.468	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		83	237	0	0	0	0.01441	0	83	237				
LRP1B	53353	broad.mit.edu	37	2	141946049	141946049	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:141946049G>T	ENST00000389484.3	-	7	1925	c.954C>A	c.(952-954)gtC>gtA	p.V318V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	318					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.V318V(2)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAATCAGGGTGACACATACAG	0.413										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(952-954)GTC>GTA		low density lipoprotein-related protein 1B							106.0	98.0	101.0					2																	141946049		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141946049G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.954C>A	2.37:g.141946049G>T		TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Intron	p.V318V	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	7	1926	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	318			Extracellular (Potential).|LDL-receptor class B 2.		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.954C>A	CCDS2182.1																																																																																				0.413	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		22	40	1	0	1.28384e-07	0.012319	1.39152e-07	22	40				
TTN	7273	broad.mit.edu	37	2	179407873	179407873	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:179407873C>T	ENST00000591111.1	-	297	92128	c.91904G>A	c.(91903-91905)aGa>aAa	p.R30635K	TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R23336K|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R23403K|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R23211K|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R29708K|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R32276K|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30635	Fibronectin type-III 123. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R29708K(2)|p.R23336K(2)|p.R23211K(2)|p.R23403K(2)|p.R29706K(2)|p.R29706T(1)|p.R23403T(1)|p.R23211T(1)|p.R29708T(1)|p.R23336T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCCCTTATTCTAAATAAGTA	0.418																																							uc010zfg.1		NA																	15	Substitution - Missense(15)		lung(15)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(89122-89124)AGA>AAA		titin isoform N2-A							208.0	201.0	203.0					2																	179407873		1890	4127	6017	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179407873C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.91904G>A	2.37:g.179407873C>T	ENSP00000465570:p.Arg30635Lys					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R23403K|TTN_uc010zfi.1_Missense_Mutation_p.R23336K|TTN_uc010zfj.1_Missense_Mutation_p.R23211K	p.R29708K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		296	89347	-			30635					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.89123G>A		.	.	.	.	.	.	.	.	.	.	C	17.97	3.518522	0.64634	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.61	5.61	0.85477	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80149	0.4570	M	0.84773	2.715	0.58432	D	0.999991	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.79784	0.993;0.993;0.993;0.993	T	0.82325	-0.0513	9	0.87932	D	0	.	20.0018	0.97417	0.0:1.0:0.0:0.0	.	23211;23336;23403;30635	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	29708;23211;23403;23336;23208	ENSP00000343764:R29708K;ENSP00000434586:R23211K;ENSP00000340554:R23403K;ENSP00000352154:R23336K	ENSP00000340554:R23403K	R	-	2	0	TTN	179116119	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.793000	0.96121	0.655000	0.94253	AGA		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		55	216	0	0	0	0.01441	0	55	216				
FARSB	10056	broad.mit.edu	37	2	223489197	223489197	+	Splice_Site	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:223489197C>G	ENST00000281828.6	-	12	1227	c.964G>C	c.(964-966)Gaa>Caa	p.E322Q	FARSB_ENST00000536361.1_Splice_Site_p.E223Q	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	322	B5. {ECO:0000255|PROSITE- ProRule:PRU00816}.				gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)	p.E322Q(2)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	TCTGGAGTTTCTCTGAAAAAG	0.343																																							uc002vne.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(964-966)GAA>CAA		phenylalanyl-tRNA synthetase, beta subunit	L-Phenylalanine(DB00120)						58.0	56.0	57.0					2																	223489197		2203	4300	6503	SO:0001630	splice_region_variant	10056				phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|RNA binding	g.chr2:223489197C>G	AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.963-1G>C	2.37:g.223489197C>G						FARSB_uc010zlq.1_Missense_Mutation_p.E342Q|FARSB_uc002vnf.1_Missense_Mutation_p.E223Q	p.E322Q	NM_005687	NP_005678	Q9NSD9	SYFB_HUMAN		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	12	999	-		Renal(207;0.0183)	322			B5.		B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Missense_Mutation	SNP	ENST00000281828.6	37	c.964G>C	CCDS2454.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854132	0.51270	.	.	ENSG00000116120	ENST00000281828;ENST00000536361	T;T	0.31510	1.49;1.49	5.69	5.69	0.88448	DNA binding domain, putative (1);tRNA synthetase, B5-domain (4);	0.000000	0.85682	D	0.000000	T	0.36853	0.0982	L	0.48260	1.515	0.80722	D	1	P;B	0.38565	0.637;0.42	B;B	0.41860	0.186;0.368	T	0.07177	-1.0786	10	0.49607	T	0.09	-25.33	19.8273	0.96622	0.0:1.0:0.0:0.0	.	322;322	A8K666;Q9NSD9	.;SYFB_HUMAN	Q	322;223	ENSP00000281828:E322Q;ENSP00000442950:E223Q	ENSP00000281828:E322Q	E	-	1	0	FARSB	223197441	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.456000	0.80751	2.684000	0.91462	0.655000	0.94253	GAA		0.343	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256855.2	NM_005687	Missense_Mutation	12	23	0	0	0	0.010729	0	12	23				
NEU2	4759	broad.mit.edu	37	2	233897387	233897387	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:233897387G>A	ENST00000233840.3	+	1	6	c.6G>A	c.(4-6)gcG>gcA	p.A2A		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	2					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)	p.A2A(2)		endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	GCCCCATGGCGTCCCTTCCTG	0.617																																							uc010zmn.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(4-6)GCG>GCA		neuraminidase 2							125.0	110.0	115.0					2																	233897387		2203	4300	6503	SO:0001819	synonymous_variant	4759						exo-alpha-sialidase activity	g.chr2:233897387G>A	Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.6G>A	2.37:g.233897387G>A							p.A2A	NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	1	6	+		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)	2					Q3KNW4|Q6NTB4	Silent	SNP	ENST00000233840.3	37	c.6G>A	CCDS2501.1																																																																																				0.617	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257053.2	NM_005383		65	151	0	0	0	0.01441	0	65	151				
ANO7	50636	broad.mit.edu	37	2	242141661	242141661	+	Missense_Mutation	SNP	T	T	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:242141661T>C	ENST00000274979.8	+	8	930	c.827T>C	c.(826-828)cTt>cCt	p.L276P	ANO7_ENST00000402430.3_Missense_Mutation_p.L275P	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	276					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)	p.L276P(2)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						AAAAACCTGCTTGGGATCCAC	0.612																																							uc002wax.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(2)|central_nervous_system(1)	3						c.(826-828)CTT>CCT		transmembrane protein 16G isoform NGEP long							86.0	78.0	81.0					2																	242141661		2203	4300	6503	SO:0001583	missense	50636					cell junction|chloride channel complex|cytosol	chloride channel activity	g.chr2:242141661T>C	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.827T>C	2.37:g.242141661T>C	ENSP00000274979:p.Leu276Pro						p.L276P	NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN			8	930	+			276			Cytoplasmic (Potential).		Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	c.827T>C	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	T	14.36	2.512075	0.44660	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.67171	-0.25;-0.25	3.62	1.01	0.19927	.	2.173720	0.02696	N	0.111277	T	0.61110	0.2321	L	0.34521	1.04	0.45076	D	0.99809	P	0.50710	0.938	B	0.44278	0.445	T	0.47749	-0.9093	10	0.66056	D	0.02	.	8.3829	0.32483	0.0:0.0:0.3906:0.6094	.	276	Q6IWH7	ANO7_HUMAN	P	276;275	ENSP00000274979:L276P;ENSP00000385418:L275P	ENSP00000274979:L276P	L	+	2	0	ANO7	241790334	1.000000	0.71417	0.949000	0.38748	0.542000	0.35054	2.775000	0.47702	-0.090000	0.12462	0.383000	0.25322	CTT		0.612	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891		34	85	0	0	0	0.00623	0	34	85				
PROKR2	128674	broad.mit.edu	37	20	5283318	5283318	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:5283318C>A	ENST00000217270.3	-	2	522	c.523G>T	c.(523-525)Gcc>Tcc	p.A175S	PROKR2_ENST00000546004.1_Missense_Mutation_p.A175S	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	175					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.A175S(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						CAGACCAAGGCGATCAGGAAG	0.493										HNSCC(71;0.22)																													uc010zqw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(523-525)GCC>TCC		prokineticin receptor 2							137.0	143.0	141.0					20																	5283318		2203	4300	6503	SO:0001583	missense	128674					integral to membrane|plasma membrane	neuropeptide Y receptor activity	g.chr20:5283318C>A	AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.523G>T	20.37:g.5283318C>A	ENSP00000217270:p.Ala175Ser	HNSCC(71;0.22)				PROKR2_uc010zqx.1_Missense_Mutation_p.A175S|PROKR2_uc010zqy.1_Missense_Mutation_p.A175S	p.A175S	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN			2	523	-			175			Helical; Name=4; (Potential).		A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Missense_Mutation	SNP	ENST00000217270.3	37	c.523G>T	CCDS13089.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.843277	0.32606	.	.	ENSG00000101292	ENST00000546004;ENST00000217270	T;T	0.39997	1.05;1.05	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.156254	0.56097	D	0.000022	T	0.35451	0.0932	N	0.25957	0.775	0.09310	N	1	B	0.29212	0.237	B	0.34779	0.189	T	0.27673	-1.0067	10	0.33940	T	0.23	.	16.2472	0.82450	0.0:1.0:0.0:0.0	.	175	Q8NFJ6	PKR2_HUMAN	S	175	ENSP00000440790:A175S;ENSP00000217270:A175S	ENSP00000217270:A175S	A	-	1	0	PROKR2	5231318	0.012000	0.17670	0.976000	0.42696	0.746000	0.42486	1.311000	0.33562	2.442000	0.82660	0.655000	0.94253	GCC		0.493	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077854.1	NM_144773		47	152	1	0	4.86159e-25	0.01441	6.33138e-25	47	152				
SYNDIG1	79953	broad.mit.edu	37	20	24524025	24524025	+	Missense_Mutation	SNP	G	G	A	rs139628724	byFrequency	TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:24524025G>A	ENST00000376862.3	+	2	925	c.292G>A	c.(292-294)Gtg>Atg	p.V98M		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	98					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)	p.V98M(2)		breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						TTCAGAGGGCGTGCTGCGCTC	0.652													G|||	10	0.00199681	0.0045	0.0014	5008	,	,		16776	0.0		0.003	False		,,,				2504	0.0						uc002wtw.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(292-294)GTG>ATG		transmembrane protein 90B		G	MET/VAL	15,4391	22.3+/-47.3	0,15,2188	57.0	56.0	56.0		292	0.3	0.0	20	dbSNP_134	56	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SYNDIG1	NM_024893.1	21	0,16,6487	AA,AG,GG		0.0116,0.3404,0.123	probably-damaging	98/259	24524025	16,12990	2203	4300	6503	SO:0001583	missense	79953				response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane		g.chr20:24524025G>A	AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.292G>A	20.37:g.24524025G>A	ENSP00000366058:p.Val98Met						p.V98M	NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN			2	925	+			98			Cytoplasmic (Potential).		Q6IA30|Q9H514	Missense_Mutation	SNP	ENST00000376862.3	37	c.292G>A	CCDS13164.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	9.143	1.014253	0.19277	0.003404	1.16E-4	ENSG00000101463	ENST00000376862	D	0.91068	-2.78	5.95	0.329	0.15924	.	0.379543	0.26213	N	0.025661	D	0.86138	0.5861	M	0.66939	2.045	0.37062	D	0.898114	B	0.22480	0.07	B	0.13407	0.009	T	0.77504	-0.2563	10	0.49607	T	0.09	-8.0338	6.5814	0.22596	0.2197:0.1359:0.6445:0.0	.	98	Q9H7V2	SYNG1_HUMAN	M	98	ENSP00000366058:V98M	ENSP00000366058:V98M	V	+	1	0	SYNDIG1	24472025	0.000000	0.05858	0.045000	0.18777	0.482000	0.33219	-0.700000	0.05081	-0.197000	0.10350	-0.211000	0.12701	GTG		0.652	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893		58	112	0	0	0	0.01441	0	58	112				
DEFB116	245930	broad.mit.edu	37	20	29891023	29891023	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:29891023G>T	ENST00000400549.1	-	2	300	c.301C>A	c.(301-303)Cac>Aac	p.H101N		NM_001037731.1	NP_001032820.1	Q30KQ4	DB116_HUMAN	defensin, beta 116	101					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.H101N(2)		kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			ATTCAAATGTGAGAGTAGCTT	0.378																																							uc010ztm.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(301-303)CAC>AAC		beta-defensin 116 precursor							208.0	188.0	194.0					20																	29891023		1854	4105	5959	SO:0001583	missense	245930				defense response to bacterium	extracellular region		g.chr20:29891023G>T	DQ012020	CCDS42860.1	20q11.21	2008-07-17			ENSG00000215545	ENSG00000215545		"""Defensins, beta"""	18097	protein-coding gene	gene with protein product	"""defensin, beta 16"""					11854508, 16033865	Standard	NM_001037731		Approved	DEFB-16	uc010ztm.2	Q30KQ4	OTTHUMG00000159285	ENST00000400549.1:c.301C>A	20.37:g.29891023G>T	ENSP00000383396:p.His101Asn						p.H101N	NM_001037731	NP_001032820	Q30KQ4	DB116_HUMAN	Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)		2	301	-	all_hematologic(12;0.158)		101						Missense_Mutation	SNP	ENST00000400549.1	37	c.301C>A	CCDS42860.1	.	.	.	.	.	.	.	.	.	.	G	9.202	1.028752	0.19512	.	.	ENSG00000215545	ENST00000400549	T	0.16324	2.35	3.61	-3.87	0.04218	.	.	.	.	.	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.32508	-0.9904	9	0.41790	T	0.15	.	2.5507	0.04748	0.1001:0.3211:0.3304:0.2484	.	101	Q30KQ4	DB116_HUMAN	N	101	ENSP00000383396:H101N	ENSP00000383396:H101N	H	-	1	0	DEFB116	29354684	0.000000	0.05858	0.000000	0.03702	0.170000	0.22686	-0.077000	0.11394	-0.769000	0.04620	0.655000	0.94253	CAC		0.378	DEFB116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354403.1	NM_001037731		31	100	1	0	1.62565e-12	0.012213	1.85788e-12	31	100				
SLC32A1	140679	broad.mit.edu	37	20	37356981	37356981	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:37356981G>T	ENST00000217420.1	+	2	1540	c.1277G>T	c.(1276-1278)gGg>gTg	p.G426V		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	426					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.G426V(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	AGCGGCGACGGGCGCCTGAAG	0.642																																							uc002xjc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1276-1278)GGG>GTG		solute carrier family 32, member 1	Glycine(DB00145)						27.0	29.0	29.0					20																	37356981		2203	4300	6503	SO:0001583	missense	140679				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity	g.chr20:37356981G>T	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.1277G>T	20.37:g.37356981G>T	ENSP00000217420:p.Gly426Val						p.G426V	NM_080552	NP_542119	Q9H598	VIAAT_HUMAN			2	1540	+		Myeloproliferative disorder(115;0.00878)	426			Lumenal, vesicle (Potential).		Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	c.1277G>T	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750767	0.69533	.	.	ENSG00000101438	ENST00000217420	T	0.02197	4.4	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.06645	0.0170	L	0.61218	1.895	0.80722	D	1	P	0.42248	0.774	P	0.48873	0.593	T	0.24905	-1.0147	10	0.45353	T	0.12	-20.0623	15.2881	0.73846	0.0:0.0:1.0:0.0	.	426	Q9H598	VIAAT_HUMAN	V	426	ENSP00000217420:G426V	ENSP00000217420:G426V	G	+	2	0	SLC32A1	36790395	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.739000	0.98837	2.285000	0.76669	0.563000	0.77884	GGG		0.642	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552		15	40	1	0	2.39187e-15	0.008871	2.82982e-15	15	40				
COL9A3	1299	broad.mit.edu	37	20	61460132	61460132	+	Missense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:61460132A>T	ENST00000343916.3	+	18	920	c.917A>T	c.(916-918)gAc>gTc	p.D306V		NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	306	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.D306V(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					CCGGGCAAGGACGGCCAGAAT	0.692																																							uc002ydm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(916-918)GAC>GTC		alpha 3 type IX collagen precursor							53.0	49.0	50.0					20																	61460132		2201	4300	6501	SO:0001583	missense	1299				axon guidance	collagen type IX		g.chr20:61460132A>T	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.917A>T	20.37:g.61460132A>T	ENSP00000341640:p.Asp306Val						p.D306V	NM_001853	NP_001844	Q14050	CO9A3_HUMAN			18	920	+	Breast(26;5.68e-08)		306			Triple-helical region 3 (COL3).		Q13681|Q9H4G9|Q9UPE2	Missense_Mutation	SNP	ENST00000343916.3	37	c.917A>T	CCDS13505.1	.	.	.	.	.	.	.	.	.	.	A	14.15	2.450316	0.43531	.	.	ENSG00000092758	ENST00000343916	D	0.92595	-3.07	3.93	3.93	0.45458	.	0.051139	0.85682	U	0.000000	D	0.88654	0.6495	L	0.28192	0.835	0.80722	D	1	P	0.41748	0.761	P	0.46585	0.521	D	0.88765	0.3260	10	0.51188	T	0.08	.	12.0225	0.53352	1.0:0.0:0.0:0.0	.	306	Q14050	CO9A3_HUMAN	V	306	ENSP00000341640:D306V	ENSP00000341640:D306V	D	+	2	0	COL9A3	60930577	0.984000	0.35163	0.922000	0.36590	0.515000	0.34225	2.917000	0.48821	1.784000	0.52394	0.368000	0.22195	GAC		0.692	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853		18	43	0	0	0	0.008871	0	18	43				
EEF1A2	1917	broad.mit.edu	37	20	62121879	62121879	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:62121879C>T	ENST00000298049.7	-	5	1052	c.982G>A	c.(982-984)Gac>Aac	p.D328N	EEF1A2_ENST00000217182.3_Missense_Mutation_p.D328N			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	328					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)	p.D328N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GACTTGCTGTCCCCACACACG	0.667																																							uc002yfd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(982-984)GAC>AAC		eukaryotic translation elongation factor 1 alpha							70.0	66.0	67.0					20																	62121879		2198	4287	6485	SO:0001583	missense	1917					nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity	g.chr20:62121879C>T	AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.982G>A	20.37:g.62121879C>T	ENSP00000298049:p.Asp328Asn					EEF1A2_uc002yfe.1_Missense_Mutation_p.D328N|EEF1A2_uc010gkg.1_Missense_Mutation_p.D328N	p.D328N	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.22e-05)		5	1083	-	all_cancers(38;9.45e-12)		328					B5BUF3|E1P5J1|P54266|Q0VGC7	Missense_Mutation	SNP	ENST00000298049.7	37	c.982G>A	CCDS13522.1	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685416	0.68157	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	T;T	0.46451	0.87;0.87	3.73	3.73	0.42828	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.111771	0.64402	D	0.000020	T	0.63710	0.2534	M	0.75884	2.315	0.80722	D	1	D;B	0.53885	0.963;0.025	D;B	0.68192	0.956;0.06	T	0.70510	-0.4852	10	0.72032	D	0.01	-2.0735	15.8695	0.79101	0.0:1.0:0.0:0.0	.	304;328	Q59GP5;Q05639	.;EF1A2_HUMAN	N	328	ENSP00000298049:D328N;ENSP00000217182:D328N	ENSP00000217182:D328N	D	-	1	0	EEF1A2	61592323	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.626000	0.83164	1.798000	0.52647	0.486000	0.48141	GAC		0.667	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080495.1	NM_001958		25	55	0	0	0	0.005443	0	25	55				
CECR2	27443	broad.mit.edu	37	22	17983959	17983959	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr22:17983959C>T	ENST00000400585.2	+	7	730	c.292C>T	c.(292-294)Cgc>Tgc	p.R98C	CECR2_ENST00000400573.5_Missense_Mutation_p.R239C|CECR2_ENST00000262608.8_Missense_Mutation_p.R220C|CECR2_ENST00000342247.5_Missense_Mutation_p.R219C			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	261					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)		p.R239C(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CGAGAGTTTTCGCGAGAGGAC	0.562																																							uc010gqw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(655-657)CGC>TGC		cat eye syndrome chromosome region, candidate 2							83.0	91.0	88.0					22																	17983959		1959	4141	6100	SO:0001583	missense	27443				chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding	g.chr22:17983959C>T	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.292C>T	22.37:g.17983959C>T	ENSP00000383428:p.Arg98Cys					CECR2_uc010gqv.1_Missense_Mutation_p.R98C|CECR2_uc002zml.2_Missense_Mutation_p.R98C|CECR2_uc002zmm.1_Missense_Mutation_p.R98C	p.R219C	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN		Lung(27;0.146)	6	781	+		all_epithelial(15;0.139)	261					A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	ENST00000400585.2	37	c.655C>T		.	.	.	.	.	.	.	.	.	.	C	18.08	3.543944	0.65198	.	.	ENSG00000099954	ENST00000342247;ENST00000400585;ENST00000400573;ENST00000262608	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.35	4.27	0.50696	.	0.000000	0.47852	D	0.000214	T	0.61350	0.2340	L	0.45581	1.43	0.48288	D	0.999622	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.993;0.984;0.987	T	0.62015	-0.6943	10	0.54805	T	0.06	-14.7554	15.0831	0.72130	0.1967:0.8033:0.0:0.0	.	261;98;261;239	Q9BXF3;B7WPH3;Q9BXF3-2;E2QRE6	CECR2_HUMAN;.;.;.	C	219;98;239;220	ENSP00000341219:R219C;ENSP00000383428:R98C;ENSP00000383417:R239C;ENSP00000262608:R220C	ENSP00000262608:R220C	R	+	1	0	CECR2	16363959	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	2.717000	0.47227	2.664000	0.90586	0.655000	0.94253	CGC		0.562	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413		36	126	0	0	0	0.00623	0	36	126				
APOBEC3D	140564	broad.mit.edu	37	22	39425483	39425483	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr22:39425483C>A	ENST00000216099.8	+	5	1128	c.721C>A	c.(721-723)Cac>Aac	p.H241N	APOBEC3D_ENST00000427494.2_Intron|APOBEC3D_ENST00000381568.4_Missense_Mutation_p.H241N	NM_152426.3	NP_689639.2	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D	241					defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)	11	Melanoma(58;0.04)					TACAAAGCACCACTCAGCTGT	0.478																																							uc011aoe.1		NA																	0					0						c.(721-723)CAC>AAC		apolipoprotein B mRNA editing enzyme, catalytic							110.0	95.0	99.0					22																	39425483		1568	3582	5150	SO:0001583	missense	140564				negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding	g.chr22:39425483C>A	BF832090	CCDS46709.1	22q13.1	2012-10-19	2008-05-01		ENSG00000243811	ENSG00000243811		"""Apolipoprotein B mRNA editing enzymes"""	17354	protein-coding gene	gene with protein product		609900	"""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (putative)"", ""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3E pseudogene"""	APOBEC3E		11863358	Standard	NM_152426		Approved	ARP6, APOBEC3DE	uc003awt.4	Q96AK3	OTTHUMG00000151084	ENST00000216099.8:c.721C>A	22.37:g.39425483C>A	ENSP00000216099:p.His241Asn					APOBEC3D_uc011aof.1_Intron|APOBEC3D_uc003awu.3_Intron|APOBEC3D_uc003awt.3_Missense_Mutation_p.H241N|APOBEC3D_uc010gxu.2_Missense_Mutation_p.H37N	p.H241N	NM_152426	NP_689639	Q96AK3	ABC3D_HUMAN			5	775	+	Melanoma(58;0.04)		241					Q5JZ91|Q7Z2N2|Q7Z2N5|Q7Z2N6	Missense_Mutation	SNP	ENST00000216099.8	37	c.721C>A	CCDS46709.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.085360	0.00371	.	.	ENSG00000243811	ENST00000381568;ENST00000216099	T;T	0.63580	-0.05;-0.05	1.65	-3.3	0.05003	APOBEC-like, N-terminal (1);	.	.	.	.	T	0.40979	0.1139	L	0.38531	1.155	0.09310	N	1	B	0.15141	0.012	B	0.13407	0.009	T	0.32745	-0.9895	9	0.09084	T	0.74	.	4.4855	0.11788	0.3809:0.2395:0.3796:0.0	.	241	Q96AK3	ABC3D_HUMAN	N	241	ENSP00000370980:H241N;ENSP00000216099:H241N	ENSP00000216099:H241N	H	+	1	0	APOBEC3D	37755429	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.638000	0.00407	-1.700000	0.01414	-0.719000	0.03609	CAC		0.478	APOBEC3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321232.2	NM_152426		4	83	1	0	0.00909568	0.009096	0.00926106	4	83				
CHKB	1120	broad.mit.edu	37	22	51018161	51018161	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr22:51018161G>A	ENST00000406938.2	-	9	1243	c.1026C>T	c.(1024-1026)gtC>gtT	p.V342V	CHKB-CPT1B_ENST00000452668.1_Intron|CPT1B_ENST00000434492.2_5'Flank|CPT1B_ENST00000312108.7_5'Flank|CHKB-CPT1B_ENST00000453634.1_Silent_p.V7V|CPT1B_ENST00000440709.1_5'Flank|CPT1B_ENST00000405237.3_5'Flank|CPT1B_ENST00000395650.2_5'Flank|CHKB_ENST00000463053.1_5'Flank|CPT1B_ENST00000457250.1_5'Flank|CPT1B_ENST00000360719.2_5'Flank	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	342					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)	p.V342V(2)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	CTCACCGACTGACTTCTACCA	0.522																																							uc003bms.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1024-1026)GTC>GTT		choline kinase beta	Choline(DB00122)						105.0	107.0	106.0					22																	51018161		2203	4300	6503	SO:0001819	synonymous_variant	1120				phosphatidylethanolamine biosynthetic process		ATP binding|choline kinase activity|ethanolamine kinase activity	g.chr22:51018161G>A	AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.1026C>T	22.37:g.51018161G>A						CPT1B_uc003bmk.3_5'Flank|CPT1B_uc003bml.2_5'Flank|CPT1B_uc003bmm.2_5'Flank|CPT1B_uc003bmo.2_5'Flank|CPT1B_uc011asa.1_5'Flank|CPT1B_uc003bmn.2_5'Flank|CPT1B_uc011asb.1_5'Flank|CHKB-CPT1B_uc003bmp.2_5'Flank|CHKB-CPT1B_uc003bmt.1_Silent_p.V133V|CHKB-CPT1B_uc003bmu.2_Silent_p.V221V|CHKB_uc003bmv.2_Silent_p.V342V	p.V342V	NM_005198	NP_005189	Q9Y259	CHKB_HUMAN		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	9	1244	-		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	342					A0PJM6|Q13388	Silent	SNP	ENST00000406938.2	37	c.1026C>T	CCDS14099.1																																																																																				0.522	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317267.3	NM_005198		42	113	0	0	0	0.00874	0	42	113				
XYLB	9942	broad.mit.edu	37	3	38454427	38454427	+	Splice_Site	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr3:38454427G>T	ENST00000207870.3	+	19	1624	c.1534G>T	c.(1534-1536)Gtc>Ttc	p.V512F	XYLB_ENST00000542835.1_Splice_Site_p.V375F|XYLB_ENST00000472721.1_Intron	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	512					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)	p.V512F(2)		endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		GCCCTTCTAGGTCTACGAGGC	0.498																																							uc003cic.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1534-1536)GTC>TTC		xylulokinase							83.0	85.0	84.0					3																	38454427		2203	4300	6503	SO:0001630	splice_region_variant	9942				D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity	g.chr3:38454427G>T	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.1534-1G>T	3.37:g.38454427G>T						XYLB_uc011ayp.1_Missense_Mutation_p.V375F	p.V512F	NM_005108	NP_005099	O75191	XYLB_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)	19	1643	+			512					B2RAW4|B4DDT2|B9EH64	Missense_Mutation	SNP	ENST00000207870.3	37	c.1534G>T	CCDS2678.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174085	0.38413	.	.	ENSG00000093217	ENST00000207870;ENST00000542835	T;T	0.44083	0.93;0.93	3.33	3.33	0.38152	.	0.184733	0.34828	N	0.003655	T	0.39489	0.1080	L	0.52573	1.65	0.47547	D	0.99945	P	0.44659	0.84	P	0.45232	0.474	T	0.18618	-1.0331	9	.	.	.	.	10.4566	0.44555	0.0:0.0:1.0:0.0	.	512	O75191	XYLB_HUMAN	F	512;375	ENSP00000207870:V512F;ENSP00000443659:V375F	.	V	+	1	0	XYLB	38429431	1.000000	0.71417	0.998000	0.56505	0.025000	0.11179	2.380000	0.44327	2.168000	0.68352	0.491000	0.48974	GTC		0.498	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254062.2	NM_005108	Missense_Mutation	42	107	1	0	7.53189e-24	0.007835	9.73352e-24	42	107				
TMF1	7110	broad.mit.edu	37	3	69101202	69101202	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr3:69101202G>A	ENST00000398559.2	-	1	252	c.36C>T	c.(34-36)ttC>ttT	p.F12F	CTD-2013N24.2_ENST00000595925.1_RNA|TMF1_ENST00000543976.1_Silent_p.F12F			P82094	TMF1_HUMAN	TATA element modulatory factor 1	12					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)	p.F12F(3)		cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CCTGCTTAGCGAAGCTGGAGA	0.637																																							uc003dnn.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(34-36)TTC>TTT		TATA element modulatory factor 1							64.0	68.0	67.0					3																	69101202		1929	4148	6077	SO:0001819	synonymous_variant	7110				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity	g.chr3:69101202G>A		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.36C>T	3.37:g.69101202G>A						TMF1_uc011bfx.1_Silent_p.F12F	p.F12F	NM_007114	NP_009045	P82094	TMF1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)	1	283	-		Lung NSC(201;0.0193)|Prostate(884;0.174)	12					B7ZLJ2|Q17R87|Q59GK0	Silent	SNP	ENST00000398559.2	37	c.36C>T	CCDS43105.1																																																																																				0.637	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114		17	196	0	0	0	0.012319	0	17	196				
ACPP	55	broad.mit.edu	37	3	132075715	132075715	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr3:132075715C>T	ENST00000336375.5	+	10	1244	c.1154C>T	c.(1153-1155)aCa>aTa	p.T385I	ACPP_ENST00000351273.7_Intron|ACPP_ENST00000475741.1_Missense_Mutation_p.T352I	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	385					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)	p.T385I(2)		NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						GAAGACAGTACAGATTAGTGT	0.502																																							uc010htp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1153-1155)ACA>ATA		acid phosphatase, prostate short isoform							102.0	91.0	95.0					3																	132075715		2203	4300	6503	SO:0001583	missense	55					extracellular region|lysosomal membrane	5'-nucleotidase activity|acid phosphatase activity	g.chr3:132075715C>T		CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.1154C>T	3.37:g.132075715C>T	ENSP00000337471:p.Thr385Ile					ACPP_uc003eon.3_Missense_Mutation_p.T352I|ACPP_uc003eop.3_Intron	p.T385I	NM_001099	NP_001090	P15309	PPAP_HUMAN			10	1244	+			385					D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	ENST00000336375.5	37	c.1154C>T	CCDS3073.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.605315	0.28623	.	.	ENSG00000014257	ENST00000336375;ENST00000475741	T;T	0.08008	3.14;3.14	4.98	-5.76	0.02376	.	.	.	.	.	T	0.02929	0.0087	N	0.02960	-0.455	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.45585	-0.9251	9	0.66056	D	0.02	.	6.079	0.19931	0.0:0.3017:0.2783:0.42	.	385;352	P15309;Q5FBY0	PPAP_HUMAN;.	I	385;352	ENSP00000337471:T385I;ENSP00000417744:T352I	ENSP00000337471:T385I	T	+	2	0	ACPP	133558405	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.003000	0.03682	-0.746000	0.04766	-0.140000	0.14226	ACA		0.502	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099		30	65	0	0	0	0.009535	0	30	65				
KY	339855	broad.mit.edu	37	3	134322838	134322838	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr3:134322838C>T	ENST00000423778.2	-	11	1630	c.1569G>A	c.(1567-1569)ctG>ctA	p.L523L	KY_ENST00000508956.1_Silent_p.L502L|KY_ENST00000503669.1_3'UTR	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	523					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)	p.L523L(4)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						GCTGGACTTTCAGCTCGGTCT	0.527																																							uc010hty.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(2)	2						c.(1567-1569)CTG>CTA		kyphoscoliosis peptidase							68.0	70.0	69.0					3																	134322838		2059	4201	6260	SO:0001819	synonymous_variant	339855					cytoskeleton|Z disc	peptidase activity	g.chr3:134322838C>T	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.1569G>A	3.37:g.134322838C>T						KY_uc011blw.1_3'UTR|KY_uc011blx.1_Silent_p.L502L	p.L523L	NM_178554	NP_848649	Q8NBH2	KY_HUMAN			11	1631	-			523					B7Z1S4|Q6ZT15	Silent	SNP	ENST00000423778.2	37	c.1569G>A	CCDS46920.1																																																																																				0.527	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554		18	67	0	0	0	0.012319	0	18	67				
TBC1D1	23216	broad.mit.edu	37	4	38051323	38051323	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:38051323G>A	ENST00000261439.4	+	11	2069	c.1714G>A	c.(1714-1716)Gac>Aac	p.D572N	TBC1D1_ENST00000508802.1_Missense_Mutation_p.D572N	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	572					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)	p.D572N(3)		NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CCTGTCCAGTGACTCGGAGAG	0.592																																							uc003gtb.2		NA																	3	Substitution - Missense(3)		lung(2)|urinary_tract(1)	ovary(1)	1						c.(1714-1716)GAC>AAC		TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							80.0	75.0	77.0					4																	38051323		2203	4300	6503	SO:0001583	missense	23216					nucleus	Rab GTPase activator activity	g.chr4:38051323G>A	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.1714G>A	4.37:g.38051323G>A	ENSP00000261439:p.Asp572Asn					TBC1D1_uc011byd.1_Missense_Mutation_p.D572N|TBC1D1_uc010ifd.2_Missense_Mutation_p.D319N|TBC1D1_uc011byf.1_Missense_Mutation_p.D443N	p.D572N	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN			11	2057	+			572					B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	37	c.1714G>A	CCDS33972.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758305	0.31137	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000446803;ENST00000421339	T;T;T;T	0.34859	3.6;4.0;2.23;1.34	5.36	4.51	0.55191	.	0.190221	0.36972	N	0.002315	T	0.27933	0.0688	L	0.36672	1.1	0.25876	N	0.983656	B;P;B;B	0.50617	0.282;0.937;0.361;0.282	B;B;B;B	0.43680	0.072;0.427;0.058;0.072	T	0.11397	-1.0589	10	0.18276	T	0.48	-31.1984	10.5855	0.45280	0.1476:0.0:0.8524:0.0	.	572;572;304;572	B9A6J6;E9PGH8;Q6PJJ8;Q86TI0	.;.;.;TBCD1_HUMAN	N	572;572;443;40	ENSP00000423651:D572N;ENSP00000261439:D572N;ENSP00000396877:D443N;ENSP00000410167:D40N	ENSP00000261439:D572N	D	+	1	0	TBC1D1	37727718	0.463000	0.25799	0.946000	0.38457	0.505000	0.33919	2.172000	0.42463	2.504000	0.84457	0.655000	0.94253	GAC		0.592	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173		51	158	0	0	0	0.01441	0	51	158				
SRD5A3	79644	broad.mit.edu	37	4	56236046	56236046	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:56236046G>A	ENST00000264228.4	+	5	973	c.745G>A	c.(745-747)Gaa>Aaa	p.E249K	SRD5A3_ENST00000514398.1_3'UTR|SRD5A3-AS1_ENST00000609580.1_RNA|SRD5A3-AS1_ENST00000433175.2_RNA|SRD5A3-AS1_ENST00000596312.1_RNA|SRD5A3-AS1_ENST00000609573.1_RNA|SRD5A3-AS1_ENST00000595103.1_RNA|SRD5A3-AS1_ENST00000510637.1_RNA|SRD5A3-AS1_ENST00000609487.1_RNA|SRD5A3-AS1_ENST00000609700.1_RNA|SRD5A3-AS1_ENST00000596289.1_RNA|SRD5A3-AS1_ENST00000608086.1_RNA|SRD5A3-AS1_ENST00000598906.1_RNA|SRD5A3-AS1_ENST00000608265.1_RNA|SRD5A3-AS1_ENST00000609051.1_RNA|SRD5A3-AS1_ENST00000595734.1_RNA|SRD5A3-AS1_ENST00000608558.1_RNA|SRD5A3-AS1_ENST00000609500.1_RNA	NM_024592.4	NP_078868.1	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	249					androgen biosynthetic process (GO:0006702)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|polyprenol catabolic process (GO:0016095)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)	p.E249K(2)		cervix(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)		Spironolactone(DB00421)	AGACTGGTTTGAATATGTTTC	0.423																																							uc003hau.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(745-747)GAA>AAA		steroid 5 alpha-reductase 3							160.0	134.0	142.0					4																	56236046		2203	4300	6503	SO:0001583	missense	79644				androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor	g.chr4:56236046G>A	AK023414	CCDS3498.1	4q12	2009-07-21			ENSG00000128039	ENSG00000128039			25812	protein-coding gene	gene with protein product		611715				17986282	Standard	NM_024592		Approved	FLJ13352, SRD5A2L, SRD5A2L1	uc003hau.3	Q9H8P0	OTTHUMG00000128733	ENST00000264228.4:c.745G>A	4.37:g.56236046G>A	ENSP00000264228:p.Glu249Lys					uc003hav.1_Intron|uc003haw.1_Intron	p.E249K	NM_024592	NP_078868	Q9H8P0	PORED_HUMAN	Epithelial(7;0.0179)		5	840	+	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		249			Lumenal (Potential).		Q4W5Q6	Missense_Mutation	SNP	ENST00000264228.4	37	c.745G>A	CCDS3498.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125914	0.77436	.	.	ENSG00000128039	ENST00000264228;ENST00000505210	T;T	0.35605	1.3;1.3	5.83	4.99	0.66335	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (2);	0.096417	0.64402	D	0.000001	T	0.38453	0.1041	M	0.67700	2.07	0.58432	D	0.999998	P	0.41420	0.749	B	0.41440	0.357	T	0.10382	-1.0632	10	0.18276	T	0.48	-24.4827	14.3548	0.66730	0.0704:0.0:0.9296:0.0	.	249	Q9H8P0	PORED_HUMAN	K	249;113	ENSP00000264228:E249K;ENSP00000424714:E113K	ENSP00000264228:E249K	E	+	1	0	SRD5A3	55930803	1.000000	0.71417	0.990000	0.47175	0.824000	0.46624	4.574000	0.60900	2.770000	0.95276	0.655000	0.94253	GAA		0.423	SRD5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250644.2	NM_024592		23	108	0	0	0	0.00632	0	23	108				
TMPRSS11E	28983	broad.mit.edu	37	4	69343128	69343128	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:69343128C>T	ENST00000305363.4	+	8	813	c.749C>T	c.(748-750)aCa>aTa	p.T250I		NM_014058.3	NP_054777.2	Q9UL52	TM11E_HUMAN	transmembrane protease, serine 11E	250	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cognition (GO:0050890)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.T250I(2)		endometrium(1)|lung(19)|pancreas(1)|skin(3)	24						TTTGGAGTAACAATAAAACCT	0.368																																							uc003hdz.3		NA																	2	Substitution - Missense(2)		lung(2)		NA						c.(748-750)ACA>ATA		transmembrane protease, serine 11E							141.0	154.0	150.0					4																	69343128		2203	4296	6499	SO:0001583	missense	0							g.chr4:69343128C>T	AF064819	CCDS33993.1	4q13.2	2010-04-13			ENSG00000087128	ENSG00000087128		"""Serine peptidases / Transmembrane"""	24465	protein-coding gene	gene with protein product		610399	"""transmembrane protease, serine 11E2"""	TMPRSS11E2		15328353	Standard	NM_014058		Approved	DESC1	uc003hdz.4	Q9UL52	OTTHUMG00000160438	ENST00000305363.4:c.749C>T	4.37:g.69343128C>T	ENSP00000307519:p.Thr250Ile						p.T250I	NM_014058	NP_054777					8	813	+								A6NL71|Q14DC8|Q6UW31	Missense_Mutation	SNP	ENST00000305363.4	37	c.749C>T	CCDS33993.1	.	.	.	.	.	.	.	.	.	.	C	8.400	0.841792	0.16963	.	.	ENSG00000087128	ENST00000305363	T	0.59364	0.27	5.38	2.61	0.31194	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.126886	0.35466	N	0.003198	T	0.55465	0.1922	N	0.25647	0.755	0.21967	N	0.999441	D	0.67145	0.996	D	0.63877	0.919	T	0.48811	-0.9002	10	0.18276	T	0.48	.	9.4843	0.38919	0.2882:0.5727:0.1391:0.0	.	250	Q9UL52	TM11E_HUMAN	I	250	ENSP00000307519:T250I	ENSP00000307519:T250I	T	+	2	0	TMPRSS11E	69025723	0.019000	0.18553	0.163000	0.22734	0.079000	0.17450	0.608000	0.24223	0.206000	0.20587	-0.283000	0.09986	ACA		0.368	TMPRSS11E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360584.1	NM_014058		90	170	0	0	0	0.01441	0	90	170				
NPFFR2	10886	broad.mit.edu	37	4	73013156	73013156	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:73013156C>T	ENST00000308744.6	+	4	1294	c.1196C>T	c.(1195-1197)tCa>tTa	p.S399L	NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000395999.1_Missense_Mutation_p.S300L|NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000358749.3_Missense_Mutation_p.S297L	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	399					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)	p.S399L(2)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			ATGATGCTCTCAGACTACGCT	0.483																																							uc003hgg.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(1195-1197)TCA>TTA		neuropeptide FF receptor 2 isoform 1							95.0	89.0	91.0					4																	73013156		2203	4300	6503	SO:0001583	missense	10886				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity	g.chr4:73013156C>T	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.1196C>T	4.37:g.73013156C>T	ENSP00000307822:p.Ser399Leu					NPFFR2_uc010iig.1_Missense_Mutation_p.S181L|NPFFR2_uc003hgi.2_Missense_Mutation_p.S300L|NPFFR2_uc003hgh.2_Missense_Mutation_p.S297L|NPFFR2_uc003hgj.2_RNA	p.S399L	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)		4	1294	+			399			Extracellular (Potential).		Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	c.1196C>T	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.593130	0.28357	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.72167	-0.63;-0.63;-0.63	5.91	5.91	0.95273	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000176	T	0.64204	0.2577	L	0.35723	1.085	0.47441	D	0.999427	B;B	0.28470	0.097;0.213	B;B	0.34346	0.064;0.18	T	0.58808	-0.7571	10	0.07030	T	0.85	.	19.9007	0.96985	0.0:1.0:0.0:0.0	.	300;399	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	L	399;300;297	ENSP00000307822:S399L;ENSP00000379321:S300L;ENSP00000351599:S297L	ENSP00000307822:S399L	S	+	2	0	NPFFR2	73232020	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	3.114000	0.50383	2.791000	0.96007	0.655000	0.94253	TCA		0.483	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885		23	69	0	0	0	0.014323	0	23	69				
SDAD1	55153	broad.mit.edu	37	4	76898821	76898821	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:76898821C>A	ENST00000356260.5	-	4	501	c.383G>T	c.(382-384)tGc>tTc	p.C128F	SDAD1_ENST00000395711.4_Intron	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	128					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)		p.C128F(2)		breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTTATCATGGCAACGAAAAAG	0.383																																							uc003hje.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(382-384)TGC>TTC		SDA1 domain containing 1							92.0	92.0	92.0					4																	76898821		2203	4300	6503	SO:0001583	missense	55153				protein transport|ribosomal large subunit biogenesis	nucleolus	protein binding	g.chr4:76898821C>A	AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.383G>T	4.37:g.76898821C>A	ENSP00000348596:p.Cys128Phe					SDAD1_uc003hjf.3_Missense_Mutation_p.C31F|SDAD1_uc011cbr.1_Intron	p.C128F	NM_018115	NP_060585	Q9NVU7	SDA1_HUMAN	Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)		4	502	-			128					Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Missense_Mutation	SNP	ENST00000356260.5	37	c.383G>T	CCDS3573.2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.001742	0.74932	.	.	ENSG00000198301	ENST00000356260	T	0.12774	2.65	5.19	4.34	0.51931	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.41096	0.1144	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.43327	-0.9398	10	0.49607	T	0.09	-10.4693	11.5789	0.50879	0.0:0.9138:0.0:0.0862	.	128	Q9NVU7	SDA1_HUMAN	F	128	ENSP00000348596:C128F	ENSP00000348596:C128F	C	-	2	0	SDAD1	77117845	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	7.135000	0.77276	1.547000	0.49401	0.650000	0.86243	TGC		0.383	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252418.3	NM_018115		16	73	1	0	6.94344e-10	0.006122	7.62417e-10	16	73				
C4orf45	152940	broad.mit.edu	37	4	159894386	159894386	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:159894386C>G	ENST00000434826.2	-	2	226	c.142G>C	c.(142-144)Gaa>Caa	p.E48Q	C4orf45_ENST00000508011.1_5'UTR	NM_152543.2	NP_689756.2	Q96LM5	CD045_HUMAN	chromosome 4 open reading frame 45	48								p.E48Q(2)		large_intestine(2)|lung(3)	5						CCAGTTTTTTCTAACGCCAGA	0.378																																							uc003iqf.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(142-144)GAA>CAA		hypothetical protein LOC152940							93.0	80.0	84.0					4																	159894386		1827	4085	5912	SO:0001583	missense	152940							g.chr4:159894386C>G		CCDS47156.1	4q32.1	2012-03-02			ENSG00000164123	ENSG00000164123			26342	protein-coding gene	gene with protein product							Standard	NM_152543		Approved	FLJ25371	uc003iqf.1	Q96LM5	OTTHUMG00000161988	ENST00000434826.2:c.142G>C	4.37:g.159894386C>G	ENSP00000412215:p.Glu48Gln					C4orf45_uc010iqt.1_Intron	p.E48Q	NM_152543	NP_689756	Q96LM5	CD045_HUMAN			2	227	-			48					A8MPU3|C9J0T8	Missense_Mutation	SNP	ENST00000434826.2	37	c.142G>C	CCDS47156.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512413	0.64522	.	.	ENSG00000164123	ENST00000434826	T	0.27557	1.66	5.73	5.73	0.89815	.	0.078829	0.53938	D	0.000052	T	0.56046	0.1959	M	0.79475	2.455	0.30418	N	0.778359	D	0.76494	0.999	D	0.69479	0.964	T	0.60089	-0.7331	9	.	.	.	-46.4326	15.4037	0.74861	0.0:1.0:0.0:0.0	.	48	Q96LM5	CD045_HUMAN	Q	48	ENSP00000412215:E48Q	.	E	-	1	0	C4orf45	160113836	0.898000	0.30612	0.854000	0.33618	0.679000	0.39708	3.545000	0.53648	2.706000	0.92434	0.655000	0.94253	GAA		0.378	C4orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366636.1	NM_152543		10	15	0	0	0	0.008291	0	10	15				
ISL1	3670	broad.mit.edu	37	5	50683505	50683505	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:50683505G>A	ENST00000230658.7	+	3	985	c.400G>A	c.(400-402)Gat>Aat	p.D134N	ISL1_ENST00000511384.1_Missense_Mutation_p.D134N|ISL1_ENST00000505475.2_3'UTR	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	134					atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)	p.D134N(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				AGCAGACCACGATGTGGTGGA	0.652																																							uc003jor.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|ovary(1)	3						c.(400-402)GAT>AAT		islet-1							48.0	51.0	50.0					5																	50683505		2092	4198	6290	SO:0001583	missense	3670				generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr5:50683505G>A	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.400G>A	5.37:g.50683505G>A	ENSP00000230658:p.Asp134Asn						p.D134N	NM_002202	NP_002193	P61371	ISL1_HUMAN			3	948	+		Lung NSC(810;0.000845)|Breast(144;0.0411)	134					P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	37	c.400G>A	CCDS43314.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.03|15.03	2.710775|2.710775	0.48517|0.48517	.|.	.|.	ENSG00000016082|ENSG00000016082	ENST00000230658;ENST00000503187;ENST00000511384|ENST00000505475	D;D|.	0.85411|.	-1.98;-1.91|.	5.53|5.53	5.53|5.53	0.82687|0.82687	Zinc finger, LIM-type (2);|.	0.199728|.	0.45126|.	D|.	0.000384|.	T|T	0.72550|0.72550	0.3474|0.3474	L|L	0.52759|0.52759	1.655|1.655	0.50171|0.50171	D|D	0.999854|0.999854	B|.	0.12630|.	0.006|.	B|.	0.10450|.	0.005|.	T|T	0.74372|0.74372	-0.3687|-0.3687	10|6	0.18276|0.87932	T|D	0.48|0	.|.	19.1354|19.1354	0.93426|0.93426	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	134|.	P61371|.	ISL1_HUMAN|.	N|Q	134|80	ENSP00000230658:D134N;ENSP00000422676:D134N|.	ENSP00000230658:D134N|ENSP00000421737:R80Q	D|R	+|+	1|2	0|0	ISL1|ISL1	50719262|50719262	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	6.400000|6.400000	0.73252|0.73252	2.607000|2.607000	0.88179|0.88179	0.555000|0.555000	0.69702|0.69702	GAT|CGA		0.652	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202		22	115	0	0	0	0.00278	0	22	115				
TRIM36	55521	broad.mit.edu	37	5	114466398	114466398	+	Missense_Mutation	SNP	A	A	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:114466398A>C	ENST00000282369.3	-	9	1844	c.1723T>G	c.(1723-1725)Ttc>Gtc	p.F575V	TRIM36_ENST00000513154.1_Missense_Mutation_p.F563V|TRIM36_ENST00000514154.1_Missense_Mutation_p.F420V	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	575	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.F575V(2)		breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		AAGGCCCAGAAGTGTTTTCCT	0.448																																							uc003kqs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|lung(2)|breast(2)	8						c.(1723-1725)TTC>GTC		tripartite motif-containing 36 isoform 1							170.0	162.0	165.0					5																	114466398		2202	4300	6502	SO:0001583	missense	55521					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding	g.chr5:114466398A>C	AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.1723T>G	5.37:g.114466398A>C	ENSP00000282369:p.Phe575Val					TRIM36_uc011cwc.1_Missense_Mutation_p.F563V|TRIM36_uc003kqt.2_Missense_Mutation_p.F420V	p.F575V	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)	9	2232	-		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)	575			B30.2/SPRY.		A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	ENST00000282369.3	37	c.1723T>G	CCDS4115.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.853347	0.91355	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000514154	T;T;T	0.68025	-0.3;-0.3;-0.3	5.76	5.76	0.90799	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.045896	0.85682	D	0.000000	T	0.74527	0.3728	L	0.47716	1.5	0.80722	D	1	D;P	0.53619	0.961;0.908	P;P	0.58620	0.721;0.842	T	0.77172	-0.2685	10	0.87932	D	0	.	16.0706	0.80928	1.0:0.0:0.0:0.0	.	563;575	E9PFI8;Q9NQ86	.;TRI36_HUMAN	V	575;563;420	ENSP00000282369:F575V;ENSP00000423934:F563V;ENSP00000424259:F420V	ENSP00000282369:F575V	F	-	1	0	TRIM36	114494297	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	8.788000	0.91834	2.177000	0.69029	0.460000	0.39030	TTC		0.448	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700		36	139	0	0	0	0.004289	0	36	139				
TXNDC15	79770	broad.mit.edu	37	5	134235280	134235280	+	Missense_Mutation	SNP	T	T	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:134235280T>G	ENST00000358387.4	+	5	1613	c.988T>G	c.(988-990)Tta>Gta	p.L330V	TXNDC15_ENST00000546290.1_Missense_Mutation_p.L307V	NM_024715.3	NP_078991.3	Q96J42	TXD15_HUMAN	thioredoxin domain containing 15	330					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)		p.L330V(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGTATTTTCCTTATTCTTTTT	0.403																																							uc003lac.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)	2						c.(988-990)TTA>GTA		disulfide isomerase precursor							126.0	124.0	124.0					5																	134235280		2203	4300	6503	SO:0001583	missense	79770				cell redox homeostasis	integral to membrane		g.chr5:134235280T>G	AK026278	CCDS4180.1	5q31.1	2008-02-05	2007-08-16	2007-08-16	ENSG00000113621	ENSG00000113621			20652	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 14"""	C5orf14			Standard	NM_024715		Approved	2310047H23Rik, FLJ22625	uc003lac.1	Q96J42	OTTHUMG00000129115	ENST00000358387.4:c.988T>G	5.37:g.134235280T>G	ENSP00000351157:p.Leu330Val					TXNDC15_uc010jdy.1_RNA|TXNDC15_uc011cxv.1_RNA	p.L330V	NM_024715	NP_078991	Q96J42	TXD15_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		5	1646	+			330			Helical; (Potential).		D3DQA9|Q96MT2|Q9H639	Missense_Mutation	SNP	ENST00000358387.4	37	c.988T>G	CCDS4180.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.751|5.751	0.323062|0.323062	0.10900|0.10900	.|.	.|.	ENSG00000113621|ENSG00000113621	ENST00000509954|ENST00000441965;ENST00000358387;ENST00000546290	.|T;T	.|0.46819	.|0.86;0.87	5.75|5.75	2.13|2.13	0.27403|0.27403	.|.	0.136023|0.136023	0.46758|0.46758	D|D	0.000266|0.000266	T|T	0.19005|0.19005	0.0456|0.0456	N|N	0.03608|0.03608	-0.345|-0.345	0.35611|0.35611	D|D	0.808692|0.808692	.|B	.|0.27765	.|0.188	.|B	.|0.29267	.|0.1	T|T	0.12091|0.12091	-1.0561|-1.0561	6|10	.|0.12430	.|T	.|0.62	-4.6074|-4.6074	5.672|5.672	0.17728|0.17728	0.0:0.219:0.2336:0.5474|0.0:0.219:0.2336:0.5474	.|.	.|330	.|Q96J42	.|TXD15_HUMAN	R|V	84|314;330;307	.|ENSP00000351157:L330V;ENSP00000443942:L307V	.|ENSP00000351157:L330V	L|L	+|+	2|1	0|2	TXNDC15|TXNDC15	134263179|134263179	0.005000|0.005000	0.15991|0.15991	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	-0.018000|-0.018000	0.12568|0.12568	0.453000|0.453000	0.26858|0.26858	0.533000|0.533000	0.62120|0.62120	CTT|TTA		0.403	TXNDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251160.1	NM_024715		82	106	0	0	0	0.01441	0	82	106				
PCDHGB2	56103	broad.mit.edu	37	5	140741992	140741992	+	Nonsense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:140741992G>T	ENST00000522605.1	+	1	2290	c.2290G>T	c.(2290-2292)Gag>Tag	p.E764*	PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGB1_ENST00000523390.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	764					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E764*(2)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCAAGACAGAGTTCAATTT	0.498																																							uc003ljs.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(2290-2292)GAG>TAG		protocadherin gamma subfamily B, 2 isoform 1							150.0	152.0	151.0					5																	140741992		1919	4125	6044	SO:0001587	stop_gained	56103				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140741992G>T	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2290G>T	5.37:g.140741992G>T	ENSP00000429018:p.Glu764*					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Nonsense_Mutation_p.E764*|PCDHGA5_uc011das.1_5'Flank	p.E764*	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2290	+			764			Cytoplasmic (Potential).		Q3MIJ3|Q9UN65	Nonsense_Mutation	SNP	ENST00000522605.1	37	c.2290G>T	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	38	7.091399	0.98055	.	.	ENSG00000253910	ENST00000522605	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.6302	0.88104	0.0:0.0:1.0:0.0	.	.	.	.	X	764	.	ENSP00000429018:E764X	E	+	1	0	PCDHGB2	140722176	1.000000	0.71417	0.999000	0.59377	0.849000	0.48306	3.638000	0.54332	2.515000	0.84797	0.461000	0.40582	GAG		0.498	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923		128	186	1	0	3.29933e-67	0.01441	4.65788e-67	128	186				
MRPL22	29093	broad.mit.edu	37	5	154320812	154320812	+	Missense_Mutation	SNP	A	A	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:154320812A>G	ENST00000523037.1	+	2	105	c.64A>G	c.(64-66)Aag>Gag	p.K22E	MRPL22_ENST00000439747.3_Missense_Mutation_p.K48E|MRPL22_ENST00000265229.8_5'UTR|MRPL22_ENST00000522038.1_Missense_Mutation_p.K22E	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	22					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.K22E(2)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAGCCGGGGGAAGCTGGCCTT	0.537																																							uc003lvy.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(64-66)AAG>GAG		mitochondrial ribosomal protein L22 isoform a							109.0	111.0	110.0					5																	154320812		2203	4300	6503	SO:0001583	missense	29093				translation	large ribosomal subunit|mitochondrion	structural constituent of ribosome	g.chr5:154320812A>G	AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.64A>G	5.37:g.154320812A>G	ENSP00000431040:p.Lys22Glu					MRPL22_uc003lvz.3_5'UTR	p.K22E	NM_014180	NP_054899	Q9NWU5	RM22_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		2	102	+	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	22					A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	ENST00000523037.1	37	c.64A>G	CCDS4331.1	.	.	.	.	.	.	.	.	.	.	A	1.209	-0.630205	0.03610	.	.	ENSG00000082515	ENST00000523037;ENST00000439747;ENST00000522038	T;T;T	0.47869	0.88;0.83;0.95	4.79	3.66	0.41972	.	0.861692	0.10630	N	0.652303	T	0.31702	0.0805	L	0.40543	1.245	0.09310	N	1	B	0.19817	0.039	B	0.14578	0.011	T	0.39742	-0.9599	10	0.05351	T	0.99	-15.788	6.5691	0.22529	0.8962:0.0:0.1038:0.0	.	22	Q9NWU5	RM22_HUMAN	E	22;48;22	ENSP00000431040:K22E;ENSP00000411177:K48E;ENSP00000429039:K22E	ENSP00000411177:K48E	K	+	1	0	MRPL22	154301005	0.136000	0.22515	0.233000	0.24025	0.149000	0.21700	0.557000	0.23454	2.141000	0.66446	0.528000	0.53228	AAG		0.537	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2			13	110	0	0	0	0.00245	0	13	110				
FAM71B	153745	broad.mit.edu	37	5	156589711	156589711	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:156589711G>T	ENST00000302938.4	-	2	1660	c.1565C>A	c.(1564-1566)tCt>tAt	p.S522Y		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	522						nucleus (GO:0005634)		p.S522Y(2)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCTGTGCTAGATGCAGATTG	0.502																																							uc003lwn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)|skin(1)	6						c.(1564-1566)TCT>TAT		family with sequence similarity 71, member B							120.0	122.0	121.0					5																	156589711		2203	4300	6503	SO:0001583	missense	153745					nucleus		g.chr5:156589711G>T		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1565C>A	5.37:g.156589711G>T	ENSP00000305596:p.Ser522Tyr						p.S522Y	NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	1665	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	522					Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	c.1565C>A	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.559242	0.27827	.	.	ENSG00000170613	ENST00000302938	T	0.20069	2.1	4.52	-1.44	0.08856	.	1.226200	0.06022	N	0.651458	T	0.18467	0.0443	L	0.36672	1.1	0.09310	N	1	D	0.57899	0.981	P	0.44561	0.453	T	0.34304	-0.9834	10	0.72032	D	0.01	-0.264	7.0476	0.25055	0.0:0.3044:0.2457:0.4498	.	522	Q8TC56	FA71B_HUMAN	Y	522	ENSP00000305596:S522Y	ENSP00000305596:S522Y	S	-	2	0	FAM71B	156522289	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.223000	0.09177	-0.089000	0.12484	-0.211000	0.12701	TCT		0.502	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		88	99	1	0	5.81834e-28	0.01441	7.75779e-28	88	99				
TFAP2A	7020	broad.mit.edu	37	6	10398887	10398887	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr6:10398887C>T	ENST00000482890.1	-	8	1429	c.1077G>A	c.(1075-1077)ctG>ctA	p.L359L	TFAP2A_ENST00000379608.3_Silent_p.L353L|TFAP2A_ENST00000497266.1_5'Flank|TFAP2A_ENST00000379613.3_Silent_p.L361L|TFAP2A_ENST00000319516.4_Silent_p.L355L|TFAP2A_ENST00000379604.2_Silent_p.L359L			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	359	H-S-H (helix-span-helix), dimerization.				anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.L353L(1)|p.L359L(1)|p.L355L(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				GTGAGTTCCCCAGGGGAGATC	0.607																																							uc003myr.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(1)	1						c.(1075-1077)CTG>CTA		transcription factor AP-2 alpha isoform a							139.0	149.0	145.0					6																	10398887		2203	4300	6503	SO:0001819	synonymous_variant	7020				ectoderm development|positive regulation of bone mineralization|positive regulation of tooth mineralization|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	centrosome|Golgi apparatus|nucleus	chromatin binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding	g.chr6:10398887C>T	X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.1077G>A	6.37:g.10398887C>T						TFAP2A_uc003myq.2_Silent_p.L353L|TFAP2A_uc003mys.2_RNA|TFAP2A_uc011dih.1_Nonsense_Mutation_p.W312*|TFAP2A_uc003myt.2_Silent_p.L355L	p.L359L	NM_003220	NP_003211	P05549	AP2A_HUMAN			7	1329	-	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)	359			H-S-H (helix-span-helix), dimerization.		Q13777|Q5TAV5|Q8N1C6	Silent	SNP	ENST00000482890.1	37	c.1077G>A	CCDS4510.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733561	0.89482	.	.	ENSG00000137203	ENST00000466073	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4846	19.8463	0.96708	0.0:1.0:0.0:0.0	.	.	.	.	X	312	.	ENSP00000417495:W312X	W	-	2	0	TFAP2A	10506873	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.005000	0.57075	2.688000	0.91661	0.655000	0.94253	TGG		0.607	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220		33	509	0	0	0	0.004878	0	33	509				
FKBPL	63943	broad.mit.edu	37	6	32097522	32097522	+	Missense_Mutation	SNP	C	C	A	rs143627051		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr6:32097522C>A	ENST00000375156.3	-	2	306	c.36G>T	c.(34-36)aaG>aaT	p.K12N	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank|ATF6B_ENST00000468502.1_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	12					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.K12N(2)									GAGAGGTGTCCTTTTCTCCAA	0.493																																							uc003nzr.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(34-36)AAG>AAT		WAF-1/CIP1 stabilizing protein 39							34.0	38.0	37.0					6																	32097522		2200	4300	6500	SO:0001583	missense	63943				response to radiation	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr6:32097522C>A	AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.36G>T	6.37:g.32097522C>A	ENSP00000364298:p.Lys12Asn					ATF6B_uc003nzo.2_5'Flank|ATF6B_uc003nzn.2_5'Flank|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_5'Flank	p.K12N	NM_022110	NP_071393	Q9UIM3	FKBPL_HUMAN			2	306	-			12					A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	ENST00000375156.3	37	c.36G>T	CCDS4738.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234710	0.39498	.	.	ENSG00000204315	ENST00000375156	D	0.82526	-1.62	5.24	-4.1	0.03940	.	1.310710	0.05257	N	0.515119	T	0.49304	0.1549	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46105	-0.9215	10	0.49607	T	0.09	-2.2941	7.9326	0.29912	0.0:0.262:0.1266:0.6114	.	12	Q9UIM3	FKBPL_HUMAN	N	12	ENSP00000364298:K12N	ENSP00000364298:K12N	K	-	3	2	FKBPL	32205500	0.001000	0.12720	0.000000	0.03702	0.249000	0.25844	-1.324000	0.02690	-1.290000	0.02372	0.462000	0.41574	AAG		0.493	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076221.2			32	18	1	0	8.16721e-17	0.010818	9.87116e-17	32	18				
DYNLT1	6993	broad.mit.edu	37	6	159065728	159065728	+	Missense_Mutation	SNP	G	G	C	rs151068285		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr6:159065728G>C	ENST00000367089.3	-	1	43	c.13C>G	c.(13-15)Cag>Gag	p.Q5E	DYNLT1_ENST00000367088.1_5'Flank|DYNLT1_ENST00000367085.3_Missense_Mutation_p.Q5E	NM_006519.2	NP_006510.1	P63172	DYLT1_HUMAN	dynein, light chain, Tctex-type 1	5					establishment of mitotic spindle orientation (GO:0000132)|intracellular transport of viral protein in host cell (GO:0019060)|microtubule-dependent intracellular transport of viral material towards nucleus (GO:0075521)|mitotic nuclear division (GO:0007067)|negative regulation of neurogenesis (GO:0050768)|neuron projection morphogenesis (GO:0048812)|regulation of cytoskeleton organization (GO:0051493)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of Rac GTPase activity (GO:0032314)|viral entry into host cell (GO:0046718)	cytoplasmic dynein complex (GO:0005868)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)	identical protein binding (GO:0042802)|motor activity (GO:0003774)	p.Q5E(2)		lung(2)	2		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;4.02e-18)|BRCA - Breast invasive adenocarcinoma(81;9.53e-06)		TCCGCAGCCTGGTAGTCTTCC	0.726																																							uc003qrn.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(13-15)CAG>GAG		dynein, light chain, Tctex-type 1		G	GLU/GLN	1,4405	2.1+/-5.4	0,1,2202	42.0	45.0	44.0		13	4.1	1.0	6	dbSNP_134	44	0,8598		0,0,4299	no	missense	DYNLT1	NM_006519.2	29	0,1,6501	CC,CG,GG		0.0,0.0227,0.0077	benign	5/114	159065728	1,13003	2203	4299	6502	SO:0001583	missense	6993				cell division|establishment of mitotic spindle orientation|intracellular transport of viral proteins in host cell|mitosis|negative regulation of neurogenesis|regulation of G-protein coupled receptor protein signaling pathway	cytoplasmic dynein complex|Golgi apparatus|microtubule|spindle	identical protein binding|motor activity	g.chr6:159065728G>C	D50663	CCDS5257.1	6q25.2-q25.3	2008-02-05	2005-11-24	2005-11-24	ENSG00000146425	ENSG00000146425		"""Cytoplasmic dyneins"""	11697	protein-coding gene	gene with protein product		601554	"""t-complex-associated-testis-expressed 1-like 1"""	TCTEL1		8646886, 16260502	Standard	XM_005267117		Approved		uc003qrn.2	P63172	OTTHUMG00000015918	ENST00000367089.3:c.13C>G	6.37:g.159065728G>C	ENSP00000356056:p.Gln5Glu						p.Q5E	NM_006519	NP_006510	P63172	DYLT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;4.02e-18)|BRCA - Breast invasive adenocarcinoma(81;9.53e-06)	1	13	-		Breast(66;0.00519)|Ovarian(120;0.123)	5					Q15763|Q5VTU4	Missense_Mutation	SNP	ENST00000367089.3	37	c.13C>G	CCDS5257.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396662	0.42512	2.27E-4	0.0	ENSG00000146425	ENST00000367089;ENST00000367085	T	0.44881	0.91	4.11	4.11	0.48088	.	0.087356	0.47455	D	0.000237	T	0.17619	0.0423	L	0.43152	1.355	0.43896	D	0.996528	B	0.02656	0.0	B	0.04013	0.001	T	0.07947	-1.0746	10	0.07644	T	0.81	-6.0693	15.8772	0.79173	0.0:0.0:1.0:0.0	.	5	P63172	DYLT1_HUMAN	E	5	ENSP00000356056:Q5E	ENSP00000356052:Q5E	Q	-	1	0	DYNLT1	158985716	1.000000	0.71417	0.998000	0.56505	0.588000	0.36517	4.061000	0.57485	2.291000	0.77112	0.655000	0.94253	CAG		0.726	DYNLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042881.1	NM_006519		8	25	0	0	0	0.008291	0	8	25				
RBAK	57786	broad.mit.edu	37	7	5105125	5105125	+	Nonsense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:5105125G>T	ENST00000353796.3	+	6	2362	c.2038G>T	c.(2038-2040)Gaa>Taa	p.E680*	RBAK_ENST00000396912.1_Nonsense_Mutation_p.E680*|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	680	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.E680*(2)		NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		GAAACCCTATGAATGTAACGA	0.388																																							uc010kss.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|kidney(1)|skin(1)	5						c.(2038-2040)GAA>TAA		RB-associated KRAB repressor							92.0	102.0	99.0					7																	5105125		2203	4299	6502	SO:0001587	stop_gained	57786				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr7:5105125G>T	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.2038G>T	7.37:g.5105125G>T	ENSP00000275423:p.Glu680*					LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Nonsense_Mutation_p.E680*	p.E680*	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)	6	2362	+		Ovarian(82;0.0175)	680			Interaction with AR.|C2H2-type 16.		A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Nonsense_Mutation	SNP	ENST00000353796.3	37	c.2038G>T	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	G	39	7.720916	0.98453	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	.	.	.	3.76	3.76	0.43208	.	0.120380	0.38111	N	0.001815	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8561	0.63527	0.0:0.0:1.0:0.0	.	.	.	.	X	680	.	.	E	+	1	0	RBAK	5071651	0.000000	0.05858	1.000000	0.80357	0.995000	0.86356	-0.266000	0.08631	2.386000	0.81285	0.555000	0.69702	GAA		0.388	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163		45	96	1	0	1.61572e-30	0.010771	2.17153e-30	45	96				
ZNF12	7559	broad.mit.edu	37	7	6732203	6732203	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:6732203C>G	ENST00000405858.1	-	5	911	c.370G>C	c.(370-372)Gaa>Caa	p.E124Q	ZNF12_ENST00000404360.1_Intron|AC073343.13_ENST00000366167.2_RNA|ZNF12_ENST00000342651.5_Intron|AC073343.2_ENST00000577401.1_RNA	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	124					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E124Q(2)		NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		GGGTTCGTTTCTACATCAAAA	0.368																																							uc003sqt.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(370-372)GAA>CAA		zinc finger protein 12 isoform a							190.0	185.0	187.0					7																	6732203		1832	4088	5920	SO:0001583	missense	7559				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:6732203C>G	X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.370G>C	7.37:g.6732203C>G	ENSP00000385939:p.Glu124Gln					ZNF12_uc011jxa.1_5'UTR|ZNF12_uc003sqs.1_Intron	p.E124Q	NM_016265	NP_057349	P17014	ZNF12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)	5	924	-		Ovarian(82;0.0776)	124					A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Missense_Mutation	SNP	ENST00000405858.1	37	c.370G>C	CCDS47538.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.191664	0.38707	.	.	ENSG00000164631	ENST00000405858;ENST00000399476;ENST00000330442	T	0.05258	3.47	4.45	2.62	0.31277	.	0.162880	0.29321	N	0.012498	T	0.02767	0.0083	N	0.11201	0.11	0.51767	D	0.999938	B	0.32245	0.361	B	0.25140	0.058	T	0.54918	-0.8221	10	0.15952	T	0.53	.	8.1548	0.31162	0.0:0.7497:0.1602:0.0901	.	124	P17014	ZNF12_HUMAN	Q	124;182;88	ENSP00000385939:E124Q	ENSP00000331039:E88Q	E	-	1	0	ZNF12	6698728	0.000000	0.05858	0.124000	0.21820	0.783000	0.44284	0.034000	0.13776	0.791000	0.33826	0.650000	0.86243	GAA		0.368	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324373.2	NM_016265		82	188	0	0	0	0.01441	0	82	188				
SCIN	85477	broad.mit.edu	37	7	12668762	12668762	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:12668762G>A	ENST00000297029.5	+	9	1335	c.1234G>A	c.(1234-1236)Gac>Aac	p.D412N	SCIN_ENST00000445618.2_Missense_Mutation_p.D165N|SCIN_ENST00000519209.1_Missense_Mutation_p.D165N	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	412	Ca(2+)-dependent actin binding.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.D412N(4)		endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GATCCAAGTTGACCAAAACTC	0.368																																							uc003ssn.3		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(1234-1236)GAC>AAC		scinderin isoform 1							138.0	132.0	134.0					7																	12668762		1899	4119	6018	SO:0001583	missense	85477				actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding	g.chr7:12668762G>A	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.1234G>A	7.37:g.12668762G>A	ENSP00000297029:p.Asp412Asn					SCIN_uc010ktt.2_RNA|SCIN_uc003sso.3_Missense_Mutation_p.D165N	p.D412N	NM_001112706	NP_001106177	Q9Y6U3	ADSV_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)	9	1444	+			412			Ca(2+)-dependent actin binding.|Gelsolin-like 4.		A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	37	c.1234G>A	CCDS47545.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.178596	0.57692	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.55234	0.53;0.53;0.53	5.1	4.15	0.48705	Gelsolin domain (1);	0.170139	0.50627	N	0.000108	T	0.51805	0.1696	L	0.59967	1.855	0.46011	D	0.99881	B	0.13145	0.007	B	0.28916	0.096	T	0.51679	-0.8675	10	0.51188	T	0.08	-17.6745	12.6604	0.56811	0.0874:0.0:0.9126:0.0	.	412	Q9Y6U3	ADSV_HUMAN	N	412;165;165	ENSP00000297029:D412N;ENSP00000430997:D165N;ENSP00000390189:D165N	ENSP00000297029:D412N	D	+	1	0	SCIN	12635287	1.000000	0.71417	0.025000	0.17156	0.855000	0.48748	5.235000	0.65348	1.133000	0.42147	0.462000	0.41574	GAC		0.368	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128		16	59	0	0	0	0.004007	0	16	59				
GLI3	2737	broad.mit.edu	37	7	42012056	42012056	+	Missense_Mutation	SNP	C	C	G	rs564000094		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:42012056C>G	ENST00000395925.3	-	13	2067	c.1983G>C	c.(1981-1983)caG>caC	p.Q661H	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	661					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q661H(2)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCGACCTGGACTGTGAATGGC	0.612									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																														uc011kbh.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						c.(1981-1983)CAG>CAC		GLI-Kruppel family member GLI3							93.0	97.0	96.0					7																	42012056		2203	4300	6503	SO:0001583	missense	2737	Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome	Familial Cancer Database	;	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:42012056C>G		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1983G>C	7.37:g.42012056C>G	ENSP00000379258:p.Gln661His					GLI3_uc011kbg.1_Missense_Mutation_p.Q602H	p.Q661H	NM_000168	NP_000159	P10071	GLI3_HUMAN			13	2074	-			661					A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	c.1983G>C	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816205	0.50527	.	.	ENSG00000106571	ENST00000395925	T	0.15017	2.46	5.92	2.53	0.30540	.	0.122625	0.56097	N	0.000024	T	0.15998	0.0385	L	0.57536	1.79	0.80722	D	1	B	0.24675	0.109	B	0.18561	0.022	T	0.06935	-1.0799	10	0.54805	T	0.06	.	8.5492	0.33440	0.0:0.5956:0.2787:0.1257	.	661	P10071	GLI3_HUMAN	H	661	ENSP00000379258:Q661H	ENSP00000379258:Q661H	Q	-	3	2	GLI3	41978581	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.153000	0.31676	1.495000	0.48549	0.655000	0.94253	CAG		0.612	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		48	134	0	0	0	0.01441	0	48	134				
DLD	1738	broad.mit.edu	37	7	107558381	107558381	+	Missense_Mutation	SNP	A	A	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:107558381A>G	ENST00000205402.5	+	12	1530	c.1249A>G	c.(1249-1251)Aaa>Gaa	p.K417E	DLD_ENST00000440410.1_Missense_Mutation_p.K394E|DLD_ENST00000537148.1_Missense_Mutation_p.K318E|DLD_ENST00000437604.2_Missense_Mutation_p.K369E	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	417					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)	p.K417E(4)		NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	TATTGAGTACAAAGTTGGGAA	0.393																																							uc003vet.2		NA																	4	Substitution - Missense(4)		lung(4)	central_nervous_system(1)	1						c.(1249-1251)AAA>GAA		dihydrolipoamide dehydrogenase precursor	NADH(DB00157)						117.0	112.0	113.0					7																	107558381		2203	4300	6503	SO:0001583	missense	1738				branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity	g.chr7:107558381A>G	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.1249A>G	7.37:g.107558381A>G	ENSP00000205402:p.Lys417Glu					DLD_uc011kmg.1_Missense_Mutation_p.K369E|DLD_uc011kmh.1_Missense_Mutation_p.K394E|DLD_uc011kmi.1_Missense_Mutation_p.K318E	p.K417E	NM_000108	NP_000099	P09622	DLDH_HUMAN			12	1359	+			417					B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	ENST00000205402.5	37	c.1249A>G	CCDS5749.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.429722	0.83776	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000537148;ENST00000440410;ENST00000437604;ENST00000539590	D;D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06;-3.06	6.06	6.06	0.98353	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (2);	0.086238	0.85682	D	0.000000	D	0.93802	0.8018	L	0.57536	1.79	0.80722	D	1	P;P;P	0.45212	0.798;0.853;0.77	P;P;P	0.52823	0.648;0.71;0.524	D	0.94235	0.7480	10	0.87932	D	0	-2.0028	16.6154	0.84909	1.0:0.0:0.0:0.0	.	394;369;417	E9PEX6;B4DT69;P09622	.;.;DLDH_HUMAN	E	417;417;318;394;369;367	ENSP00000205402:K417E;ENSP00000390667:K417E;ENSP00000442399:K318E;ENSP00000417016:K394E;ENSP00000387542:K369E	ENSP00000205402:K417E	K	+	1	0	DLD	107345617	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.431000	0.80335	2.315000	0.78130	0.533000	0.62120	AAA		0.393	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108		30	58	0	0	0	0.012213	0	30	58				
LZTS1	11178	broad.mit.edu	37	8	20110503	20110503	+	Silent	SNP	G	G	A	rs372926159		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr8:20110503G>A	ENST00000381569.1	-	3	1296	c.939C>T	c.(937-939)ggC>ggT	p.G313G	LZTS1_ENST00000522290.1_Silent_p.G313G|LZTS1_ENST00000265801.6_Silent_p.G313G			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	313					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G313G(2)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GCTTGTTGCCGCCTTTGGGCT	0.682																																							uc003wzr.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(937-939)GGC>GGT		leucine zipper, putative tumor suppressor 1		G		1,4405		0,1,2202	29.0	30.0	30.0		939	4.2	0.0	8		30	1,8595		0,1,4297	no	coding-synonymous	LZTS1	NM_021020.2		0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154		313/597	20110503	2,13000	2203	4298	6501	SO:0001819	synonymous_variant	11178				cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr8:20110503G>A	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.939C>T	8.37:g.20110503G>A						LZTS1_uc010ltg.1_Silent_p.G313G	p.G313G	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN		Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)	2	1050	-			313			Potential.		D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Silent	SNP	ENST00000381569.1	37	c.939C>T	CCDS6015.1																																																																																				0.682	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020		36	84	0	0	0	0.004289	0	36	84				
LRP12	29967	broad.mit.edu	37	8	105509951	105509951	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr8:105509951C>G	ENST00000276654.5	-	5	937	c.829G>C	c.(829-831)Gac>Cac	p.D277H	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.D258H	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	277	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.D277H(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GGATAAAAGTCTGGATAATTG	0.403																																							uc003yma.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(829-831)GAC>CAC		low density lipoprotein-related protein 12							62.0	65.0	64.0					8																	105509951		2203	4300	6503	SO:0001583	missense	29967				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding	g.chr8:105509951C>G	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.829G>C	8.37:g.105509951C>G	ENSP00000276654:p.Asp277His					LRP12_uc003ymb.2_Missense_Mutation_p.D258H|LRP12_uc003ylz.2_5'Flank	p.D277H	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)		5	924	-			277			Extracellular (Potential).|CUB 2.		A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	c.829G>C	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.815071	0.70912	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.30448	1.53;1.53	5.66	5.66	0.87406	CUB (5);	0.000000	0.85682	D	0.000000	T	0.50752	0.1634	L	0.58302	1.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.32851	-0.9891	10	0.08599	T	0.76	-24.3327	19.7554	0.96287	0.0:1.0:0.0:0.0	.	258;277	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	H	258;277	ENSP00000399148:D258H;ENSP00000276654:D277H	ENSP00000276654:D277H	D	-	1	0	LRP12	105579127	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.487000	0.81328	2.665000	0.90641	0.563000	0.77884	GAC		0.403	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437		10	60	0	0	0	0.013537	0	10	60				
CNTLN	54875	broad.mit.edu	37	9	17466001	17466001	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:17466001G>T	ENST00000380647.3	+	22	3638	c.3554G>T	c.(3553-3555)tGt>tTt	p.C1185F	CNTLN_ENST00000262360.5_Missense_Mutation_p.C1185F|CNTLN_ENST00000425824.1_Missense_Mutation_p.C1185F			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	1185					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.C1185F(2)		breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		ACTGAAGAATGTTCCAACAAG	0.308																																							uc003zmz.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(3550-3552)TGT>TTT		centlein isoform 1							83.0	76.0	78.0					9																	17466001		1831	4077	5908	SO:0001583	missense	54875					centriole|membrane	two-component sensor activity	g.chr9:17466001G>T	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.3554G>T	9.37:g.17466001G>T	ENSP00000370021:p.Cys1185Phe					CNTLN_uc003zmy.2_Missense_Mutation_p.C1185F|CNTLN_uc010mio.2_Missense_Mutation_p.C864F	p.C1184F	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN		GBM - Glioblastoma multiforme(50;6.14e-10)	22	3577	+			1185			Potential.		A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	c.3551G>T	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934672	0.73442	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.19250	2.16;2.16;2.42	5.74	5.74	0.90152	.	.	.	.	.	T	0.46639	0.1403	M	0.68952	2.095	0.48236	D	0.999614	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	T	0.10200	-1.0640	9	0.28530	T	0.3	.	19.528	0.95214	0.0:0.0:1.0:0.0	.	1185;1185;1185	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	F	1185	ENSP00000370021:C1185F;ENSP00000392798:C1185F;ENSP00000262360:C1185F	ENSP00000262360:C1185F	C	+	2	0	CNTLN	17456001	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.169000	0.64984	2.714000	0.92807	0.650000	0.86243	TGT		0.308	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738		7	18	1	0	5.18039e-06	0.00308	5.57888e-06	7	18				
SPATA31C2	645961	broad.mit.edu	37	9	90746160	90746160	+	IGR	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:90746160G>C								U6 (132910 upstream) : U3 (243023 downstream)																							AGCCAGGATCGACGCACACTC	0.527																																							uc011lti.1		NA																	0					NA						c.(1792-1794)CGA>GGA		SubName: Full=cDNA FLJ59639;							41.0	36.0	37.0					9																	90746160		692	1591	2283	SO:0001628	intergenic_variant	0							g.chr9:90746160G>C																													9.37:g.90746160G>C							p.R598G							4	1821	-									Missense_Mutation	SNP		37	c.1792C>G																																																																																				0	0.527									61	189	0	0	0	0.01441	0	61	189				
PTCH1	5727	broad.mit.edu	37	9	98218671	98218671	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:98218671C>A	ENST00000331920.6	-	19	3492	c.3193G>T	c.(3193-3195)Gtc>Ttc	p.V1065F	PTCH1_ENST00000418258.1_Missense_Mutation_p.V914F|PTCH1_ENST00000430669.2_Missense_Mutation_p.V999F|PTCH1_ENST00000375274.2_Missense_Mutation_p.V1064F|PTCH1_ENST00000429896.2_Missense_Mutation_p.V914F|PTCH1_ENST00000421141.1_Missense_Mutation_p.V914F|PTCH1_ENST00000437951.1_Missense_Mutation_p.V999F	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1065					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.V1065F(4)|p.V1064F(4)|p.V1057_L1102del(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AACAGCTCGACCGTCATCAGC	0.627																																							uc004avk.3		NA																	9	Substitution - Missense(8)|Deletion - In frame(1)	p.V1057_L1102del(1)	lung(8)|central_nervous_system(1)	skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379						c.(3193-3195)GTC>TTC		patched isoform L							94.0	67.0	76.0					9																	98218671		2203	4300	6503	SO:0001583	missense	5727	Basal_Cell_Nevus_syndrome			embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	g.chr9:98218671C>A	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.3193G>T	9.37:g.98218671C>A	ENSP00000332353:p.Val1065Phe					PTCH1_uc010mro.2_Missense_Mutation_p.V914F|PTCH1_uc010mrp.2_Missense_Mutation_p.V914F|PTCH1_uc010mrq.2_Missense_Mutation_p.V914F|PTCH1_uc004avl.3_Missense_Mutation_p.V914F|PTCH1_uc010mrr.2_Missense_Mutation_p.V999F|PTCH1_uc004avm.3_Missense_Mutation_p.V1064F	p.V1065F	NM_000264	NP_000255	Q13635	PTC1_HUMAN			19	3381	-		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)	1065			Helical; (Potential).		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	c.3193G>T	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766171	0.90020	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08;-2.08;-2.08	5.61	4.71	0.59529	.	0.056666	0.64402	D	0.000001	D	0.92319	0.7563	M	0.69823	2.125	0.80722	D	1	D;D;P	0.76494	0.996;0.999;0.885	D;D;P	0.74023	0.974;0.982;0.688	D	0.92635	0.6119	10	0.56958	D	0.05	-25.576	14.4117	0.67119	0.0:0.9292:0.0:0.0708	.	999;1064;1065	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	F	1065;999;914;914;501;999;914;1064	ENSP00000332353:V1065F;ENSP00000389744:V999F;ENSP00000399981:V914F;ENSP00000396135:V914F;ENSP00000410287:V999F;ENSP00000414823:V914F;ENSP00000364423:V1064F	ENSP00000332353:V1065F	V	-	1	0	PTCH1	97258492	0.993000	0.37304	0.140000	0.22221	0.767000	0.43475	3.104000	0.50306	1.374000	0.46228	0.655000	0.94253	GTC		0.627	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264		15	34	1	0	2.31682e-05	0.003163	2.46346e-05	15	34				
ADAMTS13	11093	broad.mit.edu	37	9	136290667	136290667	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:136290667G>A	ENST00000371929.3	+	4	793	c.349G>A	c.(349-351)Gac>Aac	p.D117N	ADAMTS13_ENST00000356589.2_Missense_Mutation_p.D117N|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.D117N|ADAMTS13_ENST00000371911.3_Missense_Mutation_p.D117N|ADAMTS13_ENST00000371916.1_Missense_Mutation_p.D117N|ADAMTS13_ENST00000485925.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	117	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D117N(1)		central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		ACTGCTTCGGGACCCGTCCCT	0.632																																							uc004cdv.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6						c.(349-351)GAC>AAC		ADAM metallopeptidase with thrombospondin type 1							49.0	44.0	45.0					9																	136290667		2203	4300	6503	SO:0001583	missense	11093				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr9:136290667G>A	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.349G>A	9.37:g.136290667G>A	ENSP00000360997:p.Asp117Asn					ADAMTS13_uc004cdp.3_5'UTR|ADAMTS13_uc004cdt.1_Missense_Mutation_p.D117N|ADAMTS13_uc004cdu.1_Missense_Mutation_p.D117N|ADAMTS13_uc004cdw.3_Missense_Mutation_p.D117N|ADAMTS13_uc004cdx.3_Missense_Mutation_p.D117N|ADAMTS13_uc004cdq.1_Missense_Mutation_p.D117N|ADAMTS13_uc004cds.1_5'UTR|ADAMTS13_uc004cdr.1_RNA	p.D117N	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)	4	793	+			117			Peptidase M12B.		Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	c.349G>A	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745403	0.69418	.	.	ENSG00000160323	ENST00000371929;ENST00000371916;ENST00000355699;ENST00000356589;ENST00000371911	D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23	4.57	2.66	0.31614	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	D	0.88138	0.6356	M	0.79258	2.445	0.80722	D	1	P;P;P;P	0.48640	0.907;0.886;0.886;0.913	P;P;P;P	0.49301	0.585;0.449;0.449;0.606	D	0.84618	0.0682	9	0.44086	T	0.13	.	7.906	0.29763	0.0939:0.163:0.743:0.0	.	117;117;117;117	Q76LX8;Q76LX8-3;Q76LX8-2;E7EV88	ATS13_HUMAN;.;.;.	N	117	ENSP00000360997:D117N;ENSP00000360984:D117N;ENSP00000347927:D117N;ENSP00000348997:D117N;ENSP00000360979:D117N	ENSP00000347927:D117N	D	+	1	0	ADAMTS13	135280488	1.000000	0.71417	0.999000	0.59377	0.695000	0.40330	5.578000	0.67450	0.330000	0.23485	0.460000	0.39030	GAC		0.632	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025		11	49	0	0	0	0.010729	0	11	49				
ADAMTS13	11093	broad.mit.edu	37	9	136291428	136291428	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:136291428G>C	ENST00000371929.3	+	6	1093	c.649G>C	c.(649-651)Gac>Cac	p.D217H	ADAMTS13_ENST00000536611.1_5'Flank|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.D217H|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.D217H|ADAMTS13_ENST00000371911.3_Missense_Mutation_p.D217H|ADAMTS13_ENST00000371916.1_Missense_Mutation_p.D217H|ADAMTS13_ENST00000485925.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	217	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D217H(2)		central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CACTGGCTTCGACCTGGGAGT	0.637																																							uc004cdv.3		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6						c.(649-651)GAC>CAC		ADAM metallopeptidase with thrombospondin type 1							64.0	56.0	59.0					9																	136291428		2203	4300	6503	SO:0001583	missense	11093				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr9:136291428G>C	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.649G>C	9.37:g.136291428G>C	ENSP00000360997:p.Asp217His					ADAMTS13_uc004cdp.3_5'UTR|ADAMTS13_uc004cdt.1_Missense_Mutation_p.D217H|ADAMTS13_uc004cdu.1_Missense_Mutation_p.D217H|ADAMTS13_uc004cdw.3_Missense_Mutation_p.D217H|ADAMTS13_uc004cdx.3_Missense_Mutation_p.D217H|ADAMTS13_uc004cdy.1_5'Flank|ADAMTS13_uc004cdq.1_Missense_Mutation_p.D217H|ADAMTS13_uc004cds.1_Silent_p.S46S|ADAMTS13_uc004cdr.1_RNA	p.D217H	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)	6	1093	+			217			Peptidase M12B.		Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	c.649G>C	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999144	0.74818	.	.	ENSG00000160323	ENST00000371929;ENST00000371916;ENST00000355699;ENST00000356589;ENST00000371911;ENST00000338351	D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32	4.69	4.69	0.59074	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	D	0.91181	0.7222	L	0.52573	1.65	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;0.981;1.0	D	0.90481	0.4460	9	0.37606	T	0.19	.	16.5974	0.84800	0.0:0.0:1.0:0.0	.	217;217;217;217	Q76LX8;Q76LX8-3;Q76LX8-2;E7EV88	ATS13_HUMAN;.;.;.	H	217;217;217;217;217;87	ENSP00000360997:D217H;ENSP00000360984:D217H;ENSP00000347927:D217H;ENSP00000348997:D217H;ENSP00000360979:D217H	ENSP00000345120:D87H	D	+	1	0	ADAMTS13	135281249	1.000000	0.71417	0.974000	0.42286	0.534000	0.34807	9.160000	0.94734	2.161000	0.67846	0.650000	0.86243	GAC		0.637	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025		29	94	0	0	0	0.008361	0	29	94				
NSDHL	50814	broad.mit.edu	37	X	152027454	152027454	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chrX:152027454G>T	ENST00000370274.3	+	4	602	c.408G>T	c.(406-408)ggG>ggT	p.G136G	NSDHL_ENST00000440023.1_Silent_p.G136G	NM_015922.2	NP_057006.1	Q15738	NSDHL_HUMAN	NAD(P) dependent steroid dehydrogenase-like	136					cholesterol biosynthetic process (GO:0006695)|hair follicle development (GO:0001942)|labyrinthine layer blood vessel development (GO:0060716)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity (GO:0047012)	p.G136G(2)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(5)	15	Acute lymphoblastic leukemia(192;6.56e-05)					AAGAGGCTGGGGTTCAGGTAA	0.517																																							uc004fgt.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(406-408)GGG>GGT		NAD(P) dependent steroid dehydrogenase-like	NADH(DB00157)						82.0	74.0	77.0					X																	152027454		2203	4300	6503	SO:0001819	synonymous_variant	50814				cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|C-3 sterol dehydrogenase (C-4 sterol decarboxylase) activity|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity	g.chrX:152027454G>T	X96621	CCDS14717.1	Xq28	2011-09-14			ENSG00000147383	ENSG00000147383	1.1.1.170	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	13398	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 31E, member 1"""	300275				10710235, 12837764, 19027726	Standard	NM_015922		Approved	XAP104, H105e3, SDR31E1	uc004fgs.1	Q15738	OTTHUMG00000024185	ENST00000370274.3:c.408G>T	X.37:g.152027454G>T						NSDHL_uc004fgs.1_Silent_p.G136G	p.G136G	NM_001129765	NP_001123237	Q15738	NSDHL_HUMAN			5	669	+	Acute lymphoblastic leukemia(192;6.56e-05)		136					D3DWT6|O00344	Silent	SNP	ENST00000370274.3	37	c.408G>T	CCDS14717.1																																																																																				0.517	NSDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060927.1	NM_015922		32	35	1	0	2.08457e-15	0.010818	2.48374e-15	32	35				
GSTP1	2950	broad.mit.edu	37	11	67353976	67353977	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:67353976_67353977insCC	ENST00000398606.3	+	7	810_811	c.561_562insCC	c.(562-564)cccfs	p.P188fs	GSTP1_ENST00000498765.1_3'UTR|GSTP1_ENST00000398603.1_Frame_Shift_Ins_p.P152fs	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	188	GST C-terminal.				cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)	p.R187R(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	TCAGTGCCCGGCCCAAGCTCAA	0.629																																							uc001omf.2		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(1)	1						c.(559-564)CGGCCCfs		glutathione transferase	Ethacrynic acid(DB00903)|Glutathione(DB00143)																																			SO:0001589	frameshift_variant	2950				anti-apoptosis|cellular response to lipopolysaccharide|central nervous system development|common myeloid progenitor cell proliferation|glutathione metabolic process|negative regulation of acute inflammatory response|negative regulation of ERK1 and ERK2 cascade|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 beta production|negative regulation of JUN kinase activity|negative regulation of leukocyte proliferation|negative regulation of monocyte chemotactic protein-1 production|negative regulation of necrotic cell death|negative regulation of nitric-oxide synthase 2 biosynthetic process|negative regulation of stress-activated MAPK cascade|negative regulation of tumor necrosis factor production|nitric oxide storage|positive regulation of superoxide anion generation|response to reactive oxygen species|xenobiotic metabolic process	cytosol|protein complex	dinitrosyl-iron complex binding|glutathione transferase activity|JUN kinase binding|kinase regulator activity|nitric oxide binding|S-nitrosoglutathione binding	g.chr11:67353976_67353977insCC	U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.562_563dupCC	11.37:g.67353977_67353978dupCC	ENSP00000381607:p.Pro188fs					GSTP1_uc001omg.1_Frame_Shift_Ins_p.R168fs	p.R187fs	NM_000852	NP_000843	P09211	GSTP1_HUMAN			7	810_811	+			187_188			GST C-terminal.		O00460|Q15690|Q5TZY3	Frame_Shift_Ins	INS	ENST00000398606.3	37	c.561_562insCC	CCDS41679.1																																																																																				0.629	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268504.1	NM_000852		21	63	NA	NA	NA	NA	NA	21	63	---	---	---	---
TLN2	83660	broad.mit.edu	37	15	63044512	63044512	+	Frame_Shift_Del	DEL	T	T	-			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:63044512delT	ENST00000561311.1	+	34	4448	c.4218delT	c.(4216-4218)ggtfs	p.G1406fs	TLN2_ENST00000306829.6_Frame_Shift_Del_p.G1406fs			Q9Y4G6	TLN2_HUMAN	talin 2	1406					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AGGTTCTGGGTGAATCGATGG	0.512																																							uc002alb.3		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						c.(4216-4218)GGTfs		talin 2							191.0	183.0	186.0					15																	63044512		2203	4300	6503	SO:0001589	frameshift_variant	83660				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	g.chr15:63044512delT	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.4218delT	15.37:g.63044512delT	ENSP00000453508:p.Gly1406fs					TLN2_uc002alc.3_5'UTR	p.G1406fs	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN			32	4218	+			1406					A6NLB8	Frame_Shift_Del	DEL	ENST00000561311.1	37	c.4218delT	CCDS32261.1																																																																																				0.512	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2			32	183	NA	NA	NA	NA	NA	32	183	---	---	---	---
ELAC1	55520	broad.mit.edu	37	18	48513152	48513152	+	Frame_Shift_Del	DEL	A	A	-			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr18:48513152delA	ENST00000269466.3	+	4	896	c.789delA	c.(787-789)gtafs	p.V263fs	RP11-729L2.2_ENST00000588256.1_Intron|RP11-729L2.2_ENST00000590722.2_Intron|SMAD4_ENST00000452201.2_Intron|ELAC1_ENST00000588577.1_3'UTR	NM_018696.2	NP_061166.1	Q9H777	RNZ1_HUMAN	elaC ribonuclease Z 1	263					tRNA 3'-trailer cleavage (GO:0042779)	cytosol (GO:0005829)|nucleus (GO:0005634)	endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(4)|prostate(1)	6		Colorectal(6;0.0269)|all_epithelial(6;0.0729)		Colorectal(21;0.000943)|COAD - Colon adenocarcinoma(17;0.0398)|READ - Rectum adenocarcinoma(32;0.0894)|STAD - Stomach adenocarcinoma(97;0.18)		ATGGAGGAGTAAAACTGTGCT	0.478																																							uc002lez.2		NA																	0					0						c.(787-789)GTAfs		elaC homolog 1							94.0	84.0	87.0					18																	48513152		2203	4300	6503	SO:0001589	frameshift_variant	55520				tRNA 3'-trailer cleavage	nucleus	endoribonuclease activity, producing 5'-phosphomonoesters|metal ion binding	g.chr18:48513152delA	AB029151	CCDS11949.1	18q21	2013-05-24	2013-05-24		ENSG00000141642	ENSG00000141642	3.1.26.11		14197	protein-coding gene	gene with protein product	"""tRNA Z (short form)"", ""RNaseZ(S)"""	608079	"""elaC (E. coli) homolog 1"", ""elaC homolog 1 (E. coli)"""			12711671, 21559454	Standard	NM_018696		Approved	D29	uc002lez.3	Q9H777	OTTHUMG00000132695	ENST00000269466.3:c.789delA	18.37:g.48513152delA	ENSP00000269466:p.Val263fs					SMAD4_uc010xdo.1_Intron	p.V263fs	NM_018696	NP_061166	Q9H777	RNZ1_HUMAN		Colorectal(21;0.000943)|COAD - Colon adenocarcinoma(17;0.0398)|READ - Rectum adenocarcinoma(32;0.0894)|STAD - Stomach adenocarcinoma(97;0.18)	4	895	+		Colorectal(6;0.0269)|all_epithelial(6;0.0729)	263					Q9NS99	Frame_Shift_Del	DEL	ENST00000269466.3	37	c.789delA	CCDS11949.1																																																																																				0.478	ELAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255992.2			21	56	NA	NA	NA	NA	NA	21	56	---	---	---	---
RBM10	8241	broad.mit.edu	37	X	47034469	47034470	+	Frame_Shift_Ins	INS	-	-	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chrX:47034469_47034470insA	ENST00000377604.3	+	6	1296_1297	c.554_555insA	c.(553-558)acacgafs	p.R186fs	RBM10_ENST00000329236.7_Frame_Shift_Ins_p.R109fs|RBM10_ENST00000345781.6_Frame_Shift_Ins_p.R109fs	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	186	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CAGGACGCTACACGATGGATGG	0.525																																					Melanoma(171;120 2705 19495 39241)	Melanoma(171;120 2705 19495 39241)	uc004dhf.2		NA																	0				ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						c.(553-555)ACAfs		RNA binding motif protein 10 isoform 1																																				SO:0001589	frameshift_variant	8241				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding	g.chrX:47034469_47034470insA	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.555dupA	X.37:g.47034470_47034470dupA	ENSP00000366829:p.Arg186fs					RBM10_uc004dhe.1_Intron|RBM10_uc004dhg.2_Frame_Shift_Ins_p.T108fs|RBM10_uc004dhh.2_Frame_Shift_Ins_p.T185fs|RBM10_uc010nhq.2_Frame_Shift_Ins_p.T108fs|RBM10_uc004dhi.2_Frame_Shift_Ins_p.T250fs	p.T185fs	NM_005676	NP_005667	P98175	RBM10_HUMAN			6	933_934	+			185			RRM 1.		C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Frame_Shift_Ins	INS	ENST00000377604.3	37	c.554_555insA	CCDS14274.1																																																																																				0.525	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676		36	26	NA	NA	NA	NA	NA	36	26	---	---	---	---
