#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
UBE4B	10277	broad.mit.edu	37	1	10207112	10207112	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:10207112A>T	ENST00000253251.8	+	18	3007	c.2168A>T	c.(2167-2169)cAg>cTg	p.Q723L	UBE4B_ENST00000343090.6_Missense_Mutation_p.Q852L|UBE4B_ENST00000377157.3_Missense_Mutation_p.Q607L					ubiquitination factor E4B									p.Q723L(1)|p.Q852L(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CTTCTCATTCAGCTGCTGCTC	0.527																																							uc001aqs.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)	4						c.(2554-2556)CAG>CTG		ubiquitination factor E4B isoform 1							192.0	172.0	179.0					1																	10207112		2203	4300	6503	SO:0001583	missense	10277				apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding	g.chr1:10207112A>T	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2168A>T	1.37:g.10207112A>T	ENSP00000253251:p.Gln723Leu					UBE4B_uc001aqr.3_Missense_Mutation_p.Q723L|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Missense_Mutation_p.Q307L|UBE4B_uc001aqt.1_Missense_Mutation_p.Q192L	p.Q852L	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)	19	3268	+		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	852						Missense_Mutation	SNP	ENST00000253251.8	37	c.2555A>T	CCDS110.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.417117	0.83449	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.42900	0.96;0.96;0.96	5.68	5.68	0.88126	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.48857	0.1523	L	0.38175	1.15	0.80722	D	1	D;D;D	0.63880	0.993;0.993;0.991	P;P;P	0.57620	0.824;0.824;0.73	T	0.34079	-0.9843	10	0.26408	T	0.33	-19.1941	15.9856	0.80151	1.0:0.0:0.0:0.0	.	723;852;723	A8K8S9;O95155;O95155-2	.;UBE4B_HUMAN;.	L	723;607;852	ENSP00000253251:Q723L;ENSP00000366362:Q607L;ENSP00000343001:Q852L	ENSP00000253251:Q723L	Q	+	2	0	UBE4B	10129699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.939000	0.92951	2.180000	0.69256	0.456000	0.33151	CAG		0.527	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048		40	103	0	0	0	0.006999	0	40	103				
KIF1B	23095	broad.mit.edu	37	1	10355764	10355764	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:10355764G>T	ENST00000377086.1	+	19	1919	c.1717G>T	c.(1717-1719)Ggg>Tgg	p.G573W	KIF1B_ENST00000377081.1_Missense_Mutation_p.G573W|KIF1B_ENST00000263934.6_Missense_Mutation_p.G527W|KIF1B_ENST00000377083.1_Missense_Mutation_p.G527W|KIF1B_ENST00000377093.4_Missense_Mutation_p.G527W			O60333	KIF1B_HUMAN	kinesin family member 1B	573	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.G527W(2)		breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AGTGCTGAGCGGGGCTCACAT	0.507																																							uc001aqx.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(1717-1719)GGG>TGG		kinesin family member 1B isoform b							81.0	86.0	84.0					1																	10355764		2203	4300	6503	SO:0001583	missense	23095				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding	g.chr1:10355764G>T	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1717G>T	1.37:g.10355764G>T	ENSP00000366290:p.Gly573Trp					KIF1B_uc001aqv.3_Missense_Mutation_p.G527W|KIF1B_uc001aqw.3_Missense_Mutation_p.G527W|KIF1B_uc001aqy.2_Missense_Mutation_p.G547W|KIF1B_uc001aqz.2_Missense_Mutation_p.G573W|KIF1B_uc001ara.2_Missense_Mutation_p.G533W|KIF1B_uc001arb.2_Missense_Mutation_p.G559W	p.G573W	NM_015074	NP_055889	O60333	KIF1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)	19	1919	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	573			FHA.		A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37	c.1717G>T		.	.	.	.	.	.	.	.	.	.	G	32	5.184634	0.94885	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2	6.07	6.07	0.98685	Forkhead-associated (FHA) domain (4);SMAD/FHA domain (1);	0.000000	0.85682	D	0.000000	D	0.96068	0.8719	H	0.96547	3.84	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.996;1.0	D	0.96607	0.9449	10	0.87932	D	0	.	19.6475	0.95784	0.0:0.0:1.0:0.0	.	559;533;573;547;573;527;527	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	W	573;527;527;573;527;573	ENSP00000263934:G527W;ENSP00000366297:G527W;ENSP00000366290:G573W;ENSP00000366287:G527W;ENSP00000366284:G573W	ENSP00000263934:G527W	G	+	1	0	KIF1B	10278351	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GGG		0.507	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1			13	61	1	0	0.000308642	0.003163	0.000346293	13	61				
CASP9	842	broad.mit.edu	37	1	15844850	15844850	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:15844850A>C	ENST00000333868.5	-	2	267	c.173T>G	c.(172-174)cTg>cGg	p.L58R	CASP9_ENST00000469637.1_5'UTR|CASP9_ENST00000546424.1_Missense_Mutation_p.L58R|CASP9_ENST00000375890.4_5'UTR|CASP9_ENST00000348549.5_Missense_Mutation_p.L58R	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	58	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)	p.L58R(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		ATCTATGATCAGCTGCCTGGC	0.517																																							uc001awn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|kidney(1)	2						c.(172-174)CTG>CGG		caspase 9 isoform alpha preproprotein							55.0	57.0	56.0					1																	15844850		2203	4300	6503	SO:0001583	missense	842				activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding	g.chr1:15844850A>C	U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.173T>G	1.37:g.15844850A>C	ENSP00000330237:p.Leu58Arg					CASP9_uc001awm.1_Missense_Mutation_p.L58R|CASP9_uc001awo.2_Missense_Mutation_p.L58R|CASP9_uc001awp.2_5'UTR|CASP9_uc009voi.2_5'UTR|CASP9_uc010obm.1_5'UTR|CASP9_uc001awq.2_5'UTR	p.L58R	NM_001229	NP_001220	P55211	CASP9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)	2	268	-		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	58			CARD.		B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Missense_Mutation	SNP	ENST00000333868.5	37	c.173T>G	CCDS158.1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.659398	0.47467	.	.	ENSG00000132906	ENST00000546424;ENST00000333868;ENST00000348549;ENST00000440484	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.59	5.59	0.84812	DEATH-like (2);Caspase Recruitment (3);	0.318362	0.30347	N	0.009821	T	0.80778	0.4688	M	0.86420	2.815	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.84060	0.0374	10	0.87932	D	0	.	12.1597	0.54098	1.0:0.0:0.0:0.0	.	58;58;58	P55211-2;P55211;F8VVS7	.;CASP9_HUMAN;.	R	58	ENSP00000449584:L58R;ENSP00000330237:L58R;ENSP00000255256:L58R;ENSP00000411304:L58R	ENSP00000330237:L58R	L	-	2	0	CASP9	15717437	1.000000	0.71417	0.990000	0.47175	0.426000	0.31534	5.794000	0.69067	2.128000	0.65567	0.460000	0.39030	CTG		0.517	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996		15	55	0	0	0	0.004007	0	15	55				
ESPNP	284729	broad.mit.edu	37	1	17023377	17023377	+	RNA	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:17023377G>T	ENST00000492551.1	-	0	1570					NR_026567.1				espin pseudogene																		CAGTAGCTCCGAGTTGTCGCC	0.617																																							uc001azn.1		NA																	0					0						c.(1456-1458)TCG>TAG		RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;																																						284729							g.chr1:17023377G>T	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17023377G>T							p.S486*	NR_026567						9	1571	-									Nonsense_Mutation	SNP	ENST00000492551.1	37	c.1457C>A																																																																																					0.617	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1			8	16	1	0	5.18039e-06	0.00308	6.31954e-06	8	16				
NBL1	4681	broad.mit.edu	37	1	19983389	19983389	+	Missense_Mutation	SNP	G	G	A	rs202183847		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:19983389G>A	ENST00000375136.3	+	4	616	c.313G>A	c.(313-315)Gtg>Atg	p.V105M	NBL1_ENST00000548815.1_Missense_Mutation_p.V104M|NBL1_ENST00000289749.2_Missense_Mutation_p.V140M|MINOS1-NBL1_ENST00000602662.1_Missense_Mutation_p.V105M	NM_001204085.1|NM_001204089.1|NM_001278164.1|NM_001278166.1	NP_001191014.1|NP_001191018.1|NP_001265093.1|NP_001265095.1	P41271	NBL1_HUMAN	neuroblastoma 1, DAN family BMP antagonist	105	CTCK.				determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of monocyte chemotaxis (GO:0090027)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)|positive regulation of neuron differentiation (GO:0045666)|sequestering of BMP from receptor via BMP binding (GO:0038098)|sequestering of BMP in extracellular matrix (GO:0035582)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)	p.V104M(1)		lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCACGAGGAGGTGCCCAGGGT	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		13739	0.001		0.0	False		,,,				2504	0.0						uc001bck.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(310-312)GTG>ATG		neuroblastoma, suppression of tumorigenicity 1 2							52.0	47.0	48.0					1																	19983389		2202	4300	6502	SO:0001583	missense	4681					extracellular region		g.chr1:19983389G>A		CCDS196.1, CCDS41278.1, CCDS196.2, CCDS72720.1	1p36.3-p36.2	2013-02-26	2013-02-26		ENSG00000158747	ENSG00000158747			7650	protein-coding gene	gene with protein product	"""neuroblastoma candidate region, suppression of tumorigenicity 1"", ""neuroblastoma suppressor of tumorigenicity 1"", ""differential screening-selected gene aberrant in neuroblastoma"""	600613	"""neuroblastoma, suppression of tumorigenicity 1"""			7633401	Standard	NM_182744		Approved	D1S1733E, NB, DAN, NO3, DAND1	uc001bcj.2	P41271	OTTHUMG00000002700	ENST00000375136.3:c.313G>A	1.37:g.19983389G>A	ENSP00000364278:p.Val105Met					NBL1_uc009vpl.1_Missense_Mutation_p.V105M|NBL1_uc001bcj.1_Missense_Mutation_p.V140M|NBL1_uc009vpm.1_Missense_Mutation_p.V105M	p.V104M	NM_005380	NP_005371	P41271	NBL1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	4	465	+		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)	104			CTCK.		A3KFI7|Q5TGZ2|Q5U0N4|Q96L68	Missense_Mutation	SNP	ENST00000375136.3	37	c.310G>A	CCDS196.2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	9.516	1.107117	0.20714	.	.	ENSG00000158747	ENST00000428975;ENST00000289749;ENST00000451758;ENST00000439664;ENST00000375136;ENST00000548815;ENST00000425400;ENST00000427894	T;T;T;T;T;T;T;T	0.57595	1.49;0.39;1.49;1.49;0.39;0.39;1.49;0.39	3.16	2.25	0.28309	DAN (1);Cystine knot, C-terminal (1);	0.363979	0.25294	N	0.031702	T	0.23886	0.0578	N	0.08118	0	0.32007	N	0.602647	B;B	0.15141	0.0;0.012	B;B	0.12156	0.0;0.007	T	0.09443	-1.0674	9	.	.	.	-14.9707	2.7507	0.05280	0.2416:0.0:0.531:0.2273	.	104;140	P41271;P41271-2	NBL1_HUMAN;.	M	105;140;105;105;105;104;105;104	ENSP00000412419:V105M;ENSP00000289749:V140M;ENSP00000390607:V105M;ENSP00000399333:V105M;ENSP00000364278:V105M;ENSP00000449007:V104M;ENSP00000400250:V105M;ENSP00000394079:V104M	.	V	+	1	0	NBL1	19855976	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.966000	0.40481	0.903000	0.36546	0.561000	0.74099	GTG		0.642	NBL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007681.4	NM_005380		8	16	0	0	0	0.00308	0	8	16				
RAB42	115273	broad.mit.edu	37	1	28920492	28920492	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:28920492G>A	ENST00000373826.3	+	2	487	c.181G>A	c.(181-183)Gct>Act	p.A61T	TAF12_ENST00000471683.1_Intron|RAB42_ENST00000465518.1_3'UTR	NM_152304.1	NP_689517.1	Q8N4Z0	RAB42_HUMAN	RAB42, member RAS oncogene family	61					small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.A61T(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00618)|all_lung(284;0.00909)|Breast(348;0.0249)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0577)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00298)|KIRC - Kidney renal clear cell carcinoma(1967;0.00948)|BRCA - Breast invasive adenocarcinoma(304;0.0213)|READ - Rectum adenocarcinoma(331;0.0649)		TGACACCCTCGCTGATGCTAT	0.617																																							uc001bqu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(181-183)GCT>ACT		RAB42, member RAS oncogene family							43.0	39.0	40.0					1																	28920492		2203	4300	6503	SO:0001583	missense	115273				small GTPase mediated signal transduction	membrane	GTP binding	g.chr1:28920492G>A	BC033175	CCDS325.1	1p35.3	2014-02-12	2006-04-28		ENSG00000188060	ENSG00000188060		"""RAB, member RAS oncogene"""	28702	protein-coding gene	gene with protein product			"""RAB42, member RAS homolog family"""				Standard	NM_152304		Approved	MGC45806	uc001bqv.3	Q8N4Z0	OTTHUMG00000003656	ENST00000373826.3:c.181G>A	1.37:g.28920492G>A	ENSP00000362932:p.Ala61Thr					RAB42_uc001bqv.2_Missense_Mutation_p.A61T	p.A61T	NM_152304	NP_689517	Q8N4Z0	RAB42_HUMAN		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00298)|KIRC - Kidney renal clear cell carcinoma(1967;0.00948)|BRCA - Breast invasive adenocarcinoma(304;0.0213)|READ - Rectum adenocarcinoma(331;0.0649)	2	487	+		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00618)|all_lung(284;0.00909)|Breast(348;0.0249)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0577)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)	61					B2R5G2	Missense_Mutation	SNP	ENST00000373826.3	37	c.181G>A	CCDS325.1	.	.	.	.	.	.	.	.	.	.	G	0.076	-1.192062	0.01607	.	.	ENSG00000188060	ENST00000373826	T	0.80738	-1.41	5.46	-0.902	0.10537	.	0.441347	0.19441	N	0.114186	T	0.58793	0.2147	N	0.25332	0.735	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.41288	-0.9517	10	0.06891	T	0.86	.	5.162	0.15066	0.5607:0.0:0.2956:0.1437	.	61	Q8N4Z0	RAB42_HUMAN	T	61	ENSP00000362932:A61T	ENSP00000362932:A61T	A	+	1	0	RAB42	28793079	0.001000	0.12720	0.000000	0.03702	0.264000	0.26372	0.350000	0.20079	-0.114000	0.11936	0.561000	0.74099	GCT		0.617	RAB42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010371.1	NM_152304		8	23	0	0	0	0.004482	0	8	23				
CSMD2	114784	broad.mit.edu	37	1	34033332	34033332	+	Missense_Mutation	SNP	G	G	T	rs140959425		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:34033332G>T	ENST00000373381.4	-	53	8417	c.8241C>A	c.(8239-8241)aaC>aaA	p.N2747K		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2724	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N2724K(1)|p.N2724N(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGATGTGTCCGTTGACAATGG	0.547																																							uc001bxn.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		large_intestine(1)|lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(8170-8172)AAC>AAA		CUB and Sushi multiple domains 2							100.0	84.0	89.0					1																	34033332		2203	4300	6503	SO:0001583	missense	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34033332G>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8241C>A	1.37:g.34033332G>T	ENSP00000362479:p.Asn2747Lys					CSMD2_uc001bxm.1_Missense_Mutation_p.N2747K	p.N2724K	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN			54	8201	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	2724			Sushi 18.|Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37	c.8172C>A		.	.	.	.	.	.	.	.	.	.	G	11.02	1.514851	0.27123	.	.	ENSG00000121904	ENST00000373381	T	0.65364	-0.15	5.31	-10.6	0.00265	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.81206	0.4774	H	0.95816	3.725	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.97110	0.981;1.0	D	0.91205	0.4994	10	0.72032	D	0.01	.	19.469	0.94954	0.7445:0.0:0.2555:0.0	.	2724;2747	Q7Z408;E7EUA6	CSMD2_HUMAN;.	K	2747	ENSP00000362479:N2747K	ENSP00000241312:N2724K	N	-	3	2	CSMD2	33805919	0.001000	0.12720	0.122000	0.21767	0.502000	0.33828	-1.226000	0.02953	-2.705000	0.00396	-2.173000	0.00322	AAC		0.547	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		7	14	1	0	3.09899e-07	0.004482	4.00405e-07	7	14				
SFPQ	6421	broad.mit.edu	37	1	35652807	35652807	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:35652807C>A	ENST00000357214.5	-	8	1959	c.1861G>T	c.(1861-1863)Gga>Tga	p.G621*		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	621					alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.G621*(1)	SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				CACTTACCTCCCATGTTCATT	0.403			T	TFE3	papillary renal cell																																		uc001bys.2		NA		Dom	yes		1	1p34.3	6421	T	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)			E	TFE3		papillary renal cell	SFPQ/TFE3(6)	1	Substitution - Nonsense(1)		lung(1)	kidney(4)|soft_tissue(2)|ovary(1)|skin(1)	8						c.(1861-1863)GGA>TGA		splicing factor proline/glutamine rich							128.0	129.0	128.0					1																	35652807		2203	4300	6503	SO:0001587	stop_gained	6421				alternative nuclear mRNA splicing, via spliceosome|DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|nucleotide binding|protein binding|protein binding|RNA binding	g.chr1:35652807C>A	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.1861G>T	1.37:g.35652807C>A	ENSP00000349748:p.Gly621*					SFPQ_uc001byr.2_RNA	p.G621*	NM_005066	NP_005057	P23246	SFPQ_HUMAN			8	1954	-		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)	621					P30808|Q5SZ71	Nonsense_Mutation	SNP	ENST00000357214.5	37	c.1861G>T	CCDS388.1	.	.	.	.	.	.	.	.	.	.	C	40	7.982127	0.98594	.	.	ENSG00000116560	ENST00000357214	.	.	.	6.1	6.1	0.99115	.	0.055041	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.7146	0.99709	0.0:1.0:0.0:0.0	.	.	.	.	X	621	.	ENSP00000349748:G621X	G	-	1	0	SFPQ	35425394	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.570000	0.53834	2.902000	0.99343	0.650000	0.86243	GGA		0.403	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066		10	149	1	0	0.00829132	0.008291	0.00880795	10	149				
RLF	6018	broad.mit.edu	37	1	40701600	40701600	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:40701600G>A	ENST00000372771.4	+	8	1253	c.1226G>A	c.(1225-1227)aGa>aAa	p.R409K		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	409					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R409K(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TTAGAAGTTAGACGAGCCTGT	0.353																																							uc001cfc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1225-1227)AGA>AAA		rearranged L-myc fusion							73.0	80.0	78.0					1																	40701600		2203	4300	6503	SO:0001583	missense	6018				chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr1:40701600G>A		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.1226G>A	1.37:g.40701600G>A	ENSP00000361857:p.Arg409Lys					RLF_uc001cfd.3_Missense_Mutation_p.R100K	p.R409K	NM_012421	NP_036553	Q13129	RLF_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)		8	1257	+	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	409					Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	37	c.1226G>A	CCDS448.1	.	.	.	.	.	.	.	.	.	.	G	5.756	0.323920	0.10900	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.41400	1.0	6.07	6.07	0.98685	.	0.141100	0.64402	D	0.000008	T	0.37705	0.1013	N	0.20401	0.57	0.39437	D	0.967185	B;D	0.54207	0.067;0.965	B;P	0.47044	0.078;0.535	T	0.06058	-1.0848	10	0.18710	T	0.47	-19.412	20.6593	0.99626	0.0:0.0:1.0:0.0	.	102;409	F5H2M5;Q13129	.;RLF_HUMAN	K	409;102	ENSP00000361857:R409K	ENSP00000361857:R409K	R	+	2	0	RLF	40474187	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.907000	0.63300	2.885000	0.99019	0.655000	0.94253	AGA		0.353	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421		11	74	0	0	0	0.008291	0	11	74				
ZMPSTE24	10269	broad.mit.edu	37	1	40758147	40758147	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:40758147C>T	ENST00000372759.3	+	10	1399	c.1234C>T	c.(1234-1236)Cgc>Tgc	p.R412C		NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	412					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)	p.R412S(1)|p.R412C(1)		endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			AGTCCTAAGCCGCAGATTTGA	0.383																																							uc001cfg.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)		0						c.(1234-1236)CGC>TGC		zinc metallopeptidase STE24							97.0	106.0	103.0					1																	40758147		2203	4300	6503	SO:0001583	missense	10269					endoplasmic reticulum membrane|Golgi membrane|integral to membrane	metal ion binding|metalloexopeptidase activity	g.chr1:40758147C>T	Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.1234C>T	1.37:g.40758147C>T	ENSP00000361845:p.Arg412Cys						p.R412C	NM_005857	NP_005848	O75844	FACE1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)		10	1445	+	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	412					B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Missense_Mutation	SNP	ENST00000372759.3	37	c.1234C>T	CCDS449.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412893	0.83340	.	.	ENSG00000084073	ENST00000372759	D	0.90261	-2.64	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.96303	0.8794	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97003	0.9730	10	0.87932	D	0	-33.874	14.9429	0.71009	0.1435:0.8565:0.0:0.0	.	412	O75844	FACE1_HUMAN	C	412	ENSP00000361845:R412C	ENSP00000361845:R412C	R	+	1	0	ZMPSTE24	40530734	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.613000	0.67688	2.560000	0.86352	0.467000	0.42956	CGC		0.383	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015766.1			14	137	0	0	0	0.00499	0	14	137				
TM2D1	83941	broad.mit.edu	37	1	62175007	62175007	+	Missense_Mutation	SNP	C	C	T	rs369821446		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:62175007C>T	ENST00000606498.1	-	3	361	c.341G>A	c.(340-342)cGa>cAa	p.R114Q	TM2D1_ENST00000371180.2_Missense_Mutation_p.R176Q|TM2D1_ENST00000371177.2_Missense_Mutation_p.R114Q|TM2D1_ENST00000294613.5_Missense_Mutation_p.R114Q|TM2D1_ENST00000472989.1_5'UTR			Q9BX74	TM2D1_HUMAN	TM2 domain containing 1	114					apoptotic signaling pathway (GO:0097190)	integral component of plasma membrane (GO:0005887)	beta-amyloid binding (GO:0001540)|G-protein coupled receptor activity (GO:0004930)	p.R176Q(1)|p.R114Q(1)|p.R176L(1)		large_intestine(2)|lung(3)|ovary(1)	6						TTACACATTTCGGCAAGATAT	0.363																																							uc001czz.1		NA																	3	Substitution - Missense(3)		lung(2)|large_intestine(1)	ovary(1)	1						c.(340-342)CGA>CAA		beta-amyloid binding protein precursor		C	GLN/ARG	0,3680		0,0,1840	78.0	74.0	75.0		341	5.5	1.0	1		75	1,8165		0,1,4082	no	missense	TM2D1	NM_032027.2	43	0,1,5922	TT,TC,CC		0.0122,0.0,0.0084	probably-damaging	114/208	62175007	1,11845	1840	4083	5923	SO:0001583	missense	83941				apoptosis			g.chr1:62175007C>T	AF353990	CCDS65554.1	1p32.1	2008-02-05			ENSG00000162604	ENSG00000162604			24142	protein-coding gene	gene with protein product		610080				11278849, 12553667	Standard	NM_032027		Approved	BBP	uc001czz.1	Q9BX74	OTTHUMG00000008466	ENST00000606498.1:c.341G>A	1.37:g.62175007C>T	ENSP00000475700:p.Arg114Gln						p.R114Q	NM_032027	NP_114416	Q9BX74	TM2D1_HUMAN			3	644	-			114					A6NDA8	Missense_Mutation	SNP	ENST00000606498.1	37	c.341G>A		.	.	.	.	.	.	.	.	.	.	C	29.0	4.971915	0.92919	0.0	1.22E-4	ENSG00000162604	ENST00000371180;ENST00000294613;ENST00000371178;ENST00000371177	.	.	.	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000004	T	0.61999	0.2392	M	0.68593	2.085	0.53005	D	0.999965	D	0.63880	0.993	P	0.44860	0.462	T	0.66846	-0.5820	9	0.56958	D	0.05	-10.9907	18.396	0.90499	0.0:1.0:0.0:0.0	.	114	Q9BX74	TM2D1_HUMAN	Q	176;114;114;114	.	ENSP00000294613:R114Q	R	-	2	0	TM2D1	61947595	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.467000	0.66737	2.882000	0.98803	0.655000	0.94253	CGA		0.363	TM2D1-012	KNOWN	non_canonical_U12|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470779.2	NM_032027		5	38	0	0	0	0.001168	0	5	38				
C1orf141	400757	broad.mit.edu	37	1	67559010	67559010	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:67559010T>A	ENST00000371007.2	-	8	990	c.881A>T	c.(880-882)gAt>gTt	p.D294V	C1orf141_ENST00000371006.1_Missense_Mutation_p.D294V|C1orf141_ENST00000544837.1_Missense_Mutation_p.D294V	NM_001276351.1	NP_001263280.1	Q5JVX7	CA141_HUMAN	chromosome 1 open reading frame 141	294								p.D294V(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18						TAGTTTATCATCTACAGTTGT	0.333																																							uc001ddl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(880-882)GAT>GTT		hypothetical protein LOC400757							86.0	88.0	87.0					1																	67559010		2203	4299	6502	SO:0001583	missense	400757							g.chr1:67559010T>A	BC090886	CCDS30745.1, CCDS72804.1	1p31.2	2012-07-23			ENSG00000203963	ENSG00000203963			32044	protein-coding gene	gene with protein product							Standard	NM_001276351		Approved		uc001ddm.2	Q5JVX7	OTTHUMG00000009406	ENST00000371007.2:c.881A>T	1.37:g.67559010T>A	ENSP00000360046:p.Asp294Val					C1orf141_uc001ddm.1_Missense_Mutation_p.D294V|C1orf141_uc001ddn.1_RNA	p.D294V	NM_001013674	NP_001013696	Q5JVX7	CA141_HUMAN			7	992	-			294					Q0P5P5|Q5JVX5	Missense_Mutation	SNP	ENST00000371007.2	37	c.881A>T	CCDS30745.1	.	.	.	.	.	.	.	.	.	.	T	9.507	1.104811	0.20632	.	.	ENSG00000203963	ENST00000371007;ENST00000371006;ENST00000544837	T;T;T	0.32272	1.46;1.46;1.46	4.85	-0.775	0.10988	.	1.915850	0.02540	N	0.094562	T	0.06781	0.0173	N	0.19112	0.55	0.09310	N	1	B	0.21905	0.062	B	0.18561	0.022	T	0.26985	-1.0087	10	0.45353	T	0.12	4.6646	4.1603	0.10280	0.0:0.3153:0.1781:0.5066	.	294	Q5JVX7	CA141_HUMAN	V	294	ENSP00000360046:D294V;ENSP00000360045:D294V;ENSP00000444018:D294V	ENSP00000360045:D294V	D	-	2	0	C1orf141	67331598	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.027000	0.13621	0.045000	0.15804	-0.250000	0.11733	GAT		0.333	C1orf141-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026096.2	NM_001013674		29	29	0	0	0	0.00632	0	29	29				
IL23R	149233	broad.mit.edu	37	1	67724401	67724401	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:67724401G>A	ENST00000347310.5	+	11	1651	c.1480G>A	c.(1480-1482)Gag>Aag	p.E494K	IL23R_ENST00000371002.1_3'UTR|IL23R_ENST00000395227.1_Missense_Mutation_p.E239K|IL23R_ENST00000473881.1_3'UTR	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	494					defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)		p.E494K(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						TTTTCTGCCTGAGGGAAGCCA	0.373																																							uc001ddo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1480-1482)GAG>AAG		interleukin 23 receptor precursor							62.0	64.0	63.0					1																	67724401		2203	4300	6503	SO:0001583	missense	149233				inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity	g.chr1:67724401G>A	AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.1480G>A	1.37:g.67724401G>A	ENSP00000321345:p.Glu494Lys					IL23R_uc009waz.2_Missense_Mutation_p.E291K|IL23R_uc010opi.1_RNA|IL23R_uc010opj.1_Missense_Mutation_p.E92K|IL23R_uc010opk.1_3'UTR|IL23R_uc010opl.1_Missense_Mutation_p.E76K|IL23R_uc010opm.1_RNA|IL23R_uc001ddq.2_Missense_Mutation_p.E240K|IL23R_uc010opn.1_Missense_Mutation_p.E339K|IL23R_uc001ddr.2_RNA|IL23R_uc010ops.1_Missense_Mutation_p.E291K|IL23R_uc010opt.1_Missense_Mutation_p.E135K|IL23R_uc010opu.1_Missense_Mutation_p.E190K|IL23R_uc010opv.1_Missense_Mutation_p.E252K|IL23R_uc010opw.1_Missense_Mutation_p.E129K|IL23R_uc010opx.1_Missense_Mutation_p.E135K|IL23R_uc010opy.1_Missense_Mutation_p.E261K|IL23R_uc010opz.1_Missense_Mutation_p.E135K|IL23R_uc010oqa.1_Missense_Mutation_p.E135K|IL23R_uc010oqb.1_Missense_Mutation_p.E323K|IL23R_uc010oqc.1_Missense_Mutation_p.E210K|IL23R_uc010oqd.1_Missense_Mutation_p.E129K|IL23R_uc010oqe.1_Missense_Mutation_p.E92K|IL23R_uc010oqf.1_Missense_Mutation_p.E92K|IL23R_uc010oqg.1_Missense_Mutation_p.E92K|IL23R_uc010oqh.1_Missense_Mutation_p.E135K|IL23R_uc001dds.2_Missense_Mutation_p.E239K|IL23R_uc001ddt.2_Missense_Mutation_p.E92K	p.E494K	NM_144701	NP_653302	Q5VWK5	IL23R_HUMAN			11	1565	+			494			Cytoplasmic (Potential).		C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Missense_Mutation	SNP	ENST00000347310.5	37	c.1480G>A	CCDS637.1	.	.	.	.	.	.	.	.	.	.	G	1.599	-0.526960	0.04141	.	.	ENSG00000162594	ENST00000347310;ENST00000395227	T;T	0.32988	1.43;1.51	5.3	3.33	0.38152	.	1.165590	0.06135	N	0.671351	T	0.05640	0.0148	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.26258	0.018;0.018;0.039;0.018;0.145	B;B;B;B;B	0.26517	0.026;0.021;0.07;0.021;0.061	T	0.16453	-1.0402	10	0.02654	T	1	-34.9833	10.9566	0.47362	0.0:0.0:0.6634:0.3366	.	240;129;92;239;494	Q5VWK5-2;Q5VWK5-5;Q5VWK5-7;Q5VWK5-6;Q5VWK5	.;.;.;.;IL23R_HUMAN	K	494;239	ENSP00000321345:E494K;ENSP00000378652:E239K	ENSP00000321345:E494K	E	+	1	0	IL23R	67496989	0.003000	0.15002	0.001000	0.08648	0.005000	0.04900	1.326000	0.33735	1.222000	0.43521	0.650000	0.86243	GAG		0.373	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025199.2	NM_144701		30	33	0	0	0	0.009535	0	30	33				
ERICH3	127254	broad.mit.edu	37	1	75102097	75102097	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:75102097G>C	ENST00000326665.5	-	6	688	c.470C>G	c.(469-471)cCa>cGa	p.P157R	C1orf173_ENST00000420661.2_5'Flank	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		157								p.P157R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CATATTTCCTGGAGCAGTATA	0.398																																							uc001dgg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(469-471)CCA>CGA		hypothetical protein LOC127254							206.0	215.0	212.0					1																	75102097		2203	4300	6503	SO:0001583	missense	127254							g.chr1:75102097G>C																												ENST00000326665.5:c.470C>G	1.37:g.75102097G>C	ENSP00000322609:p.Pro157Arg					C1orf173_uc001dgi.3_5'Flank	p.P157R	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN			6	689	-			157					Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	c.470C>G	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013704	0.75161	.	.	ENSG00000178965	ENST00000326665	T	0.54279	0.58	5.35	5.35	0.76521	.	.	.	.	.	T	0.65417	0.2689	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64210	-0.6461	9	0.48119	T	0.1	-8.5345	18.2066	0.89857	0.0:0.0:1.0:0.0	.	157	Q5RHP9	CA173_HUMAN	R	157	ENSP00000322609:P157R	ENSP00000322609:P157R	P	-	2	0	C1orf173	74874685	1.000000	0.71417	0.983000	0.44433	0.963000	0.63663	6.569000	0.73992	2.661000	0.90470	0.557000	0.71058	CCA		0.398	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			12	196	0	0	0	0.00245	0	12	196				
USP33	23032	broad.mit.edu	37	1	78189129	78189129	+	Splice_Site	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:78189129C>A	ENST00000370793.1	-	13	1716		c.e13-1		USP33_ENST00000357428.1_Splice_Site|USP33_ENST00000370794.3_Splice_Site|USP33_ENST00000370792.3_Splice_Site	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33						axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						GCAGACTGAGCTAGGATTGAA	0.318																																					Melanoma(152;72 1870 11110 26780 42647)	Melanoma(152;72 1870 11110 26780 42647)	uc001dht.2		NA																	1	Unknown(1)		lung(1)	lung(2)|ovary(1)	3						c.e13-1		ubiquitin specific protease 33 isoform 1							101.0	93.0	96.0					1																	78189129		2203	4299	6502	SO:0001630	splice_region_variant	23032				axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr1:78189129C>A	AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.1370-1G>T	1.37:g.78189129C>A						USP33_uc001dhs.2_Splice_Site_p.A178_splice|USP33_uc001dhu.2_Splice_Site_p.A426_splice|USP33_uc001dhv.2_Splice_Site_p.A262_splice|USP33_uc001dhw.2_Splice_Site_p.A457_splice	p.A457_splice	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN			13	1717	-								Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Splice_Site	SNP	ENST00000370793.1	37	c.1370_splice	CCDS678.1	.	.	.	.	.	.	.	.	.	.	C	8.777	0.927410	0.18056	.	.	ENSG00000077254	ENST00000370794;ENST00000481579;ENST00000370793;ENST00000357428;ENST00000370792	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5269	0.90975	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP33	77961717	1.000000	0.71417	0.953000	0.39169	0.158000	0.22134	1.351000	0.34022	2.547000	0.85894	0.655000	0.94253	.		0.318	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017	Intron	4	24	1	0	0.00024832	0.009096	0.000280413	4	24				
TTLL7	79739	broad.mit.edu	37	1	84417625	84417625	+	Silent	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:84417625T>A	ENST00000260505.8	-	3	437	c.60A>T	c.(58-60)acA>acT	p.T20T	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	20					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)	p.T20T(1)		kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		AAGGTAATTCTGTATTCAAAT	0.333																																							uc001djc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(58-60)ACA>ACT		tubulin tyrosine ligase-like family, member 7							45.0	48.0	47.0					1																	84417625		2203	4300	6503	SO:0001819	synonymous_variant	79739				cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity	g.chr1:84417625T>A	AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.60A>T	1.37:g.84417625T>A						TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_Intron|TTLL7_uc001djg.2_RNA	p.T20T	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN		all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)	3	456	-			20					Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Silent	SNP	ENST00000260505.8	37	c.60A>T	CCDS690.2																																																																																				0.333	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027498.1	NM_024686		17	55	0	0	0	0.006122	0	17	55				
LRRC8C	84230	broad.mit.edu	37	1	90178352	90178352	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:90178352G>T	ENST00000370454.4	+	3	478	c.223G>T	c.(223-225)Gtt>Ttt	p.V75F	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	75					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.V75F(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CTCTCAAGCAGTTGCCAGTAC	0.478																																							uc001dnl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(223-225)GTT>TTT		leucine rich repeat containing 8 family, member							109.0	102.0	104.0					1																	90178352		2203	4300	6503	SO:0001583	missense	84230					endoplasmic reticulum membrane|integral to membrane		g.chr1:90178352G>T		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.223G>T	1.37:g.90178352G>T	ENSP00000359483:p.Val75Phe						p.V75F	NM_032270	NP_115646	Q8TDW0	LRC8C_HUMAN		all cancers(265;0.00756)|Epithelial(280;0.0313)	3	465	+		all_lung(203;0.126)	75					B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	37	c.223G>T	CCDS725.1	.	.	.	.	.	.	.	.	.	.	G	5.040	0.192985	0.09599	.	.	ENSG00000171488	ENST00000370454	T	0.24908	1.83	5.78	3.57	0.40892	.	0.647700	0.16351	N	0.218238	T	0.03783	0.0107	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.41360	-0.9513	10	0.14252	T	0.57	.	9.7422	0.40424	0.2338:0.0:0.7662:0.0	.	75	Q8TDW0	LRC8C_HUMAN	F	75	ENSP00000359483:V75F	ENSP00000359483:V75F	V	+	1	0	LRRC8C	89950940	0.001000	0.12720	0.874000	0.34290	0.991000	0.79684	0.579000	0.23788	1.434000	0.47414	0.655000	0.94253	GTT		0.478	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270		32	47	1	0	7.11191e-15	0.013726	1.08779e-14	32	47				
LRRC8D	55144	broad.mit.edu	37	1	90399291	90399291	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:90399291G>T	ENST00000337338.5	+	3	1071	c.664G>T	c.(664-666)Gag>Tag	p.E222*	LRRC8D_ENST00000394593.3_Nonsense_Mutation_p.E222*	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	222					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E222*(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		CGAAGACTCAGAGGAAAACAA	0.443																																							uc001dnm.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(664-666)GAG>TAG		leucine rich repeat containing 8 family, member							60.0	60.0	60.0					1																	90399291		2203	4300	6503	SO:0001587	stop_gained	55144					integral to membrane	protein binding	g.chr1:90399291G>T	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.664G>T	1.37:g.90399291G>T	ENSP00000338887:p.Glu222*					LRRC8D_uc001dnn.2_Nonsense_Mutation_p.E222*	p.E222*	NM_001134479	NP_001127951	Q7L1W4	LRC8D_HUMAN		all cancers(265;0.0109)|Epithelial(280;0.0427)	3	1089	+		all_lung(203;0.0894)|Lung NSC(277;0.227)	222					D3DT29|Q6UWB2|Q9NVW3	Nonsense_Mutation	SNP	ENST00000337338.5	37	c.664G>T	CCDS726.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698688	0.68501	.	.	ENSG00000171492	ENST00000337338;ENST00000394593;ENST00000441269	.	.	.	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	.	.	.	X	222	.	.	E	+	1	0	LRRC8D	90171879	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.914000	0.87478	2.840000	0.97914	0.655000	0.94253	GAG		0.443	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103		33	50	1	0	8.4185e-14	0.012213	1.26822e-13	33	50				
DPYD	1806	broad.mit.edu	37	1	98058934	98058934	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:98058934G>T	ENST00000370192.3	-	10	1068	c.968C>A	c.(967-969)gCc>gAc	p.A323D		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	323					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.A323D(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	AGAGTGACAGGCGCACATTCC	0.453																																							uc001drv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|breast(2)	8						c.(967-969)GCC>GAC		dihydropyrimidine dehydrogenase isoform 1	Capecitabine(DB01101)|Enfuvirtide(DB00109)						110.0	94.0	99.0					1																	98058934		2203	4300	6503	SO:0001583	missense	1806				'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity	g.chr1:98058934G>T	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.968C>A	1.37:g.98058934G>T	ENSP00000359211:p.Ala323Asp						p.A323D	NM_000110	NP_000101	Q12882	DPYD_HUMAN		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	10	1105	-		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)	323					A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	c.968C>A	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319129	0.41096	.	.	ENSG00000188641	ENST00000370192	D	0.89123	-2.47	6.17	5.26	0.73747	.	0.442660	0.26851	N	0.022163	T	0.77638	0.4160	L	0.47078	1.49	0.80722	D	1	B	0.19331	0.035	B	0.18263	0.021	T	0.74362	-0.3690	10	0.25106	T	0.35	-7.4549	13.6852	0.62511	0.0704:0.0:0.9296:0.0	.	323	Q12882	DPYD_HUMAN	D	323	ENSP00000359211:A323D	ENSP00000359211:A323D	A	-	2	0	DPYD	97831522	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.554000	0.45845	1.631000	0.50456	0.655000	0.94253	GCC		0.453	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110		15	54	1	0	1.05317e-09	0.00245	1.47825e-09	15	54				
COL11A1	1301	broad.mit.edu	37	1	103573670	103573670	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:103573670A>T	ENST00000370096.3	-	1	377	c.65T>A	c.(64-66)cTc>cAc	p.L22H	COL11A1_ENST00000358392.2_Missense_Mutation_p.L22H|COL11A1_ENST00000512756.1_Missense_Mutation_p.L22H|COL11A1_ENST00000353414.4_Missense_Mutation_p.L22H	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	22					cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.L22H(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GGTCAATGCGAGGGTTGTTAC	0.547																																							uc001dul.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(64-66)CTC>CAC		alpha 1 type XI collagen isoform A							175.0	139.0	151.0					1																	103573670		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103573670A>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.65T>A	1.37:g.103573670A>T	ENSP00000359114:p.Leu22His					COL11A1_uc001dum.2_Missense_Mutation_p.L22H|COL11A1_uc001dun.2_Missense_Mutation_p.L22H|COL11A1_uc009weh.2_Missense_Mutation_p.L22H	p.L22H	NM_001854	NP_001845	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	1	383	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	22					B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.65T>A	CCDS778.1	.	.	.	.	.	.	.	.	.	.	A	15.25	2.776427	0.49786	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36	5.31	5.31	0.75309	.	0.156420	0.43579	D	0.000545	T	0.25938	0.0632	L	0.42245	1.32	0.34975	D	0.753564	P;D;D;P	0.53885	0.806;0.963;0.963;0.938	B;B;P;B	0.47015	0.249;0.432;0.534;0.249	T	0.14504	-1.0470	10	0.62326	D	0.03	.	14.0975	0.65032	1.0:0.0:0.0:0.0	.	22;22;22;22	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	H	22	ENSP00000359114:L22H;ENSP00000351163:L22H;ENSP00000302551:L22H;ENSP00000426533:L22H;ENSP00000408640:L22H	ENSP00000302551:L22H	L	-	2	0	COL11A1	103346258	1.000000	0.71417	0.865000	0.33974	0.755000	0.42902	7.522000	0.81844	2.001000	0.58596	0.533000	0.62120	CTC		0.547	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		9	51	0	0	0	0.008291	0	9	51				
ATP5F1	515	broad.mit.edu	37	1	111998816	111998816	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:111998816A>G	ENST00000369722.3	+	4	938	c.332A>G	c.(331-333)tAt>tGt	p.Y111C	ATP5F1_ENST00000369721.4_3'UTR|ATP5F1_ENST00000483994.1_Missense_Mutation_p.Y50C	NM_001688.4	NP_001679.2	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1	111					ATP catabolic process (GO:0006200)|ATP synthesis coupled proton transport (GO:0015986)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)	p.Y111C(1)		breast(1)|cervix(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		GTAATGGTCTATGGAATTAAA	0.373																																							uc001ebc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(331-333)TAT>TGT		ATP synthase, H+ transporting, mitochondrial F0							134.0	136.0	136.0					1																	111998816		2203	4297	6500	SO:0001583	missense	515				ATP catabolic process|respiratory electron transport chain	mitochondrial matrix|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transporting ATP synthase activity, rotational mechanism|protein binding	g.chr1:111998816A>G	X60221	CCDS836.1	1p13.2	2012-10-12	2010-06-11		ENSG00000116459	ENSG00000116459		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	840	protein-coding gene	gene with protein product		603270	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1"""			1831354	Standard	XM_005270929		Approved		uc001ebc.3	P24539	OTTHUMG00000011745	ENST00000369722.3:c.332A>G	1.37:g.111998816A>G	ENSP00000358737:p.Tyr111Cys					ATP5F1_uc009wgf.1_Missense_Mutation_p.Y258C|ATP5F1_uc001ebd.3_Intron	p.Y111C	NM_001688	NP_001679	P24539	AT5F1_HUMAN		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)	4	753	+		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)	111					Q9BQ68|Q9BRU8	Missense_Mutation	SNP	ENST00000369722.3	37	c.332A>G	CCDS836.1	.	.	.	.	.	.	.	.	.	.	A	11.53	1.664901	0.29604	.	.	ENSG00000116459	ENST00000369722;ENST00000483994	T;T	0.30981	1.51;1.51	5.37	3.0	0.34707	.	0.053284	0.85682	D	0.000000	T	0.38983	0.1061	M	0.82823	2.61	0.58432	D	0.999999	D;D	0.57571	0.98;0.98	P;P	0.59171	0.853;0.853	T	0.36089	-0.9762	9	.	.	.	.	10.7402	0.46149	0.7467:0.0:0.0:0.2533	.	111;111	Q08ET0;P24539	.;AT5F1_HUMAN	C	111;50	ENSP00000358737:Y111C;ENSP00000420366:Y50C	.	Y	+	2	0	ATP5F1	111800339	1.000000	0.71417	0.501000	0.27601	0.003000	0.03518	5.604000	0.67626	0.402000	0.25451	-1.574000	0.00870	TAT		0.373	ATP5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032455.1	NM_001688		5	100	0	0	0	0.001168	0	5	100				
NRAS	4893	broad.mit.edu	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	T	A	rs11554290	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:115256529T>A	ENST00000369535.4	-	3	435	c.182A>T	c.(181-183)cAa>cTa	p.Q61L		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61R(817)|p.Q61L(175)|p.Q61P(23)|p.Q61K(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458	Q61L(C3A_LIVER)|Q61L(HEPG2_LIVER)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MELJUSO_SKIN)|Q61L(MHHES1_BONE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(HT1197_URINARY_TRACT)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(KU1919_URINARY_TRACT)|Q61R(NCIH2347_LUNG)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(SKMEL2_SKIN)|Q61R(SW1271_LUNG)|Q61R(TT2609C02_THYROID)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																													uc009wgu.2	Q61L(HEPG2_LIVER)|Q61R(SKMEL2_SKIN)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MHHES1_BONE)|Q61R(HT1197_URINARY_TRACT)|Q61L(MELJUSO_SKIN)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(KU1919_URINARY_TRACT)|Q61L(C3A_LIVER)|Q61R(TT2609C02_THYROID)|Q61R(NCIH2347_LUNG)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(SW1271_LUNG)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	50		Dom	yes		1	1p13.2	4893	Mis	neuroblastoma RAS viral (v-ras) oncogene homolog			"""L, E"""			melanoma|MM|AML|thyroid		1016	Substitution - Missense(1016)	p.Q61R(757)|p.Q61K(537)|p.Q61L(147)|p.Q61H(95)|p.Q61P(21)|p.Q61E(9)|p.Q61?(4)|p.Q61Q(3)|p.Q61_E62>HK(1)	skin(466)|thyroid(279)|haematopoietic_and_lymphoid_tissue(124)|NS(50)|large_intestine(27)|lung(17)|urinary_tract(11)|adrenal_gland(7)|liver(7)|breast(7)|soft_tissue(4)|testis(3)|endometrium(3)|ovary(3)|central_nervous_system(2)|pancreas(2)|eye(1)|prostate(1)|meninges(1)|autonomic_ganglia(1)	haematopoietic_and_lymphoid_tissue(1008)|skin(956)|thyroid(334)|large_intestine(62)|NS(60)|soft_tissue(32)|lung(31)|upper_aerodigestive_tract(25)|urinary_tract(12)|liver(10)|adrenal_gland(9)|autonomic_ganglia(8)|testis(8)|central_nervous_system(8)|prostate(8)|breast(7)|biliary_tract(6)|ovary(6)|stomach(5)|pancreas(5)|endometrium(2)|kidney(2)|cervix(2)|eye(1)	2607						c.(181-183)CAA>CTA		neuroblastoma RAS viral (v-ras) oncogene homolog							180.0	156.0	164.0					1																	115256529		2203	4300	6503	SO:0001583	missense	4893	Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	Golgi membrane|plasma membrane	GTP binding|GTPase activity	g.chr1:115256529T>A	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.182A>T	1.37:g.115256529T>A	ENSP00000358548:p.Gln61Leu	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)					p.Q61L	NM_002524	NP_002515	P01111	RASN_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	3	436	-	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	61		Q -> K (in neuroblastoma cell).	GTP.		Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	c.182A>T	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.844732	0.91197	.	.	ENSG00000213281	ENST00000369535	D	0.83992	-1.79	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.92446	0.7602	H	0.96748	3.875	0.80722	D	1	D	0.55800	0.973	P	0.61533	0.89	D	0.94664	0.7851	10	0.72032	D	0.01	.	15.0132	0.71565	0.0:0.0:0.0:1.0	.	61	P01111	RASN_HUMAN	L	61	ENSP00000358548:Q61L	ENSP00000358548:Q61L	Q	-	2	0	NRAS	115058052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.761000	0.85260	2.120000	0.65058	0.533000	0.62120	CAA		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524		100	88	0	0	0	0.00361	0	100	88				
TBX15	6913	broad.mit.edu	37	1	119467342	119467342	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:119467342T>A	ENST00000369429.3	-	4	629	c.620A>T	c.(619-621)gAc>gTc	p.D207V	TBX15_ENST00000207157.3_Missense_Mutation_p.D101V			Q96SF7	TBX15_HUMAN	T-box 15	207					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.D101V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		CATCCAGGTGTCTCCAGAAGC	0.458																																							uc001ehl.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)	2						c.(301-303)GAC>GTC		T-box 15							168.0	167.0	167.0					1																	119467342		2203	4300	6503	SO:0001583	missense	6913					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:119467342T>A	AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.620A>T	1.37:g.119467342T>A	ENSP00000358437:p.Asp207Val						p.D101V	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)	4	617	-	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)	207			T-box.		Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	ENST00000369429.3	37	c.302A>T		.	.	.	.	.	.	.	.	.	.	T	25.0	4.592334	0.86953	.	.	ENSG00000092607	ENST00000207157;ENST00000369429	D;D	0.88124	-2.34;-2.34	5.96	5.96	0.96718	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.91703	0.7377	M	0.72353	2.195	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	D	0.92636	0.6120	10	0.72032	D	0.01	.	16.4484	0.83959	0.0:0.0:0.0:1.0	.	207	Q96SF7	TBX15_HUMAN	V	101;207	ENSP00000207157:D101V;ENSP00000358437:D207V	ENSP00000207157:D101V	D	-	2	0	TBX15	119268865	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.285000	0.76669	0.533000	0.62120	GAC		0.458	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	NM_152380		40	139	0	0	0	0.00874	0	40	139				
ANKRD35	148741	broad.mit.edu	37	1	145561885	145561885	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:145561885C>G	ENST00000355594.4	+	10	1660	c.1573C>G	c.(1573-1575)Ccc>Gcc	p.P525A		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	525								p.P525A(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCTGGGGACTCCCCGTGCTGA	0.617																																					Melanoma(9;127 754 22988 51047)	Melanoma(9;127 754 22988 51047)	uc001eob.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(1573-1575)CCC>GCC		ankyrin repeat domain 35							66.0	81.0	76.0					1																	145561885		2199	4298	6497	SO:0001583	missense	148741							g.chr1:145561885C>G	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1573C>G	1.37:g.145561885C>G	ENSP00000347802:p.Pro525Ala					NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Missense_Mutation_p.P368A	p.P525A	NM_144698	NP_653299	Q8N283	ANR35_HUMAN			10	1681	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		525					A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	c.1573C>G	CCDS919.1	.	.	.	.	.	.	.	.	.	.	C	7.917	0.737709	0.15574	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.65549	-0.16	5.24	-5.53	0.02552	.	0.751662	0.11888	N	0.519837	T	0.23171	0.0560	M	0.63428	1.95	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.23404	-1.0189	10	0.12103	T	0.63	-0.2265	3.4791	0.07595	0.1197:0.2336:0.1173:0.5294	.	525	Q8N283	ANR35_HUMAN	A	434;525	ENSP00000347802:P525A	ENSP00000347802:P525A	P	+	1	0	ANKRD35	144273242	0.000000	0.05858	0.021000	0.16686	0.601000	0.36947	-0.775000	0.04679	-0.665000	0.05317	-0.812000	0.03155	CCC		0.617	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698		19	258	0	0	0	0.010504	0	19	258				
ANP32E	81611	broad.mit.edu	37	1	150199078	150199078	+	Silent	SNP	C	C	G	rs144321821		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:150199078C>G	ENST00000314136.8	-	5	912	c.543G>C	c.(541-543)ccG>ccC	p.P181P	ANP32E_ENST00000533654.1_Missense_Mutation_p.R126P|ANP32E_ENST00000369114.5_Intron|ANP32E_ENST00000369115.2_Silent_p.P49P|ANP32E_ENST00000436748.2_Silent_p.P140P|ANP32E_ENST00000369116.4_Silent_p.P49P|ANP32E_ENST00000369119.3_Silent_p.P133P	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	181	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)	p.P181P(1)		breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			cATATCCTTCCGGTGGACCAG	0.438																																							uc001etw.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(541-543)CCG>CCC		acidic (leucine-rich) nuclear phosphoprotein 32							209.0	182.0	191.0					1																	150199078		2203	4300	6503	SO:0001819	synonymous_variant	81611					cytoplasmic membrane-bounded vesicle|nucleus	phosphatase inhibitor activity	g.chr1:150199078C>G	AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.543G>C	1.37:g.150199078C>G						ANP32E_uc010pbt.1_RNA|ANP32E_uc010pbu.1_Silent_p.P133P|ANP32E_uc010pbv.1_Silent_p.P140P|ANP32E_uc001etv.3_Silent_p.P181P|ANP32E_uc010pbw.1_Missense_Mutation_p.R126P	p.P181P	NM_030920	NP_112182	Q9BTT0	AN32E_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		5	913	-	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		181			Asp/Glu-rich (highly acidic).		B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Silent	SNP	ENST00000314136.8	37	c.543G>C	CCDS946.1	.	.	.	.	.	.	.	.	.	.	C	8.347	0.830078	0.16749	.	.	ENSG00000143401	ENST00000533654	T	0.00337	8.05	5.42	-6.53	0.01866	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.58432	D	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.01188	-1.1424	7	.	.	.	.	3.4063	0.07341	0.1759:0.3991:0.0719:0.3531	.	126	E9PLC4	.	P	126	ENSP00000435215:R126P	.	R	-	2	0	ANP32E	148465702	0.061000	0.20836	0.964000	0.40570	0.339000	0.28857	-0.985000	0.03751	-0.579000	0.05952	-3.143000	0.00059	CGG		0.438	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035056.1	NM_030920		16	43	0	0	0	0.004007	0	16	43				
FLG2	388698	broad.mit.edu	37	1	152326607	152326608	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:152326607_152326608CC>AA	ENST00000388718.5	-	3	3726_3727	c.3654_3655GG>TT	c.(3652-3657)ttGGgc>ttTTgc	p.1218_1219LG>FC	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1218	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.L1218_G1219>FC(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCACCCTGGCCCAAGCCAGTTG	0.46																																							uc001ezw.3		NA																	1	Complex - compound substitution(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(3652-3657)TTGGGC>TTTTGC		filaggrin family member 2																																				SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152326607_152326608CC>AA	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3654_3655delinsAA	1.37:g.152326607_152326608delinsAA	ENSP00000373370:p.L1218_G1219delinsFC					uc001ezv.2_Intron	p.1218_1219LG>FC	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	3727_3728	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1218_1219			Ser-rich.		Q9H4U1	Missense_Mutation	DNP	ENST00000388718.5	37	c.3654_3655GG>TT	CCDS30861.1																																																																																				0.460	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		53	147	0	0	0	0.004672	0	53	147				
SPTA1	6708	broad.mit.edu	37	1	158592846	158592846	+	Missense_Mutation	SNP	C	C	T	rs199993378		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:158592846C>T	ENST00000368147.4	-	43	6227	c.6047G>A	c.(6046-6048)cGc>cAc	p.R2016H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2016					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R2016H(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTGTTCCCAGCGCTTCAGCAG	0.478																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(6046-6048)CGC>CAC		spectrin, alpha, erythrocytic 1		C	HIS/ARG	3,3867		0,3,1932	231.0	230.0	231.0		6047	-1.5	0.6	1		231	1,8273		0,1,4136	yes	missense	SPTA1	NM_003126.2	29	0,4,6068	TT,TC,CC		0.0121,0.0775,0.0329	benign	2016/2420	158592846	4,12140	1935	4137	6072	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158592846C>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6047G>A	1.37:g.158592846C>T	ENSP00000357129:p.Arg2016His						p.R2016H	NM_003126	NP_003117	P02549	SPTA1_HUMAN			43	6246	-	all_hematologic(112;0.0378)		2016			Spectrin 19.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.6047G>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.288856	0.23478	7.75E-4	1.21E-4	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.40476	1.03;1.03	4.78	-1.49	0.08718	.	.	.	.	.	T	0.17619	0.0423	L	0.56340	1.77	0.38903	D	0.957367	P	0.47106	0.89	B	0.41723	0.365	T	0.10132	-1.0643	9	0.40728	T	0.16	.	5.6431	0.17575	0.1234:0.5367:0.0:0.3399	.	2016	P02549	SPTA1_HUMAN	H	2016;2013	ENSP00000357130:R2016H;ENSP00000357129:R2013H	ENSP00000357129:R2013H	R	-	2	0	SPTA1	156859470	0.999000	0.42202	0.633000	0.29310	0.020000	0.10135	0.741000	0.26202	-0.360000	0.08138	-0.136000	0.14681	CGC		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		117	305	0	0	0	0.00361	0	117	305				
SPTA1	6708	broad.mit.edu	37	1	158595971	158595971	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:158595971C>G	ENST00000368147.4	-	42	6055	c.5875G>C	c.(5875-5877)Gac>Cac	p.D1959H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1959					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.D1959H(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCACCAAGGTCTGCACCATTG	0.423																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(5875-5877)GAC>CAC		spectrin, alpha, erythrocytic 1							130.0	128.0	128.0					1																	158595971		1912	4120	6032	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158595971C>G	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5875G>C	1.37:g.158595971C>G	ENSP00000357129:p.Asp1959His						p.D1959H	NM_003126	NP_003117	P02549	SPTA1_HUMAN			42	6074	-	all_hematologic(112;0.0378)		1959			Spectrin 19.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.5875G>C	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.298603	0.60195	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.49432	0.78;0.78	4.93	4.02	0.46733	.	0.239639	0.21586	N	0.072176	T	0.62853	0.2462	M	0.83118	2.625	0.49798	D	0.99982	D	0.89917	1.0	D	0.97110	1.0	T	0.70382	-0.4887	10	0.87932	D	0	.	13.2455	0.60020	0.0:0.8394:0.1606:0.0	.	1959	P02549	SPTA1_HUMAN	H	1959;1956	ENSP00000357130:D1959H;ENSP00000357129:D1956H	ENSP00000357129:D1956H	D	-	1	0	SPTA1	156862595	0.998000	0.40836	0.971000	0.41717	0.683000	0.39861	4.076000	0.57591	1.312000	0.45043	-0.223000	0.12442	GAC		0.423	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		6	33	0	0	0	0.004482	0	6	33				
SPTA1	6708	broad.mit.edu	37	1	158617448	158617448	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:158617448G>A	ENST00000368147.4	-	27	3957	c.3777C>T	c.(3775-3777)gaC>gaT	p.D1259D		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1259					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.D1259D(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTCTCTGCAGGTCCTCAGTGG	0.537																																							uc001fst.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(3775-3777)GAC>GAT		spectrin, alpha, erythrocytic 1							86.0	86.0	86.0					1																	158617448		1969	4169	6138	SO:0001819	synonymous_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158617448G>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3777C>T	1.37:g.158617448G>A							p.D1259D	NM_003126	NP_003117	P02549	SPTA1_HUMAN			27	3976	-	all_hematologic(112;0.0378)		1259			Spectrin 12.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	c.3777C>T	CCDS41423.1																																																																																				0.537	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		4	75	0	0	0	0.000602	0	4	75				
OR6K6	128371	broad.mit.edu	37	1	158724939	158724939	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:158724939T>A	ENST00000368144.2	+	1	430	c.334T>A	c.(334-336)Tgc>Agc	p.C112S		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C112S(1)		endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					GATGCTGTCCTGCCTAATCAG	0.517																																							uc001fsw.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(334-336)TGC>AGC		olfactory receptor, family 6, subfamily K,							120.0	118.0	119.0					1																	158724939		2203	4300	6503	SO:0001583	missense	128371				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158724939T>A	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.334T>A	1.37:g.158724939T>A	ENSP00000357126:p.Cys112Ser						p.C112S	NM_001005184	NP_001005184	Q8NGW6	OR6K6_HUMAN			1	334	+	all_hematologic(112;0.0378)		112			Extracellular (Potential).		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	c.334T>A	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	T	7.671	0.686949	0.14973	.	.	ENSG00000180433	ENST00000368144	T	0.00381	7.63	5.48	1.73	0.24493	GPCR, rhodopsin-like superfamily (1);	0.433884	0.19487	N	0.113096	T	0.00012	0.0000	N	0.00077	-2.24	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.46775	-0.9167	10	0.41790	T	0.15	-1.6916	2.2371	0.04011	0.5151:0.1336:0.0747:0.2767	.	112	Q8NGW6	OR6K6_HUMAN	S	112	ENSP00000357126:C112S	ENSP00000357126:C112S	C	+	1	0	OR6K6	156991563	0.000000	0.05858	0.001000	0.08648	0.868000	0.49771	0.169000	0.16641	0.118000	0.18165	-0.339000	0.08088	TGC		0.517	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184		5	120	0	0	0	0.001168	0	5	120				
OR6N1	128372	broad.mit.edu	37	1	158736121	158736121	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:158736121T>C	ENST00000335094.2	-	1	371	c.352A>G	c.(352-354)Atg>Gtg	p.M118V		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M118V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					TCGTAGGCCATAGCTGTCAGG	0.507																																							uc010piq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(352-354)ATG>GTG		olfactory receptor, family 6, subfamily N,							58.0	60.0	59.0					1																	158736121		2203	4300	6503	SO:0001583	missense	128372				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158736121T>C	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.352A>G	1.37:g.158736121T>C	ENSP00000335535:p.Met118Val						p.M118V	NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN			1	352	-	all_hematologic(112;0.0378)		118			Helical; Name=3; (Potential).		Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	c.352A>G	CCDS30905.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.358780	0.61403	.	.	ENSG00000197403	ENST00000335094	T	0.00995	5.46	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000027	T	0.05777	0.0151	H	0.97131	3.945	0.35723	D	0.8173	D	0.59767	0.986	D	0.69654	0.965	T	0.01639	-1.1306	10	0.87932	D	0	-28.4588	13.9937	0.64382	0.0:0.0:0.0:1.0	.	118	Q8NGY5	OR6N1_HUMAN	V	118	ENSP00000335535:M118V	ENSP00000335535:M118V	M	-	1	0	OR6N1	157002745	1.000000	0.71417	0.987000	0.45799	0.956000	0.61745	5.852000	0.69488	2.119000	0.64992	0.533000	0.62120	ATG		0.507	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185		6	48	0	0	0	0.001168	0	6	48				
SLAMF8	56833	broad.mit.edu	37	1	159799686	159799686	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:159799686A>T	ENST00000289707.5	+	2	220	c.71A>T	c.(70-72)cAa>cTa	p.Q24L	SLAMF8_ENST00000368104.4_Intron	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	24					cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.Q24L(1)		endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					ACTGGTGCCCAAGTGCTGAGC	0.587																																							uc001fue.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(70-72)CAA>CTA		SLAM family member 8 precursor							89.0	98.0	95.0					1																	159799686		2203	4300	6503	SO:0001583	missense	56833					integral to membrane		g.chr1:159799686A>T	AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.71A>T	1.37:g.159799686A>T	ENSP00000289707:p.Gln24Leu						p.Q24L	NM_020125	NP_064510	Q9P0V8	SLAF8_HUMAN			2	281	+	all_hematologic(112;0.0597)		24			Extracellular (Potential).		Q32MC6|Q5VU15	Missense_Mutation	SNP	ENST00000289707.5	37	c.71A>T	CCDS1188.1	.	.	.	.	.	.	.	.	.	.	A	10.61	1.399570	0.25291	.	.	ENSG00000158714	ENST00000289707	T	0.06294	3.32	4.44	3.3	0.37823	.	5.464940	0.00879	U	0.002110	T	0.02267	0.0070	L	0.32530	0.975	0.80722	D	1	B	0.23058	0.079	B	0.20384	0.029	T	0.30966	-0.9960	10	0.27082	T	0.32	-0.8323	8.033	0.30476	0.7935:0.2065:0.0:0.0	.	24	Q9P0V8	SLAF8_HUMAN	L	24	ENSP00000289707:Q24L	ENSP00000289707:Q24L	Q	+	2	0	SLAMF8	158066310	0.430000	0.25538	0.781000	0.31783	0.459000	0.32528	2.019000	0.41001	0.726000	0.32339	-0.940000	0.02684	CAA		0.587	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085983.1	NM_020125		68	127	0	0	0	0.00361	0	68	127				
FCGR3A	2214	broad.mit.edu	37	1	161518430	161518430	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:161518430A>G	ENST00000436743.1	-	4	254	c.100T>C	c.(100-102)Tgg>Cgg	p.W34R	FCGR3A_ENST00000443193.1_Missense_Mutation_p.W69R|RP11-25K21.6_ENST00000537821.2_RNA|FCGR3A_ENST00000540048.1_Missense_Mutation_p.W34R|FCGR3A_ENST00000476031.1_5'UTR|FCGR3A_ENST00000367969.3_Missense_Mutation_p.W70R	NM_001127593.1|NM_001127595.1|NM_001127596.1	NP_001121065.1|NP_001121067.1|NP_001121068.1	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)	34	Ig-like C2-type 1.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.W70R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ACCCTGTACCATTGAGGCTCC	0.542																																							uc001gat.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(100-102)TGG>CGG		Fc fragment of IgG, low affinity IIIa, receptor	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						137.0	131.0	133.0					1																	161518430		2203	4300	6503	SO:0001583	missense	2214				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity	g.chr1:161518430A>G	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000436743.1:c.100T>C	1.37:g.161518430A>G	ENSP00000416607:p.Trp34Arg					FCGR3A_uc001gar.2_Missense_Mutation_p.W70R|FCGR3A_uc001gas.2_Missense_Mutation_p.W69R|FCGR3A_uc009wuh.2_Missense_Mutation_p.W33R|FCGR3A_uc009wui.2_Missense_Mutation_p.W34R	p.W34R	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)		4	237	-	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		34			Ig-like C2-type 1.|Extracellular (Potential).		A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000436743.1	37	c.100T>C	CCDS44266.1	.	.	.	.	.	.	.	.	.	.	A	15.87	2.961358	0.53400	.	.	ENSG00000203747	ENST00000367969;ENST00000443193;ENST00000436743;ENST00000367967;ENST00000540048;ENST00000442336	T;T;T;T;T;T	0.07327	3.2;3.2;3.2;3.2;3.2;3.2	4.43	4.43	0.53597	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.48286	D	0.000182	T	0.24736	0.0600	M	0.92691	3.335	0.32634	N	0.521587	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.28522	-1.0041	10	0.87932	D	0	.	10.2704	0.43479	1.0:0.0:0.0:0.0	.	34;69;34	P08637;E9PG94;Q9UPY7	FCG3A_HUMAN;.;.	R	70;69;34;34;34;33	ENSP00000356946:W70R;ENSP00000392047:W69R;ENSP00000416607:W34R;ENSP00000356944:W34R;ENSP00000444971:W34R;ENSP00000396567:W33R	ENSP00000356944:W34R	W	-	1	0	FCGR3A	159785054	0.104000	0.21937	0.433000	0.26760	0.008000	0.06430	2.573000	0.46007	1.989000	0.58080	0.482000	0.46254	TGG		0.542	FCGR3A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102169.2	NM_000569		35	117	0	0	0	0.004289	0	35	117				
GPA33	10223	broad.mit.edu	37	1	167032937	167032937	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:167032937C>A	ENST00000367868.3	-	4	796	c.453G>T	c.(451-453)gaG>gaT	p.E151D	GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	151	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.E151D(1)		endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						CAATTATGGTCTCTCCCTCGA	0.542																																							uc001gea.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(451-453)GAG>GAT		transmembrane glycoprotein A33 precursor							203.0	172.0	182.0					1																	167032937		2203	4300	6503	SO:0001583	missense	10223					integral to plasma membrane	receptor activity	g.chr1:167032937C>A	U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.453G>T	1.37:g.167032937C>A	ENSP00000356842:p.Glu151Asp						p.E151D	NM_005814	NP_005805	Q99795	GPA33_HUMAN			4	797	-			151			Ig-like C2-type.|Extracellular (Potential).		Q5VZP6	Missense_Mutation	SNP	ENST00000367868.3	37	c.453G>T	CCDS1258.1	.	.	.	.	.	.	.	.	.	.	C	9.139	1.013288	0.19277	.	.	ENSG00000143167	ENST00000367868	T	0.15834	2.39	5.64	0.787	0.18596	Immunoglobulin-like (1);	0.348773	0.32343	N	0.006228	T	0.07773	0.0195	L	0.49513	1.565	0.29679	N	0.841856	P	0.38617	0.64	P	0.48114	0.567	T	0.27872	-1.0061	10	0.18276	T	0.48	.	5.8175	0.18500	0.0:0.5056:0.2958:0.1986	.	151	Q99795	GPA33_HUMAN	D	151	ENSP00000356842:E151D	ENSP00000356842:E151D	E	-	3	2	GPA33	165299561	0.997000	0.39634	0.926000	0.36857	0.091000	0.18340	0.567000	0.23608	0.254000	0.21573	-0.376000	0.06991	GAG		0.542	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083245.1	NM_005814		13	181	1	0	0.000422831	0.004007	0.000472895	13	181				
SELP	6403	broad.mit.edu	37	1	169586542	169586542	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:169586542C>T	ENST00000263686.6	-	3	242	c.205G>A	c.(205-207)Gcc>Acc	p.A69T	SELP_ENST00000458599.2_Missense_Mutation_p.A69T|SELP_ENST00000367788.2_Missense_Mutation_p.A69T|SELP_ENST00000367792.2_Missense_Mutation_p.A69T|SELP_ENST00000367794.2_Missense_Mutation_p.A69T|SELP_ENST00000367793.2_Missense_Mutation_p.A69T|SELP_ENST00000367786.2_Missense_Mutation_p.A69T|SELP_ENST00000367791.2_Missense_Mutation_p.A69T	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	69	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.A69T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	TTCTGGATGGCCACTAAGTCT	0.413																																							uc001ggi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(205-207)GCC>ACC		selectin P precursor	Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)						171.0	158.0	163.0					1																	169586542		2203	4300	6503	SO:0001583	missense	6403				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding	g.chr1:169586542C>T	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.205G>A	1.37:g.169586542C>T	ENSP00000263686:p.Ala69Thr					SELP_uc001ggh.2_5'UTR|SELP_uc009wvr.2_Missense_Mutation_p.A69T	p.A69T	NM_003005	NP_002996	P16109	LYAM3_HUMAN			3	270	-	all_hematologic(923;0.208)		69			Extracellular (Potential).|C-type lectin.		Q5R344|Q8IVD1	Missense_Mutation	SNP	ENST00000263686.6	37	c.205G>A	CCDS1282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.4|22.4	4.290369|4.290369	0.80914|0.80914	.|.	.|.	ENSG00000174175|ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367788;ENST00000367786;ENST00000458599|ENST00000446728	T;T;T;T;T;T;T|.	0.17854|.	2.25;2.25;2.25;2.25;2.25;2.25;2.25|.	5.9|5.9	5.9|5.9	0.94986|0.94986	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);|.	0.115199|.	0.38897|.	N|.	0.001522|.	T|T	0.65439|0.65439	0.2691|0.2691	L|L	0.57130|0.57130	1.785|1.785	0.58432|0.58432	D|D	0.99999|0.99999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.61501|0.61501	-0.7050|-0.7050	10|5	0.25751|.	T|.	0.34|.	-22.1104|-22.1104	17.7661|17.7661	0.88478|0.88478	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	69;69|.	Q6NUL9;P16109|.	.;LYAM3_HUMAN|.	T|D	69;69;68;69;69;69;69;69;69;69;69;69;54|68	ENSP00000263686:A69T;ENSP00000356767:A69T;ENSP00000356768:A69T;ENSP00000356766:A69T;ENSP00000356765:A69T;ENSP00000356762:A69T;ENSP00000356760:A69T|.	ENSP00000263686:A69T|.	A|G	-|-	1|2	0|0	SELP|SELP	167853166|167853166	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.298000|0.298000	0.27526|0.27526	7.487000|7.487000	0.81328|0.81328	2.793000|2.793000	0.96121|0.96121	0.563000|0.563000	0.77884|0.77884	GCC|GGC		0.413	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005		56	136	0	0	0	0.00361	0	56	136				
C1orf112	55732	broad.mit.edu	37	1	169798428	169798428	+	Missense_Mutation	SNP	C	C	G	rs370645133		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:169798428C>G	ENST00000286031.6	+	13	1852	c.1152C>G	c.(1150-1152)ttC>ttG	p.F384L	C1orf112_ENST00000359326.4_Missense_Mutation_p.F384L|C1orf112_ENST00000413811.2_Missense_Mutation_p.S312C|C1orf112_ENST00000498289.1_3'UTR	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	384								p.F384L(1)		breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AAGCCGTTTTCTACAGTTTTG	0.373																																							uc001ggp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1150-1152)TTC>TTG		hypothetical protein LOC55732		C	LEU/PHE	1,4405	2.1+/-5.4	0,1,2202	133.0	131.0	132.0		1152	3.8	1.0	1		132	0,8600		0,0,4300	no	missense	C1orf112	NM_018186.2	22	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	probably-damaging	384/854	169798428	1,13005	2203	4300	6503	SO:0001583	missense	55732							g.chr1:169798428C>G	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.1152C>G	1.37:g.169798428C>G	ENSP00000286031:p.Phe384Leu					C1orf112_uc001ggj.2_RNA|C1orf112_uc001ggq.2_Missense_Mutation_p.F384L|C1orf112_uc009wvt.2_Missense_Mutation_p.F61L|C1orf112_uc010plu.1_Missense_Mutation_p.S312C|C1orf112_uc009wvu.1_Missense_Mutation_p.F260L|C1orf112_uc001ggr.2_Missense_Mutation_p.F249L|C1orf112_uc010plv.1_Missense_Mutation_p.F326L	p.F384L	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN			14	1462	+	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		384					A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	ENST00000286031.6	37	c.1152C>G	CCDS1285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.5|23.5	4.425923|4.425923	0.83667|0.83667	2.27E-4|2.27E-4	0.0|0.0	ENSG00000000460|ENSG00000000460	ENST00000359326;ENST00000286031|ENST00000413811	T;T|T	0.67865|0.47528	-0.29;-0.29|0.84	5.78|5.78	3.79|3.79	0.43588|0.43588	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.50463|0.50463	0.1617|0.1617	M|M	0.78637|0.78637	2.42|2.42	0.18873|0.18873	N|N	0.999986|0.999986	D;D|D	0.89917|0.65815	1.0;1.0|0.995	D;D|P	0.87578|0.60415	0.998;0.998|0.874	T|T	0.43278|0.43278	-0.9401|-0.9401	10|9	0.87932|0.72032	D|D	0|0.01	-17.7221|-17.7221	9.0246|9.0246	0.36220|0.36220	0.0:0.8097:0.0:0.1903|0.0:0.8097:0.0:0.1903	.|.	326;384|312	B4DGF2;Q9NSG2|B4E0A9	.;CA112_HUMAN|.	L|C	384|312	ENSP00000352276:F384L;ENSP00000286031:F384L|ENSP00000389257:S312C	ENSP00000286031:F384L|ENSP00000389257:S312C	F|S	+|+	3|2	2|0	C1orf112|C1orf112	168065052|168065052	0.392000|0.392000	0.25229|0.25229	0.998000|0.998000	0.56505|0.56505	0.973000|0.973000	0.67179|0.67179	0.781000|0.781000	0.26774|0.26774	1.307000|1.307000	0.44944|0.44944	0.563000|0.563000	0.77884|0.77884	TTC|TCT		0.373	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186		4	54	0	0	0	0.009096	0	4	54				
TNR	7143	broad.mit.edu	37	1	175372466	175372466	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:175372466C>T	ENST00000367674.2	-	4	1494	c.786G>A	c.(784-786)agG>agA	p.R262R	TNR_ENST00000263525.2_Silent_p.R262R			Q92752	TENR_HUMAN	tenascin R	262	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.R262R(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					ACCTCAGTTCCCTGCAGTCCT	0.637																																							uc001gkp.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(784-786)AGG>AGA		tenascin R precursor							121.0	83.0	95.0					1																	175372466		2203	4300	6503	SO:0001819	synonymous_variant	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175372466C>T	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.786G>A	1.37:g.175372466C>T						TNR_uc009wwu.1_Silent_p.R262R|TNR_uc010pmz.1_Silent_p.R262R	p.R262R	NM_003285	NP_003276	Q92752	TENR_HUMAN			2	867	-	Renal(580;0.146)		262			Cys-rich.		C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	c.786G>A	CCDS1318.1																																																																																				0.637	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		13	35	0	0	0	0.001855	0	13	35				
PAPPA2	60676	broad.mit.edu	37	1	176525707	176525707	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:176525707C>A	ENST00000367662.3	+	2	1413	c.249C>A	c.(247-249)ccC>ccA	p.P83P	PAPPA2_ENST00000367661.3_Silent_p.P83P	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	83					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P83P(4)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGCCCTACCCCGTGGGGGAGC	0.562																																							uc001gkz.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(247-249)CCC>CCA		pappalysin 2 isoform 1							128.0	121.0	123.0					1																	176525707		1953	4138	6091	SO:0001819	synonymous_variant	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176525707C>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.249C>A	1.37:g.176525707C>A						PAPPA2_uc001gky.1_Silent_p.P83P|PAPPA2_uc009www.2_RNA	p.P83P	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			2	1413	+			83					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	37	c.249C>A	CCDS41438.1																																																																																				0.562	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			74	151	1	0	1.52589e-26	0.00361	2.53349e-26	74	151				
PAPPA2	60676	broad.mit.edu	37	1	176564446	176564446	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:176564446T>A	ENST00000367662.3	+	3	2870	c.1706T>A	c.(1705-1707)gTc>gAc	p.V569D	PAPPA2_ENST00000367661.3_Missense_Mutation_p.V569D	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	569	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V569D(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CAGCTGAGCGTCCACCAGGTC	0.572																																							uc001gkz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(1705-1707)GTC>GAC		pappalysin 2 isoform 1							84.0	87.0	86.0					1																	176564446		2140	4241	6381	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176564446T>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1706T>A	1.37:g.176564446T>A	ENSP00000356634:p.Val569Asp					PAPPA2_uc001gky.1_Missense_Mutation_p.V569D|PAPPA2_uc009www.2_RNA	p.V569D	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			3	2870	+			569			Metalloprotease.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.1706T>A	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.942747	0.73672	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.41758	0.99;0.99	5.11	3.98	0.46160	.	0.472525	0.20997	N	0.081922	T	0.57021	0.2025	M	0.79258	2.445	0.53688	D	0.999975	P;D	0.62365	0.923;0.991	P;P	0.55871	0.714;0.786	T	0.60281	-0.7294	10	0.87932	D	0	-4.6024	10.5164	0.44892	0.0:0.0772:0.0:0.9228	.	569;569	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	D	569	ENSP00000356634:V569D;ENSP00000356633:V569D	ENSP00000356633:V569D	V	+	2	0	PAPPA2	174831069	0.725000	0.28048	0.514000	0.27761	0.824000	0.46624	4.131000	0.57970	0.787000	0.33731	0.455000	0.32223	GTC		0.572	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			11	66	0	0	0	0.008291	0	11	66				
ASTN1	460	broad.mit.edu	37	1	176915133	176915133	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:176915133C>A	ENST00000367654.3	-	13	2413	c.2202G>T	c.(2200-2202)ggG>ggT	p.G734G	ASTN1_ENST00000424564.2_Silent_p.G726G|ASTN1_ENST00000361833.2_Silent_p.G726G|ASTN1_ENST00000367657.3_Silent_p.G726G|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	734					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.G726G(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AGAACATCTCCCCAAAGAGGG	0.502																																							uc001glc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(2176-2178)GGG>GGT		astrotactin isoform 1							118.0	117.0	117.0					1																	176915133		2203	4300	6503	SO:0001819	synonymous_variant	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176915133C>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2202G>T	1.37:g.176915133C>A						ASTN1_uc001glb.1_Silent_p.G726G|ASTN1_uc001gld.1_Silent_p.G726G|ASTN1_uc009wwx.1_Silent_p.G726G	p.G726G	NM_004319	NP_004310	O14525	ASTN1_HUMAN			13	2390	-			734					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	37	c.2178G>T																																																																																					0.502	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		24	98	1	0	1.85244e-09	0.00333	2.5794e-09	24	98				
TOR1AIP2	163590	broad.mit.edu	37	1	179820017	179820017	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:179820017C>A	ENST00000367612.3	-	4	903	c.516G>T	c.(514-516)gaG>gaT	p.E172D	TOR1AIP2_ENST00000609928.1_Missense_Mutation_p.E172D	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0								p.E172D(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						TATCCTCACCCTCTTGCCCTG	0.552																																							uc001gnk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(514-516)GAG>GAT		torsin A interacting protein 2							100.0	100.0	100.0					1																	179820017		2203	4300	6503	SO:0001583	missense	163590					endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr1:179820017C>A		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.516G>T	1.37:g.179820017C>A	ENSP00000356584:p.Glu172Asp					TOR1AIP2_uc001gnl.2_Missense_Mutation_p.E172D	p.E172D	NM_145034	NP_659471	Q8NFQ8	TOIP2_HUMAN			4	904	-			172					Q05BU2	Missense_Mutation	SNP	ENST00000367612.3	37	c.516G>T	CCDS1334.1	.	.	.	.	.	.	.	.	.	.	C	9.244	1.039086	0.19669	.	.	ENSG00000169905	ENST00000367612	T	0.23754	1.89	5.11	1.98	0.26296	.	0.592008	0.15242	N	0.272845	T	0.20088	0.0483	L	0.57536	1.79	0.09310	N	1	B	0.16603	0.018	B	0.20184	0.028	T	0.26395	-1.0104	10	0.16896	T	0.51	-3.6787	4.0192	0.09657	0.0:0.5488:0.2266:0.2246	.	172	Q8NFQ8	TOIP2_HUMAN	D	172	ENSP00000356584:E172D	ENSP00000356584:E172D	E	-	3	2	TOR1AIP2	178086640	0.002000	0.14202	0.058000	0.19502	0.160000	0.22226	0.304000	0.19228	0.702000	0.31825	0.563000	0.77884	GAG		0.552	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034		35	81	1	0	4.65686e-17	0.003755	7.26595e-17	35	81				
QSOX1	5768	broad.mit.edu	37	1	180158700	180158700	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:180158700G>T	ENST00000367602.3	+	9	1105	c.1031G>T	c.(1030-1032)cGg>cTg	p.R344L	QSOX1_ENST00000367600.5_Missense_Mutation_p.R344L			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	344					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)	p.R344L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						TTCCCTGGCCGGCCCTTAGTC	0.502																																							uc001gnz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1030-1032)CGG>CTG		quiescin Q6 sulfhydryl oxidase 1 isoform a							119.0	126.0	124.0					1																	180158700		2203	4300	6503	SO:0001583	missense	5768				cell redox homeostasis|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity	g.chr1:180158700G>T	U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.1031G>T	1.37:g.180158700G>T	ENSP00000356574:p.Arg344Leu					QSOX1_uc001gny.2_Missense_Mutation_p.R344L|QSOX1_uc001goa.2_Missense_Mutation_p.R344L	p.R344L	NM_002826	NP_002817	O00391	QSOX1_HUMAN			9	1106	+			344					Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	ENST00000367602.3	37	c.1031G>T	CCDS1337.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.730131	0.69074	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.16897	3.54;2.31	5.2	-3.58	0.04597	.	0.424875	0.28354	N	0.015645	T	0.26810	0.0656	M	0.71036	2.16	0.38745	D	0.953986	D;P;D	0.64830	0.99;0.552;0.994	P;B;P	0.57283	0.661;0.146;0.817	T	0.12578	-1.0542	10	0.51188	T	0.08	-3.7821	8.8848	0.35396	0.2915:0.1418:0.5667:0.0	.	344;344;344	A8K477;O00391;O00391-2	.;QSOX1_HUMAN;.	L	344	ENSP00000356574:R344L;ENSP00000356572:R344L	ENSP00000356572:R344L	R	+	2	0	QSOX1	178425323	1.000000	0.71417	0.983000	0.44433	0.751000	0.42716	0.626000	0.24492	-0.501000	0.06605	-1.326000	0.01283	CGG		0.502	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085289.1	NM_002826		10	270	1	0	6.40141e-05	0.010729	7.44523e-05	10	270				
CACNA1E	777	broad.mit.edu	37	1	181763998	181763998	+	Splice_Site	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:181763998A>T	ENST00000367573.2	+	46	6027		c.e46-1		CACNA1E_ENST00000358338.5_Splice_Site|CACNA1E_ENST00000367570.1_Splice_Site|CACNA1E_ENST00000360108.3_Splice_Site|CACNA1E_ENST00000367567.4_Splice_Site|CACNA1E_ENST00000357570.5_Splice_Site|CACNA1E_ENST00000526775.1_Splice_Site	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit						calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.?(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTGTATTTCCAGGTGGTGACA	0.453																																							uc001gow.2		NA																	2	Unknown(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.e45-2		calcium channel, voltage-dependent, R type,							64.0	60.0	61.0					1																	181763998		1919	4136	6055	SO:0001630	splice_region_variant	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181763998A>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6028-1A>T	1.37:g.181763998A>T						CACNA1E_uc009wxs.2_Splice_Site_p.V1855_splice|CACNA1E_uc009wxt.2_Splice_Site_p.V1236_splice	p.V1967_splice	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			45	6064	+								B1AM12|B1AM13|B1AM14|Q14580|Q14581	Splice_Site	SNP	ENST00000367573.2	37	c.5899_splice	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.257593	0.80246	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0098	0.80391	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1E	180030621	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	4.929000	0.63455	2.254000	0.74563	0.533000	0.62120	.		0.453	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	Intron	8	55	0	0	0	0.00308	0	8	55				
KCNT2	343450	broad.mit.edu	37	1	196227561	196227561	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:196227561G>C	ENST00000294725.9	-	26	3889	c.2974C>G	c.(2974-2976)Cac>Gac	p.H992D	KCNT2_ENST00000367433.5_Missense_Mutation_p.H968D|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.H925D|KCNT2_ENST00000367431.4_Missense_Mutation_p.H926D			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	992					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.H992D(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TTGCTGCGGTGGTGCCCTTGT	0.453																																							uc001gtd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(1)|skin(1)	7						c.(2974-2976)CAC>GAC		potassium channel, subfamily T, member 2							220.0	180.0	193.0					1																	196227561		2203	4300	6503	SO:0001583	missense	343450					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr1:196227561G>C	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2974C>G	1.37:g.196227561G>C	ENSP00000294725:p.His992Asp					KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.H925D|KCNT2_uc001gtf.1_Missense_Mutation_p.H968D|KCNT2_uc001gtg.1_RNA|KCNT2_uc001gth.1_Missense_Mutation_p.H496D	p.H992D	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN			26	3034	-			992			Cytoplasmic (Potential).		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	c.2974C>G	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	4.401	0.074018	0.08485	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.17054	2.3;2.32;2.57	5.74	5.74	0.90152	.	0.095453	0.46145	D	0.000301	T	0.06188	0.0160	N	0.03608	-0.345	0.80722	D	1	B;B;B;B	0.10296	0.003;0.003;0.003;0.002	B;B;B;B	0.08055	0.003;0.002;0.003;0.001	T	0.40459	-0.9562	10	0.11794	T	0.64	-11.9783	6.0268	0.19660	0.1122:0.0:0.7028:0.185	.	957;968;925;992	Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	D	968;926;992	ENSP00000356403:H968D;ENSP00000356401:H926D;ENSP00000294725:H992D	ENSP00000294725:H992D	H	-	1	0	KCNT2	194494184	0.997000	0.39634	1.000000	0.80357	0.902000	0.53008	2.009000	0.40903	2.710000	0.92621	0.643000	0.83706	CAC		0.453	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		39	126	0	0	0	0.009718	0	39	126				
KCNT2	343450	broad.mit.edu	37	1	196395074	196395074	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:196395074C>A	ENST00000294725.9	-	11	1944	c.1029G>T	c.(1027-1029)caG>caT	p.Q343H	KCNT2_ENST00000367433.5_Missense_Mutation_p.Q343H|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000609185.1_Missense_Mutation_p.Q343H|KCNT2_ENST00000367431.4_Missense_Mutation_p.Q343H			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	343					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.Q343H(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CCCTTCGAACCTGTACATCCA	0.373																																							uc001gtd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(1)|skin(1)	7						c.(1027-1029)CAG>CAT		potassium channel, subfamily T, member 2							138.0	122.0	128.0					1																	196395074		2203	4300	6503	SO:0001583	missense	343450					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr1:196395074C>A	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1029G>T	1.37:g.196395074C>A	ENSP00000294725:p.Gln343His					KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.Q343H|KCNT2_uc001gtf.1_Missense_Mutation_p.Q343H|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Missense_Mutation_p.Q343H|KCNT2_uc009wyv.1_Missense_Mutation_p.Q318H	p.Q343H	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN			11	1089	-			343			Cytoplasmic (Potential).		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	c.1029G>T	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.505290	0.64410	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000294725	T;T;T	0.70399	-0.48;-0.48;-0.48	5.64	-2.84	0.05751	NAD(P)-binding domain (1);	0.000000	0.64402	D	0.000008	T	0.72938	0.3523	L	0.50333	1.59	0.80722	D	1	D;D;P;D	0.60575	0.987;0.988;0.933;0.987	P;P;P;P	0.60117	0.663;0.869;0.77;0.663	T	0.73613	-0.3927	10	0.66056	D	0.02	-18.4525	12.3646	0.55222	0.0:0.6124:0.0:0.3876	.	343;343;343;343	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	H	343;343;164;343	ENSP00000356403:Q343H;ENSP00000356401:Q343H;ENSP00000294725:Q343H	ENSP00000294725:Q343H	Q	-	3	2	KCNT2	194661697	0.633000	0.27181	0.993000	0.49108	0.962000	0.63368	-0.117000	0.10708	-0.310000	0.08766	-0.247000	0.11927	CAG		0.373	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		10	33	1	0	0.000978159	0.010729	0.00107844	10	33				
PTPRC	5788	broad.mit.edu	37	1	198725263	198725263	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:198725263C>A	ENST00000367376.2	+	33	4039	c.3868C>A	c.(3868-3870)Cat>Aat	p.H1290N	PTPRC_ENST00000352140.3_Missense_Mutation_p.H1242N|PTPRC_ENST00000594404.1_Missense_Mutation_p.H1129N|PTPRC_ENST00000348564.6_Missense_Mutation_p.H1131N|PTPRC_ENST00000442510.2_Missense_Mutation_p.H1292N	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1290					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.H1290N(1)		breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						GGGGCCAGAACATTCTGTCAA	0.448																																							uc001gur.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						c.(3868-3870)CAT>AAT		protein tyrosine phosphatase, receptor type, C							58.0	59.0	59.0					1																	198725263		2203	4300	6503	SO:0001583	missense	5788				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:198725263C>A	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.3868C>A	1.37:g.198725263C>A	ENSP00000356346:p.His1290Asn					PTPRC_uc001gus.1_Missense_Mutation_p.H1242N|PTPRC_uc001gut.1_Missense_Mutation_p.H1129N	p.H1290N	NM_002838	NP_002829	P08575	PTPRC_HUMAN			33	4048	+			1290			Cytoplasmic (Potential).		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37	c.3868C>A		.	.	.	.	.	.	.	.	.	.	C	3.336	-0.135640	0.06711	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	T	0.02656	4.21	5.85	1.03	0.20045	.	0.597729	0.15054	N	0.283128	T	0.03053	0.0090	M	0.62723	1.935	0.24793	N	0.992745	B;B;B	0.13145	0.004;0.004;0.007	B;B;B	0.11329	0.006;0.006;0.004	T	0.44065	-0.9352	10	0.27082	T	0.32	.	1.1726	0.01829	0.4451:0.234:0.1051:0.2158	.	1131;1242;1290	B1ALS3;E9PC28;P08575	.;.;PTPRC_HUMAN	N	1292;1242;1290;1129	ENSP00000193532:H1242N	ENSP00000306782:H1129N	H	+	1	0	PTPRC	196991886	0.442000	0.25633	0.502000	0.27614	0.143000	0.21401	0.396000	0.20867	0.206000	0.20587	0.557000	0.71058	CAT		0.448	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				16	18	1	0	1.67942e-08	0.006122	2.27502e-08	16	18				
SHISA4	149345	broad.mit.edu	37	1	201860534	201860534	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:201860534G>T	ENST00000362011.6	+	4	672	c.385G>T	c.(385-387)Gag>Tag	p.E129*	RP11-307B6.3_ENST00000414927.1_RNA|SHISA4_ENST00000464117.1_3'UTR	NM_198149.2	NP_937792.2	Q96DD7	SHSA4_HUMAN	shisa family member 4	129						integral component of membrane (GO:0016021)		p.E129*(1)		kidney(1)|lung(4)	5						TCTAGGCCAGGAGATTCCAAT	0.587																																							uc001gxa.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(385-387)GAG>TAG		shisa homolog 4 precursor							110.0	109.0	109.0					1																	201860534		2203	4300	6503	SO:0001587	stop_gained	149345					integral to membrane		g.chr1:201860534G>T	AY358589	CCDS1416.1	1q32.1	2013-07-31	2013-07-31	2008-04-01	ENSG00000198892	ENSG00000198892		"""Shisa homologs"""	27139	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 40"", ""transmembrane protein 58"", ""shisa homolog 4 (Xenopus laevis)"""	C1orf40, TMEM58		12975309	Standard	NR_030775		Approved	hShisa4	uc001gxa.3	Q96DD7	OTTHUMG00000035807	ENST00000362011.6:c.385G>T	1.37:g.201860534G>T	ENSP00000355064:p.Glu129*						p.E129*	NM_198149	NP_937792	Q96DD7	SHSA4_HUMAN			4	476	+			129			Cytoplasmic (Potential).		B4DFI0|B7ZAJ7|Q5VUU1|Q6P711|Q6UWY7	Nonsense_Mutation	SNP	ENST00000362011.6	37	c.385G>T	CCDS1416.1	.	.	.	.	.	.	.	.	.	.	G	36	5.899621	0.97081	.	.	ENSG00000198892	ENST00000362011	.	.	.	5.17	4.26	0.50523	.	0.463487	0.24424	N	0.038654	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-6.057	9.6724	0.40019	0.0972:0.0:0.9028:0.0	.	.	.	.	X	129	.	ENSP00000355064:E129X	E	+	1	0	SHISA4	200127157	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.782000	0.55401	1.172000	0.42781	0.561000	0.74099	GAG		0.587	SHISA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087096.1	NM_198149		41	67	1	0	6.61955e-31	0.00361	1.11228e-30	41	67				
CNTN2	6900	broad.mit.edu	37	1	205042200	205042201	+	Missense_Mutation	DNP	TG	TG	CT	rs191122323		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:205042200_205042201TG>CT	ENST00000331830.4	+	22	3133_3134	c.2849_2850TG>CT	c.(2848-2850)cTG>cCT	p.L950P		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	950	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.L950P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCACAGATGCTGTACCAGAATG	0.54																																					Melanoma(183;2548 2817 37099 41192)	Melanoma(183;2548 2817 37099 41192)	uc001hbr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2848-2850)CTG>CCT		contactin 2 precursor																																				SO:0001583	missense	6900				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding	g.chr1:205042200_205042201TG>CT	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	Exception_encountered	1.37:g.205042200_205042201delinsCT	ENSP00000330633:p.Leu950Pro					CNTN2_uc001hbs.2_Missense_Mutation_p.L738P	p.L950P	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		22	3118_3119	+	all_cancers(21;0.144)|Breast(84;0.0437)		950			Fibronectin type-III 4.		P78432|Q5T054	Missense_Mutation	DNP	ENST00000331830.4	37	c.2849_2850TG>CT	CCDS1449.1																																																																																				0.540	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076		5	26	0	0	0	0.004672	0	5	26				
CR1L	1379	broad.mit.edu	37	1	207867945	207867945	+	Silent	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:207867945T>C	ENST00000508064.2	+	5	771	c.711T>C	c.(709-711)aaT>aaC	p.N237N	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	237	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)		p.N245N(1)|p.N237N(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						ATGTGGAAAATGGAATATTGG	0.463																																							uc001hga.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(709-711)AAT>AAC		complement component (3b/4b) receptor 1-like							187.0	181.0	183.0					1																	207867945		1855	4095	5950	SO:0001819	synonymous_variant	1379					cytoplasm|extracellular region|membrane		g.chr1:207867945T>C	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.711T>C	1.37:g.207867945T>C						CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	p.N237N	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN			5	832	+			237			Sushi 4.		Q32MC9|Q8NEU7	Silent	SNP	ENST00000508064.2	37	c.711T>C	CCDS44310.1																																																																																				0.463	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735		91	316	0	0	0	0.00361	0	91	316				
URB2	9816	broad.mit.edu	37	1	229772435	229772435	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:229772435G>T	ENST00000258243.2	+	4	2211	c.2075G>T	c.(2074-2076)cGg>cTg	p.R692L		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	692						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						ACTAGTTTCCGGTCTGAAGGA	0.443																																							uc001hts.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(2074-2076)CGG>CTG		URB2 ribosome biogenesis 2 homolog							136.0	146.0	143.0					1																	229772435		2203	4300	6503	SO:0001583	missense	9816					nucleolus		g.chr1:229772435G>T	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2075G>T	1.37:g.229772435G>T	ENSP00000258243:p.Arg692Leu					URB2_uc009xfd.1_Missense_Mutation_p.R692L	p.R692L	NM_014777	NP_055592	Q14146	URB2_HUMAN			4	2211	+			692					Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	c.2075G>T	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	G	2.812	-0.246698	0.05867	.	.	ENSG00000135763	ENST00000258243	T	0.28454	1.61	5.12	-8.21	0.01041	.	1.445370	0.04002	N	0.296620	T	0.10895	0.0266	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14476	-1.0471	9	.	.	.	0.5456	2.0631	0.03596	0.2081:0.1951:0.385:0.2118	.	692	Q14146	URB2_HUMAN	L	692	ENSP00000258243:R692L	.	R	+	2	0	URB2	227839058	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	0.156000	0.16382	-1.351000	0.02197	-1.105000	0.02106	CGG		0.443	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777		131	262	1	0	6.47804e-62	0.00361	1.11806e-61	131	262				
GGPS1	9453	broad.mit.edu	37	1	235505515	235505515	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:235505515G>T	ENST00000282841.5	+	4	563	c.331G>T	c.(331-333)Gca>Tca	p.A111S	GGPS1_ENST00000391855.2_Missense_Mutation_p.A57S|GGPS1_ENST00000358966.2_Missense_Mutation_p.A111S|GGPS1_ENST00000488594.1_Missense_Mutation_p.A111S|GGPS1_ENST00000476121.1_Missense_Mutation_p.A111S			O95749	GGPPS_HUMAN	geranylgeranyl diphosphate synthase 1	111					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|geranylgeranyl diphosphate biosynthetic process (GO:0033386)|isoprenoid metabolic process (GO:0006720)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	dimethylallyltranstransferase activity (GO:0004161)|farnesyltranstransferase activity (GO:0004311)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)	p.A111S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	8	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;1.39e-05)		Zoledronate(DB00399)	TCACCCAGATGCAGTGAAGCT	0.448																																							uc001hwv.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(331-333)GCA>TCA		geranylgeranyl diphosphate synthase 1 isoform A							61.0	58.0	59.0					1																	235505515		2203	4300	6503	SO:0001583	missense	9453				cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	dimethylallyltranstransferase activity|farnesyltranstransferase activity|geranyltranstransferase activity|metal ion binding	g.chr1:235505515G>T	AB016043	CCDS1604.1	1q43	2010-04-27			ENSG00000152904	ENSG00000152904	2.5.1.1, 2.5.1.10, 2.5.1.29		4249	protein-coding gene	gene with protein product		606982				9741684, 10101267	Standard	NR_036605		Approved	GGPPS1	uc001hwv.3	O95749	OTTHUMG00000037963	ENST00000282841.5:c.331G>T	1.37:g.235505515G>T	ENSP00000282841:p.Ala111Ser					GGPS1_uc001hww.2_Missense_Mutation_p.A111S|GGPS1_uc001hwx.2_Missense_Mutation_p.A57S|GGPS1_uc001hwy.2_Missense_Mutation_p.A111S	p.A111S	NM_001037277	NP_001032354	O95749	GGPPS_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;1.39e-05)		4	415	+	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	111					A8MVQ8|Q5T2C8|Q6NW19	Missense_Mutation	SNP	ENST00000282841.5	37	c.331G>T	CCDS1604.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.748442	0.89753	.	.	ENSG00000152904	ENST00000488594;ENST00000471812;ENST00000358966;ENST00000282841;ENST00000391855;ENST00000476121;ENST00000497327	T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	6.17	6.17	0.99709	Terpenoid synthase (2);	0.000000	0.85682	D	0.000000	T	0.79263	0.4416	M	0.76002	2.32	0.80722	D	1	P	0.46457	0.878	P	0.59487	0.858	T	0.77381	-0.2609	10	0.56958	D	0.05	-19.6619	20.8794	0.99867	0.0:0.0:1.0:0.0	.	111	O95749	GGPPS_HUMAN	S	111;111;111;111;57;111;111	ENSP00000418690:A111S;ENSP00000417772:A111S;ENSP00000351852:A111S;ENSP00000282841:A111S;ENSP00000375728:A57S;ENSP00000420183:A111S;ENSP00000417865:A111S	ENSP00000282841:A111S	A	+	1	0	GGPS1	233572138	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.941000	0.99782	0.655000	0.94253	GCA		0.448	GGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092656.1	NM_004837		10	41	1	0	0.00621372	0.006214	0.00663113	10	41				
RYR2	6262	broad.mit.edu	37	1	237711773	237711773	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:237711773G>A	ENST00000366574.2	+	26	3266	c.2949G>A	c.(2947-2949)ctG>ctA	p.L983L	RYR2_ENST00000542537.1_Silent_p.L967L|RYR2_ENST00000360064.6_Silent_p.L981L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	983	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.L981L(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTATGGACCTGAGCTTTATCA	0.453																																							uc001hyl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(2947-2949)CTG>CTA		cardiac muscle ryanodine receptor							57.0	54.0	55.0					1																	237711773		1895	4114	6009	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237711773G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2949G>A	1.37:g.237711773G>A							p.L983L	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		26	3069	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	983			Cytoplasmic (By similarity).|2.|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.2949G>A	CCDS55691.1																																																																																				0.453	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		15	17	0	0	0	0.003163	0	15	17				
RYR2	6262	broad.mit.edu	37	1	237875121	237875121	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:237875121A>T	ENST00000366574.2	+	71	10624	c.10307A>T	c.(10306-10308)aAg>aTg	p.K3436M	RYR2_ENST00000542537.1_Missense_Mutation_p.K3420M|RYR2_ENST00000360064.6_Missense_Mutation_p.K3434M|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3436					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.K3434M(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACTGATACCAAGTCAAAGATG	0.303																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(10306-10308)AAG>ATG		cardiac muscle ryanodine receptor							48.0	48.0	48.0					1																	237875121		1831	4073	5904	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237875121A>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10307A>T	1.37:g.237875121A>T	ENSP00000355533:p.Lys3436Met					RYR2_uc010pxz.1_Missense_Mutation_p.K391M	p.K3436M	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		71	10427	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3436					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.10307A>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.106273	0.56291	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96992	-4.2;-4.17;-4.2	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000006	D	0.97639	0.9226	M	0.75447	2.3	0.80722	D	1	D	0.76494	0.999	D	0.66497	0.944	D	0.98423	1.0578	10	0.87932	D	0	-12.1047	15.093	0.72211	1.0:0.0:0.0:0.0	.	3436	Q92736	RYR2_HUMAN	M	3436;3434;3420;391	ENSP00000355533:K3436M;ENSP00000353174:K3434M;ENSP00000443798:K3420M	ENSP00000353174:K3434M	K	+	2	0	RYR2	235941744	1.000000	0.71417	1.000000	0.80357	0.612000	0.37316	7.292000	0.78731	1.973000	0.57446	0.482000	0.46254	AAG		0.303	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		8	19	0	0	0	0.006214	0	8	19				
NLRP3	114548	broad.mit.edu	37	1	247587738	247587738	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:247587738C>T	ENST00000336119.3	+	3	1739	c.993C>T	c.(991-993)ctC>ctT	p.L331L	NLRP3_ENST00000366496.2_Silent_p.L331L|NLRP3_ENST00000366497.2_Silent_p.L331L|NLRP3_ENST00000348069.2_Silent_p.L331L|NLRP3_ENST00000391827.2_Silent_p.L331L|NLRP3_ENST00000391828.3_Silent_p.L331L|NLRP3_ENST00000474792.1_3'UTR	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	331	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.L331L(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GAGACATTCTCCTGAGCAGCC	0.582																																							uc001icr.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(991-993)CTC>CTT		NLR family, pyrin domain containing 3 isoform a							57.0	59.0	58.0					1																	247587738		2203	4300	6503	SO:0001819	synonymous_variant	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247587738C>T	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.993C>T	1.37:g.247587738C>T						NLRP3_uc001ics.2_Silent_p.L331L|NLRP3_uc001icu.2_Silent_p.L331L|NLRP3_uc001icw.2_Silent_p.L331L|NLRP3_uc001icv.2_Silent_p.L331L|NLRP3_uc010pyw.1_Silent_p.L329L|NLRP3_uc001ict.1_Silent_p.L329L	p.L331L	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	1131	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	331			NACHT.		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	37	c.993C>T	CCDS1632.1																																																																																				0.582	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		22	63	0	0	0	0.012319	0	22	63				
OR2B11	127623	broad.mit.edu	37	1	247614592	247614592	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:247614592C>A	ENST00000318749.6	-	1	716	c.693G>T	c.(691-693)agG>agT	p.R231S		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R231S(1)		endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			AGGACTGGATCCTGAGCACTG	0.547																																							uc010pyx.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(691-693)AGG>AGT		olfactory receptor, family 2, subfamily B,							105.0	102.0	103.0					1																	247614592		2203	4300	6503	SO:0001583	missense	127623				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247614592C>A		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.693G>T	1.37:g.247614592C>A	ENSP00000325682:p.Arg231Ser						p.R231S	NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	693	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	231			Cytoplasmic (Potential).		B2RP03	Missense_Mutation	SNP	ENST00000318749.6	37	c.693G>T	CCDS31090.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.910760	0.33721	.	.	ENSG00000177535	ENST00000318749	T	0.00249	8.44	5.09	1.21	0.21127	GPCR, rhodopsin-like superfamily (1);	0.307487	0.27936	N	0.017244	T	0.00210	0.0006	M	0.75085	2.285	0.26471	N	0.975277	B	0.32653	0.379	B	0.28385	0.089	T	0.31194	-0.9952	10	0.56958	D	0.05	.	8.3661	0.32387	0.0:0.6571:0.0:0.3429	.	231	Q5JQS5	OR2BB_HUMAN	S	231	ENSP00000325682:R231S	ENSP00000325682:R231S	R	-	3	2	OR2B11	245681215	0.000000	0.05858	0.986000	0.45419	0.615000	0.37417	-0.442000	0.06871	0.430000	0.26230	0.643000	0.83706	AGG		0.547	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492		22	81	1	0	7.41877e-09	0.012319	1.01681e-08	22	81				
OR2B11	127623	broad.mit.edu	37	1	247614655	247614655	+	Silent	SNP	G	G	A	rs199665492		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:247614655G>A	ENST00000318749.6	-	1	653	c.630C>T	c.(628-630)ttC>ttT	p.F210F		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F210F(1)		endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GCACCAACACGAAGAAGGCCA	0.562																																							uc010pyx.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(628-630)TTC>TTT		olfactory receptor, family 2, subfamily B,							67.0	69.0	68.0					1																	247614655		2203	4300	6503	SO:0001819	synonymous_variant	127623				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247614655G>A		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.630C>T	1.37:g.247614655G>A							p.F210F	NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	630	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	210			Helical; Name=5; (Potential).		B2RP03	Silent	SNP	ENST00000318749.6	37	c.630C>T	CCDS31090.1																																																																																				0.562	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492		15	57	0	0	0	0.004007	0	15	57				
OR6F1	343169	broad.mit.edu	37	1	247875162	247875162	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:247875162T>A	ENST00000302084.2	-	1	943	c.896A>T	c.(895-897)gAg>gTg	p.E299V	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E299V(1)		breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CAGCAGAGTCTCTCTTACTTC	0.428																																							uc001idj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(895-897)GAG>GTG		olfactory receptor, family 6, subfamily F,							122.0	122.0	122.0					1																	247875162		2203	4300	6503	SO:0001583	missense	343169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247875162T>A	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.896A>T	1.37:g.247875162T>A	ENSP00000305640:p.Glu299Val						p.E299V	NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	896	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		299			Cytoplasmic (Potential).		B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	37	c.896A>T	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	T	14.35	2.509550	0.44660	.	.	ENSG00000169214	ENST00000302084	T	0.38401	1.14	3.49	3.49	0.39957	.	0.151421	0.30547	N	0.009384	T	0.40815	0.1132	L	0.48935	1.535	0.09310	N	1	D	0.57899	0.981	P	0.52109	0.69	T	0.22068	-1.0227	10	0.56958	D	0.05	-10.5217	11.2643	0.49101	0.0:0.0:0.0:1.0	.	299	Q8NGZ6	OR6F1_HUMAN	V	299	ENSP00000305640:E299V	ENSP00000305640:E299V	E	-	2	0	OR6F1	245941785	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.097000	0.11042	1.574000	0.49760	0.482000	0.46254	GAG		0.428	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286		41	136	0	0	0	0.010771	0	41	136				
OR14A16	284532	broad.mit.edu	37	1	247978434	247978434	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:247978434T>A	ENST00000357627.1	-	1	597	c.598A>T	c.(598-600)Att>Ttt	p.I200F		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I200F(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						ACTACATTAATAAGGATGAGT	0.393																																					Ovarian(112;180 1586 15073 21914 33526)	Ovarian(112;180 1586 15073 21914 33526)	uc001idm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(598-600)ATT>TTT		olfactory receptor, family 14, subfamily A,							72.0	73.0	73.0					1																	247978434		2203	4300	6503	SO:0001583	missense	284532				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247978434T>A	BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.598A>T	1.37:g.247978434T>A	ENSP00000350248:p.Ile200Phe						p.I200F	NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN			1	598	-			200			Helical; Name=5; (Potential).		Q6IF96	Missense_Mutation	SNP	ENST00000357627.1	37	c.598A>T	CCDS31097.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.535144	0.00942	.	.	ENSG00000196772	ENST00000357627	T	0.00048	8.82	3.75	-1.58	0.08479	GPCR, rhodopsin-like superfamily (1);	0.941451	0.08713	U	0.904670	T	0.00039	0.0001	N	0.02120	-0.675	0.09310	N	1	B	0.15141	0.012	B	0.24848	0.056	T	0.14980	-1.0453	10	0.07030	T	0.85	.	1.0246	0.01525	0.1824:0.3006:0.1299:0.3871	.	200	Q8NHC5	O14AG_HUMAN	F	200	ENSP00000350248:I200F	ENSP00000350248:I200F	I	-	1	0	OR14A16	246045057	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.703000	0.01900	-0.166000	0.10890	0.486000	0.48141	ATT		0.393	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096856.1	NM_001001966		8	52	0	0	0	0.006214	0	8	52				
OR2W3	343171	broad.mit.edu	37	1	248058993	248058993	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:248058993C>A	ENST00000360358.3	+	1	105	c.105C>A	c.(103-105)taC>taA	p.Y35*	OR2W3_ENST00000537741.1_Nonsense_Mutation_p.Y35*	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y35*(1)		breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGATCGCGTACCTCCTGACCC	0.572																																							uc001idp.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|breast(1)|pancreas(1)	3						c.(103-105)TAC>TAA		olfactory receptor, family 2, subfamily W,							174.0	152.0	160.0					1																	248058993		2203	4300	6503	SO:0001587	stop_gained	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248058993C>A	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.105C>A	1.37:g.248058993C>A	ENSP00000353516:p.Tyr35*					OR2W3_uc010pzb.1_Nonsense_Mutation_p.Y35*	p.Y35*	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	374	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		35			Helical; Name=1; (Potential).		Q6IF06|Q8NG86	Nonsense_Mutation	SNP	ENST00000360358.3	37	c.105C>A	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011744	0.75046	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	.	.	.	5.29	-0.734	0.11140	.	0.000000	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.802	0.52133	0.0:0.5764:0.0:0.4236	.	.	.	.	X	35	.	ENSP00000353516:Y35X	Y	+	3	2	OR2W3	246125616	0.000000	0.05858	0.703000	0.30354	0.052000	0.14988	-0.472000	0.06623	-0.249000	0.09569	0.609000	0.83330	TAC		0.572	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		39	72	1	0	1.42033e-22	0.004289	2.33054e-22	39	72				
OR14C36	127066	broad.mit.edu	37	1	248512748	248512748	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:248512748C>A	ENST00000317861.1	+	1	672	c.672C>A	c.(670-672)ctC>ctA	p.L224L		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L224L(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						CGACCGTGCTCGGGTTTCCAA	0.498																																							uc010pzl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(670-672)CTC>CTA		olfactory receptor, family 14, subfamily C,							193.0	149.0	164.0					1																	248512748		2203	4300	6503	SO:0001819	synonymous_variant	127066				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248512748C>A	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.672C>A	1.37:g.248512748C>A							p.L224L	NM_001001918	NP_001001918	Q8NHC7	O14CZ_HUMAN			1	672	+			224			Cytoplasmic (Potential).		Q6IEZ6	Silent	SNP	ENST00000317861.1	37	c.672C>A	CCDS31112.1																																																																																				0.498	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918		15	79	1	0	3.27435e-08	0.00245	4.40149e-08	15	79				
PFKP	5214	broad.mit.edu	37	10	3124618	3124618	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:3124618A>G	ENST00000381125.4	+	2	227	c.151A>G	c.(151-153)Atc>Gtc	p.I51V	PFKP_ENST00000421751.1_3'UTR|PFKP_ENST00000381075.2_Missense_Mutation_p.Y16C	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	51	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)	p.Y16C(1)|p.I51V(1)		breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		GCGCATGGGTATCTACGTGGG	0.607																																							uc001igp.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3						c.(151-153)ATC>GTC		phosphofructokinase, platelet							139.0	103.0	115.0					10																	3124618		2203	4300	6503	SO:0001583	missense	5214				glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding	g.chr10:3124618A>G	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.151A>G	10.37:g.3124618A>G	ENSP00000370517:p.Ile51Val					PFKP_uc001igq.2_Missense_Mutation_p.Y16C|PFKP_uc009xhr.2_Missense_Mutation_p.I13V	p.I51V	NM_002627	NP_002618	Q01813	K6PP_HUMAN		GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)	2	187	+			51					B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	ENST00000381125.4	37	c.151A>G	CCDS7059.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.39|14.39	2.521174|2.521174	0.44866|0.44866	.|.	.|.	ENSG00000067057|ENSG00000067057	ENST00000381125;ENST00000421751;ENST00000407806|ENST00000397834;ENST00000381075	T;T;T|T	0.78364|0.81078	-1.17;-1.17;-1.17|-1.45	4.31|4.31	4.31|4.31	0.51392|0.51392	Phosphofructokinase domain (2);|.	0.195549|.	0.50627|.	D|.	0.000106|.	T|T	0.77356|0.77356	0.4118|0.4118	M|M	0.79343|0.79343	2.45|2.45	0.80722|0.80722	D|D	1|1	B|B	0.31910|0.29232	0.346|0.238	B|B	0.37731|0.12156	0.257|0.007	T|T	0.77104|0.77104	-0.2711|-0.2711	10|9	0.72032|0.46703	D|T	0.01|0.11	.|.	10.1069|10.1069	0.42539|0.42539	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	51|16	Q01813|Q5VSR7	K6PP_HUMAN|.	V|C	51;13;13|13;16	ENSP00000370517:I51V;ENSP00000410590:I13V;ENSP00000385880:I13V|ENSP00000370465:Y16C	ENSP00000370517:I51V|ENSP00000370465:Y16C	I|Y	+|+	1|2	0|0	PFKP|PFKP	3114618|3114618	1.000000|1.000000	0.71417|0.71417	0.605000|0.605000	0.28930|0.28930	0.640000|0.640000	0.38277|0.38277	6.867000|6.867000	0.75511|0.75511	1.957000|1.957000	0.56846|0.56846	0.445000|0.445000	0.29226|0.29226	ATC|TAT		0.607	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627		13	88	0	0	0	0.00245	0	13	88				
IL2RA	3559	broad.mit.edu	37	10	6104076	6104076	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:6104076G>A	ENST00000379959.3	-	1	212	c.39C>T	c.(37-39)ttC>ttT	p.F13F	IL2RA_ENST00000256876.6_Silent_p.F13F|IL2RA_ENST00000379954.1_Silent_p.F13F	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	13					activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)	p.F13F(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GCACCATGATGAACGTGAGCA	0.612																																							uc001iiz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(37-39)TTC>TTT		interleukin 2 receptor, alpha chain precursor	Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)						78.0	73.0	74.0					10																	6104076		2203	4300	6503	SO:0001819	synonymous_variant	3559				cell proliferation	integral to membrane	interleukin-2 receptor activity	g.chr10:6104076G>A	X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.39C>T	10.37:g.6104076G>A						IL2RA_uc009xih.1_Silent_p.F13F	p.F13F	NM_000417	NP_000408	P01589	IL2RA_HUMAN			1	198	-			13					Q5W007	Silent	SNP	ENST00000379959.3	37	c.39C>T	CCDS7076.1																																																																																				0.612	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1	NM_000417		5	117	0	0	0	0.001984	0	5	117				
MCM10	55388	broad.mit.edu	37	10	13239666	13239666	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:13239666C>A	ENST00000484800.2	+	15	2124	c.2021C>A	c.(2020-2022)aCa>aAa	p.T674K	MCM10_ENST00000378694.1_Missense_Mutation_p.T673K|MCM10_ENST00000378714.3_Missense_Mutation_p.T673K			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	674					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.T674K(1)		central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						CAGGTTCTTACAAAAACAAAC	0.398																																							uc001ima.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2020-2022)ACA>AAA		minichromosome maintenance complex component 10							93.0	86.0	89.0					10																	13239666		2203	4300	6503	SO:0001583	missense	55388				cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding	g.chr10:13239666C>A	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.2021C>A	10.37:g.13239666C>A	ENSP00000418268:p.Thr674Lys					MCM10_uc001imb.2_Missense_Mutation_p.T673K|MCM10_uc001imc.2_Missense_Mutation_p.T673K	p.T674K	NM_182751	NP_877428	Q7L590	MCM10_HUMAN			15	2122	+			674					A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	c.2021C>A	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	C	5.288	0.238482	0.10023	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.29655	1.56;1.56;1.56	5.23	3.38	0.38709	Replication factor Mcm10 (1);	0.563036	0.20191	N	0.097320	T	0.19765	0.0475	L	0.38838	1.175	0.33544	D	0.595259	B;B;B	0.20550	0.024;0.037;0.046	B;B;B	0.22152	0.02;0.022;0.038	T	0.25572	-1.0128	10	0.05525	T	0.97	-6.5495	9.6793	0.40061	0.2503:0.6829:0.0:0.0668	.	673;673;674	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	K	673;674;674;673	ENSP00000367986:T673K;ENSP00000418268:T674K;ENSP00000367966:T673K	ENSP00000354945:T674K	T	+	2	0	MCM10	13279672	0.014000	0.17966	0.998000	0.56505	0.801000	0.45260	1.034000	0.30204	0.709000	0.31976	-0.126000	0.14955	ACA		0.398	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751		8	54	1	0	1.06961e-07	0.00308	1.41068e-07	8	54				
ITGA8	8516	broad.mit.edu	37	10	15649716	15649716	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:15649716T>A	ENST00000378076.3	-	17	2077	c.1724A>T	c.(1723-1725)cAg>cTg	p.Q575L		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	575					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.Q575L(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GTGGGATTTCTGCCTTTTTAT	0.438																																							uc001ioc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)	6						c.(1723-1725)CAG>CTG		integrin, alpha 8 precursor							196.0	201.0	199.0					10																	15649716		2203	4300	6503	SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15649716T>A	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1724A>T	10.37:g.15649716T>A	ENSP00000367316:p.Gln575Leu					ITGA8_uc010qcb.1_Missense_Mutation_p.Q560L	p.Q575L	NM_003638	NP_003629	P53708	ITA8_HUMAN			17	1724	-			575			Extracellular (Potential).		B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	c.1724A>T	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	T	11.09	1.536333	0.27475	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.49139	0.79	5.84	4.7	0.59300	Integrin alpha-2 (1);	0.573529	0.21149	N	0.079359	T	0.43344	0.1243	L	0.54323	1.7	0.30347	N	0.785187	B;B	0.29212	0.199;0.237	B;B	0.31101	0.076;0.124	T	0.43097	-0.9412	10	0.30854	T	0.27	.	11.5754	0.50858	0.0:0.0695:0.0:0.9305	.	560;575	F5H818;P53708	.;ITA8_HUMAN	L	575;560	ENSP00000367316:Q575L	ENSP00000367316:Q575L	Q	-	2	0	ITGA8	15689722	1.000000	0.71417	0.116000	0.21606	0.022000	0.10575	3.233000	0.51311	1.046000	0.40249	0.482000	0.46254	CAG		0.438	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		7	200	0	0	0	0.00308	0	7	200				
GPR158	57512	broad.mit.edu	37	10	25886839	25886839	+	Missense_Mutation	SNP	C	C	A	rs542611999		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:25886839C>A	ENST00000376351.3	+	11	2643	c.2284C>A	c.(2284-2286)Cca>Aca	p.P762T	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	762					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P762T(2)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TACGGAGATCCCAGAGACAGT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		16764	0.001		0.0	False		,,,				2504	0.0						uc001isj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(2284-2286)CCA>ACA		G protein-coupled receptor 158 precursor							97.0	108.0	105.0					10																	25886839		2203	4300	6503	SO:0001583	missense	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25886839C>A	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2284C>A	10.37:g.25886839C>A	ENSP00000365529:p.Pro762Thr					GPR158_uc001isk.2_Missense_Mutation_p.P137T	p.P762T	NM_020752	NP_065803	Q5T848	GP158_HUMAN			11	2344	+			762			Cytoplasmic (Potential).		Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	c.2284C>A	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	C	31	5.075086	0.94000	.	.	ENSG00000151025	ENST00000376351	T	0.70516	-0.49	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000005	D	0.84790	0.5550	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85855	0.1406	10	0.72032	D	0.01	.	19.4771	0.94994	0.0:1.0:0.0:0.0	.	762	Q5T848	GP158_HUMAN	T	762	ENSP00000365529:P762T	ENSP00000365529:P762T	P	+	1	0	GPR158	25926845	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.487000	0.81328	2.606000	0.88127	0.650000	0.86243	CCA		0.547	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		16	114	1	0	3.52763e-06	0.00499	4.34122e-06	16	114				
ANKRD30A	91074	broad.mit.edu	37	10	37486390	37486390	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:37486390G>C	ENST00000602533.1	+	29	2629	c.2530G>C	c.(2530-2532)Gaa>Caa	p.E844Q	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.E963Q|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.E844Q			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	900					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E844Q(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ATTGAAGAATGAACAAACATT	0.333																																							uc001iza.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|breast(1)|skin(1)	9						c.(2530-2532)GAA>CAA		ankyrin repeat domain 30A							106.0	94.0	98.0					10																	37486390		1814	4073	5887	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37486390G>C	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2530G>C	10.37:g.37486390G>C	ENSP00000473551:p.Glu844Gln						p.E844Q	NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN			29	2629	+			900					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.2530G>C		.	.	.	.	.	.	.	.	.	.	.	0.308	-0.969549	0.02232	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.06528	3.29;3.29	1.36	-2.73	0.05950	.	.	.	.	.	T	0.03651	0.0104	N	0.22421	0.69	0.09310	N	1	B	0.29037	0.231	B	0.21917	0.037	T	0.39683	-0.9602	9	0.34782	T	0.22	.	5.8082	0.18452	0.4662:0.0:0.5338:0.0	.	900	Q9BXX3	AN30A_HUMAN	Q	844;963	ENSP00000354432:E844Q;ENSP00000363792:E963Q	ENSP00000354432:E844Q	E	+	1	0	ANKRD30A	37526396	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.369000	0.02578	-1.090000	0.03069	-0.505000	0.04504	GAA		0.333	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		4	57	0	0	0	0.009096	0	4	57				
ZNF33A	7581	broad.mit.edu	37	10	38305840	38305840	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:38305840G>T	ENST00000458705.2	+	3	209	c.51G>T	c.(49-51)gtG>gtT	p.V17V	ZNF33A_ENST00000307441.9_Silent_p.V17V|ZNF33A_ENST00000469037.2_Silent_p.V17V|ZNF33A_ENST00000476504.1_3'UTR|ZNF33A_ENST00000432900.2_Silent_p.V24V|ZNF33A_ENST00000374618.3_Silent_p.V17V			Q06730	ZN33A_HUMAN	zinc finger protein 33A	17	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V17V(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						TTAAAGATGTGACTGTGGGCT	0.468																																							uc001izh.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(49-51)GTG>GTT		zinc finger protein 33A isoform b							78.0	78.0	78.0					10																	38305840		2203	4300	6503	SO:0001819	synonymous_variant	7581					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr10:38305840G>T	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.51G>T	10.37:g.38305840G>T						ZNF33A_uc001izg.2_Silent_p.V17V|ZNF33A_uc010qev.1_Silent_p.V24V|ZNF33A_uc001izi.1_Silent_p.V17V|ZNF33A_uc001izj.2_RNA	p.V17V	NM_006974	NP_008905	Q06730	ZN33A_HUMAN			3	229	+			17			KRAB.		A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Silent	SNP	ENST00000458705.2	37	c.51G>T	CCDS31182.1																																																																																				0.468	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974		13	41	1	0	6.31663e-08	0.003163	8.42619e-08	13	41				
BMS1	9790	broad.mit.edu	37	10	43292409	43292409	+	Missense_Mutation	SNP	G	G	T	rs377531157		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:43292409G>T	ENST00000374518.5	+	10	1780	c.1717G>T	c.(1717-1719)Gct>Tct	p.A573S		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	573					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.A573S(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GAAGAAAGCAGCTCTCCCCAC	0.483																																							uc001jaj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(1717-1719)GCT>TCT		BMS1-like, ribosome assembly protein		G	SER/ALA	0,4406		0,0,2203	91.0	84.0	86.0		1717	-1.0	0.0	10		86	1,8599	1.2+/-3.3	0,1,4299	no	missense	BMS1	NM_014753.3	99	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign	573/1283	43292409	1,13005	2203	4300	6503	SO:0001583	missense	9790				ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity	g.chr10:43292409G>T	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.1717G>T	10.37:g.43292409G>T	ENSP00000363642:p.Ala573Ser						p.A573S	NM_014753	NP_055568	Q14692	BMS1_HUMAN			10	2075	+			573					Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	c.1717G>T	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	g	0.906	-0.720679	0.03182	0.0	1.16E-4	ENSG00000165733	ENST00000374518	T	0.24723	1.84	4.79	-0.989	0.10242	.	1.282520	0.04963	N	0.462491	T	0.18045	0.0433	L	0.36672	1.1	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.28996	-1.0026	10	0.09084	T	0.74	.	7.9558	0.30042	0.2633:0.0:0.6206:0.1161	.	573	Q14692	BMS1_HUMAN	S	573	ENSP00000363642:A573S	ENSP00000363642:A573S	A	+	1	0	BMS1	42612415	0.008000	0.16893	0.030000	0.17652	0.021000	0.10359	0.009000	0.13219	-0.138000	0.11434	0.549000	0.68633	GCT		0.483	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753		19	38	1	0	8.28177e-16	0.007413	1.28358e-15	19	38				
GDF10	2662	broad.mit.edu	37	10	48429174	48429174	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:48429174T>A	ENST00000224605.2	-	2	977	c.712A>T	c.(712-714)Agc>Tgc	p.S238C		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	238					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.S238C(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						GCATAGGGGCTGGGCCGGGGC	0.667																																							uc001jfb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(712-714)AGC>TGC		growth differentiation factor 10 precursor							11.0	15.0	13.0					10																	48429174		2182	4291	6473	SO:0001583	missense	2662				growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity	g.chr10:48429174T>A	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.712A>T	10.37:g.48429174T>A	ENSP00000224605:p.Ser238Cys					GDF10_uc009xnp.2_Missense_Mutation_p.S237C|GDF10_uc009xnq.1_Missense_Mutation_p.S238C	p.S238C	NM_004962	NP_004953	P55107	BMP3B_HUMAN			2	1168	-			238					Q5VSQ8|Q9UCX6	Missense_Mutation	SNP	ENST00000224605.2	37	c.712A>T	CCDS7220.1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.472182	0.26423	.	.	ENSG00000107623	ENST00000374247;ENST00000224605	T	0.76316	-1.01	5.28	-1.3	0.09259	.	0.727454	0.14260	N	0.330856	T	0.80696	0.4672	L	0.58101	1.795	0.09310	N	1	P;D	0.58620	0.726;0.983	B;P	0.56788	0.237;0.806	T	0.73886	-0.3841	10	0.62326	D	0.03	.	12.0009	0.53230	0.0:0.539:0.0:0.461	.	48;238	Q8N6T2;P55107	.;BMP3B_HUMAN	C	48;238	ENSP00000224605:S238C	ENSP00000224605:S238C	S	-	1	0	GDF10	48049180	0.000000	0.05858	0.001000	0.08648	0.041000	0.13682	-0.579000	0.05834	-0.228000	0.09869	-0.441000	0.05720	AGC		0.667	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962		4	15	0	0	0	0.000602	0	4	15				
LRRC18	474354	broad.mit.edu	37	10	50121546	50121546	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:50121546C>T	ENST00000374160.3	-	1	731	c.655G>A	c.(655-657)Gac>Aac	p.D219N	RP11-523O18.7_ENST00000430438.1_RNA|WDFY4_ENST00000413659.2_Intron|WDFY4_ENST00000325239.5_Intron|LRRC18_ENST00000298124.3_Missense_Mutation_p.D219N	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	219						cytoplasm (GO:0005737)				NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						TTCAGGTTGTCCCGGGCGTTT	0.498																																							uc001jhd.2		NA																	0				ovary(1)|pancreas(1)	2						c.(655-657)GAC>AAC		leucine rich repeat containing 18							171.0	175.0	174.0					10																	50121546		2203	4300	6503	SO:0001583	missense	474354					cytoplasm		g.chr10:50121546C>T	AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.655G>A	10.37:g.50121546C>T	ENSP00000363275:p.Asp219Asn					WDFY4_uc001jha.3_Intron|LRRC18_uc001jhe.1_Missense_Mutation_p.D219N	p.D219N	NM_001006939	NP_001006940	Q8N456	LRC18_HUMAN			1	735	-			219					Q6UY02	Missense_Mutation	SNP	ENST00000374160.3	37	c.655G>A	CCDS31197.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.769056	0.31320	.	.	ENSG00000165383	ENST00000374160;ENST00000298124	T;T	0.58210	0.53;0.35	5.87	5.87	0.94306	.	0.545614	0.21831	N	0.068480	T	0.46034	0.1372	L	0.46157	1.445	0.34598	D	0.716187	B	0.11235	0.004	B	0.10450	0.005	T	0.50725	-0.8794	9	.	.	.	.	13.4087	0.60929	0.0:0.9285:0.0:0.0715	.	219	Q8N456	LRC18_HUMAN	N	219	ENSP00000363275:D219N;ENSP00000298124:D219N	.	D	-	1	0	LRRC18	49791552	0.381000	0.25140	0.274000	0.24659	0.282000	0.26991	1.144000	0.31565	2.785000	0.95823	0.655000	0.94253	GAC		0.498	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047964.1	NM_001006939		5	136	0	0	0	0.000602	0	5	136				
CTNNA3	29119	broad.mit.edu	37	10	69299427	69299427	+	Splice_Site	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:69299427C>A	ENST00000433211.2	-	4	467	c.293G>T	c.(292-294)aGt>aTt	p.S98I	CTNNA3_ENST00000373744.4_Splice_Site_p.S98I|CTNNA3_ENST00000545309.1_Splice_Site_p.S98I	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.S98I(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						CAGAGCTTCACCTGAAAAATA	0.418																																							uc009xpn.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						c.(292-294)AGT>ATT		catenin, alpha 3							51.0	52.0	52.0					10																	69299427		2203	4300	6503	SO:0001630	splice_region_variant	29119				cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity	g.chr10:69299427C>A	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.293-1G>T	10.37:g.69299427C>A						CTNNA3_uc001jmw.2_Missense_Mutation_p.S98I|CTNNA3_uc001jmx.3_Missense_Mutation_p.S98I|CTNNA3_uc009xpo.1_Intron|CTNNA3_uc001jna.2_Missense_Mutation_p.S110I	p.S98I	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN			4	416	-			98			Potential.			Missense_Mutation	SNP	ENST00000433211.2	37	c.293G>T	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.976499	0.74360	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309;ENST00000330298;ENST00000540598	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.04	5.04	0.67666	.	0.000000	0.56097	U	0.000029	T	0.50905	0.1643	L	0.34521	1.04	0.41740	D	0.989605	D;P;D	0.65815	0.995;0.788;0.971	P;P;P	0.61658	0.892;0.536;0.693	T	0.55289	-0.8164	10	0.87932	D	0	.	15.2956	0.73906	0.0:1.0:0.0:0.0	.	98;98;98	F2Z2R0;Q9UI47-2;Q9UI47	.;.;CTNA3_HUMAN	I	98	ENSP00000389714:S98I;ENSP00000362849:S98I;ENSP00000441444:S98I;ENSP00000330570:S98I	ENSP00000330570:S98I	S	-	2	0	CTNNA3	68969433	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.868000	0.69605	2.324000	0.78689	0.484000	0.47621	AGT		0.418	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	Missense_Mutation	16	33	1	0	3.45872e-05	0.004007	4.0977e-05	16	33				
ZFYVE27	118813	broad.mit.edu	37	10	99504558	99504558	+	Missense_Mutation	SNP	G	G	A	rs368586141		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:99504558G>A	ENST00000393677.4	+	4	545	c.341G>A	c.(340-342)cGg>cAg	p.R114Q	ZFYVE27_ENST00000337540.7_Missense_Mutation_p.R82Q|ZFYVE27_ENST00000356257.4_Missense_Mutation_p.R114Q|ZFYVE27_ENST00000453958.2_Missense_Mutation_p.R114Q|ZFYVE27_ENST00000357540.4_Intron|ZFYVE27_ENST00000370613.3_Intron|ZFYVE27_ENST00000370610.3_Missense_Mutation_p.R16Q|ZFYVE27_ENST00000359980.3_Missense_Mutation_p.R114Q	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	114					cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)	p.R114Q(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		GAGGTTTGCCGGGCACGGCTG	0.592																																							uc001koo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(340-342)CGG>CAG		zinc finger, FYVE domain containing 27 isoform		G	GLN/ARG,GLN/ARG,GLN/ARG,,GLN/ARG,,GLN/ARG	0,4406		0,0,2203	56.0	50.0	52.0		341,341,245,,47,,341	3.8	1.0	10		52	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense,intron,missense,intron,missense	ZFYVE27	NM_001002261.3,NM_001002262.3,NM_001174119.1,NM_001174120.1,NM_001174121.1,NM_001174122.1,NM_144588.6	43,43,43,,43,,43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign,benign,,benign,,benign	114/417,114/405,82/373,,16/312,,114/412	99504558	2,13004	2203	4300	6503	SO:0001583	missense	118813				cell death|nerve growth factor receptor signaling pathway|neuron projection development|protein localization in plasma membrane	axon|dendrite|endoplasmic reticulum membrane|growth cone membrane|integral to membrane|recycling endosome membrane	metal ion binding|protein binding	g.chr10:99504558G>A	BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.341G>A	10.37:g.99504558G>A	ENSP00000377282:p.Arg114Gln					ZFYVE27_uc001kon.2_Missense_Mutation_p.R114Q|ZFYVE27_uc001koq.2_Intron|ZFYVE27_uc010qpa.1_Intron|ZFYVE27_uc001kop.2_Missense_Mutation_p.R114Q|ZFYVE27_uc010qpb.1_Missense_Mutation_p.R16Q|ZFYVE27_uc010qpc.1_RNA|ZFYVE27_uc010qpd.1_Missense_Mutation_p.R82Q|ZFYVE27_uc001kok.1_RNA|ZFYVE27_uc001kol.1_Missense_Mutation_p.R114Q|ZFYVE27_uc001kom.1_Missense_Mutation_p.R114Q	p.R114Q	NM_144588	NP_653189	Q5T4F4	ZFY27_HUMAN		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)	4	541	+		Colorectal(252;0.0846)	114			Cytoplasmic (Potential).		B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Missense_Mutation	SNP	ENST00000393677.4	37	c.341G>A	CCDS31263.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451352	0.43531	0.0	2.33E-4	ENSG00000155256	ENST00000337540;ENST00000370610;ENST00000393677;ENST00000453958;ENST00000359980;ENST00000356257;ENST00000423811	T;T;T;T;T;T;T	0.49720	0.78;0.77;1.44;1.41;1.42;1.44;1.45	5.65	3.81	0.43845	.	0.396922	0.28940	N	0.013654	T	0.29652	0.0740	N	0.17082	0.46	0.37198	D	0.904254	B;B;B;B;B	0.18968	0.006;0.006;0.032;0.01;0.007	B;B;B;B;B	0.14023	0.003;0.004;0.01;0.006;0.003	T	0.13124	-1.0521	10	0.32370	T	0.25	-11.1957	9.8092	0.40812	0.211:0.0:0.789:0.0	.	82;16;114;114;114	B7Z404;B7Z3S0;Q5T4F4-3;Q5T4F4-2;Q5T4F4	.;.;.;.;ZFY27_HUMAN	Q	82;16;114;114;114;114;92	ENSP00000337993:R82Q;ENSP00000359642:R16Q;ENSP00000377282:R114Q;ENSP00000401580:R114Q;ENSP00000353069:R114Q;ENSP00000348593:R114Q;ENSP00000409594:R92Q	ENSP00000337993:R82Q	R	+	2	0	ZFYVE27	99494548	1.000000	0.71417	0.998000	0.56505	0.811000	0.45836	2.770000	0.47662	0.744000	0.32741	0.591000	0.81541	CGG		0.592	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049745.2	NM_144588		4	47	0	0	0	0.009096	0	4	47				
NEURL1	9148	broad.mit.edu	37	10	105331369	105331369	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:105331369G>C	ENST00000369780.4	+	3	848	c.439G>C	c.(439-441)Gtg>Ctg	p.V147L	NEURL_ENST00000369777.2_Missense_Mutation_p.V130L	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		147	NHR 1. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V147L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CCCCGACCTGGTGTCCCAGAG	0.647																																							uc001kxh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(439-441)GTG>CTG		neuralized-like							70.0	54.0	59.0					10																	105331369		2203	4300	6503	SO:0001583	missense	9148				nervous system development	perinuclear region of cytoplasm	zinc ion binding	g.chr10:105331369G>C																												ENST00000369780.4:c.439G>C	10.37:g.105331369G>C	ENSP00000358795:p.Val147Leu						p.V147L	NM_004210	NP_004201	O76050	NEU1A_HUMAN		Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)	3	849	+			147			NHR 1.		Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	37	c.439G>C	CCDS7551.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.838585	0.91117	.	.	ENSG00000107954	ENST00000369780;ENST00000437579;ENST00000369777;ENST00000455386	T;T	0.30714	1.52;1.52	5.79	4.89	0.63831	NEUZ (2);	0.000000	0.85682	D	0.000000	T	0.48077	0.1480	L	0.46885	1.475	0.80722	D	1	D	0.65815	0.995	D	0.74674	0.984	T	0.47535	-0.9110	10	0.62326	D	0.03	-9.3952	14.0499	0.64730	0.0723:0.0:0.9277:0.0	.	147	O76050	NEU1A_HUMAN	L	147;130;130;72	ENSP00000358795:V147L;ENSP00000358792:V130L	ENSP00000358792:V130L	V	+	1	0	NEURL	105321359	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	1.447000	0.47661	0.561000	0.74099	GTG		0.647	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1			4	33	0	0	0	0.009096	0	4	33				
SORCS1	114815	broad.mit.edu	37	10	108466382	108466382	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:108466382C>A	ENST00000263054.6	-	8	1161	c.1154G>T	c.(1153-1155)gGa>gTa	p.G385V	SORCS1_ENST00000344440.6_Missense_Mutation_p.G385V	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	385					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.G385V(2)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TGGCCGCCCTCCTGATGTCAG	0.468																																							uc001kym.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(1153-1155)GGA>GTA		SORCS receptor 1 isoform a							130.0	113.0	118.0					10																	108466382		2203	4300	6503	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108466382C>A	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1154G>T	10.37:g.108466382C>A	ENSP00000263054:p.Gly385Val					SORCS1_uc001kyl.2_Missense_Mutation_p.G385V|SORCS1_uc009xxs.2_Missense_Mutation_p.G385V|SORCS1_uc001kyn.1_Missense_Mutation_p.G385V|SORCS1_uc001kyo.2_Missense_Mutation_p.G385V	p.G385V	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	8	1162	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	385			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.1154G>T	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.706615	0.68615	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.36878	1.23;1.23	5.64	5.64	0.86602	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.55955	0.1953	M	0.65498	2.005	0.80722	D	1	D;P;D;D;D	0.58620	0.972;0.944;0.983;0.972;0.983	P;P;P;P;P	0.58210	0.689;0.755;0.835;0.758;0.835	T	0.51803	-0.8659	9	.	.	.	-14.8892	19.7013	0.96054	0.0:1.0:0.0:0.0	.	385;385;385;385;385	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	V	385	ENSP00000263054:G385V;ENSP00000345964:G385V	.	G	-	2	0	SORCS1	108456372	0.976000	0.34144	1.000000	0.80357	0.770000	0.43624	2.852000	0.48310	2.657000	0.90304	0.655000	0.94253	GGA		0.468	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		7	56	1	0	0.00198382	0.001984	0.0021667	7	56				
SORCS1	114815	broad.mit.edu	37	10	108489872	108489872	+	Splice_Site	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:108489872C>T	ENST00000263054.6	-	6	967	c.960G>A	c.(958-960)tgG>tgA	p.W320*	SORCS1_ENST00000344440.6_Splice_Site_p.W320*	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	320					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.W320*(2)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CCATCACAGACCTAAAAAATG	0.418																																							uc001kym.2		NA																	2	Substitution - Nonsense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(958-960)TGG>TGA		SORCS receptor 1 isoform a							103.0	88.0	93.0					10																	108489872		2203	4300	6503	SO:0001630	splice_region_variant	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108489872C>T	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.960-1G>A	10.37:g.108489872C>T						SORCS1_uc001kyl.2_Nonsense_Mutation_p.W320*|SORCS1_uc009xxs.2_Nonsense_Mutation_p.W320*|SORCS1_uc001kyn.1_Nonsense_Mutation_p.W320*|SORCS1_uc001kyo.2_Nonsense_Mutation_p.W320*	p.W320*	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	6	968	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	320			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Nonsense_Mutation	SNP	ENST00000263054.6	37	c.960G>A	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	36	5.870625	0.97049	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	.	.	.	5.89	5.89	0.94794	.	0.257636	0.42053	D	0.000767	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7619	0.78091	0.0:1.0:0.0:0.0	.	.	.	.	X	320	.	.	W	-	3	0	SORCS1	108479862	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	4.218000	0.58554	2.793000	0.96121	0.655000	0.94253	TGG		0.418	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	Nonsense_Mutation	20	38	0	0	0	0.008871	0	20	38				
XPNPEP1	7511	broad.mit.edu	37	10	111633124	111633124	+	Splice_Site	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:111633124C>T	ENST00000502935.1	-	16	1572		c.e16+1		XPNPEP1_ENST00000369680.4_Splice_Site|XPNPEP1_ENST00000322238.8_Splice_Site|XPNPEP1_ENST00000369683.1_Splice_Site					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble									p.?(2)		endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		CTCCACCTTACCTTCTCGTAG	0.408																																							uc001kyp.1		NA																	2	Unknown(2)		lung(2)	ovary(3)|pancreas(1)	4						c.e16+1		X-prolyl aminopeptidase (aminopeptidase P) 1,							156.0	146.0	149.0					10																	111633124		2203	4300	6503	SO:0001630	splice_region_variant	7511				bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity	g.chr10:111633124C>T		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1452+1G>A	10.37:g.111633124C>T						XPNPEP1_uc009xxt.1_Splice_Site_p.K460_splice|XPNPEP1_uc001kyq.1_Splice_Site_p.K370_splice	p.K441_splice	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)	16	1463	-		Breast(234;0.174)							Splice_Site	SNP	ENST00000502935.1	37	c.1323_splice	CCDS7560.2	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891945	0.72524	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2796	0.90094	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	XPNPEP1	111623114	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	7.506000	0.81665	2.752000	0.94435	0.655000	0.94253	.		0.408	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2		Intron	12	143	0	0	0	0.001855	0	12	143				
FGFR2	2263	broad.mit.edu	37	10	123279674	123279674	+	Missense_Mutation	SNP	G	G	A	rs77543610|rs281865420|rs387907372		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:123279674G>A	ENST00000358487.5	-	7	1030	c.758C>T	c.(757-759)cCt>cTt	p.P253L	FGFR2_ENST00000369059.1_Missense_Mutation_p.P138L|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000457416.2_Missense_Mutation_p.P253L|FGFR2_ENST00000346997.2_Missense_Mutation_p.P253L|FGFR2_ENST00000360144.3_Missense_Mutation_p.P164L|FGFR2_ENST00000369060.4_Missense_Mutation_p.P253L|FGFR2_ENST00000369056.1_Missense_Mutation_p.P253L|FGFR2_ENST00000478859.1_Missense_Mutation_p.P25L|FGFR2_ENST00000351936.6_Missense_Mutation_p.P253L|FGFR2_ENST00000357555.5_Missense_Mutation_p.P164L|FGFR2_ENST00000369061.4_Intron|FGFR2_ENST00000356226.4_Missense_Mutation_p.P138L	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	253			P -> R (in APRS; common mutation). {ECO:0000269|PubMed:11781872, ECO:0000269|PubMed:7668257, ECO:0000269|PubMed:7719344, ECO:0000269|PubMed:9452027, ECO:0000269|PubMed:9677057}.|SP -> FS (in PS).		angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.P253R(7)|p.P253L(3)|p.P164R(1)|p.P164L(1)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	GGGCCGGTGAGGCGATCGCTC	0.567		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																														uc010qtk.1		5		Dom	yes		10	10q26	2263	Mis	fibroblast growth factor receptor 2	yes	Crouzon|Pfeiffer|and Apert syndromes	E			gastric. NSCLC|endometrial		12	Substitution - Missense(12)	p.P253R(2)	endometrium(8)|lung(4)	endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96	GRCh37	CM950459	FGFR2	M	rs77543610	c.(757-759)CCT>CTT		fibroblast growth factor receptor 2 isoform 1	Palifermin(DB00039)						58.0	47.0	50.0					10																	123279674		2203	4300	6503	SO:0001583	missense	2263	Apert_syndrome|Saethre-Chotzen_syndrome	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding	g.chr10:123279674G>A	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.758C>T	10.37:g.123279674G>A	ENSP00000351276:p.Pro253Leu					FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Missense_Mutation_p.P138L|FGFR2_uc010qti.1_Missense_Mutation_p.P164L|FGFR2_uc010qtj.1_Missense_Mutation_p.P253L|FGFR2_uc010qtl.1_Missense_Mutation_p.P253L|FGFR2_uc010qtm.1_Missense_Mutation_p.P138L|FGFR2_uc001lfl.3_Missense_Mutation_p.P253L|FGFR2_uc001lfm.2_Missense_Mutation_p.P164L|FGFR2_uc001lfn.3_RNA|FGFR2_uc010qtn.1_Missense_Mutation_p.P272L|FGFR2_uc010qto.1_Missense_Mutation_p.P157L|FGFR2_uc001lfo.1_Missense_Mutation_p.P272L|FGFR2_uc010qtp.1_Missense_Mutation_p.P272L|FGFR2_uc001lfg.3_5'Flank	p.P253L	NM_000141	NP_000132	P21802	FGFR2_HUMAN	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	7	1405	-		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	253		P -> R (in APRS; common mutation).|SP -> FS (in PS).	Extracellular (Potential).		B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	ENST00000358487.5	37	c.758C>T	CCDS31298.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055216	0.75960	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000358487;ENST00000356226;ENST00000369060;ENST00000369059;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000360144;ENST00000369056;ENST00000369058;ENST00000336553	D;D;T;D;D;D;D;D;D;D;D;T	0.82167	-1.5;-1.53;-1.48;-1.58;-1.51;-1.53;-1.55;-1.53;-1.51;-1.52;-1.52;-1.47	5.79	5.79	0.91817	.	0.047110	0.85682	D	0.000000	D	0.87985	0.6316	M	0.83852	2.665	0.80722	D	1	P;B;P;B;B;B;B;P;B;P	0.51057	0.916;0.007;0.941;0.007;0.026;0.393;0.001;0.759;0.077;0.536	P;B;P;B;B;P;B;B;B;B	0.46659	0.517;0.009;0.523;0.021;0.093;0.506;0.022;0.205;0.067;0.278	D	0.89641	0.3862	10	0.87932	D	0	.	20.0368	0.97565	0.0:0.0:1.0:0.0	.	272;138;253;272;253;164;138;272;164;253	D3DRD4;B5A963;B5A960;D3DRD5;P21802-18;P21802-21;P21802-20;D3DRE0;P21802-22;P21802-17	.;.;.;.;.;.;.;.;.;.	L	164;253;253;138;253;138;253;253;253;164;253;253;164	ENSP00000350166:P164L;ENSP00000351276:P253L;ENSP00000348559:P138L;ENSP00000358056:P253L;ENSP00000358055:P138L;ENSP00000263451:P253L;ENSP00000410294:P253L;ENSP00000309878:P253L;ENSP00000353262:P164L;ENSP00000358052:P253L;ENSP00000358054:P253L;ENSP00000337665:P164L	ENSP00000337665:P164L	P	-	2	0	FGFR2	123269664	1.000000	0.71417	0.871000	0.34182	0.805000	0.45488	9.860000	0.99555	2.735000	0.93741	0.563000	0.77884	CCT		0.567	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141		5	22	0	0	0	0.001168	0	5	22				
DOCK1	1793	broad.mit.edu	37	10	129172391	129172391	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:129172391G>A	ENST00000280333.6	+	35	3634	c.3525G>A	c.(3523-3525)gtG>gtA	p.V1175V		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1175					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.V1175V(1)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AACTCGTTGTGCGCTTAATGG	0.423																																							uc001ljt.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9						c.(3523-3525)GTG>GTA		dedicator of cytokinesis 1							81.0	78.0	79.0					10																	129172391		1900	4128	6028	SO:0001819	synonymous_variant	1793				apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr10:129172391G>A	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.3525G>A	10.37:g.129172391G>A						DOCK1_uc010qun.1_Silent_p.V1196V|DOCK1_uc009yaq.2_Silent_p.V170V	p.V1175V	NM_001380	NP_001371	Q14185	DOCK1_HUMAN		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)	35	3589	+		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)	1175			DHR-2.		A9Z1Z5	Silent	SNP	ENST00000280333.6	37	c.3525G>A																																																																																					0.423	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380		5	25	0	0	0	0.001984	0	5	25				
OR52E2	119678	broad.mit.edu	37	11	5080000	5080000	+	Silent	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:5080000T>A	ENST00000321522.2	-	1	857	c.858A>T	c.(856-858)ccA>ccT	p.P286P		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P286P(1)		endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		GATTGAGCATTGGTGGCACCA	0.423																																							uc010qyw.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(856-858)CCA>CCT		olfactory receptor, family 52, subfamily E,							72.0	75.0	74.0					11																	5080000		2201	4296	6497	SO:0001819	synonymous_variant	119678				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5080000T>A	AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.858A>T	11.37:g.5080000T>A							p.P286P	NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)	1	858	-		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)	286			Helical; Name=7; (Potential).			Silent	SNP	ENST00000321522.2	37	c.858A>T	CCDS31371.1																																																																																				0.423	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142815.1	NM_001005164		12	25	0	0	0	0.001855	0	12	25				
HBG2	3048	broad.mit.edu	37	11	5275539	5275539	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:5275539C>A	ENST00000380259.2	-	7	1538	c.298G>T	c.(298-300)Gat>Tat	p.D100Y	HBG2_ENST00000336906.4_Missense_Mutation_p.D100Y|HBG2_ENST00000380252.1_Missense_Mutation_p.D90Y			P69892	HBG2_HUMAN	hemoglobin, gamma G	100					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)	p.D100Y(1)		endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	13		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCTCAGGATCCACATGCAGC	0.502																																							uc001mai.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(298-300)GAT>TAT		A-gamma globin							162.0	126.0	138.0					11																	5275539		2201	4297	6498	SO:0001583	missense	3048				blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity	g.chr11:5275539C>A	BC029387	CCDS7755.1	11p15.5	2014-05-19			ENSG00000196565	ENSG00000196565			4832	protein-coding gene	gene with protein product		142250				2649166	Standard	NM_000184		Approved	HBG-T1		P69892	OTTHUMG00000066673	ENST00000380259.2:c.298G>T	11.37:g.5275539C>A	ENSP00000369609:p.Asp100Tyr					HBG2_uc001mak.1_RNA|HBG2_uc001maj.1_Missense_Mutation_p.D100Y	p.D100Y	NM_000559	NP_000550	P69892	HBG2_HUMAN		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	735	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	100					A8MZE0|P02096|P62027|Q14491|Q68NH9|Q96FH6|Q96FH7	Missense_Mutation	SNP	ENST00000380259.2	37	c.298G>T	CCDS7755.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059865	0.76074	.	.	ENSG00000196565	ENST00000380252;ENST00000380259;ENST00000336906;ENST00000380247	D;D;D	0.95137	-3.62;-3.62;-3.62	3.97	3.97	0.46021	Globin-like (2);Globin, structural domain (2);	0.115998	0.56097	U	0.000033	D	0.98213	0.9409	H	0.97682	4.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99364	1.0918	10	0.87932	D	0	.	15.1309	0.72523	0.0:1.0:0.0:0.0	.	100;100	P69892;P69891	HBG2_HUMAN;HBG1_HUMAN	Y	90;100;100;100	ENSP00000369602:D90Y;ENSP00000369609:D100Y;ENSP00000338082:D100Y	ENSP00000338082:D100Y	D	-	1	0	HBG2	5232115	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	5.460000	0.66691	2.184000	0.69523	0.650000	0.86243	GAT		0.502	HBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142967.2	NM_000184		21	49	1	0	4.4004e-07	0.00333	5.65419e-07	21	49				
SAAL1	113174	broad.mit.edu	37	11	18113861	18113861	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:18113861A>G	ENST00000524803.1	-	4	393	c.344T>C	c.(343-345)gTg>gCg	p.V115A	SAAL1_ENST00000533851.1_5'UTR|SAAL1_ENST00000300013.4_Missense_Mutation_p.V115A|SAAL1_ENST00000529318.1_Missense_Mutation_p.V115A			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	115								p.V115A(1)		breast(2)|large_intestine(5)|lung(8)	15						TAAAATTCCCACACAGATTTC	0.348																																							uc001mnq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(343-345)GTG>GCG		serum amyloid A-like 1							83.0	86.0	85.0					11																	18113861		2200	4293	6493	SO:0001583	missense	113174				acute-phase response	extracellular region	binding	g.chr11:18113861A>G	AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.344T>C	11.37:g.18113861A>G	ENSP00000432487:p.Val115Ala					SAAL1_uc001mnr.2_Missense_Mutation_p.V115A|SAAL1_uc001mns.2_RNA|SAAL1_uc009yhf.2_Missense_Mutation_p.V115A	p.V115A	NM_138421	NP_612430	Q96ER3	SAAL1_HUMAN			4	394	-			115					A6NH05	Missense_Mutation	SNP	ENST00000524803.1	37	c.344T>C	CCDS31439.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.700774	0.88924	.	.	ENSG00000166788	ENST00000524803;ENST00000300013;ENST00000531751;ENST00000529318;ENST00000530180	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.053606	0.64402	D	0.000001	T	0.64972	0.2647	M	0.73217	2.22	0.53005	D	0.99996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	T	0.68326	-0.5438	10	0.87932	D	0	-10.1334	16.2826	0.82703	1.0:0.0:0.0:0.0	.	115;115;115	E9PRZ1;G1UCX3;Q96ER3	.;.;SAAL1_HUMAN	A	115;115;4;115;115	ENSP00000432487:V115A;ENSP00000300013:V115A;ENSP00000436031:V4A;ENSP00000432216:V115A;ENSP00000431489:V115A	ENSP00000300013:V115A	V	-	2	0	SAAL1	18070437	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.145000	0.89625	2.307000	0.77673	0.528000	0.53228	GTG		0.348	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389728.1	NM_138421		12	29	0	0	0	0.013537	0	12	29				
NELL1	4745	broad.mit.edu	37	11	20949926	20949926	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:20949926G>A	ENST00000357134.5	+	9	1050	c.898G>A	c.(898-900)Ggt>Agt	p.G300S	NELL1_ENST00000298925.5_Missense_Mutation_p.G328S|NELL1_ENST00000532434.1_Missense_Mutation_p.G300S|NELL1_ENST00000325319.5_Missense_Mutation_p.G243S	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	300	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.G300S(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TCCTCAGAGTGGTGCCGTGGA	0.522																																							uc001mqe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(898-900)GGT>AGT		nel-like 1 isoform 1 precursor							186.0	150.0	162.0					11																	20949926		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:20949926G>A	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.898G>A	11.37:g.20949926G>A	ENSP00000349654:p.Gly300Ser					NELL1_uc001mqf.2_Missense_Mutation_p.G300S|NELL1_uc009yid.2_Missense_Mutation_p.G328S|NELL1_uc010rdo.1_Missense_Mutation_p.G243S|NELL1_uc010rdp.1_Missense_Mutation_p.G60S	p.G300S	NM_006157	NP_006148	Q92832	NELL1_HUMAN			9	1051	+			300			VWFC 1.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.898G>A	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352006	0.82132	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69	5.93	5.93	0.95920	von Willebrand factor, type C (4);	0.000000	0.85682	D	0.000000	D	0.86851	0.6032	M	0.86028	2.79	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.994;1.0	D	0.87360	0.2343	10	0.66056	D	0.02	-23.4376	20.328	0.98708	0.0:0.0:1.0:0.0	.	243;328;300;300	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	S	328;300;243;300	ENSP00000298925:G328S;ENSP00000349654:G300S;ENSP00000317837:G243S;ENSP00000437170:G300S	ENSP00000298925:G328S	G	+	1	0	NELL1	20906502	1.000000	0.71417	0.990000	0.47175	0.298000	0.27526	8.416000	0.90244	2.802000	0.96397	0.561000	0.74099	GGT		0.522	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		19	48	0	0	0	0.002299	0	19	48				
OR4A15	81328	broad.mit.edu	37	11	55136012	55136012	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:55136012C>A	ENST00000314706.3	+	1	653	c.653C>A	c.(652-654)aCc>aAc	p.T218N		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T218N(1)		NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						CTTGCTTGCACCAATACCTAT	0.413																																							uc010rif.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(652-654)ACC>AAC		olfactory receptor, family 4, subfamily A,							127.0	117.0	121.0					11																	55136012		2201	4296	6497	SO:0001583	missense	81328				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55136012C>A	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.653C>A	11.37:g.55136012C>A	ENSP00000325065:p.Thr218Asn						p.T218N	NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN			1	653	+			218			Extracellular (Potential).		Q6IFL4|Q96R65	Missense_Mutation	SNP	ENST00000314706.3	37	c.653C>A	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	-	9.552	1.116099	0.20795	.	.	ENSG00000181958	ENST00000314706	T	0.00174	8.62	3.65	0.512	0.16994	GPCR, rhodopsin-like superfamily (1);	0.123818	0.36444	N	0.002596	T	0.00356	0.0011	M	0.66378	2.025	0.25440	N	0.988104	D	0.56521	0.976	D	0.67548	0.952	T	0.48364	-0.9042	10	0.87932	D	0	.	5.3724	0.16146	0.0:0.6213:0.1683:0.2104	.	218	Q8NGL6	O4A15_HUMAN	N	218	ENSP00000325065:T218N	ENSP00000325065:T218N	T	+	2	0	OR4A15	54892588	0.000000	0.05858	0.414000	0.26521	0.047000	0.14425	-0.056000	0.11787	0.229000	0.21039	-0.464000	0.05259	ACC		0.413	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275		14	33	1	0	3.45872e-05	0.004007	4.0977e-05	14	33				
OR8K5	219453	broad.mit.edu	37	11	55927530	55927530	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:55927530A>T	ENST00000313447.1	-	1	263	c.264T>A	c.(262-264)gaT>gaA	p.D88E		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D88E(1)		large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				TAGTATTTCGATCCACAACAA	0.388																																							uc010rja.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(262-264)GAT>GAA		olfactory receptor, family 8, subfamily K,							101.0	100.0	100.0					11																	55927530		2201	4296	6497	SO:0001583	missense	219453				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55927530A>T	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.264T>A	11.37:g.55927530A>T	ENSP00000323853:p.Asp88Glu						p.D88E	NM_001004058	NP_001004058	Q8NH50	OR8K5_HUMAN			1	264	-	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)	88			Extracellular (Potential).		Q6IFB5	Missense_Mutation	SNP	ENST00000313447.1	37	c.264T>A	CCDS31521.1	.	.	.	.	.	.	.	.	.	.	A	4.733	0.136272	0.09032	.	.	ENSG00000181752	ENST00000313447	T	0.00630	6.1	3.88	-2.11	0.07187	GPCR, rhodopsin-like superfamily (1);	0.598087	0.15832	N	0.242460	T	0.00328	0.0010	N	0.05259	-0.085	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.44452	-0.9327	10	0.02654	T	1	.	5.7841	0.18322	0.4052:0.4202:0.1745:0.0	.	88	Q8NH50	OR8K5_HUMAN	E	88	ENSP00000323853:D88E	ENSP00000323853:D88E	D	-	3	2	OR8K5	55684106	0.000000	0.05858	0.294000	0.24946	0.469000	0.32828	-1.838000	0.01687	-0.109000	0.12044	0.462000	0.41574	GAT		0.388	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058		9	49	0	0	0	0.004482	0	9	49				
OR8K1	390157	broad.mit.edu	37	11	56114132	56114132	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:56114132G>T	ENST00000279783.2	+	1	712	c.618G>T	c.(616-618)ttG>ttT	p.L206F		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L206F(1)		large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					TAATAATTTTGATCTTCTCAG	0.373										HNSCC(65;0.19)																													uc010rjg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(616-618)TTG>TTT		olfactory receptor, family 8, subfamily K,							113.0	112.0	113.0					11																	56114132		2201	4296	6497	SO:0001583	missense	390157				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56114132G>T	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.618G>T	11.37:g.56114132G>T	ENSP00000279783:p.Leu206Phe	HNSCC(65;0.19)					p.L206F	NM_001002907	NP_001002907	Q8NGG5	OR8K1_HUMAN			1	618	+	Esophageal squamous(21;0.00448)		206			Helical; Name=5; (Potential).		B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	ENST00000279783.2	37	c.618G>T	CCDS31528.1	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.879479	0.00537	.	.	ENSG00000150261	ENST00000279783	T	0.00158	8.65	5.0	-0.854	0.10705	GPCR, rhodopsin-like superfamily (1);	0.179620	0.27164	N	0.020621	T	0.00039	0.0001	N	0.03209	-0.39	0.09310	N	1	B	0.21147	0.052	B	0.20384	0.029	T	0.42430	-0.9452	10	0.02654	T	1	-14.1306	2.0281	0.03523	0.2948:0.2863:0.3135:0.1054	.	206	Q8NGG5	OR8K1_HUMAN	F	206	ENSP00000279783:L206F	ENSP00000279783:L206F	L	+	3	2	OR8K1	55870708	0.000000	0.05858	0.068000	0.19968	0.072000	0.16883	-0.734000	0.04893	-0.137000	0.11455	-0.326000	0.08463	TTG		0.373	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907		12	50	1	0	3.03607e-14	0.013537	4.61351e-14	12	50				
DTX4	23220	broad.mit.edu	37	11	58949516	58949516	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:58949516G>T	ENST00000227451.3	+	2	620	c.516G>T	c.(514-516)caG>caT	p.Q172H	DTX4_ENST00000532982.1_Missense_Mutation_p.Q66H	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	172					innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.Q172H(1)|p.Q66H(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				CTAAGGCTCAGTCCTGGCCAG	0.657																																							uc001nns.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|central_nervous_system(1)	3						c.(514-516)CAG>CAT		deltex 4 homolog							42.0	48.0	46.0					11																	58949516		2108	4223	6331	SO:0001583	missense	23220				Notch signaling pathway	cytoplasm	zinc ion binding	g.chr11:58949516G>T	AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.516G>T	11.37:g.58949516G>T	ENSP00000227451:p.Gln172His					DTX4_uc001nnr.2_Missense_Mutation_p.Q66H	p.Q172H	NM_015177	NP_055992	Q9Y2E6	DTX4_HUMAN			2	773	+		all_epithelial(135;0.125)	172					Q0VF38	Missense_Mutation	SNP	ENST00000227451.3	37	c.516G>T	CCDS44612.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340221	0.24339	.	.	ENSG00000110042	ENST00000532982;ENST00000227451	T;T	0.14266	2.52;2.8	4.47	1.54	0.23209	.	0.467853	0.21226	N	0.078069	T	0.11024	0.0269	L	0.46741	1.465	0.30836	N	0.736169	B	0.12630	0.006	B	0.08055	0.003	T	0.12268	-1.0554	10	0.30854	T	0.27	.	7.671	0.28460	0.352:0.0:0.648:0.0	.	172	Q9Y2E6	DTX4_HUMAN	H	66;172	ENSP00000434055:Q66H;ENSP00000227451:Q172H	ENSP00000227451:Q172H	Q	+	3	2	DTX4	58706092	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	0.558000	0.23469	0.239000	0.21243	0.655000	0.94253	CAG		0.657	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394228.1	XM_166213		7	44	1	0	0.000157383	0.00308	0.000179756	7	44				
MPEG1	219972	broad.mit.edu	37	11	58978321	58978321	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:58978321G>A	ENST00000361050.3	-	1	2103	c.2018C>T	c.(2017-2019)aCc>aTc	p.T673I		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	673						integral component of membrane (GO:0016021)		p.T673I(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				GATGGCCAAGGTGATAACAAC	0.552																																							uc001nnu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2017-2019)ACC>ATC		macrophage expressed gene 1 precursor							129.0	132.0	131.0					11																	58978321		2047	4183	6230	SO:0001583	missense	219972					integral to membrane		g.chr11:58978321G>A	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.2018C>T	11.37:g.58978321G>A	ENSP00000354335:p.Thr673Ile						p.T673I	NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN			1	2174	-		all_epithelial(135;0.125)	673			Helical; (Potential).		Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	c.2018C>T	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	G	0.165	-1.077650	0.01903	.	.	ENSG00000197629	ENST00000361050	T	0.21734	1.99	5.69	1.79	0.24919	.	1.021400	0.07785	N	0.953961	T	0.16938	0.0407	L	0.40543	1.245	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.31998	-0.9923	10	0.44086	T	0.13	-0.2259	4.9808	0.14164	0.3195:0.1434:0.537:0.0	.	673	Q2M385	MPEG1_HUMAN	I	673	ENSP00000354335:T673I	ENSP00000354335:T673I	T	-	2	0	MPEG1	58734897	0.211000	0.23529	0.002000	0.10522	0.013000	0.08279	0.511000	0.22739	0.082000	0.17018	-0.768000	0.03414	ACC		0.552	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396		25	56	0	0	0	0.00278	0	25	56				
MPEG1	219972	broad.mit.edu	37	11	58980169	58980169	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:58980169A>G	ENST00000361050.3	-	1	255	c.170T>C	c.(169-171)gTg>gCg	p.V57A	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	57	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)		p.V57A(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				TCCCATGTCCACATTCCGCAG	0.478																																							uc001nnu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(169-171)GTG>GCG		macrophage expressed gene 1 precursor							164.0	165.0	164.0					11																	58980169		2021	4177	6198	SO:0001583	missense	219972					integral to membrane		g.chr11:58980169A>G	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.170T>C	11.37:g.58980169A>G	ENSP00000354335:p.Val57Ala						p.V57A	NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN			1	326	-		all_epithelial(135;0.125)	57			MACPF.|Extracellular (Potential).		Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	c.170T>C	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	A	13.94	2.386870	0.42308	.	.	ENSG00000197629	ENST00000361050;ENST00000545098	T	0.23147	1.92	5.41	5.41	0.78517	Membrane attack complex component/perforin (MACPF) domain (1);	0.182139	0.47455	D	0.000225	T	0.25269	0.0614	M	0.73598	2.24	0.31653	N	0.646582	P	0.43094	0.799	B	0.32762	0.152	T	0.49952	-0.8884	10	0.56958	D	0.05	-15.2766	9.6908	0.40127	0.8255:0.1745:0.0:0.0	.	57	Q2M385	MPEG1_HUMAN	A	57	ENSP00000354335:V57A	ENSP00000354335:V57A	V	-	2	0	MPEG1	58736745	1.000000	0.71417	0.987000	0.45799	0.989000	0.77384	6.650000	0.74368	2.074000	0.62210	0.524000	0.50904	GTG		0.478	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396		28	148	0	0	0	0.004656	0	28	148				
CD6	923	broad.mit.edu	37	11	60785469	60785469	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:60785469C>A	ENST00000313421.7	+	11	2007	c.1821C>A	c.(1819-1821)acC>acA	p.T607T	CD6_ENST00000452451.2_Silent_p.T566T|CD6_ENST00000346437.4_Silent_p.T534T|CD6_ENST00000344028.5_Silent_p.T575T|CD6_ENST00000352009.5_Silent_p.T575T	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	607					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)	p.T607T(2)		endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						TGGCCGGCACCCAGCCAGCCT	0.592																																					Pancreas(169;904 2017 4767 38890 42505)	Pancreas(169;904 2017 4767 38890 42505)	uc001nqq.2		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(1819-1821)ACC>ACA		CD6 molecule precursor							39.0	44.0	42.0					11																	60785469		2198	4292	6490	SO:0001819	synonymous_variant	923				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity	g.chr11:60785469C>A		CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1821C>A	11.37:g.60785469C>A						CD6_uc001nqp.2_Silent_p.T607T|CD6_uc001nqr.2_Silent_p.T575T|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Silent_p.T566T	p.T607T	NM_006725	NP_006716	P30203	CD6_HUMAN			11	2044	+			607			Cytoplasmic (Potential).		A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Silent	SNP	ENST00000313421.7	37	c.1821C>A	CCDS7999.1																																																																																				0.592	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1	NM_006725		13	67	1	0	2.23348e-06	0.004007	2.7829e-06	13	67				
DAGLA	747	broad.mit.edu	37	11	61511175	61511175	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:61511175G>T	ENST00000257215.5	+	20	2459	c.2343G>T	c.(2341-2343)gaG>gaT	p.E781D	RP11-467L20.10_ENST00000536405.1_lincRNA	NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	781					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.E781D(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CCACCATGGAGAGCCTCTCGG	0.721																																							uc001nsa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(2341-2343)GAG>GAT		neural stem cell-derived dendrite regulator							24.0	29.0	27.0					11																	61511175		2076	4091	6167	SO:0001583	missense	747				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity	g.chr11:61511175G>T	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2343G>T	11.37:g.61511175G>T	ENSP00000257215:p.Glu781Asp						p.E781D	NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN		READ - Rectum adenocarcinoma(4;0.219)	20	2454	+			781			Cytoplasmic (Potential).		A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	37	c.2343G>T	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692716	0.68271	.	.	ENSG00000134780	ENST00000257215	T	0.27104	1.69	3.11	2.2	0.27929	.	0.054481	0.64402	D	0.000001	T	0.31544	0.0800	N	0.24115	0.695	0.51233	D	0.999919	D	0.58970	0.984	D	0.65443	0.935	T	0.08006	-1.0743	10	0.66056	D	0.02	-27.7897	10.7595	0.46256	0.0968:0.0:0.9032:0.0	.	781	Q9Y4D2	DGLA_HUMAN	D	781	ENSP00000257215:E781D	ENSP00000257215:E781D	E	+	3	2	DAGLA	61267751	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.278000	0.58946	0.895000	0.36342	0.491000	0.48974	GAG		0.721	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133		13	44	1	0	4.93089e-13	0.00245	7.33339e-13	13	44				
SF1	7536	broad.mit.edu	37	11	64536578	64536578	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:64536578G>A	ENST00000377390.3	-	8	1140	c.803C>T	c.(802-804)tCa>tTa	p.S268L	SF1_ENST00000489544.1_5'UTR|SF1_ENST00000433274.2_Missense_Mutation_p.S242L|SF1_ENST00000227503.9_Missense_Mutation_p.S268L|SF1_ENST00000377387.1_Missense_Mutation_p.S393L|SF1_ENST00000334944.5_Missense_Mutation_p.S268L|SF1_ENST00000422298.2_Missense_Mutation_p.S153L|SF1_ENST00000377394.3_Missense_Mutation_p.S268L	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	268					Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.S268L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						GCGGGTCTCTGAGCTCTGCCA	0.488																																							uc001obb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(802-804)TCA>TTA		splicing factor 1 isoform 1							132.0	137.0	136.0					11																	64536578		2201	4297	6498	SO:0001583	missense	7536				nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding	g.chr11:64536578G>A	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.803C>T	11.37:g.64536578G>A	ENSP00000366607:p.Ser268Leu					SF1_uc010rnm.1_5'UTR|SF1_uc010rnn.1_Missense_Mutation_p.S242L|SF1_uc001oaz.1_Missense_Mutation_p.S393L|SF1_uc001oba.1_Missense_Mutation_p.S268L|SF1_uc001obc.1_Missense_Mutation_p.S268L|SF1_uc001obd.1_Missense_Mutation_p.S268L|SF1_uc001obe.1_Missense_Mutation_p.S153L|SF1_uc010rno.1_Missense_Mutation_p.S153L	p.S268L	NM_004630	NP_004621	Q15637	SF01_HUMAN			8	1180	-			268					B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	ENST00000377390.3	37	c.803C>T	CCDS31599.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.674843	0.88445	.	.	ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000377394;ENST00000334944;ENST00000422298;ENST00000433274	T;T;T;T;T;T;T	0.46063	0.89;0.9;0.9;0.9;0.88;0.9;0.9	5.81	5.81	0.92471	.	0.268407	0.37809	N	0.001935	T	0.38188	0.1031	N	0.22421	0.69	0.58432	D	0.999998	P;P;P;P;P;P	0.43633	0.716;0.683;0.683;0.716;0.813;0.813	B;B;B;B;B;B	0.44224	0.203;0.256;0.181;0.219;0.391;0.444	T	0.29822	-0.9999	10	0.87932	D	0	.	17.5751	0.87946	0.0:0.0:1.0:0.0	.	153;268;268;268;268;393	B4DX42;Q15637-6;Q15637-4;Q15637;Q15637-2;Q15637-5	.;.;.;SF01_HUMAN;.;.	L	393;268;268;268;268;153;242	ENSP00000366604:S393L;ENSP00000366607:S268L;ENSP00000227503:S268L;ENSP00000366611:S268L;ENSP00000334414:S268L;ENSP00000413084:S153L;ENSP00000396793:S242L	ENSP00000227503:S268L	S	-	2	0	SF1	64293154	1.000000	0.71417	0.989000	0.46669	0.989000	0.77384	9.384000	0.97219	2.752000	0.94435	0.557000	0.71058	TCA		0.488	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630		29	119	0	0	0	0.007291	0	29	119				
SYVN1	84447	broad.mit.edu	37	11	64899785	64899785	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:64899785G>A	ENST00000377190.3	-	6	559	c.465C>T	c.(463-465)ttC>ttT	p.F155F	SYVN1_ENST00000526121.1_5'UTR|SYVN1_ENST00000526060.1_Silent_p.F155F|SYVN1_ENST00000307289.6_Intron|SYVN1_ENST00000294256.8_Silent_p.F155F	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	155					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)	p.F155F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CGTGGCTGACGAAGAGGAAGT	0.592																																							uc001odb.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(463-465)TTC>TTT		synoviolin 1 isoform b							100.0	96.0	98.0					11																	64899785		2201	4297	6498	SO:0001819	synonymous_variant	84447				ER-associated protein catabolic process|response to stress	endoplasmic reticulum membrane|integral to membrane|nucleus	acid-amino acid ligase activity|protein binding|zinc ion binding	g.chr11:64899785G>A	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.465C>T	11.37:g.64899785G>A						SYVN1_uc001odc.2_Silent_p.F155F|SYVN1_uc009yqc.2_Intron	p.F155F	NM_172230	NP_757385	Q86TM6	SYVN1_HUMAN			6	559	-			155			Helical; (Potential).		Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Silent	SNP	ENST00000377190.3	37	c.465C>T	CCDS31605.1																																																																																				0.592	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431		20	55	0	0	0	0.012319	0	20	55				
RIN1	9610	broad.mit.edu	37	11	66102525	66102525	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:66102525C>T	ENST00000311320.4	-	6	871	c.745G>A	c.(745-747)Gtg>Atg	p.V249M	RIN1_ENST00000530056.1_Missense_Mutation_p.V144M|RIN1_ENST00000524804.1_5'Flank|RP11-867G23.12_ENST00000526655.1_RNA|RIN1_ENST00000424433.2_Missense_Mutation_p.V144M	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	249					associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.V249M(1)		breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						TCTGTGGACACGCGCACTTTG	0.672																																							uc001ohn.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|breast(1)	3						c.(745-747)GTG>ATG		ras inhibitor RIN1							57.0	53.0	55.0					11																	66102525		2200	4295	6495	SO:0001583	missense	9610				endocytosis|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase activator activity|protein binding	g.chr11:66102525C>T	L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.745G>A	11.37:g.66102525C>T	ENSP00000310406:p.Val249Met					RIN1_uc010roy.1_Translation_Start_Site|RIN1_uc009yrd.1_Translation_Start_Site|RIN1_uc010roz.1_Missense_Mutation_p.V144M|RIN1_uc010rpa.1_Missense_Mutation_p.V144M	p.V249M	NM_004292	NP_004283	Q13671	RIN1_HUMAN			6	872	-			249					O15010|Q00427|Q96CC8	Missense_Mutation	SNP	ENST00000311320.4	37	c.745G>A	CCDS31614.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019295	0.75275	.	.	ENSG00000174791	ENST00000311320;ENST00000424433;ENST00000530056	T;T;T	0.15718	2.96;2.82;2.4	4.43	4.43	0.53597	.	0.090894	0.43747	D	0.000522	T	0.36441	0.0967	L	0.59436	1.845	0.33927	D	0.64155	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.959	T	0.51702	-0.8672	10	0.72032	D	0.01	-18.8396	12.9046	0.58145	0.0:1.0:0.0:0.0	.	144;249	E9PNR2;Q13671	.;RIN1_HUMAN	M	249;144;144	ENSP00000310406:V249M;ENSP00000400560:V144M;ENSP00000432798:V144M	ENSP00000310406:V249M	V	-	1	0	RIN1	65859101	0.958000	0.32768	0.914000	0.36105	0.955000	0.61496	2.305000	0.43664	2.183000	0.69458	0.462000	0.41574	GTG		0.672	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392980.2	NM_004292		7	44	0	0	0	0.001984	0	7	44				
SPTBN2	6712	broad.mit.edu	37	11	66461658	66461658	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:66461658C>A	ENST00000533211.1	-	22	4786	c.4455G>T	c.(4453-4455)caG>caT	p.Q1485H	SPTBN2_ENST00000529997.1_Missense_Mutation_p.Q1485H|SPTBN2_ENST00000309996.2_Missense_Mutation_p.Q1485H			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1485					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.Q1485H(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CGCGAGAAGCCTGCAGGCGCC	0.647											OREG0021113	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001ojd.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(4453-4455)CAG>CAT		spectrin, beta, non-erythrocytic 2							63.0	60.0	61.0					11																	66461658		2200	4295	6495	SO:0001583	missense	6712				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton	g.chr11:66461658C>A	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.4455G>T	11.37:g.66461658C>A	ENSP00000432568:p.Gln1485His		OREG0021113	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1092		p.Q1485H	NM_006946	NP_008877	O15020	SPTN2_HUMAN			21	4527	-			1485			Spectrin 11.		O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	c.4455G>T	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.195088	0.38806	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.52295	0.67;0.67;0.67	4.63	-4.78	0.03209	.	0.237802	0.36234	N	0.002716	T	0.34716	0.0907	L	0.27053	0.805	0.20873	N	0.999832	P	0.44521	0.837	P	0.49477	0.612	T	0.41716	-0.9493	10	0.59425	D	0.04	.	6.7812	0.23646	0.0:0.2736:0.2255:0.5009	.	1485	O15020	SPTN2_HUMAN	H	1485	ENSP00000432568:Q1485H;ENSP00000311489:Q1485H;ENSP00000433593:Q1485H	ENSP00000311489:Q1485H	Q	-	3	2	SPTBN2	66218234	0.001000	0.12720	0.741000	0.31004	0.948000	0.59901	-1.490000	0.02304	-1.420000	0.02009	-0.251000	0.11542	CAG		0.647	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946		13	54	1	0	2.27111e-07	0.013537	2.94528e-07	13	54				
MRGPRF	116535	broad.mit.edu	37	11	68777421	68777421	+	De_novo_Start_OutOfFrame	SNP	C	C	T	rs368963464		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:68777421C>T	ENST00000309099.6	-	0	331				RP11-554A11.6_ENST00000569428.1_RNA|RP11-554A11.6_ENST00000569432.1_RNA|MRGPRF_ENST00000320913.6_De_novo_Start_OutOfFrame|RP11-554A11.6_ENST00000538407.2_RNA|MRGPRF_ENST00000441623.1_De_novo_Start_OutOfFrame	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			AGTCTGCACACCCACCTGGCA	0.672																																							uc001ooo.3		NA																	0					0						c.(-53--49)GGGTG>GGATG		MAS-related GPR, member F							51.0	46.0	48.0					11																	68777421		1327	2309	3636			116535					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:68777421C>T	AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.-52G>A	11.37:g.68777421C>T						MRGPRF_uc001oop.3_Translation_Start_Site|uc001ooq.2_5'Flank		NM_001098515	NP_001091985	Q96AM1	MRGRF_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		2	316	-								B3KV43|Q8NBK8	Translation_Start_Site	SNP	ENST00000309099.6	37	c.-51G>A	CCDS8188.1																																																																																				0.672	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396875.1	NM_145015		16	40	0	0	0	0.003163	0	16	40				
B3GNT6	192134	broad.mit.edu	37	11	76750737	76750737	+	Missense_Mutation	SNP	C	C	A	rs558213415		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:76750737C>A	ENST00000533140.1	+	2	280	c.142C>A	c.(142-144)Cca>Aca	p.P48T	B3GNT6_ENST00000354301.5_Missense_Mutation_p.P48T|B3GNT6_ENST00000421061.1_Silent_p.R31R			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)	p.P48T(2)		central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGAGGAGACGCCAGAGGGTCC	0.731											OREG0021252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		12225	0.001		0.0	False		,,,				2504	0.0						uc001oxw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(142-144)CCA>ACA		UDP-GlcNAc:betaGal							15.0	16.0	16.0					11																	76750737		1883	4083	5966	SO:0001583	missense	192134				O-glycan processing, core 3	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity|galactosyltransferase activity	g.chr11:76750737C>A	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.142C>A	11.37:g.76750737C>A	ENSP00000435352:p.Pro48Thr		OREG0021252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1170		p.P48T	NM_138706	NP_619651	Q6ZMB0	B3GN6_HUMAN			2	230	+			48			Lumenal (Potential).		Q4TTN0	Missense_Mutation	SNP	ENST00000533140.1	37	c.142C>A	CCDS53681.1	.	.	.	.	.	.	.	.	.	.	C	8.812	0.935465	0.18206	.	.	ENSG00000198488	ENST00000533140;ENST00000354301;ENST00000528622	T;T	0.27256	1.68;1.69	2.92	-5.85	0.02311	.	2.909720	0.01328	N	0.011174	T	0.13586	0.0329	N	0.19112	0.55	0.09310	N	0.999999	B	0.15141	0.012	B	0.14578	0.011	T	0.12734	-1.0536	10	0.44086	T	0.13	.	1.6274	0.02726	0.1347:0.2968:0.362:0.2065	.	48	Q6ZMB0	B3GN6_HUMAN	T	48	ENSP00000435352:P48T;ENSP00000346256:P48T	ENSP00000346256:P48T	P	+	1	0	B3GNT6	76428385	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.287000	0.01151	-1.219000	0.02597	-0.314000	0.08810	CCA		0.731	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706		6	17	1	0	0.00116845	0.001168	0.00128016	6	17				
FAT3	120114	broad.mit.edu	37	11	92495238	92495238	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:92495238G>T	ENST00000298047.6	+	4	3903	c.3886G>T	c.(3886-3888)Gtg>Ttg	p.V1296L	RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000409404.2_Missense_Mutation_p.V1296L|FAT3_ENST00000525166.1_Missense_Mutation_p.V1146L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1296	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V1296L(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTACAGTATTGTGGATGGGAA	0.453										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(3886-3888)GTG>TTG		FAT tumor suppressor homolog 3							104.0	102.0	102.0					11																	92495238		1876	4108	5984	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92495238G>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3886G>T	11.37:g.92495238G>T	ENSP00000298047:p.Val1296Leu	TCGA Ovarian(4;0.039)					p.V1296L	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			4	3903	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	1296			Cadherin 12.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.3886G>T		.	.	.	.	.	.	.	.	.	.	G	14.80	2.643487	0.47258	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.43294	0.95;0.95;0.95	5.58	4.67	0.58626	.	.	.	.	.	T	0.34366	0.0895	N	0.25332	0.735	0.80722	D	1	P	0.49090	0.919	P	0.44359	0.447	T	0.07102	-1.0790	9	0.34782	T	0.22	.	14.228	0.65873	0.0713:0.0:0.9287:0.0	.	1296	Q8TDW7-3	.	L	1296;1296;1146	ENSP00000298047:V1296L;ENSP00000387040:V1296L;ENSP00000432586:V1146L	ENSP00000298047:V1296L	V	+	1	0	FAT3	92134886	1.000000	0.71417	0.996000	0.52242	0.951000	0.60555	5.705000	0.68355	1.356000	0.45884	0.563000	0.77884	GTG		0.453	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		23	150	1	0	7.87624e-14	0.00278	1.18909e-13	23	150				
AMOTL1	154810	broad.mit.edu	37	11	94554901	94554901	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:94554901C>A	ENST00000433060.2	+	4	1468	c.1327C>A	c.(1327-1329)Caa>Aaa	p.Q443K	AMOTL1_ENST00000317837.9_Intron|AMOTL1_ENST00000539727.1_3'UTR|AMOTL1_ENST00000317829.8_Missense_Mutation_p.Q393K	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	443					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)	p.Q443K(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				GCGAGCCCAGCAAATGGTGGA	0.602																																							uc001pfb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1327-1329)CAA>AAA		angiomotin like 1							76.0	80.0	79.0					11																	94554901		1971	4158	6129	SO:0001583	missense	154810					cytoplasm|tight junction	identical protein binding	g.chr11:94554901C>A	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.1327C>A	11.37:g.94554901C>A	ENSP00000387739:p.Gln443Lys					AMOTL1_uc001pfc.2_Missense_Mutation_p.Q393K	p.Q443K	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN			4	1497	+		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)	443			Potential.		Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	c.1327C>A	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.149889	0.78001	.	.	ENSG00000166025	ENST00000317829;ENST00000542840;ENST00000433060	T;T	0.14893	2.47;2.47	5.68	5.68	0.88126	.	0.078292	0.53938	D	0.000044	T	0.27731	0.0682	L	0.40543	1.245	0.80722	D	1	P;B	0.45283	0.855;0.094	P;B	0.52109	0.69;0.04	T	0.00236	-1.1891	10	0.28530	T	0.3	-26.5855	19.7951	0.96477	0.0:1.0:0.0:0.0	.	393;443	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	K	393;449;443	ENSP00000320968:Q393K;ENSP00000387739:Q443K	ENSP00000320968:Q393K	Q	+	1	0	AMOTL1	94194549	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.503000	0.81632	2.698000	0.92095	0.561000	0.74099	CAA		0.602	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847		22	126	1	0	4.26978e-12	0.00333	6.23084e-12	22	126				
MMP27	64066	broad.mit.edu	37	11	102562551	102562551	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:102562551G>A	ENST00000260229.4	-	10	1579	c.1488C>T	c.(1486-1488)agC>agT	p.S496S		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	496	Required for retention in the endoplasmic reticulum. {ECO:0000269|PubMed:24548619}.				collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S496S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	AAATAAACAAGCTTAAACTCT	0.284																																							uc001phd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(1486-1488)AGC>AGT		matrix metalloproteinase 27 precursor							109.0	108.0	108.0					11																	102562551		2202	4295	6497	SO:0001819	synonymous_variant	64066				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102562551G>A	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.1488C>T	11.37:g.102562551G>A							p.S496S	NM_022122	NP_071405	Q9H306	MMP27_HUMAN	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	10	1511	-	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	496					Q6UWK6	Silent	SNP	ENST00000260229.4	37	c.1488C>T	CCDS8319.1																																																																																				0.284	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122		21	41	0	0	0	0.008871	0	21	41				
CASP1	834	broad.mit.edu	37	11	104897650	104897650	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:104897650C>A	ENST00000533400.1	-	8	1070	c.1035G>T	c.(1033-1035)atG>atT	p.M345I	CASP1_ENST00000526568.1_Missense_Mutation_p.M252I|CASP1_ENST00000527979.1_Missense_Mutation_p.M308I|CASP1_ENST00000525825.1_Missense_Mutation_p.M324I|CASP1_ENST00000598974.1_Missense_Mutation_p.M345I|CASP1_ENST00000593315.1_Missense_Mutation_p.M324I|CASP1_ENST00000446369.1_Missense_Mutation_p.M204I|CASP1_ENST00000353247.5_Missense_Mutation_p.M29I|CASP1_ENST00000531166.1_Missense_Mutation_p.M29I|CASP1_ENST00000393136.4_Missense_Mutation_p.M324I|CASP1_ENST00000436863.3_Missense_Mutation_p.M345I|CASP1_ENST00000528974.1_3'UTR|CASP1_ENST00000594519.1_Missense_Mutation_p.M204I|CASP1_ENST00000415981.2_Missense_Mutation_p.M29I|CASP1_ENST00000534497.1_Missense_Mutation_p.M204I	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	345					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)	p.M345I(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	AAACAGAGCCCATTGTGGGAT	0.398																																					NSCLC(41;1246 1743 4934)	NSCLC(41;1246 1743 4934)	uc010rve.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1033-1035)ATG>ATT		caspase 1 isoform alpha precursor	Minocycline(DB01017)|Penicillamine(DB00859)						102.0	96.0	98.0					11																	104897650		2202	4299	6501	SO:0001583	missense	834				cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding	g.chr11:104897650C>A	U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.1035G>T	11.37:g.104897650C>A	ENSP00000433138:p.Met345Ile					CASP1_uc001pig.2_Missense_Mutation_p.M252I|CASP1_uc001pik.2_Missense_Mutation_p.M308I|CASP1_uc010rvf.1_Missense_Mutation_p.M252I|CASP1_uc010rvg.1_Missense_Mutation_p.M324I|CASP1_uc010rvh.1_Missense_Mutation_p.M204I|CASP1_uc010rvi.1_Missense_Mutation_p.M29I|CASP1_uc001pim.3_Missense_Mutation_p.M345I|CASP1_uc009yxi.2_Missense_Mutation_p.M324I|CASP1_uc010rvj.1_Missense_Mutation_p.M345I|CASP1_uc009yxj.2_Missense_Mutation_p.M190I|CASP1_uc010rvk.1_3'UTR	p.M345I	NM_033292	NP_150634	P29466	CASP1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	8	1052	-		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)	345					B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	ENST00000533400.1	37	c.1035G>T	CCDS8330.1	.	.	.	.	.	.	.	.	.	.	.	10.63	1.404839	0.25378	.	.	ENSG00000137752	ENST00000532439;ENST00000526568;ENST00000527979;ENST00000533400;ENST00000436863;ENST00000415981;ENST00000446369;ENST00000353247;ENST00000393136;ENST00000525825;ENST00000531166;ENST00000534497	T;T;T;T;T;T;T;T;T;T;T;T	0.40756	2.08;2.08;2.08;2.08;2.08;2.08;1.02;2.08;2.08;2.08;2.08;1.02	4.06	-0.4	0.12411	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (2);	5.147880	0.00481	N	0.000135	T	0.27765	0.0683	N	0.19112	0.55	0.09310	N	0.999998	B;B;B;B;B;B;B	0.15930	0.015;0.001;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.09377	0.004;0.001;0.001;0.001;0.001;0.001;0.001	T	0.16571	-1.0398	10	0.49607	T	0.09	.	3.1864	0.06602	0.3072:0.4524:0.1496:0.0908	.	29;204;345;324;345;308;252	P29466-5;P29466-4;A8K249;P29466-2;P29466;G3V169;P29466-3	.;.;.;.;CASP1_HUMAN;.;.	I	194;252;308;345;345;29;204;29;324;324;29;204	ENSP00000435536:M194I;ENSP00000434250:M252I;ENSP00000432340:M308I;ENSP00000433138:M345I;ENSP00000410076:M345I;ENSP00000408446:M29I;ENSP00000403260:M204I;ENSP00000344132:M29I;ENSP00000376844:M324I;ENSP00000434779:M324I;ENSP00000434303:M29I;ENSP00000436875:M204I	ENSP00000344132:M29I	M	-	3	0	CASP1	104402860	0.000000	0.05858	0.055000	0.19348	0.168000	0.22595	-1.411000	0.02478	-0.164000	0.10927	0.460000	0.39030	ATG		0.398	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	NM_033292		12	29	1	0	5.50884e-06	0.013537	6.6852e-06	12	29				
MSANTD4	84437	broad.mit.edu	37	11	105881245	105881245	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:105881245C>A	ENST00000301919.4	-	2	1815	c.400G>T	c.(400-402)Gca>Tca	p.A134S	MSANTD4_ENST00000529805.1_5'Flank	NM_032424.1	NP_115800.1	Q8NCY6	MSD4_HUMAN	Myb/SANT-like DNA-binding domain containing 4 with coiled-coils	134						nucleus (GO:0005634)		p.A134S(1)									GATCCACCTGCATCCCTGAAA	0.423																																							uc001piy.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(400-402)GCA>TCA		hypothetical protein LOC84437							136.0	139.0	138.0					11																	105881245		2201	4299	6500	SO:0001583	missense	84437					nucleus		g.chr11:105881245C>A	AB058729	CCDS31663.1	11q22	2012-03-13	2012-03-13	2012-03-13	ENSG00000170903	ENSG00000170903			29383	protein-coding gene	gene with protein product			"""KIAA1826"""	KIAA1826			Standard	XM_005271697		Approved		uc001piz.3	Q8NCY6	OTTHUMG00000166240	ENST00000301919.4:c.400G>T	11.37:g.105881245C>A	ENSP00000304713:p.Ala134Ser					KIAA1826_uc001piz.2_Missense_Mutation_p.A134S	p.A134S	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)	2	573	-		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)	134					Q96JK1|Q96JZ3|Q9H2N4	Missense_Mutation	SNP	ENST00000301919.4	37	c.400G>T	CCDS31663.1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160056	0.38119	.	.	ENSG00000170903	ENST00000301919;ENST00000530788	.	.	.	5.58	4.66	0.58398	.	0.229627	0.43579	D	0.000555	T	0.57431	0.2053	L	0.51422	1.61	0.43191	D	0.99502	B	0.28026	0.198	B	0.24701	0.055	T	0.56013	-0.8049	9	0.38643	T	0.18	-22.2459	16.4766	0.84134	0.0:0.7535:0.2465:0.0	.	134	Q8NCY6	K1826_HUMAN	S	134	.	ENSP00000304713:A134S	A	-	1	0	KIAA1826	105386455	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.182000	0.32029	1.478000	0.48253	0.561000	0.74099	GCA		0.423	MSANTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388619.1	NM_032424		59	48	1	0	2.20561e-19	0.00361	3.54419e-19	59	48				
NXPE4	54827	broad.mit.edu	37	11	114441811	114441811	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:114441811T>A	ENST00000375478.3	-	6	1664	c.1484A>T	c.(1483-1485)cAa>cTa	p.Q495L	NXPE4_ENST00000424261.2_Missense_Mutation_p.Q211L	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	495						extracellular vesicular exosome (GO:0070062)		p.Q495L(1)									GATGAGATATTGAATGTAACC	0.378																																							uc001ppc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1483-1485)CAA>CTA		hypothetical protein LOC54827 isoform 1							176.0	160.0	165.0					11																	114441811		1902	4124	6026	SO:0001583	missense	54827					extracellular region		g.chr11:114441811T>A	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.1484A>T	11.37:g.114441811T>A	ENSP00000364627:p.Gln495Leu					FAM55D_uc001ppd.2_Missense_Mutation_p.Q211L	p.Q495L	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)	6	1665	-		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)	495					Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	c.1484A>T	CCDS41718.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.861369	0.51482	.	.	ENSG00000137634	ENST00000424261;ENST00000375478	T;T	0.22539	1.95;1.95	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000018	T	0.31606	0.0802	L	0.32530	0.975	0.35637	D	0.810678	D	0.67145	0.996	D	0.72625	0.978	T	0.14420	-1.0473	10	0.09843	T	0.71	.	14.9325	0.70926	0.0:0.0:0.0:1.0	.	495	Q6UWF7	FA55D_HUMAN	L	211;495	ENSP00000401503:Q211L;ENSP00000364627:Q495L	ENSP00000364627:Q495L	Q	-	2	0	FAM55D	113947021	0.939000	0.31865	0.028000	0.17463	0.622000	0.37654	2.858000	0.48356	2.258000	0.74832	0.533000	0.62120	CAA		0.378	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678		18	59	0	0	0	0.010504	0	18	59				
TMPRSS4	56649	broad.mit.edu	37	11	117985987	117985987	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:117985987A>T	ENST00000437212.3	+	11	1358	c.1144A>T	c.(1144-1146)Acc>Tcc	p.T382S	TMPRSS4_ENST00000518413.2_Intron|TMPRSS4_ENST00000523251.1_Missense_Mutation_p.T342S|TMPRSS4_ENST00000522307.1_Missense_Mutation_p.T235S|TMPRSS4_ENST00000522824.1_Missense_Mutation_p.T377S|TMPRSS4_ENST00000534111.1_Missense_Mutation_p.T380S			Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4	382	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.T382S(1)		breast(2)|central_nervous_system(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		GGGTGTGGACACCTGCCAGGT	0.557																																							uc010rxo.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|central_nervous_system(1)	2						c.(1144-1146)ACC>TCC		transmembrane protease, serine 4 isoform 1							54.0	49.0	51.0					11																	117985987		2200	4296	6496	SO:0001583	missense	56649				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr11:117985987A>T	AF179224	CCDS31684.1, CCDS44743.1, CCDS53716.1, CCDS53717.1	11q23.3	2010-04-13			ENSG00000137648	ENSG00000137648		"""Serine peptidases / Transmembrane"""	11878	protein-coding gene	gene with protein product	"""transmembrane serine protease 3"", ""membrane-type serine protease 2"", ""type II membrane serine protease"""	606565				10825129	Standard	NM_001083947		Approved	TMPRSS3, MT-SP2	uc021qrd.1	Q9NRS4	OTTHUMG00000164122	ENST00000437212.3:c.1144A>T	11.37:g.117985987A>T	ENSP00000416037:p.Thr382Ser					TMPRSS4_uc010rxp.1_Missense_Mutation_p.T377S|TMPRSS4_uc010rxq.1_Missense_Mutation_p.T235S|TMPRSS4_uc010rxr.1_Missense_Mutation_p.T357S|TMPRSS4_uc010rxs.1_Missense_Mutation_p.T342S|TMPRSS4_uc009yzu.2_Intron|TMPRSS4_uc010rxt.1_Missense_Mutation_p.T357S	p.T382S	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)	11	1435	+	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)	382			Extracellular (Potential).|Peptidase S1.		A8MU84|B0YJB0|B7Z8C5|E7ERX8|Q5XKQ6|Q6UX37|Q9NZA5	Missense_Mutation	SNP	ENST00000437212.3	37	c.1144A>T	CCDS31684.1	.	.	.	.	.	.	.	.	.	.	A	10.04	1.241006	0.22711	.	.	ENSG00000137648	ENST00000534111;ENST00000522307;ENST00000523251;ENST00000437212;ENST00000522824	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	5.26	2.91	0.33838	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.205916	0.34025	N	0.004340	T	0.28532	0.0706	N	0.03177	-0.4	0.41003	D	0.984945	B;B;P;B;P	0.42973	0.411;0.411;0.624;0.223;0.796	B;B;B;B;B	0.40444	0.225;0.225;0.329;0.163;0.326	T	0.08638	-1.0712	10	0.10111	T	0.7	.	9.0929	0.36621	0.8423:0.0:0.1577:0.0	.	357;342;235;382;380	B7Z900;E7ERX8;E7ESG9;Q9NRS4;Q9NRS4-3	.;.;.;TMPS4_HUMAN;.	S	380;235;342;382;377	ENSP00000435184:T380S;ENSP00000428814:T235S;ENSP00000429209:T342S;ENSP00000416037:T382S;ENSP00000430547:T377S	ENSP00000416037:T382S	T	+	1	0	TMPRSS4	117491197	0.989000	0.36119	1.000000	0.80357	0.424000	0.31475	0.322000	0.19576	0.845000	0.35118	-0.379000	0.06801	ACC		0.557	TMPRSS4-004	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377328.2	NM_019894		8	73	0	0	0	0.006214	0	8	73				
ARCN1	372	broad.mit.edu	37	11	118463522	118463522	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:118463522G>T	ENST00000264028.4	+	7	1178	c.1083G>T	c.(1081-1083)gtG>gtT	p.V361V	RNU6-1157P_ENST00000384456.1_RNA|ARCN1_ENST00000392859.3_Silent_p.V273V|ARCN1_ENST00000359415.4_Silent_p.V402V|ARCN1_ENST00000534182.2_Intron	NM_001655.4	NP_001646.2	P48444	COPD_HUMAN	archain 1	361	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer maturation (GO:0021691)|COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pigmentation (GO:0043473)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	clathrin adaptor complex (GO:0030131)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.V361V(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|urinary_tract(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		ACGTAGGGGTGCTAAAGTGGA	0.433																																							uc001ptq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1081-1083)GTG>GTT		archain isoform 1							181.0	186.0	184.0					11																	118463522		2200	4295	6495	SO:0001819	synonymous_variant	372				COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	clathrin adaptor complex|COPI vesicle coat|cytosol		g.chr11:118463522G>T	X81197	CCDS8400.1, CCDS44749.1	11q23.3	2010-04-21	2003-01-29		ENSG00000095139	ENSG00000095139			649	protein-coding gene	gene with protein product		600820	"""coatomer protein complex, subunit delta"""	COPD		7782067, 8854871	Standard	NM_001655		Approved		uc001ptq.3	P48444	OTTHUMG00000166340	ENST00000264028.4:c.1083G>T	11.37:g.118463522G>T						ARCN1_uc009zah.2_Intron|ARCN1_uc010ryg.1_Silent_p.V273V|ARCN1_uc009zag.2_Silent_p.V402V	p.V361V	NM_001655	NP_001646	P48444	COPD_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)	7	1244	+	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)	361			MHD.		B4E1X2|E9PEU4|Q52M80	Silent	SNP	ENST00000264028.4	37	c.1083G>T	CCDS8400.1																																																																																				0.433	ARCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389278.1			306	173	1	0	6.77638e-166	0.00361	1.17245e-165	306	173				
ABCG4	64137	broad.mit.edu	37	11	119029413	119029413	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:119029413C>A	ENST00000449422.2	+	11	1502	c.1314C>A	c.(1312-1314)gcC>gcA	p.A438A	ABCG4_ENST00000531739.1_Silent_p.A438A|AP002956.1_ENST00000599663.1_5'Flank|ABCG4_ENST00000307417.3_Silent_p.A438A	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	438	ABC transmembrane type-2.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.A438A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		TGTTCGCCGCCCTCATGCCAA	0.627																																							uc001pvs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1312-1314)GCC>GCA		ATP-binding cassette, subfamily G, member 4							105.0	92.0	96.0					11																	119029413		2200	4295	6495	SO:0001819	synonymous_variant	64137				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:119029413C>A	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1314C>A	11.37:g.119029413C>A						ABCG4_uc009zar.2_Silent_p.A438A	p.A438A	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)	11	1650	+	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	438			Helical; Name=2; (Potential).|ABC transmembrane type-2.		A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Silent	SNP	ENST00000449422.2	37	c.1314C>A	CCDS8415.1																																																																																				0.627	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169		117	59	1	0	2.54773e-45	0.00361	4.36486e-45	117	59				
POU2F3	25833	broad.mit.edu	37	11	120175760	120175760	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:120175760C>T	ENST00000543440.2	+	7	616	c.466C>T	c.(466-468)Cca>Tca	p.P156S	POU2F3_ENST00000260264.4_Missense_Mutation_p.P158S	NM_014352.3	NP_055167.2	Q9UKI9	PO2F3_HUMAN	POU class 2 homeobox 3	156					epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|negative regulation by host of viral transcription (GO:0043922)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.P156S(1)		large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)	17		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		CCCTGGGCTGCCAGGATCCTC	0.488																																							uc001pxc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(466-468)CCA>TCA		POU transcription factor							61.0	65.0	64.0					11																	120175760		2203	4299	6502	SO:0001583	missense	25833				negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding	g.chr11:120175760C>T	AF133895	CCDS8431.1, CCDS58190.1	11q23.3	2011-06-20	2007-07-13		ENSG00000137709	ENSG00000137709		"""Homeoboxes / POU class"""	19864	protein-coding gene	gene with protein product		607394	"""POU domain class 2, transcription factor 3"""			10473598	Standard	NM_014352		Approved	OCT11, PLA-1, Skn-1a, Epoc-1	uc021qrk.1	Q9UKI9	OTTHUMG00000166140	ENST00000543440.2:c.466C>T	11.37:g.120175760C>T	ENSP00000441687:p.Pro156Ser					POU2F3_uc010rzk.1_Missense_Mutation_p.P110S|POU2F3_uc010rzl.1_Missense_Mutation_p.P86S|POU2F3_uc001pxe.1_5'Flank	p.P156S	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)	7	568	+		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)	156					A8K7H8|B4DY07|F5GWW6|Q3MIY3|Q9UKR7|Q9Y504	Missense_Mutation	SNP	ENST00000543440.2	37	c.466C>T	CCDS8431.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.504102	0.44558	.	.	ENSG00000137709	ENST00000543440;ENST00000260264;ENST00000533620	D;D;D	0.83506	-1.69;-1.68;-1.73	6.17	4.3	0.51218	.	0.217150	0.49305	N	0.000157	T	0.74465	0.3720	L	0.38175	1.15	0.48341	D	0.999634	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.001	T	0.66304	-0.5957	10	0.24483	T	0.36	.	12.5729	0.56347	0.0:0.8646:0.0:0.1354	.	110;156	E9PIN6;Q9UKI9	.;PO2F3_HUMAN	S	158;156;110	ENSP00000441687:P158S;ENSP00000260264:P156S;ENSP00000435738:P110S	ENSP00000260264:P156S	P	+	1	0	POU2F3	119680970	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.318000	0.51975	0.919000	0.36945	0.655000	0.94253	CCA		0.488	POU2F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388039.2			45	88	0	0	0	0.00361	0	45	88				
OR10G9	219870	broad.mit.edu	37	11	123893726	123893726	+	Nonsense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:123893726A>T	ENST00000375024.1	+	1	7	c.7A>T	c.(7-9)Aag>Tag	p.K3*		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K3*(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		AGAAATGTCCAAGACCAGCCT	0.517																																							uc010sad.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)	2						c.(7-9)AAG>TAG		olfactory receptor, family 10, subfamily G,							136.0	127.0	130.0					11																	123893726		2201	4299	6500	SO:0001587	stop_gained	219870				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123893726A>T	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.7A>T	11.37:g.123893726A>T	ENSP00000364164:p.Lys3*						p.K3*	NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	7	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	3			Extracellular (Potential).			Nonsense_Mutation	SNP	ENST00000375024.1	37	c.7A>T	CCDS31703.1	.	.	.	.	.	.	.	.	.	.	A	18.76	3.693109	0.68271	.	.	ENSG00000236981	ENST00000375024	.	.	.	3.63	3.63	0.41609	.	0.116776	0.37809	N	0.001939	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	8.5752	0.33595	1.0:0.0:0.0:0.0	.	.	.	.	X	3	.	ENSP00000364164:K3X	K	+	1	0	OR10G9	123398936	0.026000	0.19158	0.008000	0.14137	0.008000	0.06430	2.070000	0.41491	1.512000	0.48834	0.533000	0.62120	AAG		0.517	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953		21	117	0	0	0	0.010504	0	21	117				
OR8B8	26493	broad.mit.edu	37	11	124310801	124310801	+	Missense_Mutation	SNP	A	A	T	rs571737437		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:124310801A>T	ENST00000328064.2	-	1	253	c.181T>A	c.(181-183)Ttc>Atc	p.F61I		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	61					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F61I(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TAGAGGAAGAAGTACATAGGG	0.443																																							uc010sal.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(181-183)TTC>ATC		olfactory receptor, family 8, subfamily B,							121.0	123.0	122.0					11																	124310801		2201	4299	6500	SO:0001583	missense	26493				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:124310801A>T	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.181T>A	11.37:g.124310801A>T	ENSP00000330280:p.Phe61Ile						p.F61I	NM_012378	NP_036510	Q15620	OR8B8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)	1	181	-		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	61			Helical; Name=2; (Potential).		A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	37	c.181T>A	CCDS8446.1	.	.	.	.	.	.	.	.	.	.	A	17.71	3.456631	0.63401	.	.	ENSG00000197125	ENST00000328064	T	0.00557	6.62	3.8	2.68	0.31781	GPCR, rhodopsin-like superfamily (1);	0.275214	0.25487	N	0.030321	T	0.01254	0.0041	M	0.79475	2.455	0.37531	D	0.917907	D	0.62365	0.991	P	0.55871	0.786	T	0.61387	-0.7073	10	0.87932	D	0	.	5.8011	0.18414	0.7411:0.1683:0.0906:0.0	.	61	Q15620	OR8B8_HUMAN	I	61	ENSP00000330280:F61I	ENSP00000330280:F61I	F	-	1	0	OR8B8	123816011	1.000000	0.71417	0.983000	0.44433	0.944000	0.59088	2.445000	0.44899	0.813000	0.34350	-0.385000	0.06624	TTC		0.443	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378		14	50	0	0	0	0.001855	0	14	50				
CACNA1C	775	broad.mit.edu	37	12	2778097	2778097	+	Splice_Site	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:2778097A>T	ENST00000347598.4	+	40	4767		c.e40-1		CACNA1C_ENST00000399595.1_Splice_Site|CACNA1C_ENST00000406454.3_Splice_Site|CACNA1C_ENST00000399649.1_Splice_Site|CACNA1C_ENST00000399644.1_Splice_Site|CACNA1C_ENST00000399606.1_Splice_Site|CACNA1C_ENST00000399601.1_Splice_Site|CACNA1C_ENST00000399597.1_Splice_Site|CACNA1C-AS2_ENST00000545526.1_RNA|CACNA1C_ENST00000399637.1_Splice_Site|CACNA1C_ENST00000399655.1_Splice_Site|CACNA1C_ENST00000327702.7_Splice_Site|CACNA1C_ENST00000399634.1_Splice_Site|CACNA1C_ENST00000399617.1_Splice_Site|CACNA1C_ENST00000399641.1_Splice_Site|CACNA1C_ENST00000399603.1_Splice_Site|CACNA1C_ENST00000402845.3_Splice_Site|CACNA1C_ENST00000335762.5_Splice_Site|CACNA1C_ENST00000344100.3_Splice_Site|CACNA1C_ENST00000399591.1_Splice_Site|CACNA1C_ENST00000399638.1_Splice_Site|CACNA1C_ENST00000399621.1_Splice_Site|CACNA1C_ENST00000399629.1_Splice_Site	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit						adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.?(5)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CTTCGCCTGCAGCGCCTGGTC	0.577																																							uc009zdu.1		NA																	5	Unknown(5)		lung(5)	ovary(10)|central_nervous_system(1)	11						c.e40-2		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						93.0	95.0	94.0					12																	2778097		2197	4298	6495	SO:0001630	splice_region_variant	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2778097A>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4768-1A>T	12.37:g.2778097A>T						CACNA1C_uc009zdv.1_Splice_Site_p.R1539_splice|CACNA1C_uc001qkb.2_Splice_Site_p.R1542_splice|CACNA1C_uc001qkc.2_Splice_Site_p.R1542_splice|CACNA1C_uc001qke.2_Splice_Site_p.R1531_splice|CACNA1C_uc001qkf.2_Splice_Site_p.R1531_splice|CACNA1C_uc001qjz.2_Splice_Site_p.R1542_splice|CACNA1C_uc001qkd.2_Splice_Site_p.R1542_splice|CACNA1C_uc001qkg.2_Splice_Site_p.R1529_splice|CACNA1C_uc009zdw.1_Splice_Site_p.R1564_splice|CACNA1C_uc001qkh.2_Splice_Site_p.R1531_splice|CACNA1C_uc001qkl.2_Splice_Site_p.R1590_splice|CACNA1C_uc001qkn.2_Splice_Site_p.R1542_splice|CACNA1C_uc001qko.2_Splice_Site_p.R1562_splice|CACNA1C_uc001qkp.2_Splice_Site_p.R1542_splice|CACNA1C_uc001qkr.2_Splice_Site_p.R1559_splice|CACNA1C_uc001qku.2_Splice_Site_p.R1542_splice|CACNA1C_uc001qkq.2_Splice_Site_p.R1570_splice|CACNA1C_uc001qks.2_Splice_Site_p.R1542_splice|CACNA1C_uc001qkt.2_Splice_Site_p.R1542_splice|CACNA1C_uc001qki.1_Splice_Site_p.R1278_splice|CACNA1C_uc001qkj.1_Splice_Site_p.R1278_splice|CACNA1C_uc001qkk.1_Splice_Site_p.R1278_splice|CACNA1C_uc001qkm.1_Splice_Site_p.R1267_splice|CACNA1C_uc010sea.1_Splice_Site_p.R233_splice	p.R1590_splice	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	40	5081	+								B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Splice_Site	SNP	ENST00000347598.4	37	c.4768_splice	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.781219	0.70222	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	.	.	.	3.71	3.71	0.42584	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9215	0.58234	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1C	2648358	1.000000	0.71417	0.993000	0.49108	0.919000	0.55068	9.084000	0.94076	1.694000	0.51137	0.451000	0.29950	.		0.577	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	Intron	17	101	0	0	0	0.004007	0	17	101				
GNB3	2784	broad.mit.edu	37	12	6948210	6948210	+	5'Flank	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:6948210G>A	ENST00000229264.3	+	0	0				GNB3_ENST00000435982.2_5'Flank|LEPREL2_ENST00000538102.1_RNA|LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000251761.8_RNA	NM_002075.2	NP_002066.1	P16520	GBB3_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 3						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|signal transducer activity (GO:0004871)	p.G466D(1)|p.G650D(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|stomach(1)	20						TTCAGCTCCGGTGTCGAGAAT	0.657																																							uc001qra.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1951-1953)GGT>GAT		leprecan-like 2 precursor	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)						39.0	44.0	42.0					12																	6948210		2081	4194	6275	SO:0001631	upstream_gene_variant	10536				negative regulation of cell proliferation	endoplasmic reticulum	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity	g.chr12:6948210G>A		CCDS8564.1, CCDS73427.1	12p13	2013-01-10			ENSG00000111664	ENSG00000111664		"""WD repeat domain containing"""	4400	protein-coding gene	gene with protein product		139130				11770079, 16600389	Standard	XM_005253680		Approved		uc001qrd.3	P16520	OTTHUMG00000168517		12.37:g.6948210G>A	Exception_encountered					LEPREL2_uc001qqz.1_Missense_Mutation_p.G458D|LEPREL2_uc001qrb.1_Missense_Mutation_p.G458D|GNB3_uc001qrc.2_5'Flank|GNB3_uc001qrd.2_5'Flank|GNB3_uc009zfe.2_5'Flank	p.G651D	NM_014262	NP_055077	Q8IVL6	P3H3_HUMAN			16	1986	+			651			Fe2OG dioxygenase.		Q96B71|Q9BQC0	Missense_Mutation	SNP	ENST00000229264.3	37	c.1952G>A	CCDS8564.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.776437	0.90195	.	.	ENSG00000110811	ENST00000451242;ENST00000396725;ENST00000290510	T;T	0.61392	0.11;0.59	4.99	4.99	0.66335	Oxoglutarate/iron-dependent oxygenase (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.78233	0.4251	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81974	-0.0687	9	0.87932	D	0	-15.531	18.2817	0.90101	0.0:0.0:1.0:0.0	.	651	Q8IVL6	P3H3_HUMAN	D	78;650;466	ENSP00000379951:G650D;ENSP00000290510:G466D	ENSP00000290510:G466D	G	+	2	0	LEPREL2	6818471	1.000000	0.71417	0.887000	0.34795	0.678000	0.39670	9.476000	0.97823	2.319000	0.78375	0.561000	0.74099	GGT		0.657	GNB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400006.1	NM_002075		20	25	0	0	0	0.008871	0	20	25				
ATN1	1822	broad.mit.edu	37	12	7050624	7050624	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:7050624A>C	ENST00000356654.4	+	9	3683	c.3446A>C	c.(3445-3447)gAg>gCg	p.E1149A	U47924.31_ENST00000607421.1_RNA|C12orf57_ENST00000537087.1_5'Flank|C12orf57_ENST00000544681.1_5'Flank|RNU7-1_ENST00000458811.1_RNA|C12orf57_ENST00000540506.2_5'Flank|ATN1_ENST00000396684.2_Missense_Mutation_p.E1149A|C12orf57_ENST00000229281.5_5'Flank	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	1149					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.E1149A(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CAGTCAGCTGAGCTGCAGCGC	0.642																																							uc001qrw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|pancreas(1)|skin(1)	6						c.(3445-3447)GAG>GCG		atrophin-1							52.0	53.0	53.0					12																	7050624		2203	4297	6500	SO:0001583	missense	1822				cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding	g.chr12:7050624A>C	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.3446A>C	12.37:g.7050624A>C	ENSP00000349076:p.Glu1149Ala					ATN1_uc001qrx.1_Missense_Mutation_p.E1149A|C12orf57_uc009zfj.1_5'Flank|C12orf57_uc001qrz.2_5'Flank	p.E1149A	NM_001007026	NP_001007027	P54259	ATN1_HUMAN			9	3683	+			1149					Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	c.3446A>C	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.094971	0.76870	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.71103	-0.54;-0.54;-0.54	4.32	3.15	0.36227	.	0.000000	0.34338	U	0.004046	T	0.79787	0.4506	M	0.62723	1.935	0.58432	D	0.999999	D	0.65815	0.995	D	0.80764	0.994	T	0.79967	-0.1580	10	0.87932	D	0	.	10.3945	0.44192	0.8534:0.0:0.0:0.1466	.	1149	P54259	ATN1_HUMAN	A	1149;1149;1149;734	ENSP00000349076:E1149A;ENSP00000379915:E1149A;ENSP00000441744:E1149A	ENSP00000229279:E734A	E	+	2	0	ATN1	6920885	1.000000	0.71417	0.949000	0.38748	0.960000	0.62799	9.139000	0.94554	0.796000	0.33947	0.533000	0.62120	GAG		0.642	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940		35	34	0	0	0	0.003755	0	35	34				
A2M	2	broad.mit.edu	37	12	9225370	9225370	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:9225370G>A	ENST00000318602.7	-	30	4161	c.3854C>T	c.(3853-3855)aCa>aTa	p.T1285I		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1285					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.T1285I(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GCTGGAAAATGTCCCTGAAGA	0.517																																							uc001qvk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|skin(1)	5						c.(3853-3855)ACA>ATA		alpha-2-macroglobulin precursor	Bacitracin(DB00626)|Becaplermin(DB00102)						142.0	143.0	143.0					12																	9225370		2151	4281	6432	SO:0001583	missense	2				blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding	g.chr12:9225370G>A	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3854C>T	12.37:g.9225370G>A	ENSP00000323929:p.Thr1285Ile					A2M_uc001qvj.1_Missense_Mutation_p.T327I|A2M_uc009zgk.1_Missense_Mutation_p.T1135I	p.T1285I	NM_000014	NP_000005	P01023	A2MG_HUMAN			30	3967	-			1285					Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	c.3854C>T	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.499915	0.26861	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.28895	1.59	5.77	-1.11	0.09840	.	0.983616	0.08334	N	0.961938	T	0.34019	0.0883	M	0.81802	2.56	0.09310	N	1	B	0.21309	0.054	B	0.26693	0.072	T	0.43766	-0.9371	10	0.44086	T	0.13	.	6.0071	0.19553	0.0602:0.3599:0.3021:0.2778	.	1285	P01023	A2MG_HUMAN	I	1285;1300	ENSP00000323929:T1285I	ENSP00000323929:T1285I	T	-	2	0	A2M	9116637	0.000000	0.05858	0.076000	0.20297	0.609000	0.37215	-0.218000	0.09240	0.053000	0.16036	0.650000	0.86243	ACA		0.517	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014		6	109	0	0	0	0.001168	0	6	109				
AEBP2	121536	broad.mit.edu	37	12	19615515	19615515	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:19615515G>A	ENST00000398864.3	+	2	769	c.743G>A	c.(742-744)gGa>gAa	p.G248E	AEBP2_ENST00000541908.1_Missense_Mutation_p.G19E|AEBP2_ENST00000266508.9_Missense_Mutation_p.G248E|AEBP2_ENST00000360995.4_Missense_Mutation_p.G32E	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	248	Interaction with RBBP4.|Ser-rich.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)	p.G248E(1)		ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					ATGATGAATGGACAAGGAAGC	0.423																																							uc001ref.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(742-744)GGA>GAA		AE binding protein 2 isoform b							92.0	84.0	86.0					12																	19615515		1926	4146	6072	SO:0001583	missense	121536				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|zinc ion binding	g.chr12:19615515G>A		CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.743G>A	12.37:g.19615515G>A	ENSP00000381840:p.Gly248Glu					AEBP2_uc001ree.2_Missense_Mutation_p.G248E|AEBP2_uc001reg.1_Missense_Mutation_p.G19E	p.G248E	NM_001114176	NP_001107648	Q6ZN18	AEBP2_HUMAN			2	769	+	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)		248			Ser-rich.|Interaction with RBBP4.		Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	ENST00000398864.3	37	c.743G>A	CCDS44841.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283131	0.80803	.	.	ENSG00000139154	ENST00000538425;ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995	D;T;D;D;T	0.90900	-2.28;-0.45;-2.75;-2.75;-0.34	5.55	4.66	0.58398	.	.	.	.	.	D	0.91673	0.7368	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92433	0.5955	9	0.54805	T	0.06	0.0037	14.732	0.69388	0.0692:0.0:0.9308:0.0	.	248	Q6ZN18	AEBP2_HUMAN	E	19;19;248;182;248;32	ENSP00000444255:G19E;ENSP00000437983:G19E;ENSP00000381840:G248E;ENSP00000266508:G248E;ENSP00000354267:G32E	ENSP00000266508:G248E	G	+	2	0	AEBP2	19506782	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.263000	0.95617	1.578000	0.49821	0.655000	0.94253	GGA		0.423	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401575.1	NM_153207		17	17	0	0	0	0.006122	0	17	17				
FAR2	55711	broad.mit.edu	37	12	29474839	29474839	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:29474839G>A	ENST00000536681.3	+	10	1485	c.1239G>A	c.(1237-1239)ctG>ctA	p.L413L	FAR2_ENST00000182377.4_Silent_p.L413L|FAR2_ENST00000547116.1_Silent_p.L316L	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	413					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)	p.L413L(1)		central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						TGTCTGAGCTGAGTCCTGAAG	0.403																																							uc001ris.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1237-1239)CTG>CTA		fatty acyl CoA reductase 2							116.0	104.0	108.0					12																	29474839		2203	4300	6503	SO:0001819	synonymous_variant	55711				ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor	g.chr12:29474839G>A	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.1239G>A	12.37:g.29474839G>A						FAR2_uc001rit.2_Silent_p.L413L|FAR2_uc009zjm.2_Silent_p.L316L	p.L413L	NM_018099	NP_060569	Q96K12	FACR2_HUMAN			10	1386	+			413					F8VV73|Q9H0D5|Q9NVW8	Silent	SNP	ENST00000536681.3	37	c.1239G>A	CCDS8717.1																																																																																				0.403	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099		13	59	0	0	0	0.001855	0	13	59				
IPO8	10526	broad.mit.edu	37	12	30784831	30784831	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:30784831G>A	ENST00000256079.4	-	24	3352	c.3014C>T	c.(3013-3015)gCa>gTa	p.A1005V	IPO8_ENST00000544829.1_Missense_Mutation_p.A800V	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	1005					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)	p.A1005V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TGGCTGACCTGCCACCGTCCG	0.557																																							uc001rjd.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(3013-3015)GCA>GTA		importin 8							113.0	84.0	94.0					12																	30784831		2203	4300	6503	SO:0001583	missense	10526				intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding	g.chr12:30784831G>A	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.3014C>T	12.37:g.30784831G>A	ENSP00000256079:p.Ala1005Val					IPO8_uc001rje.1_Missense_Mutation_p.A494V|IPO8_uc010sjt.1_Missense_Mutation_p.A800V	p.A1005V	NM_006390	NP_006381	O15397	IPO8_HUMAN			24	3184	-	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)		1005					B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	37	c.3014C>T	CCDS8719.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.44|15.44	2.833864|2.833864	0.50951|0.50951	.|.	.|.	ENSG00000133704|ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829|ENST00000535598	T;T|.	0.48522|.	1.8;0.81|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.185997|.	0.45606|.	D|.	0.000344|.	T|.	0.63546|.	0.2520|.	L|L	0.48642|0.48642	1.525|1.525	0.38260|0.38260	D|D	0.94186|0.94186	B;B;P|.	0.34662|.	0.075;0.319;0.462|.	B;B;B|.	0.38378|.	0.025;0.146;0.272|.	T|.	0.64024|.	-0.6504|.	10|.	0.15952|.	T|.	0.53|.	-10.2066|-10.2066	16.7538|16.7538	0.85494|0.85494	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	800;481;1005|.	B7Z7M3;Q59F59;O15397|.	.;.;IPO8_HUMAN|.	V|X	1005;481;800|163	ENSP00000256079:A1005V;ENSP00000444520:A800V|.	ENSP00000256079:A1005V|.	A|Q	-|-	2|1	0|0	IPO8|IPO8	30676098|30676098	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.953000|0.953000	0.61014|0.61014	4.032000|4.032000	0.57274|0.57274	2.454000|2.454000	0.82982|0.82982	0.650000|0.650000	0.86243|0.86243	GCA|CAG		0.557	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390		7	58	0	0	0	0.00308	0	7	58				
TSPAN11	441631	broad.mit.edu	37	12	31135488	31135488	+	Missense_Mutation	SNP	A	A	T	rs148719778	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:31135488A>T	ENST00000261177.9	+	6	537	c.478A>T	c.(478-480)Agc>Tgc	p.S160C	TSPAN11_ENST00000546076.1_Missense_Mutation_p.S160C|TSPAN11_ENST00000544427.1_Missense_Mutation_p.S150C|TSPAN11_ENST00000535215.1_Missense_Mutation_p.S89C	NM_001080509.2	NP_001073978.1	A1L157	TSN11_HUMAN	tetraspanin 11	160						integral component of membrane (GO:0016021)		p.S160C(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)	11	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TGGAAGCAACAGCTCAGCCGA	0.627																																							uc010sju.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(478-480)AGC>TGC		tetraspanin 11							35.0	38.0	37.0					12																	31135488		2203	4299	6502	SO:0001583	missense	441631					integral to membrane		g.chr12:31135488A>T		CCDS31765.1	12p11.21	2013-02-14				ENSG00000110900		"""Tetraspanins"""	30795	protein-coding gene	gene with protein product							Standard	NM_001080509		Approved		uc001rjp.3	A1L157		ENST00000261177.9:c.478A>T	12.37:g.31135488A>T	ENSP00000261177:p.Ser160Cys					TSPAN11_uc001rjp.2_Missense_Mutation_p.S160C|TSPAN11_uc010sjv.1_Missense_Mutation_p.S150C	p.S160C	NM_001080509	NP_001073978	A1L157	TSN11_HUMAN			6	858	+	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)		160					A1L158|B2RUX6	Missense_Mutation	SNP	ENST00000261177.9	37	c.478A>T	CCDS31765.1	.	.	.	.	.	.	.	.	.	.	A	14.62	2.591189	0.46214	.	.	ENSG00000110900	ENST00000546076;ENST00000535215;ENST00000544427;ENST00000261177	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	4.13	2.98	0.34508	Tetraspanin, EC2 domain (1);	0.123733	0.52532	U	0.000068	D	0.93772	0.8009	M	0.90145	3.09	0.37004	D	0.895399	D;D	0.71674	0.998;0.997	D;D	0.66351	0.94;0.943	D	0.93348	0.6716	10	0.72032	D	0.01	.	7.4334	0.27141	0.8914:0.0:0.1086:0.0	.	150;160	F5H0F0;A1L157	.;TSN11_HUMAN	C	160;89;150;160	ENSP00000437403:S160C;ENSP00000445503:S89C;ENSP00000439895:S150C;ENSP00000261177:S160C	ENSP00000261177:S160C	S	+	1	0	TSPAN11	31026755	1.000000	0.71417	0.873000	0.34254	0.392000	0.30506	3.980000	0.56895	0.454000	0.26884	0.260000	0.18958	AGC		0.627	TSPAN11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399888.1	XM_497334		3	49	0	0	0	0.000602	0	3	49				
SYT10	341359	broad.mit.edu	37	12	33559996	33559996	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:33559996G>C	ENST00000228567.3	-	3	1101	c.805C>G	c.(805-807)Cct>Gct	p.P269A	RP11-438D14.2_ENST00000561632.1_lincRNA|SYT10_ENST00000535526.1_Missense_Mutation_p.P88A|SYT10_ENST00000567656.1_5'Flank	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	269	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.P269A(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					TTCACATAAGGGTCAGAAGTT	0.343																																							uc001rll.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(805-807)CCT>GCT		synaptotagmin X							61.0	61.0	61.0					12																	33559996		2203	4300	6503	SO:0001583	missense	341359					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr12:33559996G>C	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.805C>G	12.37:g.33559996G>C	ENSP00000228567:p.Pro269Ala					SYT10_uc009zju.1_Missense_Mutation_p.P79A	p.P269A	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN			3	1102	-	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)		269			Cytoplasmic (Potential).|C2 1.		Q495U2	Missense_Mutation	SNP	ENST00000228567.3	37	c.805C>G	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479175	0.84747	.	.	ENSG00000110975	ENST00000228567;ENST00000535526	T;T	0.76448	-1.02;-1.02	4.94	4.94	0.65067	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.41294	U	0.000919	D	0.90031	0.6887	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91727	0.5393	10	0.87932	D	0	.	18.0323	0.89289	0.0:0.0:1.0:0.0	.	269	Q6XYQ8	SYT10_HUMAN	A	269;88	ENSP00000228567:P269A;ENSP00000438691:P88A	ENSP00000228567:P269A	P	-	1	0	SYT10	33451263	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.451000	0.97610	2.665000	0.90641	0.563000	0.77884	CCT		0.343	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992		5	41	0	0	0	0.001984	0	5	41				
NELL2	4753	broad.mit.edu	37	12	44926385	44926385	+	Missense_Mutation	SNP	G	G	T	rs80147310		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:44926385G>T	ENST00000429094.2	-	16	2287	c.1783C>A	c.(1783-1785)Cca>Aca	p.P595T	NELL2_ENST00000452445.2_Missense_Mutation_p.P595T|NELL2_ENST00000549027.1_Missense_Mutation_p.P594T|NELL2_ENST00000551601.1_Intron|NELL2_ENST00000437801.2_Missense_Mutation_p.P645T|NELL2_ENST00000333837.4_Missense_Mutation_p.P618T|NELL2_ENST00000395487.2_Missense_Mutation_p.P594T	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	595	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.P645T(1)|p.P595T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TCTCCACTTGGTGAAAACATC	0.408																																							uc001rog.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(1783-1785)CCA>ACA		NEL-like protein 2 isoform b precursor							175.0	150.0	159.0					12																	44926385		2203	4300	6503	SO:0001583	missense	4753				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity	g.chr12:44926385G>T	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1783C>A	12.37:g.44926385G>T	ENSP00000390680:p.Pro595Thr					NELL2_uc001rof.3_Missense_Mutation_p.P594T|NELL2_uc001roh.2_Missense_Mutation_p.P595T|NELL2_uc009zkd.2_Intron|NELL2_uc010skz.1_Missense_Mutation_p.P645T|NELL2_uc010sla.1_Missense_Mutation_p.P618T|NELL2_uc001roi.1_Missense_Mutation_p.P595T|NELL2_uc010slb.1_Missense_Mutation_p.P594T	p.P595T	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN		GBM - Glioblastoma multiforme(48;0.092)	16	2378	-	Lung SC(27;0.192)	Lung NSC(34;0.144)	595			EGF-like 5; calcium-binding (Potential).		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	c.1783C>A	CCDS8746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.545|1.545	-0.540759|-0.540759	0.04053|0.04053	.|.	.|.	ENSG00000184613|ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801|ENST00000550139	D;D;D;D;D;D|.	0.95307|.	-3.67;-3.67;-3.67;-3.67;-3.67;-3.67|.	5.72|5.72	2.53|2.53	0.30540|0.30540	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);|.	0.443109|.	0.25236|.	N|.	0.032123|.	T|T	0.27524|0.27524	0.0676|0.0676	N|N	0.21373|0.21373	0.66|0.66	0.29699|0.29699	N|N	0.840317|0.840317	B;B;B;B|.	0.17465|.	0.003;0.022;0.005;0.011|.	B;B;B;B|.	0.18871|.	0.023;0.021;0.008;0.023|.	T|T	0.24512|0.24512	-1.0158|-1.0158	10|5	0.10636|.	T|.	0.68|.	0.2168|0.2168	5.5602|5.5602	0.17140|0.17140	0.2529:0.1378:0.6093:0.0|0.2529:0.1378:0.6093:0.0	.|.	618;645;595;594|.	B7Z2U7;B7Z9U3;Q99435;Q96JS2|.	.;.;NELL2_HUMAN;.|.	T|N	594;595;595;594;618;645|7	ENSP00000378866:P594T;ENSP00000390680:P595T;ENSP00000394612:P595T;ENSP00000447927:P594T;ENSP00000327988:P618T;ENSP00000416341:P645T|.	ENSP00000327988:P618T|.	P|T	-|-	1|2	0|0	NELL2|NELL2	43212652|43212652	1.000000|1.000000	0.71417|0.71417	0.392000|0.392000	0.26245|0.26245	0.997000|0.997000	0.91878|0.91878	2.787000|2.787000	0.47798|0.47798	0.197000|0.197000	0.20387|0.20387	0.655000|0.655000	0.94253|0.94253	CCA|ACC		0.408	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159		8	41	1	0	3.86212e-05	0.008291	4.52198e-05	8	41				
KCNH3	23416	broad.mit.edu	37	12	49937199	49937199	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:49937199A>G	ENST00000257981.6	+	5	981	c.721A>G	c.(721-723)Act>Gct	p.T241A	KCNH3_ENST00000550434.1_3'UTR	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	241					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.T241A(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						TGTGGCTGTCACTGTGCCCTA	0.647																																							uc001ruh.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(721-723)ACT>GCT		potassium voltage-gated channel, subfamily H							49.0	42.0	44.0					12																	49937199		2203	4300	6503	SO:0001583	missense	23416				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity	g.chr12:49937199A>G	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.721A>G	12.37:g.49937199A>G	ENSP00000257981:p.Thr241Ala					KCNH3_uc010smj.1_Missense_Mutation_p.T181A	p.T241A	NM_012284	NP_036416	Q9ULD8	KCNH3_HUMAN			5	981	+			241			Helical; Name=Segment S1; (Potential).		Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	c.721A>G	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.260409	0.39995	.	.	ENSG00000135519	ENST00000257981	D	0.97352	-4.35	4.56	4.56	0.56223	.	0.000000	0.48286	D	0.000188	D	0.94899	0.8351	L	0.49350	1.555	0.36183	D	0.849527	B	0.19200	0.034	B	0.24394	0.053	D	0.94809	0.7977	10	0.48119	T	0.1	.	12.2109	0.54379	1.0:0.0:0.0:0.0	.	241	Q9ULD8	KCNH3_HUMAN	A	241	ENSP00000257981:T241A	ENSP00000257981:T241A	T	+	1	0	KCNH3	48223466	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.139000	0.94554	2.069000	0.61940	0.533000	0.62120	ACT		0.647	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284		15	28	0	0	0	0.00245	0	15	28				
FAIM2	23017	broad.mit.edu	37	12	50282944	50282944	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:50282944G>A	ENST00000320634.3	-	10	787	c.693C>T	c.(691-693)ctC>ctT	p.L231L	FAIM2_ENST00000550890.1_Silent_p.L185L	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2	231					apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)		p.L231L(1)		endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						AAAGAGTCATGAGAAGCACGA	0.617																																							uc001rvj.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(691-693)CTC>CTT		Fas apoptotic inhibitory molecule 2							97.0	82.0	87.0					12																	50282944		2203	4300	6503	SO:0001819	synonymous_variant	23017				anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane		g.chr12:50282944G>A	AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.693C>T	12.37:g.50282944G>A						FAIM2_uc001rvi.1_Silent_p.L185L|FAIM2_uc001rvk.1_RNA	p.L231L	NM_012306	NP_036438	Q9BWQ8	FAIM2_HUMAN			10	838	-			231			Helical; (Potential).		A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Silent	SNP	ENST00000320634.3	37	c.693C>T	CCDS8791.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302453	0.60195	.	.	ENSG00000135472	ENST00000552863	.	.	.	4.74	3.84	0.44239	.	.	.	.	.	T	0.59211	0.2177	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55412	-0.8145	4	.	.	.	-24.2522	9.3197	0.37957	0.1019:0.0:0.8981:0.0	.	.	.	.	Y	100	.	.	H	-	1	0	FAIM2	48569211	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.696000	0.47052	0.978000	0.38470	0.563000	0.77884	CAT		0.617	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405984.1	NM_012306		3	10	0	0	0	0.004672	0	3	10				
ANKRD33	341405	broad.mit.edu	37	12	52282384	52282384	+	5'UTR	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:52282384C>A	ENST00000340970.4	+	0	148				ANKRD33_ENST00000547119.1_3'UTR|ANKRD33_ENST00000301190.6_Missense_Mutation_p.L60M|ANKRD33_ENST00000538991.1_5'UTR			Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.L60M(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.0969)		GACTCACCTTCTGGTTCCCTG	0.597																																							uc001rzf.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(-225--221)TTCTG>TTATG		ankyrin repeat domain 33 isoform 1							79.0	73.0	75.0					12																	52282384		2203	4300	6503	SO:0001623	5_prime_UTR_variant	341405							g.chr12:52282384C>A		CCDS8815.1, CCDS44892.1	12q13.13	2013-01-10	2005-01-07	2005-01-07		ENSG00000167612		"""Ankyrin repeat domain containing"""	13788	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 7"""	C12orf7		20026326	Standard	NM_182608		Approved	DKFZp686O1689, PANKY	uc001rzd.3	Q7Z3H0	OTTHUMG00000169506	ENST00000340970.4:c.-224C>A	12.37:g.52282384C>A						ANKRD33_uc001rzh.3_Missense_Mutation_p.L60M|ANKRD33_uc001rzd.2_Missense_Mutation_p.L60M|ANKRD33_uc001rze.2_Translation_Start_Site|ANKRD33_uc001rzg.3_Translation_Start_Site|ANKRD33_uc001rzi.3_Translation_Start_Site		NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0969)	2	356	+								Q0VAA7|Q5K619|Q5K621|Q5K622|Q5K623|Q5K624|Q6ZUN0	Translation_Start_Site	SNP	ENST00000340970.4	37	c.-223C>A	CCDS44892.1	.	.	.	.	.	.	.	.	.	.	C	8.452	0.853314	0.17106	.	.	ENSG00000167612	ENST00000301190	T	0.20598	2.06	3.43	-0.448	0.12230	.	68.397800	0.00166	N	0.000000	T	0.26629	0.0651	N	0.14661	0.345	0.09310	N	0.999993	D;P	0.69078	0.997;0.899	D;P	0.64237	0.923;0.571	T	0.18713	-1.0328	10	0.72032	D	0.01	.	5.886	0.18882	0.0:0.4794:0.0:0.5206	.	60;60	F8VTQ6;Q7Z3H0-2	.;.	M	60	ENSP00000301190:L60M	ENSP00000301190:L60M	L	+	1	2	ANKRD33	50568651	0.000000	0.05858	0.030000	0.17652	0.036000	0.12997	0.217000	0.17603	-0.232000	0.09811	0.462000	0.41574	CTG		0.597	ANKRD33-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404515.1	NM_182608		6	71	1	0	0.00116845	0.001168	0.00128016	6	71				
HOXC10	3226	broad.mit.edu	37	12	54379623	54379623	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:54379623G>T	ENST00000303460.4	+	1	654	c.580G>T	c.(580-582)Ggc>Tgc	p.G194C	HOXC-AS3_ENST00000567780.1_RNA|RP11-834C11.12_ENST00000513209.1_5'Flank|HOXC-AS3_ENST00000514702.1_RNA|HOXC-AS3_ENST00000509870.1_RNA|HOXC-AS3_ENST00000513165.1_RNA	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10	194					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G194C(1)		endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						TCAGCTGGGGGGCAAAGTGAG	0.642																																							uc001sen.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(580-582)GGC>TGC		homeobox C10							31.0	36.0	35.0					12																	54379623		2203	4299	6502	SO:0001583	missense	3226				positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54379623G>T		CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.580G>T	12.37:g.54379623G>T	ENSP00000307321:p.Gly194Cys						p.G194C	NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN			1	678	+			194					O15219|O15220|Q9BVD5	Missense_Mutation	SNP	ENST00000303460.4	37	c.580G>T	CCDS8868.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242790	0.58995	.	.	ENSG00000180818	ENST00000515593;ENST00000303460	D	0.92249	-3.0	4.63	3.73	0.42828	.	0.216340	0.40302	N	0.001132	D	0.89192	0.6645	L	0.34521	1.04	0.47659	D	0.999483	D	0.58620	0.983	P	0.49561	0.615	D	0.89203	0.3559	10	0.54805	T	0.06	.	11.4077	0.49908	0.0912:0.0:0.9088:0.0	.	194	Q9NYD6	HXC10_HUMAN	C	82;194	ENSP00000307321:G194C	ENSP00000307321:G194C	G	+	1	0	HOXC10	52665890	0.796000	0.28864	1.000000	0.80357	0.793000	0.44817	0.869000	0.27996	2.298000	0.77334	0.561000	0.74099	GGC		0.642	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358952.2			9	22	1	0	3.03607e-14	0.013537	4.61351e-14	9	22				
MIP	4284	broad.mit.edu	37	12	56848062	56848062	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:56848062G>T	ENST00000257979.4	-	1	364	c.336C>A	c.(334-336)gtC>gtA	p.V112V	MIP_ENST00000555551.1_Intron	NM_012064.3	NP_036196.1	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	112					canalicular bile acid transport (GO:0015722)|lens development in camera-type eye (GO:0002088)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)|water transport (GO:0006833)	gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intracellular canaliculus (GO:0046691)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|structural constituent of eye lens (GO:0005212)|transporter activity (GO:0005215)|water channel activity (GO:0015250)	p.V112V(1)		kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	16						GGTTTCCTCGGACAGCAGGTG	0.602																																							uc001slh.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(334-336)GTC>GTA		major intrinsic protein of lens fiber							63.0	69.0	67.0					12																	56848062		2203	4300	6503	SO:0001819	synonymous_variant	4284				response to stimulus|visual perception	gap junction|integral to plasma membrane	structural constituent of eye lens	g.chr12:56848062G>T		CCDS8919.1	12q13	2012-10-02				ENSG00000135517		"""Ion channels / Aquaporins"""	7103	protein-coding gene	gene with protein product	aquaporin 0	154050				1840563, 7536742	Standard	NM_012064		Approved	MP26, LIM1, AQP0	uc001slh.3	P30301		ENST00000257979.4:c.336C>A	12.37:g.56848062G>T							p.V112V	NM_012064	NP_036196	P30301	MIP_HUMAN			1	368	-			112			Extracellular (By similarity).		Q17R41	Silent	SNP	ENST00000257979.4	37	c.336C>A	CCDS8919.1																																																																																				0.602	MIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409620.1	NM_012064		8	64	1	0	0.00448238	0.004482	0.00482771	8	64				
ZBTB39	9880	broad.mit.edu	37	12	57396914	57396914	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:57396914C>T	ENST00000300101.2	-	2	1873	c.1788G>A	c.(1786-1788)ctG>ctA	p.L596L		NM_014830.2	NP_055645.1	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	596					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L596L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|prostate(1)	16						GTTGGCCCTGCAGCGCCAGCT	0.587																																							uc001sml.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(1786-1788)CTG>CTA		zinc finger and BTB domain containing 39							58.0	60.0	59.0					12																	57396914		2203	4300	6503	SO:0001819	synonymous_variant	9880				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr12:57396914C>T	AB002350	CCDS31839.1	12q13.3	2013-01-09				ENSG00000166860		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	29014	protein-coding gene	gene with protein product						9205841	Standard	NM_014830		Approved	KIAA0352, ZNF922	uc001sml.2	O15060		ENST00000300101.2:c.1788G>A	12.37:g.57396914C>T						RDH16_uc010sqx.1_5'Flank	p.L596L	NM_014830	NP_055645	O15060	ZBT39_HUMAN			2	1874	-			596					A7MD38|Q9UD98	Silent	SNP	ENST00000300101.2	37	c.1788G>A	CCDS31839.1																																																																																				0.587	ZBTB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411214.1	NM_014830		13	63	0	0	0	0.001855	0	13	63				
KCNC2	3747	broad.mit.edu	37	12	75601598	75601598	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:75601598G>C	ENST00000549446.1	-	2	846	c.166C>G	c.(166-168)Ccg>Gcg	p.P56A	KCNC2_ENST00000341669.3_Missense_Mutation_p.P56A|KCNC2_ENST00000350228.2_Missense_Mutation_p.P56A|KCNC2_ENST00000540018.1_Missense_Mutation_p.P56A|KCNC2_ENST00000393288.2_Missense_Mutation_p.P56A|KCNC2_ENST00000548513.1_Missense_Mutation_p.P56A|KCNC2_ENST00000298972.1_Missense_Mutation_p.P56A|KCNC2_ENST00000550433.1_Missense_Mutation_p.P56A	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	56	Gly/Pro-rich (insert).				action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.P56A(2)		breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	ggcggcgacggctgcagcTTG	0.746																																							uc001sxg.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|pancreas(2)|skin(1)|lung(1)	6						c.(166-168)CCG>GCG		Shaw-related voltage-gated potassium channel							10.0	9.0	10.0					12																	75601598		1818	3595	5413	SO:0001583	missense	3747				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:75601598G>C	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.166C>G	12.37:g.75601598G>C	ENSP00000449253:p.Pro56Ala					KCNC2_uc009zry.2_Missense_Mutation_p.P56A|KCNC2_uc001sxe.2_Missense_Mutation_p.P56A|KCNC2_uc001sxf.2_Missense_Mutation_p.P56A|KCNC2_uc010stw.1_Missense_Mutation_p.P56A	p.P56A	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN			2	710	-			56			Gly/Pro-rich (insert).|Cytoplasmic (Potential).		B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	37	c.166C>G	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	g	8.233	0.805175	0.16467	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000350228;ENST00000540018;ENST00000393288	D;D;D;D;D;D;D;D	0.96940	-4.18;-4.16;-4.16;-4.18;-4.16;-4.17;-4.16;-4.18	3.68	1.77	0.24775	BTB/POZ-like (1);BTB/POZ fold (1);Potassium channel, voltage dependent, Kv, tetramerisation (1);	3.245280	0.01064	N	0.004681	D	0.92760	0.7698	L	0.29908	0.895	0.24359	N	0.994881	B;B;B;B;B	0.12630	0.006;0.002;0.002;0.002;0.002	B;B;B;B;B	0.16722	0.016;0.005;0.012;0.005;0.005	T	0.83210	-0.0074	10	0.39692	T	0.17	.	5.3147	0.15849	0.2016:0.1663:0.6321:0.0	.	56;56;56;56;56	F5H030;Q96PR1-2;Q96PR1;Q96PR1-4;Q96PR1-3	.;.;KCNC2_HUMAN;.;.	A	56	ENSP00000448301:P56A;ENSP00000449941:P56A;ENSP00000449253:P56A;ENSP00000340121:P56A;ENSP00000298972:P56A;ENSP00000319877:P56A;ENSP00000438423:P56A;ENSP00000376966:P56A	ENSP00000298972:P56A	P	-	1	0	KCNC2	73887865	1.000000	0.71417	0.791000	0.31998	0.951000	0.60555	1.920000	0.40025	0.739000	0.32628	0.558000	0.71614	CCG		0.746	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748		3	11	0	0	0	0.009096	0	3	11				
NAV3	89795	broad.mit.edu	37	12	78334186	78334186	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:78334186G>T	ENST00000397909.2	+	2	504	c.331G>T	c.(331-333)Gta>Tta	p.V111L	NAV3_ENST00000266692.7_Missense_Mutation_p.V111L|NAV3_ENST00000536525.2_Missense_Mutation_p.V111L|NAV3_ENST00000228327.6_Missense_Mutation_p.V111L			Q8IVL0	NAV3_HUMAN	neuron navigator 3	111	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.V111L(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TGCAGATGGAGTACTCCTAGC	0.448										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(331-333)GTA>TTA		neuron navigator 3							141.0	137.0	138.0					12																	78334186		1919	4151	6070	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78334186G>T	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.331G>T	12.37:g.78334186G>T	ENSP00000381007:p.Val111Leu	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.V111L	p.V111L	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			2	504	+			111			CH.		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.331G>T		.	.	.	.	.	.	.	.	.	.	G	21.4	4.139191	0.77775	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12	5.58	5.58	0.84498	Calponin homology domain (5);	0.000000	0.34435	U	0.003980	T	0.64204	0.2577	N	0.16708	0.43	0.80722	D	1	P;P	0.48407	0.91;0.89	D;D	0.68483	0.958;0.947	T	0.64935	-0.6290	10	0.41790	T	0.15	-15.3156	19.5781	0.95453	0.0:0.0:1.0:0.0	.	111;111	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	L	111	ENSP00000446628:V111L;ENSP00000446132:V111L;ENSP00000381007:V111L;ENSP00000228327:V111L;ENSP00000266692:V111L	ENSP00000228327:V111L	V	+	1	0	NAV3	76858317	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	9.861000	0.99562	2.637000	0.89404	0.643000	0.83706	GTA		0.448	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		29	40	1	0	1.55811e-20	0.008361	2.52111e-20	29	40				
CDK17	5128	broad.mit.edu	37	12	96692734	96692734	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:96692734T>C	ENST00000261211.3	-	7	1231	c.628A>G	c.(628-630)Aga>Gga	p.R210G	CDK17_ENST00000553042.1_5'UTR|CDK17_ENST00000542666.1_Missense_Mutation_p.R157G|CDK17_ENST00000543119.2_Missense_Mutation_p.R210G	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	210	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.R210G(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						AATTTACTTCTTCCTTTATAT	0.308																																							uc001tep.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7						c.(628-630)AGA>GGA		PCTAIRE protein kinase 2							144.0	136.0	139.0					12																	96692734		2203	4299	6502	SO:0001583	missense	5128						ATP binding|cyclin-dependent protein kinase activity	g.chr12:96692734T>C		CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.628A>G	12.37:g.96692734T>C	ENSP00000261211:p.Arg210Gly					CDK17_uc009ztk.2_Missense_Mutation_p.R210G|CDK17_uc010svb.1_Missense_Mutation_p.R157G	p.R210G	NM_002595	NP_002586	Q00537	CDK17_HUMAN			7	1117	-			210			Protein kinase.		A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	ENST00000261211.3	37	c.628A>G	CCDS9061.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.178630	0.57692	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666	T;T;T	0.47869	0.83;0.83;0.83	5.78	4.61	0.57282	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61211	0.2329	M	0.71871	2.18	0.54753	D	0.999982	P;P	0.49447	0.924;0.924	P;P	0.55222	0.771;0.771	T	0.64499	-0.6393	10	0.72032	D	0.01	-18.7274	12.9746	0.58531	0.0:0.0:0.1353:0.8647	.	210;210	A8K1U6;Q00537	.;CDK17_HUMAN	G	210;210;157	ENSP00000261211:R210G;ENSP00000444459:R210G;ENSP00000442926:R157G	ENSP00000261211:R210G	R	-	1	2	CDK17	95216865	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.532000	0.45659	0.975000	0.38392	0.482000	0.46254	AGA		0.308	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408751.1	NM_002595		17	57	0	0	0	0.006122	0	17	57				
SLC5A8	160728	broad.mit.edu	37	12	101577997	101577997	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:101577997T>A	ENST00000536262.2	-	8	1525	c.967A>T	c.(967-969)Atg>Ttg	p.M323L		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8									p.M323L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AAATAAGGCATGAGCTGAAAA	0.378																																					GBM(60;420 1056 13605 22380 47675)	GBM(60;420 1056 13605 22380 47675)	uc001thz.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(967-969)ATG>TTG		solute carrier family 5 (iodide transporter),							60.0	58.0	59.0					12																	101577997		2203	4300	6503	SO:0001583	missense	160728				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity	g.chr12:101577997T>A	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.967A>T	12.37:g.101577997T>A	ENSP00000445340:p.Met323Leu						p.M323L	NM_145913	NP_666018	Q8N695	SC5A8_HUMAN			8	1357	-			323			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000536262.2	37	c.967A>T	CCDS9080.1	.	.	.	.	.	.	.	.	.	.	T	15.00	2.703085	0.48412	.	.	ENSG00000256870	ENST00000536262	D	0.86956	-2.19	5.66	3.19	0.36642	.	0.077100	0.85682	N	0.000000	T	0.74718	0.3753	N	0.11201	0.11	0.58432	D	0.999992	B	0.19935	0.04	B	0.26969	0.075	T	0.63346	-0.6658	10	0.30078	T	0.28	.	10.81	0.46540	0.2522:0.0:0.0:0.7478	.	323	Q8N695	SC5A8_HUMAN	L	323	ENSP00000445340:M323L	ENSP00000445340:M323L	M	-	1	0	SLC5A8	100102128	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.458000	0.53014	0.367000	0.24454	0.533000	0.62120	ATG		0.378	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913		6	34	0	0	0	0.001168	0	6	34				
MAPKAPK5	8550	broad.mit.edu	37	12	112326315	112326315	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:112326315G>A	ENST00000551404.2	+	11	1101	c.993G>A	c.(991-993)caG>caA	p.Q331Q	MAPKAPK5_ENST00000550735.2_Silent_p.Q331Q			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5	331					activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.Q331Q(2)		endometrium(1)|lung(11)|ovary(1)	13						GAATCCAGCAGGCTCACGCGG	0.498																																							uc001tta.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(2)|ovary(1)	3						c.(991-993)CAG>CAA		MAP kinase-activated protein kinase 5 isoform 2							126.0	126.0	126.0					12																	112326315		1989	4177	6166	SO:0001819	synonymous_variant	8550				signal transduction	cytoplasm|nucleus	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity	g.chr12:112326315G>A	AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.993G>A	12.37:g.112326315G>A						MAPKAPK5_uc001tsz.2_Silent_p.Q331Q|MAPKAPK5_uc001ttb.2_Silent_p.Q264Q	p.Q331Q	NM_139078	NP_620777	Q8IW41	MAPK5_HUMAN			11	1252	+			331					B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Silent	SNP	ENST00000551404.2	37	c.993G>A	CCDS44975.1																																																																																				0.498	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078		10	88	0	0	0	0.008291	0	10	88				
HECTD4	283450	broad.mit.edu	37	12	112708216	112708216	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:112708216C>T	ENST00000430131.2	-	11	1839	c.694G>A	c.(694-696)Gtt>Att	p.V232I	HECTD4_ENST00000377560.5_Missense_Mutation_p.V482I|HECTD4_ENST00000550722.1_Missense_Mutation_p.V520I			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	232					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.V482I(1)|p.V232I(1)									ATCGCACCAACGTGGTGCAAT	0.448																																							uc009zwc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)	2						c.(694-696)GTT>ATT		chromosome 12 open reading frame 51							284.0	283.0	283.0					12																	112708216		2203	4300	6503	SO:0001583	missense	283450							g.chr12:112708216C>T	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.694G>A	12.37:g.112708216C>T	ENSP00000404379:p.Val232Ile					C12orf51_uc010syk.1_Missense_Mutation_p.V55I|C12orf51_uc001tts.2_Missense_Mutation_p.V55I|C12orf51_uc001ttt.3_Missense_Mutation_p.V55I	p.V232I	NM_001109662	NP_001103132					5	712	-								L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37	c.694G>A		.	.	.	.	.	.	.	.	.	.	C	24.8	4.569757	0.86439	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.57752	0.39;0.4;0.38	5.78	5.78	0.91487	.	.	.	.	.	T	0.59662	0.2210	N	0.19112	0.55	0.48087	D	0.999587	D;D;D	0.57899	0.981;0.968;0.981	P;P;P	0.62184	0.899;0.854;0.899	T	0.64028	-0.6503	9	0.87932	D	0	.	20.0079	0.97439	0.0:1.0:0.0:0.0	.	232;232;232	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	I	482;232;520	ENSP00000366783:V482I;ENSP00000404379:V232I;ENSP00000449784:V520I	ENSP00000366783:V482I	V	-	1	0	C12orf51	111192599	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	7.456000	0.80751	2.722000	0.93159	0.655000	0.94253	GTT		0.448	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		24	238	0	0	0	0.004656	0	24	238				
DTX1	1840	broad.mit.edu	37	12	113515322	113515322	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:113515322G>C	ENST00000257600.3	+	2	856	c.353G>C	c.(352-354)tGg>tCg	p.W118S		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	118	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.W118S(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						GGCGGCGCATGGACGGCCTAC	0.632																																							uc001tuk.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|central_nervous_system(1)	4						c.(352-354)TGG>TCG		deltex homolog 1							90.0	73.0	79.0					12																	113515322		2203	4300	6503	SO:0001583	missense	1840				negative regulation of neuron differentiation|Notch signaling pathway|regulation of Notch signaling pathway|transcription from RNA polymerase II promoter	cytoplasm|nucleus	Notch binding|SH3 domain binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding	g.chr12:113515322G>C	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.353G>C	12.37:g.113515322G>C	ENSP00000257600:p.Trp118Ser						p.W118S	NM_004416	NP_004407	Q86Y01	DTX1_HUMAN			2	689	+			118			WWE 2.		O60630|Q9BS04	Missense_Mutation	SNP	ENST00000257600.3	37	c.353G>C	CCDS9164.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983559	0.74474	.	.	ENSG00000135144	ENST00000257600	T	0.67523	-0.27	3.13	3.13	0.36017	WWE domain (2);WWE domain, subgroup (1);	0.000000	0.64402	D	0.000001	D	0.83431	0.5253	M	0.89534	3.04	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.87170	0.2220	10	0.87932	D	0	-9.6888	13.0942	0.59182	0.0:0.0:1.0:0.0	.	118	Q86Y01	DTX1_HUMAN	S	118	ENSP00000257600:W118S	ENSP00000257600:W118S	W	+	2	0	DTX1	111999705	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.816000	0.91979	1.552000	0.49463	0.436000	0.28706	TGG		0.632	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2			8	53	0	0	0	0.008291	0	8	53				
NOS1	4842	broad.mit.edu	37	12	117768467	117768467	+	Silent	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:117768467G>C	ENST00000338101.4	-	1	412	c.408C>G	c.(406-408)tcC>tcG	p.S136S	NOS1_ENST00000344089.3_Silent_p.S136S|NOS1_ENST00000549189.1_5'Flank|NOS1_ENST00000317775.6_Silent_p.S136S			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0	Ala-rich.				cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GTGGCTGGTGGGACAGATCCA	0.657																																					Esophageal Squamous(162;1748 2599 51982 52956)	Esophageal Squamous(162;1748 2599 51982 52956)	uc001twm.1		NA																	0				ovary(3)|skin(3)|pancreas(1)	7						c.(406-408)TCC>TCG		nitric oxide synthase 1, neuronal	L-Citrulline(DB00155)						34.0	37.0	36.0					12																	117768467		1883	4105	5988	SO:0001819	synonymous_variant	4842				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr12:117768467G>C		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.408C>G	12.37:g.117768467G>C							p.S136S	NM_000620	NP_000611	P29475	NOS1_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0561)	2	1094	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		136			Interaction with NOSIP (By similarity).			Silent	SNP	ENST00000338101.4	37	c.408C>G	CCDS55890.1																																																																																				0.657	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			36	72	0	0	0	0.005524	0	36	72				
KSR2	283455	broad.mit.edu	37	12	118105377	118105377	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:118105377G>A	ENST00000339824.5	-	5	1800	c.1073C>T	c.(1072-1074)cCg>cTg	p.P358L	KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000302438.5_Missense_Mutation_p.P55L|KSR2_ENST00000425217.1_Missense_Mutation_p.P329L			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	358					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.P390L(1)|p.P55L(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGACAGCAGCGGGGAGCGCTG	0.582																																							uc001two.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15						c.(985-987)CCG>CTG		kinase suppressor of ras 2							50.0	54.0	53.0					12																	118105377		2004	4167	6171	SO:0001583	missense	283455				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr12:118105377G>A	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1073C>T	12.37:g.118105377G>A	ENSP00000339952:p.Pro358Leu						p.P329L	NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN			5	1041	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		358					A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	37	c.986C>T		.	.	.	.	.	.	.	.	.	.	G	18.08	3.543099	0.65198	.	.	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	T;T;T	0.52057	0.68;0.68;0.68	4.9	4.01	0.46588	.	0.071788	0.56097	D	0.000030	T	0.36331	0.0963	L	0.42245	1.32	0.80722	D	1	B	0.33238	0.403	B	0.18871	0.023	T	0.30592	-0.9973	10	0.59425	D	0.04	.	12.42	0.55514	0.0833:0.0:0.9167:0.0	.	358	Q6VAB6	KSR2_HUMAN	L	329;358;55;30	ENSP00000389715:P329L;ENSP00000339952:P358L;ENSP00000305466:P55L	ENSP00000305466:P55L	P	-	2	0	KSR2	116589760	1.000000	0.71417	0.996000	0.52242	0.949000	0.60115	9.366000	0.97143	1.199000	0.43173	-0.251000	0.11542	CCG		0.582	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598		3	23	0	0	0	0.004672	0	3	23				
SIRT4	23409	broad.mit.edu	37	12	120741852	120741852	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr12:120741852G>T	ENST00000202967.4	+	2	547	c.488G>T	c.(487-489)tGc>tTc	p.C163F	SIRT4_ENST00000537892.1_3'UTR	NM_012240.2	NP_036372.1			sirtuin 4									p.C163F(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTCCACGGATGCATGGACAGG	0.547																																							uc001tyc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(487-489)TGC>TTC		sirtuin 4							47.0	43.0	44.0					12																	120741852		2203	4300	6503	SO:0001583	missense	23409				chromatin silencing|negative regulation of insulin secretion|protein ADP-ribosylation|protein deacetylation	mitochondrial matrix	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ ADP-ribosyltransferase activity|NAD+ binding|protein binding|zinc ion binding	g.chr12:120741852G>T	AF083109	CCDS9194.1	12q24.31	2010-06-25	2010-06-25		ENSG00000089163	ENSG00000089163			14932	protein-coding gene	gene with protein product		604482	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 4"", ""sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae)"""			10381378	Standard	NM_012240		Approved	SIR2L4	uc001tyc.3	Q9Y6E7	OTTHUMG00000169028	ENST00000202967.4:c.488G>T	12.37:g.120741852G>T	ENSP00000202967:p.Cys163Phe						p.C163F	NM_012240	NP_036372	Q9Y6E7	SIRT4_HUMAN			2	508	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		163			Deacetylase sirtuin-type.			Missense_Mutation	SNP	ENST00000202967.4	37	c.488G>T	CCDS9194.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148594	0.57151	.	.	ENSG00000089163	ENST00000536460;ENST00000202967	T;T	0.16743	2.32;2.32	5.42	4.52	0.55395	.	0.088754	0.85682	D	0.000000	T	0.37652	0.1011	L	0.60455	1.87	0.58432	D	0.999993	D	0.64830	0.994	D	0.66196	0.942	T	0.22871	-1.0204	10	0.66056	D	0.02	-27.4129	16.4692	0.84095	0.0:0.1314:0.8686:0.0	.	163	Q9Y6E7	SIRT4_HUMAN	F	104;163	ENSP00000444838:C104F;ENSP00000202967:C163F	ENSP00000202967:C163F	C	+	2	0	SIRT4	119226235	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.335000	0.72949	1.408000	0.46895	0.650000	0.86243	TGC		0.547	SIRT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402003.1	NM_012240		4	64	1	0	0.00909568	0.009096	0.00957512	4	64				
KL	9365	broad.mit.edu	37	13	33628269	33628269	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr13:33628269G>C	ENST00000380099.3	+	2	1193	c.1185G>C	c.(1183-1185)agG>agC	p.R395S	KL_ENST00000487852.1_3'UTR|KL_ENST00000426690.2_Missense_Mutation_p.R88S	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	395	Glycosyl hydrolase-1 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)	p.R395S(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		CCAACCTGAGGCAACTGCTTT	0.443																																							uc001uus.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(1183-1185)AGG>AGC		klotho precursor							171.0	177.0	175.0					13																	33628269		2203	4300	6503	SO:0001583	missense	9365				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding	g.chr13:33628269G>C	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.1185G>C	13.37:g.33628269G>C	ENSP00000369442:p.Arg395Ser					KL_uc001uur.1_Missense_Mutation_p.R88S	p.R395S	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)	2	1193	+	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)	395			Glycosyl hydrolase-1 1.|Extracellular (Potential).		Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	ENST00000380099.3	37	c.1185G>C	CCDS9347.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.627350	0.66901	.	.	ENSG00000133116	ENST00000426690;ENST00000380099	T;T	0.36340	1.26;1.26	5.9	4.18	0.49190	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.63757	0.2538	M	0.82923	2.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.68236	-0.5462	10	0.72032	D	0.01	-32.5974	15.6891	0.77436	0.1238:0.0:0.8762:0.0	.	395;88	Q9UEF7;B3KUJ4	KLOT_HUMAN;.	S	88;395	ENSP00000399513:R88S;ENSP00000369442:R395S	ENSP00000369442:R395S	R	+	3	2	KL	32526269	1.000000	0.71417	0.998000	0.56505	0.853000	0.48598	3.272000	0.51616	0.428000	0.26173	-0.797000	0.03246	AGG		0.443	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1			28	145	0	0	0	0.007291	0	28	145				
HTR2A	3356	broad.mit.edu	37	13	47409209	47409209	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr13:47409209C>A	ENST00000378688.4	-	3	1310	c.1179G>T	c.(1177-1179)cgG>cgT	p.R393R	HTR2A_ENST00000543956.1_Silent_p.R309R|HTR2A_ENST00000542664.1_Silent_p.R393R			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	393					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.R393R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ACTGAATATACCGTGAAAAGG	0.418																																							uc001vbq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(1177-1179)CGG>CGT		5-hydroxytryptamine receptor 2A isoform 1	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)						128.0	124.0	125.0					13																	47409209		2203	4300	6503	SO:0001819	synonymous_variant	3356				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity	g.chr13:47409209C>A	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.1179G>T	13.37:g.47409209C>A						HTR2A_uc001vbr.2_Silent_p.R293R|HTR2A_uc010acr.2_Silent_p.R393R	p.R393R	NM_000621	NP_000612	P28223	5HT2A_HUMAN		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	3	1313	-		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)	393			Cytoplasmic (By similarity).		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Silent	SNP	ENST00000378688.4	37	c.1179G>T	CCDS9405.1																																																																																				0.418	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621		13	47	1	0	5.50884e-06	0.013537	6.6852e-06	13	47				
HTR2A	3356	broad.mit.edu	37	13	47466626	47466626	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr13:47466626A>T	ENST00000378688.4	-	2	643	c.512T>A	c.(511-513)cTg>cAg	p.L171Q	HTR2A_ENST00000543956.1_Missense_Mutation_p.L87Q|HTR2A_ENST00000542664.1_Missense_Mutation_p.L171Q			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	171					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.L171Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GTAGCGGTCCAGCGAGATGGC	0.547																																							uc001vbq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(511-513)CTG>CAG		5-hydroxytryptamine receptor 2A isoform 1	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)						231.0	219.0	223.0					13																	47466626		2203	4300	6503	SO:0001583	missense	3356				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity	g.chr13:47466626A>T	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.512T>A	13.37:g.47466626A>T	ENSP00000367959:p.Leu171Gln					HTR2A_uc001vbr.2_Missense_Mutation_p.L71Q|HTR2A_uc010acr.2_Missense_Mutation_p.L171Q	p.L171Q	NM_000621	NP_000612	P28223	5HT2A_HUMAN		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	2	646	-		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)	171			Helical; Name=3; (By similarity).		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	ENST00000378688.4	37	c.512T>A	CCDS9405.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.985517	0.93044	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.42513	0.97;0.97;0.97	6.16	6.16	0.99307	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.78935	0.4362	H	0.98407	4.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.87140	0.2202	10	0.87932	D	0	.	15.9872	0.80168	1.0:0.0:0.0:0.0	.	87;171	F5GWE8;P28223	.;5HT2A_HUMAN	Q	171;87;171	ENSP00000367959:L171Q;ENSP00000441861:L87Q;ENSP00000437737:L171Q	ENSP00000367959:L171Q	L	-	2	0	HTR2A	46364627	1.000000	0.71417	0.946000	0.38457	0.961000	0.63080	9.331000	0.96430	2.367000	0.80283	0.528000	0.53228	CTG		0.547	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621		53	182	0	0	0	0.00361	0	53	182				
Unknown	0	broad.mit.edu	37	13	75814465	75814465	+	IGR	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr13:75814465G>A								AL162571.1 (31292 upstream) : LINC01078 (10150 downstream)																							GGGTAGCACCGGGCTCCTCCA	0.592																																							uc010ths.1		NA																	0					0						c.(10-12)CCC>CCT		Homo sapiens mRNA; cDNA DKFZp434F0327 (from clone DKFZp434F0327).																																				SO:0001628	intergenic_variant	647288							g.chr13:75814465G>A																													13.37:g.75814465G>A							p.P4P	NR_027466						1	53	-									Silent	SNP		37	c.12C>T																																																																																				0	0.592									3	27	0	0	0	0.004672	0	3	27				
CLN5	1203	broad.mit.edu	37	13	77569228	77569228	+	Silent	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr13:77569228T>G	ENST00000377453.3	+	2	1643	c.351T>G	c.(349-351)ccT>ccG	p.P117P	CLN5_ENST00000485938.1_3'UTR	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	68					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)	p.P117P(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		AACCTGATCCTTATTGTCAAG	0.378																																							uc001vkc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(349-351)CCT>CCG		ceroid-lipofuscinosis, neuronal 5							138.0	137.0	137.0					13																	77569228		2203	4300	6503	SO:0001819	synonymous_variant	1203				brain development|cell death|lysosomal lumen acidification|neuron maturation|protein catabolic process	endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding	g.chr13:77569228T>G		CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.351T>G	13.37:g.77569228T>G							p.P117P	NM_006493	NP_006484	O75503	CLN5_HUMAN		GBM - Glioblastoma multiforme(99;0.0503)	2	379	+		Acute lymphoblastic leukemia(28;0.205)	68					B3KQK7	Silent	SNP	ENST00000377453.3	37	c.351T>G	CCDS9456.1																																																																																				0.378	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493		6	78	0	0	0	0.001168	0	6	78				
CLN5	1203	broad.mit.edu	37	13	77569333	77569333	+	Silent	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr13:77569333A>G	ENST00000377453.3	+	2	1748	c.456A>G	c.(454-456)gaA>gaG	p.E152E	CLN5_ENST00000485938.1_3'UTR	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	103					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)	p.E152E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		CAGTATGGGAATTTAAATATG	0.383																																							uc001vkc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(454-456)GAA>GAG		ceroid-lipofuscinosis, neuronal 5							150.0	152.0	151.0					13																	77569333		2203	4300	6503	SO:0001819	synonymous_variant	1203				brain development|cell death|lysosomal lumen acidification|neuron maturation|protein catabolic process	endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding	g.chr13:77569333A>G		CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.456A>G	13.37:g.77569333A>G							p.E152E	NM_006493	NP_006484	O75503	CLN5_HUMAN		GBM - Glioblastoma multiforme(99;0.0503)	2	484	+		Acute lymphoblastic leukemia(28;0.205)	103					B3KQK7	Silent	SNP	ENST00000377453.3	37	c.456A>G	CCDS9456.1																																																																																				0.383	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493		6	112	0	0	0	0.001984	0	6	112				
DCT	1638	broad.mit.edu	37	13	95092211	95092211	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr13:95092211C>A	ENST00000377028.5	-	8	1914	c.1501G>T	c.(1501-1503)Gga>Tga	p.G501*	DCT_ENST00000446125.1_Nonsense_Mutation_p.G534*	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	501					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)	p.G534*(1)|p.G501*(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		GGTGTATATCCTTTTCGAAGT	0.458																																							uc001vlv.3		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(1501-1503)GGA>TGA		dopachrome tautomerase isoform 1							116.0	115.0	115.0					13																	95092211		2203	4300	6503	SO:0001587	stop_gained	1638				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity	g.chr13:95092211C>A	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.1501G>T	13.37:g.95092211C>A	ENSP00000366227:p.Gly501*					DCT_uc010afh.2_Nonsense_Mutation_p.G534*	p.G501*	NM_001922	NP_001913	P40126	TYRP2_HUMAN		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)	8	1928	-	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)	501			Cytoplasmic (Potential).		Q09GT4	Nonsense_Mutation	SNP	ENST00000377028.5	37	c.1501G>T	CCDS9470.1	.	.	.	.	.	.	.	.	.	.	C	41	8.759688	0.98943	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	.	.	.	4.88	4.88	0.63580	.	0.165226	0.52532	D	0.000071	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-15.5529	16.9465	0.86231	0.0:1.0:0.0:0.0	.	.	.	.	X	501;534	.	ENSP00000366227:G501X	G	-	1	0	DCT	93890212	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	5.376000	0.66178	2.407000	0.81776	0.563000	0.77884	GGA		0.458	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3			7	38	1	0	8.12818e-05	0.001984	9.37558e-05	7	38				
COL4A1	1282	broad.mit.edu	37	13	110819542	110819542	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr13:110819542C>T	ENST00000375820.4	-	44	4033	c.3912G>A	c.(3910-3912)aaG>aaA	p.K1304K		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1304	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.K1304K(1)|p.K947K(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCATATCACCCTTAGAGCCTG	0.517																																							uc001vqw.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(3910-3912)AAG>AAA		alpha 1 type IV collagen preproprotein							179.0	169.0	172.0					13																	110819542		2203	4300	6503	SO:0001819	synonymous_variant	1282				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding	g.chr13:110819542C>T	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.3912G>A	13.37:g.110819542C>T						COL4A1_uc010agl.2_Intron	p.K1304K	NM_001845	NP_001836	P02462	CO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)		44	4034	-	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	1304			Triple-helical region.		A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Silent	SNP	ENST00000375820.4	37	c.3912G>A	CCDS9511.1																																																																																				0.517	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3			7	199	0	0	0	0.001984	0	7	199				
RASA3	22821	broad.mit.edu	37	13	114773056	114773056	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr13:114773056C>A	ENST00000334062.7	-	18	1816	c.1695G>T	c.(1693-1695)ggG>ggT	p.G565G	RASA3_ENST00000389544.4_Silent_p.G533G	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	565					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.G565G(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			GGTCTCTTCTCCCCGAGGACG	0.537																																							uc001vui.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|skin(1)	4						c.(1693-1695)GGG>GGT		RAS p21 protein activator 3							125.0	99.0	108.0					13																	114773056		2201	4298	6499	SO:0001819	synonymous_variant	22821				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity	g.chr13:114773056C>A		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1695G>T	13.37:g.114773056C>A						RASA3_uc010tkk.1_Silent_p.G533G|RASA3_uc001vuj.2_Silent_p.G182G	p.G565G	NM_007368	NP_031394	Q14644	RASA3_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.128)		18	1826	-	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	565					A6NL15|F8W6X8|Q8IUY2	Silent	SNP	ENST00000334062.7	37	c.1695G>T	CCDS32016.1																																																																																				0.537	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368		9	38	1	0	2.17888e-05	0.006214	2.59904e-05	9	38				
POTEG	404785	broad.mit.edu	37	14	19563437	19563437	+	Silent	SNP	G	G	T	rs200807306	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:19563437G>T	ENST00000409832.3	+	5	1003	c.951G>T	c.(949-951)tcG>tcT	p.S317S	CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	317										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GTTGTGGATCGGCAAGTATAG	0.358																																							uc001vuz.1		NA																	0				ovary(1)	1						c.(949-951)TCG>TCT		POTE ankyrin domain family, member G							2.0	1.0	1.0					14																	19563437		322	617	939	SO:0001819	synonymous_variant	404785							g.chr14:19563437G>T		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.951G>T	14.37:g.19563437G>T						POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA|uc001vvb.2_RNA	p.S317S	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN			5	1003	+			317			ANK 5.		A1L153|A6NMI9|Q6S5H6|Q6S8J2	Silent	SNP	ENST00000409832.3	37	c.951G>T	CCDS32018.1																																																																																				0.358	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356		11	72	1	0	1.5739e-10	0.004007	2.23609e-10	11	72				
OR4Q3	441669	broad.mit.edu	37	14	20216191	20216191	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:20216191C>A	ENST00000331723.1	+	1	605	c.605C>A	c.(604-606)gCc>gAc	p.A202D		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A202D(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTGGTGATAGCCAACAGTGGT	0.498																																							uc010tkt.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)	3						c.(604-606)GCC>GAC		olfactory receptor, family 4, subfamily Q,							217.0	169.0	185.0					14																	20216191		2203	4300	6503	SO:0001583	missense	441669				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20216191C>A	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.605C>A	14.37:g.20216191C>A	ENSP00000330049:p.Ala202Asp						p.A202D	NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	605	+	all_cancers(95;0.00108)		202			Helical; Name=5; (Potential).		Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	c.605C>A	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	9.277	1.047126	0.19827	.	.	ENSG00000182652	ENST00000331723	T	0.00183	8.6	4.21	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.447862	0.16319	U	0.219654	T	0.00440	0.0014	M	0.76328	2.33	0.21256	N	0.999743	D	0.59767	0.986	D	0.64687	0.928	T	0.49409	-0.8943	10	0.87932	D	0	.	7.8354	0.29368	0.0:0.8879:0.0:0.1121	.	202	Q8NH05	OR4Q3_HUMAN	D	202	ENSP00000330049:A202D	ENSP00000330049:A202D	A	+	2	0	OR4Q3	19286031	0.000000	0.05858	0.992000	0.48379	0.176000	0.22953	0.224000	0.17738	2.166000	0.68216	0.509000	0.49947	GCC		0.498	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			13	31	1	0	0.00010058	0.013537	0.000115634	13	31				
TGM1	7051	broad.mit.edu	37	14	24727494	24727494	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:24727494T>A	ENST00000206765.6	-	9	1522	c.1399A>T	c.(1399-1401)Agt>Tgt	p.S467C	TGM1_ENST00000544573.1_Missense_Mutation_p.S25C	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	467					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.S467C(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	AGCTTACCACTGCTAGTCTCT	0.617																																							uc001wod.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(1399-1401)AGT>TGT		transglutaminase 1	L-Glutamine(DB00130)						38.0	37.0	38.0					14																	24727494		2203	4300	6503	SO:0001583	missense	7051				cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity	g.chr14:24727494T>A	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.1399A>T	14.37:g.24727494T>A	ENSP00000206765:p.Ser467Cys					TGM1_uc010tog.1_Missense_Mutation_p.S25C	p.S467C	NM_000359	NP_000350	P22735	TGM1_HUMAN		GBM - Glioblastoma multiforme(265;0.0186)	9	1523	-			467					B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	c.1399A>T	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	T	14.92	2.678800	0.47886	.	.	ENSG00000092295	ENST00000206765;ENST00000544573	D;D	0.95690	-3.78;-3.78	4.91	4.91	0.64330	.	0.258207	0.46442	D	0.000300	D	0.91683	0.7371	L	0.43923	1.385	0.33498	D	0.589521	P	0.47034	0.889	B	0.36959	0.237	D	0.94905	0.8060	10	0.87932	D	0	.	12.5436	0.56186	0.0:0.0:0.0:1.0	.	467	P22735	TGM1_HUMAN	C	467;25	ENSP00000206765:S467C;ENSP00000439446:S25C	ENSP00000206765:S467C	S	-	1	0	TGM1	23797334	0.010000	0.17322	1.000000	0.80357	0.642000	0.38348	0.043000	0.13971	2.074000	0.62210	0.459000	0.35465	AGT		0.617	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359		3	30	0	0	0	0.004672	0	3	30				
NYNRIN	57523	broad.mit.edu	37	14	24884816	24884816	+	Silent	SNP	C	C	T	rs566510965	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:24884816C>T	ENST00000382554.3	+	9	4179	c.3861C>T	c.(3859-3861)ccC>ccT	p.P1287P		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1287					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)	p.P1287P(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TGCTCACCCCCGCGGCCTCCA	0.622													C|||	2	0.000399361	0.0	0.0	5008	,	,		17567	0.0		0.0	False		,,,				2504	0.002						uc001wpf.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(3859-3861)CCC>CCT		hypothetical protein LOC57523							74.0	79.0	77.0					14																	24884816		2039	4173	6212	SO:0001819	synonymous_variant	57523				DNA integration	integral to membrane	DNA binding	g.chr14:24884816C>T	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3861C>T	14.37:g.24884816C>T							p.P1287P	NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN			9	4179	+			1287					Q6P153|Q86TR3|Q9HAC4	Silent	SNP	ENST00000382554.3	37	c.3861C>T	CCDS45090.1																																																																																				0.622	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1			11	121	0	0	0	0.008291	0	11	121				
GZMH	2999	broad.mit.edu	37	14	25076845	25076845	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:25076845G>C	ENST00000216338.4	-	3	356	c.312C>G	c.(310-312)aaC>aaG	p.N104K	RP11-104E19.1_ENST00000557736.1_RNA|RP11-104E19.1_ENST00000555300.1_RNA|GZMH_ENST00000557220.2_Intron|GZMH_ENST00000382548.4_Missense_Mutation_p.N104K	NM_033423.4	NP_219491.1	P20718	GRAH_HUMAN	granzyme H (cathepsin G-like 2, protein h-CCPX)	104	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)	membrane (GO:0016020)	serine-type endopeptidase activity (GO:0004252)	p.N104K(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)	12				GBM - Glioblastoma multiforme(265;0.0267)		CGTTGGAGAAGTTCTTAGGAT	0.537																																							uc001wpr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(310-312)AAC>AAG		granzyme H precursor							236.0	221.0	226.0					14																	25076845		2203	4297	6500	SO:0001583	missense	2999				apoptosis|cytolysis|proteolysis	cytoplasm	serine-type endopeptidase activity	g.chr14:25076845G>C	M72150	CCDS9632.1, CCDS59243.1	14q11.2	2003-10-20			ENSG00000100450	ENSG00000100450			4710	protein-coding gene	gene with protein product		116831		CTSGL2		2049336	Standard	NM_033423		Approved	CGL-2, CCP-X, CTLA1, CSP-C	uc001wpr.2	P20718	OTTHUMG00000140185	ENST00000216338.4:c.312C>G	14.37:g.25076845G>C	ENSP00000216338:p.Asn104Lys					GZMH_uc010aly.1_Missense_Mutation_p.N104K|GZMH_uc010alz.1_Intron	p.N104K	NM_033423	NP_219491	P20718	GRAH_HUMAN		GBM - Glioblastoma multiforme(265;0.0267)	3	357	-			104			Peptidase S1.		G3V2C5|Q6XGZ0|Q6XGZ1	Missense_Mutation	SNP	ENST00000216338.4	37	c.312C>G	CCDS9632.1	.	.	.	.	.	.	.	.	.	.	g	7.181	0.589683	0.13812	.	.	ENSG00000100450	ENST00000216338;ENST00000382548	D;D	0.88201	-2.35;-2.35	4.69	-4.35	0.03656	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.78188	0.4244	L	0.28556	0.865	0.09310	N	1	B;B	0.22541	0.071;0.048	B;B	0.30401	0.115;0.028	T	0.64071	-0.6493	9	0.40728	T	0.16	.	0.7306	0.00956	0.2401:0.119:0.2777:0.3631	.	104;104	Q6XGZ1;P20718	.;GRAH_HUMAN	K	104	ENSP00000216338:N104K;ENSP00000371988:N104K	ENSP00000216338:N104K	N	-	3	2	GZMH	24146685	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.079000	0.11357	-1.038000	0.03279	-1.028000	0.02416	AAC		0.537	GZMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276538.2	NM_033423		6	173	0	0	0	0.00333	0	6	173				
PRKD1	5587	broad.mit.edu	37	14	30135337	30135337	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:30135337C>T	ENST00000331968.5	-	3	710	c.481G>A	c.(481-483)Gat>Aat	p.D161N	PRKD1_ENST00000415220.2_Missense_Mutation_p.D161N	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	161					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.D161N(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		CCACAGTGATCACAGAAAGCT	0.433																																							uc001wqh.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|large_intestine(2)|ovary(2)|skin(1)	8						c.(481-483)GAT>AAT		protein kinase D1							149.0	137.0	141.0					14																	30135337		2203	4300	6503	SO:0001583	missense	5587				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr14:30135337C>T		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.481G>A	14.37:g.30135337C>T	ENSP00000333568:p.Asp161Asn						p.D161N	NM_002742	NP_002733	Q15139	KPCD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)	3	662	-	Hepatocellular(127;0.0604)		161			Phorbol-ester/DAG-type 1.		A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	37	c.481G>A	CCDS9637.1	.	.	.	.	.	.	.	.	.	.	C	36	5.622340	0.96660	.	.	ENSG00000184304	ENST00000331968;ENST00000415220;ENST00000549503	D;D;D	0.92965	-3.14;-3.14;-3.14	5.53	5.53	0.82687	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.95868	0.8655	M	0.70108	2.13	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.96007	0.8998	10	0.87932	D	0	-28.3761	19.4531	0.94876	0.0:1.0:0.0:0.0	.	161	Q15139	KPCD1_HUMAN	N	161;161;84	ENSP00000333568:D161N;ENSP00000390535:D161N;ENSP00000446866:D84N	ENSP00000333568:D161N	D	-	1	0	PRKD1	29205088	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.600000	0.87896	0.591000	0.81541	GAT		0.433	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742		13	88	0	0	0	0.004007	0	13	88				
HEATR5A	25938	broad.mit.edu	37	14	31774347	31774347	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:31774347T>A	ENST00000389961.3	-	31	4984	c.4985A>T	c.(4984-4986)gAg>gTg	p.E1662V	HEATR5A_ENST00000439348.1_Missense_Mutation_p.E1662V|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000543095.2_Missense_Mutation_p.E1668V|HEATR5A_ENST00000439727.1_Missense_Mutation_p.E1375V			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1662								p.E1662V(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		CTCTCCAAACTCTGGCAGAGT	0.438																																							uc001wrf.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(4123-4125)GAG>GTG		HEAT repeat containing 5A							60.0	59.0	60.0					14																	31774347		1882	4119	6001	SO:0001583	missense	25938						binding	g.chr14:31774347T>A	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.4985A>T	14.37:g.31774347T>A	ENSP00000374611:p.Glu1662Val					HEATR5A_uc010ami.2_Missense_Mutation_p.E1273V	p.E1375V	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)	26	4201	-	Hepatocellular(127;0.0877)|Breast(36;0.137)		1662					Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	ENST00000389961.3	37	c.4124A>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.79|12.79	2.043256|2.043256	0.36085|0.36085	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095|ENST00000538864	T;T;T;T|.	0.73047|.	0.87;-0.71;0.87;0.87|.	5.92|5.92	4.76|4.76	0.60689|0.60689	.|.	0.187537|.	0.48767|.	D|.	0.000170|.	T|T	0.40272|0.40272	0.1110|0.1110	N|N	0.16903|0.16903	0.455|0.455	0.80722|0.80722	D|D	1|1	B|.	0.19445|.	0.036|.	B|.	0.18263|.	0.021|.	T|T	0.19257|0.19257	-1.0311|-1.0311	10|5	0.23302|.	T|.	0.38|.	.|.	10.4174|10.4174	0.44329|0.44329	0.261:0.0:0.0:0.739|0.261:0.0:0.0:0.739	.|.	1662|.	Q86XA9-2|.	.|.	V|C	1662;1662;1375;1668|1296	ENSP00000374611:E1662V;ENSP00000405407:E1662V;ENSP00000408681:E1375V;ENSP00000437968:E1668V|.	ENSP00000374611:E1662V|.	E|S	-|-	2|1	0|0	HEATR5A|HEATR5A	30844098|30844098	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.995000|0.995000	0.86356|0.86356	3.226000|3.226000	0.51254|0.51254	1.046000|1.046000	0.40249|0.40249	0.533000|0.533000	0.62120|0.62120	GAG|AGT		0.438	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473		17	45	0	0	0	0.004007	0	17	45				
SEC23A	10484	broad.mit.edu	37	14	39543704	39543704	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:39543704T>C	ENST00000307712.6	-	9	1535	c.1018A>G	c.(1018-1020)Aca>Gca	p.T340A	SEC23A_ENST00000536508.1_Missense_Mutation_p.T214A|SEC23A_ENST00000537403.1_Missense_Mutation_p.T138A|SEC23A_ENST00000545328.2_Missense_Mutation_p.T311A	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	340					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.T340A(1)		kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		TGGCCAGTTGTAGCAGCTCGA	0.338																																							uc001wup.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)	5						c.(1018-1020)ACA>GCA		SEC23-related protein A							121.0	122.0	122.0					14																	39543704		2203	4300	6503	SO:0001583	missense	10484				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|Golgi membrane|smooth endoplasmic reticulum membrane	protein binding|zinc ion binding	g.chr14:39543704T>C	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1018A>G	14.37:g.39543704T>C	ENSP00000306881:p.Thr340Ala					SEC23A_uc010tqa.1_Missense_Mutation_p.T202A|SEC23A_uc010tqb.1_Missense_Mutation_p.T311A|SEC23A_uc010tqc.1_Missense_Mutation_p.T202A	p.T340A	NM_006364	NP_006355	Q15436	SC23A_HUMAN	Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)	9	1241	-	Hepatocellular(127;0.213)		340					B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	37	c.1018A>G	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	T	2.020	-0.425003	0.04701	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328;ENST00000554645	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	5.49	4.34	0.51931	Sec23/Sec24, trunk domain (1);	0.238799	0.46758	N	0.000274	T	0.54711	0.1875	N	0.16130	0.375	0.20873	N	0.999835	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.001	T	0.38929	-0.9638	10	0.02654	T	1	-7.2928	8.5124	0.33226	0.0:0.2166:0.0:0.7834	.	228;311;214;340	G3V531;F5H365;F5H6C4;Q15436	.;.;.;SC23A_HUMAN	A	138;340;214;311;228	ENSP00000444193:T138A;ENSP00000306881:T340A;ENSP00000437715:T214A;ENSP00000445393:T311A	ENSP00000306881:T340A	T	-	1	0	SEC23A	38613455	0.326000	0.24669	0.898000	0.35279	0.988000	0.76386	0.738000	0.26158	0.923000	0.37045	-0.256000	0.11100	ACA		0.338	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2			71	61	0	0	0	0.00361	0	71	61				
HSPA2	3306	broad.mit.edu	37	14	65008744	65008744	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:65008744G>T	ENST00000394709.1	+	2	1253	c.1177G>T	c.(1177-1179)Gac>Tac	p.D393Y	RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000247207.6_Missense_Mutation_p.D393Y			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	393					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)	p.D393Y(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		GAATGTGCAGGACCTGCTGCT	0.612																																					Pancreas(136;1211 1835 24894 31984 38227)	Pancreas(136;1211 1835 24894 31984 38227)	uc001xhj.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1177-1179)GAC>TAC		heat shock 70kDa protein 2							70.0	65.0	66.0					14																	65008744		2203	4300	6503	SO:0001583	missense	3306				response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding	g.chr14:65008744G>T	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.1177G>T	14.37:g.65008744G>T	ENSP00000378199:p.Asp393Tyr					HSPA2_uc001xhk.3_Missense_Mutation_p.D393Y	p.D393Y	NM_021979	NP_068814	P54652	HSP72_HUMAN		all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)	2	1253	+			393					Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	ENST00000394709.1	37	c.1177G>T	CCDS9766.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.376058	0.61735	.	.	ENSG00000126803	ENST00000394709;ENST00000247207;ENST00000545222	T;T	0.01279	5.06;5.06	5.11	5.11	0.69529	.	0.000000	0.56097	U	0.000026	T	0.25382	0.0617	H	0.99983	5.22	0.50313	D	0.999867	D	0.89917	1.0	D	0.77557	0.99	T	0.63950	-0.6521	10	0.87932	D	0	-11.5544	18.6095	0.91279	0.0:0.0:1.0:0.0	.	393	P54652	HSP72_HUMAN	Y	393;393;167	ENSP00000378199:D393Y;ENSP00000247207:D393Y	ENSP00000247207:D393Y	D	+	1	0	HSPA2	64078497	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	9.865000	0.99609	2.395000	0.81488	0.558000	0.71614	GAC		0.612	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1			11	43	1	0	3.07112e-06	0.010729	3.79278e-06	11	43				
DCAF5	8816	broad.mit.edu	37	14	69521308	69521308	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:69521308T>G	ENST00000341516.5	-	9	2242	c.2095A>C	c.(2095-2097)Aaa>Caa	p.K699Q	DCAF5_ENST00000557386.1_Missense_Mutation_p.K698Q|DCAF5_ENST00000556847.1_Missense_Mutation_p.K617Q|DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000554215.1_Missense_Mutation_p.K617Q	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	699					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)		p.K699Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						GGGTTGTCTTTGTGGCTGGTT	0.537																																							uc001xkp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2095-2097)AAA>CAA		WD repeat domain 22							110.0	119.0	116.0					14																	69521308		2203	4300	6503	SO:0001583	missense	8816					CUL4 RING ubiquitin ligase complex		g.chr14:69521308T>G	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2095A>C	14.37:g.69521308T>G	ENSP00000341351:p.Lys699Gln					DCAF5_uc001xkq.2_Missense_Mutation_p.K698Q	p.K699Q	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN			9	2314	-			699					B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	ENST00000341516.5	37	c.2095A>C	CCDS32106.1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.303064	0.40795	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.69926	-0.44;-0.27;-0.27;0.2	4.99	4.99	0.66335	.	0.145416	0.44688	D	0.000424	T	0.52725	0.1752	N	0.24115	0.695	0.80722	D	1	P;B	0.35908	0.527;0.392	B;B	0.34180	0.177;0.086	T	0.55811	-0.8082	10	0.39692	T	0.17	-15.2915	14.854	0.70323	0.0:0.0:0.0:1.0	.	698;699	G3V4J7;Q96JK2	.;DCAF5_HUMAN	Q	699;617;617;698	ENSP00000341351:K699Q;ENSP00000451551:K617Q;ENSP00000452052:K617Q;ENSP00000451845:K698Q	ENSP00000341351:K699Q	K	-	1	0	DCAF5	68591061	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	5.750000	0.68712	2.094000	0.63399	0.459000	0.35465	AAA		0.537	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861		7	145	0	0	0	0.001984	0	7	145				
ZFYVE1	53349	broad.mit.edu	37	14	73440837	73440837	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:73440837G>A	ENST00000556143.1	-	11	2772	c.2052C>T	c.(2050-2052)gcC>gcT	p.A684A	ZFYVE1_ENST00000553891.1_Silent_p.A684A|ZFYVE1_ENST00000554145.1_5'Flank|ZFYVE1_ENST00000318876.5_Silent_p.A670A|ZFYVE1_ENST00000555072.1_Silent_p.A269A|ZFYVE1_ENST00000394207.2_Silent_p.A269A	NM_001281735.1|NM_021260.2	NP_001268664.1|NP_067083.1	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1	684					negative regulation of phosphatase activity (GO:0010923)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|ER-mitochondrion membrane contact site (GO:0044233)|Golgi stack (GO:0005795)|perinuclear region of cytoplasm (GO:0048471)|pre-autophagosomal structure (GO:0000407)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|zinc ion binding (GO:0008270)	p.A684A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(17)|ovary(1)|prostate(2)|skin(1)	35		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		TGTTCTGCACGGCCTCGCCCA	0.557																																							uc001xnm.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(2050-2052)GCC>GCT		zinc finger, FYVE domain containing 1 isoform 1							149.0	116.0	127.0					14																	73440837		2203	4300	6503	SO:0001819	synonymous_variant	53349					endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding	g.chr14:73440837G>A	AF251025	CCDS9811.1, CCDS41969.1, CCDS61498.1	14q24.2	2014-06-13	2003-02-28	2003-03-07		ENSG00000165861		"""Zinc fingers, FYVE domain containing"""	13180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 172"""	605471	"""zinc finger protein, subfamily 2A (FYVE domain containing), 1"""	ZNFN2A1		11024279, 11256955	Standard	NM_021260		Approved	DFCP1, KIAA1589, TAFF1, PPP1R172	uc001xnm.3	Q9HBF4		ENST00000556143.1:c.2052C>T	14.37:g.73440837G>A						ZFYVE1_uc001xnl.2_Silent_p.A269A|ZFYVE1_uc010arj.2_Silent_p.A670A	p.A684A	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)	11	2692	-		all_lung(585;1.33e-09)	684					J3KNL9|Q8WYX7|Q96K57|Q9BXP9|Q9HCI3	Silent	SNP	ENST00000556143.1	37	c.2052C>T	CCDS9811.1																																																																																				0.557	ZFYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413172.1	NM_021260		9	61	0	0	0	0.006214	0	9	61				
DNAL1	83544	broad.mit.edu	37	14	74125618	74125618	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:74125618A>G	ENST00000553645.2	+	3	152	c.111A>G	c.(109-111)atA>atG	p.I37M	DNAL1_ENST00000554871.1_5'UTR|RNU6-240P_ENST00000516098.1_RNA|DNAL1_ENST00000554339.1_Intron|DNAL1_ENST00000540526.1_5'UTR|DNAL1_ENST00000311089.3_Intron	NM_031427.3	NP_113615.2	Q4LDG9	DNAL1_HUMAN	dynein, axonemal, light chain 1	37								p.I37M(2)		kidney(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)		TTCCCCCTATAGAGAAGATGG	0.398																																							uc001xoq.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(109-111)ATA>ATG		axonemal dynein light chain 1							271.0	267.0	268.0					14																	74125618		1847	4105	5952	SO:0001583	missense	83544							g.chr14:74125618A>G	BC005343	CCDS45134.1, CCDS55928.1	14q24.3	2012-05-03	2006-09-04	2006-09-04	ENSG00000119661	ENSG00000119661			23247	protein-coding gene	gene with protein product		610062	"""chromosome 14 open reading frame 168"""	C14orf168		15845866	Standard	NM_031427		Approved	MGC12435, 1700010H15RiK, CILD16	uc001xoq.4	Q4LDG9		ENST00000553645.2:c.111A>G	14.37:g.74125618A>G	ENSP00000452037:p.Ile37Met					DNAL1_uc010aru.2_Translation_Start_Site|DNAL1_uc010arv.2_Intron	p.I37M	NM_031427	NP_113615	Q4LDG9	DNAL1_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)	3	276	+			37					B2RD38|Q5JPB7|Q9BS43	Missense_Mutation	SNP	ENST00000553645.2	37	c.111A>G	CCDS45134.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.045054	0.75846	.	.	ENSG00000119661	ENST00000553645	T	0.29397	1.57	5.71	5.71	0.89125	.	0.107041	0.64402	D	0.000004	T	0.74711	0.3752	H	0.99525	4.61	0.80722	D	1	P	0.42248	0.774	D	0.65684	0.937	D	0.84382	0.0550	10	0.87932	D	0	-11.0933	14.9616	0.71161	1.0:0.0:0.0:0.0	.	37	Q4LDG9	DNAL1_HUMAN	M	37	ENSP00000452037:I37M	ENSP00000310360:I37M	I	+	3	3	DNAL1	73195371	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.587000	0.46128	2.182000	0.69389	0.460000	0.39030	ATA		0.398	DNAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414565.2	NM_031427		57	211	0	0	0	0.00361	0	57	211				
FOXN3	1112	broad.mit.edu	37	14	89647103	89647103	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:89647103G>C	ENST00000345097.4	-	6	975	c.859C>G	c.(859-861)Ctg>Gtg	p.L287V	FOXN3_ENST00000557258.1_Missense_Mutation_p.L265V|FOXN3_ENST00000261302.5_Missense_Mutation_p.L287V|FOXN3_ENST00000555353.1_Missense_Mutation_p.L265V	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	287					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L287V(1)|p.L265V(1)		endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCAGGAAACAGCCCTCGGCTC	0.592																																							uc001xxo.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)	3						c.(859-861)CTG>GTG		checkpoint suppressor 1 isoform 1							28.0	27.0	28.0					14																	89647103		2203	4300	6503	SO:0001583	missense	1112				DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr14:89647103G>C		CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.859C>G	14.37:g.89647103G>C	ENSP00000343288:p.Leu287Val					FOXN3_uc001xxn.3_Missense_Mutation_p.L265V|FOXN3_uc010atk.2_Missense_Mutation_p.L265V	p.L287V	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN			6	996	-			287					Q96II7|Q9UIE7	Missense_Mutation	SNP	ENST00000345097.4	37	c.859C>G	CCDS41977.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489215	0.44249	.	.	ENSG00000053254	ENST00000345097;ENST00000261302;ENST00000557258;ENST00000555353	D;D;D;D	0.94966	-3.57;-3.57;-3.36;-3.36	5.56	4.59	0.56863	.	0.347798	0.26542	N	0.023786	D	0.90215	0.6941	L	0.43152	1.355	0.47153	D	0.99933	B;B	0.17465	0.002;0.022	B;B	0.16722	0.002;0.016	D	0.84779	0.0772	10	0.16420	T	0.52	.	10.9934	0.47561	0.0:0.0:0.4309:0.5691	.	287;265	O00409;O00409-2	FOXN3_HUMAN;.	V	287;287;265;265	ENSP00000343288:L287V;ENSP00000261302:L287V;ENSP00000452005:L265V;ENSP00000452227:L265V	ENSP00000261302:L287V	L	-	1	2	FOXN3	88716856	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.255000	0.58804	1.260000	0.44134	0.561000	0.74099	CTG		0.592	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410902.2	NM_005197		9	12	0	0	0	0.010729	0	9	12				
BTBD7	55727	broad.mit.edu	37	14	93709128	93709128	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr14:93709128T>G	ENST00000334746.5	-	11	3197	c.2890A>C	c.(2890-2892)Acc>Ccc	p.T964P	BTBD7_ENST00000393170.2_Missense_Mutation_p.T538P|BTBD7_ENST00000554565.1_Missense_Mutation_p.T613P	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	964					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)		p.T964P(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GGGGAAGGGGTGCGTCTGCTG	0.488																																							uc001ybo.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2890-2892)ACC>CCC		BTB (POZ) domain containing 7 isoform 1							159.0	144.0	149.0					14																	93709128		2203	4300	6503	SO:0001583	missense	55727							g.chr14:93709128T>G	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.2890A>C	14.37:g.93709128T>G	ENSP00000335615:p.Thr964Pro					BTBD7_uc010aur.2_Missense_Mutation_p.T489P|BTBD7_uc010two.1_Missense_Mutation_p.T784P|BTBD7_uc001ybp.2_Missense_Mutation_p.T613P	p.T964P	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)	11	3216	-		all_cancers(154;0.08)	964					A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	ENST00000334746.5	37	c.2890A>C	CCDS32146.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.306997	0.40795	.	.	ENSG00000011114	ENST00000334746;ENST00000554565;ENST00000553975;ENST00000393170	T;T	0.48201	1.15;0.82	5.68	-3.58	0.04597	.	0.766811	0.13343	N	0.395013	T	0.18383	0.0441	N	0.08118	0	0.19575	N	0.999963	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.08055	0.003;0.002;0.0	T	0.09840	-1.0656	10	0.42905	T	0.14	.	0.6428	0.00813	0.3146:0.184:0.1084:0.393	.	538;613;964	E7ERI4;Q9P203-5;Q9P203	.;.;BTBD7_HUMAN	P	964;613;579;538	ENSP00000335615:T964P;ENSP00000451010:T613P	ENSP00000335615:T964P	T	-	1	0	BTBD7	92778881	0.951000	0.32395	0.065000	0.19835	0.553000	0.35397	1.419000	0.34793	-0.129000	0.11620	-0.250000	0.11733	ACC		0.488	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860		29	45	0	0	0	0.009535	0	29	45				
GABRB3	2562	broad.mit.edu	37	15	26866615	26866615	+	Missense_Mutation	SNP	G	G	T	rs267604145		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:26866615G>T	ENST00000311550.5	-	4	418	c.307C>A	c.(307-309)Cct>Act	p.P103T	GABRB3_ENST00000545868.1_Missense_Mutation_p.P18T|GABRB3_ENST00000400188.3_Missense_Mutation_p.P32T|GABRB3_ENST00000541819.2_Missense_Mutation_p.P159T|GABRB3_ENST00000299267.4_Missense_Mutation_p.P103T	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	103					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)	p.P103T(2)|p.P159T(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGGTTGAGAGGGATCCCAGAA	0.418																																							uc001zaz.2		NA																	3	Substitution - Missense(3)		lung(3)	upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5						c.(307-309)CCT>ACT		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						103.0	100.0	101.0					15																	26866615		2203	4300	6503	SO:0001583	missense	2562				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr15:26866615G>T		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.307C>A	15.37:g.26866615G>T	ENSP00000308725:p.Pro103Thr					GABRB3_uc010uae.1_Missense_Mutation_p.P18T|GABRB3_uc001zba.2_Missense_Mutation_p.P103T|GABRB3_uc001zbb.2_Missense_Mutation_p.P159T|GABRB3_uc001zbc.2_RNA	p.P103T	NM_000814	NP_000805	P28472	GBRB3_HUMAN		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	4	449	-		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)	103			Extracellular (Probable).		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	37	c.307C>A	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268593	0.40095	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868;ENST00000555094	T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	5.81	4.9	0.64082	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.62527	0.2435	N	0.16567	0.415	0.80722	D	1	B;B;B	0.29646	0.253;0.049;0.06	B;B;B	0.25506	0.061;0.037;0.038	T	0.59920	-0.7363	10	0.30078	T	0.28	.	13.8386	0.63424	0.073:0.0:0.927:0.0	.	159;103;103	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	T	103;159;103;32;18;18	ENSP00000308725:P103T;ENSP00000442408:P159T;ENSP00000299267:P103T;ENSP00000383049:P32T;ENSP00000439169:P18T;ENSP00000452272:P18T	ENSP00000299267:P103T	P	-	1	0	GABRB3	24417708	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.747000	0.85070	1.465000	0.48006	0.467000	0.42956	CCT		0.418	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2			17	55	1	0	5.35267e-07	0.007413	6.84006e-07	17	55				
GABRA5	2558	broad.mit.edu	37	15	27182439	27182439	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:27182439C>A	ENST00000335625.5	+	8	1576	c.688C>A	c.(688-690)Cag>Aag	p.Q230K	GABRA5_ENST00000355395.5_Missense_Mutation_p.Q230K|GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Missense_Mutation_p.Q230K	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	230					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.Q230K(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CCTGATGGGGCAGACGGTGGG	0.607																																							uc001zbd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(688-690)CAG>AAG		gamma-aminobutyric acid A receptor, alpha 5	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						65.0	69.0	68.0					15																	27182439		2131	4227	6358	SO:0001583	missense	2558				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity	g.chr15:27182439C>A		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.688C>A	15.37:g.27182439C>A	ENSP00000335592:p.Gln230Lys					GABRB3_uc001zbb.2_Intron	p.Q230K	NM_000810	NP_000801	P31644	GBRA5_HUMAN		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	9	1027	+		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)	230			Extracellular (Potential).		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	c.688C>A	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366603	0.61513	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	T;T;T	0.79033	-1.23;-1.23;-1.23	5.28	5.28	0.74379	Neurotransmitter-gated ion-channel ligand-binding (3);	0.111455	0.64402	D	0.000006	T	0.78181	0.4243	L	0.49126	1.545	0.50813	D	0.999891	B	0.33299	0.407	B	0.43018	0.405	T	0.77233	-0.2663	10	0.45353	T	0.12	.	13.9518	0.64123	0.0:0.8482:0.1518:0.0	.	230	P31644	GBRA5_HUMAN	K	230	ENSP00000335592:Q230K;ENSP00000347557:Q230K;ENSP00000382953:Q230K	ENSP00000335592:Q230K	Q	+	1	0	GABRA5	24765185	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.808000	0.69165	2.615000	0.88500	0.462000	0.41574	CAG		0.607	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1			3	22	1	0	0.00909568	0.009096	0.00957512	3	22				
HERC2	8924	broad.mit.edu	37	15	28474639	28474639	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:28474639C>A	ENST00000261609.7	-	33	5195	c.5087G>T	c.(5086-5088)tGg>tTg	p.W1696L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.W1696L(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AAGTCTTTGCCATCCACAAAA	0.388																																							uc001zbj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(5086-5088)TGG>TTG		hect domain and RLD 2							85.0	90.0	88.0					15																	28474639		2203	4299	6502	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28474639C>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.5087G>T	15.37:g.28474639C>A	ENSP00000261609:p.Trp1696Leu						p.W1696L	NM_004667	NP_004658	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	33	5193	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	1696						Missense_Mutation	SNP	ENST00000261609.7	37	c.5087G>T	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.317419	0.60524	.	.	ENSG00000128731	ENST00000261609	T	0.51325	0.71	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.62490	0.2432	L	0.54323	1.7	0.80722	D	1	D	0.54601	0.967	P	0.62382	0.901	T	0.66968	-0.5789	10	0.72032	D	0.01	.	17.2082	0.86923	0.0:1.0:0.0:0.0	.	1696	O95714	HERC2_HUMAN	L	1696	ENSP00000261609:W1696L	ENSP00000261609:W1696L	W	-	2	0	HERC2	26148234	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.205000	0.77881	2.282000	0.76494	0.555000	0.69702	TGG		0.388	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		14	81	1	0	1.36491e-13	0.001855	2.05177e-13	14	81				
PLA2G4D	283748	broad.mit.edu	37	15	42374529	42374529	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:42374529A>G	ENST00000290472.3	-	9	825	c.731T>C	c.(730-732)cTg>cCg	p.L244P		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	244					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)	p.L244P(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		CAAGGGCCTCAGGGGCACAGT	0.478																																							uc001zox.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|skin(1)	2						c.(730-732)CTG>CCG		phospholipase A2, group IVD							129.0	106.0	114.0					15																	42374529		2203	4299	6502	SO:0001583	missense	283748				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity	g.chr15:42374529A>G	AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.731T>C	15.37:g.42374529A>G	ENSP00000290472:p.Leu244Pro						p.L244P	NM_178034	NP_828848	Q86XP0	PA24D_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)	9	826	-		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)	244					Q8N176	Missense_Mutation	SNP	ENST00000290472.3	37	c.731T>C	CCDS32203.1	.	.	.	.	.	.	.	.	.	.	A	16.83	3.231803	0.58777	.	.	ENSG00000159337	ENST00000290472	T	0.01516	4.81	4.36	4.36	0.52297	.	0.169082	0.28052	N	0.016785	T	0.10723	0.0262	M	0.87097	2.86	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	T	0.00140	-1.2000	10	0.87932	D	0	-5.3153	9.8926	0.41298	1.0:0.0:0.0:0.0	.	244	Q86XP0	PA24D_HUMAN	P	244	ENSP00000290472:L244P	ENSP00000290472:L244P	L	-	2	0	PLA2G4D	40161821	0.803000	0.28956	0.286000	0.24833	0.108000	0.19459	4.359000	0.59449	1.844000	0.53588	0.533000	0.62120	CTG		0.478	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1	NM_178034		3	58	0	0	0	0.004672	0	3	58				
SLC12A1	6557	broad.mit.edu	37	15	48551398	48551399	+	Splice_Site	DNP	CC	CC	AA			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:48551398_48551399CC>AA	ENST00000558405.1	+	16	2058_2059	c.2044_2045CC>AA	c.(2044-2046)CCc>AAc	p.P682N	SLC12A1_ENST00000396577.3_Splice_Site_p.P682N|SLC12A1_ENST00000380993.3_Splice_Site_p.P682N			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	682					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)	p.P682N(2)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TACTTCCAGGCCCCAGTGCATT	0.48																																							uc001zwn.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(2044-2046)CCC>AAC		sodium potassium chloride cotransporter 2	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)																																			SO:0001630	splice_region_variant	6557				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity	g.chr15:48551398_48551399CC>AA		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	Exception_encountered	15.37:g.48551398_48551399delinsAA						SLC12A1_uc010uew.1_Missense_Mutation_p.P488N|SLC12A1_uc010bem.2_Missense_Mutation_p.P682N|SLC12A1_uc001zwq.3_Missense_Mutation_p.P453N|SLC12A1_uc001zwr.3_Missense_Mutation_p.P409N	p.P682N	NM_000338	NP_000329	Q13621	S12A1_HUMAN		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	17	2260_2261	+		all_lung(180;0.00219)	682					A8JYA2|E9PDW4	Missense_Mutation	DNP	ENST00000558405.1	37	c.2044_2045CC>AA	CCDS10129.2																																																																																				0.480	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		Missense_Mutation	8	81	0	0	0	0.004672	0	8	81				
CEP152	22995	broad.mit.edu	37	15	49036530	49036530	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:49036530C>A	ENST00000380950.2	-	24	3929	c.3742G>T	c.(3742-3744)Gca>Tca	p.A1248S	CEP152_ENST00000399334.3_Missense_Mutation_p.A1192S|CEP152_ENST00000325747.5_Missense_Mutation_p.A1155S	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1248					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.A1192S(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		ATGGCCCCTGCTGACAATGAC	0.338																																							uc001zwy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(3574-3576)GCA>TCA		centrosomal protein 152kDa							50.0	47.0	48.0					15																	49036530		1809	4069	5878	SO:0001583	missense	22995				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding	g.chr15:49036530C>A	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3742G>T	15.37:g.49036530C>A	ENSP00000370337:p.Ala1248Ser					CEP152_uc001zwz.2_Missense_Mutation_p.A1248S|CEP152_uc001zxa.1_Missense_Mutation_p.A1155S	p.A1192S	NM_014985	NP_055800	O94986	CE152_HUMAN		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)	23	3608	-		all_lung(180;0.0428)	1192					E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	c.3574G>T	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	C	8.200	0.797906	0.16327	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.51071	0.74;0.77;0.72	5.09	5.09	0.68999	.	0.496175	0.19770	N	0.106442	T	0.37433	0.1003	L	0.36672	1.1	0.27076	N	0.963198	B;B;B	0.27068	0.167;0.11;0.11	B;B;B	0.31101	0.124;0.04;0.04	T	0.18840	-1.0324	10	0.12766	T	0.61	-11.4255	12.7184	0.57127	0.0:0.9133:0.0:0.0866	.	1155;1248;1192	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	S	1248;1155;1192	ENSP00000370337:A1248S;ENSP00000321000:A1155S;ENSP00000382271:A1192S	ENSP00000321000:A1155S	A	-	1	0	CEP152	46823822	0.989000	0.36119	1.000000	0.80357	0.753000	0.42808	2.810000	0.47979	2.531000	0.85337	0.460000	0.39030	GCA		0.338	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985		6	30	1	0	8.12818e-05	0.001984	9.37558e-05	6	30				
ALDH1A2	8854	broad.mit.edu	37	15	58253451	58253451	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:58253451C>A	ENST00000249750.4	-	11	2060	c.1293G>T	c.(1291-1293)atG>atT	p.M431I	ALDH1A2_ENST00000347587.3_Missense_Mutation_p.M393I|ALDH1A2_ENST00000558231.1_Missense_Mutation_p.M402I|ALDH1A2_ENST00000559517.1_Missense_Mutation_p.M335I|ALDH1A2_ENST00000537372.1_Missense_Mutation_p.M410I	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	431					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)	p.M431I(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	TAACTTCATCCATCGTCTTAA	0.413																																							uc002aex.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1291-1293)ATG>ATT		aldehyde dehydrogenase 1A2 isoform 1	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)						95.0	87.0	90.0					15																	58253451		2192	4292	6484	SO:0001583	missense	8854				negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity	g.chr15:58253451C>A	AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.1293G>T	15.37:g.58253451C>A	ENSP00000249750:p.Met431Ile					ALDH1A2_uc002aey.2_Missense_Mutation_p.M393I|ALDH1A2_uc010ugv.1_Missense_Mutation_p.M410I|ALDH1A2_uc010ugw.1_Missense_Mutation_p.M402I|ALDH1A2_uc002aew.2_Missense_Mutation_p.M335I	p.M431I	NM_003888	NP_003879	O94788	AL1A2_HUMAN		GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	11	1351	-			431					B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Missense_Mutation	SNP	ENST00000249750.4	37	c.1293G>T	CCDS10163.1	.	.	.	.	.	.	.	.	.	.	C	3.449	-0.112395	0.06881	.	.	ENSG00000128918	ENST00000249750;ENST00000430119;ENST00000543386;ENST00000347587;ENST00000537372	T;T;T	0.14516	2.5;2.5;2.5	5.63	5.63	0.86233	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.291406	0.44688	D	0.000421	T	0.04137	0.0115	N	0.00980	-1.08	0.40284	D	0.978439	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.001	T	0.31475	-0.9942	10	0.02654	T	1	.	13.9479	0.64096	0.1516:0.8484:0.0:0.0	.	402;410;393;431	B4DH89;F5H2Y9;O94788-2;O94788	.;.;.;AL1A2_HUMAN	I	431;335;402;393;410	ENSP00000249750:M431I;ENSP00000309623:M393I;ENSP00000438296:M410I	ENSP00000249750:M431I	M	-	3	0	ALDH1A2	56040743	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.443000	0.35057	2.826000	0.97356	0.655000	0.94253	ATG		0.413	ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255869.1			3	32	1	0	0.00024832	0.009096	0.000280413	3	32				
CORO2B	10391	broad.mit.edu	37	15	69007578	69007578	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:69007578G>A	ENST00000566799.1	+	8	924	c.895G>A	c.(895-897)Gag>Aag	p.E299K	CORO2B_ENST00000540068.1_Missense_Mutation_p.E294K|CORO2B_ENST00000261861.5_Missense_Mutation_p.E294K|CORO2B_ENST00000543950.1_Missense_Mutation_p.E294K			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	299					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)	p.E299K(1)		kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CCGGTACTACGAGATCAGCAC	0.617																																							uc002arj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|large_intestine(1)	6						c.(895-897)GAG>AAG		coronin, actin binding protein, 2B							161.0	137.0	145.0					15																	69007578		2200	4298	6498	SO:0001583	missense	10391				actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding	g.chr15:69007578G>A	AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.895G>A	15.37:g.69007578G>A	ENSP00000454783:p.Glu299Lys					CORO2B_uc010bic.2_Missense_Mutation_p.E294K|CORO2B_uc002ark.2_Missense_Mutation_p.E66K	p.E299K	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN			8	924	+			299			WD 5.		A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	ENST00000566799.1	37	c.895G>A	CCDS10229.2	.	.	.	.	.	.	.	.	.	.	G	31	5.088800	0.94100	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.49432	0.78;0.78	4.59	4.59	0.56863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);Domain of unknown function DUF1900 (1);	0.000000	0.85682	D	0.000000	T	0.77955	0.4208	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.85593	0.1247	10	0.87932	D	0	-33.5116	16.3471	0.83146	0.0:0.0:1.0:0.0	.	299	Q9UQ03	COR2B_HUMAN	K	299;294;294	ENSP00000446250:E294K;ENSP00000443819:E294K	ENSP00000261861:E299K	E	+	1	0	CORO2B	66794632	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	9.273000	0.95719	2.278000	0.76064	0.563000	0.77884	GAG		0.617	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091		6	115	0	0	0	0.001168	0	6	115				
GOLGA6C	653641	broad.mit.edu	37	15	75557766	75557766	+	Splice_Site	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:75557766G>A	ENST00000300576.5	+	9	759		c.e9+1		RN7SL489P_ENST00000486185.2_RNA	NM_001164404.1	NP_001157876.1	A6NDK9	GOG6C_HUMAN	golgin A6 family, member C							Golgi apparatus (GO:0005794)		p.?(1)		ovary(1)	1						GTCGGTGGAGGTGAGGTCTGA	0.512																																							uc002azs.1		NA																	1	Unknown(1)		lung(1)	ovary(1)	1						c.e9+1		golgi autoantigen, golgin subfamily a, 6D																																				SO:0001630	splice_region_variant	653641							g.chr15:75557766G>A		CCDS58388.1	15q24.2	2014-02-12	2010-02-12		ENSG00000167195	ENSG00000167195			32206	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6C"""				Standard	NM_001164404		Approved		uc002azs.2	A6NDK9	OTTHUMG00000172671	ENST00000300576.5:c.759+1G>A	15.37:g.75557766G>A						uc002azt.1_5'Flank	p.E241_splice	NM_001145224	NP_001138696	A6NDK9	GOG6C_HUMAN			9	800	+									Splice_Site	SNP	ENST00000300576.5	37	c.723_splice	CCDS58388.1	.	.	.	.	.	.	.	.	.	.	G	5.869	0.344512	0.11126	.	.	ENSG00000167195	ENST00000300576	.	.	.	0.167	0.167	0.15006	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1731	0.20429	3.0E-4:0.0:0.9997:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GOLGA6C	73344819	1.000000	0.71417	0.013000	0.15412	0.013000	0.08279	3.535000	0.53575	0.276000	0.22118	0.281000	0.19383	.		0.512	GOLGA6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419797.1	NM_001164404	Intron	8	78	0	0	0	0.00308	0	8	78				
DNM1P34	729809	broad.mit.edu	37	15	75595021	75595021	+	RNA	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:75595021C>T	ENST00000567292.1	-	0	285							Q6PK57	DMP34_HUMAN	DNM1 pseudogene 34							microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										ACGAAGGCATCAGGGCGGCCA	0.612																																							uc002azx.1		NA																	0					NA						c.(34-36)CTG>CTA		SubName: Full=Putative uncharacterized protein DNM1P33;																																						0							g.chr15:75595021C>T	AJ576251		15q24.2	2013-04-25			ENSG00000260357	ENSG00000260357			35181	pseudogene	pseudogene				DNM1DN8@			Standard	NG_009143		Approved	DNM1DN8-1, DNM1DN8-5	uc002azx.1	Q6PK57	OTTHUMG00000172673		15.37:g.75595021C>T							p.L12L							1	286	-									Silent	SNP	ENST00000567292.1	37	c.36G>A																																																																																					0.612	DNM1P34-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000419799.1	NG_009143		3	10	0	0	0	0.004672	0	3	10				
C15orf27	123591	broad.mit.edu	37	15	76496577	76496577	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:76496577C>A	ENST00000388942.3	+	11	1793	c.1517C>A	c.(1516-1518)cCc>cAc	p.P506H		NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	506					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)	p.P506H(1)		endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						CACTTCCAGCCCACTGTGCCC	0.552																																							uc002bbq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1516-1518)CCC>CAC		hypothetical protein LOC123591							80.0	85.0	83.0					15																	76496577		2197	4294	6491	SO:0001583	missense	123591					integral to membrane		g.chr15:76496577C>A	AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.1517C>A	15.37:g.76496577C>A	ENSP00000373594:p.Pro506His					C15orf27_uc010bkp.2_Intron|C15orf27_uc002bbr.2_Missense_Mutation_p.P322H|C15orf27_uc002bbs.2_Missense_Mutation_p.P184H	p.P506H	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN			11	1672	+			506					Q8N993|Q96LL5	Missense_Mutation	SNP	ENST00000388942.3	37	c.1517C>A	CCDS10289.2	.	.	.	.	.	.	.	.	.	.	C	14.61	2.585988	0.46110	.	.	ENSG00000169758	ENST00000388942	T	0.32753	1.44	4.75	4.75	0.60458	.	0.183522	0.49305	D	0.000154	T	0.39600	0.1084	M	0.64997	1.995	0.33081	D	0.536686	D	0.55385	0.971	P	0.50378	0.639	T	0.58645	-0.7600	10	0.72032	D	0.01	-19.1119	10.7124	0.45990	0.2046:0.7954:0.0:0.0	.	506	Q2M3C6	CO027_HUMAN	H	506	ENSP00000373594:P506H	ENSP00000373594:P506H	P	+	2	0	C15orf27	74283632	0.993000	0.37304	0.895000	0.35142	0.585000	0.36419	3.755000	0.55197	2.171000	0.68590	0.557000	0.71058	CCC		0.552	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286637.2	NM_152335		19	101	1	0	5.35267e-07	0.007413	6.84006e-07	19	101				
SH2D7	646892	broad.mit.edu	37	15	78390402	78390403	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:78390402_78390403CC>AA	ENST00000328828.5	+	3	398_399	c.398_399CC>AA	c.(397-399)cCC>cAA	p.P133Q	SH2D7_ENST00000409568.2_5'UTR	NM_001101404.1	NP_001094874.1	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7	133	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.							p.P133Q(1)		endometrium(2)|kidney(2)|lung(3)	7						CAGCTCGAGCCCTTCAAAGAGA	0.624																																							uc010blb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(397-399)CCC>CAA		SH2 domain containing 7																																				SO:0001583	missense	646892							g.chr15:78390402_78390403CC>AA		CCDS45315.1	15q25.1	2013-02-14			ENSG00000183476	ENSG00000183476		"""SH2 domain containing"""	34549	protein-coding gene	gene with protein product							Standard	NM_001101404		Approved	LOC646892	uc010blb.1	A6NKC9	OTTHUMG00000154271	Exception_encountered	15.37:g.78390402_78390403delinsAA	ENSP00000327846:p.Pro133Gln						p.P133Q	NM_001101404	NP_001094874	A6NKC9	SH2D7_HUMAN			3	398_399	+			133			SH2.			Missense_Mutation	DNP	ENST00000328828.5	37	c.398_399CC>AA	CCDS45315.1																																																																																				0.624	SH2D7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000334660.2	NM_001101404		3	18	0	0	0	0.004672	0	3	18				
BNC1	646	broad.mit.edu	37	15	83926469	83926469	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:83926469C>T	ENST00000345382.2	-	5	2795	c.2710G>A	c.(2710-2712)Gat>Aat	p.D904N	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.D897N	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	904					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D904N(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GGGTACTCATCTTCCCCAGGG	0.547																																							uc002bjt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2710-2712)GAT>AAT		basonuclin 1							207.0	185.0	192.0					15																	83926469		2203	4300	6503	SO:0001583	missense	646				epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr15:83926469C>T	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2710G>A	15.37:g.83926469C>T	ENSP00000307041:p.Asp904Asn					BNC1_uc010uos.1_Missense_Mutation_p.D892N	p.D904N	NM_001717	NP_001708	Q01954	BNC1_HUMAN			5	2798	-			904					Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	c.2710G>A	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.777330	0.70107	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.50277	0.75	5.4	4.49	0.54785	.	0.405411	0.27627	N	0.018525	T	0.45637	0.1352	L	0.36672	1.1	0.35232	D	0.777053	P;B	0.46142	0.873;0.001	P;B	0.47346	0.544;0.002	T	0.60520	-0.7247	10	0.56958	D	0.05	-8.6594	13.1996	0.59761	0.0:0.9243:0.0:0.0757	.	897;904	F5GY04;Q01954	.;BNC1_HUMAN	N	904;897	ENSP00000307041:D904N	ENSP00000307041:D904N	D	-	1	0	BNC1	81717473	1.000000	0.71417	0.156000	0.22583	0.839000	0.47603	5.650000	0.67944	1.521000	0.48983	0.557000	0.71058	GAT		0.547	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717		34	205	0	0	0	0.004289	0	34	205				
ADAMTSL3	57188	broad.mit.edu	37	15	84611461	84611461	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:84611461G>T	ENST00000286744.5	+	18	2455	c.2231G>T	c.(2230-2232)cGa>cTa	p.R744L	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.R744L	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	744	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R744L(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GAGGAGTGCCGAGATGAAAAG	0.582																																							uc002bjz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27						c.(2230-2232)CGA>CTA		ADAMTS-like 3 precursor							69.0	71.0	70.0					15																	84611461		2203	4300	6503	SO:0001583	missense	57188					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr15:84611461G>T	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2231G>T	15.37:g.84611461G>T	ENSP00000286744:p.Arg744Leu					ADAMTSL3_uc010bmt.1_Missense_Mutation_p.R744L|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.R744L	p.R744L	NM_207517	NP_997400	P82987	ATL3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		18	2455	+			744			TSP type-1 5.		A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	c.2231G>T	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	G	5.643	0.303276	0.10678	.	.	ENSG00000156218	ENST00000286744	T	0.53206	0.63	5.31	-0.423	0.12325	.	0.787324	0.10364	N	0.683705	T	0.22437	0.0541	N	0.04260	-0.245	0.09310	N	1	B;B	0.23806	0.012;0.091	B;B	0.28232	0.068;0.087	T	0.26744	-1.0094	10	0.28530	T	0.3	.	5.362	0.16093	0.4223:0.1443:0.4334:0.0	.	744;744	P82987-2;P82987	.;ATL3_HUMAN	L	744	ENSP00000286744:R744L	ENSP00000286744:R744L	R	+	2	0	ADAMTSL3	82402465	0.000000	0.05858	0.000000	0.03702	0.878000	0.50629	0.510000	0.22723	0.241000	0.21283	-0.137000	0.14449	CGA		0.582	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517		17	41	1	0	1.02788e-11	0.00499	1.49374e-11	17	41				
AGBL1	123624	broad.mit.edu	37	15	86940733	86940733	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:86940733C>G	ENST00000441037.2	+	17	2468	c.2373C>G	c.(2371-2373)ttC>ttG	p.F791L	AGBL1_ENST00000421325.2_Missense_Mutation_p.F791L|AGBL1_ENST00000389298.3_Missense_Mutation_p.F522L	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	791					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						ACTTCATCTTCAAGATCATAC	0.512																																							uc002blz.1		NA																	0					0						c.(2371-2373)TTC>TTG		ATP/GTP binding protein-like 1							179.0	173.0	175.0					15																	86940733		2046	4178	6224	SO:0001583	missense	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:86940733C>G	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2373C>G	15.37:g.86940733C>G	ENSP00000413001:p.Phe791Leu						p.F791L	NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN			17	2453	+			791					A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	c.2373C>G	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.027005	0.93518	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.10099	2.91;2.91	5.49	5.49	0.81192	Peptidase M14, carboxypeptidase A (1);	0.000000	0.85682	D	0.000000	T	0.33118	0.0852	M	0.64997	1.995	0.53005	D	0.99996	D	0.89917	1.0	D	0.87578	0.998	T	0.01087	-1.1456	10	0.87932	D	0	-25.3218	18.7311	0.91735	0.0:1.0:0.0:0.0	.	791	Q96MI9	CBPC4_HUMAN	L	820;791;522	ENSP00000397173:F791L;ENSP00000373949:F522L	ENSP00000373949:F522L	F	+	3	2	AGBL1	84741737	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.237000	0.51344	2.733000	0.93635	0.655000	0.94253	TTC		0.512	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		3	71	0	0	0	0.004672	0	3	71				
NTRK3	4916	broad.mit.edu	37	15	88678345	88678345	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:88678345C>A	ENST00000360948.2	-	9	1352	c.1191G>T	c.(1189-1191)aaG>aaT	p.K397N	NTRK3_ENST00000540489.2_Missense_Mutation_p.K397N|NTRK3_ENST00000394480.2_Missense_Mutation_p.K397N|NTRK3_ENST00000355254.2_Missense_Mutation_p.K397N|NTRK3_ENST00000557856.1_Missense_Mutation_p.K397N|NTRK3_ENST00000542733.2_Missense_Mutation_p.K299N|NTRK3_ENST00000317501.3_Missense_Mutation_p.K397N|NTRK3_ENST00000558676.1_Missense_Mutation_p.K397N|NTRK3_ENST00000357724.2_Missense_Mutation_p.K397N	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	397					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.K397N(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GAAAGGGCTCCTTGAGGAAGT	0.527			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	3	Substitution - Missense(3)		lung(3)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(1189-1191)AAG>AAT		neurotrophic tyrosine kinase, receptor, type 3							198.0	180.0	186.0					15																	88678345		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88678345C>A	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1191G>T	15.37:g.88678345C>A	ENSP00000354207:p.Lys397Asn	TSP Lung(13;0.10)				NTRK3_uc002bmh.2_Missense_Mutation_p.K397N|NTRK3_uc002bmf.1_Missense_Mutation_p.K397N|NTRK3_uc010upl.1_Missense_Mutation_p.K299N|NTRK3_uc010bnh.1_Missense_Mutation_p.K397N|NTRK3_uc002bmg.2_Missense_Mutation_p.K397N	p.K397N	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		9	1353	-			397			Extracellular (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.1191G>T	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.703458	0.30232	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.74002	-0.8;-0.76;-0.75;-0.8;-0.68;0.08;0.08	5.28	5.28	0.74379	Immunoglobulin-like fold (1);	0.373689	0.31145	N	0.008167	T	0.61800	0.2376	L	0.29908	0.895	0.29189	N	0.875951	B;B;B;B;B;B	0.28760	0.013;0.015;0.004;0.221;0.026;0.009	B;B;B;B;B;B	0.21360	0.009;0.014;0.028;0.028;0.034;0.028	T	0.60311	-0.7288	10	0.41790	T	0.15	.	13.2721	0.60167	0.0:0.9216:0.0:0.0784	.	299;397;397;397;397;397	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	N	397;397;397;397;299;397;397	ENSP00000377990:K397N;ENSP00000354207:K397N;ENSP00000350356:K397N;ENSP00000347397:K397N;ENSP00000437773:K299N;ENSP00000444673:K397N;ENSP00000318328:K397N	ENSP00000318328:K397N	K	-	3	2	NTRK3	86479349	0.974000	0.33945	1.000000	0.80357	0.981000	0.71138	0.259000	0.18405	2.466000	0.83321	0.563000	0.77884	AAG		0.527	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				15	92	1	0	1.33834e-09	0.007413	1.87099e-09	15	92				
NTRK3	4916	broad.mit.edu	37	15	88678354	88678354	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:88678354G>T	ENST00000360948.2	-	9	1343	c.1182C>A	c.(1180-1182)caC>caA	p.H394Q	NTRK3_ENST00000540489.2_Missense_Mutation_p.H394Q|NTRK3_ENST00000394480.2_Missense_Mutation_p.H394Q|NTRK3_ENST00000355254.2_Missense_Mutation_p.H394Q|NTRK3_ENST00000557856.1_Missense_Mutation_p.H394Q|NTRK3_ENST00000542733.2_Missense_Mutation_p.H296Q|NTRK3_ENST00000317501.3_Missense_Mutation_p.H394Q|NTRK3_ENST00000558676.1_Missense_Mutation_p.H394Q|NTRK3_ENST00000357724.2_Missense_Mutation_p.H394Q	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	394					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.H394Q(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CCTTGAGGAAGTGGCCATTGA	0.537			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	3	Substitution - Missense(3)		lung(3)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(1180-1182)CAC>CAA		neurotrophic tyrosine kinase, receptor, type 3							211.0	192.0	198.0					15																	88678354		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88678354G>T	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1182C>A	15.37:g.88678354G>T	ENSP00000354207:p.His394Gln	TSP Lung(13;0.10)				NTRK3_uc002bmh.2_Missense_Mutation_p.H394Q|NTRK3_uc002bmf.1_Missense_Mutation_p.H394Q|NTRK3_uc010upl.1_Missense_Mutation_p.H296Q|NTRK3_uc010bnh.1_Missense_Mutation_p.H394Q|NTRK3_uc002bmg.2_Missense_Mutation_p.H394Q	p.H394Q	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		9	1344	-			394			Extracellular (Potential).		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.1182C>A	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727531	0.48833	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.73897	-0.79;-0.74;-0.73;-0.79;-0.66;0.05;0.05	5.28	4.36	0.52297	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.79341	0.4429	L	0.42744	1.35	0.54753	D	0.999989	D;D;B;D;D;B	0.89917	0.999;0.998;0.125;1.0;0.999;0.125	D;D;B;D;D;B	0.83275	0.989;0.99;0.082;0.992;0.996;0.052	T	0.78285	-0.2263	10	0.48119	T	0.1	.	9.4789	0.38889	0.1605:0.0:0.8395:0.0	.	296;394;394;394;394;394	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	Q	394;394;394;394;296;394;394	ENSP00000377990:H394Q;ENSP00000354207:H394Q;ENSP00000350356:H394Q;ENSP00000347397:H394Q;ENSP00000437773:H296Q;ENSP00000444673:H394Q;ENSP00000318328:H394Q	ENSP00000318328:H394Q	H	-	3	2	NTRK3	86479358	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.173000	0.42472	1.224000	0.43551	0.563000	0.77884	CAC		0.537	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				17	95	1	0	1.33834e-09	0.007413	1.87099e-09	17	95				
ARPIN	348110	broad.mit.edu	37	15	90447054	90447054	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr15:90447054C>A	ENST00000357484.5	-	4	583	c.463G>T	c.(463-465)Ggg>Tgg	p.G155W	C15orf38-AP3S2_ENST00000560224.1_5'Flank|C15orf38-AP3S2_ENST00000398333.3_Missense_Mutation_p.G155W|C15orf38_ENST00000460685.1_Missense_Mutation_p.G59W	NM_001282380.1|NM_182616.2	NP_001269309.1|NP_872422.1	Q7Z6K5	ARPIN_HUMAN		155					directional locomotion (GO:0033058)|negative regulation of actin nucleation (GO:0051126)|negative regulation of cell migration (GO:0030336)|negative regulation of lamellipodium morphogenesis (GO:2000393)	lamellipodium (GO:0030027)		p.G155W(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	10	Melanoma(11;0.0171)|Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			ACCCCGGCCCCCAGCTCGAGT	0.642																																							uc002bos.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(463-465)GGG>TGG		hypothetical protein LOC348110							75.0	86.0	82.0					15																	90447054		2093	4218	6311	SO:0001583	missense	10239				intracellular protein transport|vesicle-mediated transport	cytoplasmic vesicle membrane|Golgi apparatus|membrane coat	protein transporter activity	g.chr15:90447054C>A																												ENST00000357484.5:c.463G>T	15.37:g.90447054C>A	ENSP00000350075:p.Gly155Trp					C15orf38_uc002bot.1_RNA|C15orf38_uc002bou.2_Missense_Mutation_p.G155W	p.G155W	NM_182616	NP_872422	P59780	AP3S2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)		4	618	-	Lung NSC(78;0.0181)|all_lung(78;0.0384)		Error:Variant_position_missing_in_P59780_after_alignment					E2QRD5	Missense_Mutation	SNP	ENST00000357484.5	37	c.463G>T	CCDS42080.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318388	0.60524	.	.	ENSG00000250021;ENSG00000242498	ENST00000398333;ENST00000357484	T	0.79247	-1.25	5.49	5.49	0.81192	.	0.000000	0.85682	U	0.000000	D	0.87513	0.6196	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88545	0.3112	10	0.87932	D	0	-7.1618	16.865	0.86027	0.0:1.0:0.0:0.0	.	155;155	Q7Z6K5;E2QRD5	CO038_HUMAN;.	W	155	ENSP00000381377:G155W	ENSP00000381377:G155W	G	-	1	0	C15orf38-AP3S2;C15orf38	88248058	1.000000	0.71417	0.999000	0.59377	0.083000	0.17756	6.391000	0.73208	2.583000	0.87209	0.579000	0.79373	GGG		0.642	C15orf38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335629.1			12	77	1	0	2.27111e-07	0.013537	2.94528e-07	12	77				
LMF1	64788	broad.mit.edu	37	16	929612	929612	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:929612C>A	ENST00000262301.11	-	6	873	c.855G>T	c.(853-855)cgG>cgT	p.R285R	LMF1_ENST00000399843.2_Silent_p.R285R|LMF1_ENST00000568897.1_Silent_p.R68R|LMF1_ENST00000543238.1_Silent_p.R48R|LMF1_ENST00000568268.1_5'UTR	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	285					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.R285R(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				TGCACGCCCGCCGGCCGAGGA	0.662																																							uc002ckj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(853-855)CGG>CGT		lipase maturation factor 1							47.0	59.0	55.0					16																	929612		2093	4212	6305	SO:0001819	synonymous_variant	64788					endoplasmic reticulum membrane|integral to membrane		g.chr16:929612C>A	AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.855G>T	16.37:g.929612C>A						LMF1_uc010brh.2_Silent_p.R68R|LMF1_uc010bri.2_Silent_p.R48R|LMF1_uc002ckk.2_Silent_p.R68R|LMF1_uc010uuu.1_RNA	p.R285R	NM_022773	NP_073610	Q96S06	LMF1_HUMAN			6	859	-		Hepatocellular(780;0.00308)	285			Lumenal (Potential).		Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Silent	SNP	ENST00000262301.11	37	c.855G>T	CCDS45373.1																																																																																				0.662	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109071.3	NM_022773		4	18	1	0	1.23904e-05	0.000602	1.49069e-05	4	18				
ERCC4	2072	broad.mit.edu	37	16	14028125	14028125	+	Silent	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:14028125A>T	ENST00000311895.7	+	7	1188	c.1179A>T	c.(1177-1179)gcA>gcT	p.A393A	CTD-2135D7.2_ENST00000570663.1_RNA|CTD-2135D7.2_ENST00000575137.1_RNA	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	393	Helicase-like.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.A393A(1)		NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						AAATTGAGGCAGAAAATAAGG	0.368			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc002dce.2		NA	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""			E		skin basal cell|skin squamous cell|melanoma			1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(3)|skin(2)|pancreas(1)	10						c.(1177-1179)GCA>GCT	Direct_reversal_of_damage|NER	excision repair cross-complementing rodent							133.0	150.0	144.0					16																	14028125		2197	4300	6497	SO:0001819	synonymous_variant	2072	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity	g.chr16:14028125A>T	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.1179A>T	16.37:g.14028125A>T						ERCC4_uc010uyz.1_5'UTR	p.A393A	NM_005236	NP_005227	Q92889	XPF_HUMAN			7	1188	+			393					A5PKV6|A8K111|O00140|Q8TD83	Silent	SNP	ENST00000311895.7	37	c.1179A>T	CCDS32390.1																																																																																				0.368	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236		40	115	0	0	0	0.00874	0	40	115				
GPRC5B	51704	broad.mit.edu	37	16	19883228	19883228	+	Missense_Mutation	SNP	T	T	A	rs145563587		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:19883228T>A	ENST00000300571.2	-	2	1131	c.940A>T	c.(940-942)Agg>Tgg	p.R314W	GPRC5B_ENST00000569847.1_Missense_Mutation_p.R314W|GPRC5B_ENST00000537135.1_Missense_Mutation_p.R340W|GPRC5B_ENST00000535671.1_Missense_Mutation_p.R314W|GPRC5B_ENST00000569479.1_Missense_Mutation_p.R314W	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	314					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)	p.R314W(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						TCCCGCATCCTGGGCTGCGAC	0.597																																							uc002dgt.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)|skin(1)	3						c.(940-942)AGG>TGG		G protein-coupled receptor, family C, group 5,							79.0	73.0	75.0					16																	19883228		2197	4300	6497	SO:0001583	missense	51704							g.chr16:19883228T>A	AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.940A>T	16.37:g.19883228T>A	ENSP00000300571:p.Arg314Trp					GPRC5B_uc010vav.1_Missense_Mutation_p.R340W	p.R314W	NM_016235	NP_057319	Q9NZH0	GPC5B_HUMAN			2	1048	-			314			Cytoplasmic (Potential).		D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	ENST00000300571.2	37	c.940A>T	CCDS10581.1	.	.	.	.	.	.	.	.	.	.	T	14.65	2.598033	0.46318	.	.	ENSG00000167191	ENST00000300571;ENST00000535671;ENST00000538074;ENST00000537135	T;T;T	0.28454	1.62;1.62;1.61	5.18	0.055	0.14313	.	0.055493	0.64402	D	0.000002	T	0.41743	0.1172	L	0.36672	1.1	0.48830	D	0.999715	D;D	0.76494	0.999;0.999	D;D	0.79784	0.993;0.993	T	0.05068	-1.0908	9	.	.	.	.	15.3602	0.74469	0.0:0.0:0.6323:0.3677	.	340;314	B7Z831;Q9NZH0	.;GPC5B_HUMAN	W	314;314;163;340	ENSP00000300571:R314W;ENSP00000442858:R314W;ENSP00000441775:R340W	.	R	-	1	2	GPRC5B	19790729	0.033000	0.19621	0.077000	0.20336	0.679000	0.39708	0.134000	0.15932	-0.184000	0.10567	-0.313000	0.08912	AGG		0.597	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254285.1			35	38	0	0	0	0.013726	0	35	38				
UMOD	7369	broad.mit.edu	37	16	20352615	20352615	+	Missense_Mutation	SNP	G	G	A	rs139607138	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:20352615G>A	ENST00000570689.1	-	7	1521	c.1375C>T	c.(1375-1377)Cgg>Tgg	p.R459W	UMOD_ENST00000396134.2_Missense_Mutation_p.R492W|UMOD_ENST00000302509.4_Missense_Mutation_p.R459W|UMOD_ENST00000424589.1_Missense_Mutation_p.R492W|UMOD_ENST00000396142.2_Missense_Mutation_p.R459W|UMOD_ENST00000396138.4_Missense_Mutation_p.R508W|UMOD_ENST00000570331.1_5'UTR			P07911	UROM_HUMAN	uromodulin	459	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.R459W(2)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						AGCGCCATCCGCACGGTGAAC	0.597													G|||	9	0.00179712	0.0045	0.0043	5008	,	,		17107	0.0		0.0	False		,,,				2504	0.0						uc002dgz.2		NA																	2	Substitution - Missense(2)		upper_aerodigestive_tract(1)|lung(1)	ovary(1)|skin(1)	2						c.(1375-1377)CGG>TGG		uromodulin precursor		G	TRP/ARG,TRP/ARG	21,4385	28.1+/-56.4	0,21,2182	81.0	68.0	72.0		1375,1375	0.3	1.0	16	dbSNP_134	72	0,8600		0,0,4300	yes	missense,missense	UMOD	NM_001008389.1,NM_003361.2	101,101	0,21,6482	AA,AG,GG		0.0,0.4766,0.1615	probably-damaging,probably-damaging	459/641,459/641	20352615	21,12985	2203	4300	6503	SO:0001583	missense	7369				cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding	g.chr16:20352615G>A	M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1375C>T	16.37:g.20352615G>A	ENSP00000460548:p.Arg459Trp					UMOD_uc002dha.2_Missense_Mutation_p.R459W|UMOD_uc002dhb.2_Missense_Mutation_p.R492W	p.R459W	NM_003361	NP_003352	P07911	UROM_HUMAN			7	1504	-			459			ZP.		B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	ENST00000570689.1	37	c.1375C>T	CCDS10583.1	4	0.0018315018315018315	2	0.0040650406504065045	2	0.0055248618784530384	0	0.0	0	0.0	G	19.10	3.762614	0.69763	0.004766	0.0	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.34	0.351	0.16042	Zona pellucida sperm-binding protein (3);	0.140191	0.32357	N	0.006203	D	0.85111	0.5622	M	0.87827	2.91	0.33129	D	0.542797	D;D	0.89917	1.0;0.999	D;D	0.70487	0.938;0.969	D	0.84802	0.0785	10	0.72032	D	0.01	-17.3155	3.5153	0.07722	0.2598:0.0:0.3812:0.3589	.	492;459	E9PEA4;P07911	.;UROM_HUMAN	W	459;492;492;459;437;459	ENSP00000379438:R492W;ENSP00000416346:R492W;ENSP00000306279:R459W;ENSP00000379446:R459W	ENSP00000306279:R459W	R	-	1	2	UMOD	20260116	0.101000	0.21875	0.999000	0.59377	0.932000	0.56968	0.041000	0.13927	0.312000	0.23038	0.655000	0.94253	CGG		0.597	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1			4	34	0	0	0	0.001168	0	4	34				
OTOA	146183	broad.mit.edu	37	16	21737885	21737885	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:21737885C>A	ENST00000286149.4	+	18	1965	c.1964C>A	c.(1963-1965)cCc>cAc	p.P655H	OTOA_ENST00000388957.3_Missense_Mutation_p.P317H|OTOA_ENST00000388958.3_Missense_Mutation_p.P641H|OTOA_ENST00000388956.4_Missense_Mutation_p.P562H			Q7RTW8	OTOAN_HUMAN	otoancorin	655					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)		p.P641H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		CAGTGTGTGCCCTTTCTGATC	0.552																																							uc002djh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1921-1923)CCC>CAC		otoancorin isoform 1							120.0	116.0	117.0					16																	21737885		2198	4300	6498	SO:0001583	missense	146183				sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix		g.chr16:21737885C>A	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.1964C>A	16.37:g.21737885C>A	ENSP00000286149:p.Pro655His					uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.P562H|OTOA_uc002dji.2_Missense_Mutation_p.P317H|OTOA_uc010vbk.1_Missense_Mutation_p.P289H	p.P641H	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN		GBM - Glioblastoma multiforme(48;0.0414)	18	1923	+			655					A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	37	c.1922C>A		.	.	.	.	.	.	.	.	.	.	C	17.25	3.341642	0.61073	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957;ENST00000338456	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	5.06	4.08	0.47627	.	0.184350	0.37623	N	0.002013	D	0.85771	0.5774	M	0.61703	1.905	0.33321	D	0.567365	D;D;B;D	0.76494	0.999;0.998;0.452;0.999	D;D;B;D	0.68621	0.959;0.94;0.228;0.959	D	0.87587	0.2488	10	0.33141	T	0.24	-9.4282	11.44	0.50092	0.0:0.8092:0.1908:0.0	.	655;562;317;641	Q7RTW8;B3KWU3;Q7RTW8-2;E9PF51	OTOAN_HUMAN;.;.;.	H	641;655;562;317;50	ENSP00000373610:P641H;ENSP00000286149:P655H;ENSP00000373608:P562H;ENSP00000373609:P317H	ENSP00000286149:P655H	P	+	2	0	OTOA	21645386	1.000000	0.71417	0.992000	0.48379	0.937000	0.57800	1.875000	0.39578	1.220000	0.43490	0.655000	0.94253	CCC		0.552	OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1			23	123	1	0	6.12954e-19	0.004656	9.80445e-19	23	123				
CACNG3	10368	broad.mit.edu	37	16	24366154	24366154	+	Splice_Site	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:24366154G>A	ENST00000005284.3	+	3	1498	c.296G>A	c.(295-297)cGa>cAa	p.R99Q		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	99					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.R99Q(1)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		CTCTCCGCAGGAGCTGTGAGG	0.637																																							uc002dmf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(295-297)CGA>CAA		voltage-dependent calcium channel gamma-3							70.0	57.0	61.0					16																	24366154		2197	4300	6497	SO:0001630	splice_region_variant	10368				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr16:24366154G>A	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.296-1G>A	16.37:g.24366154G>A							p.R99Q	NM_006539	NP_006530	O60359	CCG3_HUMAN		GBM - Glioblastoma multiforme(48;0.0809)	3	1496	+			99						Missense_Mutation	SNP	ENST00000005284.3	37	c.296G>A	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	G	35	5.555332	0.96514	.	.	ENSG00000006116	ENST00000005284	D	0.89123	-2.47	5.26	5.26	0.73747	.	0.054842	0.64402	D	0.000001	D	0.94305	0.8170	M	0.87758	2.905	0.80722	D	1	D	0.56968	0.978	P	0.57846	0.828	D	0.94453	0.7669	9	.	.	.	.	18.6736	0.91521	0.0:0.0:1.0:0.0	.	99	O60359	CCG3_HUMAN	Q	99	ENSP00000005284:R99Q	.	R	+	2	0	CACNG3	24273655	1.000000	0.71417	0.999000	0.59377	0.703000	0.40648	9.208000	0.95075	2.728000	0.93425	0.561000	0.74099	CGA		0.637	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	Missense_Mutation	11	57	0	0	0	0.013537	0	11	57				
GSG1L	146395	broad.mit.edu	37	16	27802775	27802775	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:27802775G>T	ENST00000447459.2	-	7	996	c.912C>A	c.(910-912)caC>caA	p.H304Q	GSG1L_ENST00000380897.3_Missense_Mutation_p.H149Q|GSG1L_ENST00000380898.2_Missense_Mutation_p.H167Q|GSG1L_ENST00000569166.1_Missense_Mutation_p.H167Q|GSG1L_ENST00000395724.3_Missense_Mutation_p.H253Q	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	304					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H149Q(1)|p.H304Q(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						AATCCGCCATGTGTGGCTGGT	0.627																																							uc002doz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(910-912)CAC>CAA		GSG1-like isoform 1							58.0	47.0	51.0					16																	27802775		2197	4300	6497	SO:0001583	missense	146395					integral to membrane		g.chr16:27802775G>T	AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.912C>A	16.37:g.27802775G>T	ENSP00000394954:p.His304Gln					GSG1L_uc010bya.1_Missense_Mutation_p.H253Q|GSG1L_uc010bxz.1_Missense_Mutation_p.H167Q|GSG1L_uc002doy.2_Missense_Mutation_p.H149Q	p.H304Q	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN			7	997	-			304					Q7Z6F8|Q8TB81	Missense_Mutation	SNP	ENST00000447459.2	37	c.912C>A	CCDS45450.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323359	0.24080	.	.	ENSG00000169181	ENST00000447459;ENST00000395724;ENST00000380898;ENST00000380897	T;T	0.29917	1.57;1.55	2.99	2.04	0.26737	.	0.806177	0.10724	N	0.641380	T	0.29783	0.0744	N	0.08118	0	0.26993	N	0.965098	P;B;P	0.47106	0.89;0.119;0.824	D;B;P	0.66497	0.944;0.047;0.88	T	0.17077	-1.0381	10	0.42905	T	0.14	-0.4647	6.0946	0.20013	0.1421:0.0:0.8579:0.0	.	253;167;304	Q6UXU4-3;Q6UXU4-4;Q6UXU4	.;.;GSG1L_HUMAN	Q	304;253;167;149	ENSP00000394954:H304Q;ENSP00000379074:H253Q	ENSP00000370282:H149Q	H	-	3	2	GSG1L	27710276	0.979000	0.34478	0.997000	0.53966	0.909000	0.53808	1.416000	0.34759	0.845000	0.35118	0.505000	0.49811	CAC		0.627	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433832.2	NM_144675		11	25	1	0	1.58986e-06	0.008291	1.9916e-06	11	25				
SH2B1	25970	broad.mit.edu	37	16	28856035	28856035	+	5'Flank	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:28856035G>A	ENST00000322610.8	+	0	0				MIR4721_ENST00000577590.1_RNA|TUFM_ENST00000313511.3_Missense_Mutation_p.A223V			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.A223V(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						GGCACAGAGAGCAGAGCCTAC	0.607																																							uc002drh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(667-669)GCT>GTT		Tu translation elongation factor, mitochondrial							84.0	81.0	82.0					16																	28856035		2197	4300	6497	SO:0001631	upstream_gene_variant	7284					mitochondrial nucleoid	GTP binding|GTPase activity|protein binding|translation elongation factor activity	g.chr16:28856035G>A	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2			16.37:g.28856035G>A	Exception_encountered					uc010vct.1_Intron|SH2B1_uc002dri.2_5'Flank	p.A223V	NM_003321	NP_003312	P49411	EFTU_HUMAN			5	807	-			220					A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	37	c.668C>T	CCDS53996.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847969	0.91277	.	.	ENSG00000178952	ENST00000313511	T	0.79141	-1.24	5.81	4.86	0.63082	Protein synthesis factor, GTP-binding (1);	0.046978	0.85682	N	0.000000	D	0.85423	0.5693	H	0.97587	4.035	0.80722	D	1	B	0.13594	0.008	B	0.08055	0.003	D	0.85101	0.0957	10	0.87932	D	0	-28.5851	13.6779	0.62465	0.0752:0.0:0.9248:0.0	.	220	P49411	EFTU_HUMAN	V	223	ENSP00000322439:A223V	ENSP00000322439:A223V	A	-	2	0	TUFM	28763536	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.535000	0.90623	1.462000	0.47948	0.561000	0.74099	GCT		0.607	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503		4	59	0	0	0	0.009096	0	4	59				
CORO1A	11151	broad.mit.edu	37	16	30199766	30199766	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:30199766G>A	ENST00000219150.5	+	10	1455	c.1150G>A	c.(1150-1152)Gat>Aat	p.D384N	CORO1A_ENST00000570045.1_Missense_Mutation_p.D384N|CORO1A_ENST00000565497.1_Intron	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	384					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.D384N(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						GGGGGGTCGGGATGCTGGGCC	0.697																																							uc002dww.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1150-1152)GAT>AAT		coronin, actin binding protein, 1A							42.0	46.0	44.0					16																	30199766		2197	4299	6496	SO:0001583	missense	11151				cell-substrate adhesion|innate immune response|leukocyte chemotaxis|negative regulation of actin nucleation|phagolysosome assembly|positive chemotaxis|regulation of cell shape|uropod organization	actin filament|cortical actin cytoskeleton|lamellipodium|phagocytic cup|phagocytic vesicle membrane	actin filament binding|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein homodimerization activity	g.chr16:30199766G>A	X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.1150G>A	16.37:g.30199766G>A	ENSP00000219150:p.Asp384Asn					uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|CORO1A_uc010bzq.2_Missense_Mutation_p.D384N|CORO1A_uc010bzr.2_Intron|CORO1A_uc002dwx.2_Missense_Mutation_p.D278N|CORO1A_uc002dwy.1_3'UTR|LOC606724_uc002dwz.1_5'Flank	p.D384N	NM_007074	NP_009005	P31146	COR1A_HUMAN			10	1272	+			384					B2RBL1|Q2YD73	Missense_Mutation	SNP	ENST00000219150.5	37	c.1150G>A	CCDS10673.1	.	.	.	.	.	.	.	.	.	.	.	3.958	-0.010836	0.07727	.	.	ENSG00000102879	ENST00000219150	T	0.27402	1.67	4.96	2.98	0.34508	Domain of unknown function DUF1900 (1);	0.241261	0.40640	N	0.001060	T	0.11922	0.0290	N	0.10664	0.02	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.15292	-1.0442	10	0.02654	T	1	-0.0684	8.9434	0.35745	0.2413:0.0:0.7587:0.0	.	384	P31146	COR1A_HUMAN	N	384	ENSP00000219150:D384N	ENSP00000219150:D384N	D	+	1	0	CORO1A	30107267	0.997000	0.39634	0.985000	0.45067	0.994000	0.84299	0.395000	0.20850	1.325000	0.45301	0.561000	0.74099	GAT		0.697	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255195.2	NM_007074		12	79	0	0	0	0.010729	0	12	79				
ZNF423	23090	broad.mit.edu	37	16	49670063	49670063	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:49670063C>A	ENST00000561648.1	-	4	3053	c.3000G>T	c.(2998-3000)gaG>gaT	p.E1000D	ZNF423_ENST00000563137.2_Missense_Mutation_p.E940D|ZNF423_ENST00000562871.1_Missense_Mutation_p.E940D|ZNF423_ENST00000567169.1_Missense_Mutation_p.E883D|ZNF423_ENST00000562520.1_Missense_Mutation_p.E940D|ZNF423_ENST00000262383.2_Missense_Mutation_p.E1000D|ZNF423_ENST00000535559.1_Missense_Mutation_p.E883D	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1000					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E1000D(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TAAACTCCTCCTCGCTCTGCA	0.597																																							uc002efs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(2998-3000)GAG>GAT		zinc finger protein 423							70.0	63.0	66.0					16																	49670063		2199	4300	6499	SO:0001583	missense	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49670063C>A	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3000G>T	16.37:g.49670063C>A	ENSP00000455426:p.Glu1000Asp					ZNF423_uc010vgn.1_Missense_Mutation_p.E883D	p.E1000D	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN			5	3298	-		all_cancers(37;0.0155)	1000					O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	c.3000G>T	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.538380	0.65085	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.11063	2.81;2.86	4.81	3.84	0.44239	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.17916	0.0430	L	0.29908	0.895	0.42198	D	0.991758	D	0.71674	0.998	D	0.79108	0.992	T	0.01635	-1.1307	9	.	.	.	-33.5698	9.8246	0.40903	0.0:0.8411:0.0:0.1589	.	1000	Q2M1K9	ZN423_HUMAN	D	1000;883	ENSP00000262383:E1000D;ENSP00000442321:E883D	.	E	-	3	2	ZNF423	48227564	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.361000	0.34136	2.234000	0.73211	0.561000	0.74099	GAG		0.597	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		3	24	1	0	0.004672	0.004672	0.00500111	3	24				
RPGRIP1L	23322	broad.mit.edu	37	16	53686885	53686885	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:53686885T>G	ENST00000379925.3	-	15	1764	c.1714A>C	c.(1714-1716)Att>Ctt	p.I572L	RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.I572L|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.I572L|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.I572L	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	572					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)	p.I572L(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CCATAGGCAATATCCTTTAAT	0.368																																							uc002ehp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1714-1716)ATT>CTT		RPGRIP1-like isoform a							54.0	52.0	53.0					16																	53686885		2198	4300	6498	SO:0001583	missense	23322				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding	g.chr16:53686885T>G		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.1714A>C	16.37:g.53686885T>G	ENSP00000369257:p.Ile572Leu					RPGRIP1L_uc002eho.3_Missense_Mutation_p.I572L|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.I572L|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.I572L|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.I572L	p.I572L	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN			15	1778	-		all_cancers(37;0.0973)	572					A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	c.1714A>C	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.113610	0.56398	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.75260	-0.08;-0.92	5.45	5.45	0.79879	.	0.292182	0.36519	N	0.002549	T	0.63954	0.2555	L	0.40543	1.245	0.80722	D	1	P;B;B;P	0.36712	0.553;0.298;0.245;0.566	B;B;B;B	0.36567	0.178;0.178;0.047;0.228	T	0.61332	-0.7084	10	0.22109	T	0.4	-16.4191	10.6886	0.45858	0.0:0.0765:0.0:0.9235	.	572;572;572;572	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	L	572	ENSP00000369257:I572L;ENSP00000262135:I572L	ENSP00000262135:I572L	I	-	1	0	RPGRIP1L	52244386	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.845000	0.39279	2.056000	0.61249	0.460000	0.39030	ATT		0.368	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272		5	64	0	0	0	0.000602	0	5	64				
GINS3	64785	broad.mit.edu	37	16	58437222	58437222	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:58437222A>T	ENST00000318129.5	+	2	615	c.407A>T	c.(406-408)cAg>cTg	p.Q136L	GINS3_ENST00000426538.2_Missense_Mutation_p.Q175L|GINS3_ENST00000328514.7_Intron	NM_022770.3	NP_073607.2	Q9BRX5	PSF3_HUMAN	GINS complex subunit 3 (Psf3 homolog)	136					DNA replication (GO:0006260)	nucleus (GO:0005634)		p.Q136L(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	7						GACATTTCCCAGTCTCTGCTG	0.517																																							uc002enh.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(406-408)CAG>CTG		GINS complex subunit 3 isoform b							50.0	44.0	46.0					16																	58437222		2198	4300	6498	SO:0001583	missense	64785				DNA replication	nucleus		g.chr16:58437222A>T	BC005879	CCDS10796.1, CCDS45498.1, CCDS45499.1	16q21	2008-02-05			ENSG00000181938	ENSG00000181938			25851	protein-coding gene	gene with protein product		610610				12477932	Standard	NM_022770		Approved	FLJ13912, PSF3	uc010cdj.3	Q9BRX5	OTTHUMG00000133486	ENST00000318129.5:c.407A>T	16.37:g.58437222A>T	ENSP00000318196:p.Gln136Leu					GINS3_uc010cdj.2_Missense_Mutation_p.Q175L|GINS3_uc002enj.3_Intron|GINS3_uc002eni.3_Missense_Mutation_p.Q136L	p.Q136L	NM_022770	NP_073607	Q9BRX5	PSF3_HUMAN			2	615	+			136					B2RDP3|E9PB21|Q9H870	Missense_Mutation	SNP	ENST00000318129.5	37	c.407A>T	CCDS10796.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.325126	0.60634	.	.	ENSG00000181938	ENST00000426538;ENST00000318129	T;T	0.14516	2.5;2.5	5.86	4.77	0.60923	.	0.327044	0.37761	N	0.001956	T	0.18676	0.0448	L	0.49126	1.545	0.49389	D	0.999789	P;B	0.40731	0.728;0.007	P;B	0.46144	0.505;0.01	T	0.01468	-1.1347	10	0.34782	T	0.22	-4.0364	11.1641	0.48533	0.9285:0.0:0.0715:0.0	.	175;136	E9PB21;Q9BRX5	.;PSF3_HUMAN	L	175;136	ENSP00000401018:Q175L;ENSP00000318196:Q136L	ENSP00000318196:Q136L	Q	+	2	0	GINS3	56994723	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.882000	0.75589	1.157000	0.42530	0.528000	0.53228	CAG		0.517	GINS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257384.2	NM_022770		5	21	0	0	0	0.000602	0	5	21				
DUS2	54920	broad.mit.edu	37	16	68104916	68104916	+	Missense_Mutation	SNP	G	G	T	rs150098325		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:68104916G>T	ENST00000565263.1	+	12	1209	c.715G>T	c.(715-717)Gtg>Ttg	p.V239L	DUS2_ENST00000432752.1_Missense_Mutation_p.V204L|DUS2_ENST00000358896.6_Missense_Mutation_p.V239L	NM_017803.3	NP_060273.1	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2	239					negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)|flavin adenine dinucleotide binding (GO:0050660)|protein kinase inhibitor activity (GO:0004860)|tRNA dihydrouridine synthase activity (GO:0017150)	p.V239L(1)									AGCCTCTTCCGTGATGGTGGC	0.542																																							uc002evi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(715-717)GTG>TTG		dihydrouridine synthase 2-like, SMM1 homolog							81.0	78.0	79.0					16																	68104916		2198	4300	6498	SO:0001583	missense	54920				tRNA processing	endoplasmic reticulum	double-stranded RNA binding|flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity	g.chr16:68104916G>T		CCDS10859.1, CCDS61970.1	16q22.1	2013-07-23	2013-07-23	2013-07-23	ENSG00000167264	ENSG00000167264			26014	protein-coding gene	gene with protein product	"""SMM1 homolog (S. cerevisiae)"""	609707	"""dihydrouridine synthase 2-like (SMM1, S. cerevisiae)"", ""dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)"", ""dihydrouridine synthase 2-like"""	DUS2L		15994936, 22741570	Standard	NM_017803		Approved	FLJ20399, SMM1	uc002evj.4	Q9NX74	OTTHUMG00000137538	ENST00000565263.1:c.715G>T	16.37:g.68104916G>T	ENSP00000455229:p.Val239Leu					DUS2L_uc002evj.2_Missense_Mutation_p.V239L|DUS2L_uc010vkk.1_Missense_Mutation_p.V204L|DUS2L_uc010cez.2_Missense_Mutation_p.V152L	p.V239L	NM_017803	NP_060273	Q9NX74	DUS2L_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0131)|Epithelial(162;0.0564)	12	864	+		Ovarian(137;0.192)	239					A8K3G3|Q4H4D9	Missense_Mutation	SNP	ENST00000565263.1	37	c.715G>T	CCDS10859.1	.	.	.	.	.	.	.	.	.	.	G	34	5.390299	0.95988	.	.	ENSG00000167264	ENST00000358896;ENST00000432752	T;T	0.38722	1.12;1.12	5.43	5.43	0.79202	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	T	0.60805	0.2297	L	0.56280	1.765	0.80722	D	1	D;P	0.71674	0.998;0.918	D;P	0.74023	0.982;0.854	T	0.60885	-0.7174	10	0.62326	D	0.03	-17.1654	17.3968	0.87448	0.0:0.0:1.0:0.0	.	204;239	E7EUN9;Q9NX74	.;DUS2L_HUMAN	L	239;204	ENSP00000351769:V239L;ENSP00000409498:V204L	ENSP00000351769:V239L	V	+	1	0	DUS2L	66662417	1.000000	0.71417	0.999000	0.59377	0.936000	0.57629	7.500000	0.81588	2.716000	0.92895	0.561000	0.74099	GTG		0.542	DUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268869.2	NM_017803		16	63	1	0	8.28177e-16	0.007413	1.28358e-15	16	63				
HYDIN	54768	broad.mit.edu	37	16	70975570	70975570	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:70975570C>A	ENST00000393567.2	-	43	6972	c.6822G>T	c.(6820-6822)aaG>aaT	p.K2274N		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2274					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.K2273N(1)|p.K2225N(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TCTCCTGGGCCTTCATGGCTG	0.532																																							uc002ezr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(6817-6819)AAG>AAT		hydrocephalus inducing isoform a							152.0	147.0	148.0					16																	70975570		2009	4165	6174	SO:0001583	missense	54768							g.chr16:70975570C>A	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6822G>T	16.37:g.70975570C>A	ENSP00000377197:p.Lys2274Asn						p.K2273N	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN			43	6947	-		Ovarian(137;0.0654)	2274			Potential.		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	c.6819G>T	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660076	0.67586	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01172	5.23	5.32	4.36	0.52297	.	0.000000	0.33959	U	0.004391	T	0.02888	0.0086	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59532	-0.7437	10	0.59425	D	0.04	.	6.7054	0.23248	0.0:0.6827:0.0:0.3173	.	2273	F8WD23	.	N	2274;2273	ENSP00000377197:K2274N	ENSP00000313052:K2273N	K	-	3	2	HYDIN	69533071	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	0.924000	0.28777	1.347000	0.45714	0.508000	0.49915	AAG		0.532	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			20	142	1	0	1.55795e-14	0.012319	2.37774e-14	20	142				
HYDIN	54768	broad.mit.edu	37	16	71007878	71007878	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:71007878T>A	ENST00000393567.2	-	34	5233	c.5083A>T	c.(5083-5085)Acc>Tcc	p.T1695S		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1695					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.T1694S(1)|p.T1646S(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GTTGGAATGGTCACCTTGGCT	0.483																																							uc002ezr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(5080-5082)ACC>TCC		hydrocephalus inducing isoform a							38.0	37.0	37.0					16																	71007878		1852	4092	5944	SO:0001583	missense	54768							g.chr16:71007878T>A	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.5083A>T	16.37:g.71007878T>A	ENSP00000377197:p.Thr1695Ser						p.T1694S	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN			34	5208	-		Ovarian(137;0.0654)	1695					A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	c.5080A>T	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	T	13.53	2.265402	0.40095	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01059	5.39	4.82	2.41	0.29592	.	0.229604	0.20803	U	0.085400	T	0.01765	0.0056	M	0.79475	2.455	0.80722	D	1	P	0.38827	0.649	B	0.38428	0.273	T	0.58945	-0.7546	10	0.13470	T	0.59	.	6.3487	0.21363	0.0:0.0907:0.1574:0.7519	.	1694	F8WD23	.	S	1695;1694	ENSP00000377197:T1695S	ENSP00000313052:T1694S	T	-	1	0	HYDIN	69565379	1.000000	0.71417	0.697000	0.30258	0.649000	0.38597	1.698000	0.37794	0.247000	0.21414	0.413000	0.27773	ACC		0.483	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			9	54	0	0	0	0.00499	0	9	54				
ADAMTS18	170692	broad.mit.edu	37	16	77389879	77389879	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:77389879G>A	ENST00000282849.5	-	9	1836	c.1418C>T	c.(1417-1419)tCa>tTa	p.S473L		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	473	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S473L(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GGAAGACCATGAAAACACTCC	0.473																																							uc002ffc.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(1417-1419)TCA>TTA		ADAM metallopeptidase with thrombospondin type 1							122.0	105.0	111.0					16																	77389879		2198	4300	6498	SO:0001583	missense	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77389879G>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.1418C>T	16.37:g.77389879G>A	ENSP00000282849:p.Ser473Leu					ADAMTS18_uc010chc.1_Missense_Mutation_p.S61L|ADAMTS18_uc002ffe.1_Missense_Mutation_p.S169L|ADAMTS18_uc010vni.1_RNA	p.S473L	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN			9	1837	-			473			Peptidase M12B.		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	c.1418C>T	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.178001	0.57692	.	.	ENSG00000140873	ENST00000282849	T	0.03212	4.01	5.19	4.21	0.49690	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.059866	0.64402	D	0.000002	T	0.09423	0.0232	L	0.39020	1.185	0.49915	D	0.999833	P;P	0.46220	0.566;0.874	B;P	0.57620	0.198;0.824	T	0.12708	-1.0537	10	0.52906	T	0.07	.	14.4181	0.67165	0.0:0.0:0.8515:0.1485	.	473;473	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	L	473	ENSP00000282849:S473L	ENSP00000282849:S473L	S	-	2	0	ADAMTS18	75947380	1.000000	0.71417	0.749000	0.31150	0.214000	0.24535	5.484000	0.66844	1.515000	0.48885	0.655000	0.94253	TCA		0.473	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			11	40	0	0	0	0.008291	0	11	40				
CDH13	1012	broad.mit.edu	37	16	83813620	83813620	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:83813620G>A	ENST00000566620.1	+	12	2019	c.1729G>A	c.(1729-1731)Gac>Aac	p.D577N	CDH13_ENST00000268613.10_Missense_Mutation_p.D624N|CDH13_ENST00000428848.3_Missense_Mutation_p.D538N	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	577	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)	p.D577N(1)		large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AACCCTGGAGGACGTGAATGA	0.488																																							uc002fgx.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(1729-1731)GAC>AAC		cadherin 13 preproprotein							101.0	94.0	96.0					16																	83813620		1935	4179	6114	SO:0001583	missense	1012				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding	g.chr16:83813620G>A	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1729G>A	16.37:g.83813620G>A	ENSP00000454435:p.Asp577Asn					CDH13_uc010vns.1_Missense_Mutation_p.D624N|CDH13_uc010vnt.1_Missense_Mutation_p.D323N|CDH13_uc010vnu.1_Missense_Mutation_p.D538N	p.D577N	NM_001257	NP_001248	P55290	CAD13_HUMAN		COAD - Colon adenocarcinoma(5;0.0268)	12	1849	+		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)	577			Cadherin 4.		A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	37	c.1729G>A	CCDS58486.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899511	0.91962	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143;ENST00000538855;ENST00000539548;ENST00000540531	T;T	0.66638	-0.22;0.77	5.52	5.52	0.82312	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.86535	0.5956	M	0.92412	3.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.87578	0.998;0.998;0.989	D	0.89538	0.3790	9	0.87932	D	0	.	18.4313	0.90627	0.0:0.0:1.0:0.0	.	538;624;577	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	N	624;577;538;279;136;267	ENSP00000268613:D624N;ENSP00000394557:D577N	ENSP00000268613:D624N	D	+	1	0	CDH13	82371121	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	8.812000	0.91959	2.569000	0.86673	0.655000	0.94253	GAC		0.488	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257		9	30	0	0	0	0.010729	0	9	30				
TAF1C	9013	broad.mit.edu	37	16	84215065	84215065	+	Missense_Mutation	SNP	G	G	A	rs138550395		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:84215065G>A	ENST00000567759.1	-	10	1293	c.1111C>T	c.(1111-1113)Cgg>Tgg	p.R371W	TAF1C_ENST00000566732.1_Missense_Mutation_p.R345W|TAF1C_ENST00000341690.6_Missense_Mutation_p.R278W|TAF1C_ENST00000378541.4_Missense_Mutation_p.R371W|TAF1C_ENST00000570117.1_Missense_Mutation_p.R39W|TAF1C_ENST00000541676.1_Missense_Mutation_p.R278W	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	371					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.R371W(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						TAGATTTGCCGCAGCCTTGGG	0.637																																							uc002fhn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1111-1113)CGG>TGG		TBP-associated factor 1C isoform 1		G	TRP/ARG,TRP/ARG	0,4400		0,0,2200	40.0	38.0	39.0		1111,832	3.6	0.9	16	dbSNP_134	39	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	TAF1C	NM_005679.3,NM_139353.2	101,101	0,2,6498	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	371/870,278/776	84215065	2,12998	2200	4300	6500	SO:0001583	missense	9013				regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding	g.chr16:84215065G>A	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.1111C>T	16.37:g.84215065G>A	ENSP00000455265:p.Arg371Trp					TAF1C_uc002fhm.2_Missense_Mutation_p.R278W|TAF1C_uc010vnx.1_Missense_Mutation_p.R345W|TAF1C_uc010vny.1_5'UTR|TAF1C_uc010vnz.1_Missense_Mutation_p.R39W|TAF1C_uc002fho.2_5'UTR|TAF1C_uc010voa.1_Missense_Mutation_p.R39W|TAF1C_uc002fhp.1_RNA|TAF1C_uc010vob.1_3'UTR	p.R371W	NM_005679	NP_005670	Q15572	TAF1C_HUMAN			10	1339	-			371					B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	ENST00000567759.1	37	c.1111C>T	CCDS32496.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341054	0.60963	0.0	2.33E-4	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690	T;T;T	0.32023	1.47;4.04;4.04	4.62	3.61	0.41365	WD40/YVTN repeat-like-containing domain (1);	0.445886	0.18883	N	0.128534	T	0.24890	0.0604	L	0.44542	1.39	0.09310	N	0.999998	P;D;P	0.57571	0.894;0.98;0.894	B;B;B	0.40901	0.311;0.343;0.311	T	0.23048	-1.0199	10	0.87932	D	0	-6.7246	10.1047	0.42526	0.0:0.0:0.8017:0.1983	.	345;371;278	Q15572-6;Q15572;Q15572-2	.;TAF1C_HUMAN;.	W	371;278;278	ENSP00000367802:R371W;ENSP00000437900:R278W;ENSP00000345305:R278W	ENSP00000345305:R278W	R	-	1	2	TAF1C	82772566	1.000000	0.71417	0.852000	0.33557	0.528000	0.34623	4.378000	0.59568	2.397000	0.81536	0.561000	0.74099	CGG		0.637	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353		10	26	0	0	0	0.006214	0	10	26				
CRISPLD2	83716	broad.mit.edu	37	16	84914128	84914128	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:84914128G>C	ENST00000262424.5	+	13	1467	c.1243G>C	c.(1243-1245)Gca>Cca	p.A415P	CRISPLD2_ENST00000567845.1_Missense_Mutation_p.A414P|CRISPLD2_ENST00000564567.1_Missense_Mutation_p.A415P	NM_031476.3	NP_113664.1	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain containing 2	415	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|lung development (GO:0030324)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|transport vesicle (GO:0030133)	heparin binding (GO:0008201)	p.A415P(1)		endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)	18						CCATTGTCCGGCACACTGCAA	0.433																																							uc010voh.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1243-1245)GCA>CCA		cysteine-rich secretory protein LCCL domain							178.0	168.0	172.0					16																	84914128		2199	4300	6499	SO:0001583	missense	83716					extracellular region|transport vesicle		g.chr16:84914128G>C	AL136861	CCDS10949.1	16q24.1	2008-02-05	2005-02-16	2005-02-16	ENSG00000103196	ENSG00000103196			25248	protein-coding gene	gene with protein product		612434	"""LCCL domain containing cysteine-rich secretory protein 2"""	LCRISP2		11230166	Standard	NM_031476		Approved	DKFZP434B044	uc010voh.1	Q9H0B8	OTTHUMG00000137644	ENST00000262424.5:c.1243G>C	16.37:g.84914128G>C	ENSP00000262424:p.Ala415Pro					CRISPLD2_uc010vog.1_Intron|CRISPLD2_uc002fio.2_Missense_Mutation_p.A414P|CRISPLD2_uc002fin.3_Missense_Mutation_p.A415P	p.A415P	NM_031476	NP_113664	Q9H0B8	CRLD2_HUMAN			13	1470	+			415			LCCL 2.		D3DUM0|Q6P590|Q6UWH0|Q6UXC6|Q96IB1|Q96K61	Missense_Mutation	SNP	ENST00000262424.5	37	c.1243G>C	CCDS10949.1	.	.	.	.	.	.	.	.	.	.	G	9.495	1.101811	0.20632	.	.	ENSG00000103196	ENST00000262424	D	0.90324	-2.65	5.25	2.08	0.27032	LCCL (5);	0.260679	0.39909	N	0.001226	D	0.82559	0.5063	L	0.41079	1.255	0.39557	D	0.96906	B;B	0.16603	0.018;0.016	B;B	0.18871	0.023;0.017	T	0.69292	-0.5183	10	0.22109	T	0.4	.	5.2677	0.15607	0.0815:0.143:0.6276:0.1478	.	415;415	Q9H0B8;Q9H0B8-2	CRLD2_HUMAN;.	P	415	ENSP00000262424:A415P	ENSP00000262424:A415P	A	+	1	0	CRISPLD2	83471629	0.990000	0.36364	0.002000	0.10522	0.003000	0.03518	2.458000	0.45014	0.167000	0.19631	0.655000	0.94253	GCA		0.433	CRISPLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269086.2	NM_031476		37	147	0	0	0	0.00874	0	37	147				
FOXC2	2303	broad.mit.edu	37	16	86601062	86601062	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:86601062T>C	ENST00000320354.4	+	1	206	c.121T>C	c.(121-123)Tat>Cat	p.Y41H	RP11-463O9.5_ENST00000563280.1_RNA	NM_005251.2	NP_005242.1	Q99958	FOXC2_HUMAN	forkhead box C2 (MFH-1, mesenchyme forkhead 1)	41					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|embryonic viscerocranium morphogenesis (GO:0048703)|glomerular endothelium development (GO:0072011)|glomerular mesangial cell development (GO:0072144)|glomerular visceral epithelial cell differentiation (GO:0072112)|heart development (GO:0007507)|insulin receptor signaling pathway (GO:0008286)|lymphangiogenesis (GO:0001946)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|paraxial mesodermal cell fate commitment (GO:0048343)|patterning of blood vessels (GO:0001569)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular wound healing (GO:0035470)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|response to hormone (GO:0009725)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Y41H(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						CATGGGCGTCTATTCCGGCCA	0.701									Late-onset Hereditary Lymphedema																														uc002fjq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(121-123)TAT>CAT		forkhead box C2							28.0	34.0	32.0					16																	86601062		2198	4299	6497	SO:0001583	missense	2303	Late-onset_Hereditary_Lymphedema	Familial Cancer Database	Hereditary Lymphedema type II, Meige Lymphedema	anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|embryonic viscerocranium morphogenesis|insulin receptor signaling pathway|lymphangiogenesis|metanephros development|negative regulation of transcription from RNA polymerase II promoter|neural crest cell fate commitment|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of cell adhesion mediated by integrin|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vascular wound healing|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chr16:86601062T>C	Y08223	CCDS10958.1	16q24.1	2008-04-10			ENSG00000176692	ENSG00000176692		"""Forkhead boxes"""	3801	protein-coding gene	gene with protein product		602402		FKHL14		9169153, 8674414	Standard	NM_005251		Approved	MFH-1	uc002fjq.3	Q99958	OTTHUMG00000137652	ENST00000320354.4:c.121T>C	16.37:g.86601062T>C	ENSP00000326371:p.Tyr41His						p.Y41H	NM_005251	NP_005242	Q99958	FOXC2_HUMAN			1	206	+			41					C6KMR9|Q14DA6	Missense_Mutation	SNP	ENST00000320354.4	37	c.121T>C	CCDS10958.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.542926	0.65198	.	.	ENSG00000176692	ENST00000320354	D	0.95518	-3.73	4.01	4.01	0.46588	.	0.257891	0.26863	U	0.022104	D	0.93249	0.7849	M	0.64404	1.975	0.45914	D	0.998755	B	0.22683	0.073	B	0.20184	0.028	D	0.91210	0.4998	10	0.39692	T	0.17	.	11.9448	0.52922	0.0:0.0:0.0:1.0	.	41	Q99958	FOXC2_HUMAN	H	41	ENSP00000326371:Y41H	ENSP00000326371:Y41H	Y	+	1	0	FOXC2	85158563	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.230000	0.78097	1.685000	0.51034	0.454000	0.30748	TAT		0.701	FOXC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269104.2	NM_005251		10	17	0	0	0	0.006214	0	10	17				
TP53	7157	broad.mit.edu	37	17	7578455	7578455	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:7578455C>G	ENST00000269305.4	-	5	664	c.475G>C	c.(475-477)Gcc>Ccc	p.A159P	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.A159P|TP53_ENST00000455263.2_Missense_Mutation_p.A159P|TP53_ENST00000445888.2_Missense_Mutation_p.A159P|TP53_ENST00000420246.2_Missense_Mutation_p.A159P|TP53_ENST00000359597.4_Missense_Mutation_p.A159P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	159	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A159P(19)|p.0?(8)|p.A159T(7)|p.R158fs(6)|p.R158fs*11(6)|p.A159fs*11(4)|p.A159S(4)|p.R65fs(2)|p.A27P(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.R26fs(2)|p.A66P(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.R26fs*11(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.R65fs*11(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.A159_Q167delAMAIYKQSQ(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCCATGGCGCGGACGCGG	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		85	Substitution - Missense(34)|Deletion - Frameshift(18)|Deletion - In frame(12)|Complex(10)|Whole gene deletion(8)|Complex - frameshift(2)|Insertion - In frame(1)	p.A159V(30)|p.A159P(13)|p.A159A(8)|p.A159T(7)|p.A159D(7)|p.0?(7)|p.A159fs*11(5)|p.A159S(4)|p.R158_A159insX(4)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.R158fs*11(2)|p.A159fs*21(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.A159_Q167delAMAIYKQSQ(1)|p.V157fs*21(1)|p.R158fs*8(1)	lung(20)|central_nervous_system(18)|oesophagus(8)|liver(6)|stomach(5)|breast(5)|upper_aerodigestive_tract(4)|urinary_tract(4)|bone(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|ovary(2)|thyroid(1)|soft_tissue(1)|pancreas(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(475-477)GCC>CCC	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							50.0	51.0	50.0					17																	7578455		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578455C>G	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.475G>C	17.37:g.7578455C>G	ENSP00000269305:p.Ala159Pro	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.A159P|TP53_uc002gih.2_Missense_Mutation_p.A159P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.A27P|TP53_uc010cng.1_Missense_Mutation_p.A27P|TP53_uc002gii.1_Missense_Mutation_p.A27P|TP53_uc010cnh.1_Missense_Mutation_p.A159P|TP53_uc010cni.1_Missense_Mutation_p.A159P|TP53_uc002gij.2_Missense_Mutation_p.A159P|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.A66P|TP53_uc002gio.2_Missense_Mutation_p.A27P|TP53_uc010vug.1_Missense_Mutation_p.A120P	p.A159P	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	669	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	159		A -> G (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> D (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.475G>C	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209010	0.58343	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	5.59	2.4	0.29515	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.053992	0.64402	D	0.000001	D	0.99816	0.9919	M	0.89840	3.065	0.51767	D	0.999938	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;1.0;0.997;0.995;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.986;0.995;0.997;0.996;0.987;0.998	D	0.98681	1.0692	10	0.87932	D	0	-9.0177	6.1221	0.20159	0.0:0.6615:0.1535:0.185	.	120;159;159;66;159;159;159	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	159;159;159;159;159;159;148;66;27;66;27;159	ENSP00000410739:A159P;ENSP00000352610:A159P;ENSP00000269305:A159P;ENSP00000398846:A159P;ENSP00000391127:A159P;ENSP00000391478:A159P;ENSP00000425104:A27P;ENSP00000423862:A66P;ENSP00000424104:A159P	ENSP00000269305:A159P	A	-	1	0	TP53	7519180	1.000000	0.71417	0.149000	0.22428	0.179000	0.23085	4.930000	0.63462	0.333000	0.23563	0.655000	0.94253	GCC		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		28	29	0	0	0	0.007291	0	28	29				
DNAH9	1770	broad.mit.edu	37	17	11584038	11584038	+	Splice_Site	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:11584038A>G	ENST00000262442.4	+	19	3644		c.e19-1		DNAH9_ENST00000454412.2_Splice_Site	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9						cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.?(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTTCCTTTGCAGGAGCTGCCT	0.522																																							uc002gne.2		NA																	1	Unknown(1)		lung(1)	skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.e19-2		dynein, axonemal, heavy chain 9 isoform 2							63.0	51.0	55.0					17																	11584038		2203	4300	6503	SO:0001630	splice_region_variant	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11584038A>G	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3577-1A>G	17.37:g.11584038A>G						DNAH9_uc010coo.2_Splice_Site_p.E487_splice	p.E1193_splice	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	19	3645	+		Breast(5;0.0122)|all_epithelial(5;0.131)						A2VCQ8|O15064|O95494|Q9NQ28	Splice_Site	SNP	ENST00000262442.4	37	c.3577_splice	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	18.67	3.674578	0.67928	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6706	0.77270	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH9	11524763	1.000000	0.71417	0.980000	0.43619	0.621000	0.37620	9.287000	0.95975	2.169000	0.68431	0.460000	0.39030	.		0.522	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	Intron	3	15	0	0	0	0.009096	0	3	15				
MYOCD	93649	broad.mit.edu	37	17	12656601	12656601	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:12656601G>T	ENST00000343344.4	+	10	1996	c.1996G>T	c.(1996-1998)Ggg>Tgg	p.G666W	AC005358.1_ENST00000609971.1_Missense_Mutation_p.G570W|MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Missense_Mutation_p.G666W			Q8IZQ8	MYCD_HUMAN	myocardin	666					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.G666W(2)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CTCATCCTCCGGGGCCCAGGG	0.607																																							uc002gnn.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|skin(2)|ovary(1)	5						c.(1996-1998)GGG>TGG		myocardin isoform 2							60.0	65.0	64.0					17																	12656601		2203	4300	6503	SO:0001583	missense	93649				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding	g.chr17:12656601G>T	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1996G>T	17.37:g.12656601G>T	ENSP00000341835:p.Gly666Trp					MYOCD_uc002gno.2_Missense_Mutation_p.G666W|MYOCD_uc002gnp.1_Missense_Mutation_p.G570W|MYOCD_uc002gnq.2_Missense_Mutation_p.G385W	p.G666W	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)	10	2295	+			666					Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	c.1996G>T	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535848	0.45176	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.49139	0.83;0.79	5.73	2.29	0.28610	.	0.422778	0.27618	N	0.018571	T	0.59918	0.2229	M	0.62723	1.935	0.09310	N	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.78314	0.957;0.981;0.975;0.991	T	0.47355	-0.9124	10	0.72032	D	0.01	-9.7882	7.5877	0.28002	0.3832:0.0:0.6168:0.0	.	385;570;666;666	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	W	385;666;666;570;371	ENSP00000341835:G666W;ENSP00000400148:G371W	ENSP00000341835:G666W	G	+	1	0	MYOCD	12597326	0.412000	0.25392	0.005000	0.12908	0.001000	0.01503	0.869000	0.27996	0.798000	0.33994	0.644000	0.83932	GGG		0.607	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		11	71	1	0	1.5842e-08	0.001855	2.15021e-08	11	71				
TNFRSF13B	23495	broad.mit.edu	37	17	16875341	16875341	+	Nonsense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:16875341G>A	ENST00000261652.2	-	1	61	c.49C>T	c.(49-51)Cag>Tag	p.Q17*	TNFRSF13B_ENST00000583789.1_Nonsense_Mutation_p.Q17*|TNFRSF13B_ENST00000437538.2_Nonsense_Mutation_p.Q17*|TNFRSF13B_ENST00000581616.2_5'UTR|TNFRSF13B_ENST00000579315.1_Nonsense_Mutation_p.Q17*	NM_012452.2	NP_036584.1	O14836	TR13B_HUMAN	tumor necrosis factor receptor superfamily, member 13B	17					B cell homeostasis (GO:0001782)|cell surface receptor signaling pathway (GO:0007166)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of B cell proliferation (GO:0030889)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.Q17*(1)		endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|skin(1)	16						CGCTCCTCCTGGTCCACACGG	0.622									IgA Deficiency, Selective																														uc002gqs.1		NA																	1	Substitution - Nonsense(1)		lung(1)	kidney(2)	2						c.(49-51)CAG>TAG		tumor necrosis factor receptor 13B							94.0	72.0	79.0					17																	16875341		2203	4300	6503	SO:0001587	stop_gained	23495	IgA_Deficiency_Selective	Familial Cancer Database	IGAD1, IGAD2	cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding|receptor activity	g.chr17:16875341G>A	AF023614	CCDS11181.1	17p11.2	2014-09-17			ENSG00000240505	ENSG00000240505		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	18153	protein-coding gene	gene with protein product		604907				9311921	Standard	NM_012452		Approved	TACI, CD267	uc002gqs.1	O14836	OTTHUMG00000059262	ENST00000261652.2:c.49C>T	17.37:g.16875341G>A	ENSP00000261652:p.Gln17*					TNFRSF13B_uc010vwt.1_RNA|TNFRSF13B_uc002gqt.1_Nonsense_Mutation_p.Q17*|TNFRSF13B_uc010vwu.1_Nonsense_Mutation_p.Q17*	p.Q17*	NM_012452	NP_036584	O14836	TR13B_HUMAN			1	62	-			17			Extracellular (Potential).		B2R8B0|B7Z6V8|Q32LX4|Q7Z6F5	Nonsense_Mutation	SNP	ENST00000261652.2	37	c.49C>T	CCDS11181.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.851190	0.71719	.	.	ENSG00000240505	ENST00000437538;ENST00000261652	.	.	.	2.83	1.84	0.25277	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	5.4552	0.16586	0.164:0.0:0.836:0.0	.	.	.	.	X	17	.	ENSP00000261652:Q17X	Q	-	1	0	TNFRSF13B	16816066	0.102000	0.21896	0.002000	0.10522	0.071000	0.16799	0.799000	0.27028	0.528000	0.28580	0.313000	0.20887	CAG		0.622	TNFRSF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131474.2			25	28	0	0	0	0.003954	0	25	28				
NATD1	256302	broad.mit.edu	37	17	21146659	21146659	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:21146659G>A	ENST00000399011.2	-	4	307	c.306C>T	c.(304-306)ccC>ccT	p.P102P	C17orf103_ENST00000468196.1_3'UTR	NM_152914.2	NP_690878.2	Q8N6N6	NATD1_HUMAN		103	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.							p.P102P(1)|p.P103L(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						ACTGCGGCAGGGGGTTCTCCT	0.672																																							uc010vzx.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)		0						c.(307-309)CCC>CCT		transcript expressed during hematopoiesis 2							37.0	43.0	41.0					17																	21146659		1955	4128	6083	SO:0001819	synonymous_variant	256302							g.chr17:21146659G>A																												ENST00000399011.2:c.306C>T	17.37:g.21146659G>A							p.P103P	NM_152914	NP_690878	Q8N6N6	GTL3B_HUMAN			4	311	-			103					A8MWQ7|B3KX70	Silent	SNP	ENST00000399011.2	37	c.309C>T																																																																																					0.672	C17orf103-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				3	49	0	0	0	0.000602	0	3	49				
UBBP4	23666	broad.mit.edu	37	17	21730961	21730961	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:21730961C>A	ENST00000578713.1	+	1	267	c.263C>A	c.(262-264)aCc>aAc	p.T88N	UBBP4_ENST00000584398.1_Intron|UBBP4_ENST00000583708.1_Intron|UBBP4_ENST00000584755.1_Missense_Mutation_p.T88N					ubiquitin B pseudogene 4									p.T88N(3)		endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						ACCGGCAAGACCATCACCCTG	0.532																																							uc002gyy.3		NA																	3	Substitution - Missense(3)		lung(3)		NA						c.(262-264)ACC>AAC		SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																																				SO:0001583	missense	0							g.chr17:21730961C>A	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.263C>A	17.37:g.21730961C>A	ENSP00000464265:p.Thr88Asn						p.T88N							2	388	+									Missense_Mutation	SNP	ENST00000578713.1	37	c.263C>A																																																																																					0.532	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444589.2			3	27	1	0	0.00024832	0.009096	0.000280413	3	27				
NOS2	4843	broad.mit.edu	37	17	26109073	26109073	+	Missense_Mutation	SNP	G	G	T	rs201569440		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:26109073G>T	ENST00000313735.6	-	7	923	c.690C>A	c.(688-690)caC>caA	p.H230Q		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	230					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)	p.H230Q(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	AGTAACGCACGTGTCTGCAGA	0.547																																							uc002gzu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|breast(1)	4						c.(688-690)CAC>CAA		nitric oxide synthase 2A	Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)						193.0	134.0	154.0					17																	26109073		2203	4300	6503	SO:0001583	missense	4843				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding	g.chr17:26109073G>T	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.690C>A	17.37:g.26109073G>T	ENSP00000327251:p.His230Gln					NOS2_uc010crh.1_Missense_Mutation_p.H230Q|NOS2_uc010wab.1_Missense_Mutation_p.H230Q	p.H230Q	NM_000625	NP_000616	P35228	NOS2_HUMAN			7	954	-			230					A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	c.690C>A	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383175	0.61845	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.43688	0.94	5.38	1.41	0.22369	Nitric oxide synthase, oxygenase domain (3);	0.000000	0.85682	D	0.000000	T	0.71787	0.3381	H	0.97491	4.015	0.45867	D	0.998728	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74551	-0.3628	10	0.87932	D	0	.	8.1425	0.31091	0.4665:0.0:0.5335:0.0	.	230;230	F8WEM3;P35228	.;NOS2_HUMAN	Q	230	ENSP00000327251:H230Q	ENSP00000305638:H230Q	H	-	3	2	NOS2	23133200	0.293000	0.24371	0.555000	0.28281	0.799000	0.45148	0.753000	0.26376	0.520000	0.28426	0.484000	0.47621	CAC		0.547	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625		5	18	1	0	5.9392e-07	0.001168	7.57573e-07	5	18				
EFCAB5	374786	broad.mit.edu	37	17	28380882	28380882	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:28380882G>T	ENST00000394835.3	+	10	2102	c.1910G>T	c.(1909-1911)gGa>gTa	p.G637V	EFCAB5_ENST00000541045.1_Missense_Mutation_p.G294V|EFCAB5_ENST00000378738.3_Missense_Mutation_p.G637V|EFCAB5_ENST00000320856.5_Missense_Mutation_p.G637V|EFCAB5_ENST00000394832.2_Missense_Mutation_p.G637V|EFCAB5_ENST00000536908.2_Missense_Mutation_p.G581V	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	637							calcium ion binding (GO:0005509)	p.G637V(1)		breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GCAGAACAGGGATCACTCAGA	0.443																																							uc002het.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1909-1911)GGA>GTA		EF-hand calcium binding domain 5 isoform a							186.0	175.0	179.0					17																	28380882		2030	4197	6227	SO:0001583	missense	374786						calcium ion binding	g.chr17:28380882G>T	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.1910G>T	17.37:g.28380882G>T	ENSP00000378312:p.Gly637Val					EFCAB5_uc010wbi.1_Missense_Mutation_p.G380V|EFCAB5_uc010wbj.1_Missense_Mutation_p.G581V|EFCAB5_uc010wbk.1_Missense_Mutation_p.G294V|EFCAB5_uc010csd.2_RNA|EFCAB5_uc010cse.2_Missense_Mutation_p.G516V|EFCAB5_uc010csf.2_Missense_Mutation_p.G516V	p.G637V	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN			10	2102	+			637					B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	37	c.1910G>T	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939725	0.52972	.	.	ENSG00000176927	ENST00000536908;ENST00000534836;ENST00000541045;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598;ENST00000419434	T;T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	5.55	-9.75	0.00506	.	1.705080	0.02956	N	0.142359	T	0.62109	0.2401	L	0.59436	1.845	0.09310	N	0.999999	P;P;P;P;B;B	0.46512	0.808;0.879;0.573;0.773;0.441;0.277	B;P;B;P;B;B	0.48270	0.368;0.572;0.369;0.491;0.307;0.09	T	0.68961	-0.5271	10	0.54805	T	0.06	-1.3559	11.9002	0.52680	0.5663:0.0816:0.352:0.0	.	581;581;637;637;637;637	B4DS75;F5GYL2;A8MSY9;B5MEA3;E7EVS9;A4FU69	.;.;.;.;.;EFCB5_HUMAN	V	581;380;294;637;637;637;637;581;443	ENSP00000440619:G581V;ENSP00000445575:G294V;ENSP00000378312:G637V;ENSP00000322003:G637V;ENSP00000378309:G637V;ENSP00000368012:G637V;ENSP00000417009:G443V	ENSP00000322003:G637V	G	+	2	0	EFCAB5	25405008	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.303000	0.02743	-1.981000	0.00989	-0.940000	0.02684	GGA		0.443	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529		6	98	1	0	3.59834e-05	0.001168	4.23441e-05	6	98				
MED1	5469	broad.mit.edu	37	17	37566045	37566045	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:37566045G>T	ENST00000300651.6	-	17	2652	c.2429C>A	c.(2428-2430)tCt>tAt	p.S810Y	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.S810Y(1)		NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		AGAGCTTGAAGAATCTCGAAG	0.433										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	Pancreas(21;279 768 2492 4877 24026)	uc002hrv.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8						c.(2428-2430)TCT>TAT		mediator complex subunit 1							85.0	88.0	87.0					17																	37566045		2203	4300	6503	SO:0001583	missense	5469				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:37566045G>T	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2429C>A	17.37:g.37566045G>T	ENSP00000300651:p.Ser810Tyr	HNSCC(31;0.082)				MED1_uc010wee.1_Missense_Mutation_p.S638Y|MED1_uc002hru.2_Intron	p.S810Y	NM_004774	NP_004765	Q15648	MED1_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)	17	2641	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	810			Interaction with ESR1.		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	37	c.2429C>A	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323056	0.60634	.	.	ENSG00000125686	ENST00000300651	T	0.47869	0.83	6.03	6.03	0.97812	.	.	.	.	.	T	0.60287	0.2257	L	0.27053	0.805	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.61917	-0.6964	9	0.87932	D	0	-9.8194	20.5666	0.99351	0.0:0.0:1.0:0.0	.	810	Q15648	MED1_HUMAN	Y	810	ENSP00000300651:S810Y	ENSP00000300651:S810Y	S	-	2	0	MED1	34819571	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.434000	0.97515	2.854000	0.98071	0.655000	0.94253	TCT		0.433	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774		16	128	1	0	3.45872e-05	0.004007	4.0977e-05	16	128				
KRT31	3881	broad.mit.edu	37	17	39553533	39553533	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:39553533G>T	ENST00000251645.2	-	1	311	c.259C>A	c.(259-261)Ctc>Atc	p.L87I		NM_002277.2	NP_002268.2	Q15323	K1H1_HUMAN	keratin 31	87	Coil 1A.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)	p.L87I(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	31		Breast(137;0.000496)				TCCCGGATGAGGTTCTCCAGC	0.587																																							uc002hwn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(259-261)CTC>ATC		keratin 31							71.0	68.0	69.0					17																	39553533		2203	4299	6502	SO:0001583	missense	3881				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton	g.chr17:39553533G>T	X86570	CCDS11391.1	17q21.2	2014-05-20	2006-07-17	2006-07-17	ENSG00000094796	ENSG00000094796		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6448	protein-coding gene	gene with protein product	"""hard keratin type I 1"""	601077	"""keratin, hair, acidic, 1"""	KRTHA1		7578244, 16831889	Standard	NM_002277		Approved	Ha-1	uc002hwn.3	Q15323	OTTHUMG00000133423	ENST00000251645.2:c.259C>A	17.37:g.39553533G>T	ENSP00000251645:p.Leu87Ile					KRT31_uc010cxn.2_Missense_Mutation_p.L87I	p.L87I	NM_002277	NP_002268	Q15323	K1H1_HUMAN			1	312	-		Breast(137;0.000496)	87			Coil 1A.|Rod.		Q9UE12	Missense_Mutation	SNP	ENST00000251645.2	37	c.259C>A	CCDS11391.1	.	.	.	.	.	.	.	.	.	.	g	12.31	1.900616	0.33535	.	.	ENSG00000094796	ENST00000251645	D	0.88664	-2.41	5.91	1.12	0.20585	Filament (1);	0.343612	0.21172	N	0.078979	D	0.84906	0.5576	L	0.29908	0.895	0.09310	N	1	B	0.33318	0.408	B	0.40038	0.317	T	0.78460	-0.2195	10	0.87932	D	0	.	14.7975	0.69889	0.0:0.0:0.2506:0.7493	.	87	Q15323	K1H1_HUMAN	I	87	ENSP00000251645:L87I	ENSP00000251645:L87I	L	-	1	0	KRT31	36807059	0.000000	0.05858	0.009000	0.14445	0.550000	0.35303	0.123000	0.15708	0.330000	0.23485	0.655000	0.94253	CTC		0.587	KRT31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257286.1	NM_002277		13	70	1	0	1.5842e-08	0.001855	2.15021e-08	13	70				
FMNL1	752	broad.mit.edu	37	17	43323889	43323889	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:43323889T>G	ENST00000331495.3	+	26	3565	c.3229T>G	c.(3229-3231)Ttc>Gtc	p.F1077V	MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|FMNL1_ENST00000587489.1_Intron|CTD-2020K17.4_ENST00000589518.1_RNA|CTD-2020K17.4_ENST00000420431.2_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|CTD-2020K17.4_ENST00000591361.1_RNA|FMNL1_ENST00000328118.3_Intron|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	1077	DAD. {ECO:0000255|PROSITE- ProRule:PRU00577}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)	p.F1077V(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						GACGGTGCCCTTCACGGCCCG	0.587											OREG0024478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(164;1247 1997 8702 11086 51972)	GBM(164;1247 1997 8702 11086 51972)	uc002iin.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(3229-3231)TTC>GTC		formin-like 1							41.0	43.0	42.0					17																	43323889		2203	4300	6503	SO:0001583	missense	752				actin cytoskeleton organization		actin binding|Rho GTPase binding	g.chr17:43323889T>G	AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.3229T>G	17.37:g.43323889T>G	ENSP00000329219:p.Phe1077Val		OREG0024478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	915	FMNL1_uc002iiq.2_Intron|FMNL1_uc010dag.2_Intron|LOC100133991_uc010dah.2_5'Flank	p.F1077V	NM_005892	NP_005883	O95466	FMNL_HUMAN			26	3429	+			1077			DAD.		D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Missense_Mutation	SNP	ENST00000331495.3	37	c.3229T>G	CCDS11497.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.866659	0.91511	.	.	ENSG00000184922	ENST00000331495	T	0.81330	-1.48	4.59	4.59	0.56863	Diaphanous autoregulatory (1);	.	.	.	.	T	0.73202	0.3557	L	0.53249	1.67	0.80722	D	1	P	0.47253	0.892	B	0.41466	0.358	T	0.72316	-0.4330	9	0.06757	T	0.87	.	13.2195	0.59879	0.0:0.0:0.0:1.0	.	1077	O95466	FMNL_HUMAN	V	1077	ENSP00000329219:F1077V	ENSP00000329219:F1077V	F	+	1	0	FMNL1	40679672	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.043000	0.60533	0.459000	0.35465	TTC		0.587	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450198.1	NM_005892		4	45	0	0	0	0.000602	0	4	45				
KPNB1	3837	broad.mit.edu	37	17	45748181	45748181	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:45748181C>T	ENST00000290158.4	+	12	1937	c.1530C>T	c.(1528-1530)ctC>ctT	p.L510L	KPNB1_ENST00000535458.2_Silent_p.L365L|KPNB1_ENST00000537679.1_Silent_p.L294L|KPNB1_ENST00000540627.1_Silent_p.L365L	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	510					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.L510L(1)		breast(1)|ovary(1)|pancreas(1)|skin(1)	4						TTCAGAAGCTCCTAGAGACTA	0.418																																							uc002ilt.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(1528-1530)CTC>CTT		karyopherin beta 1							133.0	131.0	132.0					17																	45748181		2203	4300	6503	SO:0001819	synonymous_variant	3837				DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding	g.chr17:45748181C>T	L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1530C>T	17.37:g.45748181C>T						KPNB1_uc010wkw.1_Silent_p.L365L|KPNB1_uc010wkx.1_Silent_p.L294L	p.L510L	NM_002265	NP_002256	Q14974	IMB1_HUMAN			12	1866	+			510					B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Silent	SNP	ENST00000290158.4	37	c.1530C>T	CCDS11513.1																																																																																				0.418	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089755.2	NM_002265		14	129	0	0	0	0.00245	0	14	129				
MPO	4353	broad.mit.edu	37	17	56355387	56355387	+	Silent	SNP	G	G	A	rs555802990		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:56355387G>A	ENST00000225275.3	-	7	1181	c.1005C>T	c.(1003-1005)tcC>tcT	p.S335S	MPO_ENST00000340482.3_Silent_p.S367S|MPO_ENST00000578493.1_5'UTR	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	335					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.S335S(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	CGTCCACGAAGGAAGTGAGCG	0.637													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19356	0.0		0.0	False		,,,				2504	0.0						uc002ivu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)|pancreas(1)	4						c.(1003-1005)TCC>TCT		myeloperoxidase	Cefdinir(DB00535)						109.0	94.0	99.0					17																	56355387		2203	4300	6503	SO:0001819	synonymous_variant	4353				anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity	g.chr17:56355387G>A		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1005C>T	17.37:g.56355387G>A							p.S335S	NM_000250	NP_000241	P05164	PERM_HUMAN			7	1182	-			335					A1L4B8|Q14862|Q4PJH5|Q9UCL7	Silent	SNP	ENST00000225275.3	37	c.1005C>T	CCDS11604.1																																																																																				0.637	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1			11	76	0	0	0	0.008291	0	11	76				
SMG8	55181	broad.mit.edu	37	17	57289749	57289749	+	Missense_Mutation	SNP	A	A	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:57289749A>C	ENST00000543872.2	+	3	2071	c.1807A>C	c.(1807-1809)Agc>Cgc	p.S603R	CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000300917.5_Missense_Mutation_p.S603R|SMG8_ENST00000580498.1_3'UTR			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	603					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)		p.S603R(1)		NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						ATATCACAATAGCCGAGCTCG	0.413																																							uc002ixi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1807-1809)AGC>CGC		SMG8 protein							103.0	112.0	109.0					17																	57289749		2203	4300	6503	SO:0001583	missense	55181				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding	g.chr17:57289749A>C	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1807A>C	17.37:g.57289749A>C	ENSP00000438748:p.Ser603Arg						p.S603R	NM_018149	NP_060619	Q8ND04	SMG8_HUMAN			2	1849	+	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)		603					Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	37	c.1807A>C	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.221586	0.79464	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.55760	0.5;0.5	5.77	5.77	0.91146	.	0.070049	0.85682	D	0.000000	T	0.72407	0.3456	M	0.75085	2.285	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.76030	-0.3108	10	0.87932	D	0	-13.0942	15.2696	0.73689	1.0:0.0:0.0:0.0	.	603	Q8ND04	SMG8_HUMAN	R	603	ENSP00000300917:S603R;ENSP00000438748:S603R	ENSP00000300917:S603R	S	+	1	0	SMG8	54644531	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.254000	0.95512	2.203000	0.70933	0.533000	0.62120	AGC		0.413	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149		35	105	0	0	0	0.003755	0	35	105				
DDX42	11325	broad.mit.edu	37	17	61890703	61890703	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:61890703G>T	ENST00000578681.1	+	16	2392	c.1791G>T	c.(1789-1791)gtG>gtT	p.V597V	DDX42_ENST00000457800.2_Silent_p.V597V|DDX42_ENST00000389924.2_Silent_p.V597V|DDX42_ENST00000359353.5_Silent_p.V478V|DDX42_ENST00000583590.1_Silent_p.V597V	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	597	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.V597V(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						AGAAAGGTGTGGCCTATACCC	0.488																																							uc002jbu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|large_intestine(1)	5						c.(1789-1791)GTG>GTT		DEAD box polypeptide 42 protein							130.0	104.0	113.0					17																	61890703		2203	4300	6503	SO:0001819	synonymous_variant	11325				protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding	g.chr17:61890703G>T	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.1791G>T	17.37:g.61890703G>T						DDX42_uc002jbv.2_Silent_p.V597V|DDX42_uc002jbw.1_Silent_p.V333V|DDX42_uc002jbx.2_Silent_p.V333V|DDX42_uc002jby.2_Silent_p.V143V|DDX42_uc010wps.1_5'Flank	p.V597V	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN			16	2048	+			597			Helicase C-terminal.		A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Silent	SNP	ENST00000578681.1	37	c.1791G>T	CCDS32704.1																																																																																				0.488	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372		7	101	1	0	0.00307968	0.00308	0.00334789	7	101				
SCN4A	6329	broad.mit.edu	37	17	62049725	62049725	+	Missense_Mutation	SNP	C	C	A	rs369830835		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:62049725C>A	ENST00000435607.1	-	2	455	c.379G>T	c.(379-381)Gtg>Ttg	p.V127L	CTC-264K15.6_ENST00000577329.1_lincRNA|SCN4A_ENST00000578147.1_Missense_Mutation_p.V127L	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	127					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.V127M(1)|p.V127L(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGGATGAGCACCTTGATGGCC	0.617																																							uc002jds.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(379-381)GTG>TTG		voltage-gated sodium channel type 4 alpha	Lamotrigine(DB00555)						59.0	63.0	62.0					17																	62049725		2149	4256	6405	SO:0001583	missense	6329				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr17:62049725C>A	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.379G>T	17.37:g.62049725C>A	ENSP00000396320:p.Val127Leu						p.V127L	NM_000334	NP_000325	P35499	SCN4A_HUMAN			2	456	-			127					Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	c.379G>T	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630606	0.28978	.	.	ENSG00000007314	ENST00000435607	D	0.95949	-3.86	4.23	3.22	0.36961	.	1.043120	0.07526	N	0.911422	D	0.93367	0.7885	L	0.48986	1.54	0.27020	N	0.964486	B	0.15719	0.014	B	0.09377	0.004	D	0.86556	0.1838	10	0.56958	D	0.05	.	11.6221	0.51124	0.0:0.9101:0.0:0.0899	.	127	P35499	SCN4A_HUMAN	L	127	ENSP00000396320:V127L	ENSP00000396320:V127L	V	-	1	0	SCN4A	59403457	0.286000	0.24305	1.000000	0.80357	0.329000	0.28539	0.241000	0.18065	2.188000	0.69820	0.313000	0.20887	GTG		0.617	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334		9	32	1	0	0.000274275	0.004482	0.000308229	9	32				
METTL23	124512	broad.mit.edu	37	17	74729667	74729667	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:74729667G>T	ENST00000341249.6	+	5	804	c.472G>T	c.(472-474)Gag>Tag	p.E158*	METTL23_ENST00000591571.1_3'UTR|MFSD11_ENST00000586622.1_5'Flank|MIR636_ENST00000384825.1_RNA|RP11-318A15.7_ENST00000587459.1_Intron|METTL23_ENST00000588783.1_3'UTR|METTL23_ENST00000588822.1_Nonsense_Mutation_p.E91*|MFSD11_ENST00000588460.1_5'Flank|METTL23_ENST00000588302.1_3'UTR|METTL23_ENST00000590964.1_Nonsense_Mutation_p.E91*|METTL23_ENST00000586200.1_Nonsense_Mutation_p.E39*|METTL23_ENST00000586738.1_3'UTR|METTL23_ENST00000586752.1_Nonsense_Mutation_p.E91*	NM_001206984.1	NP_001193913.1	Q86XA0	MET23_HUMAN	methyltransferase like 23	158						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	methyltransferase activity (GO:0008168)	p.E158*(1)		large_intestine(2)|lung(1)	3						CATTCCTCTTGAGTCTTTTGA	0.383																																							uc002jsr.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(472-474)GAG>TAG		hypothetical protein LOC124512							193.0	193.0	193.0					17																	74729667		1873	4097	5970	SO:0001587	stop_gained	124512					integral to membrane	methyltransferase activity	g.chr17:74729667G>T		CCDS45787.1, CCDS59298.1	17q25.2	2011-03-03	2011-03-03	2011-03-03	ENSG00000181038	ENSG00000181038			26988	protein-coding gene	gene with protein product		615262	"""chromosome 17 open reading frame 95"""	C17orf95		12477932	Standard	NM_001080510		Approved	LOC124512	uc021udl.1	Q86XA0		ENST00000341249.6:c.472G>T	17.37:g.74729667G>T	ENSP00000341543:p.Glu158*					C17orf95_uc002jsp.2_3'UTR|C17orf95_uc002jsq.2_RNA|C17orf95_uc002jss.2_3'UTR|C17orf95_uc002jst.2_Nonsense_Mutation_p.E91*|C17orf95_uc002jsu.2_RNA|MFSD11_uc002jsz.1_5'Flank|MFSD11_uc002jta.2_5'Flank	p.E158*	NM_001080510	NP_001073979	Q86XA0	MET23_HUMAN			5	804	+			158					H9ZYJ0|K7EK32	Nonsense_Mutation	SNP	ENST00000341249.6	37	c.472G>T	CCDS45787.1	.	.	.	.	.	.	.	.	.	.	G	37	6.572801	0.97676	.	.	ENSG00000181038	ENST00000317409;ENST00000341249	.	.	.	5.93	2.69	0.31865	.	0.688548	0.15284	N	0.270536	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-3.6238	7.6099	0.28124	0.1535:0.3954:0.4511:0.0	.	.	.	.	X	237;158	.	ENSP00000316862:E237X	E	+	1	0	METTL23	72241262	0.012000	0.17670	0.954000	0.39281	0.982000	0.71751	0.541000	0.23207	0.840000	0.34995	0.655000	0.94253	GAG		0.383	METTL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451002.1	NM_001080510		51	164	1	0	5.57489e-27	0.00361	9.30036e-27	51	164				
USP36	57602	broad.mit.edu	37	17	76794540	76794540	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:76794540G>C	ENST00000542802.3	-	20	3777	c.3334C>G	c.(3334-3336)Cac>Gac	p.H1112D	USP36_ENST00000312010.6_Missense_Mutation_p.H1112D|USP36_ENST00000449938.2_Missense_Mutation_p.H717D			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	1110					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.H1112D(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			TTTGCTGGGTGAGTCACAGAC	0.527																																							uc002jvz.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|breast(1)|kidney(1)	5						c.(3334-3336)CAC>GAC		ubiquitin specific peptidase 36							141.0	137.0	138.0					17																	76794540		2203	4300	6503	SO:0001583	missense	57602				ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr17:76794540G>C	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.3334C>G	17.37:g.76794540G>C	ENSP00000441214:p.His1112Asp					USP36_uc002jwa.1_Missense_Mutation_p.H1112D|USP36_uc002jvy.1_Missense_Mutation_p.H172D	p.H1112D	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)		20	3659	-			1110					Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	ENST00000542802.3	37	c.3334C>G	CCDS32755.1	.	.	.	.	.	.	.	.	.	.	g	15.17	2.754432	0.49362	.	.	ENSG00000055483	ENST00000312010;ENST00000449938;ENST00000542802	T;T;T	0.20881	3.11;2.04;3.11	4.52	4.52	0.55395	.	0.168338	0.39759	N	0.001267	T	0.45617	0.1351	M	0.69823	2.125	0.31479	N	0.667392	D;D	0.89917	1.0;0.995	D;P	0.85130	0.997;0.829	T	0.54873	-0.8228	10	0.56958	D	0.05	-17.9309	15.038	0.71764	0.0:0.0:1.0:0.0	.	1112;717	Q9P275-2;E9PEW0	.;.	D	1112;717;1112	ENSP00000310590:H1112D;ENSP00000401119:H717D;ENSP00000441214:H1112D	ENSP00000310590:H1112D	H	-	1	0	USP36	74306135	1.000000	0.71417	0.995000	0.50966	0.667000	0.39255	5.960000	0.70348	2.047000	0.60756	0.450000	0.29827	CAC		0.527	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090		22	95	0	0	0	0.004656	0	22	95				
ENGASE	64772	broad.mit.edu	37	17	77079624	77079624	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:77079624C>T	ENST00000579016.1	+	9	1203	c.1203C>T	c.(1201-1203)gtC>gtT	p.V401V	ENGASE_ENST00000584568.1_3'UTR	NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	401						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)	p.V401V(1)		breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						TGCCTTTCGTCACGTCCTTCT	0.627																																							uc002jwv.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1201-1203)GTC>GTT		endo-beta-N-acetylglucosaminidase							107.0	112.0	111.0					17																	77079624		2125	4243	6368	SO:0001819	synonymous_variant	64772					cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity	g.chr17:77079624C>T	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.1203C>T	17.37:g.77079624C>T						ENGASE_uc002jww.2_Silent_p.V107V	p.V401V	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN			9	1211	+			401					Q659F0|Q8TB86|Q9H6U4	Silent	SNP	ENST00000579016.1	37	c.1203C>T	CCDS42394.1																																																																																				0.627	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	NM_022759		10	51	0	0	0	0.006214	0	10	51				
ZBTB14	7541	broad.mit.edu	37	18	5290937	5290937	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr18:5290937G>C	ENST00000357006.4	-	4	1608	c.1270C>G	c.(1270-1272)Cag>Gag	p.Q424E	ZBTB14_ENST00000400143.3_Missense_Mutation_p.Q424E	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	424					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q424E(1)									GTCTCGCTCTGGATGGCACTG	0.567																																							uc002kmq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1270-1272)CAG>GAG		zinc finger protein 161 homolog							160.0	124.0	136.0					18																	5290937		2203	4300	6503	SO:0001583	missense	7541				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:5290937G>C	D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.1270C>G	18.37:g.5290937G>C	ENSP00000349503:p.Gln424Glu					ZFP161_uc002kmr.2_Missense_Mutation_p.Q424E|ZFP161_uc010dkp.2_Missense_Mutation_p.Q424E	p.Q424E	NM_003409	NP_003400	O43829	ZF161_HUMAN			4	1431	-			424					O00403|Q2TB80	Missense_Mutation	SNP	ENST00000357006.4	37	c.1270C>G	CCDS11837.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.950120	0.53186	.	.	ENSG00000198081	ENST00000357006;ENST00000400143	T;T	0.09630	2.96;2.96	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.14657	0.0354	N	0.24115	0.695	0.80722	D	1	P	0.43392	0.805	P	0.47134	0.539	T	0.01218	-1.1415	10	0.62326	D	0.03	-20.7274	19.8253	0.96616	0.0:0.0:1.0:0.0	.	424	O43829	ZF161_HUMAN	E	424	ENSP00000349503:Q424E;ENSP00000383009:Q424E	ENSP00000349503:Q424E	Q	-	1	0	ZFP161	5280937	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.830000	0.86741	2.676000	0.91093	0.650000	0.86243	CAG		0.567	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254425.1	NM_003409		30	63	0	0	0	0.009535	0	30	63				
MC5R	4161	broad.mit.edu	37	18	13825819	13825819	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr18:13825819G>T	ENST00000324750.3	+	1	277	c.55G>T	c.(55-57)Ggc>Tgc	p.G19C	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	19					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)	p.G19C(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						TGCCACAGAGGGCAACCTTTC	0.448																																							uc010xaf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|breast(1)	6						c.(55-57)GGC>TGC		melanocortin 5 receptor							85.0	83.0	84.0					18																	13825819		2203	4300	6503	SO:0001583	missense	4161				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding	g.chr18:13825819G>T	AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.55G>T	18.37:g.13825819G>T	ENSP00000318077:p.Gly19Cys						p.G19C	NM_005913	NP_005904	P33032	MC5R_HUMAN			1	55	+			19			Extracellular (Potential).		B0YJ34|Q502V1	Missense_Mutation	SNP	ENST00000324750.3	37	c.55G>T	CCDS11868.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.707666	0.48412	.	.	ENSG00000176136	ENST00000324750	T	0.37584	1.19	5.3	4.43	0.53597	.	0.919338	0.09428	N	0.803493	T	0.28300	0.0699	N	0.08118	0	0.09310	N	0.999996	D	0.57257	0.979	P	0.49502	0.613	T	0.12502	-1.0545	10	0.59425	D	0.04	.	9.3907	0.38372	0.1815:0.0:0.8185:0.0	.	19	P33032	MC5R_HUMAN	C	19	ENSP00000318077:G19C	ENSP00000318077:G19C	G	+	1	0	MC5R	13815819	0.870000	0.30015	0.441000	0.26858	0.958000	0.62258	1.312000	0.33574	1.231000	0.43661	0.455000	0.32223	GGC		0.448	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	NM_005913		28	41	1	0	1.33986e-20	0.004656	2.173e-20	28	41				
POTEC	388468	broad.mit.edu	37	18	14542897	14542897	+	Silent	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr18:14542897A>G	ENST00000358970.5	-	1	248	c.249T>C	c.(247-249)tcT>tcC	p.S83S	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	83								p.S83S(1)		NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CATGGTCTCCAGAAGTGCCCA	0.582																																							uc010dln.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)	3						c.(247-249)TCT>TCC		ANKRD26-like family B, member 2							42.0	49.0	47.0					18																	14542897		692	1591	2283	SO:0001819	synonymous_variant	388468							g.chr18:14542897A>G	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.249T>C	18.37:g.14542897A>G						POTEC_uc010xaj.1_RNA	p.S83S	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN			1	703	-			83						Silent	SNP	ENST00000358970.5	37	c.249T>C	CCDS45835.1																																																																																				0.582	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269		44	107	0	0	0	0.009718	0	44	107				
FHOD3	80206	broad.mit.edu	37	18	34298531	34298531	+	Nonsense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr18:34298531G>A	ENST00000359247.4	+	15	2694	c.2694G>A	c.(2692-2694)tgG>tgA	p.W898*	FHOD3_ENST00000445677.1_Nonsense_Mutation_p.W877*|FHOD3_ENST00000590592.1_Nonsense_Mutation_p.W1090*|FHOD3_ENST00000592128.1_5'UTR|FHOD3_ENST00000257209.4_Nonsense_Mutation_p.W915*|FHOD3_ENST00000591635.1_Nonsense_Mutation_p.W111*	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	898	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.W915*(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GTTTGTTCTGGAATGAAGTTC	0.507																																							uc002kzt.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(2692-2694)TGG>TGA		formin homology 2 domain containing 3							124.0	118.0	120.0					18																	34298531		2203	4300	6503	SO:0001587	stop_gained	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34298531G>A	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2694G>A	18.37:g.34298531G>A	ENSP00000352186:p.Trp898*					FHOD3_uc002kzs.1_Nonsense_Mutation_p.W915*|FHOD3_uc010dmz.1_Nonsense_Mutation_p.W630*|FHOD3_uc010dna.1_Nonsense_Mutation_p.W218*	p.W898*	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN			15	2791	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	898			FH2.		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Nonsense_Mutation	SNP	ENST00000359247.4	37	c.2694G>A		.	.	.	.	.	.	.	.	.	.	G	40	8.137049	0.98672	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	.	.	.	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6858	0.77409	0.0:0.0:1.0:0.0	.	.	.	.	X	915;898;877	.	ENSP00000257209:W915X	W	+	3	0	FHOD3	32552529	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.823000	0.99369	2.034000	0.60081	0.555000	0.69702	TGG		0.507	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		21	75	0	0	0	0.008871	0	21	75				
CTIF	9811	broad.mit.edu	37	18	46385872	46385872	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr18:46385872C>G	ENST00000256413.3	+	12	2034	c.1739C>G	c.(1738-1740)cCt>cGt	p.P580R	CTIF_ENST00000382998.4_Missense_Mutation_p.P582R	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	580					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)	p.P580R(1)|p.?(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						AGCTGGAACCCTCTGACGCCC	0.652																																							uc002ldc.2		NA																	2	Substitution - Missense(1)|Unknown(1)		lung(2)		0						c.(1738-1740)CCT>CGT		hypothetical protein LOC9811 isoform 1							85.0	77.0	79.0					18																	46385872		2203	4300	6503	SO:0001583	missense	9811				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding	g.chr18:46385872C>G	AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.1739C>G	18.37:g.46385872C>G	ENSP00000256413:p.Pro580Arg					KIAA0427_uc002ldd.2_Missense_Mutation_p.P582R|KIAA0427_uc002lde.3_Missense_Mutation_p.P209R	p.P580R	NM_014772	NP_055587	O43310	CTIF_HUMAN			12	2024	+			580					B3KTR8|Q8IVD5	Missense_Mutation	SNP	ENST00000256413.3	37	c.1739C>G	CCDS11935.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946584	0.73672	.	.	ENSG00000134030	ENST00000256413;ENST00000382998	T;T	0.23950	1.88;1.88	5.07	5.07	0.68467	Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.37705	0.1013	N	0.19112	0.55	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.26224	-1.0109	10	0.45353	T	0.12	.	18.0457	0.89331	0.0:1.0:0.0:0.0	.	582;580	O43310-2;O43310	.;CTIF_HUMAN	R	580;582	ENSP00000256413:P580R;ENSP00000372459:P582R	ENSP00000256413:P580R	P	+	2	0	CTIF	44639870	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	5.972000	0.70448	2.382000	0.81193	0.561000	0.74099	CCT		0.652	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255907.1	NM_014772		15	58	0	0	0	0.00499	0	15	58				
ACAA2	10449	broad.mit.edu	37	18	47329193	47329193	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr18:47329193G>C	ENST00000285093.10	-	2	522	c.47C>G	c.(46-48)cCc>cGc	p.P16R	RP11-886H22.1_ENST00000590532.2_3'UTR|ACAA2_ENST00000589432.1_5'UTR|ACAA2_ENST00000587994.1_Missense_Mutation_p.P13R	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	16					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)	p.P16R(1)		large_intestine(2)|lung(7)|ovary(1)	10						AGCTCCAAAGGGCGTTCGCTT	0.448																																							uc002ldw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(46-48)CCC>CGC		acetyl-coenzyme A acyltransferase 2							108.0	98.0	101.0					18																	47329193		2203	4300	6503	SO:0001583	missense	10449				anti-apoptosis|cholesterol biosynthetic process		acetyl-CoA C-acyltransferase activity|protein binding	g.chr18:47329193G>C	D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.47C>G	18.37:g.47329193G>C	ENSP00000285093:p.Pro16Arg					ACAA2_uc002ldx.3_Missense_Mutation_p.P13R	p.P16R	NM_006111	NP_006102	P42765	THIM_HUMAN			2	444	-			16					Q9BUT6	Missense_Mutation	SNP	ENST00000285093.10	37	c.47C>G	CCDS11939.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124651	0.77436	.	.	ENSG00000167315	ENST00000285093	D	0.93426	-3.22	5.64	4.77	0.60923	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.111353	0.64402	D	0.000007	D	0.97926	0.9318	H	0.98629	4.285	0.80722	D	1	D;D	0.76494	0.989;0.999	D;D	0.74023	0.951;0.982	D	0.98433	1.0583	10	0.72032	D	0.01	-10.2433	13.664	0.62384	0.0746:0.0:0.9254:0.0	.	16;16	B2RB23;P42765	.;THIM_HUMAN	R	16	ENSP00000285093:P16R	ENSP00000285093:P16R	P	-	2	0	ACAA2	45583191	1.000000	0.71417	0.643000	0.29450	0.761000	0.43186	7.862000	0.87013	2.659000	0.90383	0.655000	0.94253	CCC		0.448	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255921.2	NM_006111		11	52	0	0	0	0.003163	0	11	52				
CCDC102B	79839	broad.mit.edu	37	18	66504245	66504245	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr18:66504245A>T	ENST00000360242.5	+	2	362	c.245A>T	c.(244-246)aAg>aTg	p.K82M	CCDC102B_ENST00000584156.1_Missense_Mutation_p.K82M|CCDC102B_ENST00000358653.5_Missense_Mutation_p.K82M|CCDC102B_ENST00000319445.6_Missense_Mutation_p.K82M|CCDC102B_ENST00000577772.1_3'UTR	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	82								p.K82M(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				GAAGAAGTCAAGGCCAGAGCT	0.473																																							uc002lkk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(244-246)AAG>ATG		coiled-coil domain containing 102B							108.0	109.0	109.0					18																	66504245		1934	4134	6068	SO:0001583	missense	79839							g.chr18:66504245A>T	AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.245A>T	18.37:g.66504245A>T	ENSP00000353377:p.Lys82Met					CCDC102B_uc002lki.2_Missense_Mutation_p.K82M|CCDC102B_uc002lkj.1_Missense_Mutation_p.K82M	p.K82M	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN			4	468	+		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)	82			Potential.		Q7Z467|Q8NDK7|Q9H5C1	Missense_Mutation	SNP	ENST00000360242.5	37	c.245A>T	CCDS11996.2	.	.	.	.	.	.	.	.	.	.	A	13.43	2.233852	0.39498	.	.	ENSG00000150636	ENST00000319445;ENST00000358653;ENST00000360242	T;T;T	0.54479	0.57;0.57;0.57	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000015	T	0.52677	0.1749	N	0.08118	0	0.30686	N	0.751787	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.60409	-0.7269	10	0.72032	D	0.01	-23.5586	12.863	0.57924	1.0:0.0:0.0:0.0	.	82;82	Q68D86-3;Q68D86	.;C102B_HUMAN	M	82	ENSP00000316237:K82M;ENSP00000351479:K82M;ENSP00000353377:K82M	ENSP00000316237:K82M	K	+	2	0	CCDC102B	64655225	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.792000	0.75125	1.979000	0.57680	0.377000	0.23210	AAG		0.473	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256225.2	NM_024781		28	89	0	0	0	0.013726	0	28	89				
ATP8B3	148229	broad.mit.edu	37	19	1785468	1785468	+	Splice_Site	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:1785468C>A	ENST00000310127.6	-	26	3631	c.3393G>T	c.(3391-3393)gaG>gaT	p.E1131D	ATP8B3_ENST00000539485.1_Splice_Site_p.E1141D|ATP8B3_ENST00000525591.1_Splice_Site_p.E1094D	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1131					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.E1141D(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTTGCCCACCTCCATGGTGA	0.667																																							uc002ltw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3391-3393)GAG>GAT		ATPase, class I, type 8B, member 3							31.0	36.0	34.0					19																	1785468		2031	4171	6202	SO:0001630	splice_region_variant	148229				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr19:1785468C>A	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3393+1G>T	19.37:g.1785468C>A						ATP8B3_uc002ltv.2_Missense_Mutation_p.E1094D|ATP8B3_uc002ltx.2_RNA	p.E1131D	NM_138813	NP_620168	O60423	AT8B3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	26	3627	-		Hepatocellular(1079;0.137)	1131			Helical; (Potential).		Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	c.3393G>T	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.139627	0.56936	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.58940	0.3;0.3;0.3	4.48	3.44	0.39384	.	0.061993	0.64402	D	0.000005	T	0.72407	0.3456	M	0.80183	2.485	0.41096	D	0.985633	D;D	0.76494	0.996;0.999	P;D	0.64237	0.896;0.923	T	0.74256	-0.3724	9	.	.	.	.	11.1358	0.48373	0.0:0.9089:0.0:0.0911	.	1131;1094	O60423;Q7Z485	AT8B3_HUMAN;.	D	1131;1141;1094	ENSP00000311336:E1131D;ENSP00000443574:E1141D;ENSP00000437115:E1094D	.	E	-	3	2	ATP8B3	1736468	1.000000	0.71417	0.814000	0.32528	0.073000	0.16967	7.641000	0.83368	0.863000	0.35553	0.655000	0.94253	GAG		0.667	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	Missense_Mutation	4	23	1	0	0.00909568	0.009096	0.00957512	4	23				
AP3D1	8943	broad.mit.edu	37	19	2109914	2109914	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:2109914T>A	ENST00000345016.5	-	27	3353	c.3122A>T	c.(3121-3123)cAc>cTc	p.H1041L	AP3D1_ENST00000355272.6_Missense_Mutation_p.H1103L|AP3D1_ENST00000356926.4_Missense_Mutation_p.H1000L|AP3D1_ENST00000350812.6_Missense_Mutation_p.H872L	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	1041					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.H1041L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGCTGAAGTGCAGCCTGAA	0.637																																							uc002luz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3121-3123)CAC>CTC		adaptor-related protein complex 3, delta 1							86.0	94.0	91.0					19																	2109914		2095	4222	6317	SO:0001583	missense	8943				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity	g.chr19:2109914T>A	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.3122A>T	19.37:g.2109914T>A	ENSP00000344055:p.His1041Leu					AP3D1_uc010dsv.2_Missense_Mutation_p.H131L|AP3D1_uc002luy.2_Missense_Mutation_p.H1000L|AP3D1_uc002lva.2_Missense_Mutation_p.H1103L	p.H1041L	NM_003938	NP_003929	O14617	AP3D1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	27	3345	-		Hepatocellular(1079;0.137)	1041					O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	c.3122A>T	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	T	9.554	1.116683	0.20795	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	4.85	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.51907	0.1702	L	0.46157	1.445	0.54753	D	0.999989	B;D;B;B	0.62365	0.001;0.991;0.001;0.002	B;P;B;B	0.56434	0.003;0.798;0.002;0.004	T	0.50775	-0.8788	10	0.08381	T	0.77	-35.9152	8.4752	0.33009	0.1734:0.0:0.0:0.8266	.	872;1103;1041;1000	E7EMM2;O14617-5;O14617;G5E988	.;.;AP3D1_HUMAN;.	L	1000;1041;1103;909;872	ENSP00000349398:H1000L;ENSP00000344055:H1041L;ENSP00000347416:H1103L;ENSP00000342321:H872L	ENSP00000341579:H909L	H	-	2	0	AP3D1	2060914	1.000000	0.71417	0.998000	0.56505	0.230000	0.25150	4.524000	0.60552	0.670000	0.31165	0.459000	0.35465	CAC		0.637	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1			5	54	0	0	0	0.001168	0	5	54				
CREB3L3	84699	broad.mit.edu	37	19	4157097	4157097	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:4157097G>A	ENST00000078445.2	+	3	409	c.262G>A	c.(262-264)Ggc>Agc	p.G88S	CREB3L3_ENST00000602257.1_Missense_Mutation_p.G88S|CREB3L3_ENST00000252587.3_Missense_Mutation_p.G78S|CREB3L3_ENST00000595923.1_Missense_Mutation_p.G87S|CREB3L3_ENST00000602147.1_Missense_Mutation_p.G88S	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	88					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.G88C(1)|p.G88S(1)		breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGTGATAGTGGCATCTCCGA	0.677																																							uc002lzl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(262-264)GGC>AGC		cAMP responsive element binding protein 3-like							74.0	62.0	66.0					19																	4157097		2203	4300	6503	SO:0001583	missense	84699				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:4157097G>A		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.262G>A	19.37:g.4157097G>A	ENSP00000078445:p.Gly88Ser					CREB3L3_uc002lzm.2_Missense_Mutation_p.G78S|CREB3L3_uc010xib.1_Missense_Mutation_p.G79S|CREB3L3_uc010xic.1_Missense_Mutation_p.G79S	p.G88S	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)	3	378	+			88			Cytoplasmic (Potential).		B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	ENST00000078445.2	37	c.262G>A	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.042197	0.55003	.	.	ENSG00000060566	ENST00000078445;ENST00000381943;ENST00000252587	T;T	0.77358	-1.09;-1.09	5.27	4.24	0.50183	.	0.055037	0.64402	N	0.000001	D	0.82513	0.5053	M	0.62016	1.91	0.50171	D	0.999852	D;P;P;P	0.60160	0.987;0.874;0.923;0.874	P;B;P;B	0.59948	0.866;0.223;0.614;0.41	T	0.82323	-0.0514	10	0.51188	T	0.08	-17.6772	9.9378	0.41561	0.0949:0.0:0.9051:0.0	.	88;88;87;88	Q68CJ9-3;B7ZL69;Q68CJ9-2;Q68CJ9	.;.;.;CR3L3_HUMAN	S	88;88;78	ENSP00000078445:G88S;ENSP00000252587:G78S	ENSP00000078445:G88S	G	+	1	0	CREB3L3	4108097	1.000000	0.71417	0.909000	0.35828	0.575000	0.36095	3.802000	0.55553	1.242000	0.43836	0.537000	0.68136	GGC		0.677	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607		8	55	0	0	0	0.00308	0	8	55				
STAP2	55620	broad.mit.edu	37	19	4325419	4325419	+	Missense_Mutation	SNP	G	G	A	rs201644443		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:4325419G>A	ENST00000594605.1	-	10	1076	c.953C>T	c.(952-954)cCa>cTa	p.P318L	STAP2_ENST00000600324.1_Missense_Mutation_p.P318L|STAP2_ENST00000597593.1_5'UTR	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	318	Pro-rich.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.P318L(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCAACAGCTGGGCCATCTCC	0.577																																							uc002mab.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(952-954)CCA>CTA		signal transducing adaptor family member 2							104.0	102.0	102.0					19																	4325419		2203	4300	6503	SO:0001583	missense	55620					cytoplasm|nucleus	protein binding	g.chr19:4325419G>A	AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.953C>T	19.37:g.4325419G>A	ENSP00000471052:p.Pro318Leu					STAP2_uc002mac.2_Missense_Mutation_p.P318L|STAP2_uc002mad.2_Missense_Mutation_p.P211L	p.P318L	NM_001013841	NP_001013863	Q9UGK3	STAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)	10	1050	-		Hepatocellular(1079;0.137)	318			Pro-rich.		A6NKK3|Q9NXI2	Missense_Mutation	SNP	ENST00000594605.1	37	c.953C>T	CCDS45926.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.209387	0.39003	.	.	ENSG00000178078	ENST00000314714;ENST00000424810	.	.	.	4.77	3.71	0.42584	.	0.157167	0.43919	D	0.000506	T	0.45935	0.1367	M	0.62723	1.935	0.09310	N	1	B;B	0.27013	0.166;0.033	B;B	0.31812	0.136;0.027	T	0.48758	-0.9007	9	0.87932	D	0	-14.9355	9.3756	0.38281	0.1028:0.0:0.8972:0.0	.	318;318	Q9UGK3-2;Q9UGK3	.;STAP2_HUMAN	L	318	.	ENSP00000317912:P318L	P	-	2	0	STAP2	4276419	0.273000	0.24181	0.016000	0.15963	0.463000	0.32649	1.193000	0.32162	0.988000	0.38734	0.479000	0.44913	CCA		0.577	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	NM_001013841		19	101	0	0	0	0.007413	0	19	101				
EMR1	2015	broad.mit.edu	37	19	6921732	6921732	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:6921732G>T	ENST00000312053.4	+	14	1666	c.1629G>T	c.(1627-1629)caG>caT	p.Q543H	EMR1_ENST00000450315.3_Missense_Mutation_p.Q366H|EMR1_ENST00000381404.4_Missense_Mutation_p.Q491H|EMR1_ENST00000381407.5_Missense_Mutation_p.Q402H|EMR1_ENST00000250572.8_Missense_Mutation_p.Q543H	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	543	Ser/Thr-rich.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.Q543H(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					AGCCAAAGCAGAAGTTTGAGA	0.428																																							uc002mfw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|skin(1)	5						c.(1627-1629)CAG>CAT		egf-like module containing, mucin-like, hormone							58.0	55.0	56.0					19																	6921732		2203	4300	6503	SO:0001583	missense	2015				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:6921732G>T	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.1629G>T	19.37:g.6921732G>T	ENSP00000311545:p.Gln543His					EMR1_uc010dvc.2_Missense_Mutation_p.Q543H|EMR1_uc010dvb.2_Missense_Mutation_p.Q491H|EMR1_uc010xji.1_Missense_Mutation_p.Q402H|EMR1_uc010xjj.1_Missense_Mutation_p.Q366H	p.Q543H	NM_001974	NP_001965	Q14246	EMR1_HUMAN			14	1667	+	all_hematologic(4;0.166)		543			Ser/Thr-rich.|Extracellular (Potential).		A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	37	c.1629G>T	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	G	8.578	0.881570	0.17467	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.78924	-1.16;-1.2;-1.22;-0.01;0.31	4.43	2.1	0.27182	.	.	.	.	.	T	0.76011	0.3928	L	0.29908	0.895	0.09310	N	1	D;D;D;D;D	0.63880	0.993;0.985;0.993;0.991;0.976	P;P;D;P;P	0.63113	0.753;0.669;0.911;0.687;0.72	T	0.62210	-0.6902	9	0.51188	T	0.08	.	4.8421	0.13496	0.1066:0.0:0.5573:0.3361	.	366;402;543;491;543	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	H	543;543;491;543;402;366	ENSP00000311545:Q543H;ENSP00000370811:Q491H;ENSP00000250572:Q543H;ENSP00000370814:Q402H;ENSP00000405974:Q366H	ENSP00000250572:Q543H	Q	+	3	2	EMR1	6872732	0.000000	0.05858	0.211000	0.23655	0.010000	0.07245	-0.037000	0.12164	0.998000	0.38996	0.650000	0.86243	CAG		0.428	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1			4	23	1	0	0.00909568	0.009096	0.00957512	4	23				
CD209	30835	broad.mit.edu	37	19	7809059	7809059	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:7809059A>G	ENST00000315599.7	-	6	969	c.947T>C	c.(946-948)aTg>aCg	p.M316T	CD209_ENST00000593821.1_Missense_Mutation_p.M180T|CD209_ENST00000394173.4_Missense_Mutation_p.M155T|CD209_ENST00000354397.6_Missense_Mutation_p.M310T|CD209_ENST00000593660.1_Missense_Mutation_p.M246T|CD209_ENST00000602261.1_Missense_Mutation_p.M224T|CD209_ENST00000315591.8_Missense_Mutation_p.M292T|CD209_ENST00000601256.1_Intron|CD209_ENST00000301357.8_Missense_Mutation_p.M180T|CD209_ENST00000601951.1_Missense_Mutation_p.M292T|CD209_ENST00000204801.8_Missense_Mutation_p.M272T|CD209_ENST00000394161.5_Missense_Mutation_p.M80T	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	316	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)	p.M316T(2)		endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TGAAAGTCCCATCCAGGTGAA	0.557																																							uc002mht.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(946-948)ATG>ACG		CD209 molecule isoform 1							154.0	130.0	138.0					19																	7809059		2203	4300	6503	SO:0001583	missense	30835				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding	g.chr19:7809059A>G	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.947T>C	19.37:g.7809059A>G	ENSP00000315477:p.Met316Thr					CD209_uc010xju.1_Missense_Mutation_p.M155T|CD209_uc010dvp.2_Intron|CD209_uc002mhr.2_Missense_Mutation_p.M292T|CD209_uc002mhs.2_Missense_Mutation_p.M246T|CD209_uc002mhu.2_Missense_Mutation_p.M224T|CD209_uc010dvq.2_Missense_Mutation_p.M310T|CD209_uc002mhq.2_Missense_Mutation_p.M316T|CD209_uc002mhv.2_Missense_Mutation_p.M292T|CD209_uc002mhx.2_Missense_Mutation_p.M272T|CD209_uc002mhw.2_Missense_Mutation_p.M180T|CD209_uc010dvr.2_Missense_Mutation_p.M80T	p.M316T	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN			6	1014	-			316			Extracellular (Probable).|C-type lectin.		A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Missense_Mutation	SNP	ENST00000315599.7	37	c.947T>C	CCDS12186.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.116115	0.37339	.	.	ENSG00000090659	ENST00000315599;ENST00000354397;ENST00000315591;ENST00000204801;ENST00000394173;ENST00000301357;ENST00000394161	T;T;T;T;T;T	0.15834	2.39;2.39;2.39;2.39;2.39;2.39	3.81	1.7	0.24286	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.26048	0.0635	L	0.40543	1.245	0.21256	N	0.999743	P;D;D;B;B;D;P;D;D;B;P	0.71674	0.942;0.99;0.987;0.128;0.087;0.987;0.549;0.989;0.998;0.128;0.739	P;P;P;B;B;P;B;D;D;B;B	0.71870	0.754;0.882;0.899;0.058;0.118;0.899;0.368;0.929;0.975;0.058;0.365	T	0.09684	-1.0663	9	0.87932	D	0	.	3.9631	0.09420	0.6711:0.2158:0.113:0.0	.	316;80;310;272;180;292;224;316;246;292;316	B2R907;Q9NNX6-4;Q9NNX6-2;Q9NNX6-7;Q9NNX6-8;Q9NNX6-6;G5E9C4;Q9NNX6;Q9NNX6-11;Q9NNX6-10;Q9NNX6-5	.;.;.;.;.;.;.;CD209_HUMAN;.;.;.	T	316;310;292;272;224;180;80	ENSP00000315477:M316T;ENSP00000346373:M310T;ENSP00000315407:M292T;ENSP00000204801:M272T;ENSP00000301357:M180T;ENSP00000377716:M80T	ENSP00000204801:M272T	M	-	2	0	CD209	7715059	0.433000	0.25562	0.313000	0.25210	0.035000	0.12851	0.984000	0.29565	0.297000	0.22615	0.460000	0.39030	ATG		0.557	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462241.1	NM_021155		13	72	0	0	0	0.004007	0	13	72				
HNRNPM	4670	broad.mit.edu	37	19	8527445	8527445	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:8527445G>A	ENST00000325495.4	+	3	357	c.316G>A	c.(316-318)Gac>Aac	p.D106N	HNRNPM_ENST00000348943.3_Missense_Mutation_p.D106N	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	106	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)	p.D106N(1)		endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GCTCTTAATGGACGCTGAAGG	0.398																																							uc010dwe.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(316-318)GAC>AAC		heterogeneous nuclear ribonucleoprotein M							276.0	249.0	258.0					19																	8527445		2203	4300	6503	SO:0001583	missense	4670				alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding	g.chr19:8527445G>A	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.316G>A	19.37:g.8527445G>A	ENSP00000325376:p.Asp106Asn					HNRNPM_uc010dwc.1_Missense_Mutation_p.D106N|HNRNPM_uc010xke.1_Missense_Mutation_p.D106N|HNRNPM_uc010dwd.2_Missense_Mutation_p.D106N|HNRNPM_uc002mka.2_5'Flank	p.D106N	NM_005968	NP_005959	P52272	HNRPM_HUMAN			3	396	+			106			RRM 1.		Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	c.316G>A	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410977	0.83340	.	.	ENSG00000099783	ENST00000325495;ENST00000348943	T;T	0.80033	-1.33;2.89	5.82	5.82	0.92795	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.106321	0.64402	D	0.000002	D	0.88168	0.6364	L	0.54323	1.7	0.80722	D	1	P;D;B	0.89917	0.868;1.0;0.387	P;D;B	0.91635	0.751;0.999;0.262	D	0.88321	0.2962	10	0.72032	D	0.01	.	18.6568	0.91456	0.0:0.0:1.0:0.0	.	106;106;106	P52272;P52272-2;B4DEG4	HNRPM_HUMAN;.;.	N	106	ENSP00000325376:D106N;ENSP00000325732:D106N	ENSP00000325376:D106N	D	+	1	0	HNRNPM	8433445	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.756000	0.94617	0.561000	0.74099	GAC		0.398	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1			61	165	0	0	0	0.00361	0	61	165				
OR7D4	125958	broad.mit.edu	37	19	9324917	9324917	+	Silent	SNP	C	C	T	rs377419980		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:9324917C>T	ENST00000308682.2	-	1	625	c.597G>A	c.(595-597)ttG>ttA	p.L199L		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L199L(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						TGGCCACATACAAGACAATGT	0.522																																							uc002mla.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(595-597)TTG>TTA		olfactory receptor, family 7, subfamily D,							106.0	99.0	102.0					19																	9324917		2203	4300	6503	SO:0001819	synonymous_variant	125958				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9324917C>T		CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.597G>A	19.37:g.9324917C>T							p.L199L	NM_001005191	NP_001005191	Q8NG98	OR7D4_HUMAN			1	597	-			199			Helical; Name=5; (Potential).		A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Silent	SNP	ENST00000308682.2	37	c.597G>A	CCDS32901.1																																																																																				0.522	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1			32	79	0	0	0	0.013726	0	32	79				
ZNF121	7675	broad.mit.edu	37	19	9677032	9677032	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:9677032C>A	ENST00000586602.1	-	6	1173	c.757G>T	c.(757-759)Gag>Tag	p.E253*	ZNF121_ENST00000320451.6_Nonsense_Mutation_p.E253*			P58317	ZN121_HUMAN	zinc finger protein 121	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E253*(1)|p.E253Q(1)		breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						AAGGGCTTCTCCTCTGTGTGA	0.373																																							uc010xkp.1		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(1)|breast(1)	ovary(1)	1						c.(757-759)GAG>TAG		zinc finger protein 121							76.0	81.0	79.0					19																	9677032		2203	4300	6503	SO:0001587	stop_gained	7675				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9677032C>A	M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.757G>T	19.37:g.9677032C>A	ENSP00000468643:p.Glu253*					ZNF121_uc010dwt.2_Nonsense_Mutation_p.E253*|ZNF121_uc010xkq.1_Nonsense_Mutation_p.E253*	p.E253*	NM_001008727	NP_001008727	P58317	ZN121_HUMAN			4	989	-			253						Nonsense_Mutation	SNP	ENST00000586602.1	37	c.757G>T		.	.	.	.	.	.	.	.	.	.	C	23.1	4.373535	0.82573	.	.	ENSG00000197961	ENST00000538300;ENST00000320451	.	.	.	1.41	-0.882	0.10604	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.4976	0.16811	0.0:0.644:0.0:0.356	.	.	.	.	X	253	.	ENSP00000326967:E253X	E	-	1	0	ZNF121	9538032	0.871000	0.30034	0.000000	0.03702	0.370000	0.29829	2.667000	0.46808	-0.187000	0.10516	-0.327000	0.08410	GAG		0.373	ZNF121-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000449910.1	NM_001008727		10	74	1	0	0.000442599	0.006214	0.000493424	10	74				
OR7C2	26658	broad.mit.edu	37	19	15052430	15052430	+	Missense_Mutation	SNP	C	C	A	rs537843072		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:15052430C>A	ENST00000248072.3	+	1	130	c.130C>A	c.(130-132)Ctc>Atc	p.L44I		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L44I(1)		large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					CGGAAACCTGCTCATCATCCT	0.517																																							uc010xoc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(130-132)CTC>ATC		olfactory receptor, family 7, subfamily C,							109.0	90.0	97.0					19																	15052430		2203	4300	6503	SO:0001583	missense	26658				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15052430C>A	U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.130C>A	19.37:g.15052430C>A	ENSP00000248072:p.Leu44Ile						p.L44I	NM_012377	NP_036509	O60412	OR7C2_HUMAN			1	130	+	Ovarian(108;0.203)		44			Helical; Name=1; (Potential).		O43881|Q6IFP9	Missense_Mutation	SNP	ENST00000248072.3	37	c.130C>A	CCDS12320.1	.	.	.	.	.	.	.	.	.	.	c	14.22	2.471453	0.43942	.	.	ENSG00000127529	ENST00000248072	T	0.02606	4.23	4.19	0.762	0.18454	GPCR, rhodopsin-like superfamily (1);	0.407528	0.17826	U	0.160681	T	0.06462	0.0166	M	0.68728	2.09	0.25621	N	0.986406	D	0.54964	0.969	P	0.54759	0.76	T	0.21177	-1.0253	10	0.72032	D	0.01	.	2.8641	0.05595	0.1782:0.375:0.3462:0.1006	.	44	O60412	OR7C2_HUMAN	I	44	ENSP00000248072:L44I	ENSP00000248072:L44I	L	+	1	0	OR7C2	14913430	0.000000	0.05858	0.994000	0.49952	0.267000	0.26476	-2.634000	0.00869	0.488000	0.27723	0.514000	0.50259	CTC		0.517	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466281.1			23	42	1	0	2.32416e-17	0.002299	3.63442e-17	23	42				
GMIP	51291	broad.mit.edu	37	19	19749277	19749277	+	Silent	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:19749277T>C	ENST00000203556.4	-	8	689	c.552A>G	c.(550-552)aaA>aaG	p.K184K	GMIP_ENST00000587238.1_Silent_p.K184K|GMIP_ENST00000586269.1_5'Flank|GMIP_ENST00000445806.2_Silent_p.K184K	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	184					intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)	p.K184K(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						TCTCAGTCCGTTTGGCGGCGA	0.597																																							uc002nnd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(550-552)AAA>AAG		GEM interacting protein							102.0	75.0	84.0					19																	19749277		2203	4300	6503	SO:0001819	synonymous_variant	51291				negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity	g.chr19:19749277T>C	AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.552A>G	19.37:g.19749277T>C						GMIP_uc010xrb.1_Silent_p.K184K|GMIP_uc010xrc.1_Silent_p.K184K	p.K184K	NM_016573	NP_057657	Q9P107	GMIP_HUMAN			8	669	-			184					A0AVN9|B7ZLZ0	Silent	SNP	ENST00000203556.4	37	c.552A>G	CCDS12408.1																																																																																				0.597	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460551.1	NM_016573		5	22	0	0	0	0.00308	0	5	22				
ZNF14	7561	broad.mit.edu	37	19	19822649	19822649	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:19822649C>A	ENST00000344099.3	-	4	1579	c.1441G>T	c.(1441-1443)Gga>Tga	p.G481*		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	481					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				AAAACTTTTCCACACTGTTTA	0.393																																							uc002nnk.1		NA																	0				ovary(3)	3						c.(1441-1443)GGA>TGA		zinc finger protein 14							81.0	76.0	78.0					19																	19822649		2203	4300	6503	SO:0001587	stop_gained	7561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:19822649C>A	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.1441G>T	19.37:g.19822649C>A	ENSP00000340514:p.Gly481*						p.G481*	NM_021030	NP_066358	P17017	ZNF14_HUMAN			4	1595	-		Renal(1328;0.0474)	481			C2H2-type 14.		B9EGA4|Q9ULZ5	Nonsense_Mutation	SNP	ENST00000344099.3	37	c.1441G>T	CCDS12409.1	.	.	.	.	.	.	.	.	.	.	C	37	6.583843	0.97684	.	.	ENSG00000105708	ENST00000344099	.	.	.	1.8	0.695	0.18070	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	5.7588	0.18188	0.0:0.8097:0.0:0.1903	.	.	.	.	X	481	.	ENSP00000340514:G481X	G	-	1	0	ZNF14	19683649	0.998000	0.40836	0.015000	0.15790	0.936000	0.57629	2.203000	0.42752	0.083000	0.17047	0.467000	0.42956	GGA		0.393	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030		6	78	1	0	3.59834e-05	0.001168	4.23441e-05	6	78				
ZNF829	374899	broad.mit.edu	37	19	37382996	37382996	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:37382996T>A	ENST00000391711.3	-	6	1061	c.697A>T	c.(697-699)Att>Ttt	p.I233F	ZNF345_ENST00000526123.1_Intron|ZNF829_ENST00000520965.1_Missense_Mutation_p.I314F|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	233					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I233F(1)		endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCAGTGTGAATCCTCTGATGT	0.378																																							uc002ofa.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(697-699)ATT>TTT		zinc finger protein 829							59.0	63.0	61.0					19																	37382996		2202	4297	6499	SO:0001583	missense	374899				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37382996T>A	BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.697A>T	19.37:g.37382996T>A	ENSP00000429266:p.Ile233Phe					ZNF345_uc002oez.2_Intron	p.I233F	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1059	-	Esophageal squamous(110;0.183)		233			C2H2-type 3.		Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	ENST00000391711.3	37	c.697A>T	CCDS42557.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.123917	0.56613	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.18338	2.22	3.3	3.3	0.37823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23926	0.0579	L	0.57130	1.785	0.26144	N	0.980239	P	0.45176	0.852	P	0.48114	0.567	T	0.06409	-1.0828	9	0.62326	D	0.03	.	8.3803	0.32468	0.0:0.0:0.1979:0.8021	.	233	Q3KNS6	ZN829_HUMAN	F	233	ENSP00000429266:I233F	ENSP00000429266:I233F	I	-	1	0	ZNF829	42074836	0.001000	0.12720	0.997000	0.53966	0.998000	0.95712	0.940000	0.28992	1.736000	0.51660	0.528000	0.53228	ATT		0.378	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109575.3	NM_001037232		4	72	0	0	0	0.009096	0	4	72				
RYR1	6261	broad.mit.edu	37	19	38960040	38960040	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:38960040C>A	ENST00000359596.3	+	27	3652	c.3652C>A	c.(3652-3654)Ctc>Atc	p.L1218I	RYR1_ENST00000355481.4_Missense_Mutation_p.L1218I|RYR1_ENST00000360985.3_Missense_Mutation_p.L1218I			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1218	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.L1218I(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CATCTGTGGCCTCCAGGAAGG	0.602																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(3652-3654)CTC>ATC		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						145.0	137.0	140.0					19																	38960040		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38960040C>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3652C>A	19.37:g.38960040C>A	ENSP00000352608:p.Leu1218Ile					RYR1_uc002oiu.2_Missense_Mutation_p.L1218I	p.L1218I	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		27	3782	+	all_cancers(60;7.91e-06)		1218			Cytoplasmic.|6 X approximate repeats.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.3652C>A	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	c	10.43	1.349182	0.24426	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97404	-4.36;-4.37;-4.37	3.48	2.42	0.29668	.	0.000000	0.47093	U	0.000246	D	0.97306	0.9119	M	0.68952	2.095	0.31775	N	0.631644	D;D	0.89917	0.998;1.0	D;D	0.73380	0.915;0.98	D	0.95413	0.8500	10	0.72032	D	0.01	.	6.6849	0.23140	0.0:0.6902:0.0:0.3098	.	1218;1218	P21817-2;P21817	.;RYR1_HUMAN	I	1218	ENSP00000352608:L1218I;ENSP00000347667:L1218I;ENSP00000354254:L1218I	ENSP00000347667:L1218I	L	+	1	0	RYR1	43651880	0.979000	0.34478	0.999000	0.59377	0.992000	0.81027	1.458000	0.35223	0.685000	0.31468	0.434000	0.28630	CTC		0.602	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			34	222	1	0	2.05212e-20	0.005524	3.31277e-20	34	222				
ACP7	390928	broad.mit.edu	37	19	39591613	39591613	+	Silent	SNP	C	C	A	rs200240965		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:39591613C>A	ENST00000331256.5	+	8	1106	c.832C>A	c.(832-834)Cgg>Agg	p.R278R	PAPL_ENST00000594229.1_Silent_p.P236P	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		278						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)	p.R278W(1)|p.R278R(1)									CCGGGCAGCCCGGCCGTGGAT	0.627																																							uc002oki.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(1)|skin(1)		0						c.(832-834)CGG>AGG		iron/zinc purple acid phosphatase-like protein							65.0	70.0	68.0					19																	39591613		2203	4300	6503	SO:0001819	synonymous_variant	390928					extracellular region	acid phosphatase activity|metal ion binding	g.chr19:39591613C>A																												ENST00000331256.5:c.832C>A	19.37:g.39591613C>A						PAPL_uc010egl.2_Silent_p.P236P	p.R278R	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN			8	1106	+			278					B2RN68	Silent	SNP	ENST00000331256.5	37	c.832C>A	CCDS33018.1																																																																																				0.627	PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463810.1			54	95	1	0	5.2118e-15	0.00361	8.00669e-15	54	95				
FCGBP	8857	broad.mit.edu	37	19	40412002	40412002	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:40412002C>G	ENST00000221347.6	-	7	3633	c.3626G>C	c.(3625-3627)gGa>gCa	p.G1209A		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1209	Cys-rich.					extracellular vesicular exosome (GO:0070062)		p.G1209A(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGAATCACATCCGGGGCCAGG	0.667																																							uc002omp.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(3625-3627)GGA>GCA		Fc fragment of IgG binding protein precursor							42.0	42.0	42.0					19																	40412002		2203	4300	6503	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40412002C>G	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.3626G>C	19.37:g.40412002C>G	ENSP00000221347:p.Gly1209Ala						p.G1209A	NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		7	3634	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		1209			Cys-rich.		O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.3626G>C	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	8.165	0.790322	0.16258	.	.	ENSG00000090920	ENST00000221347	T	0.05925	3.37	4.3	-2.36	0.06663	.	1.743160	0.02910	N	0.136611	T	0.18002	0.0432	M	0.73372	2.23	0.09310	N	1	D	0.60160	0.987	P	0.62298	0.9	T	0.49835	-0.8897	10	0.08599	T	0.76	.	10.5392	0.45022	0.0:0.2908:0.0:0.7092	.	1209	Q9Y6R7	FCGBP_HUMAN	A	1209	ENSP00000221347:G1209A	ENSP00000221347:G1209A	G	-	2	0	FCGBP	45103842	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.136000	0.10405	-0.566000	0.06054	-0.436000	0.05848	GGA		0.667	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		37	69	0	0	0	0.004878	0	37	69				
LTBP4	8425	broad.mit.edu	37	19	41113371	41113371	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:41113371C>G	ENST00000308370.7	+	10	1293	c.1293C>G	c.(1291-1293)tgC>tgG	p.C431W	LTBP4_ENST00000545697.1_5'UTR|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000204005.9_Missense_Mutation_p.C394W|RN7SL758P_ENST00000580450.1_RNA|LTBP4_ENST00000396819.3_Missense_Mutation_p.C364W	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	431	TB 2.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.C431W(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AACAGATCTGCTGCTGCAGCC	0.667																																							uc002ooh.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1291-1293)TGC>TGG		latent transforming growth factor beta binding							21.0	24.0	23.0					19																	41113371		1980	4148	6128	SO:0001583	missense	8425				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity	g.chr19:41113371C>G	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.1293C>G	19.37:g.41113371C>G	ENSP00000311905:p.Cys431Trp					LTBP4_uc002oog.1_Missense_Mutation_p.C394W|LTBP4_uc002ooi.1_Missense_Mutation_p.C364W|LTBP4_uc002ooj.1_5'Flank|LTBP4_uc010xvo.1_5'Flank	p.C431W	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)		10	1293	+			431			TB 2.		O00508|O75412|O75413	Missense_Mutation	SNP	ENST00000308370.7	37	c.1293C>G		.	.	.	.	.	.	.	.	.	.	C	17.80	3.479273	0.63849	.	.	ENSG00000090006	ENST00000204005;ENST00000308370;ENST00000396819	D;D;D	0.99875	-7.4;-7.4;-7.4	4.56	3.52	0.40303	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.41938	D	0.000790	D	0.99843	0.9928	M	0.91663	3.23	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.97746	1.0211	10	0.87932	D	0	.	8.1232	0.30984	0.0:0.8092:0.0:0.1908	.	364;431;394	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	W	394;431;364	ENSP00000204005:C394W;ENSP00000311905:C431W;ENSP00000380031:C364W	ENSP00000204005:C394W	C	+	3	2	LTBP4	45805211	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	3.297000	0.51810	0.908000	0.36671	-0.339000	0.08088	TGC		0.667	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573		27	30	0	0	0	0.005443	0	27	30				
PSG6	5675	broad.mit.edu	37	19	43411745	43411745	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:43411745A>G	ENST00000292125.2	-	4	1012	c.968T>C	c.(967-969)gTc>gCc	p.V323A	PSG6_ENST00000187910.2_Missense_Mutation_p.V323A|PSG6_ENST00000402603.4_Intron	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	323	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.V323A(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				ATTCAGGGTGACTGGGTTACT	0.512																																							uc002ovj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(967-969)GTC>GCC		pregnancy specific beta-1-glycoprotein 6 isoform							147.0	130.0	136.0					19																	43411745		2202	4298	6500	SO:0001583	missense	5675				female pregnancy	extracellular region		g.chr19:43411745A>G		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.968T>C	19.37:g.43411745A>G	ENSP00000292125:p.Val323Ala					PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Missense_Mutation_p.V330A|PSG6_uc002ovi.2_Missense_Mutation_p.V324A|PSG6_uc010xwk.1_Missense_Mutation_p.V163A|PSG11_uc002ovk.1_Intron|PSG6_uc002ove.1_Missense_Mutation_p.V113A|PSG6_uc002ovf.1_Intron|PSG6_uc002ovg.1_Missense_Mutation_p.V323A	p.V323A	NM_002782	NP_002773	Q00889	PSG6_HUMAN			4	1020	-		Prostate(69;0.00899)	323			Ig-like C2-type 2.		O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	37	c.968T>C	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	N	9.288	1.049975	0.19827	.	.	ENSG00000170848	ENST00000187910;ENST00000292125	T;T	0.15256	2.44;2.44	1.42	1.42	0.22433	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31575	0.0801	M	0.89030	3	0.49299	D	0.999775	B;B	0.32604	0.134;0.377	B;P	0.44673	0.174;0.457	T	0.14559	-1.0468	9	0.87932	D	0	.	4.9767	0.14144	1.0:0.0:0.0:0.0	.	323;323	Q00889;Q00889-2	PSG6_HUMAN;.	A	323	ENSP00000187910:V323A;ENSP00000292125:V323A	ENSP00000187910:V323A	V	-	2	0	PSG6	48103585	0.010000	0.17322	0.175000	0.22980	0.029000	0.11900	0.876000	0.28092	0.660000	0.30964	0.113000	0.15668	GTC		0.512	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782		30	89	0	0	0	0.00361	0	30	89				
PSG7	5676	broad.mit.edu	37	19	43430607	43430607	+	RNA	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:43430607A>G	ENST00000406070.2	-	0	1067				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				ATTCAGGGTGACTGGGTCACT	0.507																																							uc002ovl.3		NA																	0					0						c.(970-972)GTC>GCC		pregnancy specific beta-1-glycoprotein 7							139.0	127.0	131.0					19																	43430607		2201	4299	6500			5676				female pregnancy	extracellular region		g.chr19:43430607A>G			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43430607A>G						PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_RNA|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Missense_Mutation_p.V202A	p.V324A	NM_002783	NP_002774	Q13046	PSG7_HUMAN			5	1073	-		Prostate(69;0.00682)	324			Ig-like C2-type 2.		Q15232	Missense_Mutation	SNP	ENST00000406070.2	37	c.971T>C																																																																																					0.507	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650		18	213	0	0	0	0.002299	0	18	213				
ZNF229	7772	broad.mit.edu	37	19	44933335	44933335	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:44933335C>A	ENST00000588931.1	-	6	2054	c.1621G>T	c.(1621-1623)Gga>Tga	p.G541*	ZNF229_ENST00000291187.4_Nonsense_Mutation_p.G535*|ZNF229_ENST00000591289.1_Intron|CTC-512J12.4_ENST00000588655.1_RNA	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	541					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G541*(1)		breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				GGTTTCTCTCCTGTGTGCAGT	0.512																																							uc002oze.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)|ovary(1)|pancreas(1)	4						c.(1621-1623)GGA>TGA		zinc finger protein 229							93.0	100.0	98.0					19																	44933335		2161	4284	6445	SO:0001587	stop_gained	7772				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44933335C>A	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.1621G>T	19.37:g.44933335C>A	ENSP00000466519:p.Gly541*					ZNF229_uc010ejk.1_Nonsense_Mutation_p.G195*|ZNF229_uc010ejl.1_Nonsense_Mutation_p.G535*	p.G541*	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN			6	2055	-		Prostate(69;0.0352)	541					B2RWN3|Q59FV2|Q86WL9	Nonsense_Mutation	SNP	ENST00000588931.1	37	c.1621G>T	CCDS42574.1	.	.	.	.	.	.	.	.	.	.	C	38	6.950791	0.97956	.	.	ENSG00000167383	ENST00000291187	.	.	.	3.82	2.76	0.32466	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	10.607	0.45400	0.0:0.8983:0.0:0.1017	.	.	.	.	X	541	.	ENSP00000291187:G541X	G	-	1	0	ZNF229	49625175	0.015000	0.18098	0.198000	0.23420	0.208000	0.24298	2.738000	0.47401	1.677000	0.50941	0.609000	0.83330	GGA		0.512	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518		14	257	1	0	2.31682e-05	0.003163	2.75887e-05	14	257				
IZUMO2	126123	broad.mit.edu	37	19	50661573	50661573	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:50661573G>T	ENST00000293405.3	-	5	448	c.448C>A	c.(448-450)Cat>Aat	p.H150N		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	150						integral component of membrane (GO:0016021)		p.H150N(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						CTCTGGCAATGTAAACAGTCC	0.502																																							uc002prp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(448-450)CAT>AAT		hypothetical protein LOC126123 precursor							125.0	116.0	119.0					19																	50661573		1936	4142	6078	SO:0001583	missense	126123					integral to membrane		g.chr19:50661573G>T	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.448C>A	19.37:g.50661573G>T	ENSP00000293405:p.His150Asn						p.H150N	NM_152358	NP_689571	Q6UXV1	IZUM2_HUMAN		GBM - Glioblastoma multiforme(134;0.00364)|OV - Ovarian serous cystadenocarcinoma(262;0.0052)	5	535	-		all_neural(266;0.0459)|Ovarian(192;0.0728)	150			Extracellular (Potential).		Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Missense_Mutation	SNP	ENST00000293405.3	37	c.448C>A	CCDS12792.2	.	.	.	.	.	.	.	.	.	.	G	5.062	0.197048	0.09599	.	.	ENSG00000161652	ENST00000293405	T	0.20463	2.07	3.85	1.57	0.23409	.	.	.	.	.	T	0.10035	0.0246	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.39781	-0.9597	9	0.02654	T	1	.	3.8291	0.08867	0.1352:0.0:0.5624:0.3025	.	150	Q6UXV1	IZUM2_HUMAN	N	150	ENSP00000293405:H150N	ENSP00000293405:H150N	H	-	1	0	IZUMO2	55353385	0.001000	0.12720	0.088000	0.20740	0.483000	0.33249	0.087000	0.14958	0.458000	0.26988	0.555000	0.69702	CAT		0.502	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358		14	70	1	0	9.16793e-09	0.00499	1.25164e-08	14	70				
MYH14	79784	broad.mit.edu	37	19	50804968	50804968	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:50804968G>A	ENST00000596571.1	+	37	5397	c.5397G>A	c.(5395-5397)aaG>aaA	p.K1799K	MYH14_ENST00000598205.1_Silent_p.K1807K|MYH14_ENST00000440075.2_Silent_p.K1840K|MYH14_ENST00000262269.8_Silent_p.K1840K|MYH14_ENST00000425460.1_Silent_p.K1807K|MYH14_ENST00000376970.2_Silent_p.K1832K|MYH14_ENST00000601313.1_Silent_p.K1840K			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1799					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.K1840K(1)		central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TCTCAGCCAAGGCAGAGAGCG	0.622																																							uc002prr.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(5395-5397)AAG>AAA		myosin, heavy chain 14 isoform 2							39.0	46.0	44.0					19																	50804968		2057	4222	6279	SO:0001819	synonymous_variant	79784				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr19:50804968G>A	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.5397G>A	19.37:g.50804968G>A						MYH14_uc010enu.1_Silent_p.K1840K|MYH14_uc002prq.1_Silent_p.K1807K|MYH14_uc010ycb.1_Silent_p.K150K|MYH14_uc002prs.1_Silent_p.K150K	p.K1799K	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)	38	5444	+		all_neural(266;0.0571)|Ovarian(192;0.0728)	1799			Potential.		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Silent	SNP	ENST00000596571.1	37	c.5397G>A	CCDS59411.1																																																																																				0.622	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729		9	53	0	0	0	0.013537	0	9	53				
NLRP7	199713	broad.mit.edu	37	19	55447801	55447801	+	Splice_Site	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:55447801T>C	ENST00000590030.1	-	5	2170		c.e5-2		NLRP7_ENST00000588756.1_Splice_Site|NLRP7_ENST00000448121.2_Splice_Site|NLRP7_ENST00000340844.2_Splice_Site|NLRP7_ENST00000328092.5_Splice_Site|NLRP7_ENST00000592784.1_Splice_Site|NLRP7_ENST00000446217.1_Splice_Site			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7								ATP binding (GO:0005524)	p.?(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TTTTTAATCCTAGGGAAAAGC	0.448																																							uc002qih.3		NA																	2	Unknown(2)		lung(2)	large_intestine(1)|breast(1)|central_nervous_system(1)	3						c.e6-1		NACHT, leucine rich repeat and PYD containing 7							62.0	61.0	61.0					19																	55447801		2203	4300	6503	SO:0001630	splice_region_variant	199713						ATP binding	g.chr19:55447801T>C	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.2130-2A>G	19.37:g.55447801T>C						NLRP7_uc002qig.3_Splice_Site_p.E682_splice|NLRP7_uc002qii.3_Splice_Site_p.E710_splice|NLRP7_uc010esk.2_Splice_Site_p.E710_splice|NLRP7_uc010esl.2_Splice_Site_p.E738_splice	p.E710_splice	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	6	2206	-								E9PE16|Q32MH8|Q7RTR1	Splice_Site	SNP	ENST00000590030.1	37	c.2130_splice	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	t	11.95	1.792013	0.31685	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	.	.	.	2.21	2.21	0.28008	.	.	.	.	.	.	.	.	.	.	.	0.45594	D	0.998539	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.4121	0.21696	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NLRP7	60139613	0.311000	0.24536	0.125000	0.21846	0.456000	0.32438	2.063000	0.41423	1.288000	0.44600	0.459000	0.35465	.		0.448	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	Intron	10	23	0	0	0	0.013537	0	10	23				
PEG3	5178	broad.mit.edu	37	19	57327451	57327451	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:57327451C>T	ENST00000326441.9	-	10	2722	c.2359G>A	c.(2359-2361)Gct>Act	p.A787T	ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.A787T|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.A661T|PEG3_ENST00000598410.1_Missense_Mutation_p.A663T	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	787					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A787T(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CTTTTCTGAGCTTCCACAGAG	0.438																																							uc002qnu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(2359-2361)GCT>ACT		paternally expressed 3 isoform 1							183.0	178.0	180.0					19																	57327451		2203	4300	6503	SO:0001583	missense	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57327451C>T	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2359G>A	19.37:g.57327451C>T	ENSP00000326581:p.Ala787Thr					ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.A758T|PEG3_uc002qnv.2_Missense_Mutation_p.A787T|PEG3_uc002qnw.2_Missense_Mutation_p.A663T|PEG3_uc002qnx.2_Missense_Mutation_p.A661T|PEG3_uc010etr.2_Missense_Mutation_p.A787T	p.A787T	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	2710	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	787					A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	c.2359G>A	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.198831	0.38806	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02606	4.23;4.23	4.11	1.98	0.26296	.	0.606245	0.14836	N	0.295567	T	0.05502	0.0145	M	0.65975	2.015	.	.	.	B;D;P	0.57257	0.061;0.979;0.932	B;P;B	0.49999	0.009;0.628;0.419	T	0.21245	-1.0251	9	0.51188	T	0.08	-7.8697	2.5059	0.04645	0.1659:0.5041:0.2182:0.1118	.	663;787;722	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	T	787	ENSP00000326581:A787T;ENSP00000403051:A787T	ENSP00000326581:A787T	A	-	1	0	ZIM2	62019263	0.000000	0.05858	0.473000	0.27253	0.332000	0.28634	-0.572000	0.05881	0.703000	0.31848	0.585000	0.79938	GCT		0.438	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			65	203	0	0	0	0.00361	0	65	203				
ZNF304	57343	broad.mit.edu	37	19	57867648	57867648	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:57867648G>T	ENST00000282286.5	+	3	584	c.411G>T	c.(409-411)aaG>aaT	p.K137N	ZNF304_ENST00000391705.3_Missense_Mutation_p.K137N|ZNF304_ENST00000598744.1_Missense_Mutation_p.K95N|ZNF304_ENST00000443917.2_Missense_Mutation_p.K184N			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K137N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		AGCACCAGAAGCAACATAATG	0.493																																							uc010ygw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(409-411)AAG>AAT		zinc finger protein 304							67.0	62.0	64.0					19																	57867648		2203	4300	6503	SO:0001583	missense	57343				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57867648G>T	AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.411G>T	19.37:g.57867648G>T	ENSP00000282286:p.Lys137Asn					ZNF304_uc010etw.2_Missense_Mutation_p.K184N|ZNF304_uc010etx.2_Missense_Mutation_p.K95N	p.K137N	NM_020657	NP_065708	Q9HCX3	ZN304_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)	3	799	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	137			C2H2-type 2.			Missense_Mutation	SNP	ENST00000282286.5	37	c.411G>T	CCDS12950.1	.	.	.	.	.	.	.	.	.	.	g	11.16	1.555804	0.27827	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	T;T;T	0.30981	2.34;2.34;1.51	3.4	1.27	0.21489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	.	.	.	.	T	0.32852	0.0843	M	0.70842	2.15	0.09310	N	1	B;B	0.31125	0.174;0.309	B;B	0.34824	0.19;0.107	T	0.28586	-1.0039	9	0.49607	T	0.09	.	7.6368	0.28272	0.2838:0.0:0.7162:0.0	.	137;184	Q9HCX3;E7EQD3	ZN304_HUMAN;.	N	137;137;184	ENSP00000282286:K137N;ENSP00000375586:K137N;ENSP00000401642:K184N	ENSP00000282286:K137N	K	+	3	2	ZNF304	62559460	0.005000	0.15991	0.015000	0.15790	0.172000	0.22775	0.713000	0.25794	0.461000	0.27071	0.462000	0.41574	AAG		0.493	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1			8	38	1	0	5.4927e-09	0.004482	7.55787e-09	8	38				
ZNF547	284306	broad.mit.edu	37	19	57888789	57888789	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:57888789G>T	ENST00000282282.3	+	4	595	c.445G>T	c.(445-447)Gtt>Ttt	p.V149F	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V149F(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAACCACAGAGTTCACATGGC	0.463																																							uc002qol.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(445-447)GTT>TTT		zinc finger protein 547							69.0	69.0	69.0					19																	57888789		2203	4300	6503	SO:0001583	missense	284306				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57888789G>T	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.445G>T	19.37:g.57888789G>T	ENSP00000282282:p.Val149Phe					ZNF547_uc002qpm.3_Missense_Mutation_p.V75F|ZNF547_uc010ygx.1_Missense_Mutation_p.V149F	p.V149F	NM_173631	NP_775902	Q8IVP9	ZN547_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	638	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)	149					A8K5Z9|Q96NC4	Missense_Mutation	SNP	ENST00000282282.3	37	c.445G>T	CCDS33131.1	.	.	.	.	.	.	.	.	.	.	G	2.836	-0.241572	0.05906	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	T	0.05447	3.44	2.09	-0.135	0.13477	.	.	.	.	.	T	0.03783	0.0107	N	0.03608	-0.345	0.09310	N	1	B;B;D	0.56968	0.005;0.013;0.978	B;B;P	0.49140	0.005;0.008;0.601	T	0.42430	-0.9452	9	0.41790	T	0.15	.	5.4522	0.16570	0.5851:0.0:0.4149:0.0	.	149;149;149	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	F	149	ENSP00000282282:V149F	ENSP00000282282:V149F	V	+	1	0	ZNF547	62580601	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	0.242000	0.18087	0.040000	0.15660	0.491000	0.48974	GTT		0.463	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631		16	34	1	0	3.57192e-18	0.006122	5.67449e-18	16	34				
ZNF416	55659	broad.mit.edu	37	19	58089425	58089425	+	Splice_Site	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:58089425C>A	ENST00000196489.3	-	2	297	c.75G>T	c.(73-75)caG>caT	p.Q25H		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	25					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q25H(1)		breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		CTCCACTCACCTGTGTAAAGC	0.527																																							uc002qpf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(73-75)CAG>CAT		zinc finger protein 416							140.0	117.0	125.0					19																	58089425		2203	4300	6503	SO:0001630	splice_region_variant	55659				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58089425C>A	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.75+1G>T	19.37:g.58089425C>A						ZNF547_uc002qpm.3_Intron	p.Q25H	NM_017879	NP_060349	Q9BWM5	ZN416_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)	2	246	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)	25					Q9NWW8	Missense_Mutation	SNP	ENST00000196489.3	37	c.75G>T	CCDS12954.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.243918	0.22796	.	.	ENSG00000083817	ENST00000196489;ENST00000428052	T	0.01059	5.39	2.57	1.46	0.22682	Krueppel-associated box (1);	.	.	.	.	T	0.01695	0.0054	M	0.64260	1.97	0.09310	N	1	B	0.34147	0.438	B	0.35353	0.201	T	0.43048	-0.9415	8	.	.	.	.	6.4425	0.21856	0.2898:0.7102:0.0:0.0	.	25	Q9BWM5	ZN416_HUMAN	H	25;5	ENSP00000196489:Q25H	.	Q	-	3	2	ZNF416	62781237	0.001000	0.12720	0.030000	0.17652	0.165000	0.22458	0.124000	0.15728	0.619000	0.30197	0.655000	0.94253	CAG		0.527	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879	Missense_Mutation	12	41	1	0	2.68362e-12	0.013537	3.94086e-12	12	41				
ZBTB45	84878	broad.mit.edu	37	19	59027778	59027778	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:59027778G>T	ENST00000594051.1	-	2	1743	c.1263C>A	c.(1261-1263)caC>caA	p.H421Q	ZBTB45_ENST00000354590.3_Missense_Mutation_p.H421Q|ZBTB45_ENST00000600990.1_Missense_Mutation_p.H421Q			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H421Q(1)		breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		GGATGAACATGTGCTTGGTGT	0.582																																					NSCLC(164;1383 2017 5233 27540 46677)	NSCLC(164;1383 2017 5233 27540 46677)	uc002qtd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1261-1263)CAC>CAA		zinc finger and BTB domain containing 45							73.0	71.0	72.0					19																	59027778		2203	4300	6503	SO:0001583	missense	84878				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:59027778G>T	AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.1263C>A	19.37:g.59027778G>T	ENSP00000469089:p.His421Gln					ZBTB45_uc002qte.2_Missense_Mutation_p.H421Q|ZBTB45_uc002qtf.2_Missense_Mutation_p.H421Q	p.H421Q	NM_032792	NP_116181	Q96K62	ZBT45_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)	2	1555	-		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)	421			C2H2-type 1.			Missense_Mutation	SNP	ENST00000594051.1	37	c.1263C>A	CCDS12984.1	.	.	.	.	.	.	.	.	.	.	g	18.31	3.595982	0.66332	.	.	ENSG00000119574	ENST00000354590	D	0.99926	-8.05	3.41	2.37	0.29283	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	D	0.99896	0.9950	M	0.84585	2.705	0.35981	D	0.836018	D	0.76494	0.999	D	0.87578	0.998	D	0.95674	0.8726	10	0.87932	D	0	.	8.763	0.34687	0.1167:0.0:0.8833:0.0	.	421	Q96K62	ZBT45_HUMAN	Q	421	ENSP00000346603:H421Q	ENSP00000346603:H421Q	H	-	3	2	ZBTB45	63719590	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.619000	0.54196	1.023000	0.39654	0.467000	0.42956	CAC		0.582	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792		8	28	1	0	0.00448238	0.004482	0.00482771	8	28				
TRIM28	10155	broad.mit.edu	37	19	59059178	59059178	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:59059178G>A	ENST00000253024.5	+	6	1148	c.859G>A	c.(859-861)Gta>Ata	p.V287I	TRIM28_ENST00000341753.6_Missense_Mutation_p.V205I	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	287	Interaction with MAGEC2.|Leucine zipper alpha helical coiled-coil region.|RBCC domain.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V287I(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GGTGTCTGACGTACAGAAGCG	0.582																																							uc002qtg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(859-861)GTA>ATA		tripartite motif-containing 28 protein							109.0	97.0	101.0					19																	59059178		2203	4300	6503	SO:0001583	missense	10155				epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent	nucleoplasm	chromo shadow domain binding|ligase activity|transcription corepressor activity|zinc ion binding	g.chr19:59059178G>A		CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.859G>A	19.37:g.59059178G>A	ENSP00000253024:p.Val287Ile					TRIM28_uc010eut.1_Missense_Mutation_p.V205I|TRIM28_uc002qth.1_5'Flank	p.V287I	NM_005762	NP_005753	Q13263	TIF1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)	6	1148	+		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)	287			RBCC domain.|Leucine zipper alpha helical coiled-coil region.		O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	ENST00000253024.5	37	c.859G>A	CCDS12985.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716891	0.30413	.	.	ENSG00000130726	ENST00000253024;ENST00000341753	T;T	0.68025	-0.08;-0.3	5.26	5.26	0.73747	B-box, C-terminal (1);	0.268051	0.30959	N	0.008522	T	0.46833	0.1413	N	0.22421	0.69	0.29064	N	0.883711	P;P	0.37997	0.614;0.48	B;B	0.29785	0.107;0.05	T	0.47598	-0.9105	10	0.25751	T	0.34	-20.3576	11.7905	0.52068	0.0:0.0:0.8245:0.1755	.	205;287	Q13263-2;Q13263	.;TIF1B_HUMAN	I	287;205	ENSP00000253024:V287I;ENSP00000342232:V205I	ENSP00000253024:V287I	V	+	1	0	TRIM28	63750990	0.998000	0.40836	0.949000	0.38748	0.945000	0.59286	3.709000	0.54853	2.649000	0.89929	0.555000	0.69702	GTA		0.582	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467074.1	NM_005762		12	53	0	0	0	0.010729	0	12	53				
UBE2M	9040	broad.mit.edu	37	19	59067459	59067459	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:59067459T>A	ENST00000253023.3	-	6	1127	c.549A>T	c.(547-549)aaA>aaT	p.K183N	CHMP2A_ENST00000312547.2_5'Flank|CHMP2A_ENST00000600118.1_5'Flank|CHMP2A_ENST00000601220.1_5'Flank	NM_003969.3	NP_003960.1	P61081	UBC12_HUMAN	ubiquitin-conjugating enzyme E2M	183					cellular protein modification process (GO:0006464)|positive regulation of neuron apoptotic process (GO:0043525)|protein neddylation (GO:0045116)|protein ubiquitination (GO:0016567)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)|ribosomal S6-glutamic acid ligase activity (GO:0018169)|ubiquitin-protein transferase activity (GO:0004842)	p.K183N(1)		large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	5		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GCCAACCCTATTTCAGGCAGC	0.627																																							uc002qtl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(547-549)AAA>AAT		ubiquitin-conjugating enzyme E2M							18.0	20.0	19.0					19																	59067459		2202	4299	6501	SO:0001583	missense	9040				protein neddylation		ATP binding|NEDD8 ligase activity|protein binding|ribosomal S6-glutamic acid ligase activity|ubiquitin-protein ligase activity	g.chr19:59067459T>A	AB012191	CCDS12987.1	19q13.43	2011-05-19	2011-05-19		ENSG00000130725	ENSG00000130725		"""Ubiquitin-conjugating enzymes E2"""	12491	protein-coding gene	gene with protein product		603173	"""ubiquitin-conjugating enzyme E2M (homologous to yeast UBC12)"", ""ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)"""			9694792	Standard	NM_003969		Approved	hUbc12, UBC12	uc002qtl.4	P61081		ENST00000253023.3:c.549A>T	19.37:g.59067459T>A	ENSP00000253023:p.Lys183Asn					CHMP2A_uc002qti.2_5'Flank|CHMP2A_uc002qtj.2_5'Flank|CHMP2A_uc002qtk.2_5'Flank	p.K183N	NM_003969	NP_003960	P61081	UBC12_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)	6	1144	-		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)	183					O76069|Q8VC50	Missense_Mutation	SNP	ENST00000253023.3	37	c.549A>T	CCDS12987.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.379495	0.61845	.	.	ENSG00000130725	ENST00000253023	T	0.74632	-0.86	4.45	3.43	0.39272	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.64402	D	0.000001	T	0.72120	0.3421	M	0.77103	2.36	0.39469	D	0.967695	P	0.40534	0.72	B	0.39185	0.293	T	0.74303	-0.3709	10	0.87932	D	0	-16.3913	8.2162	0.31514	0.0:0.0977:0.0:0.9023	.	183	P61081	UBC12_HUMAN	N	183	ENSP00000253023:K183N	ENSP00000253023:K183N	K	-	3	2	UBE2M	63759271	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.708000	0.37899	0.849000	0.35215	0.459000	0.35465	AAA		0.627	UBE2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467097.1	NM_003969		4	22	0	0	0	0.009096	0	4	22				
ALLC	55821	broad.mit.edu	37	2	3730547	3730547	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:3730547T>A	ENST00000252505.3	+	7	556	c.394T>A	c.(394-396)Tgg>Agg	p.W132R		NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	151					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)	p.W132R(2)		breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		ATCCGACGACTGGAGTTACTT	0.423										HNSCC(21;0.051)																													uc010ewt.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	central_nervous_system(1)	1						c.(394-396)TGG>AGG		allantoicase isoform a							132.0	133.0	133.0					2																	3730547		1896	4119	6015	SO:0001583	missense	55821						allantoicase activity	g.chr2:3730547T>A	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.394T>A	2.37:g.3730547T>A	ENSP00000252505:p.Trp132Arg	HNSCC(21;0.051)					p.W132R	NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)	7	555	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)	151					Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	ENST00000252505.3	37	c.394T>A	CCDS46223.1	.	.	.	.	.	.	.	.	.	.	T	14.38	2.519074	0.44866	.	.	ENSG00000151360	ENST00000252505	.	.	.	5.53	5.53	0.82687	Allantoicase domain (1);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.87877	0.6288	H	0.97540	4.025	0.51767	D	0.999931	D	0.89917	1.0	D	0.91635	0.999	D	0.91768	0.5425	9	0.87932	D	0	-23.26	13.9015	0.63806	0.0:0.0:0.0:1.0	.	151	Q8N6M5	ALLC_HUMAN	R	132	.	ENSP00000252505:W132R	W	+	1	0	ALLC	3708422	1.000000	0.71417	0.474000	0.27266	0.070000	0.16714	5.642000	0.67888	2.219000	0.72066	0.482000	0.46254	TGG		0.423	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1			27	173	0	0	0	0.003954	0	27	173				
RNF144A	9781	broad.mit.edu	37	2	7164598	7164598	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:7164598G>T	ENST00000320892.6	+	7	1050	c.608G>T	c.(607-609)tGc>tTc	p.C203F	RNF144A_ENST00000467276.1_3'UTR	NM_014746.3	NP_055561.2	P50876	R144A_HUMAN	ring finger protein 144A	203					protein ubiquitination (GO:0016567)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.C203F(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)	25	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		CAGATGATGTGCAAGAACTGC	0.537																																							uc002qys.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(607-609)TGC>TTC		ring finger protein 144							115.0	98.0	104.0					2																	7164598		2203	4300	6503	SO:0001583	missense	9781					Golgi apparatus|integral to membrane	ligase activity|zinc ion binding	g.chr2:7164598G>T	D79983	CCDS1657.1	2p25.2	2008-02-05	2007-08-20	2007-08-20	ENSG00000151692	ENSG00000151692		"""RING-type (C3HC4) zinc fingers"""	20457	protein-coding gene	gene with protein product			"""ring finger protein 144"""	RNF144		8724849, 10431818	Standard	NM_014746		Approved	UBCE7IP4, KIAA0161	uc002qys.3	P50876	OTTHUMG00000090353	ENST00000320892.6:c.608G>T	2.37:g.7164598G>T	ENSP00000321330:p.Cys203Phe					RNF144A_uc002qyt.2_Missense_Mutation_p.C52F	p.C203F	NM_014746	NP_055561	P50876	R144A_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.195)	7	1050	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)	203			RING-type 2; degenerate.		D6W4Y6|Q585H5	Missense_Mutation	SNP	ENST00000320892.6	37	c.608G>T	CCDS1657.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.653656|4.653656	0.88056|0.88056	.|.	.|.	ENSG00000151692|ENSG00000151692	ENST00000432850|ENST00000320892	.|D	.|0.99454	.|-5.92	5.87|5.87	5.87|5.87	0.94306|0.94306	.|Zinc finger, C6HC-type (2);Zinc finger, RING-type (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99778|0.99778	0.9908|0.9908	H|H	0.97852|0.97852	4.09|4.09	0.80722|0.80722	D|D	1|1	.|D	.|0.62365	.|0.991	.|D	.|0.79784	.|0.993	D|D	0.97155|0.97155	0.9834|0.9834	5|10	.|0.87932	.|D	.|0	.|.	20.2181|20.2181	0.98305|0.98305	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|203	.|P50876	.|R144A_HUMAN	S|F	199|203	.|ENSP00000321330:C203F	.|ENSP00000321330:C203F	A|C	+|+	1|2	0|0	RNF144A|RNF144A	7082049|7082049	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.649000|0.649000	0.38597|0.38597	9.751000|9.751000	0.98889|0.98889	2.785000|2.785000	0.95823|0.95823	0.655000|0.655000	0.94253|0.94253	GCA|TGC		0.537	RNF144A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206725.2	NM_014746		9	83	1	0	0.00621372	0.006214	0.00663113	9	83				
C2orf48	348738	broad.mit.edu	37	2	10282453	10282453	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:10282453G>C	ENST00000381786.3	+	3	433	c.144G>C	c.(142-144)agG>agC	p.R48S		NM_182626.2	NP_872432.1	Q96LS8	CB048_HUMAN	chromosome 2 open reading frame 48	48								p.R48S(1)		endometrium(1)|lung(7)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)		tgcgtgtcaggtgttactcgg	0.557																																							uc002rai.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(142-144)AGG>AGC		hypothetical protein LOC348738							152.0	148.0	149.0					2																	10282453		2203	4300	6503	SO:0001583	missense	348738							g.chr2:10282453G>C	AK057831	CCDS1670.1	2p25.1	2006-09-01			ENSG00000163009	ENSG00000163009			26322	protein-coding gene	gene with protein product						12477932	Standard	NM_182626		Approved	FLJ25102	uc021vds.1	Q96LS8	OTTHUMG00000119017	ENST00000381786.3:c.144G>C	2.37:g.10282453G>C	ENSP00000371205:p.Arg48Ser						p.R48S	NM_182626	NP_872432	Q96LS8	CB048_HUMAN		Epithelial(75;0.188)	3	433	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		48						Missense_Mutation	SNP	ENST00000381786.3	37	c.144G>C	CCDS1670.1	.	.	.	.	.	.	.	.	.	.	g	0.470	-0.884802	0.02530	.	.	ENSG00000163009	ENST00000381786	T	0.39056	1.1	1.05	-2.1	0.07210	.	.	.	.	.	T	0.20047	0.0482	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09530	-1.0670	9	0.87932	D	0	.	5.2618	0.15578	0.182:0.3077:0.5104:0.0	.	48	Q96LS8	CB048_HUMAN	S	48	ENSP00000371205:R48S	ENSP00000371205:R48S	R	+	3	2	C2orf48	10199904	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.151000	0.03175	-2.992000	0.00279	-1.224000	0.01588	AGG		0.557	C2orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239217.1	NM_182626		32	249	0	0	0	0.003755	0	32	249				
TRIB2	28951	broad.mit.edu	37	2	12858618	12858618	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:12858618G>A	ENST00000405331.3	+	1	255	c.185G>A	c.(184-186)gGg>gAg	p.G62E	TRIB2_ENST00000381465.2_Intron|RP11-333O1.1_ENST00000569860.1_lincRNA|TRIB2_ENST00000155926.4_Missense_Mutation_p.G62E					tribbles pseudokinase 2									p.G62E(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(5)|prostate(1)|skin(1)|stomach(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TCTTGTATCGGGAAATACTTA	0.577											OREG0014450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002rbv.3		NA																	1	Substitution - Missense(1)		lung(1)	stomach(1)	1						c.(184-186)GGG>GAG		tribbles homolog 2							73.0	77.0	76.0					2																	12858618		2203	4300	6503	SO:0001583	missense	28951				negative regulation of fat cell differentiation|negative regulation of interleukin-10 biosynthetic process|negative regulation of protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity	cytoplasm|cytoskeleton|nucleus	ATP binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity	g.chr2:12858618G>A	AY245544	CCDS1683.1	2p25.1	2013-10-03	2013-10-03		ENSG00000071575	ENSG00000071575			30809	protein-coding gene	gene with protein product		609462	"""tribbles homolog 2 (Drosophila)"""			12736262, 17097562, 16715410	Standard	NM_021643		Approved	TRB2, GS3955	uc002rbv.4	Q92519	OTTHUMG00000090575	ENST00000405331.3:c.185G>A	2.37:g.12858618G>A	ENSP00000384260:p.Gly62Glu		OREG0014450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	683	TRIB2_uc010yjp.1_Intron	p.G62E	NM_021643	NP_067675	Q92519	TRIB2_HUMAN			1	1621	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		62			Protein kinase.			Missense_Mutation	SNP	ENST00000405331.3	37	c.185G>A		.	.	.	.	.	.	.	.	.	.	G	25.8	4.671498	0.88348	.	.	ENSG00000071575	ENST00000155926;ENST00000405331	T;T	0.74106	-0.81;2.48	5.16	4.27	0.50696	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.047822	0.85682	D	0.000000	D	0.89784	0.6815	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.92570	0.6065	10	0.87932	D	0	-11.4229	14.6472	0.68769	0.0:0.1464:0.8536:0.0	.	62	Q92519	TRIB2_HUMAN	E	62	ENSP00000155926:G62E;ENSP00000384260:G62E	ENSP00000155926:G62E	G	+	2	0	TRIB2	12776069	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	1.142000	0.42291	0.655000	0.94253	GGG		0.577	TRIB2-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000323585.1	NM_021643		16	79	0	0	0	0.003163	0	16	79				
APOB	338	broad.mit.edu	37	2	21228933	21228933	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:21228933G>T	ENST00000233242.1	-	26	10934	c.10807C>A	c.(10807-10809)Cat>Aat	p.H3603N		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3603					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.H3603N(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGACTTGCATGGACCTGAACA	0.488																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(10807-10809)CAT>AAT		apolipoprotein B precursor	Atorvastatin(DB01076)						86.0	78.0	81.0					2																	21228933		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21228933G>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10807C>A	2.37:g.21228933G>T	ENSP00000233242:p.His3603Asn						p.H3603N	NM_000384	NP_000375	P04114	APOB_HUMAN			26	10935	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		3603					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.10807C>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	0.409	-0.914094	0.02415	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.69306	-0.39	5.75	3.94	0.45596	.	1.257000	0.05365	N	0.534464	T	0.59238	0.2179	L	0.29908	0.895	0.20403	N	0.999909	B	0.02656	0.0	B	0.04013	0.001	T	0.45011	-0.9290	10	0.26408	T	0.33	.	14.0272	0.64592	0.0:0.0:0.6036:0.3964	.	3603	P04114	APOB_HUMAN	N	3603	ENSP00000233242:H3603N	ENSP00000233242:H3603N	H	-	1	0	APOB	21082438	0.063000	0.20901	0.006000	0.13384	0.067000	0.16453	2.605000	0.46283	0.761000	0.33130	0.655000	0.94253	CAT		0.488	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			17	46	1	0	1.15088e-07	0.004007	1.50086e-07	17	46				
NCOA1	8648	broad.mit.edu	37	2	24929492	24929492	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:24929492C>A	ENST00000406961.1	+	13	1805	c.1153C>A	c.(1153-1155)Cga>Aga	p.R385R	NCOA1_ENST00000348332.3_Silent_p.R385R|NCOA1_ENST00000407230.1_Silent_p.R234R|NCOA1_ENST00000405141.1_Silent_p.R385R|NCOA1_ENST00000538539.1_Silent_p.R385R|NCOA1_ENST00000395856.3_Silent_p.R385R|NCOA1_ENST00000288599.5_Silent_p.R385R			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	385	Interaction with STAT3.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.R385R(2)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCAATTCCCCGAGTAAATCC	0.448			T	PAX3	alveolar rhadomyosarcoma																																		uc002rfk.2		NA		Dom	yes		2	2p23	8648	T	nuclear receptor coactivator 1			M	PAX3		alveolar rhadomyosarcoma	PAX3/NCOA1(8)	2	Substitution - coding silent(2)		lung(2)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11						c.(1153-1155)CGA>AGA		nuclear receptor coactivator 1 isoform 1							72.0	74.0	74.0					2																	24929492		2203	4300	6503	SO:0001819	synonymous_variant	8648							g.chr2:24929492C>A	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.1153C>A	2.37:g.24929492C>A						NCOA1_uc010eye.2_Silent_p.R385R|NCOA1_uc002rfi.2_Silent_p.R234R|NCOA1_uc002rfj.2_Silent_p.R385R|NCOA1_uc002rfl.2_Silent_p.R385R	p.R385R	NM_003743	NP_003734	Q15788	NCOA1_HUMAN			11	1411	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		385			Interaction with STAT3.		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Silent	SNP	ENST00000406961.1	37	c.1153C>A	CCDS1712.1																																																																																				0.448	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223		8	47	1	0	0.000157383	0.00308	0.000179756	8	47				
CENPA	1058	broad.mit.edu	37	2	27016122	27016122	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:27016122G>T	ENST00000335756.4	+	4	598	c.398G>T	c.(397-399)cGg>cTg	p.R133L	CENPA_ENST00000475662.1_3'UTR|CENPA_ENST00000233505.8_Missense_Mutation_p.R107L	NM_001809.3	NP_001800.1	P49450	CENPA_HUMAN	centromere protein A	133	H3-like.				CENP-A containing nucleosome assembly (GO:0034080)|establishment of mitotic spindle orientation (GO:0000132)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|protein localization to chromosome, centromeric region (GO:0071459)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|condensed chromosome inner kinetochore (GO:0000939)|condensed nuclear chromosome kinetochore (GO:0000778)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R133L(1)		endometrium(1)|large_intestine(3)|lung(3)|urinary_tract(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGGAGGATCCGGGGCCTTGAG	0.557																																					Pancreas(28;769 878 30250 30578 41330)	Pancreas(28;769 878 30250 30578 41330)	uc002rhr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(397-399)CGG>CTG		centromere protein A isoform a							124.0	134.0	131.0					2																	27016122		2203	4300	6503	SO:0001583	missense	1058				CenH3-containing nucleosome assembly at centromere|establishment of mitotic spindle orientation|interspecies interaction between organisms|kinetochore assembly|mitotic prometaphase|protein localization to chromosome, centromeric region	condensed nuclear chromosome kinetochore|cytosol|nucleoplasm|nucleosome	chromatin binding|DNA binding|protein binding	g.chr2:27016122G>T	U14518	CCDS1729.1, CCDS42662.1	2p23.3	2013-11-05	2006-06-16		ENSG00000115163	ENSG00000115163			1851	protein-coding gene	gene with protein product	"""centromere-specific histone"", ""histone H3-like centromeric protein A"""	117139	"""centromere protein A (17kD)"", ""centromere protein A, 17kDa"""				Standard	NM_001042426		Approved	CENP-A, CenH3	uc002rhr.3	P49450	OTTHUMG00000097073	ENST00000335756.4:c.398G>T	2.37:g.27016122G>T	ENSP00000336868:p.Arg133Leu					CENPA_uc002rht.2_RNA|CENPA_uc002rhs.2_Missense_Mutation_p.R107L	p.R133L	NM_001809	NP_001800	P49450	CENPA_HUMAN			4	581	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		133			H3-like.		D6W544|Q53T74|Q9BVW2	Missense_Mutation	SNP	ENST00000335756.4	37	c.398G>T	CCDS1729.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.853136	0.71719	.	.	ENSG00000115163	ENST00000335756;ENST00000233505	T;T	0.69175	-0.38;-0.38	5.96	4.16	0.48862	Histone-fold (2);Histone core (1);	0.000000	0.85682	D	0.000000	D	0.84497	0.5485	M	0.93898	3.47	0.50632	D	0.999883	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86013	0.1502	10	0.87932	D	0	-16.6774	10.1083	0.42546	0.0749:0.1377:0.7873:0.0	.	107;133	P49450-2;P49450	.;CENPA_HUMAN	L	133;107	ENSP00000336868:R133L;ENSP00000233505:R107L	ENSP00000233505:R107L	R	+	2	0	CENPA	26869626	1.000000	0.71417	0.829000	0.32907	0.493000	0.33554	7.299000	0.78831	0.843000	0.35070	0.650000	0.86243	CGG		0.557	CENPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214190.2	NM_001809		88	188	1	0	5.5301e-39	0.00361	9.38237e-39	88	188				
TCF23	150921	broad.mit.edu	37	2	27375715	27375715	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:27375715C>A	ENST00000296096.5	+	3	755	c.625C>A	c.(625-627)Cca>Aca	p.P209T		NM_175769.2	NP_786951.1	Q7RTU1	TCF23_HUMAN	transcription factor 23	209					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	nucleus (GO:0005634)		p.P209T(1)		large_intestine(2)|lung(11)|prostate(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCACTCTCACCAGCTCTTGG	0.537																																							uc010ylg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(625-627)CCA>ACA		transcription factor 23							133.0	135.0	134.0					2																	27375715		2203	4300	6503	SO:0001583	missense	150921				cell differentiation|muscle organ development|regulation of transcription, DNA-dependent	nucleus		g.chr2:27375715C>A	AC013403	CCDS33163.1	2p23.3	2013-05-21			ENSG00000163792	ENSG00000163792		"""Basic helix-loop-helix proteins"""	18602	protein-coding gene	gene with protein product		609635				11701948, 10652346	Standard	NM_175769		Approved	OUT, bHLHa24	uc010ylg.2	Q7RTU1	OTTHUMG00000152031	ENST00000296096.5:c.625C>A	2.37:g.27375715C>A	ENSP00000296096:p.Pro209Thr						p.P209T	NM_175769	NP_786951	Q7RTU1	TCF23_HUMAN			3	625	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		209					B2RNZ3	Missense_Mutation	SNP	ENST00000296096.5	37	c.625C>A	CCDS33163.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.131189	0.37630	.	.	ENSG00000163792	ENST00000296096	D	0.97731	-4.51	5.32	4.45	0.53987	.	1.000740	0.08063	N	0.998596	D	0.96568	0.8880	M	0.67953	2.075	0.20403	N	0.999904	P	0.50066	0.931	B	0.41466	0.358	D	0.90827	0.4713	10	0.87932	D	0	-3.3886	9.8107	0.40822	0.0:0.9048:0.0:0.0952	.	209	Q7RTU1	TCF23_HUMAN	T	209	ENSP00000296096:P209T	ENSP00000296096:P209T	P	+	1	0	TCF23	27229219	0.622000	0.27085	0.488000	0.27440	0.023000	0.10783	2.478000	0.45189	1.247000	0.43917	0.655000	0.94253	CCA		0.537	TCF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324980.1	NM_175769		40	76	1	0	1.8453e-21	0.010771	3.0137e-21	40	76				
GCKR	2646	broad.mit.edu	37	2	27730148	27730148	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:27730148G>T	ENST00000264717.2	+	13	1176	c.1113G>T	c.(1111-1113)atG>atT	p.M371I	GCKR_ENST00000424318.2_Missense_Mutation_p.M181I	NM_001486.3	NP_001477.2	Q14397	GCKR_HUMAN	glucokinase (hexokinase 4) regulator	371	SIS 2. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|negative regulation of glucokinase activity (GO:0033132)|positive regulation of glucokinase activity (GO:0033133)|protein import into nucleus, translocation (GO:0000060)|regulation of glucose transport (GO:0010827)|response to fructose (GO:0009750)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	carbohydrate binding (GO:0030246)|enzyme inhibitor activity (GO:0004857)|fructose-6-phosphate binding (GO:0070095)	p.M371I(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(2)	29	Acute lymphoblastic leukemia(172;0.155)					ACAGTGACATGTTTAACCAGA	0.493																																							uc002rky.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1111-1113)ATG>ATT		glucokinase regulatory protein							205.0	210.0	208.0					2																	27730148		2203	4300	6503	SO:0001583	missense	2646				carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding	g.chr2:27730148G>T	Z48475	CCDS1757.1	2p23	2008-05-21	2004-05-20		ENSG00000084734	ENSG00000084734			4196	protein-coding gene	gene with protein product		600842	"""glucokinase (hexokinase 4) regulatory protein"""			9570959, 8662230	Standard	NM_001486		Approved		uc002rky.3	Q14397	OTTHUMG00000128426	ENST00000264717.2:c.1113G>T	2.37:g.27730148G>T	ENSP00000264717:p.Met371Ile					GCKR_uc010ezd.2_Missense_Mutation_p.M369I|GCKR_uc010ylu.1_Missense_Mutation_p.M181I	p.M371I	NM_001486	NP_001477	Q14397	GCKR_HUMAN			13	1179	+	Acute lymphoblastic leukemia(172;0.155)		371			SIS 2.		A1L4C2|B4DPQ2|Q53RY6|Q99522	Missense_Mutation	SNP	ENST00000264717.2	37	c.1113G>T	CCDS1757.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.54|10.54	1.379478|1.379478	0.24944|0.24944	.|.	.|.	ENSG00000084734|ENSG00000084734	ENST00000411584|ENST00000264717;ENST00000424318	.|D;D	.|0.83419	.|-1.72;-1.72	4.8|4.8	3.92|3.92	0.45320|0.45320	.|Sugar isomerase (SIS) (1);	.|0.125717	.|0.53938	.|N	.|0.000050	T|T	0.73590|0.73590	0.3606|0.3606	L|L	0.39397|0.39397	1.21|1.21	0.35847|0.35847	D|D	0.826478|0.826478	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.06405	.|0.001;0.002;0.002	T|T	0.70281|0.70281	-0.4915|-0.4915	5|10	.|0.21540	.|T	.|0.41	-11.5898|-11.5898	10.2521|10.2521	0.43375|0.43375	0.0:0.0:0.8023:0.1977|0.0:0.0:0.8023:0.1977	.|.	.|181;369;371	.|F5H1P6;A8K731;Q14397	.|.;.;GCKR_HUMAN	F|I	72|371;181	.|ENSP00000264717:M371I;ENSP00000409109:M181I	.|ENSP00000264717:M371I	C|M	+|+	2|3	0|0	GCKR|GCKR	27583652|27583652	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.830000|0.830000	0.47004|0.47004	2.162000|2.162000	0.42367|0.42367	1.202000|1.202000	0.43218|0.43218	0.655000|0.655000	0.94253|0.94253	TGT|ATG		0.493	GCKR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250214.1	NM_001486		39	372	1	0	3.21399e-22	0.004878	5.26132e-22	39	372				
BIRC6	57448	broad.mit.edu	37	2	32689617	32689617	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:32689617C>T	ENST00000421745.2	+	25	5116	c.4982C>T	c.(4981-4983)gCa>gTa	p.A1661V		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1661	Poly-Ala.				apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.A1661V(1)|p.A1633V(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					Acaacagctgcagcagctgca	0.458																																					Pancreas(94;175 1509 16028 18060 45422)	Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(4981-4983)GCA>GTA		baculoviral IAP repeat-containing 6							55.0	52.0	53.0					2																	32689617		2203	4299	6502	SO:0001583	missense	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32689617C>T	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.4982C>T	2.37:g.32689617C>T	ENSP00000393596:p.Ala1661Val						p.A1661V	NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN			25	5116	+	Acute lymphoblastic leukemia(172;0.155)		1661			Poly-Ala.		Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	c.4982C>T	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	35	5.504397	0.96371	.	.	ENSG00000115760	ENST00000421745	T	0.75050	-0.9	5.93	5.93	0.95920	.	0.129398	0.51477	D	0.000093	D	0.83667	0.5304	L	0.50333	1.59	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.81373	-0.0962	10	0.41790	T	0.15	.	19.9472	0.97186	0.0:1.0:0.0:0.0	.	1661	Q9NR09	BIRC6_HUMAN	V	1661	ENSP00000393596:A1661V	ENSP00000393596:A1661V	A	+	2	0	BIRC6	32543121	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.818000	0.86416	2.805000	0.96524	0.655000	0.94253	GCA		0.458	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		6	8	0	0	0	0.001168	0	6	8				
BIRC6	57448	broad.mit.edu	37	2	32726951	32726951	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:32726951G>T	ENST00000421745.2	+	47	9337	c.9203G>T	c.(9202-9204)aGa>aTa	p.R3068I		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3068					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.R3068I(1)|p.R3040I(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TATATGGGCAGACAAGTAAGT	0.343																																					Pancreas(94;175 1509 16028 18060 45422)	Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(9202-9204)AGA>ATA		baculoviral IAP repeat-containing 6							111.0	105.0	107.0					2																	32726951		2203	4300	6503	SO:0001583	missense	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32726951G>T	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.9203G>T	2.37:g.32726951G>T	ENSP00000393596:p.Arg3068Ile						p.R3068I	NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN			47	9337	+	Acute lymphoblastic leukemia(172;0.155)		3068					Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	c.9203G>T	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	36	5.671182	0.96754	.	.	ENSG00000115760	ENST00000421745	T	0.77098	-1.07	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.85256	0.5655	L	0.44542	1.39	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	D	0.85611	0.1258	10	0.66056	D	0.02	.	19.85	0.96736	0.0:0.0:1.0:0.0	.	3068	Q9NR09	BIRC6_HUMAN	I	3068	ENSP00000393596:R3068I	ENSP00000393596:R3068I	R	+	2	0	BIRC6	32580455	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.697000	0.92050	0.563000	0.77884	AGA		0.343	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		28	70	1	0	5.91797e-21	0.012213	9.64256e-21	28	70				
BIRC6	57448	broad.mit.edu	37	2	32768471	32768471	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:32768471C>G	ENST00000421745.2	+	62	12589	c.12455C>G	c.(12454-12456)cCc>cGc	p.P4152R		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4152					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.P4124R(1)|p.P4152R(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ACCATGTCTCCCATACCTGCC	0.483																																					Pancreas(94;175 1509 16028 18060 45422)	Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(12454-12456)CCC>CGC		baculoviral IAP repeat-containing 6							320.0	279.0	293.0					2																	32768471		2203	4300	6503	SO:0001583	missense	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32768471C>G	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.12455C>G	2.37:g.32768471C>G	ENSP00000393596:p.Pro4152Arg						p.P4152R	NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN			62	12589	+	Acute lymphoblastic leukemia(172;0.155)		4152					Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	c.12455C>G	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049364	0.75846	.	.	ENSG00000115760	ENST00000421745	T	0.73897	-0.79	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.80813	0.4695	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80801	-0.1220	10	0.46703	T	0.11	.	19.4789	0.95000	0.0:1.0:0.0:0.0	.	4152	Q9NR09	BIRC6_HUMAN	R	4152	ENSP00000393596:P4152R	ENSP00000393596:P4152R	P	+	2	0	BIRC6	32621975	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.598000	0.87819	0.650000	0.86243	CCC		0.483	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		24	309	0	0	0	0.008361	0	24	309				
BIRC6	57448	broad.mit.edu	37	2	32768555	32768555	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:32768555A>T	ENST00000421745.2	+	62	12673	c.12539A>T	c.(12538-12540)cAt>cTt	p.H4180L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4180					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.H4180L(1)|p.H4152L(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GAGAGAAAACATGCCCAGTGC	0.423																																					Pancreas(94;175 1509 16028 18060 45422)	Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(12538-12540)CAT>CTT		baculoviral IAP repeat-containing 6							158.0	142.0	147.0					2																	32768555		2203	4300	6503	SO:0001583	missense	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32768555A>T	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.12539A>T	2.37:g.32768555A>T	ENSP00000393596:p.His4180Leu						p.H4180L	NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN			62	12673	+	Acute lymphoblastic leukemia(172;0.155)		4180					Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	c.12539A>T	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	17.35	3.368636	0.61624	.	.	ENSG00000115760	ENST00000421745	T	0.74002	-0.8	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.63616	0.2526	N	0.22421	0.69	0.80722	D	1	B	0.23058	0.079	B	0.28916	0.096	T	0.62388	-0.6865	10	0.51188	T	0.08	.	12.2302	0.54484	0.858:0.142:0.0:0.0	.	4180	Q9NR09	BIRC6_HUMAN	L	4180	ENSP00000393596:H4180L	ENSP00000393596:H4180L	H	+	2	0	BIRC6	32622059	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.383000	0.79741	2.100000	0.63781	0.528000	0.53228	CAT		0.423	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		41	80	0	0	0	0.006999	0	41	80				
LTBP1	4052	broad.mit.edu	37	2	33505174	33505174	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:33505174C>T	ENST00000404816.2	+	19	3414	c.3061C>T	c.(3061-3063)Cag>Tag	p.Q1021*	LTBP1_ENST00000404525.1_Nonsense_Mutation_p.Q642*|LTBP1_ENST00000402934.1_Nonsense_Mutation_p.Q642*|LTBP1_ENST00000390003.4_Nonsense_Mutation_p.Q696*|LTBP1_ENST00000407925.1_Nonsense_Mutation_p.Q695*|LTBP1_ENST00000418533.2_Nonsense_Mutation_p.Q695*|LTBP1_ENST00000354476.3_Nonsense_Mutation_p.Q1022*			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1021	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.Q1022*(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TGGATCTTACCAGTGCGTTCC	0.433																																							uc002ros.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8						c.(3064-3066)CAG>TAG		latent transforming growth factor beta binding							139.0	131.0	134.0					2																	33505174		2203	4300	6503	SO:0001587	stop_gained	4052				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity	g.chr2:33505174C>T		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.3061C>T	2.37:g.33505174C>T	ENSP00000386043:p.Gln1021*					LTBP1_uc002rot.2_Nonsense_Mutation_p.Q696*|LTBP1_uc002rou.2_Nonsense_Mutation_p.Q695*|LTBP1_uc002rov.2_Nonsense_Mutation_p.Q642*|LTBP1_uc010ymz.1_Nonsense_Mutation_p.Q695*|LTBP1_uc010yna.1_Nonsense_Mutation_p.Q642*	p.Q1022*	NM_206943	NP_996826	Q14766	LTBP1_HUMAN			19	3064	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	1021			EGF-like 7; calcium-binding (Potential).		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Nonsense_Mutation	SNP	ENST00000404816.2	37	c.3064C>T	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	C	42	9.537315	0.99198	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	12.7605	0.57361	0.0:0.9255:0.0:0.0745	.	.	.	.	X	1021;1022;696;695;642;642;695	.	ENSP00000346467:Q1022X	Q	+	1	0	LTBP1	33358678	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.204000	0.42761	2.608000	0.88229	0.561000	0.74099	CAG		0.433	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		24	45	0	0	0	0.004656	0	24	45				
RASGRP3	25780	broad.mit.edu	37	2	33774801	33774801	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:33774801G>T	ENST00000403687.3	+	14	2265	c.1525G>T	c.(1525-1527)Gaa>Taa	p.E509*	RASGRP3_ENST00000402538.3_Nonsense_Mutation_p.E509*|RASGRP3_ENST00000407811.1_Nonsense_Mutation_p.E508*	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	509					MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)	p.E509*(1)|p.E509K(1)		large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					AACCTTCTGCGAACACTGTGC	0.388																																							uc002rox.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(1)|skin(1)	lung(3)|ovary(1)|pancreas(1)	5						c.(1525-1527)GAA>TAA		RAS guanyl releasing protein 3 (calcium and							173.0	152.0	159.0					2																	33774801		1876	4105	5981	SO:0001587	stop_gained	25780				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity	g.chr2:33774801G>T	AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.1525G>T	2.37:g.33774801G>T	ENSP00000384192:p.Glu509*					RASGRP3_uc010ync.1_Nonsense_Mutation_p.E509*|RASGRP3_uc002roy.2_Nonsense_Mutation_p.E508*	p.E509*	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN			15	2152	+	all_hematologic(175;0.115)		509			Phorbol-ester/DAG-type.		D6W583|O94931|Q53SD7	Nonsense_Mutation	SNP	ENST00000403687.3	37	c.1525G>T	CCDS46256.1	.	.	.	.	.	.	.	.	.	.	G	41	8.733105	0.98933	.	.	ENSG00000152689	ENST00000402538;ENST00000403687;ENST00000407811	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-20.7975	18.4998	0.90877	0.0:0.0:1.0:0.0	.	.	.	.	X	509;509;508	.	ENSP00000385886:E509X	E	+	1	0	RASGRP3	33628305	1.000000	0.71417	0.983000	0.44433	0.914000	0.54420	9.797000	0.99108	2.455000	0.83008	0.555000	0.69702	GAA		0.388	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376		26	34	1	0	4.2108e-06	0.009535	5.17284e-06	26	34				
HEATR5B	54497	broad.mit.edu	37	2	37289111	37289111	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:37289111C>T	ENST00000233099.5	-	11	1762	c.1667G>A	c.(1666-1668)tGg>tAg	p.W556*	HEATR5B_ENST00000354531.2_Nonsense_Mutation_p.W556*	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	556						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.W556*(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				AAGTAAAAGCCAGCCAGCTTG	0.373																																							uc002rpp.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|skin(2)|breast(1)	8						c.(1666-1668)TGG>TAG		HEAT repeat containing 5B							102.0	107.0	105.0					2																	37289111		2203	4300	6503	SO:0001587	stop_gained	54497						binding	g.chr2:37289111C>T	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.1667G>A	2.37:g.37289111C>T	ENSP00000233099:p.Trp556*						p.W556*	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN			11	1763	-		all_hematologic(82;0.21)	556					B5MDU8|Q7Z3B2|Q9NVL7	Nonsense_Mutation	SNP	ENST00000233099.5	37	c.1667G>A	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	41	8.566920	0.98866	.	.	ENSG00000008869	ENST00000233099;ENST00000354531;ENST00000424416	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4463	19.8411	0.96685	0.0:1.0:0.0:0.0	.	.	.	.	X	556	.	ENSP00000233099:W556X	W	-	2	0	HEATR5B	37142615	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.625000	0.83145	2.683000	0.91414	0.655000	0.94253	TGG		0.373	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024		7	84	0	0	0	0.001984	0	7	84				
THUMPD2	80745	broad.mit.edu	37	2	39982476	39982476	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:39982476C>A	ENST00000505747.1	-	8	1064	c.1037G>T	c.(1036-1038)gGc>gTc	p.G346V	THUMPD2_ENST00000260619.6_Missense_Mutation_p.G316V	NM_025264.4	NP_079540.2	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2	346							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.G316V(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	17		all_hematologic(82;0.248)				ATCCTCAAGGCCTGCAGCTTT	0.323																																							uc002rru.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1036-1038)GGC>GTC		THUMP domain containing 2							64.0	67.0	66.0					2																	39982476		2203	4300	6503	SO:0001583	missense	80745						methyltransferase activity	g.chr2:39982476C>A	AF380576	CCDS1805.1, CCDS1805.2	2p22.2	2004-06-04	2004-06-04	2004-06-04	ENSG00000138050	ENSG00000138050			14890	protein-coding gene	gene with protein product		611751	"""chromosome 2 open reading frame 8"""	C2orf8		12063391	Standard	NM_025264		Approved	MGC2454	uc002rru.2	Q9BTF0	OTTHUMG00000102149	ENST00000505747.1:c.1037G>T	2.37:g.39982476C>A	ENSP00000423933:p.Gly346Val					THUMPD2_uc002rrv.2_RNA|THUMPD2_uc010ynt.1_Missense_Mutation_p.G237V	p.G346V	NM_025264	NP_079540	Q9BTF0	THUM2_HUMAN			8	1074	-		all_hematologic(82;0.248)	346					A8K7I7|Q53TT8|Q53TV0	Missense_Mutation	SNP	ENST00000505747.1	37	c.1037G>T	CCDS1805.2	.	.	.	.	.	.	.	.	.	.	C	16.33	3.092975	0.56075	.	.	ENSG00000138050	ENST00000505747;ENST00000260619	T;T	0.35421	1.31;1.31	5.55	3.74	0.42951	Putative RNA methylase (1);	0.159109	0.56097	D	0.000040	T	0.64670	0.2619	M	0.93550	3.43	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.68621	0.959;0.959	T	0.70908	-0.4744	9	.	.	.	.	8.8422	0.35148	0.0:0.8218:0.0:0.1782	.	237;346	B4DP37;Q9BTF0	.;THUM2_HUMAN	V	346;316	ENSP00000423933:G346V;ENSP00000260619:G316V	.	G	-	2	0	THUMPD2	39835980	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	1.063000	0.30567	1.342000	0.45619	0.561000	0.74099	GGC		0.323	THUMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219991.2	NM_025264		9	29	1	0	1.08611e-07	0.010729	1.4217e-07	9	29				
SLC8A1	6546	broad.mit.edu	37	2	40342676	40342676	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:40342676A>T	ENST00000403092.1	-	11	2672	c.2639T>A	c.(2638-2640)cTg>cAg	p.L880Q	SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1_ENST00000406391.2_Missense_Mutation_p.L844Q|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1_ENST00000406785.2_Missense_Mutation_p.L844Q|SLC8A1_ENST00000405269.1_Missense_Mutation_p.L844Q|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1_ENST00000402441.1_Missense_Mutation_p.L844Q|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000542024.1_Missense_Mutation_p.L844Q|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1_ENST00000332839.4_Missense_Mutation_p.L880Q|SLC8A1_ENST00000542756.1_Missense_Mutation_p.L875Q|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1_ENST00000408028.2_Missense_Mutation_p.L872Q|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1_ENST00000405901.3_Missense_Mutation_p.L875Q			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	880					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.L880Q(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	ACCGATTCCCAGGAAGACATT	0.567																																							uc002rrx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2638-2640)CTG>CAG		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						104.0	85.0	91.0					2																	40342676		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40342676A>T		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.2639T>A	2.37:g.40342676A>T	ENSP00000384763:p.Leu880Gln					uc002rrw.2_Intron|SLC8A1_uc002rry.2_Missense_Mutation_p.L875Q|SLC8A1_uc002rrz.2_Missense_Mutation_p.L867Q|SLC8A1_uc002rsa.2_Missense_Mutation_p.L844Q|SLC8A1_uc002rsd.3_Missense_Mutation_p.L844Q	p.L880Q	NM_021097	NP_066920	P32418	NAC1_HUMAN			10	2663	-			880			Helical; (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.2639T>A	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.116190	0.77323	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	6.07	6.07	0.98685	Sodium/calcium exchanger membrane region (1);	0.000000	0.64402	D	0.000001	D	0.88537	0.6463	H	0.98111	4.15	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.995;1.0	D	0.92385	0.5916	10	0.87932	D	0	.	14.5809	0.68288	1.0:0.0:0.0:0.0	.	844;867;875;880	P32418-2;P32418-3;F6VPY9;P32418	.;.;.;NAC1_HUMAN	Q	844;880;875;880;875;844;844;880;872;867;844;844	ENSP00000383886:L844Q;ENSP00000440727:L875Q;ENSP00000384763:L880Q;ENSP00000385678:L875Q;ENSP00000385188:L844Q;ENSP00000385535:L844Q;ENSP00000332931:L880Q;ENSP00000384908:L872Q;ENSP00000385811:L844Q;ENSP00000443515:L844Q	ENSP00000332931:L880Q	L	-	2	0	SLC8A1	40196180	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.210000	0.95106	2.326000	0.78906	0.533000	0.62120	CTG		0.567	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		12	48	0	0	0	0.010729	0	12	48				
NRXN1	9378	broad.mit.edu	37	2	50280416	50280416	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:50280416A>T	ENST00000406316.2	-	20	5507	c.4031T>A	c.(4030-4032)aTt>aAt	p.I1344N	NRXN1_ENST00000406859.3_Missense_Mutation_p.I1344N|NRXN1_ENST00000401710.1_Missense_Mutation_p.I362N|NRXN1_ENST00000401669.2_Missense_Mutation_p.I1374N|NRXN1_ENST00000402717.3_Missense_Mutation_p.I1366N|NRXN1_ENST00000405472.3_Missense_Mutation_p.I1366N|NRXN1_ENST00000342183.5_Missense_Mutation_p.I309N|NRXN1_ENST00000404971.1_Missense_Mutation_p.I1414N	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1344					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.I309N(1)|p.I1415N(1)|p.I1344N(1)|p.I1414N(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CACCTGGCTAATGGGTTCTTT	0.428																																							uc010fbp.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(925-927)ATT>AAT		neurexin 1 isoform beta precursor							101.0	111.0	108.0					2																	50280416		2203	4300	6503	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50280416A>T	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4031T>A	2.37:g.50280416A>T	ENSP00000384311:p.Ile1344Asn					NRXN1_uc002rxb.3_Missense_Mutation_p.I1046N|NRXN1_uc010fbq.2_Missense_Mutation_p.I1414N|NRXN1_uc002rxe.3_Missense_Mutation_p.I1344N	p.I309N	NM_138735	NP_620072	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		4	1733	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	309			Extracellular (Potential).		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.926T>A	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	A	15.60	2.881085	0.51801	.	.	ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T;T	0.72051	0.91;2.07;0.11;0.06;-0.62;-0.51;-0.21;-0.08	5.08	5.08	0.68730	.	0.348081	0.14525	U	0.314248	T	0.59115	0.2170	N	0.19112	0.55	0.27284	N	0.95801	B;B;B;B	0.27823	0.071;0.133;0.137;0.19	B;B;B;B	0.28465	0.085;0.09;0.085;0.039	T	0.55464	-0.8137	10	0.44086	T	0.13	.	15.1294	0.72511	1.0:0.0:0.0:0.0	.	1414;309;1344;1366	Q9ULB1-3;P58400;F8WB18;A7E294	.;NRX1B_HUMAN;.;.	N	309;263;362;1414;1344;1366;1374;1415;1366;1344	ENSP00000341184:I309N;ENSP00000385580:I362N;ENSP00000385142:I1414N;ENSP00000384311:I1344N;ENSP00000434015:I1366N;ENSP00000385017:I1374N;ENSP00000385434:I1366N;ENSP00000385681:I1344N	ENSP00000341184:I309N	I	-	2	0	NRXN1	50133920	1.000000	0.71417	0.678000	0.29963	0.934000	0.57294	6.803000	0.75180	2.036000	0.60181	0.528000	0.53228	ATT		0.428	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			7	89	0	0	0	0.001984	0	7	89				
NRXN1	9378	broad.mit.edu	37	2	50280420	50280420	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:50280420G>T	ENST00000406316.2	-	20	5503	c.4027C>A	c.(4027-4029)Ccc>Acc	p.P1343T	NRXN1_ENST00000406859.3_Missense_Mutation_p.P1343T|NRXN1_ENST00000401710.1_Missense_Mutation_p.P361T|NRXN1_ENST00000401669.2_Missense_Mutation_p.P1373T|NRXN1_ENST00000402717.3_Missense_Mutation_p.P1365T|NRXN1_ENST00000405472.3_Missense_Mutation_p.P1365T|NRXN1_ENST00000342183.5_Missense_Mutation_p.P308T|NRXN1_ENST00000404971.1_Missense_Mutation_p.P1413T	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1343					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.P1414T(1)|p.P1413T(1)|p.P308T(1)|p.P1343T(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGGCTAATGGGTTCTTTTGTC	0.438																																							uc010fbp.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(922-924)CCC>ACC		neurexin 1 isoform beta precursor							105.0	114.0	111.0					2																	50280420		2203	4300	6503	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50280420G>T	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4027C>A	2.37:g.50280420G>T	ENSP00000384311:p.Pro1343Thr					NRXN1_uc002rxb.3_Missense_Mutation_p.P1045T|NRXN1_uc010fbq.2_Missense_Mutation_p.P1413T|NRXN1_uc002rxe.3_Missense_Mutation_p.P1343T	p.P308T	NM_138735	NP_620072	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		4	1729	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	308			Extracellular (Potential).		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.922C>A	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	4.755	0.140403	0.09083	.	.	ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T;T	0.69926	1.04;2.25;0.26;0.22;-0.44;-0.33;-0.04;0.09	5.08	5.08	0.68730	.	0.431022	0.15741	U	0.246925	T	0.48390	0.1497	N	0.08118	0	0.26618	N	0.972719	B;B;B;P	0.41420	0.002;0.215;0.053;0.749	B;B;B;B	0.37601	0.008;0.101;0.138;0.254	T	0.40683	-0.9550	10	0.23302	T	0.38	.	18.8216	0.92099	0.0:0.0:1.0:0.0	.	1413;308;1343;1365	Q9ULB1-3;P58400;F8WB18;A7E294	.;NRX1B_HUMAN;.;.	T	308;262;361;1413;1343;1365;1373;1414;1365;1343	ENSP00000341184:P308T;ENSP00000385580:P361T;ENSP00000385142:P1413T;ENSP00000384311:P1343T;ENSP00000434015:P1365T;ENSP00000385017:P1373T;ENSP00000385434:P1365T;ENSP00000385681:P1343T	ENSP00000341184:P308T	P	-	1	0	NRXN1	50133924	1.000000	0.71417	0.935000	0.37517	0.913000	0.54294	9.328000	0.96403	2.518000	0.84900	0.650000	0.86243	CCC		0.438	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			7	88	1	0	0.00307968	0.00308	0.00334789	7	88				
NRXN1	9378	broad.mit.edu	37	2	50850508	50850508	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:50850508C>A	ENST00000406316.2	-	6	2554	c.1078G>T	c.(1078-1080)Gga>Tga	p.G360*	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000406859.3_Nonsense_Mutation_p.G360*|NRXN1_ENST00000401669.2_Nonsense_Mutation_p.G360*|NRXN1_ENST00000402717.3_Nonsense_Mutation_p.G360*|NRXN1_ENST00000405472.3_Nonsense_Mutation_p.G360*|NRXN1_ENST00000404971.1_Nonsense_Mutation_p.G393*	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	360	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.G393*(1)|p.G394*(1)|p.G360*(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TTAAACTTTCCATTCACAGGC	0.458																																							uc010fbq.2		NA																	3	Substitution - Nonsense(3)		lung(3)	ovary(2)	2						c.(1177-1179)GGA>TGA		neurexin 1 isoform alpha2 precursor							82.0	79.0	80.0					2																	50850508		1924	4149	6073	SO:0001587	stop_gained	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50850508C>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1078G>T	2.37:g.50850508C>A	ENSP00000384311:p.Gly360*					NRXN1_uc002rxb.3_Nonsense_Mutation_p.G40*|NRXN1_uc002rxe.3_Nonsense_Mutation_p.G360*|NRXN1_uc002rxc.1_RNA	p.G393*	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		6	2654	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Nonsense_Mutation	SNP	ENST00000406316.2	37	c.1177G>T	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	48	14.745004	0.99808	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	19.9038	0.96999	0.0:1.0:0.0:0.0	.	.	.	.	X	393;360;360;360;394;360;360	.	ENSP00000385017:G360X	G	-	1	0	NRXN1	50704012	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.708000	0.92522	0.557000	0.71058	GGA		0.458	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			8	55	1	0	5.18039e-06	0.00308	6.31954e-06	8	55				
DYSF	8291	broad.mit.edu	37	2	71743361	71743361	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:71743361A>G	ENST00000258104.3	+	8	1121	c.844A>G	c.(844-846)Atc>Gtc	p.I282V	DYSF_ENST00000409762.1_Missense_Mutation_p.I313V|DYSF_ENST00000409582.3_Missense_Mutation_p.I313V|DYSF_ENST00000410041.1_Missense_Mutation_p.I314V|DYSF_ENST00000394120.2_Missense_Mutation_p.I283V|DYSF_ENST00000409651.1_Missense_Mutation_p.I314V|DYSF_ENST00000409744.1_Missense_Mutation_p.I283V|DYSF_ENST00000409366.1_Missense_Mutation_p.I283V|DYSF_ENST00000413539.2_Missense_Mutation_p.I313V|DYSF_ENST00000410020.3_Missense_Mutation_p.I314V|DYSF_ENST00000429174.2_Missense_Mutation_p.I282V	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	282	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.I282V(1)|p.I314V(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TGATGAGCCCATCTTTATCAC	0.483																																							uc002sie.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(844-846)ATC>GTC		dysferlin isoform 8							226.0	182.0	197.0					2																	71743361		2203	4300	6503	SO:0001583	missense	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71743361A>G	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.844A>G	2.37:g.71743361A>G	ENSP00000258104:p.Ile282Val					DYSF_uc010feg.2_Missense_Mutation_p.I313V|DYSF_uc010feh.2_Missense_Mutation_p.I282V|DYSF_uc002sig.3_Missense_Mutation_p.I282V|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.I282V|DYSF_uc010fef.2_Missense_Mutation_p.I313V|DYSF_uc010fei.2_Missense_Mutation_p.I313V|DYSF_uc010fek.2_Missense_Mutation_p.I314V|DYSF_uc010fej.2_Missense_Mutation_p.I283V|DYSF_uc010fel.2_Missense_Mutation_p.I283V|DYSF_uc010feo.2_Missense_Mutation_p.I314V|DYSF_uc010fem.2_Missense_Mutation_p.I283V|DYSF_uc010fen.2_Missense_Mutation_p.I314V|DYSF_uc002sif.2_Missense_Mutation_p.I283V	p.I282V	NM_003494	NP_003485	O75923	DYSF_HUMAN			8	1220	+			282			Cytoplasmic (Potential).|C2 2.		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	c.844A>G	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	A	10.85	1.468202	0.26335	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	4.46	0.662	0.17880	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.133198	0.48286	N	0.000181	T	0.79387	0.4437	M	0.64567	1.98	0.36919	D	0.891275	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.11235	0.001;0.001;0.001;0.001;0.001;0.001;0.001;0.001;0.001;0.004;0.001;0.001;0.001;0.001	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.20184	0.006;0.011;0.011;0.011;0.009;0.011;0.017;0.028;0.011;0.009;0.017;0.011;0.011;0.019	T	0.68228	-0.5464	10	0.27082	T	0.32	-18.0252	7.5652	0.27874	0.6269:0.0:0.3731:0.0	.	314;314;283;283;314;283;313;282;313;313;282;282;283;282	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	V	313;313;313;282;282;314;283;283;283;314;314	ENSP00000407046:I313V;ENSP00000387137:I313V;ENSP00000386547:I313V;ENSP00000398305:I282V;ENSP00000258104:I282V;ENSP00000386683:I314V;ENSP00000377678:I283V;ENSP00000386285:I283V;ENSP00000386512:I283V;ENSP00000386881:I314V;ENSP00000386617:I314V	ENSP00000258104:I282V	I	+	1	0	DYSF	71596869	1.000000	0.71417	0.999000	0.59377	0.786000	0.44442	2.735000	0.47377	-0.055000	0.13244	-0.432000	0.05891	ATC		0.483	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		9	43	0	0	0	0.008291	0	9	43				
CYP26B1	56603	broad.mit.edu	37	2	72359733	72359733	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:72359733T>C	ENST00000001146.2	-	6	1365	c.1162A>G	c.(1162-1164)Aaa>Gaa	p.K388E	CYP26B1_ENST00000546307.1_Missense_Mutation_p.K313E|CYP26B1_ENST00000412253.1_Missense_Mutation_p.K197E	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	388					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)	p.K388E(1)		breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						CTCCAGCCTTTGGGGATCTGG	0.632																																							uc002sih.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(1162-1164)AAA>GAA		cytochrome P450, family 26, subfamily b,							17.0	17.0	17.0					2																	72359733		2202	4300	6502	SO:0001583	missense	56603				cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding	g.chr2:72359733T>C		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.1162A>G	2.37:g.72359733T>C	ENSP00000001146:p.Lys388Glu					CYP26B1_uc010yra.1_Missense_Mutation_p.K371E|CYP26B1_uc010yrb.1_Missense_Mutation_p.K313E	p.K388E	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN			6	1162	-			388					B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	ENST00000001146.2	37	c.1162A>G	CCDS1919.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.631147	0.87660	.	.	ENSG00000003137	ENST00000001146;ENST00000412253;ENST00000546307	T;T;T	0.73152	-0.72;-0.72;-0.72	5.11	5.11	0.69529	.	0.094078	0.64402	D	0.000001	T	0.74038	0.3664	L	0.46670	1.46	0.80722	D	1	P;P;P	0.39551	0.629;0.51;0.678	B;P;P	0.50109	0.431;0.629;0.631	T	0.76061	-0.3097	10	0.59425	D	0.04	-8.0E-4	14.1725	0.65519	0.0:0.0:0.0:1.0	.	313;371;388	B7Z2K6;B7Z2P4;Q9NR63	.;.;CP26B_HUMAN	E	388;197;313	ENSP00000001146:K388E;ENSP00000401465:K197E;ENSP00000443304:K313E	ENSP00000001146:K388E	K	-	1	0	CYP26B1	72213241	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.868000	0.87116	2.285000	0.76669	0.528000	0.53228	AAA		0.632	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885		6	7	0	0	0	0.001168	0	6	7				
NAT8	9027	broad.mit.edu	37	2	73868332	73868332	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:73868332G>C	ENST00000272425.3	-	2	573	c.424C>G	c.(424-426)Ctc>Gtc	p.L142V		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)									p.L142V(1)		breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						TCCACAAAGAGATGAAACAGC	0.557																																							uc002sji.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(424-426)CTC>GTC		N-acetyltransferase 8							75.0	77.0	76.0					2																	73868332		2203	4300	6503	SO:0001583	missense	9027				gastrulation with mouth forming second|response to drug	integral to membrane	N-acetyltransferase activity	g.chr2:73868332G>C	AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.424C>G	2.37:g.73868332G>C	ENSP00000272425:p.Leu142Val						p.L142V	NM_003960	NP_003951	Q9UHE5	NAT8_HUMAN			2	591	-			142			N-acetyltransferase.			Missense_Mutation	SNP	ENST00000272425.3	37	c.424C>G	CCDS1926.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.600136	0.46423	.	.	ENSG00000144035	ENST00000272425	T	0.21932	1.98	3.86	1.72	0.24424	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.211787	0.37906	N	0.001883	T	0.32585	0.0834	L	0.41415	1.275	0.30231	N	0.795896	D	0.89917	1.0	D	0.97110	1.0	T	0.10636	-1.0621	10	0.72032	D	0.01	-19.7825	9.6732	0.40026	0.0:0.0:0.6307:0.3693	.	142	Q9UHE5	NAT8_HUMAN	V	142	ENSP00000272425:L142V	ENSP00000272425:L142V	L	-	1	0	NAT8	73721840	0.990000	0.36364	0.007000	0.13788	0.002000	0.02628	2.167000	0.42415	0.874000	0.35823	0.644000	0.83932	CTC		0.557	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327854.1	NM_003960		4	81	0	0	0	0.009096	0	4	81				
REG3G	130120	broad.mit.edu	37	2	79255038	79255038	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:79255038G>T	ENST00000272324.5	+	5	623	c.439G>T	c.(439-441)Ggg>Tgg	p.G147W	REG3G_ENST00000393897.2_Missense_Mutation_p.G147W|REG3G_ENST00000409471.1_Missense_Mutation_p.G101W	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	147	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.G147W(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGGCCACTGTGGGAGCCTGTC	0.488																																							uc002snw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(439-441)GGG>TGG		regenerating islet-derived 3 gamma precursor							106.0	109.0	108.0					2																	79255038		2203	4300	6503	SO:0001583	missense	130120				acute-phase response	extracellular region	sugar binding	g.chr2:79255038G>T	AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.439G>T	2.37:g.79255038G>T	ENSP00000272324:p.Gly147Trp					REG3G_uc002snx.2_Missense_Mutation_p.G147W|REG3G_uc010ffu.2_Missense_Mutation_p.G101W	p.G147W	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN			5	524	+			147			C-type lectin.		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	ENST00000272324.5	37	c.439G>T	CCDS1962.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865191	0.71949	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.20332	2.08;2.08;2.2	4.73	3.85	0.44370	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.266319	0.27056	N	0.021150	T	0.43500	0.1250	M	0.76433	2.335	0.31380	N	0.679116	D;D	0.89917	0.999;1.0	D;D	0.87578	0.993;0.998	T	0.51466	-0.8702	10	0.51188	T	0.08	.	10.6111	0.45423	0.0:0.0:0.809:0.191	.	101;147	Q3SYE6;Q6UW15	.;REG3G_HUMAN	W	147;147;101	ENSP00000377475:G147W;ENSP00000272324:G147W;ENSP00000387105:G101W	ENSP00000272324:G147W	G	+	1	0	REG3G	79108546	1.000000	0.71417	0.726000	0.30738	0.744000	0.42396	1.735000	0.38176	1.344000	0.45657	0.650000	0.86243	GGG		0.488	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328247.1	NM_198448		12	115	1	0	1.08611e-07	0.010729	1.4217e-07	12	115				
LRRTM1	347730	broad.mit.edu	37	2	80530357	80530357	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:80530357C>A	ENST00000295057.3	-	2	1244	c.588G>T	c.(586-588)caG>caT	p.Q196H	CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000466387.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.Q196H	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	196					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.Q196H(2)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GACTCTTGAGCTGATTGTATC	0.572										HNSCC(69;0.2)																													uc002sok.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(586-588)CAG>CAT		leucine rich repeat transmembrane neuronal 1							67.0	70.0	69.0					2																	80530357		2203	4300	6503	SO:0001583	missense	347730					axon|endoplasmic reticulum membrane|growth cone|integral to membrane		g.chr2:80530357C>A	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.588G>T	2.37:g.80530357C>A	ENSP00000295057:p.Gln196His	HNSCC(69;0.2)				CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	p.Q196H	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN			2	858	-			196			LRR 5.|Lumenal (Potential).		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	c.588G>T	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.711626	0.48517	.	.	ENSG00000162951	ENST00000295057;ENST00000409148;ENST00000416268	T;T;T	0.80214	-1.35;-1.35;4.25	4.93	3.1	0.35709	.	0.000000	0.85682	U	0.000000	T	0.81870	0.4914	L	0.32530	0.975	0.58432	D	0.999999	D	0.71674	0.998	D	0.71656	0.974	T	0.79317	-0.1853	9	.	.	.	.	11.4548	0.50176	0.0:0.849:0.0:0.151	.	196	Q86UE6	LRRT1_HUMAN	H	196	ENSP00000295057:Q196H;ENSP00000386646:Q196H;ENSP00000415368:Q196H	.	Q	-	3	2	LRRTM1	80383868	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.065000	0.49994	1.033000	0.39918	-0.140000	0.14226	CAG		0.572	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		7	102	1	0	2.0095e-06	0.001984	2.50828e-06	7	102				
RNF103	7844	broad.mit.edu	37	2	86832183	86832183	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:86832183C>T	ENST00000237455.4	-	4	1809	c.841G>A	c.(841-843)Ggc>Agc	p.G281S	AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000439077.1_RNA|RNF103_ENST00000477307.1_5'UTR|AC015971.2_ENST00000597638.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron|CHMP3_ENST00000439940.2_Intron	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	281					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G281S(1)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						TTATATATGCCAATATCTGTC	0.348																																							uc002srn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(841-843)GGC>AGC		ring finger protein 103							46.0	49.0	48.0					2																	86832183		2203	4300	6503	SO:0001583	missense	7844				central nervous system development|ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr2:86832183C>T	D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.841G>A	2.37:g.86832183C>T	ENSP00000237455:p.Gly281Ser					VPS24_uc010ytl.1_Intron|RNF103_uc002srm.2_Missense_Mutation_p.G142S|uc002sro.2_Intron	p.G281S	NM_005667	NP_005658	O00237	RN103_HUMAN			4	1810	-			281					A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Missense_Mutation	SNP	ENST00000237455.4	37	c.841G>A	CCDS33237.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480394	0.63849	.	.	ENSG00000239305	ENST00000237455	T	0.47528	0.84	5.31	5.31	0.75309	.	0.049140	0.85682	D	0.000000	T	0.48786	0.1519	M	0.62723	1.935	0.54753	D	0.999985	P	0.46987	0.888	B	0.38985	0.287	T	0.58561	-0.7615	10	0.72032	D	0.01	-16.4191	18.9667	0.92700	0.0:1.0:0.0:0.0	.	281	O00237	RN103_HUMAN	S	281	ENSP00000237455:G281S	ENSP00000237455:G281S	G	-	1	0	RNF103	86685694	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.790000	0.69038	2.503000	0.84419	0.460000	0.39030	GGC		0.348	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330041.2	NM_005667		13	23	0	0	0	0.001855	0	13	23				
ZNF514	84874	broad.mit.edu	37	2	95815661	95815661	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:95815661C>A	ENST00000295208.2	-	5	1031	c.569G>T	c.(568-570)gGg>gTg	p.G190V	MRPS5_ENST00000475040.1_5'Flank|ZNF514_ENST00000411425.1_Missense_Mutation_p.G190V	NM_032788.1	NP_116177.1	Q96K75	ZN514_HUMAN	zinc finger protein 514	190					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G190V(1)		large_intestine(4)|lung(6)|urinary_tract(1)	11						GTTGTTTCCCCCTAAAGTCTG	0.428																																							uc002sue.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(568-570)GGG>GTG		zinc finger protein 514							127.0	134.0	132.0					2																	95815661		2203	4300	6503	SO:0001583	missense	84874				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:95815661C>A	AL832263	CCDS2011.1	2q11.2	2013-01-08			ENSG00000144026	ENSG00000144026		"""Zinc fingers, C2H2-type"", ""-"""	25894	protein-coding gene	gene with protein product							Standard	NM_032788		Approved	FLJ14457	uc002sue.1	Q96K75	OTTHUMG00000130391	ENST00000295208.2:c.569G>T	2.37:g.95815661C>A	ENSP00000295208:p.Gly190Val					ZNF514_uc002sud.1_Missense_Mutation_p.G263V	p.G190V	NM_032788	NP_116177	Q96K75	ZN514_HUMAN			5	943	-			190					Q5JPJ3	Missense_Mutation	SNP	ENST00000295208.2	37	c.569G>T	CCDS2011.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.026961	0.00410	.	.	ENSG00000144026	ENST00000295208;ENST00000411425	T;T	0.05081	3.5;3.5	3.18	1.33	0.21861	.	.	.	.	.	T	0.06826	0.0174	L	0.58810	1.83	0.09310	N	1	B;P	0.41475	0.034;0.751	B;B	0.33960	0.017;0.173	T	0.27673	-1.0067	9	0.33940	T	0.23	.	10.1225	0.42630	0.0:0.7977:0.0:0.2023	.	190;9	Q96K75;Q658L7	ZN514_HUMAN;.	V	190	ENSP00000295208:G190V;ENSP00000405509:G190V	ENSP00000295208:G190V	G	-	2	0	ZNF514	95179388	0.000000	0.05858	0.061000	0.19648	0.002000	0.02628	-2.928000	0.00690	0.052000	0.16007	-1.814000	0.00607	GGG		0.428	ZNF514-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252769.1	NM_032788		29	194	1	0	5.77227e-19	0.008361	9.25417e-19	29	194				
ADRA2B	151	broad.mit.edu	37	2	96781457	96781457	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:96781457C>A	ENST00000409345.3	-	1	527	c.432G>T	c.(430-432)tcG>tcT	p.S144S		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	144					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)	p.S144S(4)		endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GGGGCGGCAGCGAGATGACGG	0.682																																							uc002svi.2		NA																	4	Substitution - coding silent(4)		lung(2)|endometrium(2)	ovary(2)|lung(1)	3						c.(430-432)TCG>TCT		alpha-2B-adrenergic receptor	Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)						27.0	34.0	32.0					2																	96781457		2185	4285	6470	SO:0001819	synonymous_variant	151				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation	integral to plasma membrane	alpha2-adrenergic receptor activity|epinephrine binding|protein binding	g.chr2:96781457C>A	M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.432G>T	2.37:g.96781457C>A							p.S144S	NM_000682	NP_000673	P18089	ADA2B_HUMAN			1	432	-			144			Helical; Name=4; (By similarity).		Q4TUH9|Q53RF2|Q9BZK0	Silent	SNP	ENST00000409345.3	37	c.432G>T	CCDS56129.1																																																																																				0.682	ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334990.1			16	29	1	0	0.000422831	0.004007	0.000472895	16	29				
ASTL	431705	broad.mit.edu	37	2	96798292	96798292	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:96798292G>T	ENST00000342380.2	-	6	623	c.624C>A	c.(622-624)aaC>aaA	p.N208K		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)									p.N208K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						GCAGGATCTCGTTCCAGTTGA	0.662																																							uc010yui.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(622-624)AAC>AAA		astacin-like metalloendopeptidase precursor							58.0	51.0	53.0					2																	96798292		2203	4300	6503	SO:0001583	missense	431705				proteolysis		metalloendopeptidase activity|zinc ion binding	g.chr2:96798292G>T	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.624C>A	2.37:g.96798292G>T	ENSP00000343674:p.Asn208Lys						p.N208K	NM_001002036	NP_001002036	Q6HA08	ASTL_HUMAN			6	624	-			208						Missense_Mutation	SNP	ENST00000342380.2	37	c.624C>A	CCDS33249.1	.	.	.	.	.	.	.	.	.	.	G	9.967	1.224422	0.22457	.	.	ENSG00000188886	ENST00000342380	T	0.62498	0.02	4.41	-8.4	0.00965	Peptidase, metallopeptidase (1);Peptidase M12A, astacin (2);Metallopeptidase, catalytic domain (1);	0.272286	0.25405	N	0.030908	T	0.30417	0.0764	N	0.05330	-0.07	0.23704	N	0.997063	B	0.22146	0.065	B	0.22753	0.041	T	0.12142	-1.0559	10	0.34782	T	0.22	-4.4467	9.0474	0.36356	0.6996:0.0:0.187:0.1134	.	208	Q6HA08	ASTL_HUMAN	K	208	ENSP00000343674:N208K	ENSP00000343674:N208K	N	-	3	2	ASTL	96162019	0.000000	0.05858	0.768000	0.31515	0.561000	0.35649	-4.350000	0.00248	-1.204000	0.02648	-1.050000	0.02344	AAC		0.662	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1			24	45	1	0	9.95505e-16	0.002299	1.53611e-15	24	45				
ZAP70	7535	broad.mit.edu	37	2	98354099	98354099	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:98354099G>T	ENST00000264972.5	+	11	1668	c.1453G>T	c.(1453-1455)Gca>Tca	p.A485S	ZAP70_ENST00000442208.1_Missense_Mutation_p.A359S|ZAP70_ENST00000451498.2_Missense_Mutation_p.A178S|ZAP70_ENST00000463643.1_3'UTR	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	485	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.A485S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CCTCTCCAAAGCACTGGGTGC	0.612																																							uc002syd.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						c.(1453-1455)GCA>TCA		zeta-chain associated protein kinase 70kDa							60.0	54.0	56.0					2																	98354099		2203	4300	6503	SO:0001583	missense	7535				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr2:98354099G>T	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.1453G>T	2.37:g.98354099G>T	ENSP00000264972:p.Ala485Ser					ZAP70_uc002sye.1_Missense_Mutation_p.A375S|ZAP70_uc002syf.1_Missense_Mutation_p.A178S	p.A485S	NM_001079	NP_001070	P43403	ZAP70_HUMAN			11	1660	+			485			Protein kinase.		A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	37	c.1453G>T	CCDS33254.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.367361	0.82463	.	.	ENSG00000115085	ENST00000264972;ENST00000442208;ENST00000451498	D;D;D	0.82433	-1.61;-1.61;-1.61	5.2	5.2	0.72013	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.49916	D	0.000130	D	0.84696	0.5529	N	0.16233	0.39	0.80722	D	1	D;D	0.63046	0.99;0.992	D;D	0.83275	0.993;0.996	D	0.86854	0.2025	10	0.62326	D	0.03	.	16.6148	0.84904	0.0:0.0:1.0:0.0	.	359;485	P43403-3;P43403	.;ZAP70_HUMAN	S	485;359;178	ENSP00000264972:A485S;ENSP00000411141:A359S;ENSP00000400475:A178S	ENSP00000264972:A485S	A	+	1	0	ZAP70	97720531	1.000000	0.71417	0.997000	0.53966	0.449000	0.32228	9.860000	0.99555	2.610000	0.88304	0.655000	0.94253	GCA		0.612	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1			5	43	1	0	0.00116845	0.001168	0.00128016	5	43				
REV1	51455	broad.mit.edu	37	2	100038094	100038094	+	Silent	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:100038094A>G	ENST00000258428.3	-	11	1926	c.1698T>C	c.(1696-1698)gcT>gcC	p.A566A	REV1_ENST00000465835.1_5'UTR|REV1_ENST00000393445.3_Silent_p.A565A	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	566	UmuC. {ECO:0000255|PROSITE- ProRule:PRU00216}.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)	p.A566A(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CACAACTGACAGCTTCAATGT	0.428								Direct reversal of damage																															uc002tad.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1696-1698)GCT>GCC	DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage	REV1-like isoform 1							134.0	115.0	122.0					2																	100038094		2203	4300	6503	SO:0001819	synonymous_variant	51455				DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding	g.chr2:100038094A>G	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.1698T>C	2.37:g.100038094A>G						REV1_uc002tac.2_Silent_p.A565A	p.A566A	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN			11	1910	-			566			UmuC.		O95941|Q53SI7|Q9C0J4|Q9NUP2	Silent	SNP	ENST00000258428.3	37	c.1698T>C	CCDS2045.1																																																																																				0.428	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316		6	75	0	0	0	0.00308	0	6	75				
IL18RAP	8807	broad.mit.edu	37	2	103068613	103068613	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:103068613G>A	ENST00000264260.2	+	12	2361	c.1772G>A	c.(1771-1773)gGg>gAg	p.G591E	IL18RAP_ENST00000409369.1_Missense_Mutation_p.G449E	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	591					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G591E(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						GAAACCACTGGGAGGAGCTCC	0.512																																							uc002tbx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(1771-1773)GGG>GAG		interleukin 18 receptor accessory protein							76.0	86.0	83.0					2																	103068613		2203	4300	6503	SO:0001583	missense	8807				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity	g.chr2:103068613G>A	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.1772G>A	2.37:g.103068613G>A	ENSP00000264260:p.Gly591Glu					IL18RAP_uc010fiz.2_Missense_Mutation_p.G449E	p.G591E	NM_003853	NP_003844	O95256	I18RA_HUMAN			12	2256	+			591			Cytoplasmic (Potential).		B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	c.1772G>A	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.939691	0.34189	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.02345	4.41;4.33	5.92	3.15	0.36227	.	1.894900	0.02482	N	0.088608	T	0.03434	0.0099	N	0.19112	0.55	0.18873	N	0.999989	B	0.25390	0.125	B	0.26517	0.07	T	0.40869	-0.9540	10	0.54805	T	0.06	.	8.4652	0.32951	0.3035:0.0:0.6965:0.0	.	591	O95256	I18RA_HUMAN	E	591;449	ENSP00000264260:G591E;ENSP00000387201:G449E	ENSP00000264260:G591E	G	+	2	0	IL18RAP	102435045	0.111000	0.22076	0.711000	0.30485	0.920000	0.55202	0.440000	0.21592	0.838000	0.34948	0.650000	0.86243	GGG		0.512	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853		23	141	0	0	0	0.00278	0	23	141				
SLC9A2	6549	broad.mit.edu	37	2	103300683	103300683	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:103300683G>T	ENST00000233969.2	+	5	1455	c.1313G>T	c.(1312-1314)cGa>cTa	p.R438L		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	438					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.R438L(1)		breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						GGAGGACTTCGAGGTGCCATC	0.438																																							uc002tca.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|skin(3)|breast(2)	8						c.(1312-1314)CGA>CTA		solute carrier family 9 (sodium/hydrogen							249.0	227.0	234.0					2																	103300683		2203	4300	6503	SO:0001583	missense	6549					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity	g.chr2:103300683G>T		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1313G>T	2.37:g.103300683G>T	ENSP00000233969:p.Arg438Leu						p.R438L	NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN			5	1455	+			438					B2RMS2	Missense_Mutation	SNP	ENST00000233969.2	37	c.1313G>T	CCDS2062.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504295	0.85176	.	.	ENSG00000115616	ENST00000233969	T	0.23147	1.92	5.82	5.82	0.92795	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.69052	0.3068	H	0.97491	4.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80360	-0.1415	10	0.87932	D	0	.	20.088	0.97803	0.0:0.0:1.0:0.0	.	438	Q9UBY0	SL9A2_HUMAN	L	438	ENSP00000233969:R438L	ENSP00000233969:R438L	R	+	2	0	SLC9A2	102667115	1.000000	0.71417	0.215000	0.23724	0.457000	0.32468	9.397000	0.97276	2.739000	0.93911	0.655000	0.94253	CGA		0.438	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2			26	169	1	0	4.22769e-11	0.00632	6.08057e-11	26	169				
SLC5A7	60482	broad.mit.edu	37	2	108626708	108626708	+	Silent	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:108626708T>A	ENST00000264047.2	+	9	1410	c.1134T>A	c.(1132-1134)gtT>gtA	p.V378V	SLC5A7_ENST00000540517.1_Silent_p.V273V|SLC5A7_ENST00000409059.1_Silent_p.V378V	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	378					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)	p.V378V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	AAGAAATCGTTTGGGTTATGC	0.448																																							uc002tdv.2		NA																	1	Substitution - coding silent(1)	p.V378I(1)	lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1132-1134)GTT>GTA		solute carrier family 5 (choline transporter),	Choline(DB00122)						150.0	122.0	131.0					2																	108626708		2203	4300	6503	SO:0001819	synonymous_variant	60482				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity	g.chr2:108626708T>A	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.1134T>A	2.37:g.108626708T>A						SLC5A7_uc010ywm.1_Silent_p.V131V|SLC5A7_uc010fjj.2_Silent_p.V378V|SLC5A7_uc010ywn.1_Silent_p.V265V	p.V378V	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN			9	1410	+			378			Helical; (Potential).		Q53TF2	Silent	SNP	ENST00000264047.2	37	c.1134T>A	CCDS2074.1																																																																																				0.448	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1			9	54	0	0	0	0.006214	0	9	54				
MARCO	8685	broad.mit.edu	37	2	119750829	119750829	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:119750829G>T	ENST00000327097.4	+	16	1517	c.1382G>T	c.(1381-1383)cGc>cTc	p.R461L	MARCO_ENST00000541757.1_Missense_Mutation_p.R383L	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	461	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.R461L(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GTCTTCTGCCGCATGCTGGGT	0.547																																					GBM(8;18 374 7467 11269 32796)	GBM(8;18 374 7467 11269 32796)	uc002tln.1		NA																	2	Substitution - Missense(2)		lung(1)|prostate(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1381-1383)CGC>CTC		macrophage receptor with collagenous structure							150.0	146.0	147.0					2																	119750829		2203	4300	6503	SO:0001583	missense	8685				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity	g.chr2:119750829G>T	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.1382G>T	2.37:g.119750829G>T	ENSP00000318916:p.Arg461Leu					MARCO_uc010yyf.1_Missense_Mutation_p.R383L	p.R461L	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN			16	1514	+			461			SRCR.|Extracellular (Potential).		B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	c.1382G>T	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760165	0.69763	.	.	ENSG00000019169	ENST00000327097;ENST00000541757	T;T	0.42900	0.96;0.96	6.07	6.07	0.98685	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.073689	0.49916	D	0.000127	T	0.76849	0.4045	H	0.97540	4.025	0.58432	D	0.999995	D	0.71674	0.998	D	0.71414	0.973	D	0.84405	0.0562	9	.	.	.	.	16.144	0.81551	0.0:0.0:1.0:0.0	.	461	Q9UEW3	MARCO_HUMAN	L	461;383	ENSP00000318916:R461L;ENSP00000441769:R383L	.	R	+	2	0	MARCO	119467299	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	3.312000	0.51927	2.884000	0.98904	0.655000	0.94253	CGC		0.547	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770		32	165	1	0	2.80507e-11	0.012213	4.04277e-11	32	165				
CNTNAP5	129684	broad.mit.edu	37	2	125367443	125367443	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:125367443G>C	ENST00000431078.1	+	12	2183	c.1819G>C	c.(1819-1821)Gac>Cac	p.D607H		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	607	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.D607H(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CTTCTACATCGACTCAGATGG	0.532																																							uc002tno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)	10						c.(1819-1821)GAC>CAC		contactin associated protein-like 5 precursor							75.0	74.0	74.0					2																	125367443		1876	4105	5981	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125367443G>C	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1819G>C	2.37:g.125367443G>C	ENSP00000399013:p.Asp607His					CNTNAP5_uc010flu.2_Missense_Mutation_p.D608H	p.D607H	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	12	2183	+			607			Extracellular (Potential).|Fibrinogen C-terminal.		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.1819G>C	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283369	0.80803	.	.	ENSG00000155052	ENST00000431078	T	0.20463	2.07	5.66	5.66	0.87406	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (2);	0.000000	0.52532	D	0.000078	T	0.60676	0.2287	M	0.94142	3.5	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71269	-0.4643	10	0.87932	D	0	.	18.6671	0.91495	0.0:0.0:1.0:0.0	.	607	Q8WYK1	CNTP5_HUMAN	H	607	ENSP00000399013:D607H	ENSP00000399013:D607H	D	+	1	0	CNTNAP5	125083913	1.000000	0.71417	0.374000	0.26016	0.621000	0.37620	8.884000	0.92432	2.826000	0.97356	0.655000	0.94253	GAC		0.532	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			11	59	0	0	0	0.008291	0	11	59				
CNTNAP5	129684	broad.mit.edu	37	2	125671823	125671823	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:125671823G>T	ENST00000431078.1	+	24	4243	c.3879G>T	c.(3877-3879)ttG>ttT	p.L1293F		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1293					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.L1293F(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AAATTGACTTGCAAAACACAG	0.428																																							uc002tno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)	10						c.(3877-3879)TTG>TTT		contactin associated protein-like 5 precursor							109.0	110.0	110.0					2																	125671823		1887	4119	6006	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125671823G>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3879G>T	2.37:g.125671823G>T	ENSP00000399013:p.Leu1293Phe					CNTNAP5_uc010flu.2_Missense_Mutation_p.L1294F	p.L1293F	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	24	4243	+			1293			Cytoplasmic (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.3879G>T	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711069	0.30322	.	.	ENSG00000155052	ENST00000431078	D	0.87887	-2.31	6.14	3.42	0.39159	.	0.000000	0.40640	N	0.001060	D	0.82879	0.5133	M	0.62723	1.935	0.50313	D	0.999865	P	0.48503	0.911	B	0.42916	0.402	T	0.78117	-0.2329	10	0.09084	T	0.74	.	10.825	0.46627	0.2018:0.0:0.7982:0.0	.	1293	Q8WYK1	CNTP5_HUMAN	F	1293	ENSP00000399013:L1293F	ENSP00000399013:L1293F	L	+	3	2	CNTNAP5	125388293	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.073000	0.41519	0.492000	0.27815	-0.154000	0.13518	TTG		0.428	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			7	45	1	0	8.12818e-05	0.001984	9.37558e-05	7	45				
MYO7B	4648	broad.mit.edu	37	2	128324254	128324254	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:128324254T>A	ENST00000409816.2	+	4	354	c.322T>A	c.(322-324)Ttc>Atc	p.F108I	MYO7B_ENST00000428314.1_Missense_Mutation_p.F108I|MYO7B_ENST00000389524.4_Missense_Mutation_p.F108I			Q6PIF6	MYO7B_HUMAN	myosin VIIB	108	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.F108I(2)		breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CGTCAACCCGTTCCAGGTGCT	0.627																																							uc002top.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(322-324)TTC>ATC		myosin VIIB							28.0	34.0	32.0					2																	128324254		2008	4165	6173	SO:0001583	missense	4648					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr2:128324254T>A		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.322T>A	2.37:g.128324254T>A	ENSP00000386461:p.Phe108Ile						p.F108I	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0753)	5	375	+	Colorectal(110;0.1)		108			Myosin head-like.		Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	c.322T>A	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.549427	0.86127	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.89270	-2.49;-2.49;-2.49	5.55	5.55	0.83447	Myosin head, motor domain (3);	0.072825	0.56097	D	0.000022	D	0.94463	0.8218	M	0.94021	3.485	0.49687	D	0.999814	D	0.55172	0.97	P	0.53401	0.725	D	0.95717	0.8763	10	0.87932	D	0	.	15.7022	0.77549	0.0:0.0:0.0:1.0	.	108	Q6PIF6	MYO7B_HUMAN	I	108	ENSP00000374175:F108I;ENSP00000415090:F108I;ENSP00000386461:F108I	ENSP00000374175:F108I	F	+	1	0	MYO7B	128040724	1.000000	0.71417	0.938000	0.37757	0.901000	0.52897	7.945000	0.87732	2.098000	0.63641	0.459000	0.35465	TTC		0.627	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		3	9	0	0	0	0.004672	0	3	9				
AMER3	205147	broad.mit.edu	37	2	131520185	131520185	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:131520185G>T	ENST00000423981.1	+	2	650	c.540G>T	c.(538-540)gaG>gaT	p.E180D	AMER3_ENST00000321420.4_Missense_Mutation_p.E180D	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	180					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										TGGCGGCCGAGGGGAAAAGCC	0.647																																							uc002trw.2		NA																	0				pancreas(2)|ovary(1)	3						c.(538-540)GAG>GAT		hypothetical protein LOC205147							41.0	47.0	45.0					2																	131520185		2203	4294	6497	SO:0001583	missense	205147							g.chr2:131520185G>T	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.540G>T	2.37:g.131520185G>T	ENSP00000392700:p.Glu180Asp					FAM123C_uc010fmv.2_Missense_Mutation_p.E180D|FAM123C_uc010fms.1_Missense_Mutation_p.E180D|FAM123C_uc010fmt.1_Missense_Mutation_p.E180D|FAM123C_uc010fmu.1_Missense_Mutation_p.E180D	p.E180D	NM_152698	NP_689911	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	730	+	Colorectal(110;0.1)		180					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.540G>T	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	G	5.466	0.270999	0.10349	.	.	ENSG00000178171	ENST00000321420;ENST00000458606;ENST00000423981	T;T	0.44482	0.92;0.92	5.21	-1.17	0.09648	.	0.508491	0.21181	N	0.078808	T	0.18383	0.0441	N	0.14661	0.345	0.09310	N	1	B	0.22983	0.078	B	0.25614	0.062	T	0.07868	-1.0750	10	0.39692	T	0.17	.	0.7847	0.01046	0.2852:0.1215:0.3457:0.2476	.	180	Q8N944	F123C_HUMAN	D	180	ENSP00000314914:E180D;ENSP00000392700:E180D	ENSP00000314914:E180D	E	+	3	2	FAM123C	131236655	0.973000	0.33851	0.006000	0.13384	0.014000	0.08584	0.688000	0.25422	-0.192000	0.10432	-0.254000	0.11334	GAG		0.647	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		4	68	1	0	2.56e-06	0.009096	3.17277e-06	4	68				
LCT	3938	broad.mit.edu	37	2	136570111	136570111	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:136570111C>A	ENST00000264162.2	-	7	2133	c.2123G>T	c.(2122-2124)gGc>gTc	p.G708V	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	708	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.G708V(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TTGGGAGAAGCCTCCAATGGT	0.542																																							uc002tuu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(2122-2124)GGC>GTC		lactase-phlorizin hydrolase preproprotein							104.0	99.0	101.0					2																	136570111		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136570111C>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2123G>T	2.37:g.136570111C>A	ENSP00000264162:p.Gly708Val						p.G708V	NM_002299	NP_002290	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	7	2134	-			708			Extracellular (Potential).|4 X approximate repeats.|2.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.2123G>T	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	19.06	3.752936	0.69648	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.55413	0.52	5.66	5.66	0.87406	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.182212	0.49305	D	0.000155	T	0.67040	0.2851	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.69045	-0.5249	10	0.72032	D	0.01	-27.8864	9.9192	0.41453	0.0:0.8446:0.0:0.1554	.	708	P09848	LPH_HUMAN	V	708;140	ENSP00000264162:G708V	ENSP00000264162:G708V	G	-	2	0	LCT	136286581	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	4.967000	0.63722	2.666000	0.90696	0.655000	0.94253	GGC		0.542	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		10	70	1	0	1.76689e-08	0.006214	2.38889e-08	10	70				
THSD7B	80731	broad.mit.edu	37	2	137872775	137872775	+	Silent	SNP	G	G	A	rs563732139		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:137872775G>A	ENST00000409968.1	+	5	1459	c.1281G>A	c.(1279-1281)acG>acA	p.T427T	THSD7B_ENST00000413152.2_Silent_p.T396T|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Silent_p.T427T			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	427	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.T427T(2)|p.T396T(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		GGCATGTGACGGGACCCGTGT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		15307	0.0		0.001	False		,,,				2504	0.0						uc002tva.1		NA																	3	Substitution - coding silent(3)		lung(2)|large_intestine(1)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(1186-1188)ACG>ACA		thrombospondin, type I, domain containing 7B							48.0	53.0	52.0					2																	137872775		1966	4157	6123	SO:0001819	synonymous_variant	80731							g.chr2:137872775G>A			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1281G>A	2.37:g.137872775G>A						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Silent_p.T286T	p.T396T	NM_001080427	NP_001073896				BRCA - Breast invasive adenocarcinoma(221;0.19)	4	1188	+									Silent	SNP	ENST00000409968.1	37	c.1188G>A																																																																																					0.577	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9		5	34	0	0	0	0.000602	0	5	34				
LRP1B	53353	broad.mit.edu	37	2	141607774	141607774	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:141607774G>A	ENST00000389484.3	-	29	5807	c.4836C>T	c.(4834-4836)gaC>gaT	p.D1612D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1612					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.D1612D(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATGCATCGAAGTCTATCACAG	0.368										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(4834-4836)GAC>GAT		low density lipoprotein-related protein 1B							180.0	174.0	176.0					2																	141607774		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141607774G>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4836C>T	2.37:g.141607774G>A		TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Silent_p.D794D	p.D1612D	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	29	5808	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1612			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.4836C>T	CCDS2182.1																																																																																				0.368	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		7	108	0	0	0	0.001984	0	7	108				
LRP1B	53353	broad.mit.edu	37	2	141641558	141641558	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:141641558C>T	ENST00000389484.3	-	25	4968	c.3997G>A	c.(3997-3999)Ggc>Agc	p.G1333S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1333					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.G1333S(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTAGCCAGGCCATGCTCCACA	0.473										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(3997-3999)GGC>AGC		low density lipoprotein-related protein 1B							125.0	118.0	121.0					2																	141641558		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141641558C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3997G>A	2.37:g.141641558C>T	ENSP00000374135:p.Gly1333Ser	TSP Lung(27;0.18)				LRP1B_uc010fnl.1_Missense_Mutation_p.G515S	p.G1333S	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	25	4969	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1333			Extracellular (Potential).|LDL-receptor class B 9.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.3997G>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308621	0.81247	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.95788	-3.09;-3.81	5.54	5.54	0.83059	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.97629	0.9223	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.97521	1.0073	10	0.54805	T	0.06	.	19.8426	0.96695	0.0:1.0:0.0:0.0	.	516;1333	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	S	1333;1271;478	ENSP00000374135:G1333S;ENSP00000413239:G478S	ENSP00000374135:G1333S	G	-	1	0	LRP1B	141358028	1.000000	0.71417	0.999000	0.59377	0.787000	0.44495	7.673000	0.83973	2.751000	0.94390	0.591000	0.81541	GGC		0.473	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		10	69	0	0	0	0.006214	0	10	69				
KYNU	8942	broad.mit.edu	37	2	143799619	143799619	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:143799619G>T	ENST00000264170.4	+	14	1534	c.1276G>T	c.(1276-1278)Gac>Tac	p.D426Y	KYNU_ENST00000409512.1_Missense_Mutation_p.D426Y	NM_003937.2	NP_003928.1			kynureninase									p.D426Y(1)		large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		CCCACAGTGTGACAAGCGGAA	0.348																																							uc002tvl.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(1276-1278)GAC>TAC		kynureninase (L-kynurenine hydrolase) isoform a	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)						130.0	128.0	129.0					2																	143799619		2203	4299	6502	SO:0001583	missense	8942				anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity	g.chr2:143799619G>T	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.1276G>T	2.37:g.143799619G>T	ENSP00000264170:p.Asp426Tyr					KYNU_uc010fnm.2_Missense_Mutation_p.D426Y	p.D426Y	NM_003937	NP_003928	Q16719	KYNU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.072)	14	1406	+			426						Missense_Mutation	SNP	ENST00000264170.4	37	c.1276G>T	CCDS2183.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388663	0.61956	.	.	ENSG00000115919	ENST00000264170;ENST00000409512	T;T	0.55234	0.53;0.53	5.09	5.09	0.68999	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.154975	0.64402	D	0.000020	T	0.81133	0.4759	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.86528	0.1820	10	0.87932	D	0	.	14.1723	0.65517	0.0:0.0:1.0:0.0	.	426	Q16719	KYNU_HUMAN	Y	426	ENSP00000264170:D426Y;ENSP00000386731:D426Y	ENSP00000264170:D426Y	D	+	1	0	KYNU	143516089	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	4.713000	0.61895	2.804000	0.96469	0.650000	0.86243	GAC		0.348	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254772.1	NM_001032998		5	42	1	0	1.6384e-10	0.001984	2.3183e-10	5	42				
RIF1	55183	broad.mit.edu	37	2	152318785	152318785	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:152318785T>G	ENST00000243326.5	+	27	3740	c.3257T>G	c.(3256-3258)cTg>cGg	p.L1086R	RIF1_ENST00000430328.2_Missense_Mutation_p.L1086R|RIF1_ENST00000444746.2_Missense_Mutation_p.L1086R|RIF1_ENST00000453091.2_Missense_Mutation_p.L1086R|RIF1_ENST00000428287.2_Missense_Mutation_p.L1086R			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TATAATAATCTGGATGTTTCC	0.299																																							uc002txm.2		NA																	0				ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15						c.(3256-3258)CTG>CGG		RAP1 interacting factor 1							60.0	61.0	61.0					2																	152318785		2200	4297	6497	SO:0001583	missense	55183				cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding	g.chr2:152318785T>G	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.3257T>G	2.37:g.152318785T>G	ENSP00000243326:p.Leu1086Arg					RIF1_uc002txl.2_Missense_Mutation_p.L1086R|RIF1_uc002txn.2_Missense_Mutation_p.L1086R|RIF1_uc002txo.2_Missense_Mutation_p.L1086R|RIF1_uc002txp.2_5'Flank	p.L1086R	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0429)	28	3387	+			1086					A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	c.3257T>G	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.496534	0.85069	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	5.82	5.82	0.92795	.	0.067995	0.64402	D	0.000013	T	0.70150	0.3191	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.74047	-0.3790	10	0.72032	D	0.01	-5.5749	15.8421	0.78857	0.0:0.0:0.0:1.0	.	1086;1086	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	R	1086	ENSP00000390181:L1086R;ENSP00000414615:L1086R;ENSP00000415691:L1086R;ENSP00000243326:L1086R;ENSP00000416123:L1086R	ENSP00000243326:L1086R	L	+	2	0	RIF1	152027031	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.427000	0.80284	2.221000	0.72209	0.528000	0.53228	CTG		0.299	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			5	40	0	0	0	0.001984	0	5	40				
SCN2A	6326	broad.mit.edu	37	2	166170433	166170433	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:166170433A>G	ENST00000375437.2	+	10	1488	c.1198A>G	c.(1198-1200)Acg>Gcg	p.T400A	SCN2A_ENST00000283256.6_Missense_Mutation_p.T400A|SCN2A_ENST00000357398.3_Missense_Mutation_p.T400A|SCN2A_ENST00000375427.2_Missense_Mutation_p.T400A	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	400					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.T400A(2)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCTGGGAAAACGTACATGAT	0.348																																							uc002udc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|breast(1)|pancreas(1)	8						c.(1198-1200)ACG>GCG		sodium channel, voltage-gated, type II, alpha	Lamotrigine(DB00555)						89.0	89.0	89.0					2																	166170433		2203	4299	6502	SO:0001583	missense	6326				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166170433A>G	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1198A>G	2.37:g.166170433A>G	ENSP00000364586:p.Thr400Ala					SCN2A_uc002udd.2_Missense_Mutation_p.T400A|SCN2A_uc002ude.2_Missense_Mutation_p.T400A	p.T400A	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN			10	1488	+			400			I.		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	c.1198A>G	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	A	18.64	3.667805	0.67814	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9;-4.9	5.77	5.77	0.91146	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.98607	0.9534	M	0.68317	2.08	0.36206	D	0.851057	D;D	0.71674	0.998;0.998	D;D	0.85130	0.995;0.997	D	0.99968	1.1910	10	0.32370	T	0.25	.	16.3948	0.83586	1.0:0.0:0.0:0.0	.	400;400	Q99250-2;Q99250	.;SCN2A_HUMAN	A	400	ENSP00000406454:T400A;ENSP00000364586:T400A;ENSP00000349973:T400A;ENSP00000283256:T400A;ENSP00000364576:T400A	ENSP00000283256:T400A	T	+	1	0	SCN2A	165878679	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.615000	0.61190	2.326000	0.78906	0.533000	0.62120	ACG		0.348	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007		13	40	0	0	0	0.003163	0	13	40				
SCN1A	6323	broad.mit.edu	37	2	166847946	166847946	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:166847946T>C	ENST00000303395.4	-	26	5838	c.5839A>G	c.(5839-5841)Atc>Gtc	p.I1947V	AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.I1947V|SCN1A_ENST00000409050.1_Missense_Mutation_p.I1919V|SCN1A_ENST00000375405.3_Missense_Mutation_p.I1936V			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1947					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.I1947V(1)|p.I1936V(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCACCTTTGATTTTGTTTTTA	0.358																																							uc010zcz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(6)|large_intestine(1)	13						c.(5806-5808)ATC>GTC		sodium channel, voltage-gated, type I, alpha	Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)						71.0	70.0	71.0					2																	166847946		2203	4300	6503	SO:0001583	missense	6323					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166847946T>C	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5839A>G	2.37:g.166847946T>C	ENSP00000303540:p.Ile1947Val						p.I1936V	NM_006920	NP_008851	P35498	SCN1A_HUMAN			26	5824	-			1947					E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	c.5806A>G	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	T	1.899	-0.453488	0.04540	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.95821	-3.82;-3.82;-3.77;-3.75	5.76	2.1	0.27182	.	1.188910	0.05967	N	0.641664	D	0.90642	0.7065	N	0.14661	0.345	0.22081	N	0.999377	B	0.10296	0.003	B	0.12837	0.008	T	0.74957	-0.3487	10	0.17369	T	0.5	.	14.9122	0.70767	0.0:0.0:0.588:0.412	.	1936	P35498-2	.	V	1947;1947;1936;1919	ENSP00000407030:I1947V;ENSP00000303540:I1947V;ENSP00000364554:I1936V;ENSP00000386312:I1919V	ENSP00000303540:I1947V	I	-	1	0	SCN1A	166556192	0.356000	0.24930	1.000000	0.80357	0.987000	0.75469	0.287000	0.18920	0.509000	0.28195	-0.501000	0.04562	ATC		0.358	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920		24	44	0	0	0	0.004656	0	24	44				
SCN1A	6323	broad.mit.edu	37	2	166848161	166848161	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:166848161A>G	ENST00000303395.4	-	26	5623	c.5624T>C	c.(5623-5625)gTt>gCt	p.V1875A	AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.V1875A|SCN1A_ENST00000409050.1_Missense_Mutation_p.V1847A|SCN1A_ENST00000375405.3_Missense_Mutation_p.V1864A			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1875					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.V1875A(1)|p.V1864A(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCTCCTAGAACCCGCTTTGT	0.468																																							uc010zcz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|skin(6)|large_intestine(1)	13						c.(5590-5592)GTT>GCT		sodium channel, voltage-gated, type I, alpha	Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)						83.0	78.0	79.0					2																	166848161		2203	4300	6503	SO:0001583	missense	6323					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166848161A>G	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5624T>C	2.37:g.166848161A>G	ENSP00000303540:p.Val1875Ala						p.V1864A	NM_006920	NP_008851	P35498	SCN1A_HUMAN			26	5609	-			1875					E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	c.5591T>C	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.596736	0.86953	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96651	-4.08;-4.08;-4.04;-4.02	5.6	5.6	0.85130	.	0.000000	0.56097	D	0.000027	D	0.98040	0.9354	M	0.80982	2.52	0.58432	D	0.999999	D	0.76494	0.999	D	0.87578	0.998	D	0.99035	1.0822	10	0.87932	D	0	.	16.0863	0.81056	1.0:0.0:0.0:0.0	.	1864	P35498-2	.	A	1875;1875;1864;1847	ENSP00000407030:V1875A;ENSP00000303540:V1875A;ENSP00000364554:V1864A;ENSP00000386312:V1847A	ENSP00000303540:V1875A	V	-	2	0	SCN1A	166556407	1.000000	0.71417	0.972000	0.41901	0.995000	0.86356	9.284000	0.95882	2.251000	0.74343	0.528000	0.53228	GTT		0.468	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920		5	59	0	0	0	0.000602	0	5	59				
SCN1A	6323	broad.mit.edu	37	2	166894432	166894432	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:166894432T>C	ENST00000303395.4	-	15	2799	c.2800A>G	c.(2800-2802)Atg>Gtg	p.M934V	AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.M934V|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.M906V|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.M923V			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	934			M -> I (in EIEE6; dbSNP:rs121918774). {ECO:0000269|PubMed:14738421}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.M923V(1)|p.M934V(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGTCATTCATGTGCCAGCGT	0.507																																							uc010zcz.1		NA																	2	Substitution - Missense(2)	p.M923I(1)	lung(2)	ovary(6)|skin(6)|large_intestine(1)	13						c.(2767-2769)ATG>GTG		sodium channel, voltage-gated, type I, alpha	Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)						263.0	219.0	234.0					2																	166894432		2203	4300	6503	SO:0001583	missense	6323					voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:166894432T>C	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2800A>G	2.37:g.166894432T>C	ENSP00000303540:p.Met934Val					SCN1A_uc002udo.3_Missense_Mutation_p.M803V|SCN1A_uc010fpk.2_Missense_Mutation_p.M775V	p.M923V	NM_006920	NP_008851	P35498	SCN1A_HUMAN			15	2785	-			934			II.		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	c.2767A>G	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	T	16.37	3.105183	0.56291	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	5.18	5.18	0.71444	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	M	0.83483	2.645	0.58432	D	0.999994	B;D;D	0.67145	0.22;0.963;0.996	B;D;D	0.71414	0.159;0.95;0.973	D	0.99819	1.1046	10	0.87932	D	0	.	15.3188	0.74105	0.0:0.0:0.0:1.0	.	923;906;934	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	V	934;934;923;906	ENSP00000407030:M934V;ENSP00000303540:M934V;ENSP00000364554:M923V;ENSP00000386312:M906V	ENSP00000303540:M934V	M	-	1	0	SCN1A	166602678	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.946000	0.87746	2.088000	0.63022	0.482000	0.46254	ATG		0.507	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920		23	131	0	0	0	0.002299	0	23	131				
XIRP2	129446	broad.mit.edu	37	2	168104362	168104362	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:168104362A>G	ENST00000409195.1	+	9	6549	c.6460A>G	c.(6460-6462)Act>Gct	p.T2154A	XIRP2_ENST00000295237.9_Missense_Mutation_p.T2154A|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.T1932A|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1979	Pro-rich.				actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.T2154A(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TAAAATATTAACTGATACACA	0.413																																							uc002udx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(6460-6462)ACT>GCT		xin actin-binding repeat containing 2 isoform 1							39.0	37.0	38.0					2																	168104362		1843	4083	5926	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168104362A>G	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6460A>G	2.37:g.168104362A>G	ENSP00000386840:p.Thr2154Ala					XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.T1979A|XIRP2_uc010fpq.2_Missense_Mutation_p.T1932A|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'UTR	p.T2154A	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	6478	+			1979					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.6460A>G	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	A	2.203	-0.382522	0.04966	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.21191	2.02;2.02;2.02	5.84	0.641	0.17759	.	0.944047	0.08853	N	0.884199	T	0.09862	0.0242	N	0.20685	0.6	0.09310	N	1	B;B;B	0.11235	0.002;0.004;0.004	B;B;B	0.09377	0.002;0.004;0.004	T	0.40040	-0.9584	10	0.11182	T	0.66	-0.0498	1.799	0.03067	0.542:0.1257:0.2108:0.1214	.	1979;1979;1932	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	A	2154;2154;1932	ENSP00000386840:T2154A;ENSP00000295237:T2154A;ENSP00000387255:T1932A	ENSP00000295237:T2154A	T	+	1	0	XIRP2	167812608	0.003000	0.15002	0.000000	0.03702	0.009000	0.06853	0.397000	0.20883	0.120000	0.18254	-0.297000	0.09499	ACT		0.413	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		5	29	0	0	0	0.000602	0	5	29				
LRP2	4036	broad.mit.edu	37	2	170103295	170103295	+	Missense_Mutation	SNP	C	C	A	rs147058423		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:170103295C>A	ENST00000263816.3	-	21	3395	c.3110G>T	c.(3109-3111)aGa>aTa	p.R1037I	LRP2_ENST00000443831.1_Missense_Mutation_p.R900I	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1037	LDL-receptor class A 8. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R1037I(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGGCACACATCTGCCATTTTT	0.473																																							uc002ues.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29						c.(3109-3111)AGA>ATA		low density lipoprotein-related protein 2	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)						189.0	173.0	178.0					2																	170103295		2203	4300	6503	SO:0001583	missense	4036				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	g.chr2:170103295C>A		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3110G>T	2.37:g.170103295C>A	ENSP00000263816:p.Arg1037Ile					LRP2_uc010zdf.1_Missense_Mutation_p.R900I	p.R1037I	NM_004525	NP_004516	P98164	LRP2_HUMAN		STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	21	3323	-			1037			LDL-receptor class A 8.|Extracellular (Potential).		O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	c.3110G>T	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.051301	0.55218	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.96073	-3.9;-3.9	6.03	2.7	0.31948	.	0.220954	0.48286	D	0.000195	D	0.96549	0.8874	M	0.75447	2.3	0.41159	D	0.986089	D;D	0.57899	0.981;0.978	D;D	0.67725	0.953;0.917	D	0.95026	0.8165	10	0.87932	D	0	.	7.6771	0.28492	0.0:0.5945:0.0:0.4055	.	900;1037	E9PC35;P98164	.;LRP2_HUMAN	I	1037;900	ENSP00000263816:R1037I;ENSP00000409813:R900I	ENSP00000263816:R1037I	R	-	2	0	LRP2	169811541	1.000000	0.71417	0.998000	0.56505	0.270000	0.26580	1.352000	0.34033	0.192000	0.20272	0.655000	0.94253	AGA		0.473	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		45	165	1	0	1.52319e-26	0.00874	2.53349e-26	45	165				
PDK1	5163	broad.mit.edu	37	2	173451116	173451116	+	Splice_Site	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:173451116G>A	ENST00000282077.3	+	9	1238	c.1056G>A	c.(1054-1056)ctG>ctA	p.L352L	PDK1_ENST00000392571.2_Splice_Site_p.L372L|PDK1_ENST00000544863.1_Splice_Site_p.L197L|PDK1_ENST00000543905.1_Splice_Site_p.L276L|PDK1_ENST00000410055.1_Splice_Site_p.L352L			Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase, isozyme 1	352	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cell proliferation (GO:0008283)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)	p.L352L(1)		central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.12)			CAGTGCCTCTGGTATGTTATC	0.453									Autosomal Dominant Polycystic Kidney Disease																														uc002uhr.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|central_nervous_system(1)	4						c.(1054-1056)CTG>CTA		pyruvate dehydrogenase kinase 1 precursor							80.0	68.0	72.0					2																	173451116		2203	4300	6503	SO:0001630	splice_region_variant	5163	Autosomal_Dominant_Polycystic_Kidney_Disease	Familial Cancer Database	ADPKD	glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity	g.chr2:173451116G>A	L42450	CCDS2250.1, CCDS63059.1	2q31.1	2008-05-23	2005-11-16		ENSG00000152256	ENSG00000152256			8809	protein-coding gene	gene with protein product		602524	"""pyruvate dehydrogenase kinase, isoenzyme 1"""			7499431	Standard	NR_103731		Approved		uc002uhs.3	Q15118	OTTHUMG00000132285	ENST00000282077.3:c.1056+1G>A	2.37:g.173451116G>A						PDK1_uc010zdz.1_Silent_p.L197L|PDK1_uc010zea.1_RNA|PDK1_uc002uhq.1_Silent_p.L372L|PDK1_uc002uhs.2_Silent_p.L352L|PDK1_uc010zeb.1_Silent_p.L372L	p.L352L	NM_002610	NP_002601	Q15118	PDK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.12)		9	1156	+			352			Histidine kinase.		B2R6T1|B7Z937|D3DPD8|E9PD65|Q308M4	Silent	SNP	ENST00000282077.3	37	c.1056G>A	CCDS2250.1																																																																																				0.453	PDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255380.3	NM_002610	Silent	4	43	0	0	0	0.009096	0	4	43				
HOXD3	3232	broad.mit.edu	37	2	177033942	177033942	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:177033942T>G	ENST00000468418.3	+	3	2190	c.100T>G	c.(100-102)Tac>Gac	p.Y34D	HOXD3_ENST00000410016.1_Missense_Mutation_p.Y34D|HOXD3_ENST00000249440.3_Missense_Mutation_p.Y34D			P31249	HXD3_HUMAN	homeobox D3	34					anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|embryonic skeletal system morphogenesis (GO:0048704)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y34D(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		AGGCTATGGCTACAGCAAAAC	0.557																																							uc002ukt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(100-102)TAC>GAC		homeobox D3							126.0	122.0	123.0					2																	177033942		2203	4300	6503	SO:0001583	missense	3232				anterior/posterior pattern formation|cartilage development|cell-matrix adhesion|embryonic skeletal system morphogenesis|Notch signaling pathway|positive regulation of gene expression|positive regulation of neuron differentiation|thyroid gland development		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:177033942T>G		CCDS2270.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128652	ENSG00000128652		"""Homeoboxes / ANTP class : HOXL subclass"""	5137	protein-coding gene	gene with protein product		142980	"""homeo box D3"""	HOX4A, HOX4, HOX1D		1973146, 1358459	Standard	NM_006898		Approved		uc002ukt.1	P31249	OTTHUMG00000132517	ENST00000468418.3:c.100T>G	2.37:g.177033942T>G	ENSP00000424734:p.Tyr34Asp						p.Y34D	NM_006898	NP_008829	P31249	HXD3_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)	2	276	+			34					Q99955|Q9BSC5	Missense_Mutation	SNP	ENST00000468418.3	37	c.100T>G	CCDS2270.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.224514	0.79576	.	.	ENSG00000128652	ENST00000432796;ENST00000468418;ENST00000410016;ENST00000249440	D;D;D	0.90732	-2.72;-2.72;-2.72	5.32	5.32	0.75619	.	0.057239	0.64402	D	0.000001	D	0.94324	0.8176	M	0.83012	2.62	0.58432	D	0.999998	D	0.64830	0.994	P	0.56343	0.796	D	0.95055	0.8190	10	0.72032	D	0.01	.	15.5763	0.76392	0.0:0.0:0.0:1.0	.	34	P31249	HXD3_HUMAN	D	34	ENSP00000424734:Y34D;ENSP00000386498:Y34D;ENSP00000249440:Y34D	ENSP00000249440:Y34D	Y	+	1	0	HOXD3	176742188	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.655000	0.83696	2.139000	0.66308	0.533000	0.62120	TAC		0.557	HOXD3-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334246.4			8	98	0	0	0	0.00308	0	8	98				
TTN	7273	broad.mit.edu	37	2	179434299	179434300	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	TA	TA	-	-	TA	TA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:179434299_179434300TA>AT	ENST00000591111.1	-	276	71860_71861	c.71636_71637TA>AT	c.(71635-71637)aTA>aAT	p.I23879N	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I25520N|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I16647N|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I22952N|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I16580N|TTN_ENST00000460472.2_Missense_Mutation_p.I16455N|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23879	Ig-like 120.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.I22952N(1)|p.I16647N(1)|p.I16580N(1)|p.I22950N(1)|p.I16455N(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCTTATATTTATGATTTTCCT	0.416																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(68854-68856)ATA>AAT		titin isoform N2-A																																				SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179434299_179434300TA>AT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.71636_71637delinsAT	2.37:g.179434299_179434300delinsAT	ENSP00000465570:p.Ile23879Asn					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I16647N|TTN_uc010zfi.1_Missense_Mutation_p.I16580N|TTN_uc010zfj.1_Missense_Mutation_p.I16455N	p.I22952N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	69079_69080	-			23879					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	DNP	ENST00000591111.1	37	c.68855_68856TA>AT																																																																																					0.416	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		5	29	0	0	0	0.004672	0	5	29				
TTN	7273	broad.mit.edu	37	2	179530103	179530103	+	Intron	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:179530103C>A	ENST00000591111.1	-	153	34489				TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Splice_Site|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGTAACGTACTTTTCATACG	0.343																																							uc010zfk.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.e10+1		SubName: Full=Titin; Flags: Fragment;							220.0	218.0	219.0					2																	179530103		876	1991	2867	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179530103C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34264+4841G>T	2.37:g.179530103C>A						TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron	p.T161_splice			Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		10	1029	-								A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Splice_Site	SNP	ENST00000591111.1	37	c.481_splice		.	.	.	.	.	.	.	.	.	.	C	11.36	1.615097	0.28712	.	.	ENSG00000155657	ENST00000541862;ENST00000392423;ENST00000425332	.	.	.	5.5	2.53	0.30540	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8625	0.41123	0.2461:0.6861:0.0:0.0678	.	.	.	.	.	-1	.	.	.	-	.	.	TTN	179238348	0.984000	0.35163	0.550000	0.28217	0.032000	0.12392	1.810000	0.38932	0.790000	0.33803	-0.181000	0.13052	.		0.343	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		13	64	1	0	1.5842e-08	0.001855	2.15021e-08	13	64				
TTN	7273	broad.mit.edu	37	2	179567367	179567367	+	Missense_Mutation	SNP	G	G	T	rs377714947		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:179567367G>T	ENST00000591111.1	-	105	29520	c.29296C>A	c.(29296-29298)Cgc>Agc	p.R9766S	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R10083S|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.R8839S|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	13844	Ig-like 79.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R8839S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTGTATGCGCTTTGTAAAC	0.393																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(26515-26517)CGC>AGC		titin isoform N2-A							115.0	109.0	111.0					2																	179567367		1958	4150	6108	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179567367G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29296C>A	2.37:g.179567367G>T	ENSP00000465570:p.Arg9766Ser					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R5500S|TTN_uc010fre.1_5'UTR	p.R8839S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		104	26739	-			9766					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.26515C>A		.	.	.	.	.	.	.	.	.	.	G	14.22	2.470200	0.43839	.	.	ENSG00000155657	ENST00000342992	T	0.66638	-0.22	5.84	5.84	0.93424	Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.61009	0.2313	L	0.47078	1.49	0.80722	D	1	B	0.25235	0.121	B	0.24006	0.05	T	0.60707	-0.7210	9	0.87932	D	0	.	13.0931	0.59176	0.0:0.0:0.7352:0.2648	.	9766	Q8WZ42	TITIN_HUMAN	S	8839	ENSP00000343764:R8839S	ENSP00000343764:R8839S	R	-	1	0	TTN	179275612	1.000000	0.71417	0.991000	0.47740	0.931000	0.56810	5.000000	0.63940	2.764000	0.94973	0.655000	0.94253	CGC		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	54	1	0	2.56e-06	0.009096	3.17277e-06	4	54				
TTN	7273	broad.mit.edu	37	2	179593801	179593801	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:179593801A>G	ENST00000591111.1	-	63	18237	c.18013T>C	c.(18013-18015)Tct>Cct	p.S6005P	TTN_ENST00000589042.1_Missense_Mutation_p.S6322P|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.S5078P|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12796	Ig-like 41.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.S5078P(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGGTTATAGAAATAGGAGGA	0.393																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(15232-15234)TCT>CCT		titin isoform N2-A							55.0	54.0	54.0					2																	179593801		1826	4079	5905	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179593801A>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18013T>C	2.37:g.179593801A>G	ENSP00000465570:p.Ser6005Pro					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.S1739P	p.S5078P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		62	15456	-			6005					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.15232T>C		.	.	.	.	.	.	.	.	.	.	A	9.414	1.081233	0.20309	.	.	ENSG00000155657	ENST00000342992	T	0.69685	-0.42	5.93	5.93	0.95920	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79155	0.4398	M	0.91561	3.22	0.80722	D	1	P	0.35107	0.484	P	0.44623	0.455	T	0.82285	-0.0533	9	0.87932	D	0	.	12.0579	0.53546	0.8711:0.0:0.0:0.1289	.	6005	Q8WZ42	TITIN_HUMAN	P	5078	ENSP00000343764:S5078P	ENSP00000343764:S5078P	S	-	1	0	TTN	179302046	0.941000	0.31946	0.248000	0.24265	0.987000	0.75469	2.821000	0.48065	2.281000	0.76405	0.533000	0.62120	TCT		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		6	17	0	0	0	0.001984	0	6	17				
DNAJC10	54431	broad.mit.edu	37	2	183605029	183605029	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:183605029C>G	ENST00000264065.7	+	12	1406	c.991C>G	c.(991-993)Ctc>Gtc	p.L331V		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	331	Trxb 1.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)	p.L331V(1)		breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTTCTAGTTTCTCAACTCATT	0.249																																					Pancreas(56;860 1183 25669 35822 48585)	Pancreas(56;860 1183 25669 35822 48585)	uc002uow.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|breast(1)|skin(1)	4						c.(991-993)CTC>GTC		DnaJ (Hsp40) homolog, subfamily C, member 10							28.0	30.0	30.0					2																	183605029		2189	4263	6452	SO:0001583	missense	54431				apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding	g.chr2:183605029C>G		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.991C>G	2.37:g.183605029C>G	ENSP00000264065:p.Leu331Val					DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Missense_Mutation_p.L285V|DNAJC10_uc010fro.1_RNA	p.L331V	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)		12	1406	+			331					Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Missense_Mutation	SNP	ENST00000264065.7	37	c.991C>G	CCDS33345.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088058	0.36855	.	.	ENSG00000077232	ENST00000264065;ENST00000392392	T	0.37752	1.18	5.01	5.01	0.66863	Thioredoxin-like fold (1);	0.073354	0.56097	D	0.000027	T	0.41743	0.1172	M	0.67953	2.075	0.80722	D	1	P;P	0.47910	0.902;0.842	B;B	0.44044	0.439;0.272	T	0.31024	-0.9958	10	0.15499	T	0.54	.	18.6682	0.91499	0.0:1.0:0.0:0.0	.	285;331	Q8IXB1-2;Q8IXB1	.;DJC10_HUMAN	V	331;285	ENSP00000264065:L331V	ENSP00000264065:L331V	L	+	1	0	DNAJC10	183313274	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.101000	0.50283	2.472000	0.83506	0.650000	0.86243	CTC		0.249	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2	NM_018981		3	19	0	0	0	0.004672	0	3	19				
FRZB	2487	broad.mit.edu	37	2	183699582	183699582	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:183699582G>T	ENST00000295113.4	-	6	1581	c.972C>A	c.(970-972)cgC>cgA	p.R324R		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	324			R -> G (in hip OA susceptibility; has diminished ability to antagonize Wnt signaling, in vitro; dbSNP:rs7775). {ECO:0000269|PubMed:15210948}.		brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R324R(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			GGATTTAGTTGCGTGCTTGCC	0.428																																							uc002upa.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)|central_nervous_system(1)	4						c.(970-972)CGC>CGA		frizzled-related protein precursor							125.0	121.0	122.0					2																	183699582		2203	4300	6503	SO:0001819	synonymous_variant	2487				brain development|cochlea morphogenesis|gonad development|mammary gland involution|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of hepatocyte differentiation|positive regulation of apoptosis|positive regulation of fat cell differentiation|skeletal system development|vasculature development|Wnt receptor signaling pathway	cytoplasm|extracellular space|membrane	PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr2:183699582G>T	U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.972C>A	2.37:g.183699582G>T							p.R324R	NM_001463	NP_001454	Q92765	SFRP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)		6	1190	-			324					O00181|Q99686	Silent	SNP	ENST00000295113.4	37	c.972C>A	CCDS2286.1																																																																																				0.428	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255808.1	NM_001463		10	24	1	0	2.17888e-05	0.006214	2.59904e-05	10	24				
ANKRD44	91526	broad.mit.edu	37	2	197873684	197873684	+	Nonsense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:197873684T>A	ENST00000328737.2	-	19	1997	c.1921A>T	c.(1921-1923)Aaa>Taa	p.K641*	ANKRD44_ENST00000282272.8_Nonsense_Mutation_p.K658*|ANKRD44_ENST00000337207.5_Nonsense_Mutation_p.K641*|ANKRD44_ENST00000450567.1_Nonsense_Mutation_p.K641*			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	666								p.K641*(1)|p.K481*(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTGGCATCTTTCACATCGACC	0.448																																							uc002uua.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)|skin(1)	5						c.(1921-1923)AAA>TAA		ankyrin repeat domain 44							129.0	125.0	126.0					2																	197873684		2203	4300	6503	SO:0001587	stop_gained	91526						protein binding	g.chr2:197873684T>A	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1921A>T	2.37:g.197873684T>A	ENSP00000331516:p.Lys641*					ANKRD44_uc002utz.3_Nonsense_Mutation_p.K373*	p.K641*	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)		19	1998	-			666					Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Nonsense_Mutation	SNP	ENST00000328737.2	37	c.1921A>T		.	.	.	.	.	.	.	.	.	.	T	37	6.168797	0.97343	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207	.	.	.	4.47	4.47	0.54385	.	0.129791	0.52532	D	0.000080	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	10.1424	0.42742	0.0:0.0:0.1677:0.8323	.	.	.	.	X	481;658;641;641;641	.	ENSP00000282272:K658X	K	-	1	0	ANKRD44	197581929	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	2.642000	0.46596	1.883000	0.54544	0.379000	0.24179	AAA		0.448	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697		39	125	0	0	0	0.00361	0	39	125				
ECEL1	9427	broad.mit.edu	37	2	233345169	233345169	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:233345169C>G	ENST00000304546.1	-	17	2378	c.2168G>C	c.(2167-2169)cGg>cCg	p.R723P	ECEL1_ENST00000409941.1_Missense_Mutation_p.R721P	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	723					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)	p.R723P(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CTGCGACCGCCGCTTGATGCA	0.652																																							uc002vsv.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(2167-2169)CGG>CCG		endothelin converting enzyme-like 1							48.0	52.0	51.0					2																	233345169		2203	4300	6503	SO:0001583	missense	9427				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity	g.chr2:233345169C>G	Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.2168G>C	2.37:g.233345169C>G	ENSP00000302051:p.Arg723Pro					ECEL1_uc010fya.1_Missense_Mutation_p.R721P|ECEL1_uc010fyb.1_Missense_Mutation_p.R430P	p.R723P	NM_004826	NP_004817	O95672	ECEL1_HUMAN		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)	17	2373	-		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	723			Lumenal (Potential).		Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	ENST00000304546.1	37	c.2168G>C	CCDS2493.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957557	0.73902	.	.	ENSG00000171551	ENST00000411860;ENST00000304546;ENST00000409941	D;D;D	0.90504	-2.68;-2.68;-2.68	5.4	5.4	0.78164	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.075301	0.56097	D	0.000029	D	0.94506	0.8231	L	0.58583	1.82	0.80722	D	1	B;D	0.89917	0.163;1.0	B;D	0.91635	0.14;0.999	D	0.94401	0.7623	10	0.56958	D	0.05	-3.8013	19.2268	0.93821	0.0:1.0:0.0:0.0	.	721;723	O95672-2;O95672	.;ECEL1_HUMAN	P	116;723;721	ENSP00000412683:R116P;ENSP00000302051:R723P;ENSP00000386333:R721P	ENSP00000302051:R723P	R	-	2	0	ECEL1	233053413	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.727000	0.84838	2.558000	0.86282	0.450000	0.29827	CGG		0.652	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826		9	45	0	0	0	0.010729	0	9	45				
CHRND	1144	broad.mit.edu	37	2	233396061	233396061	+	Splice_Site	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:233396061G>A	ENST00000258385.3	+	8	852		c.e8-1		CHRND_ENST00000536614.1_Splice_Site|CHRND_ENST00000457943.2_Splice_Site|CHRND_ENST00000543200.1_Splice_Site	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)	p.?(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	GGCTTCCCCAGGTGGTGAGAA	0.627																																							uc002vsw.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.e8-1		nicotinic acetylcholine receptor delta							92.0	72.0	79.0					2																	233396061		2203	4300	6503	SO:0001630	splice_region_variant	1144				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr2:233396061G>A	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.821-1G>A	2.37:g.233396061G>A						CHRND_uc010zmg.1_Splice_Site_p.S259_splice|CHRND_uc010fyc.2_Splice_Site_p.S147_splice|CHRND_uc010zmh.1_Splice_Site_p.G80_splice	p.S274_splice	NM_000751	NP_000742	Q07001	ACHD_HUMAN		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	8	825	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)						A8K661|B4DT92|Q52LH4	Splice_Site	SNP	ENST00000258385.3	37	c.821_splice	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960405	0.74016	.	.	ENSG00000135902	ENST00000543200;ENST00000258385;ENST00000457943	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9961	0.97386	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CHRND	233104305	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	6.623000	0.74238	2.744000	0.94065	0.561000	0.74099	.		0.627	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2		Intron	4	64	0	0	0	0.009096	0	4	64				
AGXT	189	broad.mit.edu	37	2	241808615	241808615	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:241808615A>T	ENST00000307503.3	+	2	581	c.194A>T	c.(193-195)cAg>cTg	p.Q65L		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	65					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)	p.Q65L(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	GAAGGCATCCAGTACGTGTTC	0.622																																							uc002waa.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(193-195)CAG>CTG		alanine-glyoxylate aminotransferase	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)						158.0	129.0	138.0					2																	241808615		2203	4300	6503	SO:0001583	missense	189				glyoxylate metabolic process|protein targeting to peroxisome	mitochondrial matrix|peroxisomal matrix	alanine-glyoxylate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|serine-pyruvate transaminase activity	g.chr2:241808615A>T	D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.194A>T	2.37:g.241808615A>T	ENSP00000302620:p.Gln65Leu					AGXT_uc010zoi.1_Missense_Mutation_p.Q65L	p.Q65L	NM_000030	NP_000021	P21549	SPYA_HUMAN		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	2	315	+		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	65					Q53QU6	Missense_Mutation	SNP	ENST00000307503.3	37	c.194A>T	CCDS2543.1	.	.	.	.	.	.	.	.	.	.	A	19.55	3.848086	0.71603	.	.	ENSG00000172482	ENST00000307503	D	0.87029	-2.2	4.13	2.94	0.34122	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.179935	0.49916	D	0.000125	D	0.91222	0.7234	M	0.85945	2.785	0.58432	D	0.999999	P;D	0.56968	0.603;0.978	P;P	0.59288	0.51;0.855	D	0.91163	0.4962	10	0.87932	D	0	-33.7746	7.7195	0.28723	0.8251:0.0:0.1749:0.0	.	65;65	B7Z548;P21549	.;SPYA_HUMAN	L	65	ENSP00000302620:Q65L	ENSP00000302620:Q65L	Q	+	2	0	AGXT	241457288	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	3.945000	0.56637	1.642000	0.50584	0.402000	0.26972	CAG		0.622	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257186.1	NM_000030		22	82	0	0	0	0.00278	0	22	82				
FARP2	9855	broad.mit.edu	37	2	242429445	242429445	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:242429445C>G	ENST00000264042.3	+	22	2660	c.2490C>G	c.(2488-2490)atC>atG	p.I830M		NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	830	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I830M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		AGAAAACAATCGTGGTGGCAG	0.557																																							uc002wbi.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(2488-2490)ATC>ATG		FERM, RhoGEF and pleckstrin domain protein 2							121.0	103.0	109.0					2																	242429445		2203	4300	6503	SO:0001583	missense	9855				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr2:242429445C>G	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.2490C>G	2.37:g.242429445C>G	ENSP00000264042:p.Ile830Met						p.I830M	NM_014808	NP_055623	O94887	FARP2_HUMAN		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)	22	2607	+		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)	830			PH 1.		B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	37	c.2490C>G	CCDS33424.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.82|10.82	1.457346|1.457346	0.26161|0.26161	.|.	.|.	ENSG00000006607|ENSG00000006607	ENST00000264042|ENST00000444371	T|.	0.76448|.	-1.02|.	5.51|5.51	-9.3|-9.3	0.00649|0.00649	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.463174|.	0.22560|.	N|.	0.058473|.	T|T	0.51702|0.51702	0.1690|0.1690	M|M	0.71581|0.71581	2.175|2.175	0.58432|0.58432	D|D	0.999995|0.999995	B|.	0.31318|.	0.319|.	B|.	0.34590|.	0.186|.	T|T	0.59408|0.59408	-0.7460|-0.7460	10|5	0.52906|.	T|.	0.07|.	.|.	2.1372|2.1372	0.03765|0.03765	0.2859:0.1578:0.3666:0.1898|0.2859:0.1578:0.3666:0.1898	.|.	830|.	O94887|.	FARP2_HUMAN|.	M|G	830|24	ENSP00000264042:I830M|.	ENSP00000264042:I830M|.	I|R	+|+	3|1	3|0	FARP2|FARP2	242078118|242078118	0.002000|0.002000	0.14202|0.14202	0.002000|0.002000	0.10522|0.10522	0.261000|0.261000	0.26267|0.26267	-1.570000|-1.570000	0.02140|0.02140	-1.509000|-1.509000	0.01798|0.01798	-0.181000|-0.181000	0.13052|0.13052	ATC|CGT		0.557	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1			14	38	0	0	0	0.003163	0	14	38				
VPS16	64601	broad.mit.edu	37	20	2844701	2844701	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:2844701G>T	ENST00000380445.3	+	16	1655	c.1583G>T	c.(1582-1584)gGt>gTt	p.G528V	VPS16_ENST00000481812.2_3'UTR|VPS16_ENST00000380469.3_Missense_Mutation_p.G384V|PTPRA_ENST00000380393.3_5'Flank|VPS16_ENST00000380443.3_Missense_Mutation_p.G214V	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	528					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)		p.G528V(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						CGAGCCTATGGTTGTGGCCGC	0.587																																							uc002whe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(1582-1584)GGT>GTT		vacuolar protein sorting 16 isoform 1							82.0	84.0	84.0					20																	2844701		2203	4300	6503	SO:0001583	missense	64601				intracellular protein transport	early endosome|HOPS complex|late endosome membrane|lysosomal membrane|recycling endosome		g.chr20:2844701G>T	AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.1583G>T	20.37:g.2844701G>T	ENSP00000369810:p.Gly528Val					VPS16_uc002whh.2_RNA|PTPRA_uc002whj.2_5'Flank|VPS16_uc002whf.2_Missense_Mutation_p.G384V|VPS16_uc002whd.2_RNA|VPS16_uc002whg.2_Missense_Mutation_p.G214V|VPS16_uc002whi.2_5'UTR	p.G528V	NM_022575	NP_072097	Q9H269	VPS16_HUMAN			16	1631	+			528					Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Missense_Mutation	SNP	ENST00000380445.3	37	c.1583G>T	CCDS13036.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280158	0.40294	.	.	ENSG00000215305	ENST00000380445;ENST00000380469;ENST00000453689;ENST00000380443	T;T;T	0.43294	0.95;0.95;0.95	5.1	5.1	0.69264	Vps16, C-terminal (1);	0.101579	0.64402	D	0.000002	T	0.27454	0.0674	N	0.14661	0.345	0.80722	D	1	P;P;P	0.42584	0.784;0.719;0.784	B;B;B	0.42522	0.39;0.173;0.39	T	0.02661	-1.1127	10	0.35671	T	0.21	-26.6339	9.4289	0.38597	0.0939:0.0:0.9061:0.0	.	214;384;528	Q5JUA8;Q9H269-2;Q9H269	.;.;VPS16_HUMAN	V	528;384;266;214	ENSP00000369810:G528V;ENSP00000369836:G384V;ENSP00000369808:G214V	ENSP00000369808:G214V	G	+	2	0	VPS16	2792701	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	6.526000	0.73799	2.659000	0.90383	0.561000	0.74099	GGT		0.587	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077658.2	NM_022575		9	72	1	0	6.81908e-15	0.00245	1.04529e-14	9	72				
SLC4A11	83959	broad.mit.edu	37	20	3214271	3214271	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:3214271C>A	ENST00000380056.3	-	6	713	c.666G>T	c.(664-666)aaG>aaT	p.K222N	SLC4A11_ENST00000539553.2_Missense_Mutation_p.K206N|SLC4A11_ENST00000380059.3_Missense_Mutation_p.K249N	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	222					bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)	p.K222N(1)|p.K249N(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						TCTGTAGGGCCTTCATGGTAC	0.652																																					NSCLC(190;922 2139 10266 10292 38692)	NSCLC(190;922 2139 10266 10292 38692)	uc002wig.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(664-666)AAG>AAT		solute carrier family 4 member 11							68.0	62.0	64.0					20																	3214271		2203	4300	6503	SO:0001583	missense	83959				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity	g.chr20:3214271C>A	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.666G>T	20.37:g.3214271C>A	ENSP00000369396:p.Lys222Asn					SLC4A11_uc010zqe.1_Missense_Mutation_p.K249N|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.K206N	p.K222N	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN			6	714	-			222			Cytoplasmic (Potential).		B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	c.666G>T	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959929	0.34565	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553;ENST00000437836	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	5.27	2.22	0.28083	Phosphotransferase system, phosphoenolpyruvate-dependent sugar EIIA 2 (1);Phosphotransferase/anion transporter (1);	0.301159	0.30003	N	0.010655	T	0.79161	0.4399	L	0.48362	1.52	0.53688	D	0.999974	D;D;D	0.69078	0.996;0.997;0.997	D;D;D	0.67382	0.918;0.951;0.951	T	0.72253	-0.4347	10	0.21540	T	0.41	.	7.5787	0.27952	0.1358:0.7296:0.0:0.1346	.	206;249;222	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	N	249;222;206;206	ENSP00000369399:K249N;ENSP00000369396:K222N;ENSP00000441370:K206N;ENSP00000404271:K206N	ENSP00000369396:K222N	K	-	3	2	SLC4A11	3162271	1.000000	0.71417	0.008000	0.14137	0.583000	0.36354	2.509000	0.45459	0.206000	0.20587	0.462000	0.41574	AAG		0.652	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1			4	37	1	0	0.00909568	0.009096	0.00957512	4	37				
ADAM33	80332	broad.mit.edu	37	20	3653196	3653196	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:3653196G>C	ENST00000356518.2	-	13	1630	c.1389C>G	c.(1387-1389)tgC>tgG	p.C463W	ADAM33_ENST00000379861.4_Missense_Mutation_p.C463W|ADAM33_ENST00000466620.1_5'UTR|ADAM33_ENST00000350009.2_Missense_Mutation_p.C463W	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	463	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C463W(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						GGCAGCGCACGCAGCAGTCCC	0.652																																							uc002wit.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|skin(1)	4						c.(1387-1389)TGC>TGG		ADAM metallopeptidase domain 33 isoform alpha							41.0	46.0	44.0					20																	3653196		2180	4240	6420	SO:0001583	missense	80332				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr20:3653196G>C	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1389C>G	20.37:g.3653196G>C	ENSP00000348912:p.Cys463Trp					ADAM33_uc002wiq.1_5'Flank|ADAM33_uc002wir.1_Missense_Mutation_p.C463W|ADAM33_uc002wis.2_5'UTR|ADAM33_uc002wiu.2_Missense_Mutation_p.C463W|uc002wiv.1_5'Flank|ADAM33_uc002wiw.1_Intron|ADAM33_uc010gba.1_Intron|ADAM33_uc010gbb.1_Intron|ADAM33_uc002wix.1_Missense_Mutation_p.C195W	p.C463W	NM_025220	NP_079496	Q9BZ11	ADA33_HUMAN			13	1476	-			463			Extracellular (Potential).|Disintegrin.		A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	ENST00000356518.2	37	c.1389C>G	CCDS13058.1	.	.	.	.	.	.	.	.	.	.	g	15.81	2.942056	0.53079	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000439201	T;T;T	0.51574	0.7;0.7;0.7	4.28	1.14	0.20703	Disintegrin, conserved site (1);Blood coagulation inhibitor, Disintegrin (6);	.	.	.	.	T	0.80082	0.4558	H	0.99815	4.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.80897	-0.1177	9	0.87932	D	0	.	8.3498	0.32295	0.2743:0.0:0.7257:0.0	.	463;463;463	Q9BZ11-2;Q9BZ11;A2A2L3	.;ADA33_HUMAN;.	W	463;463;463;343	ENSP00000348912:C463W;ENSP00000369190:C463W;ENSP00000322550:C463W	ENSP00000322550:C463W	C	-	3	2	ADAM33	3601196	0.022000	0.18835	0.984000	0.44739	0.599000	0.36880	0.180000	0.16860	0.433000	0.26313	0.457000	0.33378	TGC		0.652	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220		11	74	0	0	0	0.013537	0	11	74				
CSTL1	128817	broad.mit.edu	37	20	23425464	23425464	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:23425464C>A	ENST00000246020.2	+	3	407	c.387C>A	c.(385-387)ctC>ctA	p.L129L	CSTL1_ENST00000347397.1_Silent_p.L129L			Q9H114	CST1L_HUMAN	cystatin-like 1	129						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L129L(1)		breast(2)|endometrium(2)|large_intestine(3)|lung(4)|skin(2)|stomach(1)	14	Colorectal(13;0.0993)|Lung NSC(19;0.235)					ATTTCCAGCTCTGGAACAATT	0.423																																							uc002wte.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(385-387)CTC>CTA		cystatin-like 1 precursor							89.0	84.0	86.0					20																	23425464		2203	4300	6503	SO:0001819	synonymous_variant	128817					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23425464C>A	AL096677	CCDS13153.1	20p11.21	2012-08-14			ENSG00000125823	ENSG00000125823			15958	protein-coding gene	gene with protein product						20565543	Standard	NM_138283		Approved	dJ322G13.4, CTES1	uc002wte.3	Q9H114	OTTHUMG00000032068	ENST00000246020.2:c.387C>A	20.37:g.23425464C>A						CSTL1_uc010zsu.1_RNA|CSTL1_uc010zsv.1_RNA	p.L129L	NM_138283	NP_612140	Q9H114	CST1L_HUMAN			4	633	+	Colorectal(13;0.0993)|Lung NSC(19;0.235)		129					Q17RA8|Q64FF7	Silent	SNP	ENST00000246020.2	37	c.387C>A	CCDS13153.1																																																																																				0.423	CSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078328.1			22	41	1	0	4.72057e-08	0.003954	6.30914e-08	22	41				
DLGAP4	22839	broad.mit.edu	37	20	35060432	35060433	+	Missense_Mutation	DNP	CC	CC	AA	rs144799810		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:35060432_35060433CC>AA	ENST00000373907.2	+	2	511_512	c.312_313CC>AA	c.(310-315)ctCCtg>ctAAtg	p.L105M	DLGAP4_ENST00000373913.3_Missense_Mutation_p.L105M|DLGAP4_ENST00000401952.2_Missense_Mutation_p.L105M|DLGAP4_ENST00000339266.5_Missense_Mutation_p.L105M			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	105					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)		p.L105M(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CCGCCAACCTCCTGGACCAGTT	0.639																																							uc002xff.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(310-315)CTCCTG>CTAATG		disks large-associated protein 4 isoform a																																				SO:0001583	missense	22839				cell-cell signaling	membrane	protein binding	g.chr20:35060432_35060433CC>AA	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	Exception_encountered	20.37:g.35060432_35060433delinsAA	ENSP00000363014:p.Leu105Met					DLGAP4_uc010zvp.1_Missense_Mutation_p.L105M	p.L105M	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN			3	747_748	+	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)	105					E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	DNP	ENST00000373907.2	37	c.312_313CC>AA																																																																																					0.639	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902		7	67	0	0	0	0.004672	0	7	67				
SLC32A1	140679	broad.mit.edu	37	20	37356308	37356308	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:37356308G>A	ENST00000217420.1	+	2	867	c.604G>A	c.(604-606)Ggc>Agc	p.G202S		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	202					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.G202S(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CCCAACGCTGGGCGGCCGAGT	0.632																																							uc002xjc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(604-606)GGC>AGC		solute carrier family 32, member 1	Glycine(DB00145)						78.0	65.0	69.0					20																	37356308		2203	4300	6503	SO:0001583	missense	140679				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity	g.chr20:37356308G>A	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.604G>A	20.37:g.37356308G>A	ENSP00000217420:p.Gly202Ser						p.G202S	NM_080552	NP_542119	Q9H598	VIAAT_HUMAN			2	867	+		Myeloproliferative disorder(115;0.00878)	202			Lumenal, vesicle (Potential).		Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	c.604G>A	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769554	0.90020	.	.	ENSG00000101438	ENST00000217420	T	0.06687	3.27	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.25754	0.0627	M	0.62154	1.92	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.00527	-1.1688	10	0.49607	T	0.09	-20.0214	15.3899	0.74735	0.0:0.0:1.0:0.0	.	202	Q9H598	VIAAT_HUMAN	S	202	ENSP00000217420:G202S	ENSP00000217420:G202S	G	+	1	0	SLC32A1	36789722	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.777000	0.99008	2.317000	0.78254	0.563000	0.77884	GGC		0.632	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552		7	31	0	0	0	0.001984	0	7	31				
ACTR5	79913	broad.mit.edu	37	20	37384668	37384668	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:37384668G>C	ENST00000243903.4	+	5	1199	c.1162G>C	c.(1162-1164)Gac>Cac	p.D388H		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	388					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)		p.D388H(1)		kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				GGATGTGGTAGACAGCAAGCC	0.542																																							uc002xjd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1162-1164)GAC>CAC		ARP5 actin-related protein 5 homolog							72.0	68.0	69.0					20																	37384668		2203	4300	6503	SO:0001583	missense	79913				DNA recombination|double-strand break repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent|UV-damage excision repair	cytoplasm|Ino80 complex	ATP binding|protein binding	g.chr20:37384668G>C	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.1162G>C	20.37:g.37384668G>C	ENSP00000243903:p.Asp388His						p.D388H	NM_024855	NP_079131	Q9H9F9	ARP5_HUMAN			5	1187	+		Myeloproliferative disorder(115;0.00878)	388					Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	ENST00000243903.4	37	c.1162G>C	CCDS13308.1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887562	0.72410	.	.	ENSG00000101442	ENST00000243903	D	0.96427	-4.01	5.57	5.57	0.84162	.	0.165520	0.51477	D	0.000087	D	0.97698	0.9245	M	0.73962	2.25	0.52099	D	0.999948	D	0.89917	1.0	D	0.72982	0.979	D	0.96379	0.9280	10	0.14656	T	0.56	-38.9487	19.5446	0.95285	0.0:0.0:1.0:0.0	.	388	Q9H9F9	ARP5_HUMAN	H	388	ENSP00000243903:D388H	ENSP00000243903:D388H	D	+	1	0	ACTR5	36818082	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.995000	0.70631	2.638000	0.89438	0.655000	0.94253	GAC		0.542	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855		5	23	0	0	0	0.000602	0	5	23				
PTPRT	11122	broad.mit.edu	37	20	41101140	41101140	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:41101140G>T	ENST00000373187.1	-	8	1215	c.1216C>A	c.(1216-1218)Cag>Aag	p.Q406K	PTPRT_ENST00000373201.1_Missense_Mutation_p.Q406K|PTPRT_ENST00000373198.4_Missense_Mutation_p.Q406K|PTPRT_ENST00000373184.1_Missense_Mutation_p.Q406K|PTPRT_ENST00000356100.2_Missense_Mutation_p.Q406K|PTPRT_ENST00000373193.3_Missense_Mutation_p.Q406K|PTPRT_ENST00000373190.1_Missense_Mutation_p.Q406K			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	406	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.Q406K(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GGCTCCCACTGCAGGGTCAGC	0.567																																							uc002xkg.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(8)|ovary(7)|lung(5)	20						c.(1216-1218)CAG>AAG		protein tyrosine phosphatase, receptor type, T							51.0	60.0	57.0					20																	41101140		2073	4228	6301	SO:0001583	missense	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:41101140G>T	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1216C>A	20.37:g.41101140G>T	ENSP00000362283:p.Gln406Lys					PTPRT_uc010ggj.2_Missense_Mutation_p.Q406K	p.Q406K	NM_007050	NP_008981	O14522	PTPRT_HUMAN			8	1400	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	406			Extracellular (Potential).|Fibronectin type-III 2.		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	c.1216C>A	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243558	0.79912	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62	5.61	5.61	0.85477	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.54319	0.1851	M	0.68593	2.085	0.80722	D	1	P;B	0.36959	0.575;0.439	B;B	0.39876	0.312;0.101	T	0.57266	-0.7841	10	0.56958	D	0.05	.	19.6231	0.95667	0.0:0.0:1.0:0.0	.	406;406	O14522-1;O14522	.;PTPRT_HUMAN	K	406	ENSP00000362286:Q406K;ENSP00000362283:Q406K;ENSP00000362289:Q406K;ENSP00000348408:Q406K;ENSP00000362294:Q406K;ENSP00000362280:Q406K;ENSP00000362297:Q406K	ENSP00000348408:Q406K	Q	-	1	0	PTPRT	40534554	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.674000	0.83992	2.643000	0.89663	0.462000	0.41574	CAG		0.567	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			5	37	1	0	1.23904e-05	0.000602	1.49069e-05	5	37				
ZFP64	55734	broad.mit.edu	37	20	50781293	50781293	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:50781293C>T	ENST00000216923.4	-	4	801	c.452G>A	c.(451-453)tGc>tAc	p.C151Y	ZFP64_ENST00000371515.4_Missense_Mutation_p.C149Y|ZFP64_ENST00000346617.4_Missense_Mutation_p.C97Y|ZFP64_ENST00000361387.2_Missense_Mutation_p.C151Y|ZFP64_ENST00000371518.2_Missense_Mutation_p.C151Y|ZFP64_ENST00000477786.1_5'UTR	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C151F(3)|p.C151Y(3)		breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CTTGAATTGGCAACCTAAAAA	0.378																																							uc002xwl.2		NA																	6	Substitution - Missense(6)		lung(6)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(451-453)TGC>TAC		zinc finger protein 64 isoform a							87.0	80.0	83.0					20																	50781293		2203	4300	6503	SO:0001583	missense	55734				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:50781293C>T	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.452G>A	20.37:g.50781293C>T	ENSP00000216923:p.Cys151Tyr					ZFP64_uc002xwk.2_Missense_Mutation_p.C151Y|ZFP64_uc002xwm.2_Missense_Mutation_p.C149Y|ZFP64_uc002xwn.2_Missense_Mutation_p.C97Y	p.C151Y	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN			4	801	-			151					Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	37	c.452G>A	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588563	0.86851	.	.	ENSG00000020256	ENST00000371518;ENST00000361387;ENST00000216923;ENST00000346617;ENST00000371515;ENST00000371516	T;T;T;T;T	0.14022	2.68;2.72;2.54;2.81;2.54	5.49	5.49	0.81192	Zinc finger, C2H2-like (2);	0.000000	0.64402	D	0.000009	T	0.39036	0.1063	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.998;0.997;0.997;0.996	T	0.04165	-1.0972	10	0.56958	D	0.05	-18.6081	19.7347	0.96198	0.0:1.0:0.0:0.0	.	97;149;151;151	Q9NPA5-2;Q5JWM1;Q9NPA5;Q9NTW7	.;.;ZF64A_HUMAN;ZF64B_HUMAN	Y	151;151;151;97;149;304	ENSP00000360573:C151Y;ENSP00000355179:C151Y;ENSP00000216923:C151Y;ENSP00000344615:C97Y;ENSP00000360570:C149Y	ENSP00000216923:C151Y	C	-	2	0	ZFP64	50214700	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.281000	0.78621	2.746000	0.94184	0.655000	0.94253	TGC		0.378	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197		6	25	0	0	0	0.004482	0	6	25				
PCK1	5105	broad.mit.edu	37	20	56139650	56139650	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:56139650T>A	ENST00000319441.4	+	8	1463	c.1299T>A	c.(1297-1299)ttT>ttA	p.F433L	PCK1_ENST00000543666.1_Missense_Mutation_p.F116L|PCK1_ENST00000535860.1_3'UTR	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	433					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)	p.F433L(1)		endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			GCATTATCTTTGGAGGCCGTA	0.562																																							uc002xyn.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1297-1299)TTT>TTA		cytosolic phosphoenolpyruvate carboxykinase 1							114.0	111.0	112.0					20																	56139650		2203	4300	6503	SO:0001583	missense	5105				gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity	g.chr20:56139650T>A		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.1299T>A	20.37:g.56139650T>A	ENSP00000319814:p.Phe433Leu					PCK1_uc010zzm.1_Missense_Mutation_p.F116L	p.F433L	NM_002591	NP_002582	P35558	PCKGC_HUMAN	BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)		8	1462	+	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		433					A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	ENST00000319441.4	37	c.1299T>A	CCDS13460.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.584426	0.86748	.	.	ENSG00000124253	ENST00000540165;ENST00000319441;ENST00000543666	T;T	0.25749	1.78;1.78	5.8	-4.07	0.03975	Phosphoenolpyruvate carboxykinase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.46852	0.1414	M	0.86178	2.8	0.80722	D	1	D;D	0.63880	0.981;0.993	P;D	0.66351	0.775;0.943	T	0.52275	-0.8597	10	0.72032	D	0.01	-18.3295	12.828	0.57731	0.0:0.3832:0.0:0.6168	.	116;433	B4DT64;P35558	.;PCKGC_HUMAN	L	115;433;116	ENSP00000319814:F433L;ENSP00000445767:F116L	ENSP00000319814:F433L	F	+	3	2	PCK1	55573056	0.673000	0.27539	0.895000	0.35142	0.862000	0.49288	-0.193000	0.09573	-1.133000	0.02903	0.533000	0.62120	TTT		0.562	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2			22	135	0	0	0	0.002299	0	22	135				
PHACTR3	116154	broad.mit.edu	37	20	58349510	58349510	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:58349510A>T	ENST00000371015.1	+	7	1606	c.1139A>T	c.(1138-1140)cAg>cTg	p.Q380L	PHACTR3_ENST00000395636.2_Missense_Mutation_p.Q339L|PHACTR3_ENST00000541461.1_Missense_Mutation_p.Q339L|PHACTR3_ENST00000355648.4_Missense_Mutation_p.Q339L|PHACTR3_ENST00000361300.4_Missense_Mutation_p.Q269L|PHACTR3_ENST00000395639.4_Missense_Mutation_p.Q269L|PHACTR3_ENST00000359926.3_Missense_Mutation_p.Q377L	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	380						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.Q380L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CTTTTGTATCAGGACGAGGAG	0.507																																							uc002yau.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1138-1140)CAG>CTG		phosphatase and actin regulator 3 isoform 1							133.0	136.0	135.0					20																	58349510		2203	4300	6503	SO:0001583	missense	116154					nuclear matrix	actin binding|protein phosphatase inhibitor activity	g.chr20:58349510A>T	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.1139A>T	20.37:g.58349510A>T	ENSP00000360054:p.Gln380Leu					PHACTR3_uc002yat.2_Missense_Mutation_p.Q377L|PHACTR3_uc010zzw.1_Missense_Mutation_p.Q339L|PHACTR3_uc002yav.2_Missense_Mutation_p.Q339L|PHACTR3_uc002yaw.2_Missense_Mutation_p.Q339L|PHACTR3_uc002yax.2_Missense_Mutation_p.Q269L	p.Q380L	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	BRCA - Breast invasive adenocarcinoma(7;2.76e-09)		7	1606	+	all_lung(29;0.00344)		380					B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	c.1139A>T	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.168724	0.38315	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.30981	1.9;1.91;1.51;1.91;1.91;1.91;1.51	5.06	3.96	0.45880	.	0.167044	0.44285	D	0.000471	T	0.28101	0.0693	M	0.67953	2.075	0.52099	D	0.999948	P;B;B	0.35174	0.488;0.069;0.069	B;B;B	0.28553	0.091;0.032;0.032	T	0.04565	-1.0942	10	0.42905	T	0.14	-24.0679	9.6307	0.39778	0.9182:0.0:0.0818:0.0	.	269;380;377	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	L	377;380;269;339;339;339;269	ENSP00000353002:Q377L;ENSP00000360054:Q380L;ENSP00000379001:Q269L;ENSP00000442483:Q339L;ENSP00000347866:Q339L;ENSP00000378998:Q339L;ENSP00000354555:Q269L	ENSP00000347866:Q339L	Q	+	2	0	PHACTR3	57782905	1.000000	0.71417	0.984000	0.44739	0.581000	0.36288	6.409000	0.73289	0.783000	0.33636	0.533000	0.62120	CAG		0.507	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672		25	213	0	0	0	0.005443	0	25	213				
TMPRSS15	5651	broad.mit.edu	37	21	19775907	19775907	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr21:19775907A>T	ENST00000284885.3	-	1	66	c.33T>A	c.(31-33)caT>caA	p.H11Q		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	11						brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.H11Q(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TGAGAGAATGATGCCTAGAAG	0.393																																							uc002ykw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(31-33)CAT>CAA		enterokinase precursor							148.0	140.0	142.0					21																	19775907		2203	4300	6503	SO:0001583	missense	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19775907A>T		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.33T>A	21.37:g.19775907A>T	ENSP00000284885:p.His11Gln						p.H11Q	NM_002772	NP_002763	P98073	ENTK_HUMAN			1	64	-			11			Cytoplasmic (Potential).		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.33T>A	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	A	13.65	2.301774	0.40694	.	.	ENSG00000154646	ENST00000284885	D	0.86164	-2.08	5.16	-4.72	0.03269	.	0.417341	0.23268	N	0.050046	T	0.80177	0.4575	M	0.64997	1.995	0.09310	N	1	B	0.31125	0.309	B	0.22386	0.039	T	0.65643	-0.6118	9	.	.	.	.	13.1606	0.59542	0.7784:0.0:0.2216:0.0	.	11	P98073	ENTK_HUMAN	Q	11	ENSP00000284885:H11Q	.	H	-	3	2	TMPRSS15	18697778	0.000000	0.05858	0.000000	0.03702	0.362000	0.29581	-0.527000	0.06200	-0.850000	0.04152	-0.230000	0.12252	CAT		0.393	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		7	45	0	0	0	0.00308	0	7	45				
KRTAP10-2	386679	broad.mit.edu	37	21	45971197	45971197	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr21:45971197G>C	ENST00000391621.1	-	1	191	c.145C>G	c.(145-147)Cca>Gca	p.P49A	TSPEAR_ENST00000397916.1_Intron|KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	49	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.P49A(1)		large_intestine(1)|lung(4)|skin(1)	6						CAGCTCACTGGGGTGCAGACC	0.701																																							uc002zfi.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(145-147)CCA>GCA		keratin associated protein 10-2							31.0	37.0	35.0					21																	45971197		2200	4298	6498	SO:0001583	missense	386679					keratin filament		g.chr21:45971197G>C	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.145C>G	21.37:g.45971197G>C	ENSP00000375479:p.Pro49Ala					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.P49A	NM_198693	NP_941966	P60368	KR102_HUMAN			1	192	-			49			22 X 5 AA repeats of C-C-X(3).		Q70LJ5	Missense_Mutation	SNP	ENST00000391621.1	37	c.145C>G	CCDS42955.1	.	.	.	.	.	.	.	.	.	.	g	17.13	3.310613	0.60414	.	.	ENSG00000205445	ENST00000391621	T	0.08634	3.07	3.31	3.31	0.37934	.	.	.	.	.	T	0.35508	0.0934	M	0.93106	3.38	0.34222	D	0.675534	D	0.89917	1.0	D	0.85130	0.997	T	0.59478	-0.7447	9	0.59425	D	0.04	.	12.1981	0.54309	0.0:0.0:1.0:0.0	.	49	P60368	KR102_HUMAN	A	49	ENSP00000375479:P49A	ENSP00000375479:P49A	P	-	1	0	KRTAP10-2	44795625	1.000000	0.71417	0.889000	0.34880	0.909000	0.53808	4.224000	0.58593	1.695000	0.51148	0.306000	0.20318	CCA		0.701	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1			5	58	0	0	0	0.000602	0	5	58				
POTEH	23784	broad.mit.edu	37	22	16267032	16267032	+	Missense_Mutation	SNP	C	C	A	rs7292200		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr22:16267032C>A	ENST00000343518.6	-	9	1468	c.1417G>T	c.(1417-1419)Ggt>Tgt	p.G473C		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	473								p.G473C(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						GCAGTGGCACCGTTAGTCAGG	0.408																																							uc010gqp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1417-1419)GGT>TGT		ANKRD26-like family C, member 3							590.0	477.0	511.0					22																	16267032		692	1591	2283	SO:0001583	missense	23784							g.chr22:16267032C>A	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1417G>T	22.37:g.16267032C>A	ENSP00000340610:p.Gly473Cys					POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Missense_Mutation_p.G192C|POTEH_uc002zlj.1_Missense_Mutation_p.G308C	p.G473C	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN			9	1469	-			473					A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	c.1417G>T	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	C	9.649	1.141053	0.21205	.	.	ENSG00000198062	ENST00000359587;ENST00000343518	T	0.27256	1.68	1.4	0.331	0.15933	.	.	.	.	.	T	0.31575	0.0801	L	0.34521	1.04	0.09310	N	1	D;D	0.89917	1.0;0.996	D;P	0.70016	0.967;0.818	T	0.12578	-1.0542	9	0.66056	D	0.02	.	3.6839	0.08320	0.0:0.7426:0.0:0.2574	.	473;436	Q6S545;A6NKF6	POTEH_HUMAN;.	C	436;473	ENSP00000340610:G473C	ENSP00000340610:G473C	G	-	1	0	POTEH	14647032	0.000000	0.05858	0.004000	0.12327	0.039000	0.13416	-0.106000	0.10890	0.155000	0.19261	0.184000	0.17185	GGT		0.408	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		11	191	1	0	4.68919e-08	0.008291	6.2792e-08	11	191				
PI4KA	5297	broad.mit.edu	37	22	21158629	21158629	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr22:21158629C>G	ENST00000572273.1	-	12	1476	c.1246G>C	c.(1246-1248)Gtc>Ctc	p.V416L	PI4KA_ENST00000255882.6_Missense_Mutation_p.V474L			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	416					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.V416L(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GCAATAATGACTTTGCTGGAC	0.507											OREG0026326	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(136;1332 1831 3115 23601 50806)	GBM(136;1332 1831 3115 23601 50806)	uc002zsz.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4						c.(1246-1248)GTC>CTC		phosphatidylinositol 4-kinase type 3 alpha							147.0	122.0	130.0					22																	21158629		2203	4300	6503	SO:0001583	missense	5297				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding	g.chr22:21158629C>G	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.1246G>C	22.37:g.21158629C>G	ENSP00000458238:p.Val416Leu		OREG0026326	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	746	PI4KA_uc010gsq.1_Missense_Mutation_p.V474L	p.V416L	NM_058004	NP_477352	P42356	PI4KA_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		12	1477	-	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	416					Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37	c.1246G>C		.	.	.	.	.	.	.	.	.	.	C	8.584	0.883026	0.17467	.	.	ENSG00000241973	ENST00000255882	.	.	.	5.08	4.07	0.47477	.	0.122950	0.53938	D	0.000047	T	0.35711	0.0941	N	0.11427	0.14	0.80722	D	1	B;B	0.11235	0.004;0.0	B;B	0.12156	0.007;0.001	T	0.12889	-1.0530	9	0.12766	T	0.61	-37.3844	13.3898	0.60816	0.0:0.9246:0.0:0.0754	.	474;416	D3DX33;P42356	.;PI4KA_HUMAN	L	416	.	ENSP00000255882:V416L	V	-	1	0	PI4KA	19488629	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.157000	0.50716	1.366000	0.46076	0.655000	0.94253	GTC		0.507	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004		8	49	0	0	0	0.004482	0	8	49				
BCR	613	broad.mit.edu	37	22	23627343	23627343	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr22:23627343G>C	ENST00000305877.8	+	10	3112	c.2361G>C	c.(2359-2361)ttG>ttC	p.L787F	BCR_ENST00000359540.3_Missense_Mutation_p.L787F	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	787	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L787F(1)	BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	TGGACGCTTTGAAGATCAAGA	0.562			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																		uc002zww.2		NA		Dom	yes		22	22q11.21	613	T	breakpoint cluster region			L	ABL1| FGFR1|JAK2 		CML|ALL|AML	BCR/JAK2(6)	1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(3)|urinary_tract(1)|lung(1)|skin(1)	12						c.(2359-2361)TTG>TTC		breakpoint cluster region isoform 1							79.0	64.0	69.0					22																	23627343		2203	4300	6503	SO:0001583	missense	613				regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	ATP binding|GTPase activator activity|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr22:23627343G>C		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.2361G>C	22.37:g.23627343G>C	ENSP00000303507:p.Leu787Phe					BCR_uc002zwx.2_Missense_Mutation_p.L787F|BCR_uc011aiy.1_Missense_Mutation_p.L376F|BCR_uc010gtx.1_Missense_Mutation_p.L254F|BCR_uc002zwy.1_Missense_Mutation_p.L73F	p.L787F	NM_004327	NP_004318	P11274	BCR_HUMAN			10	2957	+			787			PH.		P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	37	c.2361G>C	CCDS13806.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793812	0.70452	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.29917	1.56;1.55	5.06	5.06	0.68205	Pleckstrin homology domain (3);	0.235196	0.45126	D	0.000396	T	0.43255	0.1239	L	0.59436	1.845	0.80722	D	1	P;P;P;P;P	0.49447	0.728;0.924;0.872;0.845;0.872	B;P;P;P;P	0.52823	0.367;0.71;0.598;0.481;0.493	T	0.35992	-0.9766	10	0.72032	D	0.01	.	13.5344	0.61639	0.0:0.1562:0.8438:0.0	.	376;452;405;787;787	B4E065;Q12843;Q12844;P11274-2;P11274	.;.;.;.;BCR_HUMAN	F	787;787;452	ENSP00000303507:L787F;ENSP00000352535:L787F	ENSP00000303507:L787F	L	+	3	2	BCR	21957343	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	3.404000	0.52623	2.535000	0.85469	0.655000	0.94253	TTG		0.562	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327		9	24	0	0	0	0.004482	0	9	24				
MYO18B	84700	broad.mit.edu	37	22	26343716	26343716	+	Silent	SNP	G	G	T	rs374392610	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr22:26343716G>T	ENST00000407587.2	+	36	5842	c.5673G>T	c.(5671-5673)gcG>gcT	p.A1891A	MYO18B_ENST00000536101.1_Silent_p.A1890A|MYO18B_ENST00000335473.7_Silent_p.A1890A			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1890	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A1891A(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TTGAGAAGGCGGACCTCCTGA	0.567																																							uc003abz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(5668-5670)GCG>GCT		myosin XVIIIB							62.0	64.0	63.0					22																	26343716		2101	4230	6331	SO:0001819	synonymous_variant	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26343716G>T	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5673G>T	22.37:g.26343716G>T						MYO18B_uc003aca.1_Silent_p.A1771A|MYO18B_uc010guy.1_Silent_p.A1772A|MYO18B_uc010guz.1_Silent_p.A1770A|MYO18B_uc011aka.1_Silent_p.A1044A|MYO18B_uc011akb.1_Silent_p.A1403A	p.A1890A	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN			36	5920	+			1890			Tail.|Potential.		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37	c.5670G>T																																																																																					0.567	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		5	27	1	0	0.000602214	0.000602	0.000667112	5	27				
ELFN2	114794	broad.mit.edu	37	22	37771374	37771374	+	Silent	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr22:37771374G>C	ENST00000402918.2	-	3	986	c.201C>G	c.(199-201)ctC>ctG	p.L67L	RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	67					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.L67L(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					GCACGGCTTTGAGCTTGTTCT	0.592																																							uc003asq.3		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(199-201)CTC>CTG		leucine rich repeat containing 62							251.0	245.0	247.0					22																	37771374		2203	4300	6503	SO:0001819	synonymous_variant	114794					cell surface|integral to membrane		g.chr22:37771374G>C	BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.201C>G	22.37:g.37771374G>C							p.L67L	NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN			3	987	-	Melanoma(58;0.0574)		67			LRR 1.|Extracellular (Potential).		Q96PY3	Silent	SNP	ENST00000402918.2	37	c.201C>G	CCDS33642.1																																																																																				0.592	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318900.2	NM_052906		8	47	0	0	0	0.004482	0	8	47				
PLXNB2	23654	broad.mit.edu	37	22	50716360	50716360	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr22:50716360A>T	ENST00000449103.1	-	32	5110	c.4970T>A	c.(4969-4971)tTc>tAc	p.F1657Y	PLXNB2_ENST00000359337.4_Missense_Mutation_p.F1657Y			O15031	PLXB2_HUMAN	plexin B2	1657					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.F1700Y(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GAAGTCGAAGAAGTACTTGAC	0.597																																							uc003bkv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(4969-4971)TTC>TAC		plexin B2 precursor							58.0	68.0	65.0					22																	50716360		2175	4285	6460	SO:0001583	missense	23654				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity	g.chr22:50716360A>T		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.4970T>A	22.37:g.50716360A>T	ENSP00000409171:p.Phe1657Tyr					PLXNB2_uc003bkt.1_Missense_Mutation_p.F449Y|PLXNB2_uc003bku.1_Missense_Mutation_p.F642Y	p.F1657Y	NM_012401	NP_036533	O15031	PLXB2_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	32	5076	-		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	1657			Cytoplasmic (Potential).		A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	c.4970T>A	CCDS43035.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.7|21.7	4.186226|4.186226	0.78789|0.78789	.|.	.|.	ENSG00000196576|ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000399964;ENST00000411680|ENST00000399991	T;T;T|.	0.14022|.	2.54;2.54;2.54|.	4.08|4.08	4.08|4.08	0.47627|0.47627	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);Ras GTPase-activating protein (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.73055|0.73055	0.3538|0.3538	M|M	0.72624|0.72624	2.21|2.21	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.77397|0.77397	-0.2603|-0.2603	10|6	0.87932|0.87932	D|D	0|0	.|.	13.4923|13.4923	0.61402|0.61402	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1657|.	O15031|.	PLXB2_HUMAN|.	Y|T	1657;1657;287;209|128	ENSP00000409171:F1657Y;ENSP00000352288:F1657Y;ENSP00000400679:F209Y|.	ENSP00000352288:F1657Y|ENSP00000382873:S128T	F|S	-|-	2|1	0|0	PLXNB2|PLXNB2	49058487|49058487	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.511000|0.511000	0.34104|0.34104	6.940000|6.940000	0.75917|0.75917	1.827000|1.827000	0.53221|0.53221	0.402000|0.402000	0.26972|0.26972	TTC|TCT		0.597	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401		21	56	0	0	0	0.008871	0	21	56				
FGD5	152273	broad.mit.edu	37	3	14862143	14862143	+	Missense_Mutation	SNP	C	C	A	rs532000328		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:14862143C>A	ENST00000285046.5	+	1	1675	c.1565C>A	c.(1564-1566)aCg>aAg	p.T522K	FGD5_ENST00000543601.1_Missense_Mutation_p.T281K	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	522					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.T522K(1)|p.T281K(1)		NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						GTGGGAAAGACGCTTTTGTCA	0.612																																							uc003bzc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|kidney(1)|pancreas(1)	5						c.(1564-1566)ACG>AAG		FYVE, RhoGEF and PH domain containing 5							23.0	26.0	25.0					3																	14862143		1945	4131	6076	SO:0001583	missense	152273				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr3:14862143C>A	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1565C>A	3.37:g.14862143C>A	ENSP00000285046:p.Thr522Lys					FGD5_uc011avk.1_Missense_Mutation_p.T522K	p.T522K	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN			1	1675	+			522					B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	c.1565C>A	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740484	0.30865	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.74106	-0.81;-0.66	5.05	-0.651	0.11454	.	0.695683	0.12872	N	0.432157	T	0.54775	0.1879	L	0.47716	1.5	0.09310	N	1	B;B	0.32526	0.251;0.374	B;B	0.28991	0.09;0.097	T	0.36407	-0.9749	10	0.14252	T	0.57	-0.6937	0.3807	0.00394	0.2155:0.2385:0.1835:0.3625	.	281;522	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	K	522;281	ENSP00000285046:T522K;ENSP00000445949:T281K	ENSP00000285046:T522K	T	+	2	0	FGD5	14837147	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.165000	0.03132	-0.131000	0.11578	0.650000	0.86243	ACG		0.612	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536		10	35	1	0	2.17888e-05	0.006214	2.59904e-05	10	35				
ZNF385D	79750	broad.mit.edu	37	3	21706377	21706377	+	Splice_Site	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:21706377C>A	ENST00000281523.2	-	2	684		c.e2+1		ZNF385D_ENST00000494118.1_Intron	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.?(1)		NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						CAGGTACTTACCGCATTGAAA	0.468																																							uc003cce.2		NA																	1	Unknown(1)		lung(1)	large_intestine(2)|skin(2)|ovary(1)	5						c.e2+1		zinc finger protein 385D							97.0	91.0	93.0					3																	21706377		2203	4300	6503	SO:0001630	splice_region_variant	79750					nucleus	nucleic acid binding|zinc ion binding	g.chr3:21706377C>A	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.165+1G>T	3.37:g.21706377C>A						ZNF385D_uc010hfb.1_Intron	p.A55_splice	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN			2	573	-									Splice_Site	SNP	ENST00000281523.2	37	c.165_splice	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762897	0.69763	.	.	ENSG00000151789	ENST00000281523	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4189	0.90582	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF385D	21681381	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	5.643000	0.67895	2.604000	0.88044	0.591000	0.81541	.		0.468	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697	Intron	20	73	1	0	1.50039e-11	0.012319	2.17137e-11	20	73				
RARB	5915	broad.mit.edu	37	3	25622075	25622075	+	Silent	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:25622075C>G	ENST00000404969.1	+	5	669	c.669C>G	c.(667-669)ggC>ggG	p.G223G	RARB_ENST00000462272.1_3'UTR|RARB_ENST00000330688.4_Silent_p.G216G|RARB_ENST00000437042.2_Silent_p.G104G|RARB_ENST00000458646.1_Silent_p.G104G			P10826	RARB_HUMAN	retinoic acid receptor, beta	223	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.G223G(1)|p.G216G(1)		breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TGGACCTGGGCCTCTGGGACA	0.498																																							uc011awl.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|large_intestine(1)|pancreas(1)	3						c.(667-669)GGC>GGG		retinoic acid receptor, beta isoform 2	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)						118.0	106.0	110.0					3																	25622075		2203	4300	6503	SO:0001819	synonymous_variant	5915				embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr3:25622075C>G	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.669C>G	3.37:g.25622075C>G						RARB_uc003cdi.1_Silent_p.G104G|RARB_uc003cdh.2_Silent_p.G216G	p.G223G	NM_016152	NP_057236	P10826	RARB_HUMAN			5	735	+			223	G->D: Greatly reduced transcriptional activation in the absence of hormone. Even gretaer reduction in transcriptional activation in the absence of hormone; when associated with I-222 or S-232. Great reduction in transcriptional activation in the absence of hormone; when associated with I-222 and S-232.		Ligand-binding.		P12891|Q00989|Q15298|Q9UN48	Silent	SNP	ENST00000404969.1	37	c.669C>G																																																																																					0.498	RARB-201	KNOWN	basic	protein_coding	protein_coding		NM_000965, NM_016152		12	80	0	0	0	0.001855	0	12	80				
STT3B	201595	broad.mit.edu	37	3	31617899	31617899	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:31617899G>C	ENST00000295770.2	+	2	535	c.326G>C	c.(325-327)aGa>aCa	p.R109T	STT3B_ENST00000453168.1_3'UTR	NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	109					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)	p.R109T(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						TTTAACTATAGATCAACACAT	0.313																																							uc011axe.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(325-327)AGA>ACA		source of immunodominant MHC-associated							123.0	128.0	126.0					3																	31617899		2203	4295	6498	SO:0001583	missense	201595				protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding	g.chr3:31617899G>C	AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.326G>C	3.37:g.31617899G>C	ENSP00000295770:p.Arg109Thr					STT3B_uc010hft.1_Missense_Mutation_p.R109T|STT3B_uc003cer.1_Missense_Mutation_p.R109T	p.R109T	NM_178862	NP_849193	Q8TCJ2	STT3B_HUMAN			2	326	+			109					Q96JZ4|Q96KY7	Missense_Mutation	SNP	ENST00000295770.2	37	c.326G>C	CCDS2650.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939777	0.92526	.	.	ENSG00000163527	ENST00000295770	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.90021	0.6884	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92436	0.5958	9	0.87932	D	0	-15.9437	20.0503	0.97624	0.0:0.0:1.0:0.0	.	109	Q8TCJ2	STT3B_HUMAN	T	109	.	ENSP00000295770:R109T	R	+	2	0	STT3B	31592903	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.736000	0.93811	0.591000	0.81541	AGA		0.313	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253166.2	NM_178862		5	26	0	0	0	0.001984	0	5	26				
GPD1L	23171	broad.mit.edu	37	3	32207310	32207310	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:32207310C>T	ENST00000282541.5	+	8	1165	c.964C>T	c.(964-966)Cca>Tca	p.P322S		NM_015141.3	NP_055956.1	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like	322					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophospholipid biosynthetic process (GO:0046474)|NAD metabolic process (GO:0019674)|NADH metabolic process (GO:0006734)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase C signaling (GO:0090038)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|ventricular cardiac muscle cell action potential (GO:0086005)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|plasma membrane (GO:0005886)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|ion channel binding (GO:0044325)|NAD binding (GO:0051287)|sodium channel regulator activity (GO:0017080)	p.P322S(1)		large_intestine(4)|lung(7)|ovary(1)	12						AACTAGGTTTCCATTGTTTAC	0.408																																							uc003cew.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(964-966)CCA>TCA		glycerol-3-phosphate dehydrogenase 1-like							221.0	187.0	198.0					3																	32207310		2203	4300	6503	SO:0001583	missense	23171				glycerol-3-phosphate catabolic process	glycerol-3-phosphate dehydrogenase complex	glycerol-3-phosphate dehydrogenase|NAD binding|protein homodimerization activity	g.chr3:32207310C>T	D42047	CCDS33729.1	3p22.3	2014-09-17			ENSG00000152642	ENSG00000152642			28956	protein-coding gene	gene with protein product		611778				7788527	Standard	NM_015141		Approved	KIAA0089	uc003cew.3	Q8N335	OTTHUMG00000155846	ENST00000282541.5:c.964C>T	3.37:g.32207310C>T	ENSP00000282541:p.Pro322Ser						p.P322S	NM_015141	NP_055956	Q8N335	GPD1L_HUMAN			8	1024	+			322					A8K9U3|Q14702|Q9BRM5	Missense_Mutation	SNP	ENST00000282541.5	37	c.964C>T	CCDS33729.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747370	0.69533	.	.	ENSG00000152642	ENST00000282541	D	0.84146	-1.81	5.68	5.68	0.88126	Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);Glycerol-3-phosphate dehydrogenase, NAD-dependent, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95981	0.8691	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97350	0.9963	10	0.87932	D	0	-23.9346	19.7958	0.96481	0.0:1.0:0.0:0.0	.	322	Q8N335	GPD1L_HUMAN	S	322	ENSP00000282541:P322S	ENSP00000282541:P322S	P	+	1	0	GPD1L	32182314	1.000000	0.71417	0.984000	0.44739	0.039000	0.13416	7.730000	0.84881	2.669000	0.90835	0.563000	0.77884	CCA		0.408	GPD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341975.2	NM_015141		16	58	0	0	0	0.008871	0	16	58				
KLHL40	131377	broad.mit.edu	37	3	42730470	42730470	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:42730470C>T	ENST00000287777.4	+	4	1631	c.1531C>T	c.(1531-1533)Cgc>Tgc	p.R511C		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	511					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)		p.R511C(1)									CCATGATGGCCGCATTATCGT	0.562																																							uc003clv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1531-1533)CGC>TGC		kelch repeat and BTB (POZ) domain containing 5							74.0	64.0	67.0					3																	42730470		2203	4300	6503	SO:0001583	missense	131377							g.chr3:42730470C>T	AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.1531C>T	3.37:g.42730470C>T	ENSP00000287777:p.Arg511Cys						p.R511C	NM_152393	NP_689606	Q2TBA0	KBTB5_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.214)	4	1631	+			511					Q86SI1|Q96MR2	Missense_Mutation	SNP	ENST00000287777.4	37	c.1531C>T	CCDS2703.1	.	.	.	.	.	.	.	.	.	.	c	17.27	3.346985	0.61183	.	.	ENSG00000157119	ENST00000287777;ENST00000452129	T	0.78126	-1.15	4.37	3.33	0.38152	Kelch-type beta propeller (1);	0.183522	0.45361	D	0.000368	T	0.64260	0.2582	L	0.42632	1.34	0.46901	D	0.99924	P	0.34629	0.46	B	0.23419	0.046	T	0.65429	-0.6170	10	0.38643	T	0.18	.	9.7652	0.40557	0.472:0.528:0.0:0.0	.	511	Q2TBA0	KBTB5_HUMAN	C	511;256	ENSP00000287777:R511C	ENSP00000287777:R511C	R	+	1	0	KBTBD5	42705474	1.000000	0.71417	1.000000	0.80357	0.354000	0.29330	3.680000	0.54641	2.185000	0.69588	0.436000	0.28706	CGC		0.562	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256651.1	NM_152393		9	44	0	0	0	0.004482	0	9	44				
LAMB2	3913	broad.mit.edu	37	3	49168500	49168500	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:49168500G>C	ENST00000418109.1	-	8	962	c.798C>G	c.(796-798)atC>atG	p.I266M	LAMB2_ENST00000305544.4_Missense_Mutation_p.I266M	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	266	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.I266M(1)		NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACTTCTCTCGGATCTCCCTCC	0.582																																							uc003cwe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(796-798)ATC>ATG		laminin, beta 2 precursor							139.0	129.0	133.0					3																	49168500		2203	4300	6503	SO:0001583	missense	3913				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity	g.chr3:49168500G>C		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.798C>G	3.37:g.49168500G>C	ENSP00000388325:p.Ile266Met					LAMB2_uc003cwf.1_Missense_Mutation_p.I266M	p.I266M	NM_002292	NP_002283	P55268	LAMB2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	7	1097	-			266			Laminin N-terminal.		Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	c.798C>G	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239181	0.58995	.	.	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000494831	T;T;T	0.77750	-1.12;-1.12;-1.12	4.76	3.88	0.44766	Laminin, N-terminal (3);	0.190888	0.44285	D	0.000466	D	0.87501	0.6193	M	0.89214	3.015	0.58432	D	0.999998	D	0.55800	0.973	P	0.60609	0.877	D	0.89360	0.3667	10	0.72032	D	0.01	.	12.1967	0.54300	0.0846:0.0:0.9154:0.0	.	266	P55268	LAMB2_HUMAN	M	266;266;117	ENSP00000388325:I266M;ENSP00000307156:I266M;ENSP00000444751:I117M	ENSP00000307156:I266M	I	-	3	3	LAMB2	49143504	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	1.564000	0.36375	1.355000	0.45865	0.655000	0.94253	ATC		0.582	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292		5	75	0	0	0	0.00308	0	5	75				
C3orf62	375341	broad.mit.edu	37	3	49308858	49308858	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:49308858T>C	ENST00000343010.3	-	3	1595	c.559A>G	c.(559-561)Att>Gtt	p.I187V	Y_RNA_ENST00000362676.1_RNA|MIR4271_ENST00000582451.1_RNA	NM_198562.2	NP_940964.1	Q6ZUJ4	CC062_HUMAN	chromosome 3 open reading frame 62	187								p.I187V(1)		breast(1)|kidney(1)|large_intestine(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AATTCTTCAATAGTTCGGATG	0.393																																							uc003cwn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(559-561)ATT>GTT		hypothetical protein LOC375341							76.0	82.0	80.0					3																	49308858		2203	4300	6503	SO:0001583	missense	375341							g.chr3:49308858T>C	AK125642	CCDS2792.1	3p21.31	2006-02-11			ENSG00000188315	ENSG00000188315			24771	protein-coding gene	gene with protein product						12477932	Standard	NM_198562		Approved	FLJ43654	uc003cwn.2	Q6ZUJ4	OTTHUMG00000156819	ENST00000343010.3:c.559A>G	3.37:g.49308858T>C	ENSP00000341139:p.Ile187Val					C3orf62_uc003cwm.2_Missense_Mutation_p.I36V|hsa-mir-4271|MI0015879_5'Flank	p.I187V	NM_198562	NP_940964	Q6ZUJ4	CC062_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	3	762	-			187					Q6P7E9|Q7Z3X6	Missense_Mutation	SNP	ENST00000343010.3	37	c.559A>G	CCDS2792.1	.	.	.	.	.	.	.	.	.	.	T	16.38	3.105698	0.56291	.	.	ENSG00000188315	ENST00000343010;ENST00000436325	T;T	0.50277	0.76;0.75	5.2	5.2	0.72013	.	0.000000	0.49916	D	0.000133	T	0.55465	0.1922	L	0.34521	1.04	0.32873	D	0.509476	D	0.61697	0.99	D	0.75484	0.986	T	0.64732	-0.6338	10	0.46703	T	0.11	-19.1246	11.3734	0.49713	0.0:0.0:0.0:1.0	.	187	Q6ZUJ4	CC062_HUMAN	V	187;185	ENSP00000341139:I187V;ENSP00000413663:I185V	ENSP00000341139:I187V	I	-	1	0	C3orf62	49283862	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.810000	0.38932	2.178000	0.69098	0.477000	0.44152	ATT		0.393	C3orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345990.1	NM_198562		10	116	0	0	0	0.006214	0	10	116				
SHQ1	55164	broad.mit.edu	37	3	72799747	72799747	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:72799747A>T	ENST00000325599.8	-	11	1561	c.1422T>A	c.(1420-1422)gaT>gaA	p.D474E	SHQ1_ENST00000468371.1_5'UTR|SHQ1_ENST00000463369.1_Missense_Mutation_p.D446E	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	474	Ser-rich.				negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D474E(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CTTGTTCTGAATCTGAGCCTG	0.473																																							uc003dpf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(1420-1422)GAT>GAA		SHQ1 homolog							104.0	93.0	97.0					3																	72799747		2203	4300	6503	SO:0001583	missense	55164				ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding	g.chr3:72799747A>T	BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.1422T>A	3.37:g.72799747A>T	ENSP00000315182:p.Asp474Glu					SHQ1_uc010hod.2_Missense_Mutation_p.D385E	p.D474E	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)	11	1529	-		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)	474			Ser-rich.		B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Missense_Mutation	SNP	ENST00000325599.8	37	c.1422T>A	CCDS33788.1	.	.	.	.	.	.	.	.	.	.	A	12.12	1.843847	0.32606	.	.	ENSG00000144736	ENST00000325599;ENST00000463369	T;T	0.33865	1.44;1.39	5.79	-10.7	0.00240	.	0.490008	0.20849	N	0.084571	T	0.14098	0.0341	L	0.32530	0.975	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.41052	-0.9530	10	0.02654	T	1	-4.4844	7.5564	0.27827	0.37:0.2933:0.3367:0.0	.	474	Q6PI26	SHQ1_HUMAN	E	474;446	ENSP00000315182:D474E;ENSP00000417452:D446E	ENSP00000315182:D474E	D	-	3	2	SHQ1	72882437	0.002000	0.14202	0.003000	0.11579	0.044000	0.14063	0.219000	0.17641	-2.379000	0.00595	-0.993000	0.02533	GAT		0.473	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352310.1	NM_018130		16	41	0	0	0	0.004007	0	16	41				
ROBO1	6091	broad.mit.edu	37	3	78656193	78656193	+	Splice_Site	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:78656193T>A	ENST00000464233.1	-	29	4549		c.e29-2		ROBO1_ENST00000466906.1_Splice_Site|ROBO1_ENST00000467549.1_Splice_Site|ROBO1_ENST00000436010.2_Splice_Site|ROBO1_ENST00000495273.1_Splice_Site	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.?(4)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GTGGAAGATCTAAAAAGAAAC	0.418																																							uc003dqe.2		NA																	4	Unknown(4)		lung(4)	large_intestine(2)	2						c.e29-1		roundabout 1 isoform a							59.0	56.0	57.0					3																	78656193		1919	4139	6058	SO:0001630	splice_region_variant	6091				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding	g.chr3:78656193T>A	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4436-2A>T	3.37:g.78656193T>A						ROBO1_uc003dqb.2_Splice_Site_p.D1440_splice|ROBO1_uc003dqc.2_Splice_Site_p.D1379_splice|ROBO1_uc003dqd.2_Splice_Site_p.D1434_splice|ROBO1_uc010hoh.2_Splice_Site_p.D671_splice|ROBO1_uc011bgl.1_Intron	p.D1479_splice	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)	29	4644	-		Lung SC(41;0.0257)|Lung NSC(201;0.0439)						B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Splice_Site	SNP	ENST00000464233.1	37	c.4436_splice	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.256084	0.22965	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	.	.	.	5.22	4.07	0.47477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9566	0.47362	0.0:0.0736:0.0:0.9264	.	.	.	.	.	-1	.	.	.	-	.	.	ROBO1	78738883	1.000000	0.71417	0.998000	0.56505	0.285000	0.27093	5.979000	0.70508	0.952000	0.37798	0.397000	0.26171	.		0.418	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	Intron	5	47	0	0	0	0.000602	0	5	47				
CADM2	253559	broad.mit.edu	37	3	85932594	85932594	+	Splice_Site	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:85932594G>T	ENST00000407528.2	+	3	426		c.e3+1		CADM2_ENST00000405615.2_Splice_Site|CADM2_ENST00000383699.3_Splice_Site	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2						adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.?(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		ACCGTTCTGGGTAAGTGCAAG	0.353																																							uc003dqj.2		NA																	2	Unknown(2)		lung(2)	ovary(1)|lung(1)|kidney(1)|skin(1)	4						c.e3+1		immunoglobulin superfamily, member 4D							78.0	67.0	71.0					3																	85932594		2203	4300	6503	SO:0001630	splice_region_variant	253559				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane		g.chr3:85932594G>T	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.364+1G>T	3.37:g.85932594G>T						CADM2_uc003dqk.2_Splice_Site_p.G131_splice|CADM2_uc003dql.2_Splice_Site_p.G124_splice	p.G122_splice	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)	3	990	+		Lung NSC(201;0.0148)						G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Splice_Site	SNP	ENST00000407528.2	37	c.364_splice	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945397	0.53079	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8568	0.96762	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CADM2	86015284	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	9.420000	0.97426	2.764000	0.94973	0.650000	0.86243	.		0.353	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	Intron	8	28	1	0	0.000274275	0.004482	0.000308229	8	28				
HTR1F	3355	broad.mit.edu	37	3	88040364	88040364	+	Silent	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:88040364T>A	ENST00000319595.4	+	1	519	c.465T>A	c.(463-465)tcT>tcA	p.S155S		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	155					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.S155S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	TTTTTATCTCTATGCCTCCTC	0.413																																							uc003dqr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(463-465)TCT>TCA		5-hydroxytryptamine (serotonin) receptor 1F	Eletriptan(DB00216)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)						68.0	66.0	67.0					3																	88040364		2203	4300	6503	SO:0001819	synonymous_variant	3355				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	serotonin binding|serotonin receptor activity	g.chr3:88040364T>A	L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.465T>A	3.37:g.88040364T>A							p.S155S	NM_000866	NP_000857	P30939	5HT1F_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	2	623	+	all_cancers(8;0.147)	Lung NSC(201;0.0283)	155			Helical; Name=4; (By similarity).			Silent	SNP	ENST00000319595.4	37	c.465T>A	CCDS2920.1																																																																																				0.413	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352890.1	NM_000866		7	19	0	0	0	0.00308	0	7	19				
EPHA3	2042	broad.mit.edu	37	3	89259557	89259557	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:89259557C>A	ENST00000336596.2	+	3	926	c.701C>A	c.(700-702)tCt>tAt	p.S234Y	EPHA3_ENST00000494014.1_Missense_Mutation_p.S234Y|EPHA3_ENST00000452448.2_Missense_Mutation_p.S234Y	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	234	Cys-rich.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.S234Y(2)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GTCAACAATTCTAAGGAGGAA	0.488										TSP Lung(6;0.00050)																													uc003dqy.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(700-702)TCT>TAT		ephrin receptor EphA3 isoform a precursor							169.0	162.0	164.0					3																	89259557		2203	4300	6503	SO:0001583	missense	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89259557C>A	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.701C>A	3.37:g.89259557C>A	ENSP00000337451:p.Ser234Tyr	TSP Lung(6;0.00050)				EPHA3_uc003dqx.1_Missense_Mutation_p.S234Y|EPHA3_uc010hon.1_RNA	p.S234Y	NM_005233	NP_005224	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	3	926	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	234			Extracellular (Potential).|Cys-rich.		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	c.701C>A	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644776	0.87859	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.76709	-1.04;2.42;-1.03	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.90601	0.7053	M	0.88450	2.955	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.85130	0.982;0.997	D	0.90701	0.4620	9	.	.	.	.	20.3465	0.98790	0.0:1.0:0.0:0.0	.	234;234	P29320;P29320-2	EPHA3_HUMAN;.	Y	234	ENSP00000337451:S234Y;ENSP00000399926:S234Y;ENSP00000419190:S234Y	.	S	+	2	0	EPHA3	89342247	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.798000	0.96311	0.655000	0.94253	TCT		0.488	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		20	73	1	0	1.37522e-17	0.007413	2.15534e-17	20	73				
NDUFB4	4710	broad.mit.edu	37	3	120320105	120320105	+	Splice_Site	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:120320105G>A	ENST00000184266.2	+	2	378		c.e2+1		NDUFB4_ENST00000492739.1_Intron|NDUFB4_ENST00000485064.1_Missense_Mutation_p.V110I	NM_004547.5	NP_004538.2	O95168	NDUB4_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.V110I(1)|p.?(1)		breast(1)|large_intestine(1)|lung(3)	5				GBM - Glioblastoma multiforme(114;0.14)		AACTGAGAGGGTAAGTATTCA	0.443																																							uc003edu.2		NA																	2	Substitution - Missense(1)|Unknown(1)		lung(2)		0						c.e2+1		NADH dehydrogenase (ubiquinone) 1 beta	NADH(DB00157)						134.0	154.0	147.0					3																	120320105		2203	4296	6499	SO:0001630	splice_region_variant	4710				mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity	g.chr3:120320105G>A	AF044957	CCDS2999.1, CCDS54630.1	3q13.33	2011-07-04	2002-08-29		ENSG00000065518	ENSG00000065518		"""Mitochondrial respiratory chain complex / Complex I"""	7699	protein-coding gene	gene with protein product	"""complex I B15 subunit"""	603840	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4 (15kD, B15)"""			9878551	Standard	NM_004547		Approved	B15	uc003edu.3	O95168	OTTHUMG00000159442	ENST00000184266.2:c.327+1G>A	3.37:g.120320105G>A						NDUFB4_uc003edt.2_Missense_Mutation_p.V110I	p.R109_splice	NM_004547	NP_004538	O95168	NDUB4_HUMAN		GBM - Glioblastoma multiforme(114;0.14)	2	406	+								B2RUY3|B9EJC7	Splice_Site	SNP	ENST00000184266.2	37	c.327_splice	CCDS2999.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.09|15.09	2.729798|2.729798	0.48833|0.48833	.|.	.|.	ENSG00000065518|ENSG00000065518	ENST00000184266|ENST00000485064	.|.	.|.	.|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|.	.|.	.|.	.|.	.|T	.|0.78336	.|0.4267	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.85130	.|0.997	.|T	.|0.77459	.|-0.2580	.|6	.|.	.|.	.|.	.|.	15.093|15.093	0.72211|0.72211	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|110	.|B2RUY3	.|.	.|I	-1|110	.|.	.|.	.|V	+|+	.|1	.|0	NDUFB4|NDUFB4	121802795|121802795	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.581000|0.581000	0.36288|0.36288	6.794000|6.794000	0.75135|0.75135	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	.|GTA		0.443	NDUFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355420.1	NM_004547	Intron	11	140	0	0	0	0.013537	0	11	140				
HEG1	57493	broad.mit.edu	37	3	124720857	124720857	+	Splice_Site	SNP	C	C	A	rs200704143		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:124720857C>A	ENST00000311127.4	-	11	3424		c.e11-1			NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1						cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						GTTGGACTCCCTATAGGCAAA	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		23272	0.0		0.001	False		,,,				2504	0.0						uc003ehs.3		NA																	1	Unknown(1)		lung(1)	ovary(2)	2						c.e11-1		HEG homolog 1 precursor							59.0	58.0	58.0					3																	124720857		1987	4172	6159	SO:0001630	splice_region_variant	57493					extracellular region|integral to membrane	calcium ion binding	g.chr3:124720857C>A	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.3357-1G>T	3.37:g.124720857C>A						HEG1_uc003ehr.3_Translation_Start_Site|HEG1_uc011bke.1_Splice_Site_p.R1219_splice	p.R1119_splice	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN			11	3425	-								Q6NX66|Q8NC40|Q9BSV0	Splice_Site	SNP	ENST00000311127.4	37	c.3357_splice	CCDS46898.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	C|C	16.71|16.71	3.197703|3.197703	0.58126|0.58126	.|.	.|.	ENSG00000173706|ENSG00000173706	ENST00000311127|ENST00000487661	.|T	.|0.52057	.|0.68	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|.	.|.	.|.	.|.	.|T	.|0.62048	.|0.2396	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.56312	.|-0.8000	.|5	.|.	.|.	.|.	.|.	17.6706|17.6706	0.88216|0.88216	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|M	-1|3	.|ENSP00000417648:R3M	.|.	.|R	-|-	.|2	.|0	HEG1|HEG1	126203547|126203547	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.902000|0.902000	0.53008|0.53008	4.372000|4.372000	0.59530|0.59530	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	.|AGG		0.493	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	Intron	7	23	1	0	8.12818e-05	0.001984	9.37558e-05	7	23				
ALDH1L1	10840	broad.mit.edu	37	3	125876315	125876315	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:125876315G>T	ENST00000393434.2	-	4	748	c.399C>A	c.(397-399)tcC>tcA	p.S133S	ALDH1L1_ENST00000455064.2_5'UTR|ALDH1L1_ENST00000472186.1_Silent_p.S133S|U1_ENST00000606575.1_RNA|ALDH1L1_ENST00000452905.2_Intron|ALDH1L1_ENST00000273450.3_Silent_p.S143S|ALDH1L1_ENST00000413612.1_5'Flank|ALDH1L1_ENST00000393431.2_Silent_p.S133S	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	133	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.S133S(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CCCAGAAGATGGAAAACCCCC	0.577																																							uc003eim.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(397-399)TCC>TCA		aldehyde dehydrogenase 1 family, member L1	Tetrahydrofolic acid(DB00116)						101.0	102.0	102.0					3																	125876315		2203	4300	6503	SO:0001819	synonymous_variant	10840				10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity	g.chr3:125876315G>T	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.399C>A	3.37:g.125876315G>T						ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_Intron|ALDH1L1_uc003eio.2_5'Flank|ALDH1L1_uc010hsf.1_Silent_p.S159S|ALDH1L1_uc003eip.1_Silent_p.S42S|ALDH1L1_uc011bkj.1_5'UTR	p.S133S	NM_012190	NP_036322	O75891	AL1L1_HUMAN		GBM - Glioblastoma multiforme(114;0.0462)	4	589	-			133			GART.		B4DG36|E9PBX3|Q68CS1	Silent	SNP	ENST00000393434.2	37	c.399C>A	CCDS3034.1																																																																																				0.577	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190		9	59	1	0	3.86212e-05	0.008291	4.52198e-05	9	59				
DNAJB8	165721	broad.mit.edu	37	3	128181837	128181837	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:128181837G>T	ENST00000469083.1	-	2	2809	c.252C>A	c.(250-252)caC>caA	p.H84Q	DNAJB8_ENST00000319153.3_Missense_Mutation_p.H84Q|DNAJB8-AS1_ENST00000471626.1_RNA			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	84					chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)	p.H84Q(1)		kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		CGAAGGGGCTGTGGTAGGGCG	0.602																																							uc003ekk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(250-252)CAC>CAA		DnaJ homolog, subfamily B, member 8							72.0	76.0	75.0					3																	128181837		2203	4300	6503	SO:0001583	missense	165721				protein folding		heat shock protein binding|unfolded protein binding	g.chr3:128181837G>T		CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.252C>A	3.37:g.128181837G>T	ENSP00000417418:p.His84Gln					uc003ekl.1_5'Flank	p.H84Q	NM_153330	NP_699161	Q8NHS0	DNJB8_HUMAN		GBM - Glioblastoma multiforme(114;0.177)	3	1913	-			84					B3KWV7	Missense_Mutation	SNP	ENST00000469083.1	37	c.252C>A	CCDS3048.1	.	.	.	.	.	.	.	.	.	.	G	0.894	-0.724652	0.03158	.	.	ENSG00000179407	ENST00000469083;ENST00000319153	T;T	0.70282	-0.47;-0.47	4.12	2.28	0.28536	Heat shock protein DnaJ, N-terminal (1);	3.594190	0.00481	N	0.000139	T	0.52322	0.1727	N	0.14661	0.345	0.21967	N	0.999444	B	0.02656	0.0	B	0.01281	0.0	T	0.35895	-0.9770	10	0.15066	T	0.55	.	4.4424	0.11580	0.0865:0.1531:0.6022:0.1581	.	84	Q8NHS0	DNJB8_HUMAN	Q	84	ENSP00000417418:H84Q;ENSP00000316053:H84Q	ENSP00000316053:H84Q	H	-	3	2	DNAJB8	129664527	0.931000	0.31567	0.244000	0.24202	0.008000	0.06430	1.332000	0.33805	0.307000	0.22880	-0.304000	0.09214	CAC		0.602	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356933.1	NM_153330		12	57	1	0	7.93312e-07	0.00245	1.00457e-06	12	57				
EFCC1	79825	broad.mit.edu	37	3	128758690	128758690	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:128758690G>A	ENST00000480450.1	+	8	1796	c.1796G>A	c.(1795-1797)tGa>tAa	p.*599*	EFCC1_ENST00000436022.2_Silent_p.*162*			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	0							calcium ion binding (GO:0005509)	p.*162*(1)|p.*599*(1)									GTCTCCTGCTGAGGTTACTGG	0.647																																							uc011bkt.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1795-1797)TGA>TAA		coiled-coil domain containing 48							47.0	46.0	46.0					3																	128758690		2203	4300	6503	SO:0001819	synonymous_variant	79825							g.chr3:128758690G>A	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.1796G>A	3.37:g.128758690G>A							p.*599*	NM_024768	NP_079044	Q9HA90	CCD48_HUMAN			8	1796	+			599					A8MYE2	Silent	SNP	ENST00000480450.1	37	c.1796G>A	CCDS3054.2																																																																																				0.647	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352832.1	NM_024768		7	47	0	0	0	0.006214	0	7	47				
CLSTN2	64084	broad.mit.edu	37	3	140281150	140281150	+	Splice_Site	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:140281150G>T	ENST00000458420.3	+	13	2402	c.2212G>T	c.(2212-2214)Ggt>Tgt	p.G738C		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	738					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.G738C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CTCCATCTACGGTAAGGCCAC	0.552										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	GBM(45;858 913 3709 36904 37282)	uc003etn.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						c.(2212-2214)GGT>TGT		calsyntenin 2 precursor							97.0	89.0	92.0					3																	140281150		2203	4300	6503	SO:0001630	splice_region_variant	64084				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr3:140281150G>T	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2212+1G>T	3.37:g.140281150G>T		HNSCC(16;0.037)					p.G738C	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN			13	2402	+			738			Extracellular (Potential).		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	c.2212G>T	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.657173	0.88154	.	.	ENSG00000158258	ENST00000458420	T	0.32988	1.43	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.61350	0.2340	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64635	-0.6361	9	.	.	.	-14.9401	17.2159	0.86944	0.0:0.0:1.0:0.0	.	738	Q9H4D0	CSTN2_HUMAN	C	738	ENSP00000402460:G738C	.	G	+	1	0	CLSTN2	141763840	1.000000	0.71417	0.999000	0.59377	0.885000	0.51271	9.171000	0.94802	2.679000	0.91253	0.655000	0.94253	GGT		0.552	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	Missense_Mutation	6	36	1	0	3.59834e-05	0.001168	4.23441e-05	6	36				
CHST2	9435	broad.mit.edu	37	3	142841065	142841065	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:142841065C>A	ENST00000309575.3	+	2	2791	c.1407C>A	c.(1405-1407)ttC>ttA	p.F469L		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	469					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.F469L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						CCAAGCCTTTCGTGGTATCTG	0.582																																							uc003evm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1405-1407)TTC>TTA		carbohydrate (N-acetylglucosamine-6-O)							57.0	56.0	56.0					3																	142841065		2203	4300	6503	SO:0001583	missense	9435				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity	g.chr3:142841065C>A	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1407C>A	3.37:g.142841065C>A	ENSP00000307911:p.Phe469Leu						p.F469L	NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN			2	2296	+			469			Lumenal (Potential).		D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	c.1407C>A	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.124368	0.37533	.	.	ENSG00000175040	ENST00000309575	T	0.81330	-1.48	4.61	0.772	0.18510	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.84297	0.5441	M	0.80847	2.515	0.48040	D	0.999572	P	0.48407	0.91	P	0.54499	0.754	T	0.81088	-0.1091	10	0.45353	T	0.12	-11.9031	8.9344	0.35691	0.0:0.5389:0.0:0.4611	.	469	Q9Y4C5	CHST2_HUMAN	L	469	ENSP00000307911:F469L	ENSP00000307911:F469L	F	+	3	2	CHST2	144323755	0.042000	0.20092	0.998000	0.56505	0.432000	0.31715	-0.728000	0.04925	-0.052000	0.13311	-0.351000	0.07748	TTC		0.582	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267		13	41	1	0	1.05317e-09	0.00245	1.47825e-09	13	41				
SLC9A9	285195	broad.mit.edu	37	3	142985603	142985603	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:142985603C>A	ENST00000316549.6	-	16	2087	c.1879G>T	c.(1879-1881)Ggc>Tgc	p.G627C		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	627					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)	p.G627C(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						CCTCCCAGGCCGAGGTCTCCC	0.498																																							uc003evn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1879-1881)GGC>TGC		solute carrier family 9 (sodium/hydrogen							127.0	119.0	122.0					3																	142985603		2203	4300	6503	SO:0001583	missense	285195				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity	g.chr3:142985603C>A	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1879G>T	3.37:g.142985603C>A	ENSP00000320246:p.Gly627Cys						p.G627C	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN			16	2061	-			627					A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	c.1879G>T	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468089	0.84533	.	.	ENSG00000181804	ENST00000316549	T	0.59638	0.25	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.77075	0.4077	M	0.71581	2.175	0.53688	D	0.999977	D	0.89917	1.0	D	0.97110	1.0	T	0.78160	-0.2312	10	0.72032	D	0.01	.	19.8215	0.96599	0.0:1.0:0.0:0.0	.	627	Q8IVB4	SL9A9_HUMAN	C	627	ENSP00000320246:G627C	ENSP00000320246:G627C	G	-	1	0	SLC9A9	144468293	0.999000	0.42202	0.966000	0.40874	0.991000	0.79684	5.317000	0.65822	2.679000	0.91253	0.650000	0.86243	GGC		0.498	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653		17	62	1	0	3.32936e-07	0.006122	4.28586e-07	17	62				
ZIC4	84107	broad.mit.edu	37	3	147120537	147120537	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:147120537G>T	ENST00000383075.3	-	2	560	c.48C>A	c.(46-48)taC>taA	p.Y16*	ZIC4_ENST00000473123.1_Nonsense_Mutation_p.Y16*|ZIC4_ENST00000491672.1_Nonsense_Mutation_p.Y16*|ZIC4_ENST00000484399.1_Nonsense_Mutation_p.Y16*|ZIC4_ENST00000425731.3_Nonsense_Mutation_p.Y54*|ZIC4_ENST00000525172.2_Nonsense_Mutation_p.Y66*	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	16						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y16*(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						GAGTGTTTCGGTAAAGCCGTA	0.353																																							uc003ewd.1		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(46-48)TAC>TAA		zinc finger protein of the cerebellum 4							156.0	143.0	147.0					3																	147120537		1862	4089	5951	SO:0001587	stop_gained	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147120537G>T	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.48C>A	3.37:g.147120537G>T	ENSP00000372553:p.Tyr16*					ZIC4_uc011bno.1_Nonsense_Mutation_p.Y66*	p.Y16*	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN			2	321	-			16					A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Nonsense_Mutation	SNP	ENST00000383075.3	37	c.48C>A	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	G	33	5.282820	0.95489	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672;ENST00000462748;ENST00000484586;ENST00000463250	.	.	.	6.06	4.29	0.51040	.	0.376013	0.19215	N	0.119840	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	10.1144	0.42583	0.2026:0.0:0.7974:0.0	.	.	.	.	X	16;54;66;16;16;16;16;16;16	.	ENSP00000372553:Y16X	Y	-	3	2	ZIC4	148603227	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.048000	0.49862	0.906000	0.36621	0.655000	0.94253	TAC		0.353	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			12	84	1	0	3.27435e-08	0.00245	4.40149e-08	12	84				
OTOL1	131149	broad.mit.edu	37	3	161221370	161221371	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:161221370_161221371CC>TT	ENST00000327928.4	+	4	1074_1075	c.1074_1075CC>TT	c.(1072-1077)atCCcc>atTTcc	p.P359S		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	359	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)		p.P359S(1)		central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						CTCCTAACATCCCCATCAAATT	0.47																																							uc011bpb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1072-1077)ATCCCC>ATTTCC		otolin-1 precursor																																				SO:0001583	missense	131149					collagen		g.chr3:161221370_161221371CC>TT		CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		Exception_encountered	3.37:g.161221370_161221371delinsTT	ENSP00000330808:p.Pro359Ser						p.P359S	NM_001080440	NP_001073909	A6NHN0	OTOL1_HUMAN			4	1074_1075	+			359			C1q.			Missense_Mutation	DNP	ENST00000327928.4	37	c.1074_1075CC>TT	CCDS46948.1																																																																																				0.470	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440		7	26	0	0	0	0.004672	0	7	26				
ZBBX	79740	broad.mit.edu	37	3	167045743	167045743	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:167045743A>T	ENST00000392766.2	-	11	1189	c.849T>A	c.(847-849)caT>caA	p.H283Q	ZBBX_ENST00000392767.2_Missense_Mutation_p.H283Q|ZBBX_ENST00000469220.1_Intron|ZBBX_ENST00000392764.1_Missense_Mutation_p.H254Q|ZBBX_ENST00000455345.2_Missense_Mutation_p.H283Q|ZBBX_ENST00000307529.5_Missense_Mutation_p.H283Q	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	283						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.H283Q(2)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TTACTGCTGCATGTAAATTCT	0.413																																							uc003fep.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(847-849)CAT>CAA		zinc finger, B-box domain containing							175.0	153.0	160.0					3																	167045743		1847	4098	5945	SO:0001583	missense	79740					intracellular	zinc ion binding	g.chr3:167045743A>T	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.849T>A	3.37:g.167045743A>T	ENSP00000376519:p.His283Gln					ZBBX_uc011bpc.1_Missense_Mutation_p.H283Q|ZBBX_uc003feq.2_Missense_Mutation_p.H254Q	p.H283Q	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN			11	1172	-			283					A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	c.849T>A	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	A	6.958	0.546591	0.13312	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.08282	3.28;3.28;3.27;3.27;3.11	5.37	-10.7	0.00240	.	0.548505	0.13319	N	0.396803	T	0.02455	0.0075	N	0.17082	0.46	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.32025	-0.9922	10	0.13470	T	0.59	-0.0753	1.524	0.02521	0.2436:0.3619:0.1384:0.256	.	283;283	A8MT70-2;A8MT70	.;ZBBX_HUMAN	Q	283;283;283;283;254	ENSP00000376519:H283Q;ENSP00000376520:H283Q;ENSP00000390232:H283Q;ENSP00000305065:H283Q;ENSP00000376517:H254Q	ENSP00000305065:H283Q	H	-	3	2	ZBBX	168528437	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.773000	0.04689	-2.211000	0.00737	-1.481000	0.00988	CAT		0.413	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687		10	59	0	0	0	0.006214	0	10	59				
ABCC5	10057	broad.mit.edu	37	3	183645220	183645220	+	Silent	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:183645220T>A	ENST00000334444.6	-	28	4185	c.3945A>T	c.(3943-3945)ctA>ctT	p.L1315L	ABCC5_ENST00000265586.6_Silent_p.L1272L	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1315	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.L1315L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GTTTCAGAGGTAGCTGAGCAA	0.453																																							uc003fmg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(3943-3945)CTA>CTT		ATP-binding cassette, sub-family C, member 5							57.0	53.0	54.0					3																	183645220		1879	4114	5993	SO:0001819	synonymous_variant	10057					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity	g.chr3:183645220T>A	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3945A>T	3.37:g.183645220T>A						ABCC5_uc011bqt.1_Silent_p.L843L|ABCC5_uc010hxl.2_Silent_p.L1272L	p.L1315L	NM_005688	NP_005679	O15440	MRP5_HUMAN	Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		28	4110	-	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		1315			ABC transporter 2.		B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	ENST00000334444.6	37	c.3945A>T	CCDS43176.1																																																																																				0.453	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688		10	15	0	0	0	0.006214	0	10	15				
EIF4G1	1981	broad.mit.edu	37	3	184039223	184039223	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:184039223C>G	ENST00000346169.2	+	10	1122	c.851C>G	c.(850-852)tCt>tGt	p.S284C	EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000434061.2_Missense_Mutation_p.S88C|EIF4G1_ENST00000411531.1_Missense_Mutation_p.S244C|EIF4G1_ENST00000319274.6_Missense_Mutation_p.S284C|EIF4G1_ENST00000392537.2_Missense_Mutation_p.S197C|EIF4G1_ENST00000414031.1_Missense_Mutation_p.S244C|EIF4G1_ENST00000342981.4_Missense_Mutation_p.S284C|EIF4G1_ENST00000352767.3_Missense_Mutation_p.S291C|EIF4G1_ENST00000350481.5_Missense_Mutation_p.S120C|EIF4G1_ENST00000435046.2_Missense_Mutation_p.S88C|EIF4G1_ENST00000427845.1_Missense_Mutation_p.S197C|EIF4G1_ENST00000382330.3_Missense_Mutation_p.S291C|EIF4G1_ENST00000441154.1_Missense_Mutation_p.S120C|EIF4G1_ENST00000424196.1_Missense_Mutation_p.S291C	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	284					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.S284C(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCAGTCCTCTCTATTCCTGGG	0.542																																							uc003fnp.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(850-852)TCT>TGT		eukaryotic translation initiation factor 4							47.0	52.0	50.0					3																	184039223		2203	4300	6503	SO:0001583	missense	1981				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity	g.chr3:184039223C>G	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.851C>G	3.37:g.184039223C>G	ENSP00000316879:p.Ser284Cys					EIF4G1_uc003fno.1_Missense_Mutation_p.S225C|EIF4G1_uc010hxw.1_Missense_Mutation_p.S120C|EIF4G1_uc003fnt.2_5'UTR|EIF4G1_uc003fnq.2_Missense_Mutation_p.S197C|EIF4G1_uc003fnr.2_Missense_Mutation_p.S120C|EIF4G1_uc010hxx.2_Missense_Mutation_p.S291C|EIF4G1_uc003fns.2_Missense_Mutation_p.S244C|EIF4G1_uc010hxy.2_Missense_Mutation_p.S291C|EIF4G1_uc003fnv.3_Missense_Mutation_p.S284C|EIF4G1_uc003fnu.3_Missense_Mutation_p.S284C|EIF4G1_uc003fnw.2_Missense_Mutation_p.S291C|EIF4G1_uc003fnx.2_Missense_Mutation_p.S88C|EIF4G1_uc003fny.3_Missense_Mutation_p.S88C	p.S284C	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		10	1049	+	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		284					D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	c.851C>G	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359639	0.61403	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000444134;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000428387;ENST00000434061;ENST00000427607;ENST00000457456;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.52057	3.9;3.92;3.84;0.68;2.83;2.82;3.91;3.01;3.71;3.91;3.82;3.91;3.9;3.91;3.9;2.4;3.73;0.72;3.68;0.74;1.18;3.69	5.2	5.2	0.72013	.	0.506002	0.21440	N	0.074506	T	0.54415	0.1857	N	0.19112	0.55	0.47374	D	0.999408	D;D;D;D	0.69078	0.983;0.997;0.997;0.983	P;D;D;P	0.73708	0.635;0.981;0.981;0.541	T	0.57093	-0.7870	10	0.62326	D	0.03	-3.2545	15.9531	0.79859	0.0:1.0:0.0:0.0	.	291;284;284;291	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	C	284;244;197;88;284;291;291;225;120;291;197;284;284;291;244;120;120;88;88;88;88;88	ENSP00000316879:S284C;ENSP00000391935:S244C;ENSP00000376320:S197C;ENSP00000407244:S88C;ENSP00000391412:S284C;ENSP00000413159:S291C;ENSP00000371767:S291C;ENSP00000403269:S225C;ENSP00000317600:S120C;ENSP00000338020:S291C;ENSP00000407682:S197C;ENSP00000343450:S284C;ENSP00000323737:S284C;ENSP00000416255:S291C;ENSP00000395974:S244C;ENSP00000398145:S120C;ENSP00000399858:S120C;ENSP00000411707:S88C;ENSP00000411826:S88C;ENSP00000409545:S88C;ENSP00000399969:S88C;ENSP00000404754:S88C	ENSP00000323737:S284C	S	+	2	0	EIF4G1	185521917	0.990000	0.36364	0.888000	0.34837	0.853000	0.48598	4.392000	0.59659	2.861000	0.98227	0.655000	0.94253	TCT		0.542	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917		8	56	0	0	0	0.006214	0	8	56				
EIF4G1	1981	broad.mit.edu	37	3	184039251	184039251	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr3:184039251A>G	ENST00000346169.2	+	10	1150	c.879A>G	c.(877-879)atA>atG	p.I293M	EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000434061.2_Missense_Mutation_p.I97M|EIF4G1_ENST00000411531.1_Missense_Mutation_p.I253M|EIF4G1_ENST00000319274.6_Missense_Mutation_p.I293M|EIF4G1_ENST00000392537.2_Missense_Mutation_p.I206M|EIF4G1_ENST00000414031.1_Missense_Mutation_p.I253M|EIF4G1_ENST00000342981.4_Missense_Mutation_p.I293M|EIF4G1_ENST00000352767.3_Missense_Mutation_p.I300M|EIF4G1_ENST00000350481.5_Missense_Mutation_p.I129M|EIF4G1_ENST00000435046.2_Missense_Mutation_p.I97M|EIF4G1_ENST00000427845.1_Missense_Mutation_p.I206M|EIF4G1_ENST00000382330.3_Missense_Mutation_p.I300M|EIF4G1_ENST00000441154.1_Missense_Mutation_p.I129M|EIF4G1_ENST00000424196.1_Missense_Mutation_p.I300M	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	293					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.I293M(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGACAACTATACAAATGTCTG	0.547																																							uc003fnp.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(877-879)ATA>ATG		eukaryotic translation initiation factor 4							46.0	50.0	48.0					3																	184039251		2203	4300	6503	SO:0001583	missense	1981				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity	g.chr3:184039251A>G	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.879A>G	3.37:g.184039251A>G	ENSP00000316879:p.Ile293Met					EIF4G1_uc003fno.1_Missense_Mutation_p.I234M|EIF4G1_uc010hxw.1_Missense_Mutation_p.I129M|EIF4G1_uc003fnt.2_Missense_Mutation_p.I4M|EIF4G1_uc003fnq.2_Missense_Mutation_p.I206M|EIF4G1_uc003fnr.2_Missense_Mutation_p.I129M|EIF4G1_uc010hxx.2_Missense_Mutation_p.I300M|EIF4G1_uc003fns.2_Missense_Mutation_p.I253M|EIF4G1_uc010hxy.2_Missense_Mutation_p.I300M|EIF4G1_uc003fnv.3_Missense_Mutation_p.I293M|EIF4G1_uc003fnu.3_Missense_Mutation_p.I293M|EIF4G1_uc003fnw.2_Missense_Mutation_p.I300M|EIF4G1_uc003fnx.2_Missense_Mutation_p.I97M|EIF4G1_uc003fny.3_Missense_Mutation_p.I97M	p.I293M	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		10	1077	+	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		293					D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	c.879A>G	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	A	6.100	0.386637	0.11524	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000444134;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000428387;ENST00000434061;ENST00000427607;ENST00000457456;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.51325	4.05;4.05;3.96;0.71;2.96;2.96;4.05;3.13;3.86;4.05;3.96;4.05;4.05;4.05;4.05;2.54;3.87;0.71;3.85;0.83;1.32;3.84	5.5	-2.61	0.06171	.	0.783503	0.12629	N	0.452378	T	0.23886	0.0578	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.11235	0.001;0.001;0.001;0.004	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.13255	-1.0516	10	0.38643	T	0.18	-1.3015	0.6577	0.00837	0.2287:0.2666:0.2798:0.2249	.	300;293;293;300	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	M	293;253;206;97;293;300;300;234;129;300;206;293;293;300;253;129;129;97;97;97;97;97	ENSP00000316879:I293M;ENSP00000391935:I253M;ENSP00000376320:I206M;ENSP00000407244:I97M;ENSP00000391412:I293M;ENSP00000413159:I300M;ENSP00000371767:I300M;ENSP00000403269:I234M;ENSP00000317600:I129M;ENSP00000338020:I300M;ENSP00000407682:I206M;ENSP00000343450:I293M;ENSP00000323737:I293M;ENSP00000416255:I300M;ENSP00000395974:I253M;ENSP00000398145:I129M;ENSP00000399858:I129M;ENSP00000411707:I97M;ENSP00000411826:I97M;ENSP00000409545:I97M;ENSP00000399969:I97M;ENSP00000404754:I97M	ENSP00000323737:I293M	I	+	3	3	EIF4G1	185521945	0.996000	0.38824	0.717000	0.30585	0.522000	0.34438	0.163000	0.16520	-0.054000	0.13266	-0.250000	0.11733	ATA		0.547	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917		10	45	0	0	0	0.006214	0	10	45				
FGFBP2	83888	broad.mit.edu	37	4	15964478	15964478	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:15964478C>T	ENST00000259989.6	-	1	381	c.275G>A	c.(274-276)tGg>tAg	p.W92*	FGFBP2_ENST00000509331.1_Intron	NM_031950.3	NP_114156.1	Q9BYJ0	FGFP2_HUMAN	fibroblast growth factor binding protein 2	92						extracellular region (GO:0005576)		p.W92*(1)		central_nervous_system(1)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	9						GGCTTGATTCCAGTAAGGTTT	0.637																																							uc003gon.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(274-276)TGG>TAG		killer-specific secretory protein of 37 kDa							54.0	54.0	54.0					4																	15964478		2203	4300	6503	SO:0001587	stop_gained	83888					extracellular space	growth factor binding	g.chr4:15964478C>T	AB021123	CCDS3419.1	4p15.32	2008-07-16			ENSG00000137441	ENSG00000137441			29451	protein-coding gene	gene with protein product	"""killer-specific secretory protein of 37 kDa"""	607713				11342666, 12322897	Standard	NM_031950		Approved	KSP37	uc003gon.3	Q9BYJ0	OTTHUMG00000128513	ENST00000259989.6:c.275G>A	4.37:g.15964478C>T	ENSP00000259989:p.Trp92*						p.W92*	NM_031950	NP_114156	Q9BYJ0	FGFP2_HUMAN			1	382	-			92						Nonsense_Mutation	SNP	ENST00000259989.6	37	c.275G>A	CCDS3419.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044839	0.75732	.	.	ENSG00000137441	ENST00000259989	.	.	.	2.98	2.98	0.34508	.	0.159626	0.43747	U	0.000538	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.1961	12.0427	0.53462	0.0:1.0:0.0:0.0	.	.	.	.	X	92	.	ENSP00000259989:W92X	W	-	2	0	FGFBP2	15573576	1.000000	0.71417	0.370000	0.25965	0.722000	0.41435	3.082000	0.50128	1.175000	0.42826	0.650000	0.86243	TGG		0.637	FGFBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250324.1	NM_031950		13	48	0	0	0	0.001855	0	13	48				
ANAPC4	29945	broad.mit.edu	37	4	25382048	25382048	+	Missense_Mutation	SNP	A	A	G	rs540483057		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:25382048A>G	ENST00000315368.3	+	3	324	c.182A>G	c.(181-183)aAt>aGt	p.N61S	ANAPC4_ENST00000510092.1_Missense_Mutation_p.N61S	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	61					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)	p.N61S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				TTTCCACCAAATGAAAATACA	0.343													A|||	1	0.000199681	0.0	0.0	5008	,	,		16690	0.0		0.0	False		,,,				2504	0.001						uc003gro.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5						c.(181-183)AAT>AGT		anaphase-promoting complex subunit 4							86.0	86.0	86.0					4																	25382048		2203	4300	6503	SO:0001583	missense	29945				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity	g.chr4:25382048A>G	AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.182A>G	4.37:g.25382048A>G	ENSP00000318775:p.Asn61Ser					ANAPC4_uc003grp.2_5'Flank	p.N61S	NM_013367	NP_037499	Q9UJX5	APC4_HUMAN			3	311	+		Breast(46;0.0503)	61					A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Missense_Mutation	SNP	ENST00000315368.3	37	c.182A>G	CCDS3434.1	.	.	.	.	.	.	.	.	.	.	A	5.263	0.234053	0.09969	.	.	ENSG00000053900	ENST00000315368;ENST00000510092;ENST00000505991	T;T	0.29917	1.55;1.55	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.148662	0.64402	D	0.000012	T	0.22781	0.0550	L	0.51422	1.61	0.42107	D	0.991362	B	0.12013	0.005	B	0.08055	0.003	T	0.07481	-1.0770	10	0.09084	T	0.74	-23.678	7.4667	0.27326	0.8365:0.0:0.1635:0.0	.	61	Q9UJX5	APC4_HUMAN	S	61	ENSP00000318775:N61S;ENSP00000426654:N61S	ENSP00000318775:N61S	N	+	2	0	ANAPC4	24991146	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.665000	0.46791	1.863000	0.54032	0.477000	0.44152	AAT		0.343	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367		9	34	0	0	0	0.006214	0	9	34				
UGDH	7358	broad.mit.edu	37	4	39512309	39512309	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:39512309G>A	ENST00000316423.6	-	4	779	c.437C>T	c.(436-438)gCa>gTa	p.A146V	UGDH_ENST00000506179.1_Missense_Mutation_p.A146V|UGDH_ENST00000515398.1_5'Flank|UGDH_ENST00000501493.2_Intron|UGDH_ENST00000507089.1_Missense_Mutation_p.A49V	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	146					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)	p.A146V(1)		breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						TTTTGTGTTTGCATCAAATAT	0.368																																							uc003guk.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						c.(436-438)GCA>GTA		UDP-glucose dehydrogenase	NADH(DB00157)						196.0	192.0	193.0					4																	39512309		2203	4300	6503	SO:0001583	missense	7358				glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity	g.chr4:39512309G>A	AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.437C>T	4.37:g.39512309G>A	ENSP00000319501:p.Ala146Val					UGDH_uc011byp.1_Missense_Mutation_p.A49V|UGDH_uc003gul.1_Intron	p.A146V	NM_003359	NP_003350	O60701	UGDH_HUMAN			4	753	-			146					B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	ENST00000316423.6	37	c.437C>T	CCDS3455.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573112	0.86542	.	.	ENSG00000109814	ENST00000316423;ENST00000506179;ENST00000507089;ENST00000515021;ENST00000514106	T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07	5.95	5.95	0.96441	UDP-glucose/GDP-mannose dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.75889	0.3911	M	0.69823	2.125	0.80722	D	1	P	0.34743	0.466	B	0.23852	0.049	T	0.74639	-0.3598	10	0.36615	T	0.2	-2.4486	19.3906	0.94581	0.0:0.0:1.0:0.0	.	146	O60701	UGDH_HUMAN	V	146;146;49;159;146	ENSP00000319501:A146V;ENSP00000421757:A146V;ENSP00000426560:A49V;ENSP00000421954:A159V;ENSP00000425834:A146V	ENSP00000319501:A146V	A	-	2	0	UGDH	39188704	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	9.137000	0.94496	2.827000	0.97445	0.650000	0.86243	GCA		0.368	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216818.3	NM_003359		21	61	0	0	0	0.00278	0	21	61				
YIPF7	285525	broad.mit.edu	37	4	44638050	44638050	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:44638050G>T	ENST00000332990.5	-	3	257	c.241C>A	c.(241-243)Ctc>Atc	p.L81I	YIPF7_ENST00000415895.4_Missense_Mutation_p.L57I	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	81						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.L81I(1)		breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						GATGACATGAGCATCTCTGAT	0.408																																							uc010ifx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(241-243)CTC>ATC		Yip1 domain family, member 7							87.0	86.0	86.0					4																	44638050		1922	4144	6066	SO:0001583	missense	285525					endoplasmic reticulum membrane|integral to membrane		g.chr4:44638050G>T	AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.241C>A	4.37:g.44638050G>T	ENSP00000332772:p.Leu81Ile					YIPF7_uc010ify.1_Missense_Mutation_p.L81I	p.L81I	NM_182592	NP_872398	Q8N8F6	YIPF7_HUMAN			3	258	-			81					Q3SY21|Q3SY22	Missense_Mutation	SNP	ENST00000332990.5	37	c.241C>A	CCDS54766.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.763|5.763	0.325247|0.325247	0.10900|0.10900	.|.	.|.	ENSG00000177752|ENSG00000177752	ENST00000415895|ENST00000332990	.|T	.|0.30714	.|1.52	5.02|5.02	3.11|3.11	0.35812|0.35812	.|.	.|0.674576	.|0.14148	.|N	.|0.338209	T|T	0.18841|0.18841	0.0452|0.0452	N|N	0.22421|0.22421	0.69|0.69	0.22684|0.22684	N|N	0.99886|0.99886	.|B;B	.|0.27351	.|0.176;0.002	.|B;B	.|0.26202	.|0.067;0.005	T|T	0.14839|0.14839	-1.0458|-1.0458	5|10	.|0.30078	.|T	.|0.28	-6.7061|-6.7061	7.6883|7.6883	0.28552|0.28552	0.0936:0.0:0.7329:0.1735|0.0936:0.0:0.7329:0.1735	.|.	.|81;81	.|Q8N8F6-4;Q8N8F6	.|.;YIPF7_HUMAN	D|I	57|81	.|ENSP00000332772:L81I	.|ENSP00000332772:L81I	A|L	-|-	2|1	0|0	YIPF7|YIPF7	44332807|44332807	1.000000|1.000000	0.71417|0.71417	0.896000|0.896000	0.35187|0.35187	0.081000|0.081000	0.17604|0.17604	1.386000|1.386000	0.34419|0.34419	1.337000|1.337000	0.45525|0.45525	0.650000|0.650000	0.86243|0.86243	GCT|CTC		0.408	YIPF7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_182592		10	25	1	0	2.17888e-05	0.006214	2.59904e-05	10	25				
GABRB1	2560	broad.mit.edu	37	4	47034433	47034433	+	Splice_Site	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:47034433G>T	ENST00000295454.3	+	3	464		c.e3-1		GABRB1_ENST00000509366.1_Splice_Site|GABRB1_ENST00000538619.1_Intron	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1						cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)	p.?(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTCCCCGGCAGGGCCCCCCGT	0.627																																							uc003gxh.2		NA																	1	Unknown(1)		lung(1)	ovary(2)	2						c.e3-1		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						103.0	108.0	106.0					4																	47034433		2203	4300	6503	SO:0001630	splice_region_variant	2560				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:47034433G>T		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.173-1G>T	4.37:g.47034433G>T						GABRB1_uc011bze.1_Intron|GABRB1_uc011bzd.1_Splice_Site_p.G58_splice|GABRB1_uc010igg.2_Splice_Site	p.G58_splice	NM_000812	NP_000803	P18505	GBRB1_HUMAN			3	547	+								B2R6U7|D6REL3|Q16166|Q8TBK3	Splice_Site	SNP	ENST00000295454.3	37	c.173_splice	CCDS3474.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533624	0.45073	.	.	ENSG00000163288	ENST00000513567;ENST00000295454	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1743	0.72899	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GABRB1	46729190	1.000000	0.71417	0.998000	0.56505	0.479000	0.33129	9.136000	0.94489	2.424000	0.82194	0.591000	0.81541	.		0.627	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1		Intron	34	155	1	0	3.62531e-18	0.004289	5.74623e-18	34	155				
GABRB1	2560	broad.mit.edu	37	4	47408916	47408916	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:47408916G>T	ENST00000295454.3	+	8	1345	c.1053G>T	c.(1051-1053)aaG>aaT	p.K351N	GABRB1_ENST00000538619.1_Missense_Mutation_p.K281N	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	351					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)	p.K351N(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCAATGAGAAGAATAAACTGG	0.393																																							uc003gxh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1051-1053)AAG>AAT		gamma-aminobutyric acid (GABA) A receptor, beta	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)						89.0	87.0	88.0					4																	47408916		2203	4300	6503	SO:0001583	missense	2560				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr4:47408916G>T		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.1053G>T	4.37:g.47408916G>T	ENSP00000295454:p.Lys351Asn					GABRB1_uc011bze.1_Missense_Mutation_p.K281N	p.K351N	NM_000812	NP_000803	P18505	GBRB1_HUMAN			8	1427	+			351			Cytoplasmic (Probable).		B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	ENST00000295454.3	37	c.1053G>T	CCDS3474.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.459986	0.43736	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	D;D	0.85411	-1.98;-1.98	4.74	4.74	0.60224	Neurotransmitter-gated ion-channel transmembrane domain (2);	2.592480	0.01473	N	0.016360	D	0.89622	0.6768	L	0.46885	1.475	0.80722	D	1	B;P	0.52577	0.002;0.954	B;P	0.57057	0.005;0.812	T	0.77264	-0.2652	10	0.12103	T	0.63	-19.7436	17.5289	0.87808	0.0:0.0:1.0:0.0	.	281;351	F5GXV5;P18505	.;GBRB1_HUMAN	N	351;281	ENSP00000295454:K351N;ENSP00000440330:K281N	ENSP00000295454:K351N	K	+	3	2	GABRB1	47103673	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	6.298000	0.72763	2.464000	0.83262	0.467000	0.42956	AAG		0.393	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1			9	17	1	0	5.4927e-09	0.004482	7.55787e-09	9	17				
PDGFRA	5156	broad.mit.edu	37	4	55127576	55127576	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:55127576C>A	ENST00000257290.5	+	3	695	c.364C>A	c.(364-366)Cca>Aca	p.P122T	PDGFRA_ENST00000508170.1_Missense_Mutation_p.P122T|FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	122	Ig-like C2-type 2.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.P122T(1)		NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	CATCTATGTGCCAGGTGAGTT	0.433			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	Pancreas(151;208 1913 7310 23853 37092)	uc003han.3		NA		Dom	yes		4	4q11-q13	5156	Mis|O|T	"""platelet-derived growth factor, alpha-receptor"""			"""L, M, O"""	FIP1L1		GIST|idiopathic hypereosinophilic syndrome		1	Substitution - Missense(1)		lung(1)	soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674						c.(364-366)CCA>ACA		platelet-derived growth factor receptor alpha	Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)						96.0	96.0	96.0					4																	55127576		2203	4300	6503	SO:0001583	missense	5156	Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	g.chr4:55127576C>A	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.364C>A	4.37:g.55127576C>A	ENSP00000257290:p.Pro122Thr	TSP Lung(21;0.16)				PDGFRA_uc003haa.2_Intron|PDGFRA_uc003hal.2_Missense_Mutation_p.P122T|PDGFRA_uc010igq.1_Intron|PDGFRA_uc003ham.2_RNA	p.P122T	NM_006206	NP_006197	P16234	PGFRA_HUMAN	GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		3	695	+	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		122			Extracellular (Potential).|Ig-like C2-type 2.		B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	c.364C>A	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189997	0.78789	.	.	ENSG00000134853	ENST00000257290;ENST00000508170;ENST00000512143;ENST00000503856;ENST00000504461;ENST00000512522	T;T;T;T;T;T	0.65364	1.85;1.85;-0.15;1.85;1.85;1.85	5.97	5.97	0.96955	Immunoglobulin subtype (1);Tyrosine-protein kinase, vascular endothelial growth factor receptor (VEGFR), N-terminal (1);Immunoglobulin-like fold (1);	0.000000	0.31922	U	0.006854	T	0.75917	0.3915	L	0.46741	1.465	0.80722	D	1	D;D	0.89917	0.996;1.0	P;D	0.83275	0.874;0.996	T	0.73248	-0.4043	10	0.46703	T	0.11	.	20.4135	0.99023	0.0:1.0:0.0:0.0	.	122;122	P16234;P16234-2	PGFRA_HUMAN;.	T	122;122;147;122;122;122	ENSP00000257290:P122T;ENSP00000425648:P122T;ENSP00000425626:P147T;ENSP00000425902:P122T;ENSP00000426472:P122T;ENSP00000425232:P122T	ENSP00000257290:P122T	P	+	1	0	PDGFRA	54822333	1.000000	0.71417	1.000000	0.80357	0.593000	0.36681	5.987000	0.70571	2.835000	0.97688	0.591000	0.81541	CCA		0.433	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206		41	105	1	0	6.2361e-21	0.007835	1.01373e-20	41	105				
LPHN3	23284	broad.mit.edu	37	4	62897253	62897253	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:62897253G>A	ENST00000514591.1	+	22	3641	c.3312G>A	c.(3310-3312)atG>atA	p.M1104I	LPHN3_ENST00000545650.1_Missense_Mutation_p.M1104I|LPHN3_ENST00000514996.1_Missense_Mutation_p.M1095I|LPHN3_ENST00000508693.1_Missense_Mutation_p.M1172I|LPHN3_ENST00000506700.1_Missense_Mutation_p.M1095I|LPHN3_ENST00000514157.1_Missense_Mutation_p.M1095I|LPHN3_ENST00000506746.1_Missense_Mutation_p.M1163I|LPHN3_ENST00000504896.1_Missense_Mutation_p.M1104I|LPHN3_ENST00000512091.2_Missense_Mutation_p.M1104I|LPHN3_ENST00000507164.1_Missense_Mutation_p.M1163I|LPHN3_ENST00000511324.1_Missense_Mutation_p.M1163I|LPHN3_ENST00000506720.1_Missense_Mutation_p.M1172I|LPHN3_ENST00000509896.1_Missense_Mutation_p.M1172I|LPHN3_ENST00000508946.1_Missense_Mutation_p.M1104I|LPHN3_ENST00000507625.1_Missense_Mutation_p.M1163I			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1082					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.M1104I(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CAGTCATCATGGCCTATCTCT	0.368																																							uc010ihh.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(3310-3312)ATG>ATA		latrophilin 3 precursor							127.0	119.0	121.0					4																	62897253		1842	4086	5928	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62897253G>A	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3312G>A	4.37:g.62897253G>A	ENSP00000422533:p.Met1104Ile					LPHN3_uc003hcq.3_Missense_Mutation_p.M1104I|LPHN3_uc003hct.2_Missense_Mutation_p.M488I	p.M1104I	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			20	3485	+			1082			Helical; Name=7; (Potential).		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.3312G>A	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.656471|4.656471	0.88154|0.88154	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000502815|ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.39997	.|1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05	5.49|5.49	5.49|5.49	0.81192|0.81192	.|GPCR, family 2-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.61337|0.61337	0.2339|0.2339	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.54964	.|0.969;0.969;0.962	.|D;D;D	.|0.70227	.|0.968;0.968;0.946	T|T	0.62572|0.62572	-0.6826|-0.6826	5|10	.|0.87932	.|D	.|0	.|.	19.3706|19.3706	0.94481|0.94481	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1104;1082;1104	.|E9PE04;Q9HAR2;Q9HAR2-2	.|.;LPHN3_HUMAN;.	S|I	553|1104;1104;1172;1163;1095;1104;1082;1104;1163;1172;1163;1095;1104;1104;1172;1163;1095	.|ENSP00000423388:M1104I;ENSP00000422533:M1104I;ENSP00000423787:M1172I;ENSP00000425033:M1163I;ENSP00000424120:M1095I;ENSP00000439831:M1104I;ENSP00000421476:M1163I;ENSP00000424030:M1172I;ENSP00000421372:M1163I;ENSP00000425201:M1095I;ENSP00000423434:M1104I;ENSP00000421627:M1104I;ENSP00000420931:M1172I;ENSP00000425884:M1163I;ENSP00000424258:M1095I	.|ENSP00000280009:M1104I	G|M	+|+	1|3	0|0	LPHN3|LPHN3	62579848|62579848	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.823000|9.823000	0.99369|0.99369	2.584000|2.584000	0.87258|0.87258	0.655000|0.655000	0.94253|0.94253	GGC|ATG		0.368	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			3	17	0	0	0	0.004672	0	3	17				
UGT2B4	7363	broad.mit.edu	37	4	70361447	70361447	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:70361447C>T	ENST00000305107.6	-	1	179	c.133G>A	c.(133-135)Gaa>Aaa	p.E45K	UGT2B4_ENST00000512583.1_Missense_Mutation_p.E45K|UGT2B4_ENST00000381096.3_Intron|UGT2B4_ENST00000506580.1_5'UTR	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	45					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.E45K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	TGGACAAGTTCATCCAGGATT	0.448																																							uc003hek.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(133-135)GAA>AAA		UDP glucuronosyltransferase 2B4 precursor							125.0	128.0	127.0					4																	70361447		2203	4300	6503	SO:0001583	missense	7363				estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70361447C>T	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.133G>A	4.37:g.70361447C>T	ENSP00000305221:p.Glu45Lys					UGT2B4_uc011cap.1_Intron|UGT2B4_uc003hel.3_Missense_Mutation_p.E45K	p.E45K	NM_021139	NP_066962	P06133	UD2B4_HUMAN			1	180	-			45					A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	ENST00000305107.6	37	c.133G>A	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727962	0.30593	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000510114	T;T;T	0.60797	0.16;0.16;0.16	2.41	2.41	0.29592	.	0.216159	0.31221	U	0.008037	T	0.59555	0.2202	M	0.80183	2.485	0.18873	N	0.999988	B;B	0.30406	0.278;0.087	B;B	0.36244	0.22;0.17	T	0.55736	-0.8094	10	0.40728	T	0.16	.	10.5565	0.45121	0.0:1.0:0.0:0.0	.	45;45	G5E9X8;P06133	.;UD2B4_HUMAN	K	45	ENSP00000421290:E45K;ENSP00000305221:E45K;ENSP00000421113:E45K	ENSP00000305221:E45K	E	-	1	0	UGT2B4	70396036	0.004000	0.15560	0.011000	0.14972	0.003000	0.03518	1.649000	0.37281	1.343000	0.45638	0.306000	0.20318	GAA		0.448	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139		24	84	0	0	0	0.005443	0	24	84				
UGT2B4	7363	broad.mit.edu	37	4	70361573	70361573	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:70361573T>A	ENST00000305107.6	-	1	53	c.7A>T	c.(7-9)Atg>Ttg	p.M3L	UGT2B4_ENST00000512583.1_Missense_Mutation_p.M3L|UGT2B4_ENST00000381096.3_Intron|UGT2B4_ENST00000506580.1_5'UTR	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	3					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.M3L(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	GTCCATTTCATAGACATCCTG	0.443																																							uc003hek.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(7-9)ATG>TTG		UDP glucuronosyltransferase 2B4 precursor							144.0	140.0	142.0					4																	70361573		2203	4300	6503	SO:0001583	missense	7363				estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70361573T>A	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.7A>T	4.37:g.70361573T>A	ENSP00000305221:p.Met3Leu					UGT2B4_uc011cap.1_Intron|UGT2B4_uc003hel.3_Missense_Mutation_p.M3L	p.M3L	NM_021139	NP_066962	P06133	UD2B4_HUMAN			1	54	-			3					A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	ENST00000305107.6	37	c.7A>T	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	T	0.093	-1.163596	0.01673	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000510114	T;T;T	0.58210	0.99;0.35;3.03	2.41	-4.82	0.03171	.	1.666990	0.04158	U	0.322444	T	0.25382	0.0617	N	0.05383	-0.06	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.26710	-1.0095	10	0.07030	T	0.85	.	6.3426	0.21330	0.0:0.3547:0.4652:0.1801	.	3;3	G5E9X8;P06133	.;UD2B4_HUMAN	L	3	ENSP00000421290:M3L;ENSP00000305221:M3L;ENSP00000421113:M3L	ENSP00000305221:M3L	M	-	1	0	UGT2B4	70396162	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-3.995000	0.00317	-1.781000	0.01277	-0.856000	0.03024	ATG		0.443	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139		22	121	0	0	0	0.002299	0	22	121				
SLC4A4	8671	broad.mit.edu	37	4	72332163	72332163	+	Silent	SNP	C	C	A	rs373128647		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:72332163C>A	ENST00000264485.5	+	13	1617	c.1500C>A	c.(1498-1500)ggC>ggA	p.G500G	SLC4A4_ENST00000512686.1_Silent_p.G456G|SLC4A4_ENST00000425175.1_Silent_p.G500G|SLC4A4_ENST00000340595.3_Silent_p.G456G|SLC4A4_ENST00000351898.6_Silent_p.G500G|SLC4A4_ENST00000514331.1_3'UTR	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	500					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.G500G(1)|p.G456G(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TATTTTAGGGCGTGTTGGAGA	0.413																																							uc003hfy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|kidney(1)|skin(1)	5						c.(1498-1500)GGC>GGA		solute carrier family 4, sodium bicarbonate							161.0	157.0	158.0					4																	72332163		2203	4300	6503	SO:0001819	synonymous_variant	8671					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity	g.chr4:72332163C>A	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.1500C>A	4.37:g.72332163C>A						SLC4A4_uc010iic.2_Silent_p.G500G|SLC4A4_uc010iib.2_Silent_p.G500G|SLC4A4_uc003hfz.2_Silent_p.G500G|SLC4A4_uc003hgc.3_Silent_p.G456G|SLC4A4_uc010iid.2_Intron|SLC4A4_uc003hga.2_Silent_p.G378G|SLC4A4_uc003hgb.3_Silent_p.G456G	p.G500G	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		13	1617	+			500			Extracellular (Potential).		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	37	c.1500C>A	CCDS43236.1																																																																																				0.413	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759		14	115	1	0	1.5739e-10	0.004007	2.23609e-10	14	115				
CDS1	1040	broad.mit.edu	37	4	85560132	85560132	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:85560132T>A	ENST00000295887.5	+	9	1289	c.866T>A	c.(865-867)gTg>gAg	p.V289E		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.V289E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		TCCACAGTTGTGTTTGGATTC	0.299																																							uc011ccv.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|breast(1)	4						c.(865-867)GTG>GAG		CDP-diacylglycerol synthase 1							107.0	103.0	104.0					4																	85560132		2202	4297	6499	SO:0001583	missense	1040				signal transduction|visual perception	endoplasmic reticulum membrane|integral to membrane	diacylglycerol cholinephosphotransferase activity|phosphatidate cytidylyltransferase activity	g.chr4:85560132T>A	U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.866T>A	4.37:g.85560132T>A	ENSP00000295887:p.Val289Glu					CDS1_uc010ike.1_Missense_Mutation_p.V93E	p.V289E	NM_001263	NP_001254	Q92903	CDS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00101)	9	1364	+		Hepatocellular(203;0.114)	289			Helical; (Potential).		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000295887.5	37	c.866T>A	CCDS3608.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.561870	0.86335	.	.	ENSG00000163624	ENST00000295887	T	0.51071	0.72	4.63	4.63	0.57726	.	0.337163	0.31636	N	0.007314	T	0.72510	0.3469	M	0.91196	3.185	0.53688	D	0.999976	D	0.53619	0.961	P	0.62885	0.908	T	0.80139	-0.1507	10	0.87932	D	0	-1.4015	14.2283	0.65875	0.0:0.0:0.0:1.0	.	289	Q92903	CDS1_HUMAN	E	289	ENSP00000295887:V289E	ENSP00000295887:V289E	V	+	2	0	CDS1	85779156	0.965000	0.33210	0.997000	0.53966	0.978000	0.69477	4.955000	0.63638	1.950000	0.56595	0.455000	0.32223	GTG		0.299	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252817.2			9	20	0	0	0	0.006214	0	9	20				
PDHA2	5161	broad.mit.edu	37	4	96762200	96762200	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:96762200G>T	ENST00000295266.4	+	1	962	c.899G>T	c.(898-900)cGt>cTt	p.R300L		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	300					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)	p.R300L(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		GTCAGTTATCGTACACGAGAA	0.433																																							uc003htr.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(898-900)CGT>CTT		pyruvate dehydrogenase E1 alpha 2 precursor	NADH(DB00157)						100.0	97.0	98.0					4																	96762200		2203	4300	6503	SO:0001583	missense	5161				glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity	g.chr4:96762200G>T		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.899G>T	4.37:g.96762200G>T	ENSP00000295266:p.Arg300Leu						p.R300L	NM_005390	NP_005381	P29803	ODPAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	1	962	+		Hepatocellular(203;0.114)	300					B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	c.899G>T	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559240	0.65538	.	.	ENSG00000163114	ENST00000295266	D	0.97772	-4.53	4.91	4.91	0.64330	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.99275	0.9747	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98498	1.0613	10	0.87932	D	0	-10.2397	16.0034	0.80327	0.0:0.0:1.0:0.0	.	300	P29803	ODPAT_HUMAN	L	300	ENSP00000295266:R300L	ENSP00000295266:R300L	R	+	2	0	PDHA2	96981223	1.000000	0.71417	0.057000	0.19452	0.431000	0.31685	6.903000	0.75703	2.733000	0.93635	0.467000	0.42956	CGT		0.433	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1			14	69	1	0	2.61681e-11	0.00245	3.77924e-11	14	69				
ADH4	127	broad.mit.edu	37	4	100052734	100052734	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:100052734G>T	ENST00000265512.7	-	6	838	c.764C>A	c.(763-765)cCg>cAg	p.P255Q	RP11-696N14.1_ENST00000500358.2_RNA|ADH4_ENST00000505590.1_Missense_Mutation_p.P274Q|ADH4_ENST00000423445.1_Missense_Mutation_p.P274Q|ADH4_ENST00000508393.1_Missense_Mutation_p.P274Q	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	255					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)	p.P255Q(1)		NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		TTCCTGGATCGGTTTATGTAA	0.443																																							uc003hun.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(763-765)CCG>CAG		class II alcohol dehydrogenase, pi subunit	NADH(DB00157)						122.0	122.0	122.0					4																	100052734		2203	4300	6503	SO:0001583	missense	127				alcohol catabolic process|cellular aldehyde metabolic process|ethanol oxidation|quinone cofactor metabolic process|retinol metabolic process|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	alcohol dehydrogenase activity, zinc-dependent|all-trans retinal binding|benzaldehyde dehydrogenase activity|NAD binding|NADPH:quinone reductase activity|retinol binding|retinol dehydrogenase activity|zinc ion binding	g.chr4:100052734G>T	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.764C>A	4.37:g.100052734G>T	ENSP00000265512:p.Pro255Gln					uc003hum.1_Intron|ADH4_uc011ced.1_Missense_Mutation_p.P274Q	p.P255Q	NM_000670	NP_000661	P08319	ADH4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)	6	840	-			255					A8K470|B4DIE7|C9J4A9|Q8TCD7	Missense_Mutation	SNP	ENST00000265512.7	37	c.764C>A	CCDS34032.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457683	0.43634	.	.	ENSG00000198099	ENST00000508393;ENST00000265512;ENST00000423445;ENST00000505590	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	4.39	3.55	0.40652	Alcohol dehydrogenase, C-terminal (1);	0.069376	0.56097	D	0.000021	T	0.50820	0.1638	M	0.89214	3.015	0.54753	D	0.99998	D;D	0.89917	0.998;1.0	D;D	0.97110	0.917;1.0	T	0.60177	-0.7314	10	0.87932	D	0	-7.0211	12.4537	0.55691	0.0811:0.0:0.9189:0.0	.	274;255	P08319-2;P08319	.;ADH4_HUMAN	Q	274;255;274;274	ENSP00000424630:P274Q;ENSP00000265512:P255Q;ENSP00000397939:P274Q;ENSP00000425416:P274Q	ENSP00000265512:P255Q	P	-	2	0	ADH4	100271757	1.000000	0.71417	0.222000	0.23844	0.018000	0.09664	6.721000	0.74728	1.081000	0.41110	0.650000	0.86243	CCG		0.443	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670		13	25	1	0	0.00010058	0.013537	0.000115634	13	25				
SLC9B1	150159	broad.mit.edu	37	4	103822347	103822347	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:103822347C>A	ENST00000296422.7	-	12	1616	c.1475G>T	c.(1474-1476)gGg>gTg	p.G492V	SLC9B1_ENST00000394789.3_Intron|SLC9B1_ENST00000512651.2_5'UTR	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	492					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.G492V(1)									CATTTTAGGCCCCAGAATGCC	0.423																																							uc003hww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1474-1476)GGG>GTG		Na+/H+ exchanger domain containing 1 isoform 1							95.0	97.0	96.0					4																	103822347		1598	3178	4776	SO:0001583	missense	150159					integral to membrane	solute:hydrogen antiporter activity	g.chr4:103822347C>A	AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.1475G>T	4.37:g.103822347C>A	ENSP00000296422:p.Gly492Val					NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Missense_Mutation_p.G265V	p.G492V	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)	12	1597	-		Hepatocellular(203;0.217)	492			Helical; (Potential).		A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Missense_Mutation	SNP	ENST00000296422.7	37	c.1475G>T	CCDS34041.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225830	0.39300	.	.	ENSG00000164037	ENST00000296422	T	0.27256	1.68	3.91	3.91	0.45181	.	0.000000	0.85682	D	0.000000	T	0.51702	0.1690	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59005	-0.7535	9	0.66056	D	0.02	-9.509	15.1661	0.72825	0.0:1.0:0.0:0.0	.	492	Q4ZJI4	SL9B1_HUMAN	V	492	ENSP00000296422:G492V	ENSP00000296422:G492V	G	-	2	0	SLC9B1	104041796	0.998000	0.40836	1.000000	0.80357	0.111000	0.19643	5.040000	0.64191	2.156000	0.67533	0.484000	0.47621	GGG		0.423	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173		8	159	1	0	0.00448238	0.004482	0.00482771	8	159				
BDH2	56898	broad.mit.edu	37	4	104004086	104004086	+	Splice_Site	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:104004086C>A	ENST00000296424.4	-	8	653	c.533G>T	c.(532-534)gGa>gTa	p.G178V		NM_020139.3	NP_064524.3	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	178					epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|heme metabolic process (GO:0042168)|iron ion homeostasis (GO:0055072)|siderophore biosynthetic process (GO:0019290)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)	p.G178V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		ATCAACTGTTCCTAAATCAAA	0.343																																							uc003hwz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(532-534)GGA>GTA		3-hydroxybutyrate dehydrogenase, type 2							172.0	175.0	174.0					4																	104004086		2203	4300	6503	SO:0001630	splice_region_variant	56898				fatty acid beta-oxidation|heme metabolic process|iron ion homeostasis|siderophore biosynthetic process	cytoplasm	3-hydroxybutyrate dehydrogenase activity|NAD binding|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor	g.chr4:104004086C>A	AF164790	CCDS3663.1	4q24	2011-09-14			ENSG00000164039	ENSG00000164039	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	32389	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 15C, member 1"""		"""dehydrogenase/reductase (SDR family) member 6"""	DHRS6		16380372, 19027726	Standard	XM_005263140		Approved	UCPA-OR, FLJ13261, UNQ6308, PRO20933, SDR15C1	uc003hwz.3	Q9BUT1	OTTHUMG00000074039	ENST00000296424.4:c.533-1G>T	4.37:g.104004086C>A						BDH2_uc003hxa.2_RNA	p.G178V	NM_020139	NP_064524	Q9BUT1	BDH2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)	8	638	-		Hepatocellular(203;0.217)	178					A8K295|B4DUF6|Q503A0|Q6IA46|Q6UWD3|Q9H8S8|Q9NRX8	Missense_Mutation	SNP	ENST00000296424.4	37	c.533G>T	CCDS3663.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.562935	0.65538	.	.	ENSG00000164039	ENST00000296424	T	0.64618	-0.11	4.7	3.85	0.44370	NAD(P)-binding domain (1);	0.050486	0.85682	D	0.000000	D	0.83092	0.5179	M	0.93241	3.395	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	D	0.87510	0.2439	10	0.87932	D	0	.	14.0895	0.64980	0.0:0.8477:0.1523:0.0	.	178	Q9BUT1	BDH2_HUMAN	V	178	ENSP00000296424:G178V	ENSP00000296424:G178V	G	-	2	0	BDH2	104223535	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	4.798000	0.62510	1.074000	0.40909	0.563000	0.77884	GGA		0.343	BDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157159.2	NM_020139	Missense_Mutation	44	73	1	0	7.90463e-13	0.00361	1.16815e-12	44	73				
ANK2	287	broad.mit.edu	37	4	114208779	114208779	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:114208779C>T	ENST00000357077.4	+	19	2151	c.2098C>T	c.(2098-2100)Cac>Tac	p.H700Y	ANK2_ENST00000506722.1_Missense_Mutation_p.H679Y|ANK2_ENST00000264366.6_Missense_Mutation_p.H700Y|ANK2_ENST00000394537.3_Missense_Mutation_p.H700Y	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	700					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.H700Y(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CACATCCTTACACCTTGCAGC	0.378																																							uc003ibe.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(2098-2100)CAC>TAC		ankyrin 2 isoform 1							122.0	105.0	110.0					4																	114208779		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114208779C>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2098C>T	4.37:g.114208779C>T	ENSP00000349588:p.His700Tyr					ANK2_uc003ibd.3_Missense_Mutation_p.H679Y|ANK2_uc003ibf.3_Missense_Mutation_p.H700Y|ANK2_uc003ibc.2_Missense_Mutation_p.H676Y|ANK2_uc011cgb.1_Missense_Mutation_p.H715Y	p.H700Y	NM_001148	NP_001139	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	19	2198	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	700			ANK 21.		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.2098C>T	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435581	0.62955	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.71222	-0.48;-0.48;-0.48;-0.48;-0.55;-0.48;-0.48	5.49	5.49	0.81192	Ankyrin repeat-containing domain (3);	0.000000	0.53938	D	0.000041	D	0.85217	0.5646	M	0.78285	2.405	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.988	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.977	D	0.86507	0.1807	10	0.72032	D	0.01	.	19.3884	0.94566	0.0:1.0:0.0:0.0	.	700;700;700;679;679	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	Y	679;646;679;715;700;700;700;679	ENSP00000423799:H679Y;ENSP00000421011:H646Y;ENSP00000421067:H679Y;ENSP00000424722:H715Y;ENSP00000378044:H700Y;ENSP00000349588:H700Y;ENSP00000264366:H700Y	ENSP00000264366:H700Y	H	+	1	0	ANK2	114428228	1.000000	0.71417	1.000000	0.80357	0.047000	0.14425	7.780000	0.85658	2.550000	0.86006	0.650000	0.86243	CAC		0.378	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		10	34	0	0	0	0.010729	0	10	34				
UGT8	7368	broad.mit.edu	37	4	115544547	115544547	+	Missense_Mutation	SNP	C	C	T	rs371402834		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:115544547C>T	ENST00000310836.6	+	2	1033	c.511C>T	c.(511-513)Cct>Tct	p.P171S	UGT8_ENST00000394511.3_Missense_Mutation_p.P171S	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	171					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)	p.P171S(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		AGTGGGTGCTCCTGCTCCATT	0.443																																							uc003ibs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(511-513)CCT>TCT		UDP-galactose-ceramide galactosyltransferase 8		C	SER/PRO,SER/PRO	0,4406		0,0,2203	132.0	126.0	128.0		511,511	4.5	0.8	4		128	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	UGT8	NM_001128174.1,NM_003360.3	74,74	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	171/542,171/542	115544547	1,13005	2203	4300	6503	SO:0001583	missense	7368				central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity	g.chr4:115544547C>T	AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.511C>T	4.37:g.115544547C>T	ENSP00000311648:p.Pro171Ser					UGT8_uc003ibt.2_Missense_Mutation_p.P171S|UGT8_uc011cge.1_RNA	p.P171S	NM_001128174	NP_001121646	Q16880	CGT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000632)	2	1033	+		Ovarian(17;0.156)	171					B3KXU7|O00196	Missense_Mutation	SNP	ENST00000310836.6	37	c.511C>T	CCDS3705.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131491	0.77549	0.0	1.16E-4	ENSG00000174607	ENST00000310836;ENST00000394511	T;T	0.08102	3.13;3.13	5.34	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.28632	0.0709	M	0.76170	2.325	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.03463	-1.1034	10	0.72032	D	0.01	.	14.4744	0.67537	0.0:0.9286:0.0:0.0714	.	171	Q16880	CGT_HUMAN	S	171	ENSP00000311648:P171S;ENSP00000378019:P171S	ENSP00000311648:P171S	P	+	1	0	UGT8	115763996	1.000000	0.71417	0.752000	0.31206	0.989000	0.77384	7.749000	0.85096	1.388000	0.46506	0.650000	0.86243	CCT		0.443	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256426.2	NM_003360		15	69	0	0	0	0.003163	0	15	69				
NDST4	64579	broad.mit.edu	37	4	115749058	115749058	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:115749058G>T	ENST00000264363.2	-	14	3211	c.2533C>A	c.(2533-2535)Cat>Aat	p.H845N		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	845	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.H845N(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TCCACATTATGATCTCGGTAG	0.413																																							uc003ibu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(2533-2535)CAT>AAT		heparan sulfate N-deacetylase/N-sulfotransferase							106.0	102.0	103.0					4																	115749058		2203	4300	6503	SO:0001583	missense	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115749058G>T	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.2533C>A	4.37:g.115749058G>T	ENSP00000264363:p.His845Asn					NDST4_uc010imw.2_RNA	p.H845N	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	14	3212	-		Ovarian(17;0.156)	845			Lumenal (Potential).|Heparan sulfate N-sulfotransferase 4.		Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	c.2533C>A	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784189	0.90282	.	.	ENSG00000138653	ENST00000264363	T	0.56444	0.46	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.61489	0.2351	M	0.76170	2.325	0.80722	D	1	B	0.22541	0.071	B	0.34301	0.179	T	0.61262	-0.7098	10	0.46703	T	0.11	.	18.7903	0.91971	0.0:0.0:1.0:0.0	.	845	Q9H3R1	NDST4_HUMAN	N	845	ENSP00000264363:H845N	ENSP00000264363:H845N	H	-	1	0	NDST4	115968507	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.357000	0.97099	2.446000	0.82766	0.544000	0.68410	CAT		0.413	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		4	19	1	0	0.00909568	0.009096	0.00957512	4	19				
FAT4	79633	broad.mit.edu	37	4	126240578	126240578	+	Silent	SNP	C	C	T	rs550025709		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:126240578C>T	ENST00000394329.3	+	1	3025	c.3012C>T	c.(3010-3012)acC>acT	p.T1004T		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1004	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T1004T(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATGAAGTCACCCTTTCTGAGT	0.408																																							uc003ifj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(3010-3012)ACC>ACT		FAT tumor suppressor homolog 4 precursor							118.0	112.0	114.0					4																	126240578		1892	4114	6006	SO:0001819	synonymous_variant	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126240578C>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3012C>T	4.37:g.126240578C>T							p.T1004T	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN			1	3012	+			1004			Cadherin 10.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	c.3012C>T	CCDS3732.3																																																																																				0.408	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		8	107	0	0	0	0.00308	0	8	107				
PCDH10	57575	broad.mit.edu	37	4	134071449	134071449	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:134071449G>T	ENST00000264360.5	+	1	980	c.154G>T	c.(154-156)Ggg>Tgg	p.G52W	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	52	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G52W(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TTCGGCTCGCGGGTTTCAGAC	0.522																																							uc003iha.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(154-156)GGG>TGG		protocadherin 10 isoform 1 precursor							100.0	101.0	100.0					4																	134071449		2203	4300	6503	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134071449G>T	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.154G>T	4.37:g.134071449G>T	ENSP00000264360:p.Gly52Trp					uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.G52W	p.G52W	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	980	+			52			Cadherin 1.|Extracellular (Potential).		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.154G>T	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735414	0.49045	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.31247	1.5	4.77	-2.74	0.05932	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.568307	0.14595	N	0.310037	T	0.42854	0.1221	M	0.75447	2.3	0.30354	N	0.784459	D;P	0.56968	0.978;0.952	P;P	0.59357	0.753;0.856	T	0.46359	-0.9197	10	0.66056	D	0.02	.	6.4676	0.21990	0.3755:0.3283:0.2962:0.0	.	52;52	Q9P2E7;Q96SF0	PCD10_HUMAN;.	W	52	ENSP00000264360:G52W	ENSP00000264360:G52W	G	+	1	0	PCDH10	134290899	1.000000	0.71417	0.994000	0.49952	0.913000	0.54294	1.734000	0.38166	-0.267000	0.09325	-0.378000	0.06908	GGG		0.522	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		25	69	1	0	4.7796e-09	0.004656	6.60265e-09	25	69				
DCHS2	54798	broad.mit.edu	37	4	155295093	155295093	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:155295093C>A	ENST00000357232.4	-	4	440	c.441G>T	c.(439-441)atG>atT	p.M147I	DCHS2_ENST00000339452.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	147	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.M147I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTAAATGTGTCATTCTCTGCT	0.338																																							uc003inw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(439-441)ATG>ATT		dachsous 2 isoform 1							139.0	126.0	130.0					4																	155295093		2203	4300	6503	SO:0001583	missense	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155295093C>A	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.441G>T	4.37:g.155295093C>A	ENSP00000349768:p.Met147Ile					DCHS2_uc003inx.2_Intron	p.M147I	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	4	441	-	all_hematologic(180;0.208)	Renal(120;0.0854)	147			Cadherin 1.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	c.441G>T	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	3.503	-0.101342	0.06967	.	.	ENSG00000197410	ENST00000357232	T	0.51817	0.69	2.33	0.278	0.15673	Cadherin (4);Cadherin-like (1);	1.783210	0.04286	U	0.344717	T	0.23289	0.0563	N	0.03177	-0.4	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14227	-1.0480	10	0.38643	T;T	0.18;0.18	.	3.0525	0.06174	0.2343:0.5446:0.0:0.2211	.	147	Q6V1P9	PCD23_HUMAN	I	147	ENSP00000349768:M147I	ENSP00000349768:M147I;ENSP00000349768:M147I	M	-	3	0	DCHS2	155514543	0.003000	0.15002	0.000000	0.03702	0.021000	0.10359	1.100000	0.31025	0.039000	0.15632	0.460000	0.39030	ATG		0.338	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		8	32	1	0	6.40141e-05	0.010729	7.44523e-05	8	32				
GALNTL6	442117	broad.mit.edu	37	4	173804035	173804035	+	Nonsense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:173804035G>T	ENST00000506823.1	+	8	1675	c.1018G>T	c.(1018-1020)Gaa>Taa	p.E340*	GALNTL6_ENST00000508122.1_Nonsense_Mutation_p.E323*	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	340	Catalytic subdomain B.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.E340*(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						CTGGGGAGGAGAACAGTATGA	0.423																																							uc003isv.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(2)|ovary(1)|skin(1)	4						c.(1018-1020)GAA>TAA		N-acetylgalactosaminyltransferase-like 6							144.0	149.0	147.0					4																	173804035		2203	4300	6503	SO:0001587	stop_gained	442117					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr4:173804035G>T		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.1018G>T	4.37:g.173804035G>T	ENSP00000423313:p.Glu340*						p.E340*	NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN			8	1754	+			340			Catalytic subdomain B.|Lumenal (Potential).		Q2L4S6	Nonsense_Mutation	SNP	ENST00000506823.1	37	c.1018G>T	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	G	37	6.497328	0.97616	.	.	ENSG00000174473	ENST00000506823;ENST00000508122	.	.	.	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.2983	0.94132	0.0:0.0:1.0:0.0	.	.	.	.	X	340;323	.	ENSP00000423313:E340X	E	+	1	0	GALNTL6	174040610	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.624000	0.98398	2.567000	0.86603	0.462000	0.41574	GAA		0.423	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845		21	89	1	0	7.87624e-14	0.00278	1.18909e-13	21	89				
GPM6A	2823	broad.mit.edu	37	4	176622815	176622815	+	Silent	SNP	A	A	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:176622815A>C	ENST00000280187.7	-	3	186	c.141T>G	c.(139-141)ggT>ggG	p.G47G	GPM6A_ENST00000515090.1_Silent_p.G40G|GPM6A_ENST00000506894.1_Silent_p.G36G|GPM6A_ENST00000393658.2_Silent_p.G47G	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	47					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)	p.G47G(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		GCGCTTCATGACCGCAGCCAC	0.493																																							uc003iuf.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(139-141)GGT>GGG		glycoprotein M6A isoform 2							148.0	139.0	142.0					4																	176622815		2203	4300	6503	SO:0001819	synonymous_variant	2823					cell surface|integral to membrane		g.chr4:176622815A>C		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.141T>G	4.37:g.176622815A>C						GPM6A_uc011ckj.1_Silent_p.G40G|GPM6A_uc003iug.2_Silent_p.G47G|GPM6A_uc003iuh.2_Silent_p.G36G	p.G47G	NM_201591	NP_963885	P51674	GPM6A_HUMAN		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)	2	945	-		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	47			Extracellular (Potential).		B7Z642|E9PHI5|Q92602	Silent	SNP	ENST00000280187.7	37	c.141T>G	CCDS3824.1																																																																																				0.493	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362163.1			16	93	0	0	0	0.004007	0	16	93				
ASB5	140458	broad.mit.edu	37	4	177136756	177136756	+	Nonsense_Mutation	SNP	G	G	A	rs534160855		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:177136756G>A	ENST00000296525.3	-	7	1098	c.985C>T	c.(985-987)Cga>Tga	p.R329*	ASB5_ENST00000512254.1_Nonsense_Mutation_p.R276*	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	329	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.R329*(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		CTGTTTTATCGATACTGTAAG	0.328																																							uc003iuq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(2)	2						c.(985-987)CGA>TGA		ankyrin repeat and SOCS box-containing protein							89.0	83.0	85.0					4																	177136756		2203	4300	6503	SO:0001587	stop_gained	140458				intracellular signal transduction			g.chr4:177136756G>A	AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.985C>T	4.37:g.177136756G>A	ENSP00000296525:p.Arg329*					ASB5_uc003iup.1_Nonsense_Mutation_p.R276*	p.R329*	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)	7	1001	-		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	329			SOCS box.		Q8N7B5	Nonsense_Mutation	SNP	ENST00000296525.3	37	c.985C>T	CCDS3827.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968326	0.92855	.	.	ENSG00000164122	ENST00000296525;ENST00000512254	.	.	.	5.26	5.26	0.73747	.	0.205916	0.41938	D	0.000799	.	.	.	.	.	.	0.36517	D	0.86995	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.717	0.62702	0.0:0.0:0.807:0.193	.	.	.	.	X	329;276	.	ENSP00000296525:R329X	R	-	1	2	ASB5	177373750	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	4.713000	0.61895	2.449000	0.82847	0.591000	0.81541	CGA		0.328	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362344.1			4	30	0	0	0	0.000602	0	4	30				
CYP4V2	285440	broad.mit.edu	37	4	187115681	187115681	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:187115681C>G	ENST00000378802.4	+	2	546	c.242C>G	c.(241-243)aCa>aGa	p.T81R		NM_207352.3	NP_997235.3	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily V, polypeptide 2	81					fatty acid omega-oxidation (GO:0010430)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.T81R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)|stomach(2)	20		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		ATTGAGTACACAGAGGAATAC	0.443																																							uc003iyw.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(241-243)ACA>AGA		cytochrome P450, family 4, subfamily v,							94.0	98.0	96.0					4																	187115681		2203	4300	6503	SO:0001583	missense	285440				response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	g.chr4:187115681C>G	AK022114	CCDS34119.1	4q35.2	2004-07-05			ENSG00000145476	ENSG00000145476		"""Cytochrome P450s"""	23198	protein-coding gene	gene with protein product		608614				15042513	Standard	NM_207352		Approved	CYP4AH1	uc003iyw.4	Q6ZWL3	OTTHUMG00000160379	ENST00000378802.4:c.242C>G	4.37:g.187115681C>G	ENSP00000368079:p.Thr81Arg						p.T81R	NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)	2	546	+		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)	81					B7U6W2|Q6ZTM4	Missense_Mutation	SNP	ENST00000378802.4	37	c.242C>G	CCDS34119.1	.	.	.	.	.	.	.	.	.	.	C	6.358	0.434133	0.12045	.	.	ENSG00000145476	ENST00000378802;ENST00000274118	T	0.66460	-0.21	5.55	3.8	0.43715	.	0.551444	0.18494	N	0.139569	T	0.46210	0.1381	N	0.10945	0.07	0.24039	N	0.996088	B	0.17465	0.022	B	0.18263	0.021	T	0.13710	-1.0499	10	0.11485	T	0.65	.	15.0215	0.71635	0.0:0.7298:0.2702:0.0	.	81	Q6ZWL3	CP4V2_HUMAN	R	81;59	ENSP00000368079:T81R	ENSP00000274118:T59R	T	+	2	0	CYP4V2	187352675	0.002000	0.14202	0.223000	0.23860	0.673000	0.39480	1.610000	0.36869	0.694000	0.31654	0.563000	0.77884	ACA		0.443	CYP4V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360398.1	XM_209612		18	62	0	0	0	0.007413	0	18	62				
FAT1	2195	broad.mit.edu	37	4	187557842	187557842	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr4:187557842C>A	ENST00000441802.2	-	5	4078	c.3869G>T	c.(3868-3870)aGc>aTc	p.S1290I		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1290	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S1290I(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GTCTTCGATGCTGTAGGAGAT	0.493										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(3868-3870)AGC>ATC		FAT tumor suppressor 1 precursor							240.0	240.0	240.0					4																	187557842		1900	4122	6022	SO:0001583	missense	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187557842C>A	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.3869G>T	4.37:g.187557842C>A	ENSP00000406229:p.Ser1290Ile	HNSCC(5;0.00058)					p.S1290I	NM_005245	NP_005236	Q14517	FAT1_HUMAN			5	4057	-			1290			Extracellular (Potential).|Cadherin 11.			Missense_Mutation	SNP	ENST00000441802.2	37	c.3869G>T	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779437	0.90195	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.56103	0.48	5.31	5.31	0.75309	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.78761	0.4334	M	0.90252	3.1	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.82641	-0.0357	10	0.72032	D	0.01	.	19.1686	0.93567	0.0:1.0:0.0:0.0	.	1290	Q14517	FAT1_HUMAN	I	1290	ENSP00000406229:S1290I	ENSP00000260147:S1290I	S	-	2	0	FAT1	187794836	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	5.841000	0.69409	2.770000	0.95276	0.655000	0.94253	AGC		0.493	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		50	282	1	0	1.83081e-24	0.00361	3.02538e-24	50	282				
PLEKHG4B	153478	broad.mit.edu	37	5	163534	163534	+	Missense_Mutation	SNP	C	C	A	rs144505991	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:163534C>A	ENST00000283426.6	+	11	2329	c.2279C>A	c.(2278-2280)aCt>aAt	p.T760N		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	760							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T760N(1)		endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		GTAACCAGCACTGTAGCCACA	0.627																																							uc003jak.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(2278-2280)ACT>AAT		pleckstrin homology domain containing, family G							43.0	52.0	49.0					5																	163534		2203	4299	6502	SO:0001583	missense	153478				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr5:163534C>A	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.2279C>A	5.37:g.163534C>A	ENSP00000283426:p.Thr760Asn						p.T760N	NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)	11	2329	+			760						Missense_Mutation	SNP	ENST00000283426.6	37	c.2279C>A	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	C	6.089	0.384631	0.11524	.	.	ENSG00000153404	ENST00000283426	T	0.27402	1.67	3.01	0.676	0.17958	.	.	.	.	.	T	0.13500	0.0327	N	0.14661	0.345	0.19575	N	0.999961	B	0.21520	0.057	B	0.16289	0.015	T	0.29671	-1.0004	9	0.14252	T	0.57	.	4.4076	0.11416	0.2235:0.4053:0.3712:0.0	.	760	Q96PX9	PKH4B_HUMAN	N	760	ENSP00000283426:T760N	ENSP00000283426:T760N	T	+	2	0	PLEKHG4B	216534	0.173000	0.23056	0.077000	0.20336	0.040000	0.13550	0.550000	0.23345	1.224000	0.43551	0.313000	0.20887	ACT		0.627	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909		66	72	1	0	1.02487e-32	0.00361	1.73459e-32	66	72				
LPCAT1	79888	broad.mit.edu	37	5	1474683	1474683	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:1474683C>A	ENST00000283415.3	-	10	1149	c.1017G>T	c.(1015-1017)cgG>cgT	p.R339R		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	339					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)	p.R339R(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		ACCCGAGGCCCCGCACGAGCC	0.612																																							uc003jcm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1015-1017)CGG>CGT		lysophosphatidylcholine acyltransferase 1							38.0	39.0	39.0					5																	1474683		2203	4300	6503	SO:0001819	synonymous_variant	79888				phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding	g.chr5:1474683C>A	BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.1017G>T	5.37:g.1474683C>A							p.R339R	NM_024830	NP_079106	Q8NF37	PCAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)	10	1134	-			339			Lumenal (Potential).		Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Silent	SNP	ENST00000283415.3	37	c.1017G>T	CCDS3864.1																																																																																				0.612	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304032.1	NM_024830		9	22	1	0	1.12685e-05	0.004482	1.36275e-05	9	22				
ADAMTS16	170690	broad.mit.edu	37	5	5232586	5232586	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:5232586G>A	ENST00000274181.7	+	12	1945	c.1807G>A	c.(1807-1809)Gga>Aga	p.G603R		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	603	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G603R(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CAGGACCTGCGGAGGGGGAGT	0.567																																							uc003jdl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.(1807-1809)GGA>AGA		ADAM metallopeptidase with thrombospondin type 1							97.0	110.0	106.0					5																	5232586		2150	4258	6408	SO:0001583	missense	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5232586G>A	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1807G>A	5.37:g.5232586G>A	ENSP00000274181:p.Gly603Arg					ADAMTS16_uc003jdk.1_Missense_Mutation_p.G603R|ADAMTS16_uc010itk.1_5'Flank	p.G603R	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN			12	1945	+			603			TSP type-1 1.		C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	c.1807G>A	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197824	0.79015	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.70749	-0.51	5.18	5.18	0.71444	.	0.063720	0.64402	D	0.000007	D	0.90854	0.7127	H	0.98786	4.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.947;0.993	D	0.94618	0.7810	10	0.87932	D	0	.	17.4795	0.87669	0.0:0.0:1.0:0.0	.	603;603	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	R	603	ENSP00000274181:G603R	ENSP00000274181:G603R	G	+	1	0	ADAMTS16	5285586	1.000000	0.71417	0.954000	0.39281	0.461000	0.32589	9.379000	0.97198	2.418000	0.82041	0.491000	0.48974	GGA		0.567	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		59	84	0	0	0	0.00361	0	59	84				
ICE1	23379	broad.mit.edu	37	5	5454709	5454709	+	Missense_Mutation	SNP	A	A	T	rs34789072		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:5454709A>T	ENST00000296564.7	+	11	871	c.649A>T	c.(649-651)Aca>Tca	p.T217S	KIAA0947_ENST00000512608.1_3'UTR	NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		217					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.T217S(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CTGTGTAAACACAACACACAG	0.453																																							uc003jdm.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(649-651)ACA>TCA		hypothetical protein LOC23379							58.0	63.0	61.0					5																	5454709		1952	4143	6095	SO:0001583	missense	23379							g.chr5:5454709A>T																												ENST00000296564.7:c.649A>T	5.37:g.5454709A>T	ENSP00000296564:p.Thr217Ser						p.T217S	NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN			11	871	+			217					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	c.649A>T	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.041266	0.35989	.	.	ENSG00000164151	ENST00000296564	T	0.10099	2.91	5.25	1.42	0.22433	.	0.408150	0.21740	N	0.069836	T	0.04182	0.0116	N	0.19112	0.55	0.20926	N	0.999821	P	0.42203	0.773	B	0.38428	0.273	T	0.25847	-1.0120	10	0.02654	T	1	-14.6329	3.1425	0.06461	0.5347:0.0:0.1676:0.2977	.	217	Q9Y2F5	K0947_HUMAN	S	217	ENSP00000296564:T217S	ENSP00000296564:T217S	T	+	1	0	KIAA0947	5507709	0.974000	0.33945	0.018000	0.16275	0.553000	0.35397	0.930000	0.28858	0.062000	0.16340	-0.297000	0.09499	ACA		0.453	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			5	27	0	0	0	0.001168	0	5	27				
TRIO	7204	broad.mit.edu	37	5	14462918	14462918	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:14462918G>T	ENST00000344204.4	+	36	5575	c.5551G>T	c.(5551-5553)Ggg>Tgg	p.G1851W	TRIO_ENST00000537187.1_Missense_Mutation_p.G1851W|TRIO_ENST00000515710.1_3'UTR	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1851					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G1851W(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CTCCTCCTCGGGGATGCAGAG	0.612																																							uc003jff.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(5551-5553)GGG>TGG		triple functional domain (PTPRF interacting)							70.0	80.0	76.0					5																	14462918		2203	4300	6503	SO:0001583	missense	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14462918G>T	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.5551G>T	5.37:g.14462918G>T	ENSP00000339299:p.Gly1851Trp					TRIO_uc003jfg.2_RNA|TRIO_uc003jfh.1_Missense_Mutation_p.G1500W|TRIO_uc003jfi.1_Missense_Mutation_p.G154W	p.G1851W	NM_007118	NP_009049	O75962	TRIO_HUMAN			36	5557	+	Lung NSC(4;0.000742)		1851					D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	c.5551G>T	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.479569	0.63849	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206	T;T	0.67171	-0.25;-0.22	5.47	5.47	0.80525	.	0.051335	0.85682	D	0.000000	T	0.79493	0.4455	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.97;1.0	T	0.77686	-0.2495	10	0.41790	T	0.15	.	19.3484	0.94374	0.0:0.0:1.0:0.0	.	1851;1851;1851	D3DTD2;O75962-5;O75962	.;.;TRIO_HUMAN	W	1851;1851;1538	ENSP00000339299:G1851W;ENSP00000446348:G1851W	ENSP00000339299:G1851W	G	+	1	0	TRIO	14515918	1.000000	0.71417	0.966000	0.40874	0.541000	0.35023	9.787000	0.99055	2.570000	0.86706	0.655000	0.94253	GGG		0.612	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		82	79	1	0	8.6838e-40	0.00361	1.48048e-39	82	79				
PDZD2	23037	broad.mit.edu	37	5	32037441	32037441	+	Silent	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:32037441C>G	ENST00000438447.1	+	7	1900	c.1512C>G	c.(1510-1512)cgC>cgG	p.R504R	PDZD2_ENST00000282493.3_Silent_p.R504R			O15018	PDZD2_HUMAN	PDZ domain containing 2	504					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.R504R(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TCAAGAGTCGCCTTTCAGGTA	0.542																																							uc003jhl.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						c.(1510-1512)CGC>CGG		PDZ domain containing 2							54.0	53.0	53.0					5																	32037441		2203	4300	6503	SO:0001819	synonymous_variant	23037				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus		g.chr5:32037441C>G	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.1512C>G	5.37:g.32037441C>G						PDZD2_uc003jhm.2_Silent_p.R504R|PDZD2_uc011cnx.1_Silent_p.R330R	p.R504R	NM_178140	NP_835260	O15018	PDZD2_HUMAN			7	1900	+			504					Q9BXD4	Silent	SNP	ENST00000438447.1	37	c.1512C>G	CCDS34137.1																																																																																				0.542	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			23	19	0	0	0	0.00278	0	23	19				
UGT3A1	133688	broad.mit.edu	37	5	35965971	35965971	+	Missense_Mutation	SNP	T	T	A	rs144943338		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:35965971T>A	ENST00000274278.3	-	4	717	c.360A>T	c.(358-360)caA>caT	p.Q120H	UGT3A1_ENST00000503189.1_Missense_Mutation_p.Q120H|UGT3A1_ENST00000513233.1_Intron|UGT3A1_ENST00000507113.1_Missense_Mutation_p.Q86H|UGT3A1_ENST00000333811.4_Missense_Mutation_p.Q66H	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	120						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.Q120H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AATAACTACATTGAGTCCCAA	0.294																																							uc003jjv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(358-360)CAA>CAT		UDP glycosyltransferase 3 family, polypeptide A1							37.0	38.0	37.0					5																	35965971		2202	4295	6497	SO:0001583	missense	133688					integral to membrane	glucuronosyltransferase activity	g.chr5:35965971T>A		CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.360A>T	5.37:g.35965971T>A	ENSP00000274278:p.Gln120His					UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Missense_Mutation_p.Q120H|UGT3A1_uc011cor.1_Missense_Mutation_p.Q86H|UGT3A1_uc003jjy.1_Missense_Mutation_p.Q66H	p.Q120H	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		4	517	-	all_lung(31;0.000197)		120			Extracellular (Potential).		G5E961|Q8IYS9|Q8NAW4|Q96DM6	Missense_Mutation	SNP	ENST00000274278.3	37	c.360A>T	CCDS3913.1	.	.	.	.	.	.	.	.	.	.	T	8.296	0.818872	0.16607	.	.	ENSG00000145626	ENST00000274278;ENST00000503189;ENST00000507113;ENST00000333811	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	3.0	-6.0	0.02206	.	0.262072	0.22816	N	0.055282	T	0.32071	0.0817	N	0.21240	0.645	0.09310	N	0.999993	B;B;B;B	0.24132	0.034;0.012;0.098;0.025	B;B;B;B	0.27170	0.037;0.03;0.077;0.049	T	0.27020	-1.0086	10	0.15499	T	0.54	.	7.4163	0.27047	0.1261:0.6645:0.0:0.2095	.	86;120;66;120	E9PD17;B7Z8Q8;G5E961;Q6NUS8	.;.;.;UD3A1_HUMAN	H	120;120;86;66	ENSP00000274278:Q120H;ENSP00000427079:Q120H;ENSP00000426100:Q86H;ENSP00000328033:Q66H	ENSP00000274278:Q120H	Q	-	3	2	UGT3A1	36001728	0.000000	0.05858	0.000000	0.03702	0.604000	0.37047	-1.916000	0.01576	-1.977000	0.00994	0.260000	0.18958	CAA		0.294	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253770.2	NM_152404		8	61	0	0	0	0.008291	0	8	61				
SLC1A3	6507	broad.mit.edu	37	5	36684013	36684013	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:36684013C>A	ENST00000265113.4	+	9	1813	c.1337C>A	c.(1336-1338)gCg>gAg	p.A446E	SLC1A3_ENST00000381918.3_Intron|CTD-2353F22.1_ENST00000510740.1_RNA	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	446					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.A446E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATTCCTCAGGCGGGCCTGGTC	0.532																																							uc003jkj.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1336-1338)GCG>GAG		solute carrier family 1 (glial high affinity	L-Glutamic Acid(DB00142)						108.0	94.0	99.0					5																	36684013		2203	4300	6503	SO:0001583	missense	6507				D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity	g.chr5:36684013C>A		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.1337C>A	5.37:g.36684013C>A	ENSP00000265113:p.Ala446Glu					SLC1A3_uc011cox.1_Missense_Mutation_p.A339E|SLC1A3_uc010iuy.2_Intron	p.A446E	NM_004172	NP_004163	P43003	EAA1_HUMAN	Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		9	1813	+	all_lung(31;0.000245)		446					B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	37	c.1337C>A	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	C	35	5.562598	0.96527	.	.	ENSG00000079215	ENST00000265113;ENST00000427100	T	0.62105	0.05	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.87188	0.6115	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90853	0.4732	10	0.87932	D	0	-19.3219	19.9326	0.97124	0.0:1.0:0.0:0.0	.	446	P43003	EAA1_HUMAN	E	446;394	ENSP00000265113:A446E	ENSP00000265113:A446E	A	+	2	0	SLC1A3	36719770	1.000000	0.71417	0.965000	0.40720	0.950000	0.60333	5.993000	0.70616	2.720000	0.93068	0.650000	0.86243	GCG		0.532	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172		23	80	1	0	1.64293e-13	0.00333	2.4644e-13	23	80				
C7	730	broad.mit.edu	37	5	40964941	40964941	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:40964941T>G	ENST00000313164.9	+	14	2207	c.1848T>G	c.(1846-1848)gaT>gaG	p.D616E		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	616	CCP 2.|Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.D616E(1)					Ovarian(839;0.0112)				GTGGAGAAGATTTACGGTGGC	0.403																																							uc003jmh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1846-1848)GAT>GAG		complement component 7 precursor							165.0	164.0	164.0					5																	40964941		1988	4161	6149	SO:0001583	missense	730				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex		g.chr5:40964941T>G	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1848T>G	5.37:g.40964941T>G	ENSP00000322061:p.Asp616Glu					C7_uc011cpn.1_RNA	p.D616E	NM_000587	NP_000578	P10643	CO7_HUMAN			14	1962	+		Ovarian(839;0.0112)	616			Sushi 1.		Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	c.1848T>G	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.612780	0.66672	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	T	0.67171	-0.25	6.04	2.15	0.27550	Complement control module (2);Sushi/SCR/CCP (3);	0.172593	0.50627	D	0.000102	T	0.63165	0.2488	L	0.60067	1.865	0.25750	N	0.985061	P	0.50819	0.939	P	0.45753	0.492	T	0.57791	-0.7750	10	0.62326	D	0.03	-22.4408	9.2912	0.37789	0.0:0.4191:0.0:0.5809	.	616	P10643	CO7_HUMAN	E	616;456	ENSP00000322061:D616E	ENSP00000322061:D616E	D	+	3	2	C7	41000698	0.947000	0.32204	0.999000	0.59377	0.965000	0.64279	-0.060000	0.11712	0.118000	0.18165	0.460000	0.39030	GAT		0.403	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1			18	167	0	0	0	0.012319	0	18	167				
DDX4	54514	broad.mit.edu	37	5	55059044	55059044	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:55059044G>T	ENST00000505374.1	+	5	339	c.247G>T	c.(247-249)Ggt>Tgt	p.G83C	DDX4_ENST00000354991.5_Missense_Mutation_p.G83C|DDX4_ENST00000514278.2_Missense_Mutation_p.G83C|DDX4_ENST00000508580.1_3'UTR|DDX4_ENST00000353507.5_Missense_Mutation_p.G83C|SLC38A9_ENST00000504880.1_Intron	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	83	Gly-rich.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.G83C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				ATCCACAATGGGTGGTTTTGG	0.318																																							uc003jqg.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(247-249)GGT>TGT		DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform							135.0	133.0	134.0					5																	55059044		2203	4300	6503	SO:0001583	missense	54514				multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr5:55059044G>T	AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.247G>T	5.37:g.55059044G>T	ENSP00000424838:p.Gly83Cys					DDX4_uc010ivz.2_Missense_Mutation_p.G83C|DDX4_uc003jqh.3_Missense_Mutation_p.G83C	p.G83C	NM_001136034	NP_001129506	Q9NQI0	DDX4_HUMAN			5	321	+		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)	83			Gly-rich.		A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	37	c.247G>T	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017435	0.35606	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000515709;ENST00000506848;ENST00000514679;ENST00000354991;ENST00000511491	T;T;T;T;T;T;T;T	0.65549	1.83;1.72;1.84;3.19;0.62;-0.02;1.83;-0.16	4.99	4.13	0.48395	.	0.122449	0.36482	N	0.002571	T	0.74397	0.3711	M	0.68317	2.08	0.42832	D	0.994029	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.993;1.0	T	0.76457	-0.2952	10	0.87932	D	0	-15.6846	9.3795	0.38304	0.0972:0.0:0.9028:0.0	.	83;83;83	D6RDK4;Q9NQI0-2;Q9NQI0	.;.;DDX4_HUMAN	C	83;83;83;83;57;83;83;83;83	ENSP00000334167:G83C;ENSP00000425359:G83C;ENSP00000424838:G83C;ENSP00000427167:G83C;ENSP00000424779:G57C;ENSP00000424112:G83C;ENSP00000347087:G83C;ENSP00000427522:G83C	ENSP00000334167:G83C	G	+	1	0	DDX4	55094801	0.998000	0.40836	0.862000	0.33874	0.153000	0.21895	4.021000	0.57196	1.319000	0.45190	0.460000	0.39030	GGT		0.318	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415		3	29	1	0	0.00024832	0.009096	0.000280413	3	29				
RAD17	5884	broad.mit.edu	37	5	68695997	68695997	+	Splice_Site	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:68695997G>A	ENST00000509734.1	+	16	2404		c.e16+1		RAD17_ENST00000521422.1_Splice_Site|RAD17_ENST00000282891.6_Splice_Site|RAD17_ENST00000354312.3_Splice_Site|RAD17_ENST00000361732.2_Splice_Site|RAD17_ENST00000380774.3_Splice_Site|RAD17_ENST00000305138.4_Splice_Site|RAD17_ENST00000358030.2_Splice_Site|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000345306.6_Splice_Site|RAD17_ENST00000354868.5_Splice_Site			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)						cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.?(1)					Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		AGAAATCAAGGTAATAACATA	0.353								Other conserved DNA damage response genes																															uc003jwo.2		NA																	1	Unknown(1)		lung(1)		0						c.e14+1	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	RAD17 homolog isoform 2							54.0	47.0	49.0					5																	68695997		2203	4300	6503	SO:0001630	splice_region_variant	5884				cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding	g.chr5:68695997G>A	AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.1726+1G>A	5.37:g.68695997G>A						RAD17_uc003jwg.2_Splice_Site_p.A565_splice|RAD17_uc003jwh.2_Splice_Site_p.A565_splice|RAD17_uc003jwi.2_Splice_Site_p.A565_splice|RAD17_uc003jwj.2_Splice_Site_p.A565_splice|RAD17_uc003jwk.2_Splice_Site_p.A565_splice|RAD17_uc003jwl.2_Splice_Site_p.A565_splice|RAD17_uc003jwm.2_Splice_Site_p.A400_splice|RAD17_uc003jwn.2_Splice_Site_p.A479_splice|RAD17_uc003jwp.2_Splice_Site_p.A136_splice	p.A576_splice	NM_133339	NP_579917	O75943	RAD17_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)	14	1788	+		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)						A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Splice_Site	SNP	ENST00000509734.1	37	c.1726_splice	CCDS4003.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.381497	0.82792	.	.	ENSG00000152942	ENST00000361732;ENST00000509734;ENST00000354868;ENST00000521422;ENST00000354312;ENST00000345306;ENST00000305138;ENST00000282891;ENST00000358030;ENST00000380774;ENST00000513214	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7432	0.91782	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RAD17	68731753	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.977000	0.93446	2.729000	0.93468	0.580000	0.79431	.		0.353	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369171.1	NM_133344	Intron	6	28	0	0	0	0.001168	0	6	28				
SV2C	22987	broad.mit.edu	37	5	75581080	75581080	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:75581080C>A	ENST00000502798.2	+	5	1449	c.1007C>A	c.(1006-1008)gCc>gAc	p.A336D	RP11-466P24.6_ENST00000502589.1_RNA|SV2C_ENST00000322285.7_Missense_Mutation_p.A336D	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	336					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.A336D(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TCCGTGGTGGCCCTCACATTC	0.502																																							uc003kei.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1006-1008)GCC>GAC		synaptic vesicle glycoprotein 2C							200.0	203.0	202.0					5																	75581080		2109	4244	6353	SO:0001583	missense	22987				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr5:75581080C>A	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.1007C>A	5.37:g.75581080C>A	ENSP00000423541:p.Ala336Asp						p.A336D	NM_014979	NP_055794	Q496J9	SV2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)	5	1141	+		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)	336			Helical; (Potential).		Q496K1|Q9UPU8	Missense_Mutation	SNP	ENST00000502798.2	37	c.1007C>A	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967540	0.92855	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.75050	-0.9;-0.9	4.75	4.75	0.60458	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.330382	0.30547	N	0.009398	D	0.87857	0.6283	M	0.86502	2.82	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	D	0.90078	0.4168	10	0.62326	D	0.03	-17.1201	17.746	0.88421	0.0:1.0:0.0:0.0	.	336	Q496J9	SV2C_HUMAN	D	336	ENSP00000423541:A336D;ENSP00000316983:A336D	ENSP00000316983:A336D	A	+	2	0	SV2C	75616836	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.775000	0.85489	2.190000	0.69967	0.305000	0.20034	GCC		0.502	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4			17	96	1	0	0.000132079	0.008871	0.000151598	17	96				
RASGRF2	5924	broad.mit.edu	37	5	80369242	80369242	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:80369242C>T	ENST00000265080.4	+	5	925	c.858C>T	c.(856-858)caC>caT	p.H286H	RASGRF2_ENST00000502677.1_3'UTR	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	286	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H286H(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CCATCAGCCACGACGACGTCA	0.463																																							uc003kha.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12						c.(856-858)CAC>CAT		Ras protein-specific guanine							71.0	70.0	70.0					5																	80369242		2203	4300	6503	SO:0001819	synonymous_variant	5924				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr5:80369242C>T	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.858C>T	5.37:g.80369242C>T						RASGRF2_uc011ctn.1_RNA|RASGRF2_uc003khb.1_Silent_p.H114H	p.H286H	NM_006909	NP_008840	O14827	RGRF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)	5	858	+		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)	286			DH.		B9EG89|Q9UK56	Silent	SNP	ENST00000265080.4	37	c.858C>T	CCDS4052.1																																																																																				0.463	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909		3	42	0	0	0	0.000602	0	3	42				
PCSK1	5122	broad.mit.edu	37	5	95748052	95748052	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:95748052G>T	ENST00000311106.3	-	7	1089	c.852C>A	c.(850-852)gcC>gcA	p.A284A	CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000513085.1_5'UTR|PCSK1_ENST00000508626.1_Silent_p.A237A	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	284	Peptidase S8.				cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.A284A(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AAGCCTTCTGGGCTAGCCGGC	0.473																																							uc003kls.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(850-852)GCC>GCA		proprotein convertase subtilisin/kexin type 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						100.0	103.0	102.0					5																	95748052		2203	4300	6503	SO:0001819	synonymous_variant	5122				cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity	g.chr5:95748052G>T		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.852C>A	5.37:g.95748052G>T						PCSK1_uc010jbi.1_Silent_p.A45A	p.A284A	NM_000439	NP_000430	P29120	NEC1_HUMAN		all cancers(79;3.44e-16)	7	1058	-		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)	284			Catalytic.		B7Z8T7|E9PHA1|P78478|Q92532	Silent	SNP	ENST00000311106.3	37	c.852C>A	CCDS4081.1																																																																																				0.473	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439		15	77	1	0	4.93089e-13	0.00245	7.33339e-13	15	77				
STARD4	134429	broad.mit.edu	37	5	110843034	110843034	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:110843034T>A	ENST00000296632.3	-	2	232	c.98A>T	c.(97-99)aAg>aTg	p.K33M	STARD4_ENST00000512160.1_Missense_Mutation_p.K33M|STARD4_ENST00000511569.1_Intron|STARD4_ENST00000509887.1_Missense_Mutation_p.K33M|STARD4_ENST00000502322.1_Missense_Mutation_p.K33M	NM_139164.1	NP_631903.1	Q96DR4	STAR4_HUMAN	StAR-related lipid transfer (START) domain containing 4	33	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				lipid transport (GO:0006869)		lipid binding (GO:0008289)	p.K33M(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	12		all_cancers(142;0.00259)|all_epithelial(76;8.32e-05)|Prostate(80;0.0115)|Colorectal(10;0.0959)|Ovarian(225;0.156)|all_lung(232;0.18)|Lung NSC(167;0.248)		OV - Ovarian serous cystadenocarcinoma(64;4.91e-09)|Epithelial(69;1.39e-08)|all cancers(49;2.34e-06)|COAD - Colon adenocarcinoma(37;0.049)|Colorectal(14;0.138)		TACCGTTTTCTTAGCAACTCG	0.328																																							uc003kph.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(97-99)AAG>ATG		StAR-related lipid transfer (START) domain							174.0	162.0	166.0					5																	110843034		2202	4300	6502	SO:0001583	missense	134429				lipid transport		lipid binding	g.chr5:110843034T>A	AF480299	CCDS4104.1	5q22	2011-09-12	2007-08-16		ENSG00000164211	ENSG00000164211		"""StAR-related lipid transfer (START) domain containing"""	18058	protein-coding gene	gene with protein product		607049	"""START domain containing 4, sterol regulated"""			12011452	Standard	NM_139164		Approved		uc003kph.1	Q96DR4	OTTHUMG00000128793	ENST00000296632.3:c.98A>T	5.37:g.110843034T>A	ENSP00000296632:p.Lys33Met					STARD4_uc010jbw.1_Translation_Start_Site|STARD4_uc010jbx.1_Intron|STARD4_uc003kpi.1_RNA|STARD4_uc003kpj.2_Missense_Mutation_p.K33M	p.K33M	NM_139164	NP_631903	Q96DR4	STAR4_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;4.91e-09)|Epithelial(69;1.39e-08)|all cancers(49;2.34e-06)|COAD - Colon adenocarcinoma(37;0.049)|Colorectal(14;0.138)	2	182	-		all_cancers(142;0.00259)|all_epithelial(76;8.32e-05)|Prostate(80;0.0115)|Colorectal(10;0.0959)|Ovarian(225;0.156)|all_lung(232;0.18)|Lung NSC(167;0.248)	33			START.		Q86TN9	Missense_Mutation	SNP	ENST00000296632.3	37	c.98A>T	CCDS4104.1	.	.	.	.	.	.	.	.	.	.	T	18.66	3.672091	0.67928	.	.	ENSG00000164211	ENST00000296632;ENST00000512160;ENST00000505803;ENST00000502322;ENST00000509887	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	5.63	5.63	0.86233	Lipid-binding START (2);START-like domain (1);	0.069143	0.64402	D	0.000014	T	0.64438	0.2598	M	0.76328	2.33	0.48040	D	0.999574	D;D	0.76494	0.999;0.998	D;D	0.69307	0.963;0.916	T	0.64546	-0.6382	10	0.35671	T	0.21	.	10.5249	0.44943	0.0:0.0813:0.0:0.9187	.	33;33	Q86TN9;Q96DR4	.;STAR4_HUMAN	M	33	ENSP00000296632:K33M;ENSP00000426148:K33M;ENSP00000427478:K33M;ENSP00000427639:K33M;ENSP00000425308:K33M	ENSP00000296632:K33M	K	-	2	0	STARD4	110870933	1.000000	0.71417	0.999000	0.59377	0.906000	0.53458	3.138000	0.50570	2.147000	0.66899	0.533000	0.62120	AAG		0.328	STARD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250720.1	NM_139164		5	32	0	0	0	0.000602	0	5	32				
LVRN	206338	broad.mit.edu	37	5	115335492	115335492	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:115335492A>G	ENST00000357872.4	+	7	1532	c.1408A>G	c.(1408-1410)Atc>Gtc	p.I470V	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		470						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.I470V(1)									TTTACATAATATCCTCAGAGA	0.378																																							uc003kro.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1408-1410)ATC>GTC		laeverin							67.0	69.0	68.0					5																	115335492		2202	4300	6502	SO:0001583	missense	206338				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding	g.chr5:115335492A>G																												ENST00000357872.4:c.1408A>G	5.37:g.115335492A>G	ENSP00000350541:p.Ile470Val					AQPEP_uc003krp.2_RNA|AQPEP_uc003krq.2_RNA|AQPEP_uc003krr.2_RNA|AQPEP_uc003krs.2_RNA	p.I470V	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN			7	1572	+			470			Lumenal (Potential).		A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	c.1408A>G	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.344051	0.00222	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.02323	4.34	5.77	-7.18	0.01505	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.413670	0.04577	N	0.394361	T	0.01029	0.0034	N	0.01197	-0.965	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.49624	-0.8920	10	0.02654	T	1	.	11.7608	0.51900	0.6384:0.0898:0.2718:0.0	.	470	Q6Q4G3	AMPQ_HUMAN	V	470;459	ENSP00000350541:I470V	ENSP00000350541:I470V	I	+	1	0	AC010282.1	115363391	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.255000	0.08769	-1.343000	0.02219	-0.772000	0.03388	ATC		0.378	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1			5	39	0	0	0	0.001168	0	5	39				
FNIP1	96459	broad.mit.edu	37	5	131007483	131007483	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:131007483C>A	ENST00000510461.1	-	14	2749	c.2654G>T	c.(2653-2655)tGt>tTt	p.C885F	FNIP1_ENST00000307968.7_Missense_Mutation_p.C857F|FNIP1_ENST00000307954.8_Missense_Mutation_p.C840F|CTC-432M15.3_ENST00000514667.1_Intron	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	885					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.C885F(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		TATACATTTACAAAATTCATT	0.348																																							uc003kvs.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(2653-2655)TGT>TTT		folliculin interacting protein 1 isoform 1							67.0	69.0	68.0					5																	131007483		2203	4299	6502	SO:0001583	missense	96459				regulation of protein phosphorylation	cytoplasm	protein binding	g.chr5:131007483C>A	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.2654G>T	5.37:g.131007483C>A	ENSP00000421985:p.Cys885Phe					RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Missense_Mutation_p.C857F|FNIP1_uc010jdm.1_Missense_Mutation_p.C840F	p.C885F	NM_133372	NP_588613	Q8TF40	FNIP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)	14	2796	-		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	885					D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	c.2654G>T	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.419865	0.42918	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	T;T;T	0.15372	2.43;2.45;2.47	5.16	5.16	0.70880	.	.	.	.	.	T	0.38161	0.1030	L	0.56769	1.78	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.998	P;D;P	0.64877	0.885;0.93;0.904	T	0.05767	-1.0865	9	0.46703	T	0.11	-5.2611	18.6541	0.91441	0.0:1.0:0.0:0.0	.	885;857;885	A8K8V8;Q8TF40-3;Q8TF40	.;.;FNIP1_HUMAN	F	857;840;637;885	ENSP00000309266:C857F;ENSP00000310453:C840F;ENSP00000421985:C885F	ENSP00000310453:C840F	C	-	2	0	FNIP1	131035382	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	3.298000	0.51818	2.408000	0.81797	0.313000	0.20887	TGT		0.348	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372		3	33	1	0	0.004672	0.004672	0.00500111	3	33				
ACSL6	23305	broad.mit.edu	37	5	131312363	131312363	+	Nonsense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:131312363G>C	ENST00000379240.1	-	10	1046	c.893C>G	c.(892-894)tCa>tGa	p.S298*	ACSL6_ENST00000544770.1_Nonsense_Mutation_p.S207*|ACSL6_ENST00000379255.1_Nonsense_Mutation_p.S263*|ACSL6_ENST00000431707.1_Nonsense_Mutation_p.S278*|ACSL6_ENST00000379249.3_Nonsense_Mutation_p.S298*|ACSL6_ENST00000379246.1_Nonsense_Mutation_p.S309*|ACSL6_ENST00000379264.2_Nonsense_Mutation_p.S323*|ACSL6_ENST00000357096.1_Nonsense_Mutation_p.S263*|ACSL6_ENST00000379272.2_Nonsense_Mutation_p.S313*|ACSL6_ENST00000543479.1_Nonsense_Mutation_p.S298*|ACSL6_ENST00000379244.1_Nonsense_Mutation_p.S298*|ACSL6_ENST00000296869.4_Nonsense_Mutation_p.S323*			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	298					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)	p.S323*(2)		NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAGAAAGCCTGAGAAATCAGC	0.428																																							uc010jdo.1		NA																	2	Substitution - Nonsense(2)		lung(2)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(892-894)TCA>TGA		acyl-CoA synthetase long-chain family member 6							67.0	71.0	70.0					5																	131312363		2203	4300	6503	SO:0001587	stop_gained	23305				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr5:131312363G>C	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.893C>G	5.37:g.131312363G>C	ENSP00000368542:p.Ser298*					ACSL6_uc003kvv.1_RNA|ACSL6_uc003kvx.1_Nonsense_Mutation_p.S323*|ACSL6_uc003kvy.1_Nonsense_Mutation_p.S323*|ACSL6_uc003kwb.2_Nonsense_Mutation_p.S288*|ACSL6_uc003kvz.1_Nonsense_Mutation_p.S263*|ACSL6_uc003kwa.1_Nonsense_Mutation_p.S309*|ACSL6_uc003kvw.1_5'Flank|ACSL6_uc010jdn.1_Nonsense_Mutation_p.S313*|ACSL6_uc010jdp.1_RNA	p.S298*	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		10	976	-		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	298			Cytoplasmic (Potential).		J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Nonsense_Mutation	SNP	ENST00000379240.1	37	c.893C>G		.	.	.	.	.	.	.	.	.	.	G	38	6.896611	0.97916	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479;ENST00000434099	.	.	.	5.46	5.46	0.80206	.	0.431297	0.25765	N	0.028450	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	19.3581	0.94422	0.0:0.0:1.0:0.0	.	.	.	.	X	298;323;313;263;263;323;309;298;207;298;278;298;263	.	ENSP00000296869:S323X	S	-	2	0	ACSL6	131340262	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.851000	0.86920	2.579000	0.87056	0.650000	0.86243	TCA		0.428	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256		8	60	0	0	0	0.008291	0	8	60				
TRPC7	57113	broad.mit.edu	37	5	135692748	135692748	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:135692748G>T	ENST00000513104.1	-	2	610	c.328C>A	c.(328-330)Ctg>Atg	p.L110M	TRPC7_ENST00000426057.2_Missense_Mutation_p.L110M|TRPC7_ENST00000355180.3_Missense_Mutation_p.L110M	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	110					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.L110M(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCCAGCAGCAGCGCGTCCCCC	0.672																																							uc003lbn.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(325-327)CTG>ATG		transient receptor potential cation channel,							57.0	65.0	62.0					5																	135692748		2203	4300	6503	SO:0001583	missense	57113				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding	g.chr5:135692748G>T	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.328C>A	5.37:g.135692748G>T	ENSP00000426070:p.Leu110Met					TRPC7_uc010jef.1_Missense_Mutation_p.L101M|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.L101M|TRPC7_uc010jei.1_Missense_Mutation_p.L101M|TRPC7_uc010jej.1_Translation_Start_Site	p.L109M	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		1	328	-			110			Cytoplasmic (Potential).|ANK 3.		A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	c.325C>A	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.67|17.67	3.447199|3.447199	0.63178|0.63178	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753|ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	T;T;T|D;D;D	0.71461|0.87491	-0.57;-0.57;-0.57|-2.26;-2.26;-2.26	5.0|5.0	3.24|3.24	0.37175|0.37175	.|Ankyrin repeat-containing domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94961|0.94961	0.8370|0.8370	H|H	0.96080|0.96080	3.765|3.765	0.27961|0.27961	N|N	0.936773|0.936773	.|D;D;D;D	.|0.89917	.|0.997;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.992;0.998;0.999;0.999	D|D	0.89612|0.89612	0.3842|0.3842	7|10	0.54805|0.87932	T|D	0.06|0	-12.4126|-12.4126	11.2184|11.2184	0.48840|0.48840	0.1471:0.0:0.8529:0.0|0.1471:0.0:0.8529:0.0	.|.	.|110;110;110;110	.|Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.|.;.;.;TRPC7_HUMAN	D|M	109|110	ENSP00000330322:A109D;ENSP00000367720:A109D;ENSP00000424854:A109D|ENSP00000347312:L110M;ENSP00000441628:L110M;ENSP00000426070:L110M	ENSP00000330322:A109D|ENSP00000265193:L110M	A|L	-|-	2|1	0|2	TRPC7|TRPC7	135720647|135720647	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.995000|0.995000	0.86356|0.86356	4.762000|4.762000	0.62250|0.62250	0.718000|0.718000	0.32166|0.32166	0.561000|0.561000	0.74099|0.74099	GCT|CTG		0.672	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389		12	38	1	0	1.08611e-07	0.010729	1.4217e-07	12	38				
CDC23	8697	broad.mit.edu	37	5	137542338	137542338	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:137542338G>A	ENST00000394886.2	-	3	300	c.270C>T	c.(268-270)gcC>gcT	p.A90A	CDC23_ENST00000394884.3_Silent_p.A90A|CDC23_ENST00000505120.1_Missense_Mutation_p.P89L	NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23	90					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)	p.A84A(1)		autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AGTAGGCCTTGGCCAGGGTAT	0.403																																							uc003lcl.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(268-270)GCC>GCT		cell division cycle protein 23							84.0	80.0	81.0					5																	137542338		2203	4300	6503	SO:0001819	synonymous_variant	8697				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity	g.chr5:137542338G>A	AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.270C>T	5.37:g.137542338G>A						CDC23_uc003lcm.1_Silent_p.A90A	p.A90A	NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		3	301	-			90			TPR 1.		A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Silent	SNP	ENST00000394886.2	37	c.270C>T	CCDS4200.2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301330	0.81136	.	.	ENSG00000094880	ENST00000505120	T	0.37235	1.21	5.95	5.07	0.68467	.	.	.	.	.	T	0.45074	0.1324	.	.	.	0.36288	D	0.856232	.	.	.	.	.	.	T	0.57487	-0.7803	6	0.87932	D	0	-8.394	7.1205	0.25442	0.136:0.0:0.7207:0.1433	.	.	.	.	L	89	ENSP00000423704:P89L	ENSP00000422505:P66L	P	-	2	0	CDC23	137570237	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.222000	0.42926	1.503000	0.48686	-0.188000	0.12872	CCA		0.403	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251275.2			9	73	0	0	0	0.008291	0	9	73				
PCDHA6	56142	broad.mit.edu	37	5	140208228	140208228	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:140208228A>G	ENST00000529310.1	+	1	666	c.552A>G	c.(550-552)atA>atG	p.I184M	PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.I184M|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	184	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.I184M(2)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGTGAAAATAAACAGTGATG	0.438																																							uc003lho.2		NA																	2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(550-552)ATA>ATG		protocadherin alpha 6 isoform 1 precursor							67.0	72.0	70.0					5																	140208228		2203	4300	6503	SO:0001583	missense	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140208228A>G	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.552A>G	5.37:g.140208228A>G	ENSP00000433378:p.Ile184Met					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.I184M|PCDHA6_uc011dab.1_Missense_Mutation_p.I184M	p.I184M	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	579	+			184			Cadherin 2.|Extracellular (Potential).		O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	c.552A>G	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	A	2.756	-0.259054	0.05791	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.64803	-0.12;-0.12	3.87	-0.191	0.13252	Cadherin (4);Cadherin-like (1);	3.022610	0.02521	U	0.092596	T	0.39517	0.1081	N	0.16368	0.405	0.09310	N	1	P;B;B	0.42649	0.786;0.022;0.003	B;B;B	0.33521	0.165;0.085;0.003	T	0.38993	-0.9635	10	0.51188	T	0.08	.	1.876	0.03218	0.5029:0.127:0.2458:0.1242	.	184;184;184	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	M	184	ENSP00000433378:I184M;ENSP00000434113:I184M	ENSP00000434113:I184M	I	+	3	3	PCDHA6	140188412	0.000000	0.05858	0.964000	0.40570	0.686000	0.39977	-2.457000	0.01001	0.188000	0.20168	0.260000	0.18958	ATA		0.438	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		37	71	0	0	0	0.004878	0	37	71				
PCDHB2	56133	broad.mit.edu	37	5	140475997	140475997	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:140475997G>A	ENST00000194155.4	+	1	1771	c.1623G>A	c.(1621-1623)ccG>ccA	p.P541P		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	541	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P541P(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGGCTCCCCGGCGTTGAGCA	0.697																																							uc003lil.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(1621-1623)CCG>CCA		protocadherin beta 2 precursor							42.0	46.0	44.0					5																	140475997		2200	4298	6498	SO:0001819	synonymous_variant	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140475997G>A	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1623G>A	5.37:g.140475997G>A						PCDHB2_uc003lim.1_Silent_p.P202P	p.P541P	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1761	+			541			Extracellular (Potential).|Cadherin 5.		Q4KMU1	Silent	SNP	ENST00000194155.4	37	c.1623G>A	CCDS4244.1																																																																																				0.697	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		14	51	0	0	0	0.00245	0	14	51				
PCDHB17	54661	broad.mit.edu	37	5	140536820	140536820	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:140536820G>T	ENST00000539533.1	+	1	1244	c.1244G>T	c.(1243-1245)aGg>aTg	p.R415M						protocadherin beta 17 pseudogene									p.R415M(2)									AGAGAGAGCAGGGCCGAGTAC	0.473																																							uc003lis.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1240-1242)AGG>ATG		SubName: Full=Protocadherin-psi1;																																				SO:0001583	missense	54661							g.chr5:140536820G>T	AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.1244G>T	5.37:g.140536820G>T	ENSP00000438685:p.Arg415Met						p.R414M	NR_001280						1	1241	+									Missense_Mutation	SNP	ENST00000539533.1	37	c.1241G>T		.	.	.	.	.	.	.	.	.	.	G	0.467	-0.886215	0.02511	.	.	ENSG00000255622	ENST00000539533	T	0.01918	4.56	4.97	-0.761	0.11038	.	.	.	.	.	T	0.02119	0.0066	.	.	.	.	.	.	B	0.30068	0.267	B	0.31191	0.125	T	0.36114	-0.9761	7	0.33940	T	0.23	.	10.1225	0.42630	0.6067:0.0:0.3933:0.0	.	415	Q96T98	.	M	415	ENSP00000438685:R415M	ENSP00000438685:R415M	R	+	2	0	AC005754.1	140517004	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-3.012000	0.00647	-0.137000	0.11455	0.491000	0.48974	AGG		0.473	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				7	29	1	0	0.000157383	0.00308	0.000179756	7	29				
PCDHGA5	56110	broad.mit.edu	37	5	140744720	140744720	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:140744720G>A	ENST00000518069.1	+	1	823	c.823G>A	c.(823-825)Ggg>Agg	p.G275R	PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	275	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G275R(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGAATAAACGGGAAATTGAC	0.478																																							uc003lju.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(823-825)GGG>AGG		protocadherin gamma subfamily A, 5 isoform 1							47.0	47.0	47.0					5																	140744720		1941	4146	6087	SO:0001583	missense	56110				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140744720G>A	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.823G>A	5.37:g.140744720G>A	ENSP00000429834:p.Gly275Arg					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Missense_Mutation_p.G275R	p.G275R	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	823	+			275			Cadherin 3.|Extracellular (Potential).		Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	c.823G>A	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	17.57	3.422760	0.62733	.	.	ENSG00000253485	ENST00000518069	T	0.53423	0.62	5.52	5.52	0.82312	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.71609	0.3360	M	0.86268	2.805	0.27416	N	0.954432	D;D	0.89917	1.0;1.0	D;D	0.74348	0.971;0.983	T	0.67229	-0.5723	9	0.72032	D	0.01	.	14.2912	0.66278	0.0:0.0:0.8512:0.1488	.	275;275	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	R	275	ENSP00000429834:G275R	ENSP00000429834:G275R	G	+	1	0	PCDHGA5	140724904	1.000000	0.71417	0.621000	0.29145	0.981000	0.71138	4.696000	0.61774	2.756000	0.94617	0.563000	0.77884	GGG		0.478	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918		6	34	0	0	0	0.001168	0	6	34				
PCDHGA6	56109	broad.mit.edu	37	5	140755658	140755658	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:140755658G>T	ENST00000517434.1	+	1	2008	c.2008G>T	c.(2008-2010)Gac>Tac	p.D670Y	PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	670	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D670Y(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGATCCCCGACATCCTGGC	0.692																																							uc003ljy.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(2008-2010)GAC>TAC		protocadherin gamma subfamily A, 6 isoform 1							27.0	35.0	32.0					5																	140755658		2188	4262	6450	SO:0001583	missense	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140755658G>T	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.2008G>T	5.37:g.140755658G>T	ENSP00000429601:p.Asp670Tyr					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.D670Y	p.D670Y	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2008	+			670			Extracellular (Potential).|Cadherin 6.		A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	c.2008G>T	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	12.89	2.073416	0.36566	.	.	ENSG00000253731	ENST00000517434	T	0.49139	0.79	5.02	5.02	0.67125	Cadherin (1);	0.269330	0.18478	U	0.140020	T	0.57592	0.2064	L	0.45581	1.43	0.26123	N	0.980525	P;D	0.54772	0.955;0.968	P;P	0.58172	0.834;0.82	T	0.52909	-0.8512	10	0.87932	D	0	.	14.4968	0.67694	0.0:0.1466:0.8534:0.0	.	670;670	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	Y	670	ENSP00000429601:D670Y	ENSP00000429601:D670Y	D	+	1	0	PCDHGA6	140735842	0.902000	0.30710	0.031000	0.17742	0.221000	0.24807	2.305000	0.43664	2.767000	0.95098	0.563000	0.77884	GAC		0.692	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		10	45	1	0	0.00829132	0.008291	0.00880795	10	45				
PCDHGA12	26025	broad.mit.edu	37	5	140811758	140811758	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:140811758G>C	ENST00000252085.3	+	1	1574	c.1432G>C	c.(1432-1434)Gac>Cac	p.D478H	PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA10_ENST00000398610.2_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	478	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D478H(2)		breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCGCCCACGACCCCGACTG	0.567																																							uc003lkt.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)|skin(1)	4						c.(1432-1434)GAC>CAC		protocadherin gamma subfamily A, 12 isoform 1							69.0	72.0	71.0					5																	140811758		2203	4300	6503	SO:0001583	missense	26025				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140811758G>C	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.1432G>C	5.37:g.140811758G>C	ENSP00000252085:p.Asp478His					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Missense_Mutation_p.D478H	p.D478H	NM_003735	NP_003726	O60330	PCDGC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1601	+			478			Extracellular (Potential).|Cadherin 5.		O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	c.1432G>C	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	g	14.22	2.469591	0.43839	.	.	ENSG00000253159	ENST00000252085	T	0.75154	-0.91	5.23	5.23	0.72850	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.93805	0.8019	H	0.99940	5	0.45791	D	0.998671	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97223	0.9879	9	0.87932	D	0	.	18.7954	0.91991	0.0:0.0:1.0:0.0	.	478;478	O60330-2;O60330	.;PCDGC_HUMAN	H	478	ENSP00000252085:D478H	ENSP00000252085:D478H	D	+	1	0	PCDHGA12	140791942	1.000000	0.71417	0.153000	0.22517	0.077000	0.17291	8.020000	0.88740	2.436000	0.82500	0.561000	0.74099	GAC		0.567	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735		4	40	0	0	0	0.009096	0	4	40				
NR3C1	2908	broad.mit.edu	37	5	142779852	142779852	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:142779852T>A	ENST00000343796.2	-	2	1546	c.553A>T	c.(553-555)Acc>Tcc	p.T185S	NR3C1_ENST00000394466.2_Missense_Mutation_p.T185S|NR3C1_ENST00000504572.1_Missense_Mutation_p.T185S|NR3C1_ENST00000231509.3_Missense_Mutation_p.T185S|NR3C1_ENST00000424646.2_Missense_Mutation_p.T185S|NR3C1_ENST00000416954.2_Intron|NR3C1_ENST00000394464.2_Missense_Mutation_p.T185S|NR3C1_ENST00000503201.1_Missense_Mutation_p.T185S|NR3C1_ENST00000415690.2_Missense_Mutation_p.T185S	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	185	Modulating.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)	p.T185S(2)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	TGGTCTGTGGTATACAATTTC	0.453																																							uc003lmz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(553-555)ACC>TCC		glucocorticoid receptor isoform alpha	Amcinonide(DB00288)|Betamethasone(DB00443)|Budesonide(DB01222)|Dexamethasone(DB01234)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluticasone Propionate(DB00588)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Prednisone(DB00635)						78.0	77.0	77.0					5																	142779852		2203	4300	6503	SO:0001583	missense	2908				chromatin modification|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus|transcription from RNA polymerase II promoter	mitochondrial matrix|nucleoplasm	glucocorticoid receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding	g.chr5:142779852T>A	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.553A>T	5.37:g.142779852T>A	ENSP00000343205:p.Thr185Ser					NR3C1_uc003lmy.2_Missense_Mutation_p.T185S|NR3C1_uc003lna.2_Missense_Mutation_p.T185S|NR3C1_uc003lnb.2_Missense_Mutation_p.T185S|NR3C1_uc011dbk.1_Intron|NR3C1_uc003lnc.2_Missense_Mutation_p.T185S|NR3C1_uc003lnd.2_Missense_Mutation_p.T185S|NR3C1_uc003lne.2_Missense_Mutation_p.T185S|NR3C1_uc003lnf.2_Missense_Mutation_p.T185S|NR3C1_uc003lng.2_Missense_Mutation_p.T185S|NR3C1_uc003lnh.2_Missense_Mutation_p.T185S|NR3C1_uc003lni.2_Missense_Mutation_p.T185S	p.T185S	NM_000176	NP_000167	P04150	GCR_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		2	1045	-		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	185			Modulating.		A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	ENST00000343796.2	37	c.553A>T	CCDS4278.1	.	.	.	.	.	.	.	.	.	.	T	2.911	-0.225289	0.06022	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000361001;ENST00000415690;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000503201	T;T;T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58	5.54	-4.09	0.03951	.	0.455403	0.24869	N	0.034954	T	0.08802	0.0218	N	0.12443	0.215	0.58432	D	0.999997	B;B;B	0.30824	0.002;0.296;0.002	B;B;B	0.29942	0.003;0.109;0.002	T	0.38802	-0.9644	10	0.02654	T	1	.	1.7926	0.03055	0.2503:0.1345:0.3823:0.2329	.	185;185;185	E5KQF5;P04150;E5KQF6	.;GCR_HUMAN;.	S	185	ENSP00000377977:T185S;ENSP00000343205:T185S;ENSP00000387672:T185S;ENSP00000405282:T185S;ENSP00000422518:T185S;ENSP00000377979:T185S;ENSP00000231509:T185S;ENSP00000427672:T185S	ENSP00000231509:T185S	T	-	1	0	NR3C1	142760045	0.903000	0.30736	0.722000	0.30670	0.924000	0.55760	-0.069000	0.11542	-1.003000	0.03425	-0.256000	0.11100	ACC		0.453	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1			5	53	0	0	0	0.000602	0	5	53				
PPP2R2B	5521	broad.mit.edu	37	5	146070805	146070805	+	Splice_Site	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:146070805T>A	ENST00000394413.3	-	4	905		c.e4-2		PPP2R2B_ENST00000504198.1_Splice_Site|PPP2R2B_ENST00000336640.6_Splice_Site|PPP2R2B_ENST00000530902.1_Splice_Site|PPP2R2B_ENST00000508545.2_Splice_Site|PPP2R2B_ENST00000356826.3_Splice_Site|PPP2R2B_ENST00000394414.1_Splice_Site|PPP2R2B_ENST00000394411.4_Splice_Site|PPP2R2B_ENST00000394409.3_Splice_Site|PPP2R2B_ENST00000394410.2_Splice_Site|PPP2R2B_ENST00000453001.1_Splice_Site			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta						apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.?(4)		endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGTTTTATCTGTAGTGGGCA	0.498																																							uc003loe.2		NA																	4	Unknown(4)		lung(4)	ovary(1)|prostate(1)	2						c.e4-1		beta isoform of regulatory subunit B55, protein							66.0	71.0	70.0					5																	146070805		2203	4300	6503	SO:0001630	splice_region_variant	5521				apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity	g.chr5:146070805T>A	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.335-2A>T	5.37:g.146070805T>A						PPP2R2B_uc010jgm.2_Splice_Site_p.D101_splice|PPP2R2B_uc003log.3_Splice_Site_p.D112_splice|PPP2R2B_uc003lof.3_Splice_Site_p.D112_splice|PPP2R2B_uc003loi.3_Splice_Site_p.D115_splice|PPP2R2B_uc003loh.3_Splice_Site_p.D112_splice|PPP2R2B_uc003loj.3_Splice_Site_p.D92_splice|PPP2R2B_uc003lok.3_Splice_Site_p.D101_splice|PPP2R2B_uc011dbu.1_Splice_Site_p.D118_splice|PPP2R2B_uc011dbv.1_Splice_Site_p.D170_splice	p.D112_splice	NM_004576	NP_004567	Q00005	2ABB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		4	860	-								A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Splice_Site	SNP	ENST00000394413.3	37	c.335_splice	CCDS4284.1	.	.	.	.	.	.	.	.	.	.	T	19.58	3.853533	0.71719	.	.	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2303	0.82332	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	AC011357.1	146050998	1.000000	0.71417	0.998000	0.56505	0.646000	0.38490	7.447000	0.80620	2.233000	0.73108	0.533000	0.62120	.		0.498	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251893.2	NM_181678	Intron	7	37	0	0	0	0.001984	0	7	37				
ZNF300	91975	broad.mit.edu	37	5	150276158	150276158	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:150276158T>C	ENST00000274599.5	-	6	1063	c.643A>G	c.(643-645)Agt>Ggt	p.S215G	ZNF300_ENST00000446148.2_Missense_Mutation_p.S231G|ZNF300_ENST00000418587.2_Missense_Mutation_p.S179G|ZNF300_ENST00000394226.2_Missense_Mutation_p.S215G|ZNF300_ENST00000427179.1_3'UTR	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S215G(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTCCAAAACTCTGATCAGGT	0.338																																							uc003lsy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(643-645)AGT>GGT		zinc finger protein 300							73.0	78.0	76.0					5																	150276158		2203	4296	6499	SO:0001583	missense	91975				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr5:150276158T>C	AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.643A>G	5.37:g.150276158T>C	ENSP00000274599:p.Ser215Gly					IRGM_uc011dcl.1_Intron	p.S215G	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		6	910	-		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	215					A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Missense_Mutation	SNP	ENST00000274599.5	37	c.643A>G	CCDS4311.2	.	.	.	.	.	.	.	.	.	.	T	0.070	-1.204838	0.01568	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	T;T;T;T	0.08458	3.16;3.16;3.09;3.16	3.04	1.79	0.24919	.	.	.	.	.	T	0.06050	0.0157	N	0.24115	0.695	0.09310	N	1	B	0.19445	0.036	B	0.22753	0.041	T	0.36480	-0.9746	9	0.66056	D	0.02	.	5.5868	0.17279	0.4552:0.0:0.0:0.5447	.	215	Q96RE9	ZN300_HUMAN	G	231;215;179;215	ENSP00000397178:S231G;ENSP00000274599:S215G;ENSP00000392593:S179G;ENSP00000377773:S215G	ENSP00000274599:S215G	S	-	1	0	ZNF300	150256351	0.001000	0.12720	0.008000	0.14137	0.015000	0.08874	0.971000	0.29396	0.506000	0.28125	0.455000	0.32223	AGT		0.338	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_052860		6	37	0	0	0	0.001168	0	6	37				
FAT2	2196	broad.mit.edu	37	5	150905491	150905491	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:150905491C>T	ENST00000261800.5	-	17	10356	c.10344G>A	c.(10342-10344)ctG>ctA	p.L3448L		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3448	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L3448L(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACTCAGGATCAGCTGCAGGA	0.562																																							uc003lue.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(10342-10344)CTG>CTA		FAT tumor suppressor 2 precursor							44.0	43.0	43.0					5																	150905491		2203	4300	6503	SO:0001819	synonymous_variant	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150905491C>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.10344G>A	5.37:g.150905491C>T						GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Silent_p.L141L	p.L3448L	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		17	10357	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	3448			Extracellular (Potential).|Cadherin 31.		O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	c.10344G>A	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	9.463	1.093562	0.20471	.	.	ENSG00000086570	ENST00000520200	.	.	.	5.2	3.39	0.38822	.	.	.	.	.	T	0.52208	0.1720	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44314	-0.9336	4	.	.	.	.	4.5071	0.11893	0.128:0.6087:0.1238:0.1395	.	.	.	.	N	307	.	.	D	-	1	0	FAT2	150885684	0.912000	0.30974	1.000000	0.80357	0.997000	0.91878	0.156000	0.16382	0.676000	0.31285	0.544000	0.68410	GAT		0.562	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		8	38	0	0	0	0.004482	0	8	38				
GRIA1	2890	broad.mit.edu	37	5	153065836	153065836	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:153065836C>A	ENST00000285900.5	+	8	1424	c.1081C>A	c.(1081-1083)Cgg>Agg	p.R361R	GRIA1_ENST00000518783.1_Silent_p.R371R|GRIA1_ENST00000340592.5_Silent_p.R361R|GRIA1_ENST00000518142.1_Silent_p.R281R|GRIA1_ENST00000521843.2_Silent_p.R292R|GRIA1_ENST00000448073.4_Silent_p.R371R	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	361					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.R361R(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GAAAGGACGCCGGACCAACTA	0.468																																							uc003lva.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|skin(2)	6						c.(1081-1083)CGG>AGG		glutamate receptor, ionotropic, AMPA 1 isoform	Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						152.0	136.0	142.0					5																	153065836		2203	4300	6503	SO:0001819	synonymous_variant	2890				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding	g.chr5:153065836C>A		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1081C>A	5.37:g.153065836C>A						GRIA1_uc003luy.3_Silent_p.R361R|GRIA1_uc003luz.3_Silent_p.R266R|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Silent_p.R281R|GRIA1_uc011dcx.1_Silent_p.R292R|GRIA1_uc011dcy.1_Silent_p.R371R|GRIA1_uc011dcz.1_Silent_p.R371R|GRIA1_uc010jia.1_Silent_p.R341R	p.R361R	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		8	1446	+		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	361			Extracellular (Potential).		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	ENST00000285900.5	37	c.1081C>A	CCDS4322.1																																																																																				0.468	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3			26	65	1	0	1.7881e-09	0.008361	2.49478e-09	26	65				
GABRG2	2566	broad.mit.edu	37	5	161524813	161524813	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:161524813C>A	ENST00000361925.4	+	4	717	c.497C>A	c.(496-498)cCc>cAc	p.P166H	GABRG2_ENST00000393933.4_Missense_Mutation_p.P71H|GABRG2_ENST00000414552.2_Missense_Mutation_p.P166H|GABRG2_ENST00000356592.3_Missense_Mutation_p.P166H			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	166					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.P166H(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATCACCACCCCCAACAGGATG	0.423																																							uc003lyz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(496-498)CCC>CAC		gamma-aminobutyric acid A receptor, gamma 2							98.0	98.0	98.0					5																	161524813		2203	4300	6503	SO:0001583	missense	2566				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chr5:161524813C>A		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.497C>A	5.37:g.161524813C>A	ENSP00000354651:p.Pro166His					GABRG2_uc010jjc.2_Missense_Mutation_p.P166H|GABRG2_uc003lyy.3_Missense_Mutation_p.P166H|GABRG2_uc011dej.1_Missense_Mutation_p.P71H	p.P166H	NM_000816	NP_000807	P18507	GBRG2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	4	855	+	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	166			Extracellular (Probable).		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	c.497C>A	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658131	0.88154	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933;ENST00000522053	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	5.82	5.82	0.92795	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.87865	0.6285	M	0.68952	2.095	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.995	D;D;D	0.78314	0.991;0.957;0.928	D	0.88007	0.2760	10	0.87932	D	0	.	20.1086	0.97902	0.0:1.0:0.0:0.0	.	166;166;166	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	H	166;166;166;71;71	ENSP00000349000:P166H;ENSP00000410732:P166H;ENSP00000354651:P166H;ENSP00000377510:P71H;ENSP00000430182:P71H	ENSP00000349000:P166H	P	+	2	0	GABRG2	161457391	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.677000	0.84024	2.756000	0.94617	0.563000	0.77884	CCC		0.423	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			9	29	1	0	2.17888e-05	0.006214	2.59904e-05	9	29				
HMMR	3161	broad.mit.edu	37	5	162918138	162918138	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:162918138G>T	ENST00000358715.3	+	18	2179	c.2143G>T	c.(2143-2145)Gct>Tct	p.A715S	RP11-80G7.1_ENST00000521666.1_RNA|HMMR_ENST00000432118.2_Missense_Mutation_p.A629S|HMMR_ENST00000353866.3_Missense_Mutation_p.A700S|HMMR_ENST00000393915.4_Missense_Mutation_p.A716S|RP11-80G7.1_ENST00000514724.2_RNA			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	715					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)	p.A715S(1)		cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	CTGTTACCGAGCTCCTATGGA	0.313																																							uc003lzf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2143-2145)GCT>TCT		hyaluronan-mediated motility receptor isoform b							117.0	131.0	126.0					5																	162918138		2202	4298	6500	SO:0001583	missense	3161					cell surface|cytoplasm	hyaluronic acid binding	g.chr5:162918138G>T	U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.2143G>T	5.37:g.162918138G>T	ENSP00000351554:p.Ala715Ser					HMMR_uc003lzh.2_Missense_Mutation_p.A716S|HMMR_uc003lzg.2_Missense_Mutation_p.A700S|HMMR_uc011dem.1_Missense_Mutation_p.A629S|uc003lzi.2_Intron	p.A715S	NM_012484	NP_036616	O75330	HMMR_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	18	2325	+	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	715					A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	ENST00000358715.3	37	c.2143G>T	CCDS4362.1	.	.	.	.	.	.	.	.	.	.	A	2.165	-0.391338	0.04932	.	.	ENSG00000072571	ENST00000416990;ENST00000353866;ENST00000393915;ENST00000426586;ENST00000432118;ENST00000358715	T;T;T;T;T	0.07688	3.17;3.17;3.17;3.17;3.17	5.04	-1.52	0.08637	.	1.342550	0.05141	N	0.494238	T	0.04543	0.0124	N	0.08118	0	0.09310	N	1	B;B;B;B	0.26809	0.16;0.073;0.073;0.073	B;B;B;B	0.25291	0.059;0.059;0.059;0.059	T	0.44452	-0.9327	10	0.11794	T	0.64	0.5932	10.8229	0.46614	0.5178:0.0:0.4822:0.0	.	629;716;700;715	O75330-4;O75330-3;O75330-2;O75330	.;.;.;HMMR_HUMAN	S	601;700;716;692;629;715	ENSP00000400527:A601S;ENSP00000185942:A700S;ENSP00000377492:A716S;ENSP00000402673:A629S;ENSP00000351554:A715S	ENSP00000185942:A700S	A	+	1	0	HMMR	162850716	0.001000	0.12720	0.002000	0.10522	0.001000	0.01503	-0.666000	0.05280	-0.495000	0.06659	-0.940000	0.02684	GCT		0.313	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252752.1	NM_012484		14	42	1	0	1.52009e-12	0.003163	2.24165e-12	14	42				
LCP2	3937	broad.mit.edu	37	5	169714976	169714976	+	Silent	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:169714976C>G	ENST00000046794.5	-	3	801	c.186G>C	c.(184-186)gtG>gtC	p.V62V		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	62	SAM.				blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)		p.V62V(4)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		GTACTTACGGCACCCGGAGCT	0.527																																							uc003man.1		NA																	4	Substitution - coding silent(4)		lung(2)|endometrium(2)	ovary(1)	1						c.(184-186)GTG>GTC		lymphocyte cytosolic protein 2							88.0	88.0	88.0					5																	169714976		1920	4143	6063	SO:0001819	synonymous_variant	3937				immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding	g.chr5:169714976C>G		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.186G>C	5.37:g.169714976C>G						LCP2_uc011det.1_5'UTR	p.V62V	NM_005565	NP_005556	Q13094	LCP2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)	3	393	-	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	62			SAM.		A8KA25|Q53XV4	Silent	SNP	ENST00000046794.5	37	c.186G>C	CCDS47339.1																																																																																				0.527	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565		4	53	0	0	0	0.000602	0	4	53				
GABRP	2568	broad.mit.edu	37	5	170235643	170235643	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:170235643G>A	ENST00000518525.1	+	9	1183	c.719G>A	c.(718-720)aGg>aAg	p.R240K	GABRP_ENST00000265294.4_Missense_Mutation_p.R240K|GABRP_ENST00000519598.1_Missense_Mutation_p.R240K|GABRP_ENST00000519385.1_Missense_Mutation_p.R240K			O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	240					signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R240K(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(4)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	29	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAGCTTCGGAGGAATGTTCTG	0.418																																							uc003mau.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(718-720)AGG>AAG		gamma-aminobutyric acid (GABA) A receptor, pi							228.0	201.0	210.0					5																	170235643		2203	4300	6503	SO:0001583	missense	2568					cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr5:170235643G>A	U95367	CCDS4375.1, CCDS75368.1	5q35.1	2012-06-22			ENSG00000094755	ENSG00000094755		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4089	protein-coding gene	gene with protein product	"""GABA(A) receptor, pi"""	602729				9182563	Standard	NM_014211		Approved		uc003mau.3	O00591	OTTHUMG00000130443	ENST00000518525.1:c.719G>A	5.37:g.170235643G>A	ENSP00000430100:p.Arg240Lys					GABRP_uc011dev.1_Missense_Mutation_p.R240K	p.R240K	NM_014211	NP_055026	O00591	GBRP_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		8	917	+	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	240			Extracellular (Potential).		A8KA36|D3DQL2|Q32MJ1	Missense_Mutation	SNP	ENST00000518525.1	37	c.719G>A	CCDS4375.1	.	.	.	.	.	.	.	.	.	.	G	33	5.195207	0.94960	.	.	ENSG00000094755	ENST00000518525;ENST00000539175;ENST00000265294;ENST00000519385;ENST00000519598	D;D;D;D	0.96685	-4.09;-4.09;-4.09;-4.09	4.94	4.94	0.65067	Neurotransmitter-gated ion-channel ligand-binding (3);	0.061997	0.85682	D	0.000000	D	0.98560	0.9519	M	0.92738	3.34	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.79108	0.992;0.957	D	0.99748	1.1017	10	0.87932	D	0	.	18.1391	0.89633	0.0:0.0:1.0:0.0	.	240;240	E7EWG0;O00591	.;GBRP_HUMAN	K	240;138;240;240;240	ENSP00000430100:R240K;ENSP00000265294:R240K;ENSP00000430727:R240K;ENSP00000430772:R240K	ENSP00000265294:R240K	R	+	2	0	GABRP	170168221	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.800000	0.99124	2.431000	0.82371	0.655000	0.94253	AGG		0.418	GABRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252834.3	NM_014211		6	45	0	0	0	0.001168	0	6	45				
FLT4	2324	broad.mit.edu	37	5	180048007	180048007	+	Splice_Site	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:180048007C>T	ENST00000261937.6	-	15	2246	c.2168G>A	c.(2167-2169)gGa>gAa	p.G723E	FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Splice_Site_p.G723E|FLT4_ENST00000393347.3_Splice_Site_p.G723E	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	723	Ig-like C2-type 7.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.G723E(2)|p.G533E(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAAGTCGACTCCTGCAGGGGG	0.687																																					Colon(97;1075 1466 27033 27547 35871)	Colon(97;1075 1466 27033 27547 35871)	uc003mma.3		NA																	3	Substitution - Missense(3)		lung(3)	lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15						c.(2167-2169)GGA>GAA		fms-related tyrosine kinase 4 isoform 2	Sorafenib(DB00398)|Sunitinib(DB01268)						19.0	21.0	20.0					5																	180048007		2202	4298	6500	SO:0001630	splice_region_variant	2324	Congenital_Hereditary_Lymphedema			positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity	g.chr5:180048007C>T	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2168-1G>A	5.37:g.180048007C>T						FLT4_uc003mlz.3_Missense_Mutation_p.G723E|FLT4_uc003mmb.1_Missense_Mutation_p.G256E|FLT4_uc011dgy.1_Missense_Mutation_p.E756K	p.G723E	NM_002020	NP_002011	P35916	VGFR3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	15	2247	-	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	723			Ig-like C2-type 7.|Extracellular (Potential).		A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	c.2168G>A	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640851	0.87859	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	D;D;D	0.81659	-1.52;-1.52;-1.52	4.39	4.39	0.52855	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.88948	0.6576	M	0.71296	2.17	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.998;0.994	D	0.90270	0.4307	9	0.62326	D	0.03	.	17.3681	0.87369	0.0:1.0:0.0:0.0	.	533;723;723	E9PFB0;E9PD35;P35916	.;.;VGFR3_HUMAN	E	723;723;723;533	ENSP00000261937:G723E;ENSP00000377016:G723E;ENSP00000426057:G723E	ENSP00000261937:G723E	G	-	2	0	FLT4	179980613	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.783000	0.85696	2.175000	0.68902	0.455000	0.32223	GGA		0.687	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		Missense_Mutation	4	13	0	0	0	0.000602	0	4	13				
DUSP22	56940	broad.mit.edu	37	6	350824	350824	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:350824G>T	ENST00000344450.5	+	8	954	c.511G>T	c.(511-513)Gct>Tct	p.A171S	DUSP22_ENST00000419235.2_3'UTR|DUSP22_ENST00000604971.1_3'UTR	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	171					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.A171S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		CTTCACAGCCGCTCCGGGAAT	0.408																																							uc003msx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(511-513)GCT>TCT		dual specificity phosphatase 22							129.0	122.0	124.0					6																	350824		2203	4300	6503	SO:0001583	missense	56940				apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr6:350824G>T	AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.511G>T	6.37:g.350824G>T	ENSP00000345281:p.Ala171Ser					DUSP22_uc003msy.1_3'UTR	p.A171S	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)	8	950	+	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)	171					B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	ENST00000344450.5	37	c.511G>T	CCDS4468.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978257	0.34942	.	.	ENSG00000112679	ENST00000344450	T	0.04275	3.66	5.56	-3.48	0.04739	.	1.084750	0.07068	N	0.834937	T	0.00552	0.0018	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48246	-0.9052	10	0.09084	T	0.74	.	4.1066	0.10040	0.3326:0.0:0.3852:0.2822	.	171	Q9NRW4	DUS22_HUMAN	S	171	ENSP00000345281:A171S	ENSP00000345281:A171S	A	+	1	0	DUSP22	295824	0.000000	0.05858	0.290000	0.24890	0.833000	0.47200	-0.403000	0.07214	-0.458000	0.07023	0.557000	0.71058	GCT		0.408	DUSP22-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000039621.1	NM_020185		19	145	1	0	8.10497e-08	0.010504	1.07502e-07	19	145				
GMDS	2762	broad.mit.edu	37	6	2117778	2117778	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:2117778C>A	ENST00000380815.4	-	3	429	c.160G>T	c.(160-162)Gta>Tta	p.V54L	GMDS_ENST00000530927.1_Missense_Mutation_p.V24L	NM_001500.3	NP_001491.1	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	54					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|GDP-mannose metabolic process (GO:0019673)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	GDP-mannose 4,6-dehydratase activity (GO:0008446)|NADP+ binding (GO:0070401)	p.V54L(1)	GMDS/PDE8B(2)	breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|prostate(1)	21	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		GACCGCCGTACAATTCCATGG	0.358																																							uc003mtq.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(160-162)GTA>TTA		GDP-mannose 4,6-dehydratase							122.0	122.0	122.0					6																	2117778		2203	4300	6503	SO:0001583	missense	2762				'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity	g.chr6:2117778C>A	AF042377	CCDS4474.1, CCDS58994.1	6p25	2011-09-14			ENSG00000112699	ENSG00000112699	4.2.1.47	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4369	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 3E, member 1"""	602884				9525924, 19027726	Standard	NM_001500		Approved	GMD, SDR3E1	uc003mtq.3	O60547	OTTHUMG00000016143	ENST00000380815.4:c.160G>T	6.37:g.2117778C>A	ENSP00000370194:p.Val54Leu						p.V54L	NM_001500	NP_001491	O60547	GMDS_HUMAN		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)	3	350	-	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)	54					E9PI88|O75357|Q5T954|Q6FH09|Q9UGZ3|Q9UJK9	Missense_Mutation	SNP	ENST00000380815.4	37	c.160G>T	CCDS4474.1	.	.	.	.	.	.	.	.	.	.	C	4.289	0.052845	0.08291	.	.	ENSG00000112699	ENST00000530927;ENST00000380815	D;D	0.93189	-3.18;-3.18	5.41	5.41	0.78517	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.263595	0.35407	N	0.003234	T	0.82098	0.4963	L	0.35249	1.045	0.49130	D	0.999757	B	0.09022	0.002	B	0.09377	0.004	T	0.79162	-0.1917	10	0.02654	T	1	-14.3617	19.1976	0.93696	0.0:1.0:0.0:0.0	.	54	O60547	GMDS_HUMAN	L	24;54	ENSP00000436726:V24L;ENSP00000370194:V54L	ENSP00000370194:V54L	V	-	1	0	GMDS	2062777	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	2.182000	0.42556	2.525000	0.85131	0.655000	0.94253	GTA		0.358	GMDS-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043380.3			27	86	1	0	4.4194e-11	0.013726	6.34325e-11	27	86				
SLC17A4	10050	broad.mit.edu	37	6	25777132	25777132	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:25777132A>G	ENST00000377905.4	+	10	1332	c.1213A>G	c.(1213-1215)Atc>Gtc	p.I405V	SLC17A4_ENST00000439485.2_Missense_Mutation_p.I175V|SLC17A4_ENST00000397076.2_Missense_Mutation_p.I203V	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	405					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.I405V(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GTCTTCTGCCATCAGCAGCTT	0.522																																							uc003nfe.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1213-1215)ATC>GTC		solute carrier family 17 (sodium phosphate),							142.0	124.0	130.0					6																	25777132		2203	4300	6503	SO:0001583	missense	10050				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25777132A>G	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1213A>G	6.37:g.25777132A>G	ENSP00000367137:p.Ile405Val					SLC17A4_uc011djx.1_Missense_Mutation_p.I175V|SLC17A4_uc003nff.1_Missense_Mutation_p.I194V|SLC17A4_uc003nfg.2_Missense_Mutation_p.I342V|SLC17A4_uc010jqa.2_Intron	p.I405V	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN			10	1332	+			405			Helical; (Potential).		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	c.1213A>G	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	A	16.76	3.211061	0.58343	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	T;T;T	0.70749	0.43;0.42;-0.51	5.62	-2.24	0.06909	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.443140	0.04165	N	0.323743	T	0.40247	0.1109	L	0.36672	1.1	0.09310	N	1	B;B;B	0.28208	0.08;0.203;0.062	B;B;B	0.29176	0.026;0.099;0.071	T	0.47886	-0.9082	10	0.62326	D	0.03	.	7.0335	0.24980	0.2113:0.0984:0.0:0.6903	.	175;203;405	E7EPE8;E7EU17;Q9Y2C5	.;.;S17A4_HUMAN	V	405;175;203	ENSP00000367137:I405V;ENSP00000391345:I175V;ENSP00000380266:I203V	ENSP00000367137:I405V	I	+	1	0	SLC17A4	25885111	0.000000	0.05858	0.000000	0.03702	0.828000	0.46876	-0.525000	0.06214	-0.140000	0.11394	0.528000	0.53228	ATC		0.522	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1			6	95	0	0	0	0.001168	0	6	95				
OR10C1	442194	broad.mit.edu	37	6	29408414	29408414	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:29408414T>C	ENST00000444197.2	+	1	1332	c.622T>C	c.(622-624)Tgc>Cgc	p.C208R	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C208R(1)		NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CCTCATCCTCTGCCCCTTTGG	0.582																																							uc011dlp.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(622-624)TGC>CGC		olfactory receptor, family 10, subfamily C,							193.0	204.0	200.0					6																	29408414		1511	2709	4220	SO:0001583	missense	442194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29408414T>C		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.622T>C	6.37:g.29408414T>C	ENSP00000419119:p.Cys208Arg					OR11A1_uc010jrh.1_Intron	p.C208R	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN			1	622	+			208			Helical; Name=5; (Potential).		Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	c.622T>C	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	T	15.91	2.973681	0.53720	.	.	ENSG00000206474	ENST00000444197	T	0.36878	1.23	3.49	2.29	0.28610	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42821	D	0.000654	T	0.33527	0.0866	L	0.60067	1.865	0.51233	D	0.999918	P	0.51653	0.947	P	0.59357	0.856	T	0.10200	-1.0640	10	0.48119	T	0.1	.	7.838	0.29382	0.3296:0.0:0.0:0.6704	.	208	Q96KK4	O10C1_HUMAN	R	208	ENSP00000419119:C208R	ENSP00000419119:C208R	C	+	1	0	OR10C1	29516393	0.000000	0.05858	0.996000	0.52242	0.917000	0.54804	-0.500000	0.06405	0.412000	0.25729	0.491000	0.48974	TGC		0.582	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2			57	153	0	0	0	0.00361	0	57	153				
MUC21	394263	broad.mit.edu	37	6	30955046	30955047	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:30955046_30955047CC>AA	ENST00000376296.3	+	2	1335_1336	c.1094_1095CC>AA	c.(1093-1095)tCC>tAA	p.S365*	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	365	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S365*(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AACTCTGGGTCCAGCACGACCT	0.629																																							uc003nsh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1093-1095)TCC>TAA		mucin 21 precursor																																				SO:0001587	stop_gained	394263					integral to membrane|plasma membrane		g.chr6:30955046_30955047CC>AA	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	Exception_encountered	6.37:g.30955046_30955047delinsAA	ENSP00000365473:p.Ser365*					MUC21_uc003nsi.1_RNA	p.S365*	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN			2	1345_1346	+			365			23.|Ser-rich.|28 X 15 AA approximate tandem repeats.|Extracellular (Potential).		B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Nonsense_Mutation	DNP	ENST00000376296.3	37	c.1094_1095CC>AA	CCDS34388.1																																																																																				0.629	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909		42	115	0	0	0	0.004672	0	42	115				
C2	717	broad.mit.edu	37	6	31903837	31903837	+	Splice_Site	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:31903837A>G	ENST00000299367.5	+	7	1263	c.987A>G	c.(985-987)aaA>aaG	p.K329K	C2_ENST00000452323.2_Intron|C2_ENST00000469372.1_Splice_Site_p.K83K|CFB_ENST00000556679.1_Intron|C2_ENST00000442278.2_Splice_Site_p.K197K|CFB_ENST00000477310.1_Intron|CFB_ENST00000456570.1_Intron	NM_000063.4	NP_000054.2	P06681	CO2_HUMAN	complement component 2	329	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.K329K(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	27		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		CCAACTATAAAGGTACGGGTG	0.498																																							uc003nyf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(985-987)AAA>AAG		complement component 2 isoform 1 preproprotein							57.0	52.0	53.0					6																	31903837		1511	2709	4220	SO:0001630	splice_region_variant	717				complement activation, classical pathway|innate immune response|proteolysis	extracellular space	serine-type endopeptidase activity	g.chr6:31903837A>G		CCDS4728.1, CCDS54991.1, CCDS56416.1, CCDS75427.1, CCDS75428.1	6p21.3	2014-09-17			ENSG00000166278	ENSG00000166278		"""Complement system"""	1248	protein-coding gene	gene with protein product		613927					Standard	NM_001145903		Approved		uc011hbs.1	P06681	OTTHUMG00000031190	ENST00000299367.5:c.988+1A>G	6.37:g.31903837A>G						C2_uc003nyc.2_Silent_p.K116K|C2_uc011doo.1_Silent_p.K83K|C2_uc011dop.1_Intron|C2_uc010jtk.2_Silent_p.K197K|C2_uc011doq.1_Silent_p.K300K|C2_uc003nyg.2_Intron|CFB_uc011dor.1_Intron|C2_uc003nyh.1_5'Flank	p.K329K	NM_000063	NP_000054	P06681	CO2_HUMAN		LUAD - Lung adenocarcinoma(999;0.247)	7	1251	+		Ovarian(999;0.00965)	329			VWFA.		B4DPF3|B4DV20|E9PFN7|O19694|Q13904	Silent	SNP	ENST00000299367.5	37	c.987A>G	CCDS4728.1																																																																																				0.498	C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076379.9		Silent	5	30	0	0	0	0.001168	0	5	30				
KIFC1	3833	broad.mit.edu	37	6	33371703	33371703	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:33371703C>T	ENST00000428849.2	+	6	1003	c.553C>T	c.(553-555)Cgc>Tgc	p.R185C		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	185					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)	p.R185C(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						GGGGACAGAGCGCACAACACT	0.592																																							uc003oef.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(553-555)CGC>TGC		kinesin family member C1							114.0	113.0	113.0					6																	33371703		2203	4300	6503	SO:0001583	missense	3833				blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity	g.chr6:33371703C>T	D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.553C>T	6.37:g.33371703C>T	ENSP00000393963:p.Arg185Cys					KIFC1_uc011drf.1_Missense_Mutation_p.R177C	p.R185C	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN			6	1003	+			185			Potential.		O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	ENST00000428849.2	37	c.553C>T	CCDS34430.1	.	.	.	.	.	.	.	.	.	.	C	5.041	0.193258	0.09599	.	.	ENSG00000237649	ENST00000428849	T	0.78126	-1.15	5.17	2.07	0.26955	.	0.616132	0.17825	N	0.160723	T	0.44265	0.1285	L	0.31926	0.97	0.09310	N	0.999999	B;B	0.12013	0.005;0.003	B;B	0.04013	0.001;0.001	T	0.37407	-0.9707	10	0.45353	T	0.12	-1.4392	5.6952	0.17851	0.1651:0.6401:0.0:0.1947	.	177;185	B4E063;Q9BW19	.;KIFC1_HUMAN	C	185	ENSP00000393963:R185C	ENSP00000393963:R185C	R	+	1	0	KIFC1	33479681	0.961000	0.32948	0.027000	0.17364	0.011000	0.07611	0.231000	0.17872	0.710000	0.31997	0.563000	0.77884	CGC		0.592	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1	NM_002263		6	139	0	0	0	0.001168	0	6	139				
MDGA1	266727	broad.mit.edu	37	6	37620084	37620084	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:37620084C>A	ENST00000434837.3	-	7	2193	c.1015G>T	c.(1015-1017)Gac>Tac	p.D339Y	MDGA1_ENST00000297153.7_Missense_Mutation_p.D339Y|MDGA1_ENST00000505425.1_Missense_Mutation_p.D339Y	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	339	Ig-like 4.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)		p.D339Y(1)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						TTGATCACGTCAGGAGTGATC	0.572																																							uc003onu.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(1015-1017)GAC>TAC		MAM domain containing							37.0	41.0	40.0					6																	37620084		2152	4252	6404	SO:0001583	missense	266727				brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane		g.chr6:37620084C>A	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.1015G>T	6.37:g.37620084C>A	ENSP00000402584:p.Asp339Tyr					MDGA1_uc003onw.3_RNA	p.D339Y	NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN			7	2194	-			339			Ig-like 4.		A6NHG0|Q8NBE3	Missense_Mutation	SNP	ENST00000434837.3	37	c.1015G>T	CCDS47417.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718956	0.89205	.	.	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425	T;T;T	0.56941	0.43;0.57;0.45	5.33	5.33	0.75918	Immunoglobulin-like (1);	0.000000	0.52532	D	0.000079	T	0.65863	0.2732	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68416	-0.5414	10	0.66056	D	0.02	.	18.0107	0.89222	0.0:1.0:0.0:0.0	.	339	Q8NFP4	MDGA1_HUMAN	Y	339	ENSP00000402584:D339Y;ENSP00000297153:D339Y;ENSP00000422042:D339Y	ENSP00000297153:D339Y	D	-	1	0	MDGA1	37728062	1.000000	0.71417	0.635000	0.29338	0.942000	0.58702	7.818000	0.86416	2.496000	0.84212	0.655000	0.94253	GAC		0.572	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3			9	18	1	0	0.000442599	0.006214	0.000493424	9	18				
ZNF318	24149	broad.mit.edu	37	6	43306991	43306991	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:43306991T>A	ENST00000361428.2	-	10	4822	c.4745A>T	c.(4744-4746)gAg>gTg	p.E1582V	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1582					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.E1582V(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CCCCTTAGTCTCAGGGGCCCC	0.468																																							uc003oux.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7						c.(4744-4746)GAG>GTG		zinc finger protein 318							51.0	58.0	56.0					6																	43306991		2203	4300	6503	SO:0001583	missense	24149				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr6:43306991T>A	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4745A>T	6.37:g.43306991T>A	ENSP00000354964:p.Glu1582Val					ZNF318_uc003ouw.2_Intron	p.E1582V	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)		10	4823	-			1582					O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	c.4745A>T	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	-	12.13	1.846509	0.32606	.	.	ENSG00000171467	ENST00000361428	T	0.13307	2.6	5.82	5.82	0.92795	.	.	.	.	.	T	0.14013	0.0339	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.67548	0.952	T	0.07654	-1.0761	9	0.54805	T	0.06	.	14.7533	0.69543	0.0:0.0:0.0:1.0	.	1582	Q5VUA4	ZN318_HUMAN	V	1582	ENSP00000354964:E1582V	ENSP00000354964:E1582V	E	-	2	0	ZNF318	43414969	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	3.443000	0.52907	2.225000	0.72522	0.460000	0.39030	GAG		0.468	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		12	81	0	0	0	0.013537	0	12	81				
MRPL14	64928	broad.mit.edu	37	6	44081627	44081627	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:44081627C>T	ENST00000372014.3	-	3	522	c.391G>A	c.(391-393)Gaa>Aaa	p.E131K		NM_032111.2	NP_115487.2	Q6P1L8	RM14_HUMAN	mitochondrial ribosomal protein L14	131					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.E131K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	12	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0181)			TACTCGCCTTCCCGCTTGCGC	0.562																																							uc003owp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(391-393)GAA>AAA		mitochondrial ribosomal protein L14 precursor							57.0	53.0	54.0					6																	44081627		2203	4300	6503	SO:0001583	missense	64928				translation	mitochondrion|ribosome	structural constituent of ribosome	g.chr6:44081627C>T	AB051339	CCDS34460.1	6p21.3	2012-09-13			ENSG00000180992	ENSG00000180992		"""Mitochondrial ribosomal proteins / large subunits"""	14279	protein-coding gene	gene with protein product		611827					Standard	XM_005249300		Approved	RPML32, MRP-L32	uc003owp.3	Q6P1L8	OTTHUMG00000014756	ENST00000372014.3:c.391G>A	6.37:g.44081627C>T	ENSP00000361084:p.Glu131Lys						p.E131K	NM_032111	NP_115487	Q6P1L8	RM14_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0181)		3	520	-	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		131					B2R575|Q96Q72	Missense_Mutation	SNP	ENST00000372014.3	37	c.391G>A	CCDS34460.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.387811	0.42308	.	.	ENSG00000180992	ENST00000372014	.	.	.	5.69	5.69	0.88448	Ribosomal protein L14 domain (2);	0.051699	0.85682	D	0.000000	T	0.27063	0.0663	N	0.13272	0.32	0.80722	D	1	B	0.21071	0.051	B	0.27608	0.081	T	0.20042	-1.0287	9	0.10636	T	0.68	-7.8706	18.8032	0.92027	0.0:1.0:0.0:0.0	.	131	Q6P1L8	RM14_HUMAN	K	131	.	ENSP00000361084:E131K	E	-	1	0	MRPL14	44189605	1.000000	0.71417	0.983000	0.44433	0.679000	0.39708	4.768000	0.62293	2.681000	0.91329	0.561000	0.74099	GAA		0.562	MRPL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040707.1	NM_032111		7	47	0	0	0	0.00308	0	7	47				
COL21A1	81578	broad.mit.edu	37	6	56035886	56035886	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:56035886A>T	ENST00000244728.5	-	4	1078	c.681T>A	c.(679-681)gaT>gaA	p.D227E	COL21A1_ENST00000535941.1_Missense_Mutation_p.D227E|COL21A1_ENST00000370819.1_Missense_Mutation_p.D227E	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	227					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.D227E(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ATCCCCTTTCATCACGAGCTG	0.308																																							uc003pcs.2		NA																	2	Substitution - Missense(2)	p.D227N(1)	lung(2)	ovary(2)	2						c.(679-681)GAT>GAA		collagen, type XXI, alpha 1 precursor							93.0	86.0	88.0					6																	56035886		1831	4081	5912	SO:0001583	missense	81578				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr6:56035886A>T	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.681T>A	6.37:g.56035886A>T	ENSP00000244728:p.Asp227Glu					COL21A1_uc003pct.1_RNA|COL21A1_uc011dxi.1_Missense_Mutation_p.D227E|COL21A1_uc003pcu.1_Missense_Mutation_p.D227E	p.D227E	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)		4	913	-	Lung NSC(77;0.0483)		227					A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	c.681T>A	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	A	13.32	2.202110	0.38905	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811	D;D;D	0.89415	-2.51;-2.46;-2.51	4.17	1.68	0.24146	.	0.000000	0.52532	U	0.000068	D	0.88265	0.6390	L	0.49350	1.555	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.83275	0.996;0.978	D	0.86899	0.2053	10	0.51188	T	0.08	.	9.0498	0.36369	0.8344:0.0:0.1656:0.0	.	227;227	Q96P44-3;Q96P44	.;COLA1_HUMAN	E	227	ENSP00000244728:D227E;ENSP00000359855:D227E;ENSP00000444384:D227E	ENSP00000244728:D227E	D	-	3	2	COL21A1	56143845	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	0.973000	0.29422	0.567000	0.29293	-0.359000	0.07587	GAT		0.308	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2			5	12	0	0	0	0.001984	0	5	12				
BAI3	577	broad.mit.edu	37	6	70034899	70034899	+	Silent	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:70034899T>C	ENST00000370598.1	+	21	3771	c.2950T>C	c.(2950-2952)Ttg>Ctg	p.L984L	BAI3_ENST00000238918.8_Silent_p.L190L	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	984					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L984L(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				AAAACGCTTTTTGTGCCTTGG	0.403																																							uc003pev.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(2950-2952)TTG>CTG		brain-specific angiogenesis inhibitor 3							188.0	180.0	182.0					6																	70034899		2203	4300	6503	SO:0001819	synonymous_variant	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:70034899T>C	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2950T>C	6.37:g.70034899T>C						BAI3_uc010kak.2_Silent_p.L984L|BAI3_uc011dxx.1_Silent_p.L190L|BAI3_uc003pex.1_Silent_p.L114L	p.L984L	NM_001704	NP_001695	O60242	BAI3_HUMAN			21	3398	+		all_lung(197;0.212)	984			Helical; Name=4; (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	ENST00000370598.1	37	c.2950T>C	CCDS4968.1																																																																																				0.403	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			8	47	0	0	0	0.006214	0	8	47				
DPPA5	340168	broad.mit.edu	37	6	74063858	74063858	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:74063858G>T	ENST00000370370.3	-	1	160	c.91C>A	c.(91-93)Cgg>Agg	p.R31R		NM_001025290.2	NP_001020461.1	A6NC42	DPPA5_HUMAN	developmental pluripotency associated 5	31	KH; atypical.				multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)	p.R31R(1)		NS(1)|endometrium(1)|lung(5)	7						TTCAGCAGCCGCGTCTGGACC	0.602																																							uc003pgs.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(91-93)CGG>AGG		developmental pluripotency associated 5							69.0	67.0	68.0					6																	74063858		2203	4300	6503	SO:0001819	synonymous_variant	340168				multicellular organismal development	cytoplasm	RNA binding	g.chr6:74063858G>T		CCDS34483.1	6q13	2014-01-28			ENSG00000203909	ENSG00000203909			19201	protein-coding gene	gene with protein product		611111					Standard	NM_001025290		Approved	Esg1	uc003pgs.2	A6NC42	OTTHUMG00000015025	ENST00000370370.3:c.91C>A	6.37:g.74063858G>T							p.R31R	NM_001025290	NP_001020461	A6NC42	DPPA5_HUMAN			1	96	-			31			KH; atypical.		B2RPQ7	Silent	SNP	ENST00000370370.3	37	c.91C>A	CCDS34483.1																																																																																				0.602	DPPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041203.3	NM_001025290		16	38	1	0	7.45023e-12	0.010504	1.08494e-11	16	38				
CEP162	22832	broad.mit.edu	37	6	84872875	84872875	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:84872875C>G	ENST00000403245.3	-	19	2614	c.2500G>C	c.(2500-2502)Gct>Cct	p.A834P	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.A758P	NM_014895.2	NP_055710.2												p.A834P(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		GTGACATAAGCAATCTGATCT	0.328																																							uc010kbp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2500-2502)GCT>CCT		KIAA1009 protein							265.0	236.0	246.0					6																	84872875		2203	4300	6503	SO:0001583	missense	22832				cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding	g.chr6:84872875C>G																												ENST00000403245.3:c.2500G>C	6.37:g.84872875C>G	ENSP00000385215:p.Ala834Pro					KIAA1009_uc003pkj.3_Missense_Mutation_p.A758P|KIAA1009_uc003pki.3_Missense_Mutation_p.A220P	p.A834P	NM_014895	NP_055710	Q5TB80	QN1_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.089)	19	2597	-		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)	834			Potential.			Missense_Mutation	SNP	ENST00000403245.3	37	c.2500G>C	CCDS34494.2	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313711	0.60414	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.33654	1.4;1.4	5.39	4.5	0.54988	.	0.373083	0.26213	N	0.025671	T	0.29423	0.0733	M	0.63428	1.95	0.27192	N	0.96038	D	0.59767	0.986	P	0.54174	0.744	T	0.10613	-1.0622	10	0.34782	T	0.22	-6.2014	7.0694	0.25169	0.2557:0.6179:0.0:0.1263	.	834	Q5TB80	QN1_HUMAN	P	758;834	ENSP00000257766:A758P;ENSP00000385215:A834P	ENSP00000257766:A758P	A	-	1	0	KIAA1009	84929594	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.590000	0.36654	2.670000	0.90874	0.563000	0.77884	GCT		0.328	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1			28	62	0	0	0	0.012213	0	28	62				
ASCC3	10973	broad.mit.edu	37	6	101103674	101103674	+	Silent	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:101103674A>G	ENST00000369162.2	-	17	3068	c.2724T>C	c.(2722-2724)acT>acC	p.T908T		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	908	Helicase C-terminal 1. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.T908T(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CTTCCACATTAGTAACTGTTC	0.363																																							uc003pqk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(1)	6						c.(2722-2724)ACT>ACC		activating signal cointegrator 1 complex subunit							108.0	106.0	107.0					6																	101103674		2203	4299	6502	SO:0001819	synonymous_variant	10973				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr6:101103674A>G	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.2724T>C	6.37:g.101103674A>G						ASCC3_uc011eai.1_Silent_p.T810T	p.T908T	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)	17	3053	-		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)	908			Helicase C-terminal 1.		E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Silent	SNP	ENST00000369162.2	37	c.2724T>C	CCDS5046.1																																																																																				0.363	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828		4	10	0	0	0	0.000602	0	4	10				
PDSS2	57107	broad.mit.edu	37	6	107533374	107533374	+	Missense_Mutation	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:107533374T>G	ENST00000369037.4	-	5	1092	c.815A>C	c.(814-816)cAt>cCt	p.H272P	PDSS2_ENST00000453874.2_Intron	NM_020381.3	NP_065114.3	Q86YH6	DLP1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 2	272					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|regulation of body fluid levels (GO:0050878)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)	p.H272P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)	19	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		CTCAGCATCATGCTTTGCTAA	0.418																																							uc003prt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(814-816)CAT>CCT		prenyl diphosphate synthase, subunit 2							207.0	190.0	196.0					6																	107533374		2203	4300	6503	SO:0001583	missense	57107				isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity	g.chr6:107533374T>G	AF254956	CCDS5059.1	6q21	2006-02-14	2006-02-14	2006-02-14	ENSG00000164494	ENSG00000164494			23041	protein-coding gene	gene with protein product		610564	"""chromosome 6 open reading frame 210"""	C6orf210		16262699	Standard	NM_020381		Approved	bA59I9.3	uc003prt.2	Q86YH6	OTTHUMG00000059359	ENST00000369037.4:c.815A>C	6.37:g.107533374T>G	ENSP00000358033:p.His272Pro					PDSS2_uc011eak.1_Missense_Mutation_p.H136P|PDSS2_uc011eal.1_Intron|PDSS2_uc003pru.2_Missense_Mutation_p.H272P	p.H272P	NM_020381	NP_065114	Q86YH6	DLP1_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)	5	1105	-	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	272					Q33DR4|Q4G158|Q5VU38|Q5VU39|Q9NR58	Missense_Mutation	SNP	ENST00000369037.4	37	c.815A>C	CCDS5059.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.446192	0.84101	.	.	ENSG00000164494	ENST00000369037;ENST00000369033	T	0.62941	-0.01	5.97	5.97	0.96955	Terpenoid synthase (2);	0.045261	0.85682	N	0.000000	T	0.76593	0.4009	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.80372	-0.1410	10	0.72032	D	0.01	.	16.4452	0.83925	0.0:0.0:0.0:1.0	.	272;272	B2RE48;Q86YH6	.;DLP1_HUMAN	P	272;6	ENSP00000358033:H272P	ENSP00000358029:H6P	H	-	2	0	PDSS2	107640067	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.329000	0.79170	2.281000	0.76405	0.528000	0.53228	CAT		0.418	PDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131954.1	NM_020381		25	133	0	0	0	0.009535	0	25	133				
AK9	221264	broad.mit.edu	37	6	109954214	109954214	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:109954214C>A	ENST00000424296.2	-	12	1242	c.1166G>T	c.(1165-1167)gGa>gTa	p.G389V	AK9_ENST00000368948.2_Missense_Mutation_p.G389V|AK9_ENST00000341338.6_5'UTR|AK9_ENST00000285397.5_Missense_Mutation_p.G389V	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	389					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)	p.G389V(2)									ACATGGTGGTCCTGGCATAGG	0.363																																							uc003ptn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1165-1167)GGA>GTA		adenylate kinase domain containing 1 isoform 1							141.0	130.0	134.0					6																	109954214		2203	4300	6503	SO:0001583	missense	221264				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity	g.chr6:109954214C>A	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.1166G>T	6.37:g.109954214C>A	ENSP00000410186:p.Gly389Val					AKD1_uc003ptr.3_Missense_Mutation_p.G389V	p.G389V	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN			12	1243	-			389					A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	ENST00000424296.2	37	c.1166G>T	CCDS55048.1	.	.	.	.	.	.	.	.	.	.	C	7.352	0.622995	0.14193	.	.	ENSG00000155085	ENST00000424296;ENST00000368948;ENST00000285397	T;T;T	0.62639	0.01;0.05;2.47	5.6	-1.46	0.08800	.	1.178400	0.05710	N	0.595853	T	0.15739	0.0379	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.05937	-1.0855	9	.	.	.	-1.4016	1.7585	0.02987	0.5091:0.1539:0.1841:0.1529	.	389;389	Q5TCS8-2;Q5TCS8	.;AKD1_HUMAN	V	389	ENSP00000410186:G389V;ENSP00000357944:G389V;ENSP00000285397:G389V	.	G	-	2	0	AKD1	110060907	0.000000	0.05858	0.008000	0.14137	0.833000	0.47200	0.138000	0.16016	-0.173000	0.10761	-0.370000	0.07254	GGA		0.363	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001145128		15	14	1	0	1.5739e-10	0.004007	2.23609e-10	15	14				
CDC40	51362	broad.mit.edu	37	6	110522870	110522870	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:110522870G>T	ENST00000368932.1	+	4	487	c.386G>T	c.(385-387)aGg>aTg	p.R129M	CDC40_ENST00000307731.1_Missense_Mutation_p.R129M|CDC40_ENST00000368930.1_Missense_Mutation_p.R129M			O60508	PRP17_HUMAN	cell division cycle 40	129					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)	p.R129M(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		GAGCAGCAAAGGAGAACTTTT	0.383																																							uc003pua.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(385-387)AGG>ATG		cell division cycle 40 homolog							163.0	159.0	160.0					6																	110522870		2203	4300	6503	SO:0001583	missense	51362				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm		g.chr6:110522870G>T	AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.386G>T	6.37:g.110522870G>T	ENSP00000357928:p.Arg129Met						p.R129M	NM_015891	NP_056975	O60508	PRP17_HUMAN		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)	3	410	+		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)	129					B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	ENST00000368932.1	37	c.386G>T	CCDS5081.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.5|26.5	4.743818|4.743818	0.89663|0.89663	.|.	.|.	ENSG00000168438|ENSG00000168438	ENST00000431461|ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731;ENST00000439165;ENST00000453107	.|T;T;T;T	.|0.62364	.|0.18;0.03;0.03;0.18	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76471|0.76471	0.3992|0.3992	M|M	0.79805|0.79805	2.47|2.47	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.66979	.|0.948	T|T	0.74598|0.74598	-0.3612|-0.3612	5|10	.|0.39692	.|T	.|0.17	-3.3602|-3.3602	19.8537|19.8537	0.96750|0.96750	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|129	.|O60508	.|PRP17_HUMAN	N|M	21|129;129;129;129;129;26	.|ENSP00000357928:R129M;ENSP00000357929:R129M;ENSP00000357926:R129M;ENSP00000304370:R129M	.|ENSP00000304370:R129M	K|R	+|+	3|2	2|0	CDC40|CDC40	110629563|110629563	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.209000|9.209000	0.95087|0.95087	2.683000|2.683000	0.91414|0.91414	0.650000|0.650000	0.86243|0.86243	AAG|AGG		0.383	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041791.1	NM_015891		8	59	1	0	0.00448238	0.004482	0.00482771	8	59				
HEY2	23493	broad.mit.edu	37	6	126080786	126080786	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:126080786G>T	ENST00000368364.3	+	5	1049	c.852G>T	c.(850-852)ggG>ggT	p.G284G	HEY2_ENST00000368365.1_Silent_p.G238G	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	284	Ala-rich.				anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.G284G(1)		breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		CCTTCGCGGGGGCATTCCCCA	0.662																																							uc003qad.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(850-852)GGG>GGT		hairy/enhancer-of-split related with YRPW motif							105.0	112.0	109.0					6																	126080786		2203	4299	6502	SO:0001819	synonymous_variant	23493				negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription initiation from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|smooth muscle cell differentiation|transcription, DNA-dependent	transcriptional repressor complex	histone deacetylase binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding	g.chr6:126080786G>T	AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.852G>T	6.37:g.126080786G>T						HEY2_uc011ebr.1_Silent_p.G238G	p.G284G	NM_012259	NP_036391	Q9UBP5	HEY2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)	5	1043	+			284			Ala-rich.			Silent	SNP	ENST00000368364.3	37	c.852G>T	CCDS5131.1																																																																																				0.662	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042077.1			74	126	1	0	8.29215e-51	0.00361	1.42413e-50	74	126				
ENPP3	5169	broad.mit.edu	37	6	132054860	132054860	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:132054860C>T	ENST00000414305.1	+	22	2414	c.2086C>T	c.(2086-2088)Cct>Tct	p.P696S	ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000357639.3_Missense_Mutation_p.P696S			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	696	Nuclease.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.P696S(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		CCTCTATCCTCCTGGTTAGTA	0.458																																							uc003qcu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2086-2088)CCT>TCT		ectonucleotide pyrophosphatase/phosphodiesterase							94.0	92.0	93.0					6																	132054860		2203	4300	6503	SO:0001583	missense	5169				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity	g.chr6:132054860C>T	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.2086C>T	6.37:g.132054860C>T	ENSP00000406261:p.Pro696Ser					ENPP3_uc010kfq.2_Intron|ENPP3_uc003qcv.2_Missense_Mutation_p.P696S	p.P696S	NM_005021	NP_005012	O14638	ENPP3_HUMAN		GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)	22	2433	+	Breast(56;0.0753)		696			Extracellular (Potential).|Nuclease.		Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	37	c.2086C>T	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192072	0.78902	.	.	ENSG00000154269	ENST00000414305;ENST00000357639	T;T	0.65916	-0.18;-0.18	5.82	5.82	0.92795	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.000000	0.64402	D	0.000001	T	0.81688	0.4875	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84064	0.0376	10	0.87932	D	0	-11.8081	20.0951	0.97834	0.0:1.0:0.0:0.0	.	696	O14638	ENPP3_HUMAN	S	696	ENSP00000406261:P696S;ENSP00000350265:P696S	ENSP00000350265:P696S	P	+	1	0	ENPP3	132096553	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.458000	0.73509	2.755000	0.94549	0.460000	0.39030	CCT		0.458	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2			4	73	0	0	0	0.000602	0	4	73				
UTRN	7402	broad.mit.edu	37	6	144803498	144803498	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:144803498A>G	ENST00000367545.3	+	26	3661	c.3661A>G	c.(3661-3663)Att>Gtt	p.I1221V		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1221					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.I1221V(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTGTAATAGAATTCGAGGAAA	0.353																																							uc003qkt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(3661-3663)ATT>GTT		utrophin							89.0	87.0	87.0					6																	144803498		2203	4300	6503	SO:0001583	missense	7402				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding	g.chr6:144803498A>G	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3661A>G	6.37:g.144803498A>G	ENSP00000356515:p.Ile1221Val						p.I1221V	NM_007124	NP_009055	P46939	UTRO_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)	26	3753	+		Ovarian(120;0.218)	1221			Spectrin 8.		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	c.3661A>G	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	A	14.43	2.534399	0.45073	.	.	ENSG00000152818	ENST00000367545	T	0.48836	0.8	5.51	4.35	0.52113	.	0.000000	0.48767	D	0.000175	T	0.19886	0.0478	N	0.08118	0	0.80722	D	1	P	0.49090	0.919	P	0.53549	0.729	T	0.04915	-1.0918	10	0.10111	T	0.7	.	11.3881	0.49798	0.9289:0.0:0.071:0.0	.	1221	P46939	UTRO_HUMAN	V	1221	ENSP00000356515:I1221V	ENSP00000356515:I1221V	I	+	1	0	UTRN	144845191	1.000000	0.71417	0.966000	0.40874	0.957000	0.61999	2.812000	0.47994	0.917000	0.36895	0.460000	0.39030	ATT		0.353	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1			4	40	0	0	0	0.000602	0	4	40				
PNLDC1	154197	broad.mit.edu	37	6	160241522	160241522	+	Silent	SNP	G	G	A	rs144377714		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr6:160241522G>A	ENST00000610273.1	+	19	1707	c.1536G>A	c.(1534-1536)gcG>gcA	p.A512A	PNLDC1_ENST00000392167.3_Silent_p.A523A	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	512						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.A512A(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CCCTTCTCGCGTTCATCCTTG	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19156	0.0		0.0	False		,,,				2504	0.0						uc003qsx.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1534-1536)GCG>GCA		poly(A)-specific ribonuclease (PARN)-like domain		G		1,4405	2.1+/-5.4	0,1,2202	140.0	112.0	121.0		1536	-10.4	0.0	6	dbSNP_134	121	0,8600		0,0,4300	no	coding-synonymous	PNLDC1	NM_173516.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		512/521	160241522	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	154197					integral to membrane|nucleus	nucleic acid binding	g.chr6:160241522G>A	AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1536G>A	6.37:g.160241522G>A						PNLDC1_uc003qsy.1_Silent_p.A523A	p.A512A	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)	19	1707	+		Breast(66;0.00519)|Ovarian(120;0.123)	512			Helical; Anchor for type IV membrane protein; (Potential).		Q5TAP7|Q8N7X5	Silent	SNP	ENST00000610273.1	37	c.1536G>A	CCDS5271.1																																																																																				0.627	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516		12	48	0	0	0	0.013537	0	12	48				
THSD7A	221981	broad.mit.edu	37	7	11441426	11441426	+	Silent	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:11441426A>G	ENST00000423059.4	-	23	4658	c.4407T>C	c.(4405-4407)tgT>tgC	p.C1469C	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1469	TSP type-1 15. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.C1469C(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ACTCACCATAACATGATTTTG	0.378										HNSCC(18;0.044)																													uc003ssf.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(4405-4407)TGT>TGC		thrombospondin, type I, domain containing 7A							88.0	86.0	86.0					7																	11441426		1894	4117	6011	SO:0001819	synonymous_variant	221981					integral to membrane		g.chr7:11441426A>G		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4407T>C	7.37:g.11441426A>G		HNSCC(18;0.044)					p.C1469C	NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	22	4659	-			1469			Extracellular (Potential).|TSP type-1 15.			Silent	SNP	ENST00000423059.4	37	c.4407T>C	CCDS47543.1																																																																																				0.378	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		6	62	0	0	0	0.00308	0	6	62				
HDAC9	9734	broad.mit.edu	37	7	18705919	18705919	+	Silent	SNP	G	G	T	rs370092099		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:18705919G>T	ENST00000432645.2	+	11	1542	c.1542G>T	c.(1540-1542)gcG>gcT	p.A514A	HDAC9_ENST00000428307.2_Silent_p.A470A|HDAC9_ENST00000401921.1_Silent_p.A473A|HDAC9_ENST00000406451.4_Silent_p.A514A|HDAC9_ENST00000441542.2_Silent_p.A517A|HDAC9_ENST00000417496.2_Silent_p.A512A|HDAC9_ENST00000406072.1_Silent_p.A501A|HDAC9_ENST00000524023.1_Silent_p.A437A|HDAC9_ENST00000405010.3_Silent_p.A514A|HDAC9_ENST00000456174.2_Silent_p.A486A	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	514					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.A517A(6)|p.A512A(2)|p.A514A(2)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GGGACCAGGCGATGCAGGAAG	0.532											OREG0017877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003suh.2		NA																	10	Substitution - coding silent(10)		lung(8)|upper_aerodigestive_tract(2)	lung(2)|central_nervous_system(2)|kidney(1)	5						c.(1540-1542)GCG>GCT		histone deacetylase 9 isoform 1	Valproic Acid(DB00313)						118.0	129.0	125.0					7																	18705919		2042	4185	6227	SO:0001819	synonymous_variant	9734				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity	g.chr7:18705919G>T	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1542G>T	7.37:g.18705919G>T			OREG0017877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	727	HDAC9_uc003sue.2_Silent_p.A514A|HDAC9_uc011jyd.1_Silent_p.A514A|HDAC9_uc003sui.2_Silent_p.A517A|HDAC9_uc003suj.2_Silent_p.A473A|HDAC9_uc011jya.1_Silent_p.A511A|HDAC9_uc003sua.1_Silent_p.A492A|HDAC9_uc011jyb.1_Silent_p.A470A|HDAC9_uc003sud.1_Silent_p.A514A|HDAC9_uc011jyc.1_Silent_p.A473A|HDAC9_uc003suf.1_Silent_p.A545A|HDAC9_uc010kud.1_Silent_p.A517A|HDAC9_uc011jye.1_Silent_p.A486A|HDAC9_uc011jyf.1_Silent_p.A437A|HDAC9_uc010kue.1_Intron	p.A514A	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN			11	1583	+	all_lung(11;0.187)		514					A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Silent	SNP	ENST00000432645.2	37	c.1542G>T	CCDS47555.1																																																																																				0.532	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1			21	71	1	0	5.26018e-13	0.012319	7.80651e-13	21	71				
ABCB5	340273	broad.mit.edu	37	7	20698250	20698250	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:20698250C>A	ENST00000404938.2	+	14	2310	c.1658C>A	c.(1657-1659)tCt>tAt	p.S553Y	ABCB5_ENST00000406935.1_Missense_Mutation_p.S108Y|ABCB5_ENST00000258738.6_Missense_Mutation_p.S108Y|ABCB5_ENST00000443026.2_Missense_Mutation_p.S108Y	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	553	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.S108Y(2)|p.S553Y(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GAGGCTACGTCTGCCCTGGAT	0.448																																							uc003suw.3		NA																	3	Substitution - Missense(3)		lung(3)	skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(322-324)TCT>TAT		ATP-binding cassette, sub-family B, member 5							106.0	93.0	97.0					7																	20698250		2203	4300	6503	SO:0001583	missense	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20698250C>A	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1658C>A	7.37:g.20698250C>A	ENSP00000384881:p.Ser553Tyr					ABCB5_uc010kuh.2_Missense_Mutation_p.S553Y|ABCB5_uc003suv.3_Missense_Mutation_p.S108Y|ABCB5_uc011jyi.1_Missense_Mutation_p.S108Y	p.S108Y	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN			5	869	+			108			ABC transporter 1.|Extracellular (Potential).		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	c.323C>A	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.421114	0.62622	.	.	ENSG00000004846	ENST00000404938;ENST00000443026;ENST00000406935;ENST00000258738	D;D;D;D	0.93133	-1.96;-3.17;-3.17;-1.96	5.58	5.58	0.84498	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.219638	0.30676	N	0.009106	D	0.98349	0.9452	H	0.98833	4.345	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.997;1.0	D	0.99379	1.0922	10	0.87932	D	0	.	18.9333	0.92576	0.0:1.0:0.0:0.0	.	108;553;108;108	B5MD19;A7BKA4;Q2M3G0;Q2M3G0-2	.;.;ABCB5_HUMAN;.	Y	553;108;108;108	ENSP00000384881:S553Y;ENSP00000406730:S108Y;ENSP00000383899:S108Y;ENSP00000258738:S108Y	ENSP00000258738:S108Y	S	+	2	0	ABCB5	20664775	1.000000	0.71417	0.973000	0.42090	0.005000	0.04900	7.627000	0.83176	2.788000	0.95919	0.650000	0.86243	TCT		0.448	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559		19	39	1	0	7.41877e-09	0.012319	1.01681e-08	19	39				
STEAP1B	256227	broad.mit.edu	37	7	22532984	22532984	+	Nonsense_Mutation	SNP	G	G	A	rs375277186		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:22532984G>A	ENST00000406890.2	-	3	593	c.499C>T	c.(499-501)Cga>Tga	p.R167*	STEAP1B_ENST00000404369.4_Nonsense_Mutation_p.R186*	NM_207342.2	NP_997225.1	Q6NZ63	STEAL_HUMAN	STEAP family member 1B	167						integral component of membrane (GO:0016021)		p.R186*(1)|p.R167*(1)		endometrium(1)|kidney(1)|lung(2)	4						CTGTAGGATCGCCTCATTGCG	0.373																																							uc003svh.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(499-501)CGA>TGA		SubName: Full=cDNA FLJ60218, highly similar to Six transmembrane epithelial antigen ofprostate 1;		G	stop/ARG,stop/ARG	0,1384		0,0,692	130.0	104.0	112.0		556,499	0.2	1.0	7		112	2,3180		0,2,1589	no	stop-gained,stop-gained	STEAP1B	NM_001164460.1,NM_207342.2	,	0,2,2281	AA,AG,GG		0.0629,0.0,0.0438	,	186/343,167/246	22532984	2,4564	692	1591	2283	SO:0001587	stop_gained	256227					integral to membrane	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity	g.chr7:22532984G>A		CCDS55094.1, CCDS56469.1	7p15.3	2011-05-19			ENSG00000105889	ENSG00000105889			41907	protein-coding gene	gene with protein product							Standard	NM_207342		Approved		uc010kum.2	Q6NZ63	OTTHUMG00000152529	ENST00000406890.2:c.499C>T	7.37:g.22532984G>A	ENSP00000385239:p.Arg167*					MGC87042_uc010kum.1_Nonsense_Mutation_p.R186*	p.R167*			Q6NZ63	STEAL_HUMAN			3	596	-			167					B5MCI2	Nonsense_Mutation	SNP	ENST00000406890.2	37	c.499C>T	CCDS55094.1	.	.	.	.	.	.	.	.	.	.	g	19.97	3.924938	0.73213	0.0	6.29E-4	ENSG00000105889	ENST00000406890;ENST00000404369;ENST00000424363;ENST00000439708	.	.	.	1.23	0.219	0.15274	.	0.000000	0.42172	U	0.000752	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.9693	5.463	0.16627	0.0:0.0:0.4184:0.5816	.	.	.	.	X	167;186;186;186	.	ENSP00000384370:R186X	R	-	1	2	STEAP1B	22499509	0.999000	0.42202	0.994000	0.49952	0.200000	0.23975	1.917000	0.39996	0.086000	0.17137	0.121000	0.15741	CGA		0.373	STEAP1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326617.2			13	29	0	0	0	0.013537	0	13	29				
CHN2	1124	broad.mit.edu	37	7	29440373	29440373	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:29440373A>G	ENST00000222792.6	+	6	1035	c.505A>G	c.(505-507)Agg>Ggg	p.R169G	CHN2_ENST00000495789.2_Missense_Mutation_p.R182G|CHN2_ENST00000539406.1_Missense_Mutation_p.R244G|CHN2_ENST00000435288.2_Intron|CHN2_ENST00000546235.1_Missense_Mutation_p.R154G|CHN2_ENST00000539389.1_Intron	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	169					positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)	p.R169G(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						AGTATCCAGAAGGCTGAGCAG	0.423																																					Ovarian(1;44 48 13232 18918 31480)	Ovarian(1;44 48 13232 18918 31480)	uc003szz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(505-507)AGG>GGG		beta chimerin isoform 2							74.0	69.0	71.0					7																	29440373		2203	4300	6503	SO:0001583	missense	1124				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity	g.chr7:29440373A>G	L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.505A>G	7.37:g.29440373A>G	ENSP00000222792:p.Arg169Gly					CHN2_uc011jzs.1_Missense_Mutation_p.R244G|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Missense_Mutation_p.R134G|CHN2_uc011jzt.1_Missense_Mutation_p.R182G|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Missense_Mutation_p.R154G	p.R169G	NM_004067	NP_004058	P52757	CHIO_HUMAN			6	942	+			169					A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	c.505A>G	CCDS5420.1	.	.	.	.	.	.	.	.	.	.	A	14.18	2.458599	0.43634	.	.	ENSG00000106069	ENST00000539406;ENST00000222792;ENST00000495789;ENST00000546235;ENST00000446446	T;T;T;T;D	0.87650	-0.6;-0.52;-0.53;-0.51;-2.28	6.17	3.71	0.42584	.	0.090242	0.85682	D	0.000000	D	0.88742	0.6519	L	0.36672	1.1	0.80722	D	1	B;D;D;D;D	0.67145	0.016;0.987;0.996;0.967;0.987	B;D;D;D;D	0.77557	0.011;0.942;0.99;0.916;0.942	D	0.84779	0.0772	10	0.24483	T	0.36	.	12.8427	0.57813	0.7427:0.2573:0.0:0.0	.	154;182;244;169;169	B7Z1W9;B7Z1V0;F5H003;A4D1A2;P52757	.;.;.;.;CHIO_HUMAN	G	244;169;182;154;20	ENSP00000444063:R244G;ENSP00000222792:R169G;ENSP00000438587:R182G;ENSP00000442812:R154G;ENSP00000396867:R20G	ENSP00000222792:R169G	R	+	1	2	CHN2	29406898	0.990000	0.36364	0.808000	0.32385	0.708000	0.40852	2.933000	0.48948	0.509000	0.28195	0.533000	0.62120	AGG		0.423	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067		20	59	0	0	0	0.008871	0	20	59				
NEUROD6	63974	broad.mit.edu	37	7	31378648	31378648	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:31378648G>T	ENST00000297142.3	-	2	557	c.235C>A	c.(235-237)Ctt>Att	p.L79I		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	79					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.L79I(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						TTTTTCCTAAGACCCCTCCTT	0.502																																							uc003tch.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(235-237)CTT>ATT		neurogenic differentiation 6							264.0	255.0	258.0					7																	31378648		2203	4300	6503	SO:0001583	missense	63974				cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr7:31378648G>T	AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.235C>A	7.37:g.31378648G>T	ENSP00000297142:p.Leu79Ile						p.L79I	NM_022728	NP_073565	Q96NK8	NDF6_HUMAN			2	588	-			79					Q548T9|Q9H3H6	Missense_Mutation	SNP	ENST00000297142.3	37	c.235C>A	CCDS5434.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625887	0.28889	.	.	ENSG00000164600	ENST00000297142	D	0.95137	-3.62	5.52	4.63	0.57726	.	0.059911	0.64402	D	0.000002	D	0.89458	0.6721	L	0.29908	0.895	0.42276	D	0.99207	B	0.31100	0.308	B	0.26416	0.069	D	0.87648	0.2526	10	0.32370	T	0.25	-0.853	14.7966	0.69881	0.0703:0.0:0.9297:0.0	.	79	Q96NK8	NDF6_HUMAN	I	79	ENSP00000297142:L79I	ENSP00000297142:L79I	L	-	1	0	NEUROD6	31345173	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.645000	0.83430	2.622000	0.88805	0.644000	0.83932	CTT		0.502	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728		8	232	1	0	7.48243e-07	0.006214	9.49223e-07	8	232				
CCDC129	223075	broad.mit.edu	37	7	31617894	31617894	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:31617894G>A	ENST00000407970.3	+	8	1054	c.1016G>A	c.(1015-1017)tGc>tAc	p.C339Y	CCDC129_ENST00000451887.2_Missense_Mutation_p.C365Y|CCDC129_ENST00000319386.3_Intron|CCDC129_ENST00000409210.1_Missense_Mutation_p.C247Y	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	339								p.C339Y(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						CAGTGGCCTTGCTCATCTATG	0.488																																							uc003tcj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1015-1017)TGC>TAC		coiled-coil domain containing 129							74.0	73.0	73.0					7																	31617894		2004	4149	6153	SO:0001583	missense	223075							g.chr7:31617894G>A	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1016G>A	7.37:g.31617894G>A	ENSP00000384416:p.Cys339Tyr					CCDC129_uc011kad.1_Missense_Mutation_p.C349Y|CCDC129_uc003tci.1_Intron|CCDC129_uc011kae.1_Missense_Mutation_p.C365Y|CCDC129_uc003tck.1_Missense_Mutation_p.C247Y	p.C339Y	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN			8	2009	+			339					A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	37	c.1016G>A	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	G	0.075	-1.194754	0.01594	.	.	ENSG00000180347	ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T	0.17691	2.52;2.52;2.26	5.08	-3.84	0.04256	.	.	.	.	.	T	0.10165	0.0249	L	0.38175	1.15	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.002;0.002	T	0.37220	-0.9715	8	.	.	.	1.0659	4.9221	0.13874	0.3808:0.0:0.2498:0.3694	.	365;349;339	F5H3V5;F5H2J8;Q6ZRS4	.;.;CC129_HUMAN	Y	339;365;349;247	ENSP00000384416:C339Y;ENSP00000395835:C365Y;ENSP00000387214:C247Y	.	C	+	2	0	CCDC129	31584419	0.000000	0.05858	0.000000	0.03702	0.057000	0.15508	-0.636000	0.05465	-0.552000	0.06167	0.655000	0.94253	TGC		0.488	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300		8	61	0	0	0	0.004482	0	8	61				
BMPER	168667	broad.mit.edu	37	7	34118560	34118560	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:34118560G>A	ENST00000297161.2	+	13	1544	c.1170G>A	c.(1168-1170)ttG>ttA	p.L390L	BMPER_ENST00000426693.1_Silent_p.L390L	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	390	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.L390L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						AGTACGTTTTGACAAAAGACT	0.587																																							uc011kap.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1168-1170)TTG>TTA		BMP-binding endothelial regulator precursor							102.0	109.0	107.0					7																	34118560		2203	4300	6503	SO:0001819	synonymous_variant	168667				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space		g.chr7:34118560G>A		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1170G>A	7.37:g.34118560G>A							p.L390L	NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN			12	1284	+			390			VWFD.		A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	37	c.1170G>A	CCDS5442.1																																																																																				0.587	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468		10	157	0	0	0	0.006214	0	10	157				
KIAA0895	23366	broad.mit.edu	37	7	36396649	36396649	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:36396649T>A	ENST00000297063.6	-	3	779	c.729A>T	c.(727-729)aaA>aaT	p.K243N	KIAA0895_ENST00000415803.2_Missense_Mutation_p.K230N|KIAA0895_ENST00000338533.5_Missense_Mutation_p.K230N|KIAA0895_ENST00000436884.1_Missense_Mutation_p.K92N|KIAA0895_ENST00000317020.6_Missense_Mutation_p.K192N|KIAA0895_ENST00000440378.1_Missense_Mutation_p.K192N|KIAA0895_ENST00000480192.1_Intron|KIAA0895_ENST00000453212.1_Intron	NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895	243								p.K230N(1)|p.K243N(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						AGTTGGTGGGTTTTATAGCAG	0.393																																							uc003tfd.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(727-729)AAA>AAT		hypothetical protein LOC23366 isoform 1							106.0	99.0	101.0					7																	36396649		1841	4093	5934	SO:0001583	missense	23366							g.chr7:36396649T>A	BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.729A>T	7.37:g.36396649T>A	ENSP00000297063:p.Lys243Asn					KIAA0895_uc003tfc.2_Missense_Mutation_p.K230N|KIAA0895_uc011kaw.1_Missense_Mutation_p.K92N|KIAA0895_uc003tfb.2_Missense_Mutation_p.K192N|KIAA0895_uc011kax.1_Missense_Mutation_p.K192N|KIAA0895_uc003tfe.2_Missense_Mutation_p.K230N|KIAA0895_uc011kay.1_Missense_Mutation_p.K192N	p.K243N	NM_001100425	NP_001093895	Q8NCT3	K0895_HUMAN			3	780	-			243					B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Missense_Mutation	SNP	ENST00000297063.6	37	c.729A>T	CCDS43570.1	.	.	.	.	.	.	.	.	.	.	T	17.82	3.482233	0.63962	.	.	ENSG00000164542	ENST00000297063;ENST00000338533;ENST00000317020;ENST00000440378;ENST00000436884;ENST00000415803;ENST00000429651	.	.	.	5.5	2.71	0.32032	.	0.000000	0.85682	D	0.000000	T	0.54663	0.1872	N	0.21194	0.64	0.51767	D	0.999938	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.997;0.996;0.997;0.997;0.998;0.999;0.999	T	0.54268	-0.8319	9	0.87932	D	0	-17.6918	8.2693	0.31833	0.0:0.6914:0.0:0.3086	.	192;192;92;230;243;230;192	B4DGN6;B7ZLT4;B4DF35;Q8NCT3-4;Q8NCT3;Q8NCT3-2;Q8NCT3-3	.;.;.;.;K0895_HUMAN;.;.	N	243;230;192;192;92;230;110	.	ENSP00000297063:K243N	K	-	3	2	KIAA0895	36363174	0.997000	0.39634	1.000000	0.80357	0.960000	0.62799	0.524000	0.22940	0.283000	0.22279	-0.468000	0.05107	AAA		0.393	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337717.1	NM_015314		17	93	0	0	0	0.004007	0	17	93				
ANLN	54443	broad.mit.edu	37	7	36464304	36464304	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:36464304A>G	ENST00000265748.2	+	17	2883	c.2662A>G	c.(2662-2664)Aaa>Gaa	p.K888E	ANLN_ENST00000396068.2_Missense_Mutation_p.K851E	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	888	Localization to the cleavage furrow.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.K888E(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						GGTGCAAAAGAAAGATCCCTC	0.303																																							uc003tff.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2662-2664)AAA>GAA		anillin, actin binding protein							60.0	65.0	63.0					7																	36464304		2202	4299	6501	SO:0001583	missense	54443				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding	g.chr7:36464304A>G	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.2662A>G	7.37:g.36464304A>G	ENSP00000265748:p.Lys888Glu					ANLN_uc011kaz.1_Missense_Mutation_p.K800E|ANLN_uc003tfg.2_Missense_Mutation_p.K851E|ANLN_uc010kxe.2_Missense_Mutation_p.K850E	p.K888E	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN			17	2866	+			888			Localization to the cleavage furrow.		Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	37	c.2662A>G	CCDS5447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.73|15.73	2.919878|2.919878	0.52653|0.52653	.|.	.|.	ENSG00000011426|ENSG00000011426	ENST00000428612|ENST00000265748;ENST00000396068	.|T;T	.|0.41065	.|1.01;1.01	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.168394	.|0.53938	.|D	.|0.000051	T|T	0.55049|0.55049	0.1896|0.1896	L|L	0.42245|0.42245	1.32|1.32	0.48975|0.48975	D|D	0.999732|0.999732	.|D;P;P;P	.|0.64830	.|0.994;0.764;0.722;0.764	.|D;B;B;B	.|0.64237	.|0.923;0.415;0.291;0.415	T|T	0.56463|0.56463	-0.7975|-0.7975	5|10	.|0.62326	.|D	.|0.03	-30.0508|-30.0508	14.9539|14.9539	0.71098|0.71098	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|765;850;851;888	.|B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.|.;.;.;ANLN_HUMAN	G|E	52|888;851	.|ENSP00000265748:K888E;ENSP00000379380:K851E	.|ENSP00000265748:K888E	E|K	+|+	2|1	0|0	ANLN|ANLN	36430829|36430829	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.398000|0.398000	0.30690|0.30690	5.066000|5.066000	0.64351|0.64351	2.213000|2.213000	0.71641|0.71641	0.455000|0.455000	0.32223|0.32223	GAA|AAA		0.303	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685		8	23	0	0	0	0.006214	0	8	23				
NME8	51314	broad.mit.edu	37	7	37927904	37927904	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:37927904A>G	ENST00000199447.4	+	15	1645	c.1273A>G	c.(1273-1275)Agt>Ggt	p.S425G	NME8_ENST00000440017.1_Missense_Mutation_p.S425G|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	425	NDK 2.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.S425G(1)									TGCGATGGACAGTTTGCCGGT	0.363																																						Ovarian(108;903 1537 27096 29907 47400)	uc003tfn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1273-1275)AGT>GGT		thioredoxin domain containing 3							101.0	98.0	99.0					7																	37927904		2203	4300	6503	SO:0001583	missense	51314	Kartagener_syndrome			cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity	g.chr7:37927904A>G	AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.1273A>G	7.37:g.37927904A>G	ENSP00000199447:p.Ser425Gly						p.S425G	NM_016616	NP_057700	Q8N427	TXND3_HUMAN			15	1645	+			425			NDK 2.		Q9NZH1	Missense_Mutation	SNP	ENST00000199447.4	37	c.1273A>G	CCDS5452.1	.	.	.	.	.	.	.	.	.	.	A	5.034	0.191916	0.09547	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.55234	0.53;0.53	4.42	-5.39	0.02664	.	1.906250	0.02309	N	0.071948	T	0.38427	0.1040	N	0.20610	0.595	0.09310	N	1	B	0.12013	0.005	B	0.17979	0.02	T	0.26052	-1.0114	10	0.20046	T	0.44	1.0E-4	14.91	0.70749	0.3893:0.0:0.6107:0.0	.	425	Q8N427	TXND3_HUMAN	G	425	ENSP00000199447:S425G;ENSP00000397063:S425G	ENSP00000199447:S425G	S	+	1	0	TXNDC3	37894429	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	1.264000	0.33015	-1.069000	0.03153	-0.374000	0.07098	AGT		0.363	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616		3	37	0	0	0	0.004672	0	3	37				
AMPH	273	broad.mit.edu	37	7	38462040	38462040	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:38462040T>A	ENST00000356264.2	-	16	1468	c.1253A>T	c.(1252-1254)cAg>cTg	p.Q418L	AMPH_ENST00000471913.1_5'UTR|AMPH_ENST00000428293.2_Missense_Mutation_p.Q418L|AMPH_ENST00000325590.5_Missense_Mutation_p.Q418L	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	418					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)	p.Q418L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GATCATACTCTGGTCTGTCTG	0.353																																							uc003tgu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|liver(1)|skin(1)	5						c.(1252-1254)CAG>CTG		amphiphysin isoform 1							189.0	188.0	189.0					7																	38462040		2203	4300	6503	SO:0001583	missense	273				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane		g.chr7:38462040T>A		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1253A>T	7.37:g.38462040T>A	ENSP00000348602:p.Gln418Leu					AMPH_uc003tgv.2_Missense_Mutation_p.Q418L|AMPH_uc003tgt.2_Missense_Mutation_p.Q345L|AMPH_uc003tgw.1_Missense_Mutation_p.Q483L|AMPH_uc010kxl.1_RNA	p.Q418L	NM_001635	NP_001626	P49418	AMPH_HUMAN			16	1322	-			418					A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	c.1253A>T	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.913255	0.33815	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242;ENST00000421537	T;T;T	0.61040	0.14;0.18;0.14	4.98	4.98	0.66077	.	0.563983	0.18585	N	0.136892	T	0.65770	0.2723	L	0.34521	1.04	0.37935	D	0.932138	D;P;P;D	0.89917	1.0;0.589;0.698;0.985	D;B;B;P	0.79108	0.992;0.15;0.276;0.637	T	0.69654	-0.5087	10	0.54805	T	0.06	-21.8844	13.362	0.60661	0.0:0.0:0.0:1.0	.	506;418;418;348	Q8NFL6;P49418-2;P49418;Q8NFL4	.;.;AMPH_HUMAN;.	L	418;418;418;362;185	ENSP00000317441:Q418L;ENSP00000348602:Q418L;ENSP00000390734:Q418L	ENSP00000317441:Q418L	Q	-	2	0	AMPH	38428565	1.000000	0.71417	0.977000	0.42913	0.179000	0.23085	3.027000	0.49697	2.221000	0.72209	0.528000	0.53228	CAG		0.353	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635		8	235	0	0	0	0.004482	0	8	235				
CAMK2B	816	broad.mit.edu	37	7	44259817	44259817	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:44259817G>T	ENST00000395749.2	-	23	1921	c.1845C>A	c.(1843-1845)gcC>gcA	p.A615A	CAMK2B_ENST00000395747.2_Silent_p.A467A|CAMK2B_ENST00000457475.1_Silent_p.A467A|CAMK2B_ENST00000358707.3_Silent_p.A452A|CAMK2B_ENST00000502837.2_3'UTR|CAMK2B_ENST00000346990.4_Silent_p.A398A|CAMK2B_ENST00000350811.3_Silent_p.A491A|CAMK2B_ENST00000347193.4_Silent_p.A441A|CAMK2B_ENST00000258682.6_Silent_p.A466A|CAMK2B_ENST00000489429.1_5'UTR|CAMK2B_ENST00000440254.2_Silent_p.A491A|CAMK2B_ENST00000353625.4_Silent_p.A428A	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	615					activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)	p.A615A(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						AAGCGATGCAGGCGGCATCCT	0.667																																							uc003tkq.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1843-1845)GCC>GCA		calcium/calmodulin-dependent protein kinase II							107.0	65.0	79.0					7																	44259817		2203	4300	6503	SO:0001819	synonymous_variant	816				interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr7:44259817G>T	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.1845C>A	7.37:g.44259817G>T						CAMK2B_uc003tkp.2_Silent_p.A491A|CAMK2B_uc003tkx.2_Silent_p.A451A|CAMK2B_uc010kyd.2_RNA|CAMK2B_uc003tkr.2_Silent_p.A467A|CAMK2B_uc003tks.2_Silent_p.A466A|CAMK2B_uc003tku.2_Silent_p.A452A|CAMK2B_uc003tkv.2_Silent_p.A428A|CAMK2B_uc003tkt.2_Silent_p.A441A|CAMK2B_uc003tkw.2_Silent_p.A398A|CAMK2B_uc010kyc.2_Silent_p.A491A|CAMK2B_uc003tkn.2_Silent_p.A248A	p.A615A	NM_001220	NP_001211	Q13554	KCC2B_HUMAN			23	2055	-			615					A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Silent	SNP	ENST00000395749.2	37	c.1845C>A	CCDS5483.1																																																																																				0.667	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084		4	46	1	0	2.56e-06	0.009096	3.17277e-06	4	46				
PKD1L1	168507	broad.mit.edu	37	7	47937647	47937647	+	Nonsense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:47937647T>A	ENST00000289672.2	-	14	2259	c.2209A>T	c.(2209-2211)Aga>Tga	p.R737*		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	737	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.R737*(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGGGTCTGTCTGTGAGTGTCC	0.537																																							uc003tny.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(2209-2211)AGA>TGA		polycystin-1L1							98.0	84.0	88.0					7																	47937647		2203	4300	6503	SO:0001587	stop_gained	168507				cell-cell adhesion	integral to membrane		g.chr7:47937647T>A	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2209A>T	7.37:g.47937647T>A	ENSP00000289672:p.Arg737*						p.R737*	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN			14	2209	-			737			Extracellular (Potential).|REJ.		Q6UWK1	Nonsense_Mutation	SNP	ENST00000289672.2	37	c.2209A>T	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	T	39	7.543202	0.98348	.	.	ENSG00000158683	ENST00000289672	.	.	.	4.76	3.61	0.41365	.	0.590548	0.15953	N	0.236643	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.2034	8.5462	0.33424	0.0:0.0925:0.0:0.9075	.	.	.	.	X	737	.	ENSP00000289672:R737X	R	-	1	2	PKD1L1	47904172	0.854000	0.29725	0.120000	0.21714	0.551000	0.35334	1.260000	0.32968	0.857000	0.35407	0.519000	0.50382	AGA		0.537	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		3	31	0	0	0	0.004672	0	3	31				
POM121L12	285877	broad.mit.edu	37	7	53103526	53103526	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:53103526C>A	ENST00000408890.4	+	1	178	c.162C>A	c.(160-162)ccC>ccA	p.P54P		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	54								p.P54P(2)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						GTCCCTGGCCCCTGAGGTCCC	0.701																																							uc003tpz.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(160-162)CCC>CCA		POM121 membrane glycoprotein-like 12							28.0	34.0	32.0					7																	53103526		1990	4159	6149	SO:0001819	synonymous_variant	285877							g.chr7:53103526C>A		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.162C>A	7.37:g.53103526C>A							p.P54P	NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN			1	178	+			54					Q8NDI9	Silent	SNP	ENST00000408890.4	37	c.162C>A	CCDS43584.1																																																																																				0.701	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		6	62	1	0	5.18039e-06	0.00308	6.31954e-06	6	62				
MAGI2	9863	broad.mit.edu	37	7	78150963	78150963	+	Splice_Site	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:78150963C>A	ENST00000354212.4	-	4	792		c.e4-1		MAGI2_ENST00000517762.1_5'UTR|MAGI2_ENST00000536571.1_Splice_Site|MAGI2_ENST00000419488.1_Splice_Site|MAGI2_ENST00000535697.1_Splice_Site|MAGI2_ENST00000522391.1_Splice_Site	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2						cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.?(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TAGTAATTGTCTGCAAACAAT	0.368																																							uc003ugx.2		NA																	1	Unknown(1)		lung(1)	ovary(5)|lung(4)|breast(1)|skin(1)	11						c.e4-1		membrane associated guanylate kinase, WW and PDZ							127.0	132.0	130.0					7																	78150963		2203	4300	6503	SO:0001630	splice_region_variant	9863					cell junction|synapse|synaptosome	phosphatase binding	g.chr7:78150963C>A	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.539-1G>T	7.37:g.78150963C>A						MAGI2_uc003ugy.2_Splice_Site_p.D180_splice|MAGI2_uc011kgr.1_Splice_Site_p.D12_splice|MAGI2_uc011kgs.1_Splice_Site_p.D17_splice	p.D180_splice	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN			4	793	-		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)						A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Splice_Site	SNP	ENST00000354212.4	37	c.539_splice	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461808	0.63513	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6128	0.91293	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAGI2	77988899	1.000000	0.71417	0.997000	0.53966	0.916000	0.54674	4.625000	0.61262	2.643000	0.89663	0.609000	0.83330	.		0.368	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	Intron	26	137	1	0	9.57634e-11	0.00333	1.36889e-10	26	137				
HGF	3082	broad.mit.edu	37	7	81374416	81374416	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:81374416C>A	ENST00000222390.5	-	6	872	c.646G>T	c.(646-648)Ggg>Tgg	p.G216W	HGF_ENST00000444829.2_Missense_Mutation_p.G216W|HGF_ENST00000457544.2_Missense_Mutation_p.G211W|HGF_ENST00000453411.1_Missense_Mutation_p.G211W	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	216	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)	p.G216W(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						TAACTCTCCCCATTGCAGGTC	0.408																																							uc003uhl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(646-648)GGG>TGG		hepatocyte growth factor isoform 1							86.0	79.0	81.0					7																	81374416		2203	4300	6503	SO:0001583	missense	3082				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity	g.chr7:81374416C>A		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.646G>T	7.37:g.81374416C>A	ENSP00000222390:p.Gly216Trp					HGF_uc003uhm.2_Missense_Mutation_p.G211W|HGF_uc003uhn.1_Missense_Mutation_p.G216W|HGF_uc003uho.1_Missense_Mutation_p.G211W	p.G216W	NM_000601	NP_000592	P14210	HGF_HUMAN			6	811	-			216			Kringle 2.		A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	ENST00000222390.5	37	c.646G>T	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367704	0.82463	.	.	ENSG00000019991	ENST00000222390;ENST00000457544;ENST00000444829;ENST00000453411;ENST00000394769	D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97	4.73	4.73	0.59995	Kringle (4);Kringle-like fold (1);	0.097175	0.64402	D	0.000001	D	0.96318	0.8799	H	0.99705	4.715	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.986;0.994	D	0.98370	1.0553	10	0.87932	D	0	.	18.2555	0.90019	0.0:1.0:0.0:0.0	.	211;216;211;216	P14210-5;P14210-2;P14210-3;P14210	.;.;.;HGF_HUMAN	W	216;211;216;211;216	ENSP00000222390:G216W;ENSP00000391238:G211W;ENSP00000389854:G216W;ENSP00000408270:G211W	ENSP00000222390:G216W	G	-	1	0	HGF	81212352	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.940000	0.75917	2.609000	0.88269	0.655000	0.94253	GGG		0.408	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601		25	27	1	0	3.28513e-13	0.003954	4.90663e-13	25	27				
PCLO	27445	broad.mit.edu	37	7	82582364	82582364	+	Silent	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:82582364T>C	ENST00000333891.9	-	5	8242	c.7905A>G	c.(7903-7905)tcA>tcG	p.S2635S	PCLO_ENST00000423517.2_Silent_p.S2635S|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.S2635S(4)|p.S2566S(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGGTCTGTTCTGAAGAAATTG	0.463																																							uc003uhx.2		NA																	6	Substitution - coding silent(6)		large_intestine(3)|lung(3)	ovary(7)	7						c.(7903-7905)TCA>TCG		piccolo isoform 1							90.0	87.0	88.0					7																	82582364		1870	4110	5980	SO:0001819	synonymous_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82582364T>C	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7905A>G	7.37:g.82582364T>C						PCLO_uc003uhv.2_Silent_p.S2635S|PCLO_uc010lec.2_5'Flank	p.S2635S	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			5	8194	-			2566						Silent	SNP	ENST00000333891.9	37	c.7905A>G	CCDS47630.1																																																																																				0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		15	94	0	0	0	0.003163	0	15	94				
RUNDC3B	154661	broad.mit.edu	37	7	87459223	87459223	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:87459223C>A	ENST00000338056.3	+	12	1711	c.1300C>A	c.(1300-1302)Ctt>Att	p.L434I	RUNDC3B_ENST00000493037.1_Missense_Mutation_p.L368I|RUNDC3B_ENST00000394654.3_Missense_Mutation_p.L417I	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	434								p.L434I(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					TCCCTCATTACTTGGCCTCTG	0.353																																							uc003ujb.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1300-1302)CTT>ATT		RUN domain containing 3B isoform a							137.0	136.0	136.0					7																	87459223		2203	4300	6503	SO:0001583	missense	154661							g.chr7:87459223C>A		CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.1300C>A	7.37:g.87459223C>A	ENSP00000337732:p.Leu434Ile					RUNDC3B_uc011khe.1_Missense_Mutation_p.L417I|RUNDC3B_uc003ujc.2_Missense_Mutation_p.L368I|RUNDC3B_uc003ujd.2_Missense_Mutation_p.L290I	p.L434I	NM_138290	NP_612147	Q96NL0	RUN3B_HUMAN			12	1711	+	Esophageal squamous(14;0.00164)		434					B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Missense_Mutation	SNP	ENST00000338056.3	37	c.1300C>A	CCDS5609.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.251183	0.59212	.	.	ENSG00000105784	ENST00000338056;ENST00000493037;ENST00000394654	T;T;T	0.63580	-0.05;-0.05;-0.05	5.46	5.46	0.80206	.	0.059991	0.64402	D	0.000004	T	0.64659	0.2618	L	0.43923	1.385	0.33218	D	0.554282	P;D;D;B	0.56968	0.791;0.978;0.978;0.148	B;P;P;B	0.53861	0.272;0.649;0.736;0.083	T	0.64605	-0.6368	10	0.11182	T	0.66	-6.5476	17.4726	0.87650	0.0:1.0:0.0:0.0	.	417;290;368;434	E9PBR4;Q96NL0-2;Q96NL0-4;Q96NL0	.;.;.;RUN3B_HUMAN	I	434;368;417	ENSP00000337732:L434I;ENSP00000420394:L368I;ENSP00000378149:L417I	ENSP00000337732:L434I	L	+	1	0	RUNDC3B	87297159	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.317000	0.59184	2.568000	0.86640	0.585000	0.79938	CTT		0.353	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253679.1	NM_138290		9	57	1	0	3.86212e-05	0.008291	4.52198e-05	9	57				
ZNF804B	219578	broad.mit.edu	37	7	88966205	88966205	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:88966205C>A	ENST00000333190.4	+	4	4518	c.3909C>A	c.(3907-3909)gcC>gcA	p.A1303A		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1303							metal ion binding (GO:0046872)	p.A1303A(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TAAATCCAGCCACAACTTCTA	0.438										HNSCC(36;0.09)																													uc011khi.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11						c.(3907-3909)GCC>GCA		zinc finger protein 804B							190.0	184.0	186.0					7																	88966205		2203	4300	6503	SO:0001819	synonymous_variant	219578					intracellular	zinc ion binding	g.chr7:88966205C>A	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3909C>A	7.37:g.88966205C>A		HNSCC(36;0.09)					p.A1303A	NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	STAD - Stomach adenocarcinoma(171;0.0513)		4	4447	+	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		1303					B2RTV2|Q7Z714|Q96MN7	Silent	SNP	ENST00000333190.4	37	c.3909C>A	CCDS5613.1																																																																																				0.438	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		43	145	1	0	8.00217e-19	0.00361	1.27706e-18	43	145				
SRRT	51593	broad.mit.edu	37	7	100473278	100473278	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:100473278T>A	ENST00000347433.4	+	2	225	c.67T>A	c.(67-69)Tac>Aac	p.Y23N	SRRT_ENST00000457580.2_Missense_Mutation_p.Y23N|SRRT_ENST00000432932.1_Missense_Mutation_p.Y23N|SRRT_ENST00000388793.4_Missense_Mutation_p.Y23N			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	23	Arg-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.Y23N(1)		breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						GCGCAGCGACTACGACCGTTC	0.572																																							uc003uwy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(67-69)TAC>AAC		arsenate resistance protein 2 isoform a							131.0	120.0	124.0					7																	100473278		2203	4300	6503	SO:0001583	missense	51593				cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding	g.chr7:100473278T>A		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.67T>A	7.37:g.100473278T>A	ENSP00000314491:p.Tyr23Asn					SRRT_uc010lhl.1_Missense_Mutation_p.Y23N|SRRT_uc003uxa.2_Missense_Mutation_p.Y23N|SRRT_uc003uwz.2_Missense_Mutation_p.Y23N	p.Y23N	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN			3	335	+			23			Arg-rich.		A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	ENST00000347433.4	37	c.67T>A	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	T	15.89	2.965319	0.53507	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433;ENST00000431645	.	.	.	4.27	4.27	0.50696	.	0.000000	0.64402	D	0.000002	T	0.63117	0.2484	M	0.74647	2.275	0.54753	D	0.999988	P;P;P;P	0.49635	0.926;0.926;0.926;0.879	P;P;P;B	0.49361	0.608;0.608;0.608;0.403	T	0.63853	-0.6543	9	0.33141	T	0.24	.	11.3882	0.49798	0.0:0.0:0.0:1.0	.	23;23;23;23	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	N	23;23;23;23;30	.	ENSP00000314491:Y23N	Y	+	1	0	SRRT	100311214	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	5.309000	0.65774	1.778000	0.52293	0.459000	0.35465	TAC		0.572	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908		11	78	0	0	0	0.008291	0	11	78				
PLOD3	8985	broad.mit.edu	37	7	100856219	100856219	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:100856219C>A	ENST00000223127.3	-	8	1181	c.783G>T	c.(781-783)caG>caT	p.Q261H		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	261					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)	p.Q261H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	GGTAGTTGAGCTGCAGCTGTT	0.642																																							uc003uyd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(781-783)CAG>CAT		procollagen-lysine, 2-oxoglutarate 5-dioxygenase	Succinic acid(DB00139)|Vitamin C(DB00126)						50.0	46.0	48.0					7																	100856219		2203	4300	6503	SO:0001583	missense	8985				protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding	g.chr7:100856219C>A	AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.783G>T	7.37:g.100856219C>A	ENSP00000223127:p.Gln261His					PLOD3_uc010lhs.2_5'Flank	p.Q261H	NM_001084	NP_001075	O60568	PLOD3_HUMAN			8	1239	-	Lung NSC(181;0.168)|all_lung(186;0.215)		261					B2R6W6|Q540C3	Missense_Mutation	SNP	ENST00000223127.3	37	c.783G>T	CCDS5715.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.725|3.725	-0.056769|-0.056769	0.07362|0.07362	.|.	.|.	ENSG00000106397|ENSG00000106397	ENST00000223127;ENST00000541462|ENST00000421736	T|.	0.64260|.	-0.09|.	4.98|4.98	3.16|3.16	0.36331|0.36331	.|.	0.061995|.	0.64402|.	N|.	0.000003|.	T|T	0.51550|0.51550	0.1681|0.1681	L|L	0.42529|0.42529	1.33|1.33	0.46564|0.46564	D|D	0.9991|0.9991	P|.	0.49961|.	0.93|.	P|.	0.54460|.	0.753|.	T|T	0.38693|0.38693	-0.9649|-0.9649	10|5	0.11794|.	T|.	0.64|.	-11.1297|-11.1297	6.0506|6.0506	0.19783|0.19783	0.1873:0.7155:0.0:0.0972|0.1873:0.7155:0.0:0.0972	.|.	261|.	O60568|.	PLOD3_HUMAN|.	H|I	261;165|94	ENSP00000223127:Q261H|.	ENSP00000223127:Q261H|.	Q|S	-|-	3|2	2|0	PLOD3|PLOD3	100642939|100642939	0.982000|0.982000	0.34865|0.34865	0.998000|0.998000	0.56505|0.56505	0.419000|0.419000	0.31324|0.31324	0.217000|0.217000	0.17603|0.17603	0.500000|0.500000	0.27991|0.27991	0.462000|0.462000	0.41574|0.41574	CAG|AGC		0.642	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347470.1			6	32	1	0	2.7689e-08	0.001984	3.73641e-08	6	32				
RELN	5649	broad.mit.edu	37	7	103207069	103207069	+	Nonsense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:103207069G>A	ENST00000428762.1	-	32	4885	c.4726C>T	c.(4726-4728)Cga>Tga	p.R1576*	RELN_ENST00000343529.5_Nonsense_Mutation_p.R1576*|RELN_ENST00000424685.2_Nonsense_Mutation_p.R1576*	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1576					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R1576*(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGCCACCATCGAAATGCCGTT	0.493																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(4726-4728)CGA>TGA		reelin isoform a							123.0	107.0	112.0					7																	103207069		2203	4300	6503	SO:0001587	stop_gained	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103207069G>A		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4726C>T	7.37:g.103207069G>A	ENSP00000392423:p.Arg1576*					RELN_uc010liz.2_Nonsense_Mutation_p.R1576*	p.R1576*	NM_005045	NP_005036	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	32	4886	-			1576					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Nonsense_Mutation	SNP	ENST00000428762.1	37	c.4726C>T	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	45	11.511272	0.99570	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	.	.	.	5.95	5.95	0.96441	.	0.066530	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3454	0.66658	0.0:0.0:0.74:0.26	.	.	.	.	X	1576	.	ENSP00000345694:R1576X	R	-	1	2	RELN	102994305	1.000000	0.71417	0.931000	0.37212	0.740000	0.42216	4.928000	0.63447	2.826000	0.97356	0.491000	0.48974	CGA		0.493	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		4	84	0	0	0	0.000602	0	4	84				
DLD	1738	broad.mit.edu	37	7	107557757	107557757	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:107557757G>A	ENST00000205402.5	+	11	1367	c.1086G>A	c.(1084-1086)ctG>ctA	p.L362L	DLD_ENST00000537148.1_Silent_p.L263L|DLD_ENST00000437604.2_Silent_p.L314L|DLD_ENST00000440410.1_Silent_p.L339L	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	362					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)	p.L362L(2)		NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	GTCCAATGCTGGCTCACAAAG	0.423																																							uc003vet.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(1084-1086)CTG>CTA		dihydrolipoamide dehydrogenase precursor	NADH(DB00157)						255.0	213.0	227.0					7																	107557757		2203	4300	6503	SO:0001819	synonymous_variant	1738				branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity	g.chr7:107557757G>A	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.1086G>A	7.37:g.107557757G>A						DLD_uc011kmg.1_Silent_p.L314L|DLD_uc011kmh.1_Silent_p.L339L|DLD_uc011kmi.1_Silent_p.L263L	p.L362L	NM_000108	NP_000099	P09622	DLDH_HUMAN			11	1196	+			362			FAD.		B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Silent	SNP	ENST00000205402.5	37	c.1086G>A	CCDS5749.1																																																																																				0.423	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108		26	85	0	0	0	0.007291	0	26	85				
LAMB1	3912	broad.mit.edu	37	7	107642135	107642135	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:107642135G>T	ENST00000222399.6	-	3	311	c.81C>A	c.(79-81)agC>agA	p.S27R	LAMB1_ENST00000393560.1_Missense_Mutation_p.S27R|U3_ENST00000458938.1_RNA|LAMB1_ENST00000393561.1_Missense_Mutation_p.S51R	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	27					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.S27R(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CGCAGCCGTAGCTGAACTCGG	0.652																																							uc003vew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(79-81)AGC>AGA		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						17.0	18.0	17.0					7																	107642135		2202	4296	6498	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107642135G>T	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.81C>A	7.37:g.107642135G>T	ENSP00000222399:p.Ser27Arg					LAMB1_uc003vev.2_Missense_Mutation_p.S51R|LAMB1_uc003vex.2_Missense_Mutation_p.S27R|LAMB1_uc010ljn.1_Missense_Mutation_p.S113R	p.S27R	NM_002291	NP_002282	P07942	LAMB1_HUMAN			3	416	-			27					Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.81C>A	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409750	0.42715	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560;ENST00000439976;ENST00000393559	T;T;T;T;T	0.65549	1.44;1.44;1.15;-0.16;-0.1	4.97	4.07	0.47477	.	.	.	.	.	T	0.59865	0.2225	N	0.19112	0.55	0.42414	D	0.992611	D;B;B;B	0.71674	0.998;0.201;0.078;0.178	P;B;B;B	0.60682	0.878;0.046;0.035;0.176	T	0.53542	-0.8424	9	0.17369	T	0.5	.	13.896	0.63773	0.0794:0.0:0.9206:0.0	.	113;27;27;51	C9J296;E7EPA6;P07942;G3XAI2	.;.;LAMB1_HUMAN;.	R	51;27;27;113;27	ENSP00000377191:S51R;ENSP00000222399:S27R;ENSP00000377190:S27R;ENSP00000412686:S113R;ENSP00000377189:S27R	ENSP00000222399:S27R	S	-	3	2	LAMB1	107429371	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	0.946000	0.29069	2.450000	0.82876	0.462000	0.41574	AGC		0.652	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		3	14	1	0	6.4e-05	0.004672	7.44523e-05	3	14				
DNAJB9	4189	broad.mit.edu	37	7	108213544	108213544	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:108213544A>G	ENST00000249356.3	+	3	965	c.419A>G	c.(418-420)cAt>cGt	p.H140R	DNAJB9_ENST00000465725.1_Intron	NM_012328.2	NP_036460.1	Q9UBS3	DNJB9_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 9	140					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	misfolded protein binding (GO:0051787)	p.H140R(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13						TTTGAAAATCATTTCCAGACA	0.358																																							uc003vfn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(418-420)CAT>CGT		DnaJ (Hsp40) homolog, subfamily B, member 9							109.0	108.0	108.0					7																	108213544		2203	4300	6503	SO:0001583	missense	4189				ER-associated protein catabolic process|protein folding	endoplasmic reticulum|nucleolus	heat shock protein binding|misfolded protein binding|unfolded protein binding	g.chr7:108213544A>G	AB026908	CCDS5752.1	7q31	2011-09-02			ENSG00000128590	ENSG00000128590		"""Heat shock proteins / DNAJ (HSP40)"""	6968	protein-coding gene	gene with protein product		602634		MDG1		9533036, 11147971	Standard	NM_012328		Approved		uc003vfn.3	Q9UBS3	OTTHUMG00000154866	ENST00000249356.3:c.419A>G	7.37:g.108213544A>G	ENSP00000249356:p.His140Arg						p.H140R	NM_012328	NP_036460	Q9UBS3	DNJB9_HUMAN			3	621	+			140						Missense_Mutation	SNP	ENST00000249356.3	37	c.419A>G	CCDS5752.1	.	.	.	.	.	.	.	.	.	.	A	19.28	3.796553	0.70567	.	.	ENSG00000128590	ENST00000249356	T	0.60672	0.17	5.86	5.86	0.93980	.	0.084638	0.85682	D	0.000000	T	0.69540	0.3122	M	0.69823	2.125	0.80722	D	1	D	0.59357	0.985	P	0.55055	0.767	T	0.70753	-0.4786	9	.	.	.	.	15.448	0.75248	1.0:0.0:0.0:0.0	.	140	Q9UBS3	DNJB9_HUMAN	R	140	ENSP00000249356:H140R	.	H	+	2	0	DNAJB9	108000780	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.930000	0.92872	2.240000	0.73641	0.533000	0.62120	CAT		0.358	DNAJB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337414.1			9	27	0	0	0	0.010729	0	9	27				
PPP1R3A	5506	broad.mit.edu	37	7	113518831	113518831	+	Silent	SNP	C	C	A	rs34610491	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:113518831C>A	ENST00000284601.3	-	4	2384	c.2316G>T	c.(2314-2316)gcG>gcT	p.A772A		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	772					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.A772A(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GTGGATCAAACGCTGTTTCCT	0.408																																							uc010ljy.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						c.(2314-2316)GCG>GCT		protein phosphatase 1, regulatory (inhibitor)							125.0	108.0	114.0					7																	113518831		2203	4299	6502	SO:0001819	synonymous_variant	5506				glycogen metabolic process	integral to membrane		g.chr7:113518831C>A	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2316G>T	7.37:g.113518831C>A							p.A772A	NM_002711	NP_002702	Q16821	PPR3A_HUMAN			4	2347	-			772					A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	ENST00000284601.3	37	c.2316G>T	CCDS5759.1																																																																																				0.408	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		4	69	1	0	0.000602214	0.000602	0.000667112	4	69				
SMO	6608	broad.mit.edu	37	7	128848686	128848686	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:128848686C>A	ENST00000249373.3	+	7	1631	c.1351C>A	c.(1351-1353)Cgc>Agc	p.R451S	RP11-286H14.8_ENST00000466717.1_RNA	NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	451					adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R451S(1)		biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	GACCATGCTGCGCCTGGGTGA	0.617			Mis		skin basal cell																																		uc003vor.2		NA		Dom	yes		7	7q31-q32	6608	Mis	smoothened homolog (Drosophila)			E			skin basal cell 		1	Substitution - Missense(1)		lung(1)	skin(19)|large_intestine(10)|central_nervous_system(3)|upper_aerodigestive_tract(2)|biliary_tract(1)|lung(1)|liver(1)	37						c.(1351-1353)CGC>AGC		smoothened precursor							43.0	36.0	38.0					7																	128848686		2203	4300	6503	SO:0001583	missense	6608				adenohypophysis development|axon extension involved in axon guidance|canonical Wnt receptor signaling pathway|cardioblast differentiation|central nervous system neuron differentiation|cerebellar cortex morphogenesis|ciliary receptor clustering involved in smoothened signaling pathway|determination of left/right symmetry|dorsal/ventral neural tube patterning|embryonic camera-type eye development|embryonic digestive tract morphogenesis|embryonic neurocranium morphogenesis|embryonic viscerocranium morphogenesis|exocrine pancreas development|facial nerve development|floor plate formation|gonad development|heart morphogenesis|muscle cell fate commitment|negative regulation of apoptosis|neural crest cell migration|neuron fate commitment|neuron projection regeneration|odontogenesis of dentine-containing tooth|osteoblast differentiation|otolith morphogenesis|positive regulation of epithelial cell proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of neuroblast proliferation|positive regulation of smoothened signaling pathway|semicircular canal morphogenesis|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation|smoothened signaling pathway involved in ventral spinal cord patterning|spermatogenesis|vasculogenesis	cilium|cytoplasm|integral to membrane|neuronal cell body|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr7:128848686C>A	U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.1351C>A	7.37:g.128848686C>A	ENSP00000249373:p.Arg451Ser					SMO_uc003vos.2_Missense_Mutation_p.R126S	p.R451S	NM_005631	NP_005622	Q99835	SMO_HUMAN			7	1631	+			451			Cytoplasmic (Potential).		A4D1K5	Missense_Mutation	SNP	ENST00000249373.3	37	c.1351C>A	CCDS5811.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.476814	0.84640	.	.	ENSG00000128602	ENST00000249373	D	0.86030	-2.06	5.25	5.25	0.73442	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.94238	0.8150	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	D	0.95466	0.8547	10	0.87932	D	0	.	17.4201	0.87512	0.0:1.0:0.0:0.0	.	451;451	A4D1K5;Q99835	.;SMO_HUMAN	S	451	ENSP00000249373:R451S	ENSP00000249373:R451S	R	+	1	0	SMO	128635922	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	4.684000	0.61686	2.451000	0.82905	0.655000	0.94253	CGC		0.617	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350986.1	NM_005631		12	15	1	0	3.07112e-06	0.010729	3.79278e-06	12	15				
KEL	3792	broad.mit.edu	37	7	142637531	142637531	+	IGR	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:142637531C>A	ENST00000355265.2	-	0	2812				C7orf34_ENST00000409607.3_Missense_Mutation_p.Q101K	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.Q76K(1)|p.Q101K(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GGAAGAAGACCAGTCGTCCAA	0.542																																							uc003wca.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(301-303)CAG>AAG		hypothetical protein LOC135927							194.0	174.0	181.0					7																	142637531		2203	4300	6503	SO:0001628	intergenic_variant	135927					extracellular region		g.chr7:142637531C>A	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159		7.37:g.142637531C>A							p.Q101K	NM_178829	NP_849151	Q96L11	CG034_HUMAN			2	342	+	Melanoma(164;0.059)		76					B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	c.301C>A	CCDS34766.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.003|0.003	-2.524397|-2.524397	0.00149|0.00149	.|.	.|.	ENSG00000165131|ENSG00000165131	ENST00000458732|ENST00000409607	.|.	.|.	.|.	4.38|4.38	-6.27|-6.27	0.02026|0.02026	.|.	.|2.584220	.|0.01241	.|N	.|0.008613	T|T	0.10852|0.10852	0.0265|0.0265	N|N	0.01576|0.01576	-0.805|-0.805	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.36578|0.36578	-0.9742|-0.9742	5|9	.|0.05436	.|T	.|0.98	.|.	7.0189|7.0189	0.24902|0.24902	0.2769:0.2702:0.4529:0.0|0.2769:0.2702:0.4529:0.0	.|.	.|76	.|Q96L11	.|CG034_HUMAN	Q|K	106|101	.|.	.|ENSP00000386450:Q101K	P|Q	+|+	2|1	0|0	C7orf34|C7orf34	142347653|142347653	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-2.243000|-2.243000	0.01194|0.01194	-1.124000|-1.124000	0.02936|0.02936	-1.360000|-1.360000	0.01215|0.01215	CCA|CAG		0.542	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		47	67	1	0	3.76525e-18	0.00361	5.95454e-18	47	67				
TAS2R40	259286	broad.mit.edu	37	7	142919937	142919937	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:142919937T>C	ENST00000408947.3	+	1	808	c.766T>C	c.(766-768)Tac>Cac	p.Y256H	AC073342.1_ENST00000595842.1_5'Flank	NM_176882.1	NP_795363.1	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	256					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.Y256H(2)		kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8	Melanoma(164;0.059)					TCTCATCCTCTACATTTTCAA	0.478																																							uc011ksx.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(766-768)TAC>CAC		taste receptor, type 2, member 40							118.0	117.0	117.0					7																	142919937		1937	4140	6077	SO:0001583	missense	259286				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr7:142919937T>C	AF494229	CCDS43662.1	7q34	2012-08-22	2003-12-16		ENSG00000221937	ENSG00000221937		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18885	protein-coding gene	gene with protein product		613964	"""G protein-coupled receptor 60"""	GPR60		12379855	Standard	NM_176882		Approved		uc011ksx.2	P59535	OTTHUMG00000152638	ENST00000408947.3:c.766T>C	7.37:g.142919937T>C	ENSP00000386210:p.Tyr256His						p.Y256H	NM_176882	NP_795363	P59535	T2R40_HUMAN			1	766	+	Melanoma(164;0.059)		256			Helical; Name=6; (Potential).		A4D2I2|Q645W6	Missense_Mutation	SNP	ENST00000408947.3	37	c.766T>C	CCDS43662.1	.	.	.	.	.	.	.	.	.	.	T	18.29	3.592476	0.66219	.	.	ENSG00000221937	ENST00000408947	T	0.01185	5.21	5.46	5.46	0.80206	.	0.091372	0.45606	U	0.000348	T	0.08980	0.0222	M	0.89095	3.005	0.37568	D	0.919323	D	0.89917	1.0	D	0.97110	1.0	T	0.01508	-1.1337	10	0.87932	D	0	.	14.7336	0.69399	0.0:0.0:0.0:1.0	.	256	P59535	T2R40_HUMAN	H	256	ENSP00000386210:Y256H	ENSP00000386210:Y256H	Y	+	1	0	TAS2R40	142630059	1.000000	0.71417	0.962000	0.40283	0.665000	0.39181	3.840000	0.55843	2.070000	0.61991	0.533000	0.62120	TAC		0.478	TAS2R40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327097.1			15	165	0	0	0	0.003163	0	15	165				
FAM131B	9715	broad.mit.edu	37	7	143056027	143056027	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:143056027C>A	ENST00000409408.1	-	4	1983	c.275G>T	c.(274-276)gGg>gTg	p.G92V	FAM131B_ENST00000409346.1_Missense_Mutation_p.G92V|FAM131B_ENST00000409578.1_Missense_Mutation_p.G108V|FAM131B_ENST00000409222.3_Missense_Mutation_p.G92V|FAM131B_ENST00000443739.2_Missense_Mutation_p.G120V			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	92								p.G92V(1)|p.G120V(1)|p.G120E(1)|p.G92E(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					TGGTGTCTTCCCCCAGCCCTG	0.607																																							uc003wct.2		NA																	4	Substitution - Missense(4)		ovary(2)|lung(2)		0						c.(274-276)GGG>GTG		hypothetical protein LOC9715 isoform b							81.0	62.0	69.0					7																	143056027		2203	4300	6503	SO:0001583	missense	9715							g.chr7:143056027C>A	BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.275G>T	7.37:g.143056027C>A	ENSP00000387017:p.Gly92Val					FAM131B_uc010loz.2_Missense_Mutation_p.G60V|FAM131B_uc003wcu.3_Missense_Mutation_p.G92V|FAM131B_uc010lpa.2_Missense_Mutation_p.G120V|ZYX_uc011ktd.1_5'Flank	p.G92V	NM_014690	NP_055505	Q86XD5	F131B_HUMAN			4	1981	-	Melanoma(164;0.205)		92					A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	ENST00000409408.1	37	c.275G>T	CCDS5882.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857901	0.91433	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	5.26	5.26	0.73747	.	0.046471	0.85682	D	0.000000	T	0.49712	0.1573	M	0.63843	1.955	0.80722	D	1	D;D	0.71674	0.998;0.96	D;P	0.71656	0.974;0.643	T	0.46247	-0.9205	10	0.51188	T	0.08	-6.2043	18.8528	0.92240	0.0:1.0:0.0:0.0	.	108;92	Q86XD5-2;Q86XD5	.;F131B_HUMAN	V	120;108;92;96;92;92	ENSP00000410603:G120V;ENSP00000386568:G108V;ENSP00000386984:G92V;ENSP00000387017:G92V;ENSP00000387147:G92V	ENSP00000387147:G92V	G	-	2	0	FAM131B	142766149	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.774000	0.68906	2.442000	0.82660	0.561000	0.74099	GGG		0.607	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328057.1	NM_014690		10	25	1	0	0.000978159	0.010729	0.00107844	10	25				
OR2F1	26211	broad.mit.edu	37	7	143657496	143657496	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:143657496G>T	ENST00000392899.1	+	1	470	c.433G>T	c.(433-435)Gcc>Tcc	p.A145S	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	145					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A145S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					TGCTAGGTTGGCCATCACATC	0.527																																							uc003wds.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(433-435)GCC>TCC		olfactory receptor, family 2, subfamily F,							143.0	121.0	129.0					7																	143657496		2203	4300	6503	SO:0001583	missense	26211				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143657496G>T	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.433G>T	7.37:g.143657496G>T	ENSP00000376633:p.Ala145Ser						p.A145S	NM_012369	NP_036501	Q13607	OR2F1_HUMAN			1	477	+	Melanoma(164;0.0903)		145			Helical; Name=4; (Potential).		A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	ENST00000392899.1	37	c.433G>T	CCDS5887.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.767278	0.49574	.	.	ENSG00000213215	ENST00000392899	T	0.37058	1.22	5.53	5.53	0.82687	GPCR, rhodopsin-like superfamily (1);	0.249082	0.28665	N	0.014554	T	0.45296	0.1335	M	0.64170	1.965	0.25252	N	0.989663	P	0.39809	0.689	P	0.48114	0.567	T	0.47749	-0.9093	10	0.72032	D	0.01	-17.0675	10.2293	0.43245	0.087:0.0:0.913:0.0	.	145	Q13607	OR2F1_HUMAN	S	145	ENSP00000376633:A145S	ENSP00000376633:A145S	A	+	1	0	OR2F1	143288429	0.723000	0.28027	0.940000	0.37924	0.404000	0.30871	1.059000	0.30517	2.871000	0.98454	0.655000	0.94253	GCC		0.527	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1			8	80	1	0	3.09899e-07	0.004482	4.00405e-07	8	80				
OR2A14	135941	broad.mit.edu	37	7	143826981	143826981	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:143826981T>A	ENST00000408899.2	+	1	831	c.776T>A	c.(775-777)aTg>aAg	p.M259K		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M259K(1)		large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					GTCACGTACATGGCCCCCAAG	0.552																																							uc011kua.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(775-777)ATG>AAG		olfactory receptor, family 2, subfamily A,							112.0	118.0	116.0					7																	143826981		2006	4191	6197	SO:0001583	missense	135941				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143826981T>A		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.776T>A	7.37:g.143826981T>A	ENSP00000386137:p.Met259Lys						p.M259K	NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN			1	776	+	Melanoma(164;0.0783)		259			Extracellular (Potential).		Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	37	c.776T>A	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	T	12.45	1.942471	0.34283	.	.	ENSG00000221938	ENST00000408899	T	0.37411	1.2	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39083	U	0.001476	T	0.58906	0.2155	M	0.90425	3.115	0.30770	N	0.743084	P	0.52842	0.956	P	0.60473	0.875	T	0.66476	-0.5914	10	0.87932	D	0	-17.0551	7.1391	0.25546	0.1998:0.0:0.0:0.8002	.	259	Q96R47	O2A14_HUMAN	K	259	ENSP00000386137:M259K	ENSP00000386137:M259K	M	+	2	0	OR2A14	143457914	0.007000	0.16637	1.000000	0.80357	0.184000	0.23303	1.710000	0.37920	1.868000	0.54150	0.459000	0.35465	ATG		0.552	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1			19	200	0	0	0	0.012319	0	19	200				
OR2A14	135941	broad.mit.edu	37	7	143827000	143827000	+	Silent	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:143827000T>C	ENST00000408899.2	+	1	850	c.795T>C	c.(793-795)caT>caC	p.H265H		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H265H(1)		large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					AGTCCCGCCATCCTGAGGAGC	0.547																																							uc011kua.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(793-795)CAT>CAC		olfactory receptor, family 2, subfamily A,							119.0	125.0	123.0					7																	143827000		1974	4167	6141	SO:0001819	synonymous_variant	135941				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143827000T>C		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.795T>C	7.37:g.143827000T>C							p.H265H	NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN			1	795	+	Melanoma(164;0.0783)		265			Extracellular (Potential).		Q6IF41|Q8NGT8	Silent	SNP	ENST00000408899.2	37	c.795T>C	CCDS43672.1																																																																																				0.547	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1			121	136	0	0	0	0.00361	0	121	136				
ARHGEF5	7984	broad.mit.edu	37	7	144060384	144060384	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:144060384G>A	ENST00000056217.5	+	2	796	c.622G>A	c.(622-624)Gaa>Aaa	p.E208K	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	208					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E208K(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					CAGGCAGGGGGAAGAGCTGCC	0.542																																							uc003wel.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(622-624)GAA>AAA		rho guanine nucleotide exchange factor 5							186.0	203.0	197.0					7																	144060384		2183	4275	6458	SO:0001583	missense	7984				intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr7:144060384G>A	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.622G>A	7.37:g.144060384G>A	ENSP00000056217:p.Glu208Lys					ARHGEF5_uc003wek.2_Missense_Mutation_p.E208K	p.E208K	NM_005435	NP_005426	Q12774	ARHG5_HUMAN			2	740	+	Melanoma(164;0.14)		208					A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	c.622G>A	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	G	7.678	0.688448	0.14973	.	.	ENSG00000050327	ENST00000056217	T	0.73789	-0.78	3.16	-0.0213	0.13952	.	1.890260	0.03559	U	0.226782	T	0.59622	0.2207	L	0.29908	0.895	0.09310	N	1	B	0.21452	0.056	B	0.15484	0.013	T	0.28964	-1.0027	9	.	.	.	.	3.3384	0.07110	0.2594:0.0:0.5391:0.2016	.	208	Q12774	ARHG5_HUMAN	K	208	ENSP00000056217:E208K	.	E	+	1	0	ARHGEF5	143691317	0.996000	0.38824	0.019000	0.16419	0.012000	0.07955	1.844000	0.39269	-0.262000	0.09392	-0.384000	0.06662	GAA		0.542	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435		32	302	0	0	0	0.003271	0	32	302				
CNTNAP2	26047	broad.mit.edu	37	7	146805426	146805426	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:146805426C>A	ENST00000361727.3	+	5	1254	c.738C>A	c.(736-738)gtC>gtA	p.V246V		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	246	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.V246V(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CCAAGCTGGTCCTCAGTTTAA	0.398										HNSCC(39;0.1)																													uc003weu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(736-738)GTC>GTA		cell recognition molecule Caspr2 precursor							105.0	96.0	99.0					7																	146805426		2203	4300	6503	SO:0001819	synonymous_variant	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:146805426C>A	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.738C>A	7.37:g.146805426C>A		HNSCC(39;0.1)					p.V246V	NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		5	1254	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	246			Laminin G-like 1.|Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	ENST00000361727.3	37	c.738C>A	CCDS5889.1																																																																																				0.398	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			4	11	1	0	1.23904e-05	0.000602	1.49069e-05	4	11				
SSPO	23145	broad.mit.edu	37	7	149481971	149481971	+	RNA	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:149481971G>T	ENST00000378016.2	+	0	2760							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)	p.G256W(1)				Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCCTTCACAGGGGCATTCTGC	0.607																																							uc010lpk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.e19+1		SCO-spondin precursor							60.0	65.0	63.0					7																	149481971		2014	4182	6196			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149481971G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149481971G>T						SSPO_uc010lpl.1_Missense_Mutation_p.G256W	p.Q920_splice	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		19	2760	+	Melanoma(164;0.165)|Ovarian(565;0.177)							Q76B61	Splice_Site	SNP	ENST00000378016.2	37	c.2760_splice																																																																																					0.607	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				10	93	1	0	7.48243e-07	0.006214	9.49223e-07	10	93				
SSPO	23145	broad.mit.edu	37	7	149492318	149492318	+	RNA	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:149492318G>T	ENST00000378016.2	+	0	6207							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ATTCTCCCCTGGGGCTGGCCG	0.672																																							uc010lpk.2		NA																	0					0						c.(6205-6207)CTG>CTT		SCO-spondin precursor							33.0	37.0	36.0					7																	149492318		1933	4137	6070			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149492318G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149492318G>T							p.L2069L	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		43	6207	+	Melanoma(164;0.165)|Ovarian(565;0.177)		2069			F5/8 type C.		Q76B61	Silent	SNP	ENST00000378016.2	37	c.6207G>T																																																																																					0.672	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				16	50	1	0	9.16793e-09	0.00499	1.25164e-08	16	50				
KMT2C	58508	broad.mit.edu	37	7	151874238	151874238	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:151874238C>A	ENST00000262189.6	-	38	8518	c.8300G>T	c.(8299-8301)gGa>gTa	p.G2767V	KMT2C_ENST00000355193.2_Missense_Mutation_p.G2767V	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2767	Asp-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G2767V(2)									TTTCTTATCTCCCATGTCAAG	0.348																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(8299-8301)GGA>GTA		myeloid/lymphoid or mixed-lineage leukemia 3							132.0	130.0	131.0					7																	151874238		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151874238C>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8300G>T	7.37:g.151874238C>A	ENSP00000262189:p.Gly2767Val					MLL3_uc003wkz.2_Missense_Mutation_p.G1828V|MLL3_uc003wky.2_Missense_Mutation_p.G276V	p.G2767V	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	38	8519	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	2767			Asp-rich.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.8300G>T	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019566	0.35606	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.88586	-2.4;-2.36	5.54	4.66	0.58398	.	0.000000	0.46145	D	0.000317	D	0.93766	0.8007	M	0.74258	2.255	0.80722	D	1	P;D;D	0.89917	0.808;1.0;0.963	B;D;P	0.77004	0.422;0.989;0.626	D	0.94268	0.7508	10	0.72032	D	0.01	.	14.6397	0.68714	0.0:0.9297:0.0:0.0702	.	2767;1828;2767	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	V	2767	ENSP00000262189:G2767V;ENSP00000347325:G2767V	ENSP00000262189:G2767V	G	-	2	0	MLL3	151505171	0.842000	0.29525	0.955000	0.39395	0.970000	0.65996	1.611000	0.36879	1.333000	0.45449	0.650000	0.86243	GGA		0.348	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			18	128	1	0	3.52763e-06	0.00499	4.34122e-06	18	128				
CSMD1	64478	broad.mit.edu	37	8	2949081	2949081	+	Silent	SNP	A	A	T	rs539478192		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:2949081A>T	ENST00000520002.1	-	49	7800	c.7245T>A	c.(7243-7245)acT>acA	p.T2415T	CSMD1_ENST00000602723.1_Silent_p.T2415T|CSMD1_ENST00000542608.1_Silent_p.T2414T|CSMD1_ENST00000602557.1_Silent_p.T2415T|CSMD1_ENST00000400186.3_Silent_p.T2415T|CSMD1_ENST00000537824.1_Silent_p.T2414T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2415	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.T2414T(1)|p.T2143T(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGGCATGGTCAGTGGACCAGC	0.373													A|||	1	0.000199681	0.0008	0.0	5008	,	,		14809	0.0		0.0	False		,,,				2504	0.0						uc011kwk.1		NA																	2	Substitution - coding silent(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(7243-7245)ACT>ACA		CUB and Sushi multiple domains 1 precursor							114.0	109.0	110.0					8																	2949081		1848	4084	5932	SO:0001819	synonymous_variant	64478					integral to membrane		g.chr8:2949081A>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7245T>A	8.37:g.2949081A>T						CSMD1_uc011kwj.1_Silent_p.T1744T|CSMD1_uc010lrg.2_Silent_p.T483T	p.T2415T	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	48	7635	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2415			CUB 14.|Extracellular (Potential).		Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37	c.7245T>A		.	.	.	.	.	.	.	.	.	.	A	5.710	0.315535	0.10789	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.8	-11.6	0.00059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.4404	0.00485	0.2548:0.2472:0.2549:0.243	.	.	.	.	R	1832	.	.	X	-	1	0	CSMD1	2936488	0.012000	0.17670	0.011000	0.14972	0.612000	0.37316	-0.826000	0.04429	-3.879000	0.00096	-0.531000	0.04308	TGA		0.373	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		4	14	0	0	0	0.009096	0	4	14				
PRSS55	203074	broad.mit.edu	37	8	10387192	10387192	+	Silent	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:10387192A>G	ENST00000328655.3	+	2	370	c.330A>G	c.(328-330)ttA>ttG	p.L110L	PRSS55_ENST00000522210.1_Silent_p.L110L|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	110	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.L110L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						CTCACTGCTTATATTCCGAGG	0.592																																							uc003wta.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(328-330)TTA>TTG		hypothetical protein LOC203074 precursor							172.0	175.0	174.0					8																	10387192		2203	4300	6503	SO:0001819	synonymous_variant	203074				proteolysis	integral to membrane	serine-type endopeptidase activity	g.chr8:10387192A>G	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.330A>G	8.37:g.10387192A>G						uc010lru.2_Intron|PRSS55_uc003wtb.2_RNA	p.L110L	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN			2	345	+			110			Extracellular (Potential).|Peptidase S1.		E5RJX5	Silent	SNP	ENST00000328655.3	37	c.330A>G	CCDS5976.1																																																																																				0.592	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464		68	174	0	0	0	0.00361	0	68	174				
RP1L1	94137	broad.mit.edu	37	8	10466378	10466378	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:10466378C>A	ENST00000382483.3	-	4	5453	c.5230G>T	c.(5230-5232)Gag>Tag	p.E1744*		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1824					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.E1744*(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCGCCATCCTCACCCTCGTCC	0.632																																							uc003wtc.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(5230-5232)GAG>TAG		retinitis pigmentosa 1-like 1							104.0	110.0	108.0					8																	10466378		1994	4181	6175	SO:0001587	stop_gained	94137				intracellular signal transduction			g.chr8:10466378C>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5230G>T	8.37:g.10466378C>A	ENSP00000371923:p.Glu1744*						p.E1744*	NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	5459	-			1744					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Nonsense_Mutation	SNP	ENST00000382483.3	37	c.5230G>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	43	10.338190	0.99385	.	.	ENSG00000183638	ENST00000382483	.	.	.	3.99	-0.357	0.12579	.	1.262080	0.06181	U	0.679483	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-0.6499	2.4577	0.04533	0.1379:0.4243:0.2695:0.1683	.	.	.	.	X	1744	.	ENSP00000371923:E1744X	E	-	1	0	RP1L1	10503788	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.154000	0.10130	0.030000	0.15379	0.455000	0.32223	GAG		0.632	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			32	103	1	0	6.00712e-18	0.012213	9.45716e-18	32	103				
RP1L1	94137	broad.mit.edu	37	8	10469396	10469396	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:10469396C>A	ENST00000382483.3	-	4	2435	c.2212G>T	c.(2212-2214)Gcc>Tcc	p.A738S		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	738					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.A738S(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GTGACAGTGGCACTGCTGGTT	0.627																																							uc003wtc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(2212-2214)GCC>TCC		retinitis pigmentosa 1-like 1							46.0	55.0	52.0					8																	10469396		2027	4160	6187	SO:0001583	missense	94137				intracellular signal transduction			g.chr8:10469396C>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2212G>T	8.37:g.10469396C>A	ENSP00000371923:p.Ala738Ser						p.A738S	NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	2441	-			738					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	c.2212G>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017421	0.54576	.	.	ENSG00000183638	ENST00000382483	T	0.07021	3.23	4.82	0.686	0.18015	.	0.850659	0.09572	U	0.784058	T	0.08846	0.0219	L	0.27053	0.805	0.09310	N	1	P	0.51057	0.941	P	0.49477	0.612	T	0.35724	-0.9777	10	0.41790	T	0.15	-0.939	6.6065	0.22727	0.0:0.5487:0.0:0.4513	.	738	A6NKC6	.	S	738	ENSP00000371923:A738S	ENSP00000371923:A738S	A	-	1	0	RP1L1	10506806	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.005000	0.12855	0.051000	0.15978	0.462000	0.41574	GCC		0.627	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			24	46	1	0	5.35356e-11	0.00278	7.66831e-11	24	46				
SOX7	83595	broad.mit.edu	37	8	10584169	10584169	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:10584169C>T	ENST00000304501.1	-	2	324	c.246G>A	c.(244-246)tcG>tcA	p.S82S	SOX7_ENST00000553390.1_Silent_p.S134S|CTD-2135J3.3_ENST00000519568.1_RNA|SOX7_ENST00000554914.1_Silent_p.S134S|CTD-2135J3.3_ENST00000506149.2_RNA	NM_031439.2	NP_113627.1	Q9BT81	SOX7_HUMAN	SRY (sex determining region Y)-box 7	82					endoderm formation (GO:0001706)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|regulation of canonical Wnt signaling pathway (GO:0060828)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.S82S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				COAD - Colon adenocarcinoma(149;0.0732)		GCGCCTTCCACGACTTTCCTG	0.632																																							uc003wtf.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(244-246)TCG>TCA		SRY-box 7																																				SO:0001819	synonymous_variant	83595				endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding	g.chr8:10584169C>T	AJ409320	CCDS5977.1	8p22	2013-01-25			ENSG00000171056	ENSG00000171056		"""SRY (sex determining region Y)-boxes"""	18196	protein-coding gene	gene with protein product		612202				11691915	Standard	NM_031439		Approved		uc003wtf.3	Q9BT81	OTTHUMG00000090585	ENST00000304501.1:c.246G>A	8.37:g.10584169C>T						SOX7_uc011kwz.1_Silent_p.S134S|uc003wtg.1_5'Flank	p.S82S	NM_031439	NP_113627	Q9BT81	SOX7_HUMAN		COAD - Colon adenocarcinoma(149;0.0732)	2	325	-			82			HMG box.		B4DKV0|Q53YD0	Silent	SNP	ENST00000304501.1	37	c.246G>A	CCDS5977.1																																																																																				0.632	SOX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207131.1			6	39	0	0	0	0.001168	0	6	39				
XKR6	286046	broad.mit.edu	37	8	10756197	10756197	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:10756197C>A	ENST00000416569.2	-	3	1217	c.1191G>T	c.(1189-1191)atG>atT	p.M397I	XKR6_ENST00000304437.2_Missense_Mutation_p.M118I	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	397						integral component of membrane (GO:0016021)		p.M397I(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		TCCAGAAGGCCATGGCGCACC	0.512																																							uc003wtk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1189-1191)ATG>ATT		XK, Kell blood group complex subunit-related							95.0	89.0	91.0					8																	10756197		2203	4300	6503	SO:0001583	missense	286046					integral to membrane		g.chr8:10756197C>A	BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.1191G>T	8.37:g.10756197C>A	ENSP00000416707:p.Met397Ile						p.M397I	NM_173683	NP_775954	Q5GH73	XKR6_HUMAN		Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)	3	1218	-			397					Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	c.1191G>T	CCDS5978.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.42|19.42	3.825070|3.825070	0.71143|0.71143	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000304437;ENST00000416569|ENST00000382461	T;T|.	0.64803|.	-0.12;-0.12|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83450|0.83450	0.5257|0.5257	M|M	0.86805|0.86805	2.84|2.84	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.54964|.	0.969|.	D|.	0.70227|.	0.968|.	D|D	0.85387|0.85387	0.1123|0.1123	10|5	0.72032|.	D|.	0.01|.	-2.7698|-2.7698	18.3645|18.3645	0.90386|0.90386	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	397|.	Q5GH73|.	XKR6_HUMAN|.	I|L	118;397|174	ENSP00000307120:M118I;ENSP00000416707:M397I|.	ENSP00000307120:M118I|.	M|W	-|-	3|2	0|0	XKR6|XKR6	10793607|10793607	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.818000|7.818000	0.86416|0.86416	2.575000|2.575000	0.86900|0.86900	0.561000|0.561000	0.74099|0.74099	ATG|TGG		0.512	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683		11	36	1	0	1.58986e-06	0.008291	1.9916e-06	11	36				
MICU3	286097	broad.mit.edu	37	8	16948092	16948092	+	Splice_Site	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:16948092G>T	ENST00000318063.5	+	8	929	c.887G>T	c.(886-888)aGt>aTt	p.S296I		NM_181723.2	NP_859074.1	Q86XE3	MICU3_HUMAN	mitochondrial calcium uptake family, member 3	296						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.S296I(1)									CCTACTAATAGTGTATGTACA	0.328																																						Pancreas(177;1461 2846 10523 14242)|Colon(184;2703 2719 18484 23400)	uc003wxd.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(886-888)AGT>ATT		EF-hand domain family, member A2							220.0	224.0	223.0					8																	16948092		2203	4299	6502	SO:0001630	splice_region_variant	286097					integral to membrane	calcium ion binding	g.chr8:16948092G>T	BC032868	CCDS5999.1	8p22	2013-03-26	2013-03-26	2013-03-14	ENSG00000155970	ENSG00000155970		"""EF-hand domain containing"""	27820	protein-coding gene	gene with protein product		610633	"""EF hand domain family A2"", ""EF-hand domain family, member A2"""	EFHA2		23409044	Standard	NM_181723		Approved	DKFZp313A0139	uc003wxd.2	Q86XE3	OTTHUMG00000096965	ENST00000318063.5:c.888+1G>T	8.37:g.16948092G>T							p.S296I	NM_181723	NP_859074	Q86XE3	EFHA2_HUMAN		Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)	8	929	+			296					Q8IYZ3	Missense_Mutation	SNP	ENST00000318063.5	37	c.887G>T	CCDS5999.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523393	0.44866	.	.	ENSG00000155970	ENST00000318063	T	0.48522	0.81	5.41	4.52	0.55395	.	0.093976	0.64402	D	0.000001	T	0.38241	0.1033	L	0.44542	1.39	0.50313	D	0.999866	P	0.46512	0.879	B	0.40329	0.326	T	0.12142	-1.0559	10	0.32370	T	0.25	-19.1098	11.5133	0.50507	0.0716:0.1277:0.8007:0.0	.	296	Q86XE3	EFHA2_HUMAN	I	296	ENSP00000321455:S296I	ENSP00000321455:S296I	S	+	2	0	EFHA2	16992463	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.924000	0.56476	2.728000	0.93425	0.585000	0.79938	AGT		0.328	MICU3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214031.1	NM_181723	Missense_Mutation	17	81	1	0	1.15088e-07	0.004007	1.50086e-07	17	81				
MTUS1	57509	broad.mit.edu	37	8	17612649	17612649	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:17612649T>A	ENST00000262102.6	-	2	892	c.668A>T	c.(667-669)tAt>tTt	p.Y223F	MTUS1_ENST00000519263.1_Missense_Mutation_p.Y223F|MTUS1_ENST00000381862.3_Missense_Mutation_p.Y223F|MTUS1_ENST00000381869.3_Missense_Mutation_p.Y223F	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	223					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Y223F(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TTCTCTATCATAAGTAGTTTC	0.418																																							uc003wxv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(667-669)TAT>TTT		mitochondrial tumor suppressor 1 isoform 1							184.0	159.0	167.0					8																	17612649		1897	4119	6016	SO:0001583	missense	57509					Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle		g.chr8:17612649T>A	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.668A>T	8.37:g.17612649T>A	ENSP00000262102:p.Tyr223Phe					MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Missense_Mutation_p.Y223F|MTUS1_uc010lsz.2_Missense_Mutation_p.Y223F	p.Y223F	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN		Colorectal(111;0.0778)	2	1142	-			223					A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	c.668A>T	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	T	6.371	0.436472	0.12104	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.31769	2.37;2.44;2.37;1.48	4.25	-3.07	0.05363	.	1.125960	0.06664	N	0.765036	T	0.13628	0.0330	N	0.14661	0.345	0.09310	N	1	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.09377	0.004;0.003;0.004	T	0.25047	-1.0143	9	.	.	.	0.0623	2.465	0.04550	0.1251:0.365:0.128:0.3819	.	223;223;223	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	F	223	ENSP00000371293:Y223F;ENSP00000262102:Y223F;ENSP00000430167:Y223F;ENSP00000371286:Y223F	.	Y	-	2	0	MTUS1	17656929	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.450000	0.06803	-0.548000	0.06199	-0.433000	0.05886	TAT		0.418	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031		5	130	0	0	0	0.001984	0	5	130				
SLC18A1	6570	broad.mit.edu	37	8	20003354	20003354	+	Silent	SNP	G	G	T	rs149404030		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:20003354G>T	ENST00000276373.5	-	16	1764	c.1498C>A	c.(1498-1500)Cgg>Agg	p.R500R	SLC18A1_ENST00000519026.1_Silent_p.R468R|SLC18A1_ENST00000265808.7_Silent_p.R468R|SLC18A1_ENST00000440926.1_Silent_p.R500R|SLC18A1_ENST00000381608.4_Missense_Mutation_p.P455Q|SLC18A1_ENST00000437980.1_Missense_Mutation_p.P455Q	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	500					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)	p.R500R(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	GCATACATCCGGGTCTCCATG	0.502																																							uc011kyq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1498-1500)CGG>AGG		solute carrier family 18 (vesicular monoamine),							69.0	60.0	63.0					8																	20003354		2203	4300	6503	SO:0001819	synonymous_variant	6570				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity	g.chr8:20003354G>T		CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.1498C>A	8.37:g.20003354G>T						SLC18A1_uc003wzl.2_Silent_p.R287R|SLC18A1_uc003wzm.2_Silent_p.R500R|SLC18A1_uc011kyr.1_Missense_Mutation_p.P455Q|SLC18A1_uc003wzn.2_Silent_p.R468R|SLC18A1_uc010ltf.2_RNA|SLC18A1_uc003wzo.2_Silent_p.R468R	p.R500R	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN		Colorectal(74;0.0747)	17	1969	-			500			Cytoplasmic (Potential).		E9PDJ5|Q9BRE4	Silent	SNP	ENST00000276373.5	37	c.1498C>A	CCDS6013.1	.	.	.	.	.	.	.	.	.	.	G	16.01	3.000412	0.54147	.	.	ENSG00000036565	ENST00000437980;ENST00000381608	T;T	0.03689	3.84;3.84	5.17	2.05	0.26809	.	.	.	.	.	T	0.03220	0.0094	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.41928	-0.9481	8	0.38643	T	0.18	-1.5181	7.9017	0.29738	0.0:0.1284:0.3864:0.4852	.	455	E9PB33	.	Q	455	ENSP00000413361:P455Q;ENSP00000371021:P455Q	ENSP00000371021:P455Q	P	-	2	0	SLC18A1	20047634	0.223000	0.23663	0.025000	0.17156	0.943000	0.58893	0.886000	0.28241	0.712000	0.32039	0.650000	0.86243	CCG		0.502	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214106.1			11	51	1	0	6.42651e-13	0.010729	9.51723e-13	11	51				
PIWIL2	55124	broad.mit.edu	37	8	22210612	22210612	+	Silent	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:22210612G>T	ENST00000454009.2	+	21	3053	c.2544G>T	c.(2542-2544)gtG>gtT	p.V848V	PIWIL2_ENST00000521356.1_Silent_p.V848V|PIWIL2_ENST00000356766.6_Silent_p.V848V	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	848	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)	p.V848V(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		CCAAGATGGTGGTGTTTGTAG	0.408																																							uc003xbn.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(2542-2544)GTG>GTT		piwi-like 2							178.0	178.0	178.0					8																	22210612		2203	4300	6503	SO:0001819	synonymous_variant	55124				DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding	g.chr8:22210612G>T	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.2544G>T	8.37:g.22210612G>T						PIWIL2_uc011kzf.1_Silent_p.V848V|PIWIL2_uc010ltv.2_Silent_p.V848V|PIWIL2_uc003xbo.2_Silent_p.V2V	p.V848V	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN		Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)	21	2692	+			848			Piwi.		A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Silent	SNP	ENST00000454009.2	37	c.2544G>T	CCDS6029.1																																																																																				0.408	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375438.1			45	103	1	0	4.21674e-32	0.00361	7.10241e-32	45	103				
ADAM2	2515	broad.mit.edu	37	8	39645695	39645695	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:39645695T>C	ENST00000265708.4	-	9	821	c.718A>G	c.(718-720)Act>Gct	p.T240A	ADAM2_ENST00000347580.4_Missense_Mutation_p.T221A|ADAM2_ENST00000521880.1_Missense_Mutation_p.T240A|ADAM2_ENST00000379853.2_Intron	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	240	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T240A(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GCTTCTCCAGTGGTTGCAATT	0.289																																							uc003xnj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(718-720)ACT>GCT		ADAM metallopeptidase domain 2 proprotein							92.0	92.0	92.0					8																	39645695		2203	4293	6496	SO:0001583	missense	2515				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr8:39645695T>C	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.718A>G	8.37:g.39645695T>C	ENSP00000265708:p.Thr240Ala					ADAM2_uc003xnk.2_Missense_Mutation_p.T221A|ADAM2_uc011lck.1_Missense_Mutation_p.T240A|ADAM2_uc003xnl.2_Intron	p.T240A	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)	9	793	-		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	240			Extracellular (Potential).|Peptidase M12B.		P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	c.718A>G	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	T	8.733	0.917052	0.17907	.	.	ENSG00000104755	ENST00000347580;ENST00000265708;ENST00000521880	T;T;T	0.63255	-0.03;-0.03;-0.03	4.57	-2.63	0.06133	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.52837	0.1759	M	0.63169	1.94	0.09310	N	1	B;B;B	0.20988	0.05;0.017;0.05	B;B;B	0.28011	0.085;0.034;0.058	T	0.47522	-0.9111	8	.	.	.	.	4.7375	0.12995	0.1494:0.3799:0.0:0.4707	.	240;221;240	B4DWY7;Q99965-2;Q99965	.;.;ADAM2_HUMAN	A	221;240;240	ENSP00000343854:T221A;ENSP00000265708:T240A;ENSP00000429352:T240A	.	T	-	1	0	ADAM2	39764852	0.060000	0.20803	0.020000	0.16555	0.808000	0.45660	-0.108000	0.10857	-0.379000	0.07906	0.377000	0.23210	ACT		0.289	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464		4	8	0	0	0	0.009096	0	4	8				
ZMAT4	79698	broad.mit.edu	37	8	40532226	40532226	+	Nonsense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:40532226T>A	ENST00000297737.6	-	5	720	c.574A>T	c.(574-576)Aga>Tga	p.R192*	ZMAT4_ENST00000315769.7_Intron	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	192						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R192*(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			CCCTTACCTCTCAGTTCCCCC	0.448																																							uc003xnr.2		NA																	1	Substitution - Nonsense(1)		lung(1)	pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(574-576)AGA>TGA		zinc finger, matrin type 4 isoform a							115.0	108.0	110.0					8																	40532226		2203	4300	6503	SO:0001587	stop_gained	79698					nucleus	DNA binding|zinc ion binding	g.chr8:40532226T>A	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.574A>T	8.37:g.40532226T>A	ENSP00000297737:p.Arg192*					ZMAT4_uc003xns.2_Intron	p.R192*	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.00722)		5	720	-	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	192					Q8WUT8	Nonsense_Mutation	SNP	ENST00000297737.6	37	c.574A>T	CCDS34885.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.351744	0.82132	.	.	ENSG00000165061	ENST00000297737;ENST00000519406	.	.	.	5.85	-1.64	0.08318	.	0.309199	0.35970	N	0.002870	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.287	0.60249	0.0:0.067:0.691:0.242	.	.	.	.	X	192	.	ENSP00000297737:R192X	R	-	1	2	ZMAT4	40651383	0.506000	0.26139	0.224000	0.23877	0.606000	0.37113	0.660000	0.25009	-0.488000	0.06726	0.455000	0.32223	AGA		0.448	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376950.1	NM_024645		27	73	0	0	0	0.00632	0	27	73				
SNTG1	54212	broad.mit.edu	37	8	51449349	51449349	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:51449349C>A	ENST00000522124.1	+	11	1322	c.661C>A	c.(661-663)Ccc>Acc	p.P221T	SNTG1_ENST00000276467.5_Missense_Mutation_p.P221T|SNTG1_ENST00000517473.1_Missense_Mutation_p.P221T|SNTG1_ENST00000518864.1_Missense_Mutation_p.P221T	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	221					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.P221T(2)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TCAGTATGTGCCCGGCACAGA	0.473																																							uc010lxy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)	5						c.(661-663)CCC>ACC		syntrophin, gamma 1							198.0	177.0	184.0					8																	51449349		2203	4300	6503	SO:0001583	missense	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51449349C>A	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.661C>A	8.37:g.51449349C>A	ENSP00000429842:p.Pro221Thr					SNTG1_uc003xqs.1_Missense_Mutation_p.P221T|SNTG1_uc010lxz.1_Missense_Mutation_p.P221T|SNTG1_uc011ldl.1_RNA	p.P221T	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN			12	1032	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	221					Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	c.661C>A	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	C	3.029	-0.199980	0.06219	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	4.91	4.91	0.64330	Pleckstrin homology domain (1);	0.049069	0.85682	D	0.000000	T	0.29716	0.0742	N	0.17474	0.49	0.58432	D	0.999991	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.10222	-1.0639	10	0.17832	T	0.49	.	11.8698	0.52513	0.1747:0.8253:0.0:0.0	.	221;221	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	T	221	ENSP00000429276:P221T;ENSP00000429842:P221T;ENSP00000431123:P221T;ENSP00000276467:P221T	ENSP00000276467:P221T	P	+	1	0	SNTG1	51611902	0.995000	0.38212	0.068000	0.19968	0.029000	0.11900	3.568000	0.53820	2.281000	0.76405	0.491000	0.48974	CCC		0.473	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			42	286	1	0	5.2432e-18	0.00361	8.27313e-18	42	286				
XKR4	114786	broad.mit.edu	37	8	56436157	56436157	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:56436157A>T	ENST00000327381.6	+	3	1424	c.1324A>T	c.(1324-1326)Atc>Ttc	p.I442F	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	442						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GATTATCTATATCTTCAGTTG	0.448																																							uc003xsf.2		NA																	0				pancreas(2)	2						c.(1324-1326)ATC>TTC		XK, Kell blood group complex subunit-related							202.0	191.0	195.0					8																	56436157		2203	4300	6503	SO:0001583	missense	114786					integral to membrane		g.chr8:56436157A>T	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1324A>T	8.37:g.56436157A>T	ENSP00000328326:p.Ile442Phe						p.I442F	NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	Epithelial(17;0.000117)|all cancers(17;0.000836)		3	1356	+			442			Helical; (Potential).		Q96PZ8	Missense_Mutation	SNP	ENST00000327381.6	37	c.1324A>T	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.131693	0.77662	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.69561	-0.41	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.80518	0.4638	M	0.66506	2.035	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81571	-0.0872	10	0.54805	T	0.06	-15.1927	15.9527	0.79855	1.0:0.0:0.0:0.0	.	442	Q5GH76	XKR4_HUMAN	F	442	ENSP00000328326:I442F	ENSP00000328326:I442F	I	+	1	0	XKR4	56598711	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.339000	0.96797	2.173000	0.68751	0.533000	0.62120	ATC		0.448	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898		149	226	0	0	0	0.00361	0	149	226				
UBXN2B	137886	broad.mit.edu	37	8	59347001	59347001	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:59347001T>A	ENST00000399598.2	+	5	593	c.471T>A	c.(469-471)gaT>gaA	p.D157E	UBXN2B_ENST00000522978.1_3'UTR	NM_001077619.1	NP_001071087.1	Q14CS0	UBX2B_HUMAN	UBX domain protein 2B	157	SEP. {ECO:0000255|PROSITE- ProRule:PRU00732}.					endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.D157E(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13						GTTTAGATGATGGAGAATTGA	0.289																																							uc003xtl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(469-471)GAT>GAA		UBX domain protein 2B							94.0	85.0	88.0					8																	59347001		1808	4069	5877	SO:0001583	missense	137886					cytosol|endoplasmic reticulum|Golgi apparatus|nucleus		g.chr8:59347001T>A	AK054658	CCDS43741.1	8q12.1	2008-08-08			ENSG00000215114	ENSG00000215114		"""UBX domain containing"""	27035	protein-coding gene	gene with protein product		610686				8619474, 9110174	Standard	NM_001077619		Approved	p37	uc003xtl.3	Q14CS0	OTTHUMG00000164300	ENST00000399598.2:c.471T>A	8.37:g.59347001T>A	ENSP00000382507:p.Asp157Glu						p.D157E	NM_001077619	NP_001071087	Q14CS0	UBX2B_HUMAN			5	593	+			157			SEP.		B3KWZ3	Missense_Mutation	SNP	ENST00000399598.2	37	c.471T>A	CCDS43741.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.24|19.24	3.790237|3.790237	0.70337|0.70337	.|.	.|.	ENSG00000215114|ENSG00000215114	ENST00000399598|ENST00000521796	T|.	0.61510|.	0.1|.	5.88|5.88	2.2|2.2	0.27929|0.27929	SEP domain (4);|.	0.000000|.	0.46145|.	U|.	0.000305|.	T|T	0.56232|0.56232	0.1971|0.1971	L|L	0.58969|0.58969	1.84|1.84	0.41384|0.41384	D|D	0.987576|0.987576	B|.	0.29612|.	0.251|.	B|.	0.27796|.	0.083|.	T|T	0.48592|0.48592	-0.9022|-0.9022	10|5	0.46703|.	T|.	0.11|.	-16.4944|-16.4944	5.1829|5.1829	0.15169|0.15169	0.1316:0.1424:0.0:0.726|0.1316:0.1424:0.0:0.726	.|.	157|.	Q14CS0|.	UBX2B_HUMAN|.	E|R	157|103	ENSP00000382507:D157E|.	ENSP00000382507:D157E|.	D|W	+|+	3|1	2|0	UBXN2B|UBXN2B	59509555|59509555	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.468000|1.468000	0.35332|0.35332	0.142000|0.142000	0.18901|0.18901	0.482000|0.482000	0.46254|0.46254	GAT|TGG		0.289	UBXN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378184.1	NM_001077619		4	50	0	0	0	0.001168	0	4	50				
CYP7A1	1581	broad.mit.edu	37	8	59410881	59410881	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:59410881G>A	ENST00000301645.3	-	2	365	c.228C>T	c.(226-228)gtC>gtT	p.V76V		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	76					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.V76V(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TGATGAAATGGACATATTTTC	0.393									Neonatal Giant Cell Hepatitis																														uc003xtm.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(226-228)GTC>GTT		cytochrome P450, family 7, subfamily A,							146.0	145.0	145.0					8																	59410881		2203	4300	6503	SO:0001819	synonymous_variant	1581	Neonatal_Giant_Cell_Hepatitis	Familial Cancer Database	Neonatal Hemochromatosis	bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding	g.chr8:59410881G>A	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.228C>T	8.37:g.59410881G>A							p.V76V	NM_000780	NP_000771	P22680	CP7A1_HUMAN			2	291	-		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)	76					P78454|Q3MIL8|Q7KZ19	Silent	SNP	ENST00000301645.3	37	c.228C>T	CCDS6171.1																																																																																				0.393	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780		7	140	0	0	0	0.001984	0	7	140				
PREX2	80243	broad.mit.edu	37	8	68956759	68956759	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:68956759C>A	ENST00000288368.4	+	8	1154	c.877C>A	c.(877-879)Cgg>Agg	p.R293R	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	293	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.R293R(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGATGGACATCGGTACCTTTT	0.403																																							uc003xxv.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.(877-879)CGG>AGG		DEP domain containing 2 isoform a							155.0	144.0	148.0					8																	68956759		2203	4300	6503	SO:0001819	synonymous_variant	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:68956759C>A	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.877C>A	8.37:g.68956759C>A						PREX2_uc003xxu.1_Silent_p.R293R|PREX2_uc011lez.1_Silent_p.R228R	p.R293R	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN			8	904	+			293			PH.		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	c.877C>A	CCDS6201.1																																																																																				0.403	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170		4	38	1	0	0.00024832	0.009096	0.000280413	4	38				
SLCO5A1	81796	broad.mit.edu	37	8	70585498	70585498	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:70585498T>A	ENST00000260126.4	-	10	2859	c.2153A>T	c.(2152-2154)cAg>cTg	p.Q718L	SLCO5A1_ENST00000524945.1_3'UTR|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.Q663L	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	718						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.Q718L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			ACCACATTCCTGTTGCCAGAG	0.468																																							uc003xyl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(2152-2154)CAG>CTG		solute carrier organic anion transporter family,							157.0	156.0	156.0					8																	70585498		2203	4300	6503	SO:0001583	missense	81796					integral to membrane|plasma membrane	transporter activity	g.chr8:70585498T>A	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.2153A>T	8.37:g.70585498T>A	ENSP00000260126:p.Gln718Leu					SLCO5A1_uc010lzb.2_Missense_Mutation_p.Q663L|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_3'UTR	p.Q718L	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)		10	2860	-	Breast(64;0.0654)		718			Extracellular (Potential).		A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	c.2153A>T	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.778104	0.49786	.	.	ENSG00000137571	ENST00000260126;ENST00000530307	T;T	0.38887	1.11;1.11	5.63	4.48	0.54585	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.057729	0.64402	D	0.000001	T	0.28665	0.0710	N	0.25245	0.725	0.46701	D	0.999162	B;B	0.29590	0.081;0.25	B;B	0.29663	0.052;0.105	T	0.05419	-1.0886	10	0.28530	T	0.3	.	11.7457	0.51819	0.0:0.0689:0.0:0.9311	.	663;718	E9PKK5;Q9H2Y9	.;SO5A1_HUMAN	L	718;663	ENSP00000260126:Q718L;ENSP00000431611:Q663L	ENSP00000260126:Q718L	Q	-	2	0	SLCO5A1	70748052	1.000000	0.71417	0.997000	0.53966	0.968000	0.65278	6.137000	0.71710	1.079000	0.41038	0.533000	0.62120	CAG		0.468	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958		70	283	0	0	0	0.00361	0	70	283				
PRDM14	63978	broad.mit.edu	37	8	70964509	70964509	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:70964509G>A	ENST00000276594.2	-	8	1720	c.1519C>T	c.(1519-1521)Cac>Tac	p.H507Y		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	507					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.H507Y(1)		NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			TGCCTGATGTGTGTGCGGAGT	0.488																																					NSCLC(129;99 1813 5906 40656 46114)	NSCLC(129;99 1813 5906 40656 46114)	uc003xym.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1519-1521)CAC>TAC		PR domain containing 14							122.0	115.0	117.0					8																	70964509		2203	4300	6503	SO:0001583	missense	63978				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:70964509G>A	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.1519C>T	8.37:g.70964509G>A	ENSP00000276594:p.His507Tyr						p.H507Y	NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)		8	1721	-	Breast(64;0.193)		507			C2H2-type 4.		Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	37	c.1519C>T	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138092	0.94560	.	.	ENSG00000147596	ENST00000276594	D	0.86769	-2.17	6.08	6.08	0.98989	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96015	0.8702	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96265	0.9194	10	0.87932	D	0	-30.4849	20.6647	0.99678	0.0:0.0:1.0:0.0	.	507	Q9GZV8	PRD14_HUMAN	Y	507	ENSP00000276594:H507Y	ENSP00000276594:H507Y	H	-	1	0	PRDM14	71127063	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.283000	0.95860	2.890000	0.99128	0.655000	0.94253	CAC		0.488	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1			13	206	0	0	0	0.003163	0	13	206				
ZFHX4	79776	broad.mit.edu	37	8	77764453	77764453	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:77764453G>A	ENST00000521891.2	+	10	5744	c.5296G>A	c.(5296-5298)Ggc>Agc	p.G1766S	ZFHX4_ENST00000455469.2_Missense_Mutation_p.G1721S|ZFHX4_ENST00000518282.1_Missense_Mutation_p.G1740S|ZFHX4_ENST00000050961.6_Missense_Mutation_p.G1721S	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1721	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G1766S(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGGGATGCCTGGCATGACAGG	0.498										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(5161-5163)GGC>AGC		zinc finger homeodomain 4							37.0	35.0	36.0					8																	77764453		2074	4230	6304	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77764453G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.5296G>A	8.37:g.77764453G>A	ENSP00000430497:p.Gly1766Ser	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.G1766S|ZFHX4_uc003yaw.1_Missense_Mutation_p.G1721S	p.G1721S	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	5548	+			1721			Gln-rich.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.5161G>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	17.32	3.358789	0.61403	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.55052	0.54;0.6;0.57;0.57	4.71	4.71	0.59529	.	0.000000	0.44902	U	0.000420	T	0.64516	0.2605	M	0.61703	1.905	0.58432	D	0.999996	D;D;D	0.60160	0.978;0.987;0.987	P;P;P	0.61477	0.777;0.889;0.889	T	0.58589	-0.7610	10	0.08599	T	0.76	.	18.2749	0.90080	0.0:0.0:1.0:0.0	.	1721;1721;1766	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	S	1766;1766;1721;1721;1740	ENSP00000430497:G1766S;ENSP00000399605:G1721S;ENSP00000050961:G1721S;ENSP00000430848:G1740S	ENSP00000050961:G1721S	G	+	1	0	ZFHX4	77927008	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.755000	0.85180	2.631000	0.89168	0.632000	0.83419	GGC		0.498	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		4	36	0	0	0	0.000602	0	4	36				
ZFHX4	79776	broad.mit.edu	37	8	77768373	77768373	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:77768373C>A	ENST00000521891.2	+	10	9664	c.9216C>A	c.(9214-9216)gaC>gaA	p.D3072E	ZFHX4_ENST00000455469.2_Missense_Mutation_p.D3027E|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D3046E|ZFHX4_ENST00000050961.6_Missense_Mutation_p.D3027E	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3027	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.D3056E(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAGCTTCAGACGTGCTGGGCT	0.572										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(9079-9081)GAC>GAA		zinc finger homeodomain 4							107.0	110.0	109.0					8																	77768373		2069	4206	6275	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77768373C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9216C>A	8.37:g.77768373C>A	ENSP00000430497:p.Asp3072Glu	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.D3072E|ZFHX4_uc003yaw.1_Missense_Mutation_p.D3027E	p.D3027E	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	9468	+			3027					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.9081C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	13.24	2.177306	0.38413	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.41065	1.01;1.05;1.02;1.02	5.45	-4.11	0.03928	.	0.000000	0.45867	U	0.000329	T	0.26195	0.0639	N	0.13235	0.315	0.47778	D	0.999512	B;B;B	0.31351	0.214;0.32;0.32	B;P;P	0.44359	0.261;0.447;0.447	T	0.21586	-1.0241	10	0.02654	T	1	.	12.6993	0.57022	0.0:0.4993:0.0:0.5007	.	3027;3027;3072	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	E	3072;3056;3027;3027;3046	ENSP00000430497:D3072E;ENSP00000399605:D3027E;ENSP00000050961:D3027E;ENSP00000430848:D3046E	ENSP00000050961:D3027E	D	+	3	2	ZFHX4	77930928	0.066000	0.20996	0.624000	0.29186	0.958000	0.62258	-0.692000	0.05127	-0.957000	0.03627	0.655000	0.94253	GAC		0.572	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		24	178	1	0	7.07758e-08	0.004656	9.42329e-08	24	178				
ZFHX4	79776	broad.mit.edu	37	8	77776730	77776730	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:77776730G>T	ENST00000521891.2	+	11	11228	c.10780G>T	c.(10780-10782)Gtg>Ttg	p.V3594L	ZFHX4_ENST00000455469.2_Missense_Mutation_p.V3549L|ZFHX4_ENST00000518282.1_Missense_Mutation_p.V3568L|ZFHX4_ENST00000050961.6_Missense_Mutation_p.V3545L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.V3578L(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTCTTTGGAAGTGAAGGCTAA	0.448										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(10645-10647)GTG>TTG		zinc finger homeodomain 4							44.0	42.0	43.0					8																	77776730		1952	4165	6117	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77776730G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10780G>T	8.37:g.77776730G>T	ENSP00000430497:p.Val3594Leu	HNSCC(33;0.089)					p.V3549L	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		11	11032	+			3545					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.10645G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	15.56	2.870211	0.51588	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.51071	0.72;0.77;0.74;0.73	4.6	4.6	0.57074	.	0.178467	0.26334	U	0.024980	T	0.56156	0.1966	L	0.51422	1.61	0.52501	D	0.999958	D	0.57257	0.979	P	0.53401	0.725	T	0.58137	-0.7689	10	0.49607	T	0.09	.	17.9764	0.89129	0.0:0.0:1.0:0.0	.	3549	Q86UP3-4	.	L	3594;3578;3549;3545;3568	ENSP00000430497:V3594L;ENSP00000399605:V3549L;ENSP00000050961:V3545L;ENSP00000430848:V3568L	ENSP00000050961:V3545L	V	+	1	0	ZFHX4	77939285	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.148000	0.94652	2.551000	0.86045	0.650000	0.86243	GTG		0.448	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		9	46	1	0	0.00448238	0.004482	0.00482771	9	46				
RALYL	138046	broad.mit.edu	37	8	85799925	85799926	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:85799925_85799926CC>AG	ENST00000521268.1	+	8	1877_1878	c.772_773CC>AG	c.(772-774)CCt>AGt	p.P258S	RALYL_ENST00000522455.1_Missense_Mutation_p.P258S|RALYL_ENST00000521376.1_Intron|RALYL_ENST00000523850.1_Missense_Mutation_p.P185S|RALYL_ENST00000517638.1_Missense_Mutation_p.P271S|RALYL_ENST00000518566.1_Missense_Mutation_p.P247S|RALYL_ENST00000521695.1_Missense_Mutation_p.P258S	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	258							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P258S(2)		endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						TACAGAGGAGCCTGCTGAAGGA	0.51																																							uc003ycq.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(772-774)CCT>AGT		RALY RNA binding protein-like isoform 2																																				SO:0001583	missense	138046						identical protein binding|nucleotide binding|RNA binding	g.chr8:85799925_85799926CC>AG		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	Exception_encountered	8.37:g.85799925_85799926delinsAG	ENSP00000430367:p.Pro258Ser					RALYL_uc003ycr.3_Missense_Mutation_p.P258S|RALYL_uc003ycs.3_Missense_Mutation_p.P258S|RALYL_uc010lzy.2_Missense_Mutation_p.P247S|RALYL_uc003yct.3_Missense_Mutation_p.P271S|RALYL_uc003ycu.3_Missense_Mutation_p.P185S|RALYL_uc003ycv.3_Intron	p.P258S	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN			9	1188_1189	+			258					B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	DNP	ENST00000521268.1	37	c.772_773CC>AG	CCDS55253.1																																																																																				0.510	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1			29	71	0	0	0	0.004672	0	29	71				
CNBD1	168975	broad.mit.edu	37	8	88249304	88249304	+	Silent	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:88249304A>G	ENST00000518476.1	+	6	786	c.735A>G	c.(733-735)acA>acG	p.T245T	CNBD1_ENST00000522427.1_3'UTR	NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	245								p.T245T(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						AAAACTCTACACTTGCTGAGA	0.373																																							uc003ydy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(733-735)ACA>ACG		cyclic nucleotide binding domain containing 1							90.0	83.0	85.0					8																	88249304		1862	4096	5958	SO:0001819	synonymous_variant	168975							g.chr8:88249304A>G	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.735A>G	8.37:g.88249304A>G							p.T245T	NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN			6	783	+			245						Silent	SNP	ENST00000518476.1	37	c.735A>G	CCDS55259.1																																																																																				0.373	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538		5	29	0	0	0	0.001168	0	5	29				
DCAF4L2	138009	broad.mit.edu	37	8	88885435	88885435	+	Nonsense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:88885435A>T	ENST00000319675.3	-	1	861	c.765T>A	c.(763-765)tgT>tgA	p.C255*		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	255								p.C255*(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CTTGATTTCCACAGCGCAGAT	0.512																																							uc003ydz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(763-765)TGT>TGA		WD repeat domain 21C							121.0	114.0	117.0					8																	88885435		2203	4300	6503	SO:0001587	stop_gained	138009							g.chr8:88885435A>T	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.765T>A	8.37:g.88885435A>T	ENSP00000316496:p.Cys255*						p.C255*	NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN			1	862	-			255						Nonsense_Mutation	SNP	ENST00000319675.3	37	c.765T>A	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.691535	0.88735	.	.	ENSG00000176566	ENST00000319675	.	.	.	1.92	0.24	0.15489	.	0.768581	0.13330	N	0.396032	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	2.9798	0.05949	0.5406:0.0:0.4594:0.0	.	.	.	.	X	255	.	ENSP00000316496:C255X	C	-	3	2	DCAF4L2	88954551	0.999000	0.42202	0.004000	0.12327	0.411000	0.31082	0.406000	0.21032	0.627000	0.30340	0.383000	0.25322	TGT		0.512	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		15	115	0	0	0	0.003163	0	15	115				
DCAF4L2	138009	broad.mit.edu	37	8	88885437	88885437	+	Missense_Mutation	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:88885437A>T	ENST00000319675.3	-	1	859	c.763T>A	c.(763-765)Tgt>Agt	p.C255S		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	255								p.C255S(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TGATTTCCACAGCGCAGATCA	0.512																																							uc003ydz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(763-765)TGT>AGT		WD repeat domain 21C							122.0	115.0	117.0					8																	88885437		2203	4300	6503	SO:0001583	missense	138009							g.chr8:88885437A>T	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.763T>A	8.37:g.88885437A>T	ENSP00000316496:p.Cys255Ser						p.C255S	NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN			1	860	-			255						Missense_Mutation	SNP	ENST00000319675.3	37	c.763T>A	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	A	9.769	1.172067	0.21704	.	.	ENSG00000176566	ENST00000319675	T	0.22743	1.94	1.92	-1.35	0.09114	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.768581	0.13330	N	0.396032	T	0.09949	0.0244	L	0.29908	0.895	0.09310	N	0.999998	B	0.11235	0.004	B	0.06405	0.002	T	0.37407	-0.9707	10	0.10111	T	0.7	.	2.791	0.05388	0.5349:0.2663:0.1987:0.0	.	255	Q8NA75	DC4L2_HUMAN	S	255	ENSP00000316496:C255S	ENSP00000316496:C255S	C	-	1	0	DCAF4L2	88954553	1.000000	0.71417	0.003000	0.11579	0.398000	0.30690	2.405000	0.44548	-0.220000	0.09988	0.383000	0.25322	TGT		0.512	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418		14	114	0	0	0	0.00245	0	14	114				
NIPAL2	79815	broad.mit.edu	37	8	99264812	99264812	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:99264812G>A	ENST00000341166.3	-	3	510	c.255C>T	c.(253-255)ttC>ttT	p.F85F	NIPAL2_ENST00000430223.2_Silent_p.F85F|NIPAL2_ENST00000520545.1_5'Flank	NM_024759.1	NP_079035.1	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	85						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)	p.F85F(2)		cervix(3)|kidney(1)|large_intestine(2)|lung(5)|stomach(1)	12						GCACACTCTTGAAGTATGGCC	0.493																																							uc003yil.1		NA																	2	Substitution - coding silent(2)		cervix(1)|lung(1)		0						c.(253-255)TTC>TTT		NIPA-like domain containing 2							104.0	85.0	91.0					8																	99264812		2203	4300	6503	SO:0001819	synonymous_variant	79815					integral to membrane		g.chr8:99264812G>A	AK024017	CCDS6278.1	8q22.2	2009-03-24		2009-03-24	ENSG00000104361	ENSG00000104361			25854	protein-coding gene	gene with protein product				NPAL2		14702039	Standard	NM_024759		Approved	FLJ13955	uc003yil.1	Q9H841	OTTHUMG00000164668	ENST00000341166.3:c.255C>T	8.37:g.99264812G>A						NIPAL2_uc011lgw.1_5'Flank|NIPAL2_uc003yim.1_Silent_p.F85F	p.F85F	NM_024759	NP_079035	Q9H841	NPAL2_HUMAN			3	511	-			85					A2RTY8	Silent	SNP	ENST00000341166.3	37	c.255C>T	CCDS6278.1																																																																																				0.493	NIPAL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379677.1	NM_024759		5	83	0	0	0	0.001168	0	5	83				
GRHL2	79977	broad.mit.edu	37	8	102586052	102586052	+	Splice_Site	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:102586052G>T	ENST00000251808.3	+	6	1229	c.891G>T	c.(889-891)agG>agT	p.R297S	GRHL2_ENST00000395927.1_Splice_Site_p.R281S	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	297					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R297S(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			GCAAAGTCAGGGTAGGGGCCA	0.478																																							uc010mbu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(889-891)AGG>AGT		transcription factor CP2-like 3							63.0	56.0	59.0					8																	102586052		2203	4300	6503	SO:0001630	splice_region_variant	79977					cytoplasm|nucleus	DNA binding	g.chr8:102586052G>T	AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.891+1G>T	8.37:g.102586052G>T						GRHL2_uc011lhi.1_Missense_Mutation_p.R297S	p.R297S	NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)		6	1221	+	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		297					A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	ENST00000251808.3	37	c.891G>T	CCDS34931.1	.	.	.	.	.	.	.	.	.	.	G	35	5.432737	0.96150	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.23348	1.91;1.91	5.7	5.7	0.88788	CP2 transcription factor (1);	0.085474	0.85682	N	0.000000	T	0.54806	0.1881	M	0.74881	2.28	0.80722	D	1	D;P	0.89917	1.0;0.616	D;P	0.87578	0.998;0.574	T	0.55444	-0.8140	10	0.66056	D	0.02	-36.5595	19.8232	0.96605	0.0:0.0:1.0:0.0	.	297;297	B4DL28;Q6ISB3	.;GRHL2_HUMAN	S	297;281;297	ENSP00000251808:R297S;ENSP00000379260:R281S	ENSP00000251808:R297S	R	+	3	2	GRHL2	102655228	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.985000	0.88162	2.684000	0.91462	0.650000	0.86243	AGG		0.478	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313882.1	NM_024915	Missense_Mutation	16	28	1	0	1.56452e-12	0.007413	2.30232e-12	16	28				
RIMS2	9699	broad.mit.edu	37	8	104778725	104778725	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:104778725G>T	ENST00000406091.3	+	3	658	c.658G>T	c.(658-660)Ggc>Tgc	p.G220C		NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	251					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.G220C(1)|p.G256C(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AAATGGGTCAGGCGTGAAGCA	0.418										HNSCC(12;0.0054)																													uc003ylp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(658-660)GGC>TGC		regulating synaptic membrane exocytosis 2							89.0	85.0	86.0					8																	104778725		1922	4149	6071	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104778725G>T	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.658G>T	8.37:g.104778725G>T	ENSP00000384892:p.Gly220Cys	HNSCC(12;0.0054)					p.G220C	NM_001100117	NP_001093587	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		3	797	+			251					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000406091.3	37	c.658G>T	CCDS55269.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360027	0.61403	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998	T;T	0.36699	1.24;1.24	5.25	5.25	0.73442	.	.	.	.	.	T	0.34774	0.0909	L	0.50333	1.59	0.80722	D	1	P	0.43885	0.82	B	0.39379	0.298	T	0.22452	-1.0216	9	0.59425	D	0.04	.	14.4622	0.67459	0.0732:0.0:0.9268:0.0	.	220	F8WD47	.	C	220;251;220;251	ENSP00000427018:G220C;ENSP00000384892:G220C	ENSP00000332184:G251C	G	+	1	0	RIMS2	104847901	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.340000	0.65958	2.622000	0.88805	0.650000	0.86243	GGC		0.418	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001100117		10	44	1	0	1.58986e-06	0.008291	1.9916e-06	10	44				
RIMS2	9699	broad.mit.edu	37	8	104897822	104897822	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:104897822G>T	ENST00000436393.2	+	2	570	c.329G>T	c.(328-330)cGc>cTc	p.R110L	RIMS2_ENST00000406091.3_Missense_Mutation_p.R332L|RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000507740.1_Missense_Mutation_p.R140L|RIMS2_ENST00000262231.10_Missense_Mutation_p.R140L			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	363	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.R140L(2)|p.R368L(1)|p.R110L(1)|p.R332L(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TACCAGTCACGCTACCGAAGT	0.463										HNSCC(12;0.0054)																													uc003yls.2		NA																	5	Substitution - Missense(5)		lung(5)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(328-330)CGC>CTC		regulating synaptic membrane exocytosis 2							97.0	96.0	96.0					8																	104897822		2029	4177	6206	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104897822G>T	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.329G>T	8.37:g.104897822G>T	ENSP00000390665:p.Arg110Leu	HNSCC(12;0.0054)				RIMS2_uc003ylp.2_Missense_Mutation_p.R332L|RIMS2_uc003ylw.2_Missense_Mutation_p.R140L|RIMS2_uc003ylq.2_Missense_Mutation_p.R140L|RIMS2_uc003ylr.2_Missense_Mutation_p.R140L	p.R110L	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		2	570	+			363					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37	c.329G>T		.	.	.	.	.	.	.	.	.	.	G	28.1	4.889240	0.91889	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.32	5.32	0.75619	.	.	.	.	.	T	0.66954	0.2842	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.994;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.99;0.988;0.999;0.997;0.999	T	0.70684	-0.4804	9	0.87932	D	0	.	18.9862	0.92771	0.0:0.0:1.0:0.0	.	363;110;140;140;332	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	L	332;363;332;363;140;140;140;140;110	ENSP00000427018:R332L;ENSP00000384892:R332L;ENSP00000425205:R140L;ENSP00000262231:R140L;ENSP00000423559:R140L;ENSP00000386228:R140L;ENSP00000390665:R110L	ENSP00000262231:R140L	R	+	2	0	RIMS2	104966998	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	9.615000	0.98356	2.479000	0.83701	0.467000	0.42956	CGC		0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		3	16	1	0	0.004672	0.004672	0.00500111	3	16				
RIMS2	9699	broad.mit.edu	37	8	104898100	104898100	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:104898100G>A	ENST00000436393.2	+	2	848	c.607G>A	c.(607-609)Gca>Aca	p.A203T	RIMS2_ENST00000406091.3_Missense_Mutation_p.A425T|RIMS2_ENST00000507740.1_Missense_Mutation_p.A233T|RIMS2_ENST00000262231.10_Missense_Mutation_p.A233T			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	456					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.A233T(2)|p.A203T(1)|p.A461T(1)|p.A425T(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AAGTTCTTATGCACAAAGGAC	0.473										HNSCC(12;0.0054)																													uc003yls.2		NA																	5	Substitution - Missense(5)		lung(5)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(607-609)GCA>ACA		regulating synaptic membrane exocytosis 2							86.0	81.0	83.0					8																	104898100		1939	4138	6077	SO:0001583	missense	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104898100G>A	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.607G>A	8.37:g.104898100G>A	ENSP00000390665:p.Ala203Thr	HNSCC(12;0.0054)				RIMS2_uc003ylp.2_Missense_Mutation_p.A425T|RIMS2_uc003ylw.2_Missense_Mutation_p.A233T|RIMS2_uc003ylq.2_Missense_Mutation_p.A233T|RIMS2_uc003ylr.2_Missense_Mutation_p.A233T	p.A203T	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		2	848	+			456					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37	c.607G>A		.	.	.	.	.	.	.	.	.	.	G	8.843	0.942659	0.18281	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31	5.65	2.89	0.33648	.	.	.	.	.	T	0.24736	0.0600	N	0.19112	0.55	0.80722	D	1	B;B;B;B;B	0.19200	0.006;0.034;0.0;0.001;0.029	B;B;B;B;B	0.27715	0.004;0.082;0.006;0.002;0.04	T	0.03784	-1.1004	9	0.31617	T	0.26	.	11.0423	0.47838	0.0:0.6804:0.2528:0.0668	.	456;203;233;233;425	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	T	425;456;425;456;233;233;233;233;203	ENSP00000427018:A425T;ENSP00000384892:A425T;ENSP00000425205:A233T;ENSP00000262231:A233T;ENSP00000423559:A233T;ENSP00000386228:A233T;ENSP00000390665:A203T	ENSP00000262231:A233T	A	+	1	0	RIMS2	104967276	1.000000	0.71417	0.994000	0.49952	0.870000	0.49936	3.564000	0.53791	0.325000	0.23359	-1.097000	0.02148	GCA		0.473	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		5	13	0	0	0	0.000602	0	5	13				
RIMS2	9699	broad.mit.edu	37	8	105261776	105261776	+	Silent	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:105261776C>G	ENST00000436393.2	+	26	3946	c.3705C>G	c.(3703-3705)gcC>gcG	p.A1235A	RIMS2_ENST00000406091.3_Silent_p.A1217A|RIMS2_ENST00000339750.2_Silent_p.A153A|RIMS2_ENST00000507740.1_Silent_p.A1031A|RIMS2_ENST00000262231.10_Silent_p.A1056A			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1279					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.A1031A(2)|p.A1235A(1)|p.A1217A(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCATCCGGGCCCGTGGCCTTG	0.393										HNSCC(12;0.0054)																													uc003yls.2		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(3703-3705)GCC>GCG		regulating synaptic membrane exocytosis 2							72.0	74.0	73.0					8																	105261776		1843	4082	5925	SO:0001819	synonymous_variant	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:105261776C>G	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3705C>G	8.37:g.105261776C>G		HNSCC(12;0.0054)				RIMS2_uc003ylp.2_Silent_p.A1217A|RIMS2_uc003ylw.2_Silent_p.A1224A|RIMS2_uc003ylq.2_Silent_p.A1031A|RIMS2_uc003ylr.2_Silent_p.A1056A	p.A1235A	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		26	3946	+			1279			C2 2.		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	37	c.3705C>G																																																																																					0.393	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		3	35	0	0	0	0.001168	0	3	35				
DCSTAMP	81501	broad.mit.edu	37	8	105360857	105360858	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:105360857_105360858GG>AT	ENST00000297581.2	+	2	126_127	c.77_78GG>AT	c.(76-78)tGG>tAT	p.W26Y	DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000517991.1_Missense_Mutation_p.W26Y	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	26					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)		p.W26Y(1)|p.W26*(1)									AGCCCCGGATGGATGGACTTTA	0.495																																							uc003ylx.1		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(1)|skin(1)	pancreas(2)|large_intestine(1)|ovary(1)	4						c.(76-78)TGG>TAT		dendritic cell-specific transmembrane protein																																				SO:0001583	missense	81501				osteoclast differentiation	cell surface|integral to membrane|plasma membrane		g.chr8:105360857_105360858GG>AT	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	Exception_encountered	8.37:g.105360857_105360858delinsAT	ENSP00000297581:p.Trp26Tyr						p.W26Y	NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		2	126_127	+			26					B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	DNP	ENST00000297581.2	37	c.77_78GG>AT	CCDS6301.1																																																																																				0.495	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788		36	146	0	0	0	0.004672	0	36	146				
ZFPM2	23414	broad.mit.edu	37	8	106813908	106813908	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:106813908G>C	ENST00000407775.2	+	8	1848	c.1598G>C	c.(1597-1599)aGt>aCt	p.S533T	ZFPM2_ENST00000517361.1_Missense_Mutation_p.S401T|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Missense_Mutation_p.S264T|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.S401T|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	533					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S533T(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CATGGCAGTAGTAGCTACCCT	0.453																																							uc003ymd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)	5						c.(1597-1599)AGT>ACT		zinc finger protein, multitype 2							85.0	88.0	87.0					8																	106813908		1946	4130	6076	SO:0001583	missense	23414				blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding	g.chr8:106813908G>C	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1598G>C	8.37:g.106813908G>C	ENSP00000384179:p.Ser533Thr					ZFPM2_uc011lhs.1_Missense_Mutation_p.S264T	p.S533T	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)		8	1621	+			533					Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	c.1598G>C	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.781497	0.31502	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.20069	2.1;2.58;2.58;3.76	5.97	5.1	0.69264	.	0.084813	0.85682	D	0.000000	T	0.13329	0.0323	N	0.19112	0.55	0.42626	D	0.993362	B	0.27791	0.189	B	0.22386	0.039	T	0.07481	-1.0770	10	0.51188	T	0.08	.	9.6989	0.40173	0.2075:0.0:0.7925:0.0	.	533	Q8WW38	FOG2_HUMAN	T	533;401;401;264	ENSP00000384179:S533T;ENSP00000430757:S401T;ENSP00000428720:S401T;ENSP00000367733:S264T	ENSP00000367733:S264T	S	+	2	0	ZFPM2	106883084	1.000000	0.71417	0.978000	0.43139	0.959000	0.62525	4.128000	0.57951	1.536000	0.49237	0.655000	0.94253	AGT		0.453	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			41	177	0	0	0	0.007835	0	41	177				
CSMD3	114788	broad.mit.edu	37	8	113649205	113649205	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:113649205C>A	ENST00000297405.5	-	22	3800	c.3556G>T	c.(3556-3558)Ggc>Tgc	p.G1186C	CSMD3_ENST00000455883.2_Missense_Mutation_p.G1082C|CSMD3_ENST00000352409.3_Missense_Mutation_p.G1186C|CSMD3_ENST00000343508.3_Missense_Mutation_p.G1146C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1186	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G1146C(1)|p.G1186C(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGAGGAATGCCAGGATCTTCA	0.423										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(3556-3558)GGC>TGC		CUB and Sushi multiple domains 3 isoform 1							170.0	153.0	159.0					8																	113649205		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113649205C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3556G>T	8.37:g.113649205C>A	ENSP00000297405:p.Gly1186Cys	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.G458C|CSMD3_uc003ynt.2_Missense_Mutation_p.G1146C|CSMD3_uc011lhx.1_Missense_Mutation_p.G1082C	p.G1186C	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			22	3715	-			1186			Sushi 6.|Extracellular (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.3556G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.882471	0.91740	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.56	5.56	0.83823	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.88474	0.6446	H	0.98849	4.35	0.54753	D	0.999982	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92404	0.5932	10	0.56958	D	0.05	.	19.5386	0.95266	0.0:1.0:0.0:0.0	.	1082;1186;1146	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	C	1146;1186;526;1082;1186	ENSP00000345799:G1146C;ENSP00000297405:G1186C;ENSP00000341558:G526C;ENSP00000412263:G1082C;ENSP00000343124:G1186C	ENSP00000297405:G1186C	G	-	1	0	CSMD3	113718381	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.610000	0.88304	0.650000	0.86243	GGC		0.423	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		20	136	1	0	4.35082e-09	0.010504	6.02222e-09	20	136				
TRPS1	7227	broad.mit.edu	37	8	116426738	116426738	+	Missense_Mutation	SNP	G	G	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:116426738G>C	ENST00000220888.5	-	6	3518	c.3359C>G	c.(3358-3360)tCc>tGc	p.S1120C	TRPS1_ENST00000519076.1_Missense_Mutation_p.S874C|TRPS1_ENST00000520276.1_Missense_Mutation_p.S1124C|TRPS1_ENST00000395715.3_Missense_Mutation_p.S1133C			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1120	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S1133C(1)|p.S1120C(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CCCAGGAACGGAGAGCTTATA	0.458									Langer-Giedion syndrome																														uc003ynz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(3358-3360)TCC>TGC		zinc finger transcription factor TRPS1							92.0	89.0	90.0					8																	116426738		1932	4143	6075	SO:0001583	missense	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116426738G>C	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3359C>G	8.37:g.116426738G>C	ENSP00000220888:p.Ser1120Cys					TRPS1_uc011lhy.1_Missense_Mutation_p.S1124C|TRPS1_uc003yny.2_Missense_Mutation_p.S1133C|TRPS1_uc010mcy.2_Missense_Mutation_p.S1120C	p.S1120C	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		6	3818	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		1120			Mediates interaction with RNF4 (By similarity).		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37	c.3359C>G		.	.	.	.	.	.	.	.	.	.	G	15.74	2.922233	0.52653	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	D;D;D;D	0.98876	-5.2;-5.17;-5.13;-5.18	5.72	5.72	0.89469	.	0.061993	0.64402	D	0.000002	D	0.97932	0.9320	N	0.19112	0.55	0.80722	D	1	D;D;D	0.63880	0.993;0.988;0.993	P;P;P	0.58873	0.8;0.707;0.847	D	0.99835	1.1057	10	0.87932	D	0	.	19.865	0.96801	0.0:0.0:1.0:0.0	.	1124;1120;1133	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	C	1133;1120;874;1124	ENSP00000379065:S1133C;ENSP00000220888:S1120C;ENSP00000428910:S874C;ENSP00000428680:S1124C	ENSP00000220888:S1120C	S	-	2	0	TRPS1	116495914	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	9.069000	0.93967	2.685000	0.91497	0.655000	0.94253	TCC		0.458	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		3	30	0	0	0	0.004672	0	3	30				
SLC30A8	169026	broad.mit.edu	37	8	118159363	118159363	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:118159363G>T	ENST00000456015.2	+	2	242	c.242G>T	c.(241-243)tGc>tTc	p.C81F	SLC30A8_ENST00000519688.1_Missense_Mutation_p.C32F|SLC30A8_ENST00000521243.1_Missense_Mutation_p.C32F|SLC30A8_ENST00000427715.2_Missense_Mutation_p.C32F	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	81					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.C81F(1)		breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TCAGCAATATGCTTCATTTTC	0.468																																					Ovarian(162;1202 1922 6011 16223 52092)	Ovarian(162;1202 1922 6011 16223 52092)	uc003yoh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(241-243)TGC>TTC		solute carrier family 30 member 8							167.0	139.0	148.0					8																	118159363		2203	4300	6503	SO:0001583	missense	169026				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity	g.chr8:118159363G>T		CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.242G>T	8.37:g.118159363G>T	ENSP00000415011:p.Cys81Phe					SLC30A8_uc010mcz.2_Missense_Mutation_p.C32F|SLC30A8_uc011lia.1_Missense_Mutation_p.C32F|SLC30A8_uc003yog.2_Missense_Mutation_p.C32F	p.C81F	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	STAD - Stomach adenocarcinoma(47;0.203)		2	472	+	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		81			Helical; (Potential).		A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	ENST00000456015.2	37	c.242G>T	CCDS6322.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605564	0.87157	.	.	ENSG00000164756	ENST00000521243;ENST00000524274;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.83746	0.5321	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86382	0.1730	10	0.87932	D	0	-13.2729	18.704	0.91631	0.0:0.0:1.0:0.0	.	81	Q8IWU4	ZNT8_HUMAN	F	32;32;32;32;81	ENSP00000428545:C32F;ENSP00000427760:C32F;ENSP00000407505:C32F;ENSP00000431069:C32F;ENSP00000415011:C81F	ENSP00000407505:C32F	C	+	2	0	SLC30A8	118228544	1.000000	0.71417	0.666000	0.29783	0.818000	0.46254	8.919000	0.92770	2.749000	0.94314	0.655000	0.94253	TGC		0.468	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	NM_173851		19	42	1	0	5.3912e-06	0.006122	6.56525e-06	19	42				
MED30	90390	broad.mit.edu	37	8	118540906	118540906	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:118540906C>G	ENST00000297347.3	+	2	358	c.194C>G	c.(193-195)aCt>aGt	p.T65S	MED30_ENST00000522839.1_Missense_Mutation_p.T65S	NM_080651.2	NP_542382.1	Q96HR3	MED30_HUMAN	mediator complex subunit 30	65					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.T65S(1)		kidney(1)|lung(3)|prostate(3)	7	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		STAD - Stomach adenocarcinoma(47;0.0266)			AATGGTGTCACTTACCACACT	0.338																																					Melanoma(81;817 1341 9674 26244 29255)	Melanoma(81;817 1341 9674 26244 29255)	uc003yoj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(193-195)ACT>AGT		TRAP/Mediator complex component TRAP25							102.0	98.0	99.0					8																	118540906		2203	4300	6503	SO:0001583	missense	90390				androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr8:118540906C>G	AY083305	CCDS6323.1, CCDS64959.1	8q24.11	2007-07-30	2007-07-30	2007-07-30	ENSG00000164758	ENSG00000164758			23032	protein-coding gene	gene with protein product		610237	"""thyroid hormone receptor associated protein 6"""	THRAP6			Standard	NM_080651		Approved	TRAP25	uc003yoj.3	Q96HR3	OTTHUMG00000164920	ENST00000297347.3:c.194C>G	8.37:g.118540906C>G	ENSP00000297347:p.Thr65Ser					MED30_uc011lib.1_Missense_Mutation_p.T65S	p.T65S	NM_080651	NP_542382	Q96HR3	MED30_HUMAN	STAD - Stomach adenocarcinoma(47;0.0266)		2	345	+	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		65					C6GKU9	Missense_Mutation	SNP	ENST00000297347.3	37	c.194C>G	CCDS6323.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119803	0.77323	.	.	ENSG00000164758	ENST00000297347;ENST00000522839	.	.	.	5.72	5.72	0.89469	Mediator complex, subunit Med30, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.59280	0.2182	L	0.53249	1.67	0.80722	D	1	B;B	0.33883	0.047;0.43	B;B	0.31869	0.033;0.137	T	0.56105	-0.8034	9	0.27785	T	0.31	-4.4473	18.8767	0.92341	0.0:1.0:0.0:0.0	.	65;65	C6GKU9;Q96HR3	.;MED30_HUMAN	S	65	.	ENSP00000297347:T65S	T	+	2	0	MED30	118610087	1.000000	0.71417	0.990000	0.47175	0.714000	0.41099	7.433000	0.80362	2.700000	0.92200	0.563000	0.77884	ACT		0.338	MED30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380923.1	NM_080651		14	27	0	0	0	0.001855	0	14	27				
FER1L6	654463	broad.mit.edu	37	8	125072897	125072897	+	Nonsense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:125072897C>T	ENST00000522917.1	+	24	3300	c.3094C>T	c.(3094-3096)Cag>Tag	p.Q1032*	FER1L6-AS2_ENST00000601180.1_RNA|FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Nonsense_Mutation_p.Q1032*	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1032						integral component of membrane (GO:0016021)		p.Q1032*(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CTGCGTGATCCAGAGCTACAA	0.547																																							uc003yqw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(3094-3096)CAG>TAG		fer-1-like 6							146.0	132.0	137.0					8																	125072897		2203	4300	6503	SO:0001587	stop_gained	654463					integral to membrane		g.chr8:125072897C>T	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3094C>T	8.37:g.125072897C>T	ENSP00000428280:p.Gln1032*					uc003yqy.1_RNA	p.Q1032*	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		24	3300	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		1032			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000522917.1	37	c.3094C>T	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	C	44	11.035861	0.99506	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-17.2589	20.2159	0.98296	0.0:1.0:0.0:0.0	.	.	.	.	X	1032	.	ENSP00000381982:Q1032X	Q	+	1	0	FER1L6	125142078	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.840000	0.62817	2.882000	0.98803	0.655000	0.94253	CAG		0.547	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		11	100	0	0	0	0.013537	0	11	100				
FAM135B	51059	broad.mit.edu	37	8	139165270	139165270	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:139165270C>A	ENST00000395297.1	-	13	1618	c.1448G>T	c.(1447-1449)gGt>gTt	p.G483V		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	483								p.G483V(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CACATTCTCACCTGGCTCTGG	0.388										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)	9						c.(1447-1449)GGT>GTT		hypothetical protein LOC51059							121.0	115.0	117.0					8																	139165270		1931	4141	6072	SO:0001583	missense	51059							g.chr8:139165270C>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1448G>T	8.37:g.139165270C>A	ENSP00000378710:p.Gly483Val	HNSCC(54;0.14)				FAM135B_uc003yux.2_Missense_Mutation_p.G384V|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.G45V|FAM135B_uc003yvb.2_Missense_Mutation_p.G45V	p.G483V	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		13	1619	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		483					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.1448G>T	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	1.920	-0.448659	0.04572	.	.	ENSG00000147724	ENST00000395297	T	0.14391	2.51	5.75	-2.85	0.05734	.	1.942410	0.01884	N	0.038099	T	0.07279	0.0184	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.22983	0.078;0.078;0.013	B;B;B	0.26864	0.074;0.033;0.003	T	0.33445	-0.9868	10	0.28530	T	0.3	0.1273	9.6752	0.40037	0.0:0.5303:0.112:0.3577	.	483;483;483	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	V	483	ENSP00000378710:G483V	ENSP00000276737:G483V	G	-	2	0	FAM135B	139234452	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.120000	0.10660	-1.014000	0.03379	-1.074000	0.02243	GGT		0.388	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		59	75	1	0	3.84483e-29	0.00361	6.44494e-29	59	75				
COL22A1	169044	broad.mit.edu	37	8	139635992	139635992	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:139635992C>G	ENST00000303045.6	-	52	4200	c.3754G>C	c.(3754-3756)Ggt>Cgt	p.G1252R	COL22A1_ENST00000435777.1_Missense_Mutation_p.G1232R|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1252	Collagen-like 12.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G1252C(1)|p.G1252R(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCAGGGGGACCCGGCTTTCCA	0.443										HNSCC(7;0.00092)																													uc003yvd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(11)|pancreas(1)|skin(1)	13						c.(3754-3756)GGT>CGT		collagen, type XXII, alpha 1							190.0	202.0	198.0					8																	139635992		2203	4300	6503	SO:0001583	missense	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139635992C>G	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3754G>C	8.37:g.139635992C>G	ENSP00000303153:p.Gly1252Arg	HNSCC(7;0.00092)				COL22A1_uc011ljo.1_Missense_Mutation_p.G532R	p.G1252R	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		52	4201	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1252			Pro-rich.|Gly-rich.|Collagen-like 12.		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	c.3754G>C	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.334172	0.41297	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.99537	-6.11;-6.11	4.43	4.43	0.53597	.	0.000000	0.49305	U	0.000156	D	0.99792	0.9912	H	0.98721	4.31	0.48830	D	0.99971	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96923	0.9675	10	0.87932	D	0	.	12.8601	0.57908	0.0:1.0:0.0:0.0	.	1232;1252	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	R	1252;1232;945	ENSP00000303153:G1252R;ENSP00000387655:G1232R	ENSP00000303153:G1252R	G	-	1	0	COL22A1	139705174	0.825000	0.29262	0.886000	0.34754	0.699000	0.40488	3.567000	0.53813	2.746000	0.94184	0.591000	0.81541	GGT		0.443	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		138	345	0	0	0	0.00361	0	138	345				
GML	2765	broad.mit.edu	37	8	143927822	143927822	+	Missense_Mutation	SNP	C	C	T	rs375056481		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:143927822C>T	ENST00000220940.1	+	4	283	c.193C>T	c.(193-195)Cgt>Tgt	p.R65C		NM_002066.2	NP_002057.1	Q99445	GML_HUMAN	glycosylphosphatidylinositol anchored molecule like	65	UPAR/Ly6.				apoptotic process (GO:0006915)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of cell proliferation (GO:0008285)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)		p.R65C(1)		NS(1)|central_nervous_system(2)|endometrium(1)|large_intestine(6)|lung(8)	18	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CATAAATTCTCGTGAACTACT	0.343																																							uc003yxg.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(193-195)CGT>TGT		glycosylphosphatidylinositol anchored molecule		C	CYS/ARG	0,4406		0,0,2203	41.0	44.0	43.0		193	3.5	0.0	8		43	1,8599		0,1,4299	no	missense	GML	NM_002066.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	65/159	143927822	1,13005	2203	4300	6503	SO:0001583	missense	2765				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|negative regulation of cell proliferation	anchored to membrane|extrinsic to membrane|plasma membrane		g.chr8:143927822C>T	D84290	CCDS6391.1	8q24.3	2014-05-14	2012-11-02						4375	protein-coding gene	gene with protein product		602370	"""GPI anchored molecule like protein"", ""glycosylphosphatidylinositol anchored molecule like protein"""			8934543, 9169150	Standard	NM_002066		Approved	LY6DL	uc003yxg.3	Q99445		ENST00000220940.1:c.193C>T	8.37:g.143927822C>T	ENSP00000220940:p.Arg65Cys						p.R65C	NM_002066	NP_002057	Q99445	GML_HUMAN			4	283	+	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		65			UPAR/Ly6.		A0AVF6|O00686|O00731	Missense_Mutation	SNP	ENST00000220940.1	37	c.193C>T	CCDS6391.1	.	.	.	.	.	.	.	.	.	.	N	14.66	2.600998	0.46423	0.0	1.16E-4	ENSG00000104499	ENST00000220940	T	0.25085	1.82	3.52	3.52	0.40303	Ly-6 antigen / uPA receptor -like (1);CD59 antigen, conserved site (1);	0.000000	0.40640	N	0.001041	T	0.44891	0.1315	M	0.63843	1.955	0.20821	N	0.999841	D	0.89917	1.0	D	0.91635	0.999	T	0.13548	-1.0505	10	0.87932	D	0	-23.7982	10.8431	0.46728	0.0:1.0:0.0:0.0	.	65	Q99445	GML_HUMAN	C	65	ENSP00000220940:R65C	ENSP00000220940:R65C	R	+	1	0	GML	143924824	0.001000	0.12720	0.045000	0.18777	0.009000	0.06853	0.812000	0.27211	2.258000	0.74832	0.557000	0.71058	CGT		0.343	GML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379659.1	NM_002066		20	47	0	0	0	0.007413	0	20	47				
ZC3H3	23144	broad.mit.edu	37	8	144522481	144522481	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:144522481G>A	ENST00000262577.5	-	11	2576	c.2545C>T	c.(2545-2547)Ctc>Ttc	p.L849F		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	849					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.L849F(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			GCCGCAGTGAGGGCAGCCGAG	0.692																																							uc003yyd.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(2545-2547)CTC>TTC		zinc finger CCCH-type containing 3							11.0	16.0	14.0					8																	144522481		2187	4277	6464	SO:0001583	missense	23144				mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding	g.chr8:144522481G>A	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2545C>T	8.37:g.144522481G>A	ENSP00000262577:p.Leu849Phe						p.L849F	NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)		11	2574	-	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		849					Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	c.2545C>T	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.300528	0.23650	.	.	ENSG00000014164	ENST00000262577	T	0.50813	0.73	3.97	-0.00717	0.14010	.	0.711001	0.13093	N	0.414355	T	0.25158	0.0611	N	0.19112	0.55	0.09310	N	1	P	0.36144	0.539	B	0.25291	0.059	T	0.06734	-1.0810	10	0.48119	T	0.1	-4.3915	7.8481	0.29437	0.5097:0.0:0.4903:0.0	.	849	Q8IXZ2	ZC3H3_HUMAN	F	849	ENSP00000262577:L849F	ENSP00000262577:L849F	L	-	1	0	ZC3H3	144593624	0.007000	0.16637	0.000000	0.03702	0.004000	0.04260	-0.097000	0.11042	-0.093000	0.12396	0.467000	0.42956	CTC		0.692	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117		3	16	0	0	0	0.004672	0	3	16				
KDM4C	23081	broad.mit.edu	37	9	6814718	6814718	+	Silent	SNP	A	A	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:6814718A>T	ENST00000381309.3	+	4	973	c.408A>T	c.(406-408)gcA>gcT	p.A136A	KDM4C_ENST00000543771.1_Silent_p.A136A|KDM4C_ENST00000536108.1_Intron|KDM4C_ENST00000401787.3_Silent_p.A136A|KDM4C_ENST00000535193.1_Silent_p.A158A|KDM4C_ENST00000381306.3_Silent_p.A136A|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000442236.2_5'UTR	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	136					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)	p.A136A(2)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						TCTATGGTGCAGATATTAATG	0.353																																							uc003zkh.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(406-408)GCA>GCT		jumonji domain containing 2C isoform 1							128.0	127.0	127.0					9																	6814718		2203	4300	6503	SO:0001819	synonymous_variant	23081				positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr9:6814718A>T	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.408A>T	9.37:g.6814718A>T						KDM4C_uc010mhu.2_Silent_p.A158A|KDM4C_uc010mhw.2_Silent_p.A136A|KDM4C_uc011lmi.1_Silent_p.A136A|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Silent_p.A136A|KDM4C_uc011lmk.1_5'UTR|KDM4C_uc010mhv.2_Silent_p.A136A	p.A136A	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN			4	988	+			136					B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Silent	SNP	ENST00000381309.3	37	c.408A>T	CCDS6471.1																																																																																				0.353	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061		4	35	0	0	0	0.000602	0	4	35				
PTPRD	5789	broad.mit.edu	37	9	8528593	8528594	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:8528593_8528594GA>TT	ENST00000381196.4	-	12	1081_1082	c.538_539TC>AA	c.(538-540)TCa>AAa	p.S180K	PTPRD_ENST00000397606.3_Missense_Mutation_p.S180K|PTPRD_ENST00000355233.5_Missense_Mutation_p.S180K|PTPRD_ENST00000356435.5_Missense_Mutation_p.S180K|PTPRD_ENST00000360074.4_Missense_Mutation_p.S180K|PTPRD_ENST00000486161.1_Missense_Mutation_p.S180K|PTPRD_ENST00000397611.3_Missense_Mutation_p.S180K|PTPRD_ENST00000358503.5_Missense_Mutation_p.S180K|PTPRD_ENST00000540109.1_Missense_Mutation_p.S180K|PTPRD_ENST00000463477.1_Missense_Mutation_p.S180K|PTPRD_ENST00000397617.3_Missense_Mutation_p.S180K|PTPRD_ENST00000537002.1_Missense_Mutation_p.S180K	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	180	Ig-like C2-type 2.|Interaction with IL1RAPL1. {ECO:0000250}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.S180K(4)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GACCCTACCTGATCGTAACTGC	0.327										TSP Lung(15;0.13)																													uc003zkk.2		NA																	4	Substitution - Missense(4)		lung(4)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(538-540)TCA>AAA		protein tyrosine phosphatase, receptor type, D																																				SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8528593_8528594GA>TT	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.538_539delinsTT	9.37:g.8528593_8528594delinsTT	ENSP00000370593:p.Ser180Lys	TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Missense_Mutation_p.S180K|PTPRD_uc003zkq.2_Missense_Mutation_p.S180K|PTPRD_uc003zkr.2_Missense_Mutation_p.S180K|PTPRD_uc003zks.2_Missense_Mutation_p.S180K|PTPRD_uc003zkl.2_Missense_Mutation_p.S180K|PTPRD_uc003zkm.2_Missense_Mutation_p.S180K|PTPRD_uc003zkn.2_Missense_Mutation_p.S180K|PTPRD_uc003zko.2_Missense_Mutation_p.S180K|PTPRD_uc003zkt.1_Missense_Mutation_p.S180K	p.S180K	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	14	1249_1250	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	180			Extracellular (Potential).|Ig-like C2-type 2.		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	DNP	ENST00000381196.4	37	c.538_539TC>AA	CCDS43786.1																																																																																				0.327	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			14	106	0	0	0	0.004672	0	14	106				
IFNA17	3451	broad.mit.edu	37	9	21227612	21227612	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:21227612C>A	ENST00000413767.2	-	1	609	c.561G>T	c.(559-561)agG>agT	p.R187S		NM_021268.2	NP_067091.1	P01571	IFN17_HUMAN	interferon, alpha 17	187					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.R187S(1)		breast(1)|endometrium(2)|lung(4)|ovary(1)|skin(1)	9				Lung(24;2.13e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		TTCAATCCTTCCTCCTTAATA	0.373																																							uc003zos.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(559-561)AGG>AGT		interferon, alpha 17 precursor							101.0	127.0	118.0					9																	21227612		2201	4300	6501	SO:0001583	missense	3451				blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding	g.chr9:21227612C>A		CCDS6500.1	9p22	2010-12-10			ENSG00000234829	ENSG00000234829		"""Interferons"""	5422	protein-coding gene	gene with protein product		147583				1385305	Standard	NM_021268		Approved	LEIF2C1, IFN-alphaI	uc003zos.1	P01571	OTTHUMG00000019667	ENST00000413767.2:c.561G>T	9.37:g.21227612C>A	ENSP00000411940:p.Arg187Ser					IFNA14_uc003zoo.1_Intron	p.R187S	NM_021268	NP_067091	P01571	IFN17_HUMAN		Lung(24;2.13e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)	1	610	-			187					Q14639|Q4KMT4|Q5VZ53|Q7M4Q4	Missense_Mutation	SNP	ENST00000413767.2	37	c.561G>T	CCDS6500.1	.	.	.	.	.	.	.	.	.	.	-	0.007	-1.962676	0.00461	.	.	ENSG00000234829	ENST00000413767	T	0.03242	4.0	2.18	-4.36	0.03645	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.674880	0.02852	N	0.129236	T	0.01765	0.0056	N	0.04686	-0.185	0.09310	N	1	B	0.02656	0.0	B	0.15484	0.013	T	0.42515	-0.9447	10	0.08381	T	0.77	.	4.4582	0.11654	0.1871:0.4104:0.0:0.4025	.	187	P01571	IFN17_HUMAN	S	187	ENSP00000411940:R187S	ENSP00000411940:R187S	R	-	3	2	IFNA17	21217612	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-4.398000	0.00240	-2.094000	0.00854	-0.451000	0.05528	AGG		0.373	IFNA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051896.1	NM_021268		24	80	1	0	9.95505e-16	0.002299	1.53611e-15	24	80				
APTX	54840	broad.mit.edu	37	9	32973624	32973624	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:32973624C>G	ENST00000379819.1	-	8	942	c.943G>C	c.(943-945)Ggt>Cgt	p.G315R	APTX_ENST00000436040.2_3'UTR|APTX_ENST00000397172.3_Missense_Mutation_p.G243R|APTX_ENST00000463596.1_Missense_Mutation_p.G301R|APTX_ENST00000379825.2_3'UTR|APTX_ENST00000468275.1_Missense_Mutation_p.G301R|APTX_ENST00000476858.1_Missense_Mutation_p.G261R|APTX_ENST00000309615.3_3'UTR|APTX_ENST00000379817.2_Missense_Mutation_p.G301R|APTX_ENST00000379813.3_Missense_Mutation_p.G301R			Q7Z2E3	APTX_HUMAN	aprataxin	315					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|dephosphorylation (GO:0016311)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA ligation (GO:0006266)|double-strand break repair (GO:0006302)|polynucleotide 3' dephosphorylation (GO:0098506)|regulation of protein stability (GO:0031647)|response to hydrogen peroxide (GO:0042542)|single strand break repair (GO:0000012)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA 5'-adenosine monophosphate hydrolase activity (GO:0033699)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|phosphoglycolate phosphatase activity (GO:0008967)|phosphoprotein binding (GO:0051219)|polynucleotide 3'-phosphatase activity (GO:0046403)|protein N-terminus binding (GO:0047485)	p.G301R(1)		endometrium(1)|lung(1)|ovary(2)|prostate(2)	6			LUSC - Lung squamous cell carcinoma(29;0.0302)	GBM - Glioblastoma multiforme(74;0.105)		GTTACTCTACCAGCCTCTTGT	0.468								Editing and processing nucleases																															uc003zrm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(901-903)GGT>CGT	Direct_reversal_of_damage|Editing_and_processing_nucleases	aprataxin isoform c							90.0	87.0	88.0					9																	32973624		2203	4300	6503	SO:0001583	missense	54840				cell death|double-strand break repair|regulation of protein stability|response to hydrogen peroxide|single strand break repair	chromatin|nucleolus|nucleoplasm	chromatin binding|damaged DNA binding|DNA 5'-adenosine monophosphate hydrolase activity|double-stranded DNA binding|double-stranded RNA binding|phosphoglycolate phosphatase activity|phosphoprotein binding|polynucleotide 3'-phosphatase activity|protein N-terminus binding|zinc ion binding	g.chr9:32973624C>G	AK000164	CCDS47956.1, CCDS56568.1, CCDS75827.1	9p13.3	2014-01-28	2003-04-03		ENSG00000137074	ENSG00000137074			15984	protein-coding gene	gene with protein product		606350	"""ataxia 1, early onset with hypoalbuminemia"""	AXA1		11586299, 11586300	Standard	NM_175069		Approved	FLJ20157, AOA, AOA1, EAOH, EOAHA	uc003zry.3	Q7Z2E3	OTTHUMG00000019759	ENST00000379819.1:c.943G>C	9.37:g.32973624C>G	ENSP00000369147:p.Gly315Arg					APTX_uc010mjm.2_RNA|APTX_uc003zrj.2_Missense_Mutation_p.G213R|APTX_uc011lns.1_Missense_Mutation_p.G122R|APTX_uc003zrl.2_Missense_Mutation_p.G127R|APTX_uc003zrn.2_Missense_Mutation_p.G213R|APTX_uc003zro.2_Missense_Mutation_p.G301R|APTX_uc003zrp.2_Missense_Mutation_p.G213R|APTX_uc003zrq.2_Missense_Mutation_p.G213R|APTX_uc003zrr.2_Missense_Mutation_p.G247R|APTX_uc003zrs.2_Missense_Mutation_p.G301R|APTX_uc003zrt.2_Missense_Mutation_p.G213R|APTX_uc003zru.2_Missense_Mutation_p.G247R|APTX_uc003zrv.2_3'UTR|APTX_uc003zrw.2_Missense_Mutation_p.G229R|APTX_uc003zrx.2_3'UTR|APTX_uc003zry.2_Missense_Mutation_p.G301R|APTX_uc003zrz.2_Missense_Mutation_p.G122R	p.G301R	NM_175072	NP_778242	Q7Z2E3	APTX_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0302)	GBM - Glioblastoma multiforme(74;0.105)	7	1098	-			315					A8MTN4|D3DRK9|D3DRL0|Q0P662|Q5T781|Q5T782|Q5T784|Q6JV81|Q6JV82|Q6JV85|Q7Z2F3|Q7Z336|Q7Z5R5|Q7Z6V7|Q7Z6V8|Q9NXM5	Missense_Mutation	SNP	ENST00000379819.1	37	c.901G>C		.	.	.	.	.	.	.	.	.	.	C	25.8	4.673645	0.88445	.	.	ENSG00000137074	ENST00000397172;ENST00000379817;ENST00000379819;ENST00000468275;ENST00000463596;ENST00000476858;ENST00000344355;ENST00000379813	D;D;D;D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99	5.43	5.43	0.79202	Histidine triad-like motif (1);	0.000000	0.85682	D	0.000000	D	0.96731	0.8933	M	0.90870	3.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	D	0.96183	0.9132	10	0.34782	T	0.22	-12.1754	16.7628	0.85516	0.0:1.0:0.0:0.0	.	243;247;315	Q7Z2E3-3;Q7Z2E3-5;Q7Z2E3	.;.;APTX_HUMAN	R	243;301;315;301;301;261;296;301	ENSP00000380357:G243R;ENSP00000369145:G301R;ENSP00000369147:G315R;ENSP00000420263:G301R;ENSP00000419846:G301R;ENSP00000419042:G261R;ENSP00000369141:G301R	ENSP00000339407:G296R	G	-	1	0	APTX	32963624	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.268000	0.72552	2.546000	0.85860	0.655000	0.94253	GGT		0.468	APTX-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000052028.2	NM_017692		6	42	0	0	0	0.006214	0	6	42				
SPATA31A6	389730	broad.mit.edu	37	9	43625036	43625036	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:43625036C>A	ENST00000332857.6	-	4	3679	c.3651G>T	c.(3649-3651)atG>atT	p.M1217I	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	1217					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.M1217I(1)									GGCAAAGTGACATTTTCTTGT	0.483																																							uc011lrb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3649-3651)ATG>ATT		hypothetical protein LOC389730							32.0	31.0	31.0					9																	43625036		611	1531	2142	SO:0001583	missense	389730					integral to membrane		g.chr9:43625036C>A		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.3651G>T	9.37:g.43625036C>A	ENSP00000329825:p.Met1217Ile						p.M1217I	NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN			4	3680	-			1217						Missense_Mutation	SNP	ENST00000332857.6	37	c.3651G>T	CCDS47973.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.609183	0.00842	.	.	ENSG00000185775	ENST00000332857	T	0.04360	3.64	2.44	-2.55	0.06288	.	0.807708	0.11041	N	0.606111	T	0.03608	0.0103	L	0.39898	1.24	0.09310	N	1	B	0.09022	0.002	B	0.17979	0.02	T	0.46190	-0.9209	10	0.20519	T	0.43	-0.0385	4.2007	0.10464	0.5792:0.2868:0.0:0.134	.	1217	Q5VVP1	F75A6_HUMAN	I	1217	ENSP00000329825:M1217I	ENSP00000329825:M1217I	M	-	3	0	FAM75A6	43565032	0.007000	0.16637	0.000000	0.03702	0.001000	0.01503	0.235000	0.17948	-0.601000	0.05783	-0.932000	0.02703	ATG		0.483	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		75	221	1	0	2.9056e-39	0.00361	4.94165e-39	75	221				
SPATA31D5P	347127	broad.mit.edu	37	9	84531000	84531000	+	RNA	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:84531000G>A	ENST00000527857.1	+	0	1022					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		CTTTTCCGGAGATGTTATCTC	0.488																																							uc011lst.1		NA																	0					0						c.(919-921)GAG>GAA		SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;																																						347127							g.chr9:84531000G>A			9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84531000G>A							p.E307E	NR_026851						4	1022	+									Silent	SNP	ENST00000527857.1	37	c.921G>A																																																																																					0.488	SPATA31D5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000052810.2	NR_026851		3	3	0	0	0	0.004672	0	3	3				
SPATA31D1	389763	broad.mit.edu	37	9	84607070	84607070	+	Missense_Mutation	SNP	C	C	G	rs376833827		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:84607070C>G	ENST00000344803.2	+	4	1732	c.1685C>G	c.(1684-1686)cCc>cGc	p.P562R		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	562					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.P562R(2)									CAACCACTACCCTTGCCTCAA	0.507																																							uc004amn.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1684-1686)CCC>CGC		hypothetical protein LOC389763							136.0	129.0	131.0					9																	84607070		1930	4126	6056	SO:0001583	missense	389763					integral to membrane		g.chr9:84607070C>G		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1685C>G	9.37:g.84607070C>G	ENSP00000341988:p.Pro562Arg						p.P562R	NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN			4	1732	+			562						Missense_Mutation	SNP	ENST00000344803.2	37	c.1685C>G	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	C	8.072	0.770418	0.15983	.	.	ENSG00000214929	ENST00000344803	T	0.09255	3.0	3.57	1.66	0.24008	.	1.468830	0.04208	N	0.331244	T	0.30916	0.0780	M	0.72118	2.19	0.09310	N	1	D	0.76494	0.999	D	0.78314	0.991	T	0.03576	-1.1023	10	0.62326	D	0.03	0.2617	5.7149	0.17954	0.0:0.7387:0.0:0.2613	.	562	Q6ZQQ2	F75D1_HUMAN	R	562	ENSP00000341988:P562R	ENSP00000341988:P562R	P	+	2	0	FAM75D1	83796890	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.028000	0.13644	0.316000	0.23135	0.467000	0.42956	CCC		0.507	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670		15	136	0	0	0	0.006122	0	15	136				
S1PR3	1903	broad.mit.edu	37	9	91616365	91616365	+	Missense_Mutation	SNP	T	T	C			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:91616365T>C	ENST00000375846.3	+	1	4945	c.250T>C	c.(250-252)Tgc>Cgc	p.C84R	S1PR3_ENST00000358157.2_Missense_Mutation_p.C84R			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	84					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.C84R(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						CCTGGCTCTCTGCGACCTGCT	0.502											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004aqe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(250-252)TGC>CGC		sphingosine-1-phosphate receptor 3							80.0	82.0	81.0					9																	91616365		2203	4300	6503	SO:0001583	missense	1903				anatomical structure morphogenesis|elevation of cytosolic calcium ion concentration|inflammatory response|positive regulation of cell proliferation	integral to plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity	g.chr9:91616365T>C	AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.250T>C	9.37:g.91616365T>C	ENSP00000365006:p.Cys84Arg		OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1283		p.C84R	NM_005226	NP_005217	Q99500	S1PR3_HUMAN			2	646	+			84			Helical; Name=2; (By similarity).		Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	ENST00000375846.3	37	c.250T>C	CCDS6680.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.510391	0.64522	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.02944	4.1;4.1	5.14	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.051078	0.85682	D	0.000000	T	0.09247	0.0228	L	0.47716	1.5	0.80722	D	1	D	0.69078	0.997	D	0.68621	0.959	T	0.02275	-1.1184	10	0.87932	D	0	.	11.0168	0.47693	0.0:0.073:0.0:0.927	.	84	Q99500	S1PR3_HUMAN	R	84	ENSP00000350878:C84R;ENSP00000365006:C84R	ENSP00000350878:C84R	C	+	1	0	S1PR3	90806185	1.000000	0.71417	0.965000	0.40720	0.986000	0.74619	7.726000	0.84824	0.967000	0.38186	0.459000	0.35465	TGC		0.502	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2	NM_005226		8	70	0	0	0	0.004482	0	8	70				
TMEFF1	8577	broad.mit.edu	37	9	103261150	103261150	+	Silent	SNP	A	A	G	rs150250818		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:103261150A>G	ENST00000374879.4	+	2	732	c.300A>G	c.(298-300)caA>caG	p.Q100Q	MSANTD3-TMEFF1_ENST00000502978.1_Missense_Mutation_p.I64V|TMEFF1_ENST00000334943.6_Silent_p.Q61Q	NM_003692.4	NP_003683.2	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 1	100	Kazal-like 1. {ECO:0000255|PROSITE- ProRule:PRU00798}.				multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q100Q(1)		NS(1)|kidney(1)|large_intestine(7)|lung(9)|stomach(1)	19		Acute lymphoblastic leukemia(62;0.0452)				GTGCATGCCAATTTCAGGTGA	0.338																																							uc004baz.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(298-300)CAA>CAG		transmembrane protein with EGF-like and two		A	,	0,4406		0,0,2203	115.0	111.0	113.0		522,300	-3.1	1.0	9	dbSNP_134	113	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TMEFF1,C9orf30-TMEFF1	NM_001198812.1,NM_003692.4	,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,	174/455,100/381	103261150	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8577				multicellular organismal development	integral to membrane|plasma membrane		g.chr9:103261150A>G	U19878	CCDS6750.1	9q31	2010-05-04			ENSG00000241697	ENSG00000241697			11866	protein-coding gene	gene with protein product	"""tomoregulin-1"", ""cancer/testis antigen family 120, member 1"""	603421		C9orf2		9730596	Standard	NM_003692		Approved	H7365, CT120.1		Q8IYR6	OTTHUMG00000020367	ENST00000374879.4:c.300A>G	9.37:g.103261150A>G						TMEFF1_uc004bay.1_Silent_p.Q174Q	p.Q100Q	NM_003692	NP_003683	Q8IYR6	TEFF1_HUMAN			2	410	+		Acute lymphoblastic leukemia(62;0.0452)	100			Kazal-like 1.|Extracellular (Potential).		Q13086|Q8N3T8	Silent	SNP	ENST00000374879.4	37	c.300A>G	CCDS6750.1	.	.	.	.	.	.	.	.	.	.	A	8.902	0.956544	0.18507	0.0	1.16E-4	ENSG00000251349	ENST00000502978	.	.	.	5.75	-3.11	0.05299	.	.	.	.	.	T	0.63189	0.2490	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60999	-0.7151	4	.	.	.	-6.8375	13.5382	0.61657	0.3314:0.0:0.6686:0.0	.	.	.	.	V	64	.	.	I	+	1	0	C9orf30-TMEFF1	102300971	0.005000	0.15991	0.971000	0.41717	0.992000	0.81027	-1.601000	0.02081	-0.691000	0.05135	-0.263000	0.10527	ATT		0.338	TMEFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053418.1	NM_003692		25	37	0	0	0	0.003954	0	25	37				
BAAT	570	broad.mit.edu	37	9	104124972	104124972	+	Missense_Mutation	SNP	T	T	C	rs528729376	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:104124972T>C	ENST00000395051.3	-	3	1065	c.995A>G	c.(994-996)aAc>aGc	p.N332S	BAAT_ENST00000259407.2_Missense_Mutation_p.N332S			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	332					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)	p.N332S(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	TGCTTTGCTGTTGATAGTCTT	0.478													T|||	2	0.000399361	0.0	0.0	5008	,	,		15644	0.0		0.0	False		,,,				2504	0.002						uc010mtd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(994-996)AAC>AGC		bile acid Coenzyme A: amino acid	Glycine(DB00145)						184.0	154.0	164.0					9																	104124972		2203	4300	6503	SO:0001583	missense	570				acyl-CoA metabolic process|bile acid and bile salt transport|bile acid biosynthetic process|digestion|fatty acid metabolic process|glycine metabolic process	cytosol|peroxisomal matrix	carboxylesterase activity|glycine N-choloyltransferase activity|N-acyltransferase activity|palmitoyl-CoA hydrolase activity	g.chr9:104124972T>C	L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.995A>G	9.37:g.104124972T>C	ENSP00000378491:p.Asn332Ser					BAAT_uc004bbd.3_Missense_Mutation_p.N332S	p.N332S	NM_001127610	NP_001121082	Q14032	BAAT_HUMAN			4	1104	-		Acute lymphoblastic leukemia(62;0.0559)	332					Q3B7W9|Q96L31	Missense_Mutation	SNP	ENST00000395051.3	37	c.995A>G	CCDS6752.1	.	.	.	.	.	.	.	.	.	.	T	13.05	2.121433	0.37436	.	.	ENSG00000136881	ENST00000259407;ENST00000395051	T;T	0.39406	1.08;1.08	4.86	2.52	0.30459	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.150098	0.46145	D	0.000313	T	0.57140	0.2033	M	0.80982	2.52	0.09310	N	1	D	0.59767	0.986	P	0.60236	0.871	T	0.50448	-0.8827	10	0.66056	D	0.02	-15.3636	7.5897	0.28015	0.0:0.1775:0.0:0.8225	.	332	Q14032	BAAT_HUMAN	S	332	ENSP00000259407:N332S;ENSP00000378491:N332S	ENSP00000259407:N332S	N	-	2	0	BAAT	103164793	0.517000	0.26226	0.201000	0.23476	0.533000	0.34776	3.346000	0.52190	0.354000	0.24105	0.533000	0.62120	AAC		0.478	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053433.1			5	48	0	0	0	0.000602	0	5	48				
SVEP1	79987	broad.mit.edu	37	9	113168525	113168525	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:113168525G>A	ENST00000401783.2	-	38	9691	c.9355C>T	c.(9355-9357)Ccc>Tcc	p.P3119S	SVEP1_ENST00000297826.5_Missense_Mutation_p.P1045S|SVEP1_ENST00000374469.1_Missense_Mutation_p.P3096S	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3119	Sushi 28. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.P3122S(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CAGGACAAGGGCTCACAGACT	0.502																																							uc010mtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)	7						c.(9355-9357)CCC>TCC		polydom							137.0	144.0	142.0					9																	113168525		2006	4165	6171	SO:0001583	missense	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113168525G>A	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.9355C>T	9.37:g.113168525G>A	ENSP00000384917:p.Pro3119Ser					SVEP1_uc010mty.2_Missense_Mutation_p.P1045S	p.P3119S	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN			38	9692	-			3119			Sushi 28.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	c.9355C>T	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022629	0.54683	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.24908	1.83;1.83;1.83	5.69	5.69	0.88448	Complement control module (2);Sushi/SCR/CCP (1);	0.262816	0.39687	N	0.001292	T	0.40473	0.1118	M	0.87758	2.905	0.80722	D	1	D	0.57899	0.981	P	0.52109	0.69	T	0.42965	-0.9420	10	0.09084	T	0.74	.	10.2676	0.43464	0.1463:0.0:0.8537:0.0	.	3119	Q4LDE5	SVEP1_HUMAN	S	3119;3096;1045	ENSP00000384917:P3119S;ENSP00000363593:P3096S;ENSP00000297826:P1045S	ENSP00000297826:P1045S	P	-	1	0	SVEP1	112208346	1.000000	0.71417	0.838000	0.33150	0.889000	0.51656	3.821000	0.55700	2.685000	0.91497	0.655000	0.94253	CCC		0.502	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				44	83	0	0	0	0.009718	0	44	83				
SVEP1	79987	broad.mit.edu	37	9	113261339	113261339	+	Nonsense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:113261339G>A	ENST00000401783.2	-	7	1999	c.1663C>T	c.(1663-1665)Cag>Tag	p.Q555*	SVEP1_ENST00000374461.1_Nonsense_Mutation_p.Q532*|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Nonsense_Mutation_p.Q532*|SVEP1_ENST00000302728.8_Nonsense_Mutation_p.Q555*	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	555	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.Q555*(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ACAGCTGCCTGAACTCCGACA	0.418																																							uc010mtz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(7)	7						c.(1663-1665)CAG>TAG		polydom							58.0	54.0	55.0					9																	113261339		1936	4151	6087	SO:0001587	stop_gained	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113261339G>A	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1663C>T	9.37:g.113261339G>A	ENSP00000384917:p.Gln555*					SVEP1_uc010mua.1_Nonsense_Mutation_p.Q555*|SVEP1_uc004beu.2_Nonsense_Mutation_p.Q555*	p.Q555*	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN			7	2000	-			555			Sushi 3.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Nonsense_Mutation	SNP	ENST00000401783.2	37	c.1663C>T	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	G	42	9.441733	0.99172	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	.	.	.	5.69	5.69	0.88448	.	0.052770	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	18.5816	0.91172	0.0:0.0:1.0:0.0	.	.	.	.	X	555;532;555;532	.	ENSP00000304118:Q555X	Q	-	1	0	SVEP1	112301160	1.000000	0.71417	0.997000	0.53966	0.808000	0.45660	7.002000	0.76304	2.696000	0.92011	0.655000	0.94253	CAG		0.418	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				3	15	0	0	0	0.004672	0	3	15				
TLR4	7099	broad.mit.edu	37	9	120475965	120475965	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:120475965C>A	ENST00000355622.6	+	3	1660	c.1559C>A	c.(1558-1560)tCc>tAc	p.S520Y	TLR4_ENST00000394487.4_Missense_Mutation_p.S480Y|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	520					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.S520Y(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	AACTCACTCTCCAGTCTTCAG	0.433																																							uc004bjz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(1558-1560)TCC>TAC		toll-like receptor 4 precursor							88.0	81.0	83.0					9																	120475965		2203	4300	6503	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120475965C>A	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1559C>A	9.37:g.120475965C>A	ENSP00000363089:p.Ser520Tyr					TLR4_uc004bka.2_Missense_Mutation_p.S480Y|TLR4_uc004bkb.2_Missense_Mutation_p.S320Y	p.S520Y	NM_138554	NP_612564	O00206	TLR4_HUMAN			3	1850	+			520			Extracellular (Potential).		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.1559C>A	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.805126	0.00075	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.01051	5.4;5.4	5.82	-8.86	0.00795	.	2.119070	0.01545	N	0.019422	T	0.01156	0.0038	L	0.58969	1.84	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.50162	-0.8860	10	0.14252	T	0.57	.	1.1286	0.01740	0.239:0.2979:0.1284:0.3347	.	520	O00206	TLR4_HUMAN	Y	480;520	ENSP00000377997:S480Y;ENSP00000363089:S520Y	ENSP00000363089:S520Y	S	+	2	0	TLR4	119515786	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.044000	0.01411	-1.838000	0.01187	-2.032000	0.00423	TCC		0.433	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		17	37	1	0	1.99824e-07	0.00499	2.60106e-07	17	37				
PBX3	5090	broad.mit.edu	37	9	128678003	128678003	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:128678003G>T	ENST00000373489.5	+	3	329	c.313G>T	c.(313-315)Gat>Tat	p.D105Y	PBX3_ENST00000447726.2_Missense_Mutation_p.D30Y|PBX3_ENST00000373483.2_Intron|PBX3_ENST00000538998.1_3'UTR|PBX3_ENST00000373487.4_Missense_Mutation_p.D105Y|PBX3_ENST00000342287.5_Missense_Mutation_p.D105Y	NM_006195.5	NP_006186.1	P40426	PBX3_HUMAN	pre-B-cell leukemia homeobox 3	105					adult locomotory behavior (GO:0008344)|anterior compartment pattern formation (GO:0007387)|dorsal spinal cord development (GO:0021516)|neuron development (GO:0048666)|posterior compartment specification (GO:0007388)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D105Y(1)		biliary_tract(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)	24						GGACCCTCCCGATCCCCAGCT	0.557																																							uc004bqb.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(313-315)GAT>TAT		pre-B-cell leukemia homeobox 3 isoform 1							44.0	46.0	45.0					9																	128678003		2203	4300	6503	SO:0001583	missense	5090				anterior compartment pattern formation|posterior compartment specification		sequence-specific DNA binding transcription factor activity	g.chr9:128678003G>T		CCDS6865.1, CCDS48021.1	9q33.3	2011-06-20	2007-01-30		ENSG00000167081	ENSG00000167081		"""Homeoboxes / TALE class"""	8634	protein-coding gene	gene with protein product		176312	"""pre-B-cell leukemia transcription factor 3"""			1682799	Standard	NM_006195		Approved		uc004bqb.3	P40426	OTTHUMG00000020684	ENST00000373489.5:c.313G>T	9.37:g.128678003G>T	ENSP00000362588:p.Asp105Tyr					PBX3_uc004bqc.2_Intron|PBX3_uc004bqd.2_Intron|PBX3_uc011lzw.1_Missense_Mutation_p.D30Y|PBX3_uc011lzx.1_Missense_Mutation_p.D16Y|PBX3_uc004bqe.2_5'UTR	p.D105Y	NM_006195	NP_006186	P40426	PBX3_HUMAN			3	429	+			105					E9PB27|Q5JSA0|Q5JSA1|Q5VXL3|Q96PF9|Q96PG0	Missense_Mutation	SNP	ENST00000373489.5	37	c.313G>T	CCDS6865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.086651|4.086651	0.76642|0.76642	.|.	.|.	ENSG00000167081|ENSG00000167081	ENST00000373489;ENST00000342287;ENST00000373487;ENST00000447726;ENST00000538998|ENST00000428092	T;T;T;T;T|.	0.39056|.	1.1;1.1;1.1;1.1;1.1|.	5.87|5.87	5.87|5.87	0.94306|0.94306	PBX (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84714|0.84714	0.5533|0.5533	M|M	0.87269|0.87269	2.87|2.87	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.993;0.999|.	D|D	0.84947|0.84947	0.0869|0.0869	10|5	0.87932|.	D|.	0|.	.|.	20.5827|20.5827	0.99408|0.99408	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	16;105|.	B7Z5Q0;P40426|.	.;PBX3_HUMAN|.	Y|L	105;105;105;30;16|25	ENSP00000362588:D105Y;ENSP00000341990:D105Y;ENSP00000362586:D105Y;ENSP00000387456:D30Y;ENSP00000444005:D16Y|.	ENSP00000341990:D105Y|.	D|R	+|+	1|2	0|0	PBX3|PBX3	127717824|127717824	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.420000|9.420000	0.97426|0.97426	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAT|CGA		0.557	PBX3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417765.1			8	39	1	0	1.06961e-07	0.00308	1.41068e-07	8	39				
ADAMTS13	11093	broad.mit.edu	37	9	136321309	136321309	+	Silent	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:136321309C>T	ENST00000371929.3	+	26	4131	c.3687C>T	c.(3685-3687)gtC>gtT	p.V1229V	ADAMTS13_ENST00000355699.2_Silent_p.V1173V|ADAMTS13_ENST00000356589.2_Silent_p.V1142V|ADAMTS13_ENST00000371910.1_Silent_p.V25V|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000485925.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	1229	CUB 1.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1229V(1)		central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCCTCCGCGTCCTTGAGAGTT	0.632																																							uc004cdv.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6						c.(3685-3687)GTC>GTT		ADAM metallopeptidase with thrombospondin type 1							63.0	57.0	59.0					9																	136321309		2203	4300	6503	SO:0001819	synonymous_variant	11093				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr9:136321309C>T	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.3687C>T	9.37:g.136321309C>T						ADAMTS13_uc004cdp.3_Silent_p.V400V|ADAMTS13_uc004cdt.1_Silent_p.V1173V|ADAMTS13_uc004cdu.1_Silent_p.V1142V|ADAMTS13_uc004cdw.3_Silent_p.V1173V|ADAMTS13_uc004cdx.3_Silent_p.V1142V|ADAMTS13_uc004cdz.3_Silent_p.V899V|ADAMTS13_uc004cea.1_Silent_p.V25V|ADAMTS13_uc004ceb.3_Silent_p.V25V	p.V1229V	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)	26	4131	+			1229			CUB 1.		Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Silent	SNP	ENST00000371929.3	37	c.3687C>T	CCDS6970.1																																																																																				0.632	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025		10	45	0	0	0	0.008291	0	10	45				
GPSM1	26086	broad.mit.edu	37	9	139250962	139250962	+	Missense_Mutation	SNP	A	A	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:139250962A>G	ENST00000440944.1	+	13	2001	c.1781A>G	c.(1780-1782)gAg>gGg	p.E594G	GPSM1_ENST00000392944.1_Missense_Mutation_p.E85G|GPSM1_ENST00000429455.1_Missense_Mutation_p.E85G	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	594					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)	p.E571G(1)		biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		GAGCCCCAGGAGCCGGGGGAC	0.706																																							uc004chd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1780-1782)GAG>GGG		G-protein signaling modulator 1 (AGS3-like, C.							24.0	33.0	30.0					9																	139250962		2192	4297	6489	SO:0001583	missense	26086				cell differentiation|nervous system development|signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|plasma membrane	binding|GTPase activator activity	g.chr9:139250962A>G	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1781A>G	9.37:g.139250962A>G	ENSP00000392828:p.Glu594Gly					GPSM1_uc011mdu.1_Missense_Mutation_p.E85G|GPSM1_uc004che.2_Missense_Mutation_p.E85G	p.E594G	NM_001145638	NP_001139110	Q86YR5	GPSM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)	13	2001	+		Myeloproliferative disorder(178;0.0821)	594					A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Missense_Mutation	SNP	ENST00000440944.1	37	c.1781A>G	CCDS48055.1	.	.	.	.	.	.	.	.	.	.	A	18.14	3.556917	0.65425	.	.	ENSG00000160360	ENST00000440944;ENST00000354753;ENST00000429455;ENST00000392944;ENST00000291775	D;D	0.91792	-2.91;-2.9	5.2	4.04	0.47022	.	0.000000	0.85682	D	0.000000	D	0.94742	0.8303	M	0.66297	2.02	0.58432	D	0.999992	D	0.89917	1.0	D	0.87578	0.998	D	0.94023	0.7294	10	0.62326	D	0.03	-33.2459	11.1536	0.48473	0.8451:0.1549:0.0:0.0	.	594	Q86YR5	GPSM1_HUMAN	G	594;571;85;85;85	ENSP00000392828:E594G;ENSP00000346797:E571G	ENSP00000291775:E85G	E	+	2	0	GPSM1	138370783	1.000000	0.71417	1.000000	0.80357	0.216000	0.24613	6.889000	0.75627	0.792000	0.33850	0.379000	0.24179	GAG		0.706	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597		4	36	0	0	0	0.001984	0	4	36				
EHMT1	79813	broad.mit.edu	37	9	140611370	140611370	+	Missense_Mutation	SNP	C	C	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:140611370C>G	ENST00000460843.1	+	3	405	c.378C>G	c.(376-378)atC>atG	p.I126M	EHMT1_ENST00000334856.6_Missense_Mutation_p.I95M|EHMT1_ENST00000462484.1_Missense_Mutation_p.I126M|EHMT1_ENST00000371394.2_3'UTR	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	126					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.I126M(1)|p.I95M(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		ACGGATACATCTTAAATAAGC	0.547																																							uc011mfc.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|pancreas(1)	3						c.(376-378)ATC>ATG		euchromatic histone-lysine N-methyltransferase 1							75.0	82.0	80.0					9																	140611370		2202	4300	6502	SO:0001583	missense	79813				DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding	g.chr9:140611370C>G	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.378C>G	9.37:g.140611370C>G	ENSP00000417980:p.Ile126Met					EHMT1_uc004coa.2_Missense_Mutation_p.I126M|EHMT1_uc004cob.1_Missense_Mutation_p.I95M	p.I126M	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)	3	415	+	all_cancers(76;0.164)		126					B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	ENST00000460843.1	37	c.378C>G	CCDS7050.2	.	.	.	.	.	.	.	.	.	.	c	12.04	1.817588	0.32145	.	.	ENSG00000181090	ENST00000334856;ENST00000371400;ENST00000462484;ENST00000460843	T;T;T	0.72505	1.41;0.64;-0.66	6.0	5.11	0.69529	.	0.213958	0.40728	N	0.001024	T	0.75369	0.3840	L	0.50333	1.59	0.21697	N	0.999584	P;P;D	0.56521	0.668;0.898;0.976	P;P;P	0.59424	0.448;0.754;0.857	T	0.68062	-0.5508	10	0.62326	D	0.03	.	9.368	0.38237	0.0:0.743:0.0:0.257	.	126;95;126	Q9H9B1;Q9H9B1-2;Q9H9B1-4	EHMT1_HUMAN;.;.	M	95;95;126;126	ENSP00000334476:I95M;ENSP00000417328:I126M;ENSP00000417980:I126M	ENSP00000334476:I95M	I	+	3	3	EHMT1	139731191	1.000000	0.71417	0.155000	0.22561	0.005000	0.04900	1.986000	0.40677	1.572000	0.49736	0.639000	0.83563	ATC		0.547	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757		13	64	0	0	0	0.003163	0	13	64				
ARSF	416	broad.mit.edu	37	X	2998960	2998960	+	Silent	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:2998960C>A	ENST00000381127.1	+	5	533	c.312C>A	c.(310-312)gtC>gtA	p.V104V	ARSF_ENST00000537104.1_Silent_p.V104V|ARSF_ENST00000359361.2_Silent_p.V104V	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	104					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.V104V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATAGACGTGTCATCCAAAATC	0.428																																							uc004cre.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(310-312)GTC>GTA		arylsulfatase F precursor							94.0	77.0	83.0					X																	2998960		2203	4300	6503	SO:0001819	synonymous_variant	416					extracellular region	arylsulfatase activity|metal ion binding	g.chrX:2998960C>A	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.312C>A	X.37:g.2998960C>A						ARSF_uc004crf.1_Silent_p.V104V	p.V104V	NM_004042	NP_004033	P54793	ARSF_HUMAN			5	533	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	104					Q8TCC5	Silent	SNP	ENST00000381127.1	37	c.312C>A	CCDS14123.1																																																																																				0.428	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1			14	13	1	0	2.32078e-09	0.003163	3.22511e-09	14	13				
NLGN4X	57502	broad.mit.edu	37	X	5827164	5827164	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:5827164C>A	ENST00000381095.3	-	4	1369	c.742G>T	c.(742-744)Gtg>Ttg	p.V248L	NLGN4X_ENST00000381092.1_Missense_Mutation_p.V248L|NLGN4X_ENST00000275857.6_Missense_Mutation_p.V248L|NLGN4X_ENST00000381093.2_Missense_Mutation_p.V268L|NLGN4X_ENST00000538097.1_Missense_Mutation_p.V248L	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	248					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.V248L(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						AAGATGGTCACTCTCTTGGGG	0.592																																							uc010ndh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(742-744)GTG>TTG		X-linked neuroligin 4 precursor							77.0	70.0	72.0					X																	5827164		2203	4300	6503	SO:0001583	missense	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5827164C>A	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.742G>T	X.37:g.5827164C>A	ENSP00000370485:p.Val248Leu					NLGN4X_uc004crp.2_Missense_Mutation_p.V268L|NLGN4X_uc004crq.2_Missense_Mutation_p.V248L|NLGN4X_uc010ndi.2_Missense_Mutation_p.V285L|NLGN4X_uc004crr.2_Missense_Mutation_p.V248L|NLGN4X_uc010ndj.2_Missense_Mutation_p.V248L	p.V248L	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN			4	1243	-			248			Extracellular (Potential).		Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	c.742G>T	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489188	0.64074	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97	3.48	3.48	0.39840	Carboxylesterase, type B (1);	.	.	.	.	D	0.88089	0.6343	H	0.94542	3.55	0.58432	D	0.999999	D;P;D	0.71674	0.998;0.891;0.997	P;P;P	0.62382	0.901;0.521;0.88	D	0.91572	0.5272	9	0.87932	D	0	.	13.8719	0.63624	0.0:1.0:0.0:0.0	.	305;248;268	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	L	248;268;248;248;248	ENSP00000370485:V248L;ENSP00000370483:V268L;ENSP00000275857:V248L;ENSP00000370482:V248L;ENSP00000439203:V248L	ENSP00000275857:V248L	V	-	1	0	NLGN4X	5837164	0.754000	0.28360	0.792000	0.32020	0.485000	0.33311	1.426000	0.34870	1.508000	0.48769	0.600000	0.82982	GTG		0.592	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		20	21	1	0	7.87624e-14	0.00278	1.18909e-13	20	21				
FRMPD4	9758	broad.mit.edu	37	X	12736249	12736249	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:12736249G>A	ENST00000380682.1	+	16	3810	c.3304G>A	c.(3304-3306)Gct>Act	p.A1102T		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1102					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.A1092T(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						AGGTGGGATGGCTGAAAAAAG	0.502																																							uc004cuz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						c.(3304-3306)GCT>ACT		FERM and PDZ domain containing 4							139.0	139.0	139.0					X																	12736249		2203	4300	6503	SO:0001583	missense	9758				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chrX:12736249G>A	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3304G>A	X.37:g.12736249G>A	ENSP00000370057:p.Ala1102Thr					FRMPD4_uc011mij.1_Missense_Mutation_p.A1094T	p.A1102T	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN			16	3810	+			1102					A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	c.3304G>A	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	G	3.332	-0.136491	0.06711	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.07800	3.16	5.49	2.76	0.32466	.	0.365309	0.30949	N	0.008559	T	0.07728	0.0194	L	0.51422	1.61	0.09310	N	1	B;B	0.29188	0.121;0.236	B;B	0.26969	0.075;0.075	T	0.28964	-1.0027	10	0.56958	D	0.05	-0.1804	5.328	0.15917	0.2252:0.0:0.6322:0.1427	.	1094;1102	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	T	1102;1093;1091	ENSP00000370057:A1102T	ENSP00000304583:A1091T	A	+	1	0	FRMPD4	12646170	0.980000	0.34600	0.020000	0.16555	0.010000	0.07245	1.946000	0.40283	0.151000	0.19162	-0.191000	0.12829	GCT		0.502	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		34	77	0	0	0	0.003271	0	34	77				
DCAF8L2	347442	broad.mit.edu	37	X	27765055	27765055	+	Missense_Mutation	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:27765055G>A	ENST00000451261.2	+	5	442	c.43G>A	c.(43-45)Ggg>Agg	p.G15R		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	15								p.G15R(1)		central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						ACCAGACTTAGGGACTGAAAG	0.552																																							uc011mjy.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(43-45)GGG>AGG		DDB1 and CUL4 associated factor 8-like 2							53.0	39.0	43.0					X																	27765055		692	1591	2283	SO:0001583	missense	347442							g.chrX:27765055G>A		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.43G>A	X.37:g.27765055G>A	ENSP00000462745:p.Gly15Arg						p.G15R	NM_001136533	NP_001130005					1	130	+								B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	c.43G>A	CCDS59162.1																																																																																				0.552	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354		12	6	0	0	0	0.013537	0	12	6				
IL1RAPL1	11141	broad.mit.edu	37	X	29938104	29938104	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:29938104T>A	ENST00000378993.1	+	8	1623	c.950T>A	c.(949-951)aTc>aAc	p.I317N	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.I317N	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	317	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.I317N(2)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						GAAGTTTCCATCTCATTAATT	0.393																																							uc004dby.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(1)|pancreas(1)	5						c.(949-951)ATC>AAC		interleukin 1 receptor accessory protein-like 1							212.0	179.0	190.0					X																	29938104		2202	4300	6502	SO:0001583	missense	11141				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity	g.chrX:29938104T>A	AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.950T>A	X.37:g.29938104T>A	ENSP00000368278:p.Ile317Asn						p.I317N	NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN			8	1458	+			317			Extracellular (Potential).|Ig-like C2-type 3.		A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	c.950T>A	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.262782	0.59431	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.66638	-0.22;-0.22	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.74038	0.3664	L	0.44542	1.39	0.52501	D	0.99995	D	0.63880	0.993	D	0.63381	0.914	T	0.73049	-0.4105	9	.	.	.	.	15.3142	0.74059	0.0:0.0:0.0:1.0	.	317	Q9NZN1	IRPL1_HUMAN	N	317	ENSP00000368278:I317N;ENSP00000305200:I317N	.	I	+	2	0	IL1RAPL1	29848025	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.000000	0.58554	0.425000	0.28330	ATC		0.393	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271		19	61	0	0	0	0.012319	0	19	61				
CXorf21	80231	broad.mit.edu	37	X	30577751	30577751	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:30577751G>T	ENST00000378962.3	-	3	1044	c.722C>A	c.(721-723)gCg>gAg	p.A241E		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	241								p.A241E(1)		kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						GAGTTCAGACGCCAGAATCTG	0.438																																							uc004dcg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(721-723)GCG>GAG		hypothetical protein LOC80231							139.0	120.0	127.0					X																	30577751		2202	4300	6502	SO:0001583	missense	80231							g.chrX:30577751G>T	BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.722C>A	X.37:g.30577751G>T	ENSP00000368245:p.Ala241Glu						p.A241E	NM_025159	NP_079435	Q9HAI6	CX021_HUMAN			3	998	-			241						Missense_Mutation	SNP	ENST00000378962.3	37	c.722C>A	CCDS14224.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922553	0.52653	.	.	ENSG00000120280	ENST00000378962	.	.	.	5.11	4.2	0.49525	.	0.136324	0.47852	D	0.000201	T	0.72867	0.3514	M	0.65498	2.005	0.45995	D	0.998808	D	0.61080	0.989	P	0.58172	0.834	T	0.77387	-0.2607	9	0.87932	D	0	-8.7292	14.7813	0.69769	0.0:0.1402:0.8598:0.0	.	241	Q9HAI6	CX021_HUMAN	E	241	.	ENSP00000368245:A241E	A	-	2	0	CXorf21	30487672	1.000000	0.71417	0.997000	0.53966	0.592000	0.36648	3.911000	0.56378	2.351000	0.79841	0.513000	0.50165	GCG		0.438	CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056164.1	NM_025159		22	32	1	0	8.10497e-08	0.010504	1.07502e-07	22	32				
DMD	1756	broad.mit.edu	37	X	32430021	32430021	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:32430021T>A	ENST00000357033.4	-	30	4287	c.4081A>T	c.(4081-4083)Agg>Tgg	p.R1361W	DMD_ENST00000378677.2_Missense_Mutation_p.R1357W	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1361					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R20W(1)|p.R1356W(1)|p.R1361W(1)|p.R1357W(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AACTTTTGCCTCCTTACAGCC	0.398																																							uc004dda.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(4081-4083)AGG>TGG		dystrophin Dp427m isoform							89.0	72.0	78.0					X																	32430021		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32430021T>A	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4081A>T	X.37:g.32430021T>A	ENSP00000354923:p.Arg1361Trp					DMD_uc004dcw.2_Missense_Mutation_p.R17W|DMD_uc004dcx.2_Missense_Mutation_p.R20W|DMD_uc004dcz.2_Missense_Mutation_p.R1238W|DMD_uc004dcy.1_Missense_Mutation_p.R1357W|DMD_uc004ddb.1_Missense_Mutation_p.R1353W|DMD_uc010ngo.1_Intron	p.R1361W	NM_004006	NP_003997	P11532	DMD_HUMAN			30	4325	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1361			Spectrin 9.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.4081A>T	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	T	19.69	3.874613	0.72180	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.50001	0.76;0.76	5.68	5.68	0.88126	.	0.189391	0.24222	U	0.040429	T	0.68311	0.2987	M	0.74881	2.28	0.80722	D	1	D;D;P;P;P	0.67145	0.963;0.996;0.938;0.806;0.806	P;D;P;P;P	0.71656	0.748;0.974;0.565;0.565;0.565	T	0.72440	-0.4293	10	0.87932	D	0	.	14.9143	0.70781	0.0:0.0:0.0:1.0	.	1353;1361;1357;20;17	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	W	1353;20;17;1357;1361;1361;1238	ENSP00000367948:R1357W;ENSP00000354923:R1361W	ENSP00000354923:R1361W	R	-	1	2	DMD	32339942	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	6.522000	0.73783	1.904000	0.55121	0.412000	0.27726	AGG		0.398	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		14	17	0	0	0	0.001855	0	14	17				
FAM47B	170062	broad.mit.edu	37	X	34961437	34961437	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:34961437G>T	ENST00000329357.5	+	1	525	c.489G>T	c.(487-489)tgG>tgT	p.W163C		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	163								p.W163C(2)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AGGACGCTTGGGCTCGTTGTG	0.587																																							uc004ddi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(1)	4						c.(487-489)TGG>TGT		hypothetical protein LOC170062							45.0	41.0	42.0					X																	34961437		2202	4300	6502	SO:0001583	missense	170062							g.chrX:34961437G>T	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.489G>T	X.37:g.34961437G>T	ENSP00000328307:p.Trp163Cys						p.W163C	NM_152631	NP_689844	Q8NA70	FA47B_HUMAN			1	507	+			163					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.489G>T	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.655717	0.00779	.	.	ENSG00000189132	ENST00000329357	T	0.15256	2.44	0.843	-0.121	0.13535	.	.	.	.	.	T	0.10637	0.0260	L	0.31371	0.925	0.09310	N	1	B	0.14438	0.01	B	0.09377	0.004	T	0.30060	-0.9991	9	0.41790	T	0.15	.	4.2059	0.10488	0.1988:0.2378:0.5634:0.0	.	163	Q8NA70	FA47B_HUMAN	C	163	ENSP00000328307:W163C	ENSP00000328307:W163C	W	+	3	0	FAM47B	34871358	0.010000	0.17322	0.007000	0.13788	0.001000	0.01503	-1.493000	0.02298	-1.441000	0.01958	-2.294000	0.00264	TGG		0.587	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		11	12	1	0	0.00829132	0.008291	0.00880795	11	12				
ZNF81	347344	broad.mit.edu	37	X	47775135	47775135	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:47775135G>T	ENST00000376954.1	+	6	1458	c.1090G>T	c.(1090-1092)Ggg>Tgg	p.G364W	ZNF81_ENST00000338637.7_Missense_Mutation_p.G364W			P51508	ZNF81_HUMAN	zinc finger protein 81	364					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G364W(1)		breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				CAATGAATGTGGGAAATCATT	0.383																																							uc010nhy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1090-1092)GGG>TGG		zinc finger protein 81							55.0	55.0	55.0					X																	47775135		2162	4262	6424	SO:0001583	missense	347344					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:47775135G>T	AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.1090G>T	X.37:g.47775135G>T	ENSP00000366153:p.Gly364Trp						p.G364W	NM_007137	NP_009068	P51508	ZNF81_HUMAN			6	1458	+		all_lung(315;0.0973)	364			C2H2-type 2.		Q6RX22|Q96QH6	Missense_Mutation	SNP	ENST00000376954.1	37	c.1090G>T	CCDS43933.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223187	0.58668	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.22336	1.96;1.96	4.16	4.16	0.48862	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.355131	0.20714	N	0.087040	T	0.55401	0.1918	M	0.93763	3.455	0.36405	D	0.863388	D	0.89917	1.0	D	0.80764	0.994	T	0.72786	-0.4188	10	0.87932	D	0	.	13.3601	0.60650	0.0:0.0:1.0:0.0	.	364	P51508	ZNF81_HUMAN	W	364	ENSP00000366153:G364W;ENSP00000341151:G364W	ENSP00000341151:G364W	G	+	1	0	ZNF81	47660079	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.639000	0.54339	2.316000	0.78162	0.600000	0.82982	GGG		0.383	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056455.2	NM_007137		7	16	1	0	1.06961e-07	0.00308	1.41068e-07	7	16				
PAGE2	203569	broad.mit.edu	37	X	55117812	55117812	+	Nonsense_Mutation	SNP	G	G	T	rs369322001		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:55117812G>T	ENST00000374968.4	+	4	345	c.241G>T	c.(241-243)Gag>Tag	p.E81*	PAGE2_ENST00000374965.1_Nonsense_Mutation_p.E64*	NM_207339.2	NP_997222.1	Q7Z2X7	PAGE2_HUMAN	P antigen family, member 2 (prostate associated)	81								p.E81*(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(2)	6						GCTTAAGATAGAGGATGAGCC	0.403																																							uc004duf.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(241-243)GAG>TAG		P antigen family, member 2							99.0	107.0	104.0					X																	55117812		2171	4293	6464	SO:0001587	stop_gained	203569							g.chrX:55117812G>T	BC054022	CCDS14367.1	Xp11.22	2009-06-17			ENSG00000234068	ENSG00000234068			31804	protein-coding gene	gene with protein product		300738	"""G antigen, family C, 2"""	GAGEC2		9724777	Standard	NM_207339		Approved	MGC62094, PAGE-2, CT16.4		Q7Z2X7	OTTHUMG00000021648	ENST00000374968.4:c.241G>T	X.37:g.55117812G>T	ENSP00000364107:p.Glu81*						p.E81*	NM_207339	NP_997222	Q7Z2X7	GGEE2_HUMAN			4	295	+			81					Q5JRK7|Q5JRK8	Nonsense_Mutation	SNP	ENST00000374968.4	37	c.241G>T	CCDS14367.1	.	.	.	.	.	.	.	.	.	.	g	9.357	1.066943	0.20067	.	.	ENSG00000234068	ENST00000374968;ENST00000374965	.	.	.	1.13	1.13	0.20643	.	.	.	.	.	.	.	.	.	.	.	0.43368	A	0.995455	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	5.3082	0.15815	0.0:0.0:1.0:0.0	.	.	.	.	X	81;64	.	ENSP00000364104:E64X	E	+	1	0	PAGE2	55134537	0.000000	0.05858	0.002000	0.10522	0.059000	0.15707	0.443000	0.21644	0.862000	0.35528	0.287000	0.19450	GAG		0.403	PAGE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056857.1	NM_207339		32	22	1	0	1.59932e-28	0.007835	2.67447e-28	32	22				
ZC3H12B	340554	broad.mit.edu	37	X	64719040	64719040	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:64719040C>T	ENST00000338957.4	+	3	977	c.910C>T	c.(910-912)Ctt>Ttt	p.L304F	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.L293F	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	304							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.L154F(1)|p.L240F(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTACCGAGACCTTCAAGTTGA	0.428																																							uc010nko.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)|kidney(1)|pancreas(1)	3						c.(877-879)CTT>TTT		zinc finger CCCH-type containing 12B							100.0	91.0	94.0					X																	64719040		1885	4099	5984	SO:0001583	missense	340554						endonuclease activity|nucleic acid binding|zinc ion binding	g.chrX:64719040C>T	BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.910C>T	X.37:g.64719040C>T	ENSP00000340839:p.Leu304Phe						p.L293F	NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN			3	886	+			293					B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	ENST00000338957.4	37	c.877C>T	CCDS48131.2	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643929	0.67244	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.51071	0.72;0.72	5.19	5.19	0.71726	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.69566	0.3125	M	0.78223	2.4	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.72027	-0.4414	10	0.48119	T	0.1	-31.354	16.3038	0.82841	0.0:1.0:0.0:0.0	.	293	Q5HYM0	ZC12B_HUMAN	F	304;293;240	ENSP00000340839:L304F;ENSP00000408077:L293F	ENSP00000218172:L240F	L	+	1	0	ZC3H12B	64635765	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.802000	0.62539	2.159000	0.67721	0.513000	0.50165	CTT		0.428	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334		30	26	0	0	0	0.008361	0	30	26				
HEPH	9843	broad.mit.edu	37	X	65413396	65413396	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:65413396T>A	ENST00000343002.2	+	7	1949	c.1285T>A	c.(1285-1287)Tgg>Agg	p.W429R	HEPH_ENST00000441993.2_Missense_Mutation_p.W432R|HEPH_ENST00000419594.1_Missense_Mutation_p.W432R|HEPH_ENST00000519389.1_Missense_Mutation_p.W483R|HEPH_ENST00000374727.3_Missense_Mutation_p.W432R|HEPH_ENST00000336279.5_Missense_Mutation_p.W162R			Q9BQS7	HEPH_HUMAN	hephaestin	429	Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)	p.W429R(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						GGGCACTTACTGGAAAGTGCG	0.373																																							uc011moz.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|ovary(4)	9						c.(1294-1296)TGG>AGG		hephaestin isoform a							45.0	41.0	42.0					X																	65413396		2203	4300	6503	SO:0001583	missense	9843				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity	g.chrX:65413396T>A	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1285T>A	X.37:g.65413396T>A	ENSP00000343939:p.Trp429Arg					HEPH_uc004dwn.2_Missense_Mutation_p.W432R|HEPH_uc004dwo.2_Missense_Mutation_p.W162R|HEPH_uc010nkr.2_Missense_Mutation_p.W432R|HEPH_uc011mpa.1_Missense_Mutation_p.W432R	p.W432R	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN			8	1354	+			429			Extracellular (Potential).|Plastocyanin-like 3.		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37	c.1294T>A		.	.	.	.	.	.	.	.	.	.	T	9.648	1.140916	0.21205	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15;-5.15;-5.15;-5.15	5.39	5.39	0.77823	Cupredoxin (2);	0.431791	0.25063	N	0.033423	D	0.97964	0.9330	L	0.34521	1.04	0.34371	D	0.692001	B;B;D	0.67145	0.404;0.296;0.996	B;B;D	0.66351	0.184;0.041;0.943	D	0.99900	1.1160	10	0.22706	T	0.39	.	13.2359	0.59969	0.0:0.0:0.0:1.0	.	483;432;429	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	R	483;432;162;432;432;429;429	ENSP00000430620:W483R;ENSP00000363859:W432R;ENSP00000337418:W162R;ENSP00000411687:W432R;ENSP00000413211:W432R;ENSP00000343939:W429R;ENSP00000398078:W429R	ENSP00000337418:W162R	W	+	1	0	HEPH	65330121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.428000	0.52792	1.808000	0.52836	0.481000	0.45027	TGG		0.373	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737		16	11	0	0	0	0.004007	0	16	11				
SLC7A3	84889	broad.mit.edu	37	X	70148047	70148047	+	Silent	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:70148047T>G	ENST00000374299.3	-	5	912	c.768A>C	c.(766-768)ggA>ggC	p.G256G	SLC7A3_ENST00000298085.4_Silent_p.G256G			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	256					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)	p.G256G(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	AGGTCGCTGCTCCACGGAGAA	0.517																																							uc004dyn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)	2						c.(766-768)GGA>GGC		solute carrier family 7 (cationic amino acid	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)						83.0	67.0	73.0					X																	70148047		2203	4300	6503	SO:0001819	synonymous_variant	84889				cellular nitrogen compound metabolic process	integral to membrane|plasma membrane		g.chrX:70148047T>G	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.768A>C	X.37:g.70148047T>G						SLC7A3_uc004dyo.2_Silent_p.G256G	p.G256G	NM_032803	NP_116192	Q8WY07	CTR3_HUMAN			5	926	-	Renal(35;0.156)		256			Cytoplasmic (Potential).		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Silent	SNP	ENST00000374299.3	37	c.768A>C	CCDS14404.1																																																																																				0.517	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	NM_032803		4	12	0	0	0	0.001168	0	4	12				
ZMAT1	84460	broad.mit.edu	37	X	101139127	101139127	+	Silent	SNP	T	T	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:101139127T>G	ENST00000372782.3	-	7	1319	c.1272A>C	c.(1270-1272)acA>acC	p.T424T	ZMAT1_ENST00000540921.1_Silent_p.T424T|ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000458570.1_Silent_p.T253T	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	424						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.T424T(1)|p.T253T(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TGTTCCTGTGTGTTTCTACAG	0.408																																							uc004eim.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(757-759)ACA>ACC		zinc finger, matrin type 1 isoform 3							242.0	227.0	232.0					X																	101139127		2203	4300	6503	SO:0001819	synonymous_variant	84460					nucleus	zinc ion binding	g.chrX:101139127T>G	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.1272A>C	X.37:g.101139127T>G						ZMAT1_uc011mrl.1_Silent_p.T424T|ZMAT1_uc004ein.2_Silent_p.T253T|ZMAT1_uc011mrm.1_Silent_p.T253T	p.T253T	NM_032441	NP_115817	Q5H9K5	ZMAT1_HUMAN			2	4257	-			253					Q8NDS3|Q96JN6	Silent	SNP	ENST00000372782.3	37	c.759A>C	CCDS35348.1																																																																																				0.408	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1			42	61	0	0	0	0.013114	0	42	61				
COL4A5	1287	broad.mit.edu	37	X	107930773	107930773	+	Silent	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:107930773T>A	ENST00000361603.2	+	47	4603	c.4359T>A	c.(4357-4359)ccT>ccA	p.P1453P	COL4A5_ENST00000328300.6_Silent_p.P1459P	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1453	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.P1453P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						CAGGTCCCCCTGGAACCTCCT	0.502									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(4375-4377)CCT>CCA		type IV collagen alpha 5 isoform 2 precursor							142.0	128.0	133.0					X																	107930773		2203	4300	6503	SO:0001819	synonymous_variant	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107930773T>A	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4359T>A	X.37:g.107930773T>A						COL4A5_uc011mso.1_Silent_p.P1456P|COL4A5_uc011msp.1_Silent_p.P135P	p.P1459P	NM_033380	NP_203699	P29400	CO4A5_HUMAN			48	4579	+			1453			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	c.4377T>A	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	T	9.261	1.043296	0.19748	.	.	ENSG00000188153	ENST00000515658	.	.	.	5.58	1.42	0.22433	.	.	.	.	.	T	0.44052	0.1275	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22277	-1.0221	4	.	.	.	.	2.8394	0.05524	0.2975:0.0757:0.1038:0.523	.	.	.	.	Q	58	.	.	L	+	2	0	COL4A5	107817429	0.156000	0.22821	0.999000	0.59377	0.746000	0.42486	-0.629000	0.05508	0.220000	0.20860	0.486000	0.48141	CTG		0.502	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			30	65	0	0	0	0.009535	0	30	65				
AMOT	154796	broad.mit.edu	37	X	112054522	112054522	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:112054522C>A	ENST00000524145.1	-	4	1566	c.1492G>T	c.(1492-1494)Gag>Tag	p.E498*	AMOT_ENST00000371962.1_Nonsense_Mutation_p.E266*|AMOT_ENST00000371959.3_Nonsense_Mutation_p.E498*|AMOT_ENST00000304758.1_Nonsense_Mutation_p.E89*|AMOT_ENST00000371958.1_Nonsense_Mutation_p.E266*			Q4VCS5	AMOT_HUMAN	angiomotin	498					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.E89*(1)|p.E498*(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						ATCTCGCCCTCTAGCTTGTTT	0.512																																							uc004epr.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(1492-1494)GAG>TAG		angiomotin isoform 1							234.0	196.0	209.0					X																	112054522		2203	4300	6503	SO:0001587	stop_gained	154796				actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity	g.chrX:112054522C>A	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1492G>T	X.37:g.112054522C>A	ENSP00000429013:p.Glu498*					AMOT_uc004eps.2_Nonsense_Mutation_p.E89*|AMOT_uc004ept.1_Nonsense_Mutation_p.E498*	p.E498*	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN			3	1492	-			498			Potential.		Q504X5|Q9HD27|Q9UPT1	Nonsense_Mutation	SNP	ENST00000524145.1	37	c.1492G>T	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	C	40	7.926056	0.98565	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-19.0452	18.0306	0.89282	0.0:1.0:0.0:0.0	.	.	.	.	X	89;498;266;498;266	.	ENSP00000305557:E89X	E	-	1	0	AMOT	111941178	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.818000	0.86416	2.480000	0.83734	0.600000	0.82982	GAG		0.512	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265		82	94	1	0	1.47272e-24	0.00361	2.43941e-24	82	94				
LUZP4	51213	broad.mit.edu	37	X	114540964	114540964	+	Missense_Mutation	SNP	G	G	T	rs2232735	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:114540964G>T	ENST00000371920.3	+	4	544	c.537G>T	c.(535-537)caG>caT	p.Q179H	LUZP4_ENST00000451986.2_Missense_Mutation_p.Q97H	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	179						nucleus (GO:0005634)		p.Q179H(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						CTCAAGGGCAGCTAAAGAGAC	0.458																																							uc004eqa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(535-537)CAG>CAT		leucine zipper protein 4							125.0	117.0	120.0					X																	114540964		2203	4300	6503	SO:0001583	missense	51213					nucleus		g.chrX:114540964G>T	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.537G>T	X.37:g.114540964G>T	ENSP00000360988:p.Gln179His					LUZP4_uc004eqb.2_Missense_Mutation_p.Q97H	p.Q179H	NM_016383	NP_057467	Q9P127	LUZP4_HUMAN			4	571	+			179					B3KSD6	Missense_Mutation	SNP	ENST00000371920.3	37	c.537G>T	CCDS14567.1	.	.	.	.	.	.	.	.	.	.	G	4.637	0.118339	0.08881	.	.	ENSG00000102021	ENST00000451986;ENST00000371920	T;T	0.78595	-1.19;-1.19	2.22	-2.2	0.06994	.	.	.	.	.	T	0.62588	0.2440	L	0.32530	0.975	0.09310	N	1	B;B	0.18968	0.004;0.032	B;B	0.22386	0.005;0.039	T	0.51068	-0.8752	9	0.56958	D	0.05	.	3.8981	0.09149	0.3014:0.4071:0.2915:0.0	.	97;179	B3KSD6;Q9P127	.;LUZP4_HUMAN	H	97;179	ENSP00000411212:Q97H;ENSP00000360988:Q179H	ENSP00000360988:Q179H	Q	+	3	2	LUZP4	114447220	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	-2.485000	0.00979	-0.638000	0.05509	-1.495000	0.00966	CAG		0.458	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	NM_016383		29	36	1	0	9.80776e-20	0.00632	1.57964e-19	29	36				
MAP7D3	79649	broad.mit.edu	37	X	135303096	135303096	+	Missense_Mutation	SNP	T	T	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:135303096T>A	ENST00000316077.9	-	16	2534	c.2314A>T	c.(2314-2316)Acc>Tcc	p.T772S	MAP7D3_ENST00000495432.1_5'Flank|MAP7D3_ENST00000370663.5_Missense_Mutation_p.T754S|MAP7D3_ENST00000370661.1_Missense_Mutation_p.T737S	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	772					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.T1069S(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TTAAATTTGGTAGGTGAGCCT	0.363																																							uc004ezt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(2314-2316)ACC>TCC		MAP7 domain containing 3							223.0	196.0	205.0					X																	135303096		1835	4078	5913	SO:0001583	missense	79649					cytoplasm|spindle		g.chrX:135303096T>A	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.2314A>T	X.37:g.135303096T>A	ENSP00000318086:p.Thr772Ser					MAP7D3_uc004ezs.2_Missense_Mutation_p.T736S|MAP7D3_uc011mwc.1_Missense_Mutation_p.T754S|MAP7D3_uc010nsa.1_Missense_Mutation_p.T730S	p.T772S	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN			16	2405	-	Acute lymphoblastic leukemia(192;0.000127)		772					A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	c.2314A>T	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	T	0.045	-1.268078	0.01433	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.17213	2.29;3.71;3.71;2.31	3.64	-5.42	0.02640	.	.	.	.	.	T	0.06280	0.0162	N	0.12182	0.205	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.002	T	0.34900	-0.9810	9	0.20519	T	0.43	1.3903	2.4013	0.04402	0.1126:0.1819:0.3923:0.3132	.	754;731;772;737	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	S	737;772;754;731	ENSP00000359695:T737S;ENSP00000318086:T772S;ENSP00000359697:T754S;ENSP00000359694:T731S	ENSP00000318086:T772S	T	-	1	0	MAP7D3	135130762	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.794000	0.04584	-1.935000	0.01049	-3.680000	0.00024	ACC		0.363	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2			128	113	0	0	0	0.00361	0	128	113				
GPR112	139378	broad.mit.edu	37	X	135429849	135429849	+	Silent	SNP	G	G	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:135429849G>A	ENST00000394143.1	+	6	4275	c.3984G>A	c.(3982-3984)ttG>ttA	p.L1328L	GPR112_ENST00000412101.1_Silent_p.L1123L|GPR112_ENST00000287534.4_Silent_p.L1265L|GPR112_ENST00000394141.1_Silent_p.L1123L|GPR112_ENST00000370652.1_Silent_p.L1328L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1328					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L1328L(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ATGGAAATTTGGCTTCATCTC	0.443																																							uc004ezu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(3982-3984)TTG>TTA		G-protein coupled receptor 112							105.0	90.0	95.0					X																	135429849		2203	4300	6503	SO:0001819	synonymous_variant	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135429849G>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3984G>A	X.37:g.135429849G>A						GPR112_uc010nsb.1_Silent_p.L1123L|GPR112_uc010nsc.1_Silent_p.L1095L	p.L1328L	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	4275	+	Acute lymphoblastic leukemia(192;0.000127)		1328			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	c.3984G>A	CCDS35409.1																																																																																				0.443	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			37	22	0	0	0	0.003755	0	37	22				
MAGEC1	9947	broad.mit.edu	37	X	140994298	140994298	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:140994298C>A	ENST00000285879.4	+	4	1394	c.1108C>A	c.(1108-1110)Cag>Aag	p.Q370K	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	370								p.Q370K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GGGTTTTCCCCAGTCTCCTCT	0.468										HNSCC(15;0.026)																													uc004fbt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1108-1110)CAG>AAG		melanoma antigen family C, 1							106.0	107.0	107.0					X																	140994298		2200	4289	6489	SO:0001583	missense	9947						protein binding	g.chrX:140994298C>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1108C>A	X.37:g.140994298C>A	ENSP00000285879:p.Gln370Lys	HNSCC(15;0.026)				MAGEC1_uc010nsl.1_Intron	p.Q370K	NM_005462	NP_005453	O60732	MAGC1_HUMAN			4	1394	+	Acute lymphoblastic leukemia(192;6.56e-05)		370					A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	c.1108C>A	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	1.978	-0.434772	0.04669	.	.	ENSG00000155495	ENST00000285879	T	0.03496	3.91	.	.	.	.	.	.	.	.	T	0.01976	0.0062	N	0.08118	0	0.30643	N	0.756268	P	0.42584	0.784	B	0.39706	0.307	T	0.41610	-0.9499	8	0.87932	D	0	.	2.6709	0.05067	0.0:0.517:0.0:0.483	.	370	O60732	MAGC1_HUMAN	K	370	ENSP00000285879:Q370K	ENSP00000285879:Q370K	Q	+	1	0	MAGEC1	140821964	0.005000	0.15991	0.083000	0.20561	0.083000	0.17756	0.624000	0.24462	0.148000	0.19059	0.150000	0.16122	CAG		0.468	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		34	86	1	0	9.65963e-10	0.003271	1.36131e-09	34	86				
AFF2	2334	broad.mit.edu	37	X	147743642	147743642	+	Missense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:147743642C>A	ENST00000370460.2	+	3	873	c.394C>A	c.(394-396)Cct>Act	p.P132T	AFF2_ENST00000370458.1_Missense_Mutation_p.P128T|AFF2_ENST00000342251.3_Missense_Mutation_p.P128T|AFF2_ENST00000370457.5_Missense_Mutation_p.P128T	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	132					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.P132T(2)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TAATACCCATCCTTCAGCACC	0.398																																							uc004fcp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|pancreas(2)	5						c.(394-396)CCT>ACT		fragile X mental retardation 2							246.0	240.0	242.0					X																	147743642		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:147743642C>A	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.394C>A	X.37:g.147743642C>A	ENSP00000359489:p.Pro132Thr					AFF2_uc004fco.2_Missense_Mutation_p.P128T|AFF2_uc004fcq.2_Missense_Mutation_p.P128T|AFF2_uc004fcr.2_Missense_Mutation_p.P128T|AFF2_uc011mxb.1_Missense_Mutation_p.P132T|AFF2_uc004fcs.2_Missense_Mutation_p.P128T	p.P132T	NM_002025	NP_002016	P51816	AFF2_HUMAN			3	873	+	Acute lymphoblastic leukemia(192;6.56e-05)		132					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.394C>A	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.818774	0.00595	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.31	-4.5	0.03493	.	0.929690	0.09211	N	0.833214	T	0.38401	0.1039	N	0.21282	0.65	0.40279	D	0.978372	B;B;B;B;B;B	0.23735	0.007;0.007;0.007;0.073;0.09;0.043	B;B;B;B;B;B	0.28385	0.008;0.008;0.008;0.053;0.089;0.049	T	0.10428	-1.0630	10	0.24483	T	0.36	.	8.9161	0.35583	0.0:0.197:0.1923:0.6107	.	132;128;128;128;132;128	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	T	132;128;128;128	ENSP00000359489:P132T;ENSP00000359486:P128T;ENSP00000345459:P128T;ENSP00000359487:P128T	ENSP00000345459:P128T	P	+	1	0	AFF2	147551334	0.001000	0.12720	0.001000	0.08648	0.325000	0.28411	-0.262000	0.08682	-0.941000	0.03700	-0.170000	0.13304	CCT		0.398	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		65	168	1	0	2.18329e-32	0.00361	3.68627e-32	65	168				
MAGEA10	4109	broad.mit.edu	37	X	151302988	151302988	+	Nonsense_Mutation	SNP	C	C	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:151302988C>A	ENST00000370323.4	-	4	1421	c.1105G>T	c.(1105-1107)Gaa>Taa	p.E369*	MAGEA10_ENST00000244096.3_Nonsense_Mutation_p.E369*|RP11-1007I13.4_ENST00000509345.2_RNA	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	369						nucleus (GO:0005634)		p.E369*(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TTACTTTATTCAGGGTAGGAG	0.388																																							uc004ffk.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1105-1107)GAA>TAA		melanoma antigen family A, 10							125.0	115.0	118.0					X																	151302988		2203	4300	6503	SO:0001587	stop_gained	4109							g.chrX:151302988C>A		CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.1105G>T	X.37:g.151302988C>A	ENSP00000359347:p.Glu369*					MAGEA10_uc004ffl.2_Nonsense_Mutation_p.E369*	p.E369*	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN			5	1513	-	Acute lymphoblastic leukemia(192;6.56e-05)		369						Nonsense_Mutation	SNP	ENST00000370323.4	37	c.1105G>T	CCDS14705.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.147879	0.78001	.	.	ENSG00000124260	ENST00000370323;ENST00000244096	.	.	.	2.2	-2.82	0.05787	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	3.159	0.06514	0.5523:0.275:0.0:0.1727	.	.	.	.	X	369	.	ENSP00000244096:E369X	E	-	1	0	MAGEA10	151053644	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-1.933000	0.01553	-0.762000	0.04664	0.292000	0.19580	GAA		0.388	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060916.3	NM_021048		18	62	1	0	3.51602e-12	0.008871	5.1524e-12	18	62				
ATP2B3	492	broad.mit.edu	37	X	152814197	152814197	+	Missense_Mutation	SNP	C	C	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:152814197C>T	ENST00000349466.2	+	9	1549	c.1223C>T	c.(1222-1224)cCg>cTg	p.P408L	ATP2B3_ENST00000370181.2_Missense_Mutation_p.P394L|ATP2B3_ENST00000393842.1_Missense_Mutation_p.P394L|ATP2B3_ENST00000359149.3_Missense_Mutation_p.P408L|ATP2B3_ENST00000263519.4_Missense_Mutation_p.P408L|ATP2B3_ENST00000370186.1_Missense_Mutation_p.P394L			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	408					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.P408L(3)|p.P394L(1)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GAGTGCACGCCGGTCTATGTA	0.542																																							uc004fht.1		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(1)	1						c.(1222-1224)CCG>CTG		plasma membrane calcium ATPase 3 isoform 3b							181.0	118.0	139.0					X																	152814197		2203	4300	6503	SO:0001583	missense	492				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding	g.chrX:152814197C>T	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.1223C>T	X.37:g.152814197C>T	ENSP00000343886:p.Pro408Leu					ATP2B3_uc004fhs.1_Missense_Mutation_p.P408L	p.P408L	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN			8	1349	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		408			Extracellular (Potential).		B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	ENST00000349466.2	37	c.1223C>T	CCDS35440.1	.	.	.	.	.	.	.	.	.	.	C	11.64	1.698680	0.30142	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.94417	-3.42;-3.42;-3.41;-3.42;-3.42;-3.42	5.07	5.07	0.68467	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.89626	0.6769	N	0.17800	0.525	0.58432	D	0.999996	B;B	0.18610	0.004;0.029	B;B	0.14578	0.009;0.011	D	0.85906	0.1437	10	0.40728	T	0.16	-24.7153	16.5343	0.84369	0.0:1.0:0.0:0.0	.	408;408	Q16720;Q16720-2	AT2B3_HUMAN;.	L	394;408;394;408;408;394	ENSP00000359205:P394L;ENSP00000343886:P408L;ENSP00000377425:P394L;ENSP00000352062:P408L;ENSP00000263519:P408L;ENSP00000359200:P394L	ENSP00000263519:P408L	P	+	2	0	ATP2B3	152467391	1.000000	0.71417	0.691000	0.30163	0.190000	0.23558	7.740000	0.84986	2.248000	0.74166	0.517000	0.50305	CCG		0.542	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949		32	25	0	0	0	0.012213	0	32	25				
BRCC3	79184	broad.mit.edu	37	X	154299836	154299836	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:154299836G>T	ENST00000369462.1	+	1	59	c.34G>T	c.(34-36)Gtt>Ttt	p.V12F	CMC4_ENST00000369484.3_5'Flank|MTCP1_ENST00000369476.3_5'Flank|BRCC3_ENST00000340647.4_Missense_Mutation_p.V12F|MTCP1_ENST00000362018.2_Intron|BRCC3_ENST00000369459.2_Missense_Mutation_p.V12F|BRCC3_ENST00000399042.1_Missense_Mutation_p.V12F|MTCP1_ENST00000482244.1_5'Flank|BRCC3_ENST00000330045.7_Missense_Mutation_p.V12F	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	12	MPN.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.V12F(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ggtgcaggcggtTCATCTCGA	0.627																																							uc004fna.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|large_intestine(1)|breast(1)	6						c.(34-36)GTT>TTT		BRCA1/BRCA2-containing complex, subunit 3							43.0	63.0	56.0					X																	154299836		2126	4197	6323	SO:0001583	missense	79184				double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|positive regulation of DNA repair|response to X-ray	BRCA1-A complex|BRISC complex|nuclear ubiquitin ligase complex	enzyme regulator activity|metal ion binding|metallopeptidase activity|polyubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chrX:154299836G>T	X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.34G>T	X.37:g.154299836G>T	ENSP00000358474:p.Val12Phe					MTCP1NB_uc004fmy.2_5'Flank|MTCP1_uc004fmz.2_5'Flank|BRCC3_uc011mzy.1_Missense_Mutation_p.V12F|BRCC3_uc011mzz.1_RNA|BRCC3_uc004fnb.2_Missense_Mutation_p.V12F	p.V12F	NM_024332	NP_077308	P46736	BRCC3_HUMAN			1	127	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		12					A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Missense_Mutation	SNP	ENST00000369462.1	37	c.34G>T	CCDS56611.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279156	0.59758	.	.	ENSG00000185515	ENST00000340647;ENST00000330045;ENST00000369459;ENST00000369462;ENST00000411985;ENST00000399042;ENST00000457026	T;T;T;T;T;T	0.66460	-0.21;0.03;0.03;0.03;0.03;0.03	3.64	2.75	0.32379	.	0.081824	0.48286	N	0.000187	T	0.69342	0.3100	M	0.90082	3.085	0.80722	D	1	B;B;B	0.15719	0.001;0.001;0.014	B;B;B	0.17722	0.004;0.004;0.019	T	0.68435	-0.5409	10	0.87932	D	0	-5.1941	8.0705	0.30687	0.0:0.0:0.7575:0.2425	.	12;12;12	P46736-3;P46736-2;P46736	.;.;BRCC3_HUMAN	F	12	ENSP00000344103:V12F;ENSP00000328641:V12F;ENSP00000358471:V12F;ENSP00000358474:V12F;ENSP00000413170:V12F;ENSP00000381998:V12F	ENSP00000328641:V12F	V	+	1	0	BRCC3	153953030	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.491000	0.81471	0.629000	0.30376	0.513000	0.50165	GTT		0.627	BRCC3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058788.4	NM_024332		8	2	1	0	5.18039e-06	0.00308	6.31954e-06	8	2				
AMELY	266	broad.mit.edu	37	Y	6736316	6736316	+	Missense_Mutation	SNP	G	G	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrY:6736316G>T	ENST00000383036.1	-	5	376	c.377C>A	c.(376-378)cCa>cAa	p.P126Q	AMELY_ENST00000383037.4_Missense_Mutation_p.P126Q|AMELY_ENST00000215479.5_Missense_Mutation_p.P112Q			Q99218	AMELY_HUMAN	amelogenin, Y-linked	126	Gln-rich.				biomineral tissue development (GO:0031214)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	structural constituent of tooth enamel (GO:0030345)	p.P112Q(1)		NS(1)|lung(5)	6						GTGTTGGGTTGGAGTCATGGA	0.632																																							uc004fra.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(376-378)CCA>CAA		amelogenin, Y-linked precursor																																				SO:0001583	missense	266				biomineral tissue development	proteinaceous extracellular matrix	structural constituent of tooth enamel	g.chrY:6736316G>T	M86933	CCDS14778.1	Yp11.2	2004-12-07	2003-09-12		ENSG00000099721	ENSG00000099721			462	protein-coding gene	gene with protein product		410000	"""amelogenin (Y chromosome)"""	AMGL		2004775	Standard	NM_001143		Approved		uc004fqz.3	Q99218	OTTHUMG00000035297	ENST00000383036.1:c.377C>A	Y.37:g.6736316G>T	ENSP00000372505:p.Pro126Gln					AMELY_uc004fqz.2_Missense_Mutation_p.P112Q	p.P126Q	NM_001143	NP_001134	Q99218	AMELY_HUMAN			5	389	-			126			Gln-rich.		Q6RWT1	Missense_Mutation	SNP	ENST00000383036.1	37	c.377C>A	CCDS14778.1	.	.	.	.	.	.	.	.	.	.	.	8.864	0.947619	0.18356	.	.	ENSG00000099721	ENST00000383036;ENST00000383037	D;D	0.93953	-3.32;-3.32	1.35	1.35	0.21983	.	0.000000	0.53938	D	0.000043	D	0.96491	0.8855	M	0.92268	3.29	0.27309	N	0.957352	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96890	0.9652	7	.	.	.	0.1689	.	.	.	.	126;112	Q99218;Q99218-1	AMELY_HUMAN;.	Q	126	ENSP00000372505:P126Q;ENSP00000372506:P126Q	.	P	-	2	0	AMELY	6796316	1.000000	0.71417	1.000000	0.80357	0.131000	0.20780	5.568000	0.67385	1.063000	0.40649	0.184000	0.17185	CCA		0.632	AMELY-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000100214.1	NM_001143		21	21	1	0	1.2644e-06	0.010504	1.59823e-06	21	21				
EPHA8	2046	broad.mit.edu	37	1	22902862	22902870	+	In_Frame_Del	DEL	CCTGCGCGA	CCTGCGCGA	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	CCTGCGCGA	CCTGCGCGA	-	-	CCTGCGCGA	CCTGCGCGA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:22902862_22902870delCCTGCGCGA	ENST00000166244.3	+	3	384_392	c.312_320delCCTGCGCGA	c.(310-321)accctgcgcgac>acc	p.LRD105del	EPHA8_ENST00000538803.1_In_Frame_Del_p.LRD105del|EPHA8_ENST00000374644.4_In_Frame_Del_p.LRD105del	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	105	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.R106R(2)|p.R106H(2)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TCAAGTTTACCCTGCGCGACTGCAACAGC	0.617																																							uc001bfx.1		NA																	4	Substitution - Missense(2)|Substitution - coding silent(2)		large_intestine(2)|kidney(2)	central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13						c.(310-321)ACCCTGCGCGAC>ACC		ephrin receptor EphA8 isoform 1 precursor																																				SO:0001651	inframe_deletion	2046					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr1:22902862_22902870delCCTGCGCGA	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.312_320delCCTGCGCGA	1.37:g.22902862_22902870delCCTGCGCGA	ENSP00000166244:p.Leu105_Asp107del					EPHA8_uc001bfw.2_In_Frame_Del_p.LRD105del	p.LRD105del	NM_020526	NP_065387	P29322	EPHA8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	3	437_445	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	105_107			Extracellular (Potential).		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	In_Frame_Del	DEL	ENST00000166244.3	37	c.312_320delCCTGCGCGA	CCDS225.1																																																																																				0.617	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526		16	32	NA	NA	NA	NA	NA	16	32	---	---	---	---
KCNT2	343450	broad.mit.edu	37	1	196303087	196303087	+	Frame_Shift_Del	DEL	A	A	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr1:196303087delA	ENST00000294725.9	-	17	2802	c.1887delT	c.(1885-1887)attfs	p.I629fs	KCNT2_ENST00000367433.5_Frame_Shift_Del_p.I629fs|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_Frame_Shift_Del_p.I240fs|KCNT2_ENST00000609185.1_Frame_Shift_Del_p.I579fs|KCNT2_ENST00000367431.4_Frame_Shift_Del_p.I579fs			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	629					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AAACAGGAGCAATGCTAGGTC	0.418																																							uc001gtd.1		NA																	0				ovary(5)|breast(1)|skin(1)	7						c.(1885-1887)ATTfs		potassium channel, subfamily T, member 2							162.0	147.0	152.0					1																	196303087		2203	4300	6503	SO:0001589	frameshift_variant	343450					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr1:196303087delA	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1887delT	1.37:g.196303087delA	ENSP00000294725:p.Ile629fs					KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Frame_Shift_Del_p.I579fs|KCNT2_uc001gtf.1_Frame_Shift_Del_p.I629fs|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Frame_Shift_Del_p.I629fs|KCNT2_uc001gth.1_Frame_Shift_Del_p.I150fs	p.I629fs	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN			17	1947	-			629			Cytoplasmic (Potential).		Q3SY59|Q5VTN1|Q6ZMT3	Frame_Shift_Del	DEL	ENST00000294725.9	37	c.1887delT	CCDS1384.1																																																																																				0.418	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		11	48	NA	NA	NA	NA	NA	11	48	---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18789826	18789850	+	Frame_Shift_Del	DEL	ACATGAGGCTGCAGCATGAACAGAG	ACATGAGGCTGCAGCATGAACAGAG	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	ACATGAGGCTGCAGCATGAACAGAG	ACATGAGGCTGCAGCATGAACAGAG	-	-	ACATGAGGCTGCAGCATGAACAGAG	ACATGAGGCTGCAGCATGAACAGAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:18789826_18789850delACATGAGGCTGCAGCATGAACAGAG	ENST00000324631.7	+	5	602_626	c.542_566delACATGAGGCTGCAGCATGAACAGAG	c.(541-567)aacatgaggctgcagcatgaacagagafs	p.NMRLQHEQR181fs	CACNB2_ENST00000282343.8_Frame_Shift_Del_p.NMRLQHEQR153fs|CACNB2_ENST00000377328.1_Intron|CACNB2_ENST00000377315.4_Frame_Shift_Del_p.NMRLQHEQR133fs|CACNB2_ENST00000396576.2_Frame_Shift_Del_p.NMRLQHEQR126fs|CACNB2_ENST00000377319.3_Frame_Shift_Del_p.NMRLQHEQR126fs|CACNB2_ENST00000377331.2_Frame_Shift_Del_p.NMRLQHEQR153fs|CACNB2_ENST00000377329.4_Frame_Shift_Del_p.NMRLQHEQR127fs|CACNB2_ENST00000352115.6_Frame_Shift_Del_p.NMRLQHEQR181fs	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	181	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AAACTAGAAAACATGAGGCTGCAGCATGAACAGAGAGCCAAGCAA	0.4																																							uc001ipr.2		NA																	0				large_intestine(1)|central_nervous_system(1)|skin(1)	3						c.(541-567)AACATGAGGCTGCAGCATGAACAGAGAfs		calcium channel, voltage-dependent, beta 2	Magnesium Sulfate(DB00653)|Verapamil(DB00661)																																			SO:0001589	frameshift_variant	783				axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chr10:18789826_18789850delACATGAGGCTGCAGCATGAACAGAG	U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.542_566delACATGAGGCTGCAGCATGAACAGAG	10.37:g.18789826_18789850delACATGAGGCTGCAGCATGAACAGAG	ENSP00000320025:p.Asn181fs					CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Frame_Shift_Del_p.N181fs|CACNB2_uc001ipt.2_Frame_Shift_Del_p.N181fs|CACNB2_uc010qcl.1_RNA|CACNB2_uc001ipu.2_Frame_Shift_Del_p.N153fs|CACNB2_uc001ipv.2_Frame_Shift_Del_p.N153fs|CACNB2_uc009xka.1_Frame_Shift_Del_p.N153fs|CACNB2_uc001ipw.2_Frame_Shift_Del_p.N126fs|CACNB2_uc001ipx.2_Frame_Shift_Del_p.N126fs|CACNB2_uc009xkb.1_Frame_Shift_Del_p.N127fs|CACNB2_uc010qcm.1_Frame_Shift_Del_p.N127fs|CACNB2_uc001ipz.2_Frame_Shift_Del_p.N127fs|CACNB2_uc001ipy.2_Frame_Shift_Del_p.N127fs|CACNB2_uc010qcn.1_Frame_Shift_Del_p.N133fs|CACNB2_uc010qco.1_Frame_Shift_Del_p.N133fs|CACNB2_uc001iqa.2_Frame_Shift_Del_p.N133fs	p.N181fs	NM_201596	NP_963890	Q08289	CACB2_HUMAN			5	602_626	+			181_189					A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Frame_Shift_Del	DEL	ENST00000324631.7	37	c.542_566delACATGAGGCTGCAGCATGAACAGAG	CCDS7125.1																																																																																				0.400	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724		13	58	NA	NA	NA	NA	NA	13	58	---	---	---	---
C10orf71	118461	broad.mit.edu	37	10	50530859	50530859	+	Frame_Shift_Del	DEL	C	C	-	rs199973893		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr10:50530859delC	ENST00000374144.3	+	3	557	c.269delC	c.(268-270)acgfs	p.T90fs	C10orf71_ENST00000323868.4_Frame_Shift_Del_p.T90fs			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	90										endometrium(1)	1						TCACAGGGCACGGAACATTCG	0.577																																							uc010qgp.1		NA																	0					0						c.(268-270)ACGfs		hypothetical protein LOC118461 isoform 2							88.0	96.0	94.0					10																	50530859		1968	4147	6115	SO:0001589	frameshift_variant	118461							g.chr10:50530859delC	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.269delC	10.37:g.50530859delC	ENSP00000363259:p.Thr90fs						p.T90fs	NM_199459	NP_955629	Q711Q0	CJ071_HUMAN			3	608	+			90					A0AVL8	Frame_Shift_Del	DEL	ENST00000374144.3	37	c.269delC	CCDS44387.1																																																																																				0.577	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459		19	64	NA	NA	NA	NA	NA	19	64	---	---	---	---
OR5J2	282775	broad.mit.edu	37	11	55944383	55944383	+	Frame_Shift_Del	DEL	G	G	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:55944383delG	ENST00000312298.1	+	1	290	c.290delG	c.(289-291)tgcfs	p.C97fs		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					TTCTCTGCTTGCATGGTACAG	0.468																																							uc010rjb.1		NA																	0				ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4						c.(289-291)TGCfs		olfactory receptor, family 5, subfamily J,							168.0	138.0	148.0					11																	55944383		2201	4295	6496	SO:0001589	frameshift_variant	282775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55944383delG	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.290delG	11.37:g.55944383delG	ENSP00000310788:p.Cys97fs						p.C97fs	NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN			1	290	+	Esophageal squamous(21;0.00693)		97			Extracellular (Potential).		Q6IEU5	Frame_Shift_Del	DEL	ENST00000312298.1	37	c.290delG	CCDS31522.1																																																																																				0.468	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492		13	41	NA	NA	NA	NA	NA	13	41	---	---	---	---
C11orf63	79864	broad.mit.edu	37	11	122775073	122775074	+	Frame_Shift_Ins	INS	-	-	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr11:122775073_122775074insT	ENST00000531316.1	+	2	877_878	c.785_786insT	c.(784-789)actttgfs	p.L263fs	C11orf63_ENST00000227349.2_Frame_Shift_Ins_p.L263fs|C11orf63_ENST00000307257.6_Frame_Shift_Ins_p.L263fs			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	263					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		AACAAGCTCACTTTGGGATTAC	0.441																																							uc001pym.2		NA																	0				ovary(3)	3						c.(784-786)ACTfs		hypothetical protein LOC79864 isoform 1																																				SO:0001589	frameshift_variant	79864							g.chr11:122775073_122775074insT	BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.788dupT	11.37:g.122775076_122775076dupT	ENSP00000431669:p.Leu263fs					C11orf63_uc001pyl.1_Frame_Shift_Ins_p.T262fs	p.T262fs	NM_024806	NP_079082	Q6NUN7	CK063_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)	3	1082_1083	+		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	262					A8K6G0|Q96GB5|Q9H5D6	Frame_Shift_Ins	INS	ENST00000531316.1	37	c.785_786insT	CCDS8438.1																																																																																				0.441	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806		54	311	NA	NA	NA	NA	NA	54	311	---	---	---	---
SRRM2	23524	broad.mit.edu	37	16	2813458	2813458	+	Frame_Shift_Del	DEL	A	A	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:2813458delA	ENST00000301740.8	+	11	3478	c.2929delA	c.(2929-2931)accfs	p.T977fs		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	977	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CTCACCAGATACCAAAGTGAA	0.498																																							uc002crk.2		NA																	0				ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(2929-2931)ACCfs		splicing coactivator subunit SRm300							136.0	138.0	137.0					16																	2813458		2198	4300	6498	SO:0001589	frameshift_variant	23524					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding	g.chr16:2813458delA	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2929delA	16.37:g.2813458delA	ENSP00000301740:p.Thr977fs					SRRM2_uc002crj.1_Frame_Shift_Del_p.T881fs|SRRM2_uc002crl.1_Frame_Shift_Del_p.T977fs|SRRM2_uc010bsu.1_Frame_Shift_Del_p.T881fs	p.T977fs	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN			11	3478	+			977			Ser-rich.		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Frame_Shift_Del	DEL	ENST00000301740.8	37	c.2929delA	CCDS32373.1																																																																																				0.498	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			25	202	NA	NA	NA	NA	NA	25	202	---	---	---	---
CLEC18B	497190	broad.mit.edu	37	16	74447479	74447479	+	Frame_Shift_Del	DEL	G	G	-	rs149591176	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr16:74447479delG	ENST00000339953.5	-	4	673	c.552delC	c.(550-552)cccfs	p.P184fs		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	184						extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.P184P(1)		endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GGGCTTACCCGGGGGAGTAGG	0.607																																							uc002fct.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(550-552)CCCfs		C-type lectin domain family 18, member B							168.0	150.0	156.0					16																	74447479		2198	4300	6498	SO:0001589	frameshift_variant	497190					extracellular region	sugar binding	g.chr16:74447479delG	AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.552delC	16.37:g.74447479delG	ENSP00000341051:p.Pro184fs					CLEC18B_uc002fcu.2_Frame_Shift_Del_p.P184fs|CLEC18B_uc010vmu.1_Frame_Shift_Del_p.P104fs|CLEC18B_uc010vmw.1_Frame_Shift_Del_p.P184fs|CLEC18B_uc010vmv.1_5'Flank	p.P184fs	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN			4	752	-			184					B4DF90	Frame_Shift_Del	DEL	ENST00000339953.5	37	c.552delC	CCDS32484.1																																																																																				0.607	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1	NM_001011880		9	127	NA	NA	NA	NA	NA	9	127	---	---	---	---
BLMH	642	broad.mit.edu	37	17	28599581	28599582	+	Frame_Shift_Ins	INS	-	-	T	rs375335286		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:28599581_28599582insT	ENST00000261714.6	-	9	1199_1200	c.1025_1026insA	c.(1024-1026)aatfs	p.N342fs	BLMH_ENST00000582669.1_5'Flank|BLMH_ENST00000394819.3_Frame_Shift_Ins_p.N255fs	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	342					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	GCACTCACAGATTCATGTCACT	0.426																																					Pancreas(127;628 1772 12912 33293 36203)	Pancreas(127;628 1772 12912 33293 36203)	uc002hez.1		NA																	0				ovary(1)	1						c.(1024-1026)AATfs		bleomycin hydrolase																																				SO:0001589	frameshift_variant	642				proteolysis	cytoplasm|nucleus	aminopeptidase activity|carboxypeptidase activity|cysteine-type endopeptidase activity|protein binding	g.chr17:28599581_28599582insT	X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.1026dupA	17.37:g.28599583_28599583dupT	ENSP00000261714:p.Asn342fs					BLMH_uc010wbn.1_Frame_Shift_Ins_p.N255fs	p.N342fs	NM_000386	NP_000377	Q13867	BLMH_HUMAN			9	1262_1263	-			342					B2R796|Q53F86|Q9UER9	Frame_Shift_Ins	INS	ENST00000261714.6	37	c.1025_1026insA	CCDS32604.1																																																																																				0.426	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447940.1	NM_000386		75	278	NA	NA	NA	NA	NA	75	278	---	---	---	---
COIL	8161	broad.mit.edu	37	17	55028117	55028118	+	Frame_Shift_Ins	INS	-	-	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:55028117_55028118insT	ENST00000240316.4	-	2	519_520	c.485_486insA	c.(484-486)aacfs	p.N162fs		NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin	162						Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					TTTTTCTCTTGTTTTTTTTGCT	0.366																																							uc002iuu.2		NA																	0				ovary(1)	1						c.(484-486)AACfs		coilin																																				SO:0001589	frameshift_variant	8161					Cajal body|nucleolus	protein C-terminus binding	g.chr17:55028117_55028118insT	U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.486dupA	17.37:g.55028125_55028125dupT	ENSP00000240316:p.Asn162fs						p.N162fs	NM_004645	NP_004636	P38432	COIL_HUMAN			2	516_517	-	Breast(9;6.15e-08)		162					B2R931	Frame_Shift_Ins	INS	ENST00000240316.4	37	c.485_486insA	CCDS11592.1																																																																																				0.366	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440618.1			8	279	NA	NA	NA	NA	NA	8	279	---	---	---	---
GGA3	23163	broad.mit.edu	37	17	73235600	73235601	+	In_Frame_Ins	INS	-	-	GGT	rs150787028|rs376666665	byFrequency	TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr17:73235600_73235601insGGT	ENST00000245541.6	-	14	1851_1852	c.1635_1636insACC	c.(1633-1638)acccca>accACCcca	p.545_546insT	GGA3_ENST00000538886.1_In_Frame_Ins_p.423_424insT|GGA3_ENST00000351904.7_In_Frame_Ins_p.512_513insT|GGA3_ENST00000582486.1_In_Frame_Ins_p.473_474insT|GGA3_ENST00000582717.1_In_Frame_Ins_p.473_474insT|GGA3_ENST00000578348.1_In_Frame_Ins_p.423_424insT	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	545	Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			GGCCTGGCTGGGGTGGTGGTGG	0.673											OREG0024729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		75	0.014976	0.0492	0.0144	5008	,	,		13233	0.0		0.0	False		,,,				2504	0.0						uc002jni.1		NA																	0				ovary(1)|breast(1)	2						c.(1633-1638)insACC		ADP-ribosylation factor binding protein 3			,,,	216,3884		19,178,1853					,,,	-3.7	0.0		dbSNP_134	18	2,8026		0,2,4012	no	coding,coding,coding,coding	GGA3	NM_138619.2,NM_014001.3,NM_001172704.1,NM_001172703.1	,,,	19,180,5865	A1A1,A1R,RR		0.0249,5.2683,1.7975	,,,	,,,		218,11910				SO:0001652	inframe_insertion	23163				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding	g.chr17:73235600_73235601insGGT	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.1633_1635dupACC	17.37:g.73235607_73235609dupGGT	ENSP00000245541:p.Thr545_Thr545dup		OREG0024729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1143	GGA3_uc002jnj.1_In_Frame_Ins_p.512_513insT|GGA3_uc010wrw.1_In_Frame_Ins_p.423_424insT|GGA3_uc002jnk.1_In_Frame_Ins_p.473_474insT|GGA3_uc010wrx.1_In_Frame_Ins_p.423_424insT|GGA3_uc010wry.1_In_Frame_Ins_p.473_474insT	p.545_546insT	NM_138619	NP_619525	Q9NZ52	GGA3_HUMAN	all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)		14	1644_1645	-			545_546			Unstructured hinge.		B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	In_Frame_Ins	INS	ENST00000245541.6	37	c.1635_1636insACC	CCDS11717.1																																																																																				0.673	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619		5	5	NA	NA	NA	NA	NA	5	5	---	---	---	---
ROCK1	6093	broad.mit.edu	37	18	18622550	18622550	+	Frame_Shift_Del	DEL	C	C	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr18:18622550delC	ENST00000399799.2	-	7	1736	c.796delG	c.(796-798)gtafs	p.V266fs		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					TATAAAAATACCCCAACCGAC	0.383																																							uc002kte.2		NA																	0				lung(2)|breast(2)|central_nervous_system(1)	5						c.(796-798)GTAfs		Rho-associated, coiled-coil containing protein							105.0	96.0	99.0					18																	18622550		2203	4300	6503	SO:0001589	frameshift_variant	6093				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity	g.chr18:18622550delC		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.796delG	18.37:g.18622550delC	ENSP00000382697:p.Val266fs						p.V266fs	NM_005406	NP_005397	Q13464	ROCK1_HUMAN			7	1737	-	Melanoma(1;0.165)		266			Protein kinase.		B0YJ91|Q2KHM4|Q59GZ4	Frame_Shift_Del	DEL	ENST00000399799.2	37	c.796delG	CCDS11870.2																																																																																				0.383	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406		7	35	NA	NA	NA	NA	NA	7	35	---	---	---	---
MAN2B1	4125	broad.mit.edu	37	19	12774515	12774515	+	Splice_Site	DEL	A	A	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr19:12774515delA	ENST00000456935.2	-	5	804		c.e5+1		MAN2B1_ENST00000221363.4_Splice_Site	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1						cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CAAGCCCCCTACCAGTGAAGA	0.587																																							uc002mub.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.e5+1		mannosidase, alpha, class 2B, member 1							13.0	13.0	13.0					19																	12774515		2201	4297	6498	SO:0001630	splice_region_variant	4125				protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding	g.chr19:12774515delA		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.763+1T>-	19.37:g.12774515delA						MAN2B1_uc010dyv.1_Splice_Site_p.G255_splice	p.G255_splice	NM_000528	NP_000519	O00754	MA2B1_HUMAN			5	839	-								G5E928|O15330|Q16680|Q93094|Q9BW13	Splice_Site	DEL	ENST00000456935.2	37	c.763_splice	CCDS32919.1																																																																																				0.587	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1		Intron	5	11	NA	NA	NA	NA	NA	5	11	---	---	---	---
PSME4	23198	broad.mit.edu	37	2	54122188	54122188	+	Frame_Shift_Del	DEL	C	C	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:54122188delC	ENST00000404125.1	-	34	3923	c.3868delG	c.(3868-3870)gaafs	p.E1291fs	PSME4_ENST00000421748.2_Frame_Shift_Del_p.E435fs	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1291					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GGCTGCTCTTCCACACCAGCA	0.378																																							uc002rxp.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(3868-3870)GAAfs		proteasome (prosome, macropain) activator							187.0	164.0	172.0					2																	54122188		2203	4300	6503	SO:0001589	frameshift_variant	23198				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding	g.chr2:54122188delC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.3868delG	2.37:g.54122188delC	ENSP00000384211:p.Glu1291fs					PSME4_uc010yop.1_Frame_Shift_Del_p.E1176fs|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Frame_Shift_Del_p.E665fs|PSME4_uc010fbv.1_Frame_Shift_Del_p.E434fs	p.E1290fs	NM_014614	NP_055429	Q14997	PSME4_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		34	3924	-			1290					Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Frame_Shift_Del	DEL	ENST00000404125.1	37	c.3868delG	CCDS33197.2																																																																																				0.378	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158		11	153	NA	NA	NA	NA	NA	11	153	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179597015	179597015	+	Frame_Shift_Del	DEL	T	T	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr2:179597015delT	ENST00000591111.1	-	55	15954	c.15730delA	c.(15730-15732)accfs	p.T5244fs	TTN_ENST00000589042.1_Frame_Shift_Del_p.T5561fs|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342992.6_Frame_Shift_Del_p.T4317fs|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12063	Ig-like 33.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTAGCTGGGTGGCATCTCCC	0.408																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(12949-12951)ACCfs		titin isoform N2-A							120.0	115.0	117.0					2																	179597015		1898	4134	6032	SO:0001589	frameshift_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179597015delT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.15730delA	2.37:g.179597015delT	ENSP00000465570:p.Thr5244fs					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Frame_Shift_Del_p.T978fs	p.T4317fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		54	13173	-			5244					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	37	c.12949delA																																																																																					0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		15	142	NA	NA	NA	NA	NA	15	142	---	---	---	---
SUN5	140732	broad.mit.edu	37	20	31577467	31577467	+	Frame_Shift_Del	DEL	C	C	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr20:31577467delC	ENST00000356173.3	-	9	664	c.572delG	c.(571-573)ggafs	p.G191fs	SUN5_ENST00000375523.3_Frame_Shift_Del_p.G166fs	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	191					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						GATGTAATCTCCGTGTATCAT	0.488																																							uc002wyi.2		NA																	0				skin(1)	1						c.(571-573)GGAfs		sperm associated antigen 4-like							232.0	175.0	195.0					20																	31577467		2203	4300	6503	SO:0001589	frameshift_variant	140732				spermatogenesis			g.chr20:31577467delC	AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.572delG	20.37:g.31577467delC	ENSP00000348496:p.Gly191fs						p.G191fs	NM_080675	NP_542406	Q8TC36	SUN5_HUMAN			9	665	-			191					A6NJ82|Q5T9R0	Frame_Shift_Del	DEL	ENST00000356173.3	37	c.572delG	CCDS13209.1																																																																																				0.488	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078659.1	NM_080675		12	71	NA	NA	NA	NA	NA	12	71	---	---	---	---
MYH9	4627	broad.mit.edu	37	22	36737461	36737462	+	Frame_Shift_Ins	INS	-	-	G			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr22:36737461_36737462insG	ENST00000216181.5	-	3	673_674	c.443_444insC	c.(442-444)cctfs	p.P148fs	MYH9_ENST00000401701.1_Frame_Shift_Ins_p.P148fs	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	148	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CATAGATGTGAGGGGGCATCTC	0.53			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														uc003apg.2		NA		Dom	yes		22	22q13.1	4627	T	"""myosin, heavy polypeptide 9, non-muscle"""	yes	Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome	L	ALK		ALCL		0				breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						c.(442-444)CCTfs		myosin, heavy polypeptide 9, non-muscle																																				SO:0001589	frameshift_variant	4627	Hereditary_Macrothrombocytopenia_MYH9-associated	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity	g.chr22:36737461_36737462insG		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.444dupC	22.37:g.36737466_36737466dupG	ENSP00000216181:p.Pro148fs					MYH9_uc003aph.1_Frame_Shift_Ins_p.P12fs|MYH9_uc003api.1_Frame_Shift_Ins_p.P148fs	p.P148fs	NM_002473	NP_002464	P35579	MYH9_HUMAN			3	674_675	-			148			Myosin head-like.		A8K6E4|O60805|Q60FE2|Q86T83	Frame_Shift_Ins	INS	ENST00000216181.5	37	c.443_444insC	CCDS13927.1																																																																																				0.530	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473		12	115	NA	NA	NA	NA	NA	12	115	---	---	---	---
JADE2	23338	broad.mit.edu	37	5	133914622	133914622	+	Frame_Shift_Del	DEL	A	A	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr5:133914622delA	ENST00000282605.4	+	12	2206	c.2120delA	c.(2119-2121)gacfs	p.D707fs	PHF15_ENST00000395003.1_Frame_Shift_Del_p.D663fs|PHF15_ENST00000361895.2_Frame_Shift_Del_p.D664fs|PHF15_ENST00000402835.1_3'UTR																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCAGCCGGGGACTGTCCCATC	0.657																																							uc003kzo.1		NA																	0					0						c.(1987-1989)GACfs		PHD finger protein 15							60.0	70.0	67.0					5																	133914622		2203	4300	6503	SO:0001589	frameshift_variant	23338				histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding	g.chr5:133914622delA																												ENST00000282605.4:c.2120delA	5.37:g.133914622delA	ENSP00000282605:p.Asp707fs					PHF15_uc011cxt.1_Frame_Shift_Del_p.D707fs|PHF15_uc003kzk.2_Frame_Shift_Del_p.D723fs|PHF15_uc003kzm.2_Frame_Shift_Del_p.D664fs|PHF15_uc003kzn.2_3'UTR	p.D663fs	NM_015288	NP_056103	Q9NQC1	JADE2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		11	2167	+			663			Pro-rich.			Frame_Shift_Del	DEL	ENST00000282605.4	37	c.1988delA																																																																																					0.657	PHF15-003	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251170.1			25	127	NA	NA	NA	NA	NA	25	127	---	---	---	---
PTCD1	26024	broad.mit.edu	37	7	99031015	99031016	+	Frame_Shift_Ins	INS	-	-	A			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:99031015_99031016insA	ENST00000292478.4	-	3	729_730	c.479_480insT	c.(478-480)gagfs	p.E160fs	ATP5J2-PTCD1_ENST00000413834.1_Frame_Shift_Ins_p.E209fs|PTCD1_ENST00000555673.1_Frame_Shift_Ins_p.E209fs|ATP5J2-PTCD1_ENST00000437572.1_5'Flank|PTCD1_ENST00000485746.1_5'UTR	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	160					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GCATCTGCCTCTCAAACAGGTC	0.604																																							uc003uqh.2		NA																	0				ovary(1)	1						c.(478-480)GAGfs		pentatricopeptide repeat domain 1																																				SO:0001589	frameshift_variant	26024							g.chr7:99031015_99031016insA	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.479_480insT	7.37:g.99031015_99031016insA	ENSP00000292478:p.Glu160fs					PTCD1_uc011kiw.1_Frame_Shift_Ins_p.E209fs	p.E160fs	NM_015545	NP_056360	O75127	PTCD1_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		3	610_611	-	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		160			PPR 1.		Q3ZB78|Q66K60|Q9UDV2	Frame_Shift_Ins	INS	ENST00000292478.4	37	c.479_480insT	CCDS34691.1																																																																																				0.604	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545		70	120	NA	NA	NA	NA	NA	70	120	---	---	---	---
AGAP3	116988	broad.mit.edu	37	7	150839627	150839628	+	Frame_Shift_Ins	INS	-	-	T			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr7:150839627_150839628insT	ENST00000463381.1	+	14	1682_1683	c.1186_1187insT	c.(1186-1188)ctgfs	p.L396fs	AGAP3_ENST00000397238.2_Frame_Shift_Ins_p.L727fs	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	691	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						GCCTGAGCTGCTGGCTGTCATG	0.649																																							uc003wjg.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(2179-2181)CTGfs		centaurin, gamma 3 isoform a																																				SO:0001589	frameshift_variant	116988				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding	g.chr7:150839627_150839628insT	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.1187dupT	7.37:g.150839628_150839628dupT	ENSP00000418016:p.Leu396fs					AGAP3_uc003wje.1_Frame_Shift_Ins_p.L396fs|AGAP3_uc003wjj.1_Frame_Shift_Ins_p.L226fs|AGAP3_uc003wjk.1_Frame_Shift_Ins_p.L145fs	p.L727fs	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN			16	2182_2183	+			691			Arf-GAP.		B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Frame_Shift_Ins	INS	ENST00000463381.1	37	c.2179_2180insT																																																																																					0.649	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000351909.2	NM_031946		17	135	NA	NA	NA	NA	NA	17	135	---	---	---	---
TEX15	56154	broad.mit.edu	37	8	30701975	30701975	+	Frame_Shift_Del	DEL	T	T	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr8:30701975delT	ENST00000256246.2	-	1	4633	c.4559delA	c.(4558-4560)aatfs	p.N1520fs		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1520					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AGTGGTAGTATTTTTAGTGCT	0.353																																							uc003xil.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(4558-4560)AATfs		testis expressed 15							170.0	174.0	173.0					8																	30701975		2203	4299	6502	SO:0001589	frameshift_variant	56154							g.chr8:30701975delT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.4559delA	8.37:g.30701975delT	ENSP00000256246:p.Asn1520fs						p.N1520fs	NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	4559	-			1520						Frame_Shift_Del	DEL	ENST00000256246.2	37	c.4559delA	CCDS6080.1																																																																																				0.353	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			23	111	NA	NA	NA	NA	NA	23	111	---	---	---	---
HRCT1	646962	broad.mit.edu	37	9	35906598	35906599	+	In_Frame_Ins	INS	-	-	CCC	rs565823201		TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chr9:35906598_35906599insCCC	ENST00000354323.2	+	1	410_411	c.314_315insCCC	c.(313-318)cacccc>caCCCcccc	p.106_107insP	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	106	His-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						caccaccaccacccccaccgcc	0.673																																							uc003zyr.1		NA																	0					0						c.(313-315)CAC>CACCCC		histidine rich carboxyl terminus 1																																				SO:0001652	inframe_insertion	646962					integral to membrane		g.chr9:35906598_35906599insCCC		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.315_317dupCCC	9.37:g.35906599_35906601dupCCC	ENSP00000346283:p.Pro106_Pro106dup					LOC158376_uc003zys.1_5'Flank	p.106_107insP	NM_001039792	NP_001034881	Q6UXD1	HRCT1_HUMAN			1	410_411	+			106_107			His-rich.		B7ZBJ1	In_Frame_Ins	INS	ENST00000354323.2	37	c.314_315insCCC	CCDS35012.1																																																																																				0.673	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1	NM_001039792		3	6	NA	NA	NA	NA	NA	3	6	---	---	---	---
ATP11C	286410	broad.mit.edu	37	X	138827926	138827926	+	Frame_Shift_Del	DEL	C	C	-			TCGA-38-4632-01A-01D-1753-08	TCGA-38-4632-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	83519ed1-29e2-4f1b-922c-5779f64178bc	8709a767-d5d1-4ab8-aa7a-085c742d1e85	g.chrX:138827926delC	ENST00000327569.3	-	25	3026	c.2928delG	c.(2926-2928)gggfs	p.G976fs	ATP11C_ENST00000370543.1_Frame_Shift_Del_p.G976fs|ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000359686.2_Frame_Shift_Del_p.G976fs|ATP11C_ENST00000370557.1_Frame_Shift_Del_p.G970fs|ATP11C_ENST00000361648.2_Frame_Shift_Del_p.G976fs	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	976					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.G976G(2)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GAAAGTAAGTCCCAAAGAAGA	0.388																																							uc004faz.2		NA																	2	Substitution - coding silent(2)		kidney(2)	ovary(5)|large_intestine(3)	8						c.(2926-2928)GGGfs		ATPase, class VI, type 11C isoform a							91.0	81.0	84.0					X																	138827926		2203	4300	6503	SO:0001589	frameshift_variant	286410				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chrX:138827926delC	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.2928delG	X.37:g.138827926delC	ENSP00000332756:p.Gly976fs					ATP11C_uc004fax.2_Frame_Shift_Del_p.G184fs|ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Frame_Shift_Del_p.G976fs	p.G976fs	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN			25	3027	-	Acute lymphoblastic leukemia(192;0.000127)		976			Helical; (Potential).		Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Frame_Shift_Del	DEL	ENST00000327569.3	37	c.2928delG	CCDS14668.1																																																																																				0.388	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694		11	27	NA	NA	NA	NA	NA	11	27	---	---	---	---
