#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CLSTN1	22883	broad.mit.edu	37	1	9801204	9801204	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:9801204C>A	ENST00000377298.4	-	10	2259	c.1467G>T	c.(1465-1467)ccG>ccT	p.P489P	CLSTN1_ENST00000377288.3_Silent_p.P489P|CLSTN1_ENST00000361311.4_Silent_p.P479P	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	489					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)	p.P489P(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		ATGGATGGAGCGGGTAATCCT	0.537																																							uc001aqh.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1465-1467)CCG>CCT		calsyntenin 1 isoform 1							120.0	110.0	113.0					1																	9801204		2203	4300	6503	SO:0001819	synonymous_variant	22883				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding	g.chr1:9801204C>A	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.1467G>T	1.37:g.9801204C>A						CLSTN1_uc001aqi.2_Silent_p.P479P|CLSTN1_uc010oag.1_Silent_p.P489P	p.P489P	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)	10	2226	-	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	489			Extracellular (Potential).		A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Silent	SNP	ENST00000377298.4	37	c.1467G>T	CCDS30580.1																																																																																				0.537	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1			26	124	1	0	3.1745e-13	0.008361	4.87788e-13	26	124				
CLCNKA	1187	broad.mit.edu	37	1	16355272	16355272	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:16355272G>A	ENST00000331433.4	+	11	1004	c.985G>A	c.(985-987)Gct>Act	p.A329T	CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000375692.1_Missense_Mutation_p.A329T|CLCNKA_ENST00000439316.2_Missense_Mutation_p.A286T|CLCNKA_ENST00000420078.1_Missense_Mutation_p.A329T			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	329					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)	p.A329T(1)		breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	TGTGTACTCCGCTCTGGCCAC	0.642																																							uc001axu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(985-987)GCT>ACT		chloride channel Ka isoform 1	Niflumic Acid(DB04552)						190.0	137.0	155.0					1																	16355272		2203	4300	6503	SO:0001583	missense	1187				excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity	g.chr1:16355272G>A		CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.985G>A	1.37:g.16355272G>A	ENSP00000332771:p.Ala329Thr					CLCNKA_uc001axt.2_RNA|CLCNKA_uc001axv.2_Missense_Mutation_p.A329T|CLCNKA_uc010obw.1_Missense_Mutation_p.A286T|CLCNKB_uc001axw.3_Intron|CLCNKA_uc010obx.1_5'UTR|CLCNKA_uc010oby.1_Missense_Mutation_p.R58H	p.A329T	NM_004070	NP_004061	P51800	CLCKA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	11	1065	+		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)	329			Helical; (Potential).		B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	ENST00000331433.4	37	c.985G>A	CCDS167.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604900	0.66445	.	.	ENSG00000186510	ENST00000375692;ENST00000420078;ENST00000439316;ENST00000331433	D;D;D;D	0.94897	-3.55;-3.55;-3.55;-3.55	3.37	3.37	0.38596	Chloride channel, core (2);	0.224003	0.43919	D	0.000509	D	0.94368	0.8189	L	0.59436	1.845	0.28335	N	0.921587	P;D;D	0.55800	0.952;0.973;0.973	P;P;P	0.51487	0.577;0.671;0.671	D	0.90488	0.4465	10	0.62326	D	0.03	.	14.2065	0.65737	0.0:0.0:1.0:0.0	.	286;329;329	E7EPH6;Q5T5Q4;P51800	.;.;CLCKA_HUMAN	T	329;329;286;329	ENSP00000364844:A329T;ENSP00000410353:A329T;ENSP00000414445:A286T;ENSP00000332771:A329T	ENSP00000332771:A329T	A	+	1	0	CLCNKA	16227859	0.000000	0.05858	0.022000	0.16811	0.047000	0.14425	0.489000	0.22387	1.885000	0.54596	0.313000	0.20887	GCT		0.642	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1			8	206	0	0	0	0.004482	0	8	206				
C1QB	713	broad.mit.edu	37	1	22986035	22986035	+	Missense_Mutation	SNP	T	T	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:22986035T>G	ENST00000314933.6	+	2	218	c.86T>G	c.(85-87)cTc>cGc	p.L29R	C1QB_ENST00000509305.1_Missense_Mutation_p.L27R	NM_000491.3	NP_000482.3	P02746	C1QB_HUMAN	complement component 1, q subcomponent, B chain	29					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|inner ear development (GO:0048839)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|complement component C1 complex (GO:0005602)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)		p.L29R(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(9)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.06e-27)|Colorectal(126;1.58e-07)|GBM - Glioblastoma multiforme(114;6.72e-06)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000551)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CAGGCCCAGCTCAGCTGCACC	0.607																																							uc001bgd.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(85-87)CTC>CGC		complement component 1, q subcomponent, B chain	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						59.0	54.0	55.0					1																	22986035		2203	4300	6503	SO:0001583	missense	713				complement activation, classical pathway|innate immune response	collagen|complement component C1 complex		g.chr1:22986035T>G	X03084	CCDS228.1	1p36.3-p34.1	2014-09-17	2006-02-09		ENSG00000173369	ENSG00000173369		"""Complement system"""	1242	protein-coding gene	gene with protein product		120570	"""complement component 1, q subcomponent, beta polypeptide"""			1537612	Standard	XM_005245982		Approved		uc001bgd.3	P02746	OTTHUMG00000002896	ENST00000314933.6:c.86T>G	1.37:g.22986035T>G	ENSP00000313967:p.Leu29Arg						p.L29R	NM_000491	NP_000482	P02746	C1QB_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.06e-27)|Colorectal(126;1.58e-07)|GBM - Glioblastoma multiforme(114;6.72e-06)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000551)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)	2	218	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	29					Q5T959|Q96H17	Missense_Mutation	SNP	ENST00000314933.6	37	c.86T>G	CCDS228.1	.	.	.	.	.	.	.	.	.	.	T	4.210	0.037758	0.08148	.	.	ENSG00000173369	ENST00000510260;ENST00000509305;ENST00000432749;ENST00000314933	D;D;D;D	0.90324	-2.65;-2.58;-2.65;-2.56	4.61	0.414	0.16406	.	0.909671	0.09534	N	0.789082	D	0.83083	0.5177	L	0.43923	1.385	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.64736	-0.6337	10	0.17369	T	0.5	.	4.3151	0.10990	0.1859:0.0:0.4984:0.3158	.	29	P02746	C1QB_HUMAN	R	27;27;27;29	ENSP00000426317:L27R;ENSP00000423689:L27R;ENSP00000404606:L27R;ENSP00000313967:L29R	ENSP00000313967:L29R	L	+	2	0	C1QB	22858622	0.000000	0.05858	0.782000	0.31804	0.014000	0.08584	-0.046000	0.11983	0.134000	0.18681	-0.266000	0.10368	CTC		0.607	C1QB-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_000491		9	77	0	0	0	0.004482	0	9	77				
DLGAP3	58512	broad.mit.edu	37	1	35370069	35370069	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:35370069C>A	ENST00000373347.1	-	3	1184	c.916G>T	c.(916-918)Ggc>Tgc	p.G306C	DLGAP3_ENST00000495979.1_5'Flank|DLGAP3_ENST00000235180.4_Missense_Mutation_p.G306C			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	306					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)	p.G306C(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				TCCGACCCGCCCGAGCGCCCC	0.652																																							uc001byc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(916-918)GGC>TGC		discs, large (Drosophila) homolog-associated							44.0	47.0	46.0					1																	35370069		2203	4300	6503	SO:0001583	missense	58512				cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane		g.chr1:35370069C>A	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.916G>T	1.37:g.35370069C>A	ENSP00000362444:p.Gly306Cys						p.G306C	NM_001080418	NP_001073887	O95886	DLGP3_HUMAN			1	916	-		Myeloproliferative disorder(586;0.0393)	306					Q5TDD5|Q9H3X7	Missense_Mutation	SNP	ENST00000373347.1	37	c.916G>T	CCDS30670.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963435	0.53507	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.29397	1.57;1.57	4.49	1.52	0.23074	.	0.164142	0.52532	D	0.000061	T	0.35038	0.0918	L	0.40543	1.245	0.38958	D	0.958494	D	0.71674	0.998	P	0.60173	0.87	T	0.17440	-1.0369	10	0.72032	D	0.01	-11.6	5.4206	0.16398	0.1371:0.5716:0.0:0.2914	.	306	O95886	DLGP3_HUMAN	C	306	ENSP00000362444:G306C;ENSP00000235180:G306C	ENSP00000235180:G306C	G	-	1	0	DLGAP3	35142656	0.695000	0.27747	0.442000	0.26870	0.994000	0.84299	2.840000	0.48215	0.229000	0.21039	0.655000	0.94253	GGC		0.652	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234		58	76	1	0	7.89702e-26	0.01441	1.39056e-25	58	76				
MACF1	23499	broad.mit.edu	37	1	39945556	39945556	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:39945556G>T	ENST00000372915.3	+	95	21742	c.21655G>T	c.(21655-21657)Ggt>Tgt	p.G7219C	MACF1_ENST00000289893.4_Missense_Mutation_p.G5769C|MACF1_ENST00000567887.1_Missense_Mutation_p.G7386C|MACF1_ENST00000564288.1_Missense_Mutation_p.G7349C|MACF1_ENST00000539005.1_Missense_Mutation_p.G5131C|MACF1_ENST00000317713.7_Missense_Mutation_p.G5261C|MACF1_ENST00000545844.1_Missense_Mutation_p.G5261C|MACF1_ENST00000361689.2_Missense_Mutation_p.G5261C			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	7219	C-terminal tail. {ECO:0000250}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.G5769C(1)|p.G5261C(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCGCTCACGGGGTCGAAGGTC	0.512																																							uc010oiu.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(17305-17307)GGT>TGT		microfilament and actin filament cross-linker							99.0	83.0	88.0					1																	39945556		2203	4300	6503	SO:0001583	missense	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39945556G>T	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.21655G>T	1.37:g.39945556G>T	ENSP00000362006:p.Gly7219Cys					MACF1_uc010ois.1_Missense_Mutation_p.G5261C|MACF1_uc001cde.1_Missense_Mutation_p.G138C|MACF1_uc001cdf.1_Missense_Mutation_p.G144C|MACF1_uc001cdg.2_Missense_Mutation_p.G52C|MACF1_uc001cdh.2_Missense_Mutation_p.G52C	p.G5769C	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		62	17436	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	7219			C-terminal tail (By similarity).		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37	c.17305G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.267544|5.267544	0.95399|0.95399	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893;ENST00000539218;ENST00000422234|ENST00000372925;ENST00000446276	T;T;T;T;T;T|.	0.65549|.	-0.13;-0.04;-0.13;-0.16;0.05;1.03|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000010|0.000010	T|T	0.74658|0.74658	0.3745|0.3745	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;0.999;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;0.978;1.0;0.999;1.0;1.0|.	T|T	0.70483|0.70483	-0.4859|-0.4859	9|6	.|.	.|.	.|.	.|.	20.2983|20.2983	0.98569|0.98569	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	7219;5261;4264;52;5769;161|.	Q9UPN3;F8W8Q1;B1ALC4;Q9H8U2;Q96PK2;B1ANQ7|.	MACF1_HUMAN;.;.;.;MACF4_HUMAN;.|.	C|V	5261;7219;5261;5261;5131;5769;138;123|4264;248	ENSP00000439537:G5261C;ENSP00000362006:G7219C;ENSP00000354573:G5261C;ENSP00000313438:G5261C;ENSP00000444364:G5131C;ENSP00000289893:G5769C|.	.|.	G|G	+|+	1|2	0|0	MACF1|MACF1	39718143|39718143	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.983000|0.983000	0.72400|0.72400	9.394000|9.394000	0.97261|0.97261	2.802000|2.802000	0.96397|0.96397	0.655000|0.655000	0.94253|0.94253	GGT|GGG		0.512	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		41	67	1	0	6.5261e-18	0.00874	1.08513e-17	41	67				
BSND	7809	broad.mit.edu	37	1	55474212	55474212	+	Missense_Mutation	SNP	G	G	A	rs267598659		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:55474212G>A	ENST00000371265.4	+	4	1128	c.874G>A	c.(874-876)Gag>Aag	p.E292K		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	292					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)	p.E292K(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						TGAGAAGGAAGAGGAAGACCT	0.587																																					Ovarian(191;1657 2078 22894 42033 48899)	Ovarian(191;1657 2078 22894 42033 48899)	uc001cye.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(874-876)GAG>AAG		barttin							97.0	92.0	93.0					1																	55474212		2203	4300	6503	SO:0001583	missense	7809					basolateral plasma membrane|cytoplasm|integral to plasma membrane|protein complex		g.chr1:55474212G>A	AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.874G>A	1.37:g.55474212G>A	ENSP00000360312:p.Glu292Lys						p.E292K	NM_057176	NP_476517	Q8WZ55	BSND_HUMAN			4	1117	+			292			Cytoplasmic (Potential).		Q6NT28	Missense_Mutation	SNP	ENST00000371265.4	37	c.874G>A	CCDS602.1	.	.	.	.	.	.	.	.	.	.	G	18.29	3.591757	0.66219	.	.	ENSG00000162399	ENST00000371265	D	0.91843	-2.92	4.72	4.72	0.59763	.	0.738127	0.12548	N	0.459286	D	0.92388	0.7584	M	0.68317	2.08	0.31715	N	0.63906	P	0.40731	0.728	B	0.43623	0.425	D	0.92205	0.5771	10	0.44086	T	0.13	-8.3783	15.979	0.80091	0.0:0.0:1.0:0.0	.	292	Q8WZ55	BSND_HUMAN	K	292	ENSP00000360312:E292K	ENSP00000360312:E292K	E	+	1	0	BSND	55246800	1.000000	0.71417	0.989000	0.46669	0.201000	0.24016	5.534000	0.67167	2.597000	0.87782	0.549000	0.68633	GAG		0.587	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022213.4	NM_057176		14	161	0	0	0	0.004007	0	14	161				
USP24	23358	broad.mit.edu	37	1	55566576	55566576	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:55566576T>A	ENST00000294383.6	-	44	5206	c.5207A>T	c.(5206-5208)cAg>cTg	p.Q1736L	USP24_ENST00000407756.1_Missense_Mutation_p.Q1576L	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1736	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.Q1736L(1)|p.Q1653L(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AAAGAGAGACTGCACTTGGTA	0.363																																							uc001cyg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|kidney(6)|breast(1)	13						c.(4726-4728)CAG>CTG		ubiquitin specific protease 24							122.0	115.0	117.0					1																	55566576		1886	4099	5985	SO:0001583	missense	23358				ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr1:55566576T>A	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.5207A>T	1.37:g.55566576T>A	ENSP00000294383:p.Gln1736Leu						p.Q1576L	NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN			41	4727	-			1736					Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	c.4727A>T	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	T	28.5	4.924143	0.92319	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.61158	0.13;0.13	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.80747	0.4682	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85061	0.0934	10	0.87932	D	0	.	15.9347	0.79694	0.0:0.0:0.0:1.0	.	1576	B7WPF4	.	L	1736;1576	ENSP00000294383:Q1736L;ENSP00000385700:Q1576L	ENSP00000294383:Q1736L	Q	-	2	0	USP24	55339164	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.698000	0.84413	2.167000	0.68274	0.454000	0.30748	CAG		0.363	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			8	64	0	0	0	0.004482	0	8	64				
C1orf168	199920	broad.mit.edu	37	1	57209875	57209875	+	Silent	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:57209875A>G	ENST00000343433.6	-	10	1532	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	484								p.S484S(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						CCGAGATGGAACTTGTCTTAG	0.418																																							uc001cym.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)	5						c.(1450-1452)AGT>AGC		hypothetical protein LOC199920							134.0	133.0	134.0					1																	57209875		2203	4300	6503	SO:0001819	synonymous_variant	199920							g.chr1:57209875A>G	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.1452T>C	1.37:g.57209875A>G						C1orf168_uc009vzu.1_RNA|C1orf168_uc001cyl.2_RNA	p.S484S	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN			10	1858	-			484					Q63HM3|Q6ZUY6	Silent	SNP	ENST00000343433.6	37	c.1452T>C	CCDS30729.1																																																																																				0.418	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303		17	130	0	0	0	0.007413	0	17	130				
DAB1	1600	broad.mit.edu	37	1	57756646	57756646	+	Silent	SNP	G	G	T	rs187718590		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:57756646G>T	ENST00000371231.1	-	1	91	c.57C>A	c.(55-57)tcC>tcA	p.S19S	DAB1_ENST00000439789.2_Silent_p.S19S|DAB1_ENST00000420954.2_Silent_p.S19S|DAB1_ENST00000371234.4_Silent_p.S19S|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371236.2_Silent_p.S19S|DAB1_ENST00000371230.1_Silent_p.S19S|DAB1_ENST00000414851.2_Silent_p.S19S			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	19					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.S19S(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CTTTCTTTCTGGAGTCTTTCT	0.408																																							uc001cys.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(55-57)TCC>TCA		disabled homolog 1							146.0	135.0	139.0					1																	57756646		2203	4300	6503	SO:0001819	synonymous_variant	1600				cell differentiation|nervous system development			g.chr1:57756646G>T	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.57C>A	1.37:g.57756646G>T						DAB1_uc001cyt.1_Silent_p.S19S|DAB1_uc001cyq.1_Silent_p.S19S|DAB1_uc001cyr.1_Silent_p.S19S|DAB1_uc009vzw.1_Silent_p.S19S|DAB1_uc009vzx.1_Silent_p.S19S	p.S19S	NM_021080	NP_066566	O75553	DAB1_HUMAN			4	731	-			19					A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	ENST00000371231.1	37	c.57C>A																																																																																					0.408	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080		23	109	1	0	1.22574e-08	0.014323	1.63914e-08	23	109				
IL23R	149233	broad.mit.edu	37	1	67685289	67685289	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:67685289G>T	ENST00000347310.5	+	7	1002	c.831G>T	c.(829-831)gtG>gtT	p.V277V	IL23R_ENST00000473881.1_3'UTR|IL23R_ENST00000371002.1_Silent_p.V277V|C1orf141_ENST00000371007.2_Intron|IL23R_ENST00000395227.1_Silent_p.V22V	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	277	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)		p.V277V(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						TTACATATGTGCAACAGTCAG	0.343																																							uc001ddo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(829-831)GTG>GTT		interleukin 23 receptor precursor							91.0	92.0	92.0					1																	67685289		2203	4300	6503	SO:0001819	synonymous_variant	149233				inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity	g.chr1:67685289G>T	AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.831G>T	1.37:g.67685289G>T						IL23R_uc009waz.2_Silent_p.V74V|IL23R_uc001ddp.2_RNA|IL23R_uc010opi.1_Intron|IL23R_uc010opj.1_5'UTR|IL23R_uc010opk.1_Silent_p.V234V|IL23R_uc010opl.1_5'UTR|IL23R_uc010opm.1_RNA|IL23R_uc001ddq.2_Silent_p.V23V|IL23R_uc010opn.1_Silent_p.V122V|IL23R_uc001ddr.2_RNA|IL23R_uc010opo.1_Silent_p.V136V|IL23R_uc010opp.1_Intron|IL23R_uc010opq.1_Silent_p.V136V|IL23R_uc010opr.1_RNA|IL23R_uc010ops.1_Silent_p.V74V|IL23R_uc010opt.1_Intron|IL23R_uc010opu.1_Intron|IL23R_uc010opv.1_Intron|IL23R_uc010opw.1_5'UTR|IL23R_uc010opx.1_Intron|IL23R_uc010opy.1_Silent_p.V74V|IL23R_uc010opz.1_5'UTR|IL23R_uc010oqa.1_5'UTR|IL23R_uc010oqb.1_Silent_p.V136V|IL23R_uc010oqc.1_Silent_p.V23V|IL23R_uc010oqd.1_5'UTR|IL23R_uc010oqe.1_5'UTR|IL23R_uc010oqf.1_5'UTR|IL23R_uc010oqg.1_5'UTR|IL23R_uc010oqh.1_5'UTR|IL23R_uc001dds.2_Silent_p.V22V|IL23R_uc001ddt.2_5'UTR	p.V277V	NM_144701	NP_653302	Q5VWK5	IL23R_HUMAN			7	916	+			277			Extracellular (Potential).|Fibronectin type-III 2.		C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Silent	SNP	ENST00000347310.5	37	c.831G>T	CCDS637.1	.	.	.	.	.	.	.	.	.	.	G	0.485	-0.877921	0.02550	.	.	ENSG00000162594	ENST00000540775;ENST00000425614	.	.	.	4.79	0.103	0.14526	.	.	.	.	.	T	0.32346	0.0826	.	.	.	0.35635	D	0.810537	.	.	.	.	.	.	T	0.13926	-1.0491	4	.	.	.	-19.8081	8.254	0.31743	0.3843:0.0:0.6157:0.0	.	.	.	.	F	130;39	.	.	C	+	2	0	IL23R	67457877	0.012000	0.17670	0.064000	0.19789	0.253000	0.25986	0.373000	0.20484	-0.073000	0.12842	0.650000	0.86243	TGC		0.343	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025199.2	NM_144701		26	72	1	0	5.45024e-15	0.00333	8.68058e-15	26	72				
GBP5	115362	broad.mit.edu	37	1	89730452	89730452	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:89730452T>C	ENST00000370459.3	-	7	1193	c.1066A>G	c.(1066-1068)Agg>Ggg	p.R356G	GBP5_ENST00000343435.5_Missense_Mutation_p.R356G|GBP5_ENST00000471171.1_5'Flank|RP4-620F22.2_ENST00000437128.1_RNA			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	356						cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.R356G(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		TCACTGGTCCTGTGCAGGTCC	0.488																																							uc001dnc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1066-1068)AGG>GGG		guanylate-binding protein 5							89.0	88.0	88.0					1																	89730452		2203	4300	6503	SO:0001583	missense	115362					plasma membrane	GTP binding|GTPase activity	g.chr1:89730452T>C	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.1066A>G	1.37:g.89730452T>C	ENSP00000359488:p.Arg356Gly					GBP5_uc001dnd.2_Missense_Mutation_p.R356G|GBP5_uc001dne.1_Missense_Mutation_p.R356G	p.R356G	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN		all cancers(265;0.00784)|Epithelial(280;0.0286)	8	1603	-			356					B2RCE1|Q86TM5	Missense_Mutation	SNP	ENST00000370459.3	37	c.1066A>G	CCDS722.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.470600	0.26423	.	.	ENSG00000154451	ENST00000343435;ENST00000370459;ENST00000443807	T;T;T	0.02258	4.37;4.37;4.37	4.96	1.16	0.20824	Guanylate-binding protein, C-terminal (3);	0.683311	0.15428	N	0.262850	T	0.01454	0.0047	M	0.64404	1.975	0.09310	N	1	P	0.48694	0.914	P	0.47744	0.556	T	0.48779	-0.9005	10	0.33940	T	0.23	-2.9738	6.9683	0.24635	0.0:0.0824:0.451:0.4665	.	356	Q96PP8	GBP5_HUMAN	G	356	ENSP00000340396:R356G;ENSP00000359488:R356G;ENSP00000403010:R356G	ENSP00000340396:R356G	R	-	1	2	GBP5	89503040	0.000000	0.05858	0.053000	0.19242	0.074000	0.17049	-0.024000	0.12435	0.093000	0.17368	0.454000	0.30748	AGG		0.488	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942		23	86	0	0	0	0.014323	0	23	86				
AKNAD1	254268	broad.mit.edu	37	1	109395169	109395169	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:109395169C>A	ENST00000370001.3	-	2	386	c.118G>T	c.(118-120)Ggc>Tgc	p.G40C	AKNAD1_ENST00000369994.1_Missense_Mutation_p.G40C|AKNAD1_ENST00000369995.3_Missense_Mutation_p.G40C|AKNAD1_ENST00000357393.4_Intron	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	40						cytoplasm (GO:0005737)		p.G40C(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						ACTTCAAGGCCATCCTTTTTT	0.403																																							uc001dwa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(118-120)GGC>TGC		hypothetical protein LOC254268							93.0	91.0	91.0					1																	109395169		2203	4300	6503	SO:0001583	missense	254268							g.chr1:109395169C>A	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.118G>T	1.37:g.109395169C>A	ENSP00000359018:p.Gly40Cys					AKNAD1_uc010ovb.1_Intron|AKNAD1_uc001dwb.2_RNA	p.G40C	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN			2	387	-			40					B9EK62|Q5T1N0|Q8N990|Q8NCN9	Missense_Mutation	SNP	ENST00000370001.3	37	c.118G>T	CCDS791.2	.	.	.	.	.	.	.	.	.	.	C	9.314	1.056268	0.19907	.	.	ENSG00000162641	ENST00000370001;ENST00000369994;ENST00000369995	T;T;T	0.06849	3.26;3.26;3.25	5.77	-1.18	0.09617	.	1.303650	0.04920	N	0.454865	T	0.01254	0.0041	N	0.08118	0	0.09310	N	1	B	0.26845	0.161	B	0.24541	0.054	T	0.47315	-0.9127	10	0.38643	T	0.18	5.2053	6.8015	0.23754	0.0:0.3828:0.2651:0.3521	.	40	Q5T1N1	AKND1_HUMAN	C	40	ENSP00000359018:G40C;ENSP00000359011:G40C;ENSP00000359012:G40C	ENSP00000359011:G40C	G	-	1	0	AKNAD1	109196692	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.785000	0.04628	-0.467000	0.06932	-0.878000	0.02970	GGC		0.403	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030923.2	NM_152763		26	149	1	0	7.38237e-10	0.00632	1.02093e-09	26	149				
SLC6A17	388662	broad.mit.edu	37	1	110738261	110738261	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:110738261G>T	ENST00000331565.4	+	10	2031	c.1546G>T	c.(1546-1548)Gga>Tga	p.G516*		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	516					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)	p.G516*(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		CCAGCGCTCCGGAAACTACTT	0.572																																							uc009wfq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1546-1548)GGA>TGA		solute carrier family 6, member 17							105.0	89.0	94.0					1																	110738261		2203	4300	6503	SO:0001587	stop_gained	388662				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity	g.chr1:110738261G>T		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1546G>T	1.37:g.110738261G>T	ENSP00000330199:p.Gly516*						p.G516*	NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)	10	2007	+		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)	516			Extracellular (Potential).		A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Nonsense_Mutation	SNP	ENST00000331565.4	37	c.1546G>T	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	G	44	10.923837	0.99489	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6998	0.96048	0.0:0.0:1.0:0.0	.	.	.	.	X	516	.	ENSP00000330199:G516X	G	+	1	0	SLC6A17	110539784	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.734000	0.98822	2.657000	0.90304	0.655000	0.94253	GGA		0.572	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280		8	78	1	0	0.00448238	0.004482	0.00478627	8	78				
BOLA1	51027	broad.mit.edu	37	1	149871771	149871771	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:149871771C>G	ENST00000369153.2	+	3	823	c.159C>G	c.(157-159)aaC>aaG	p.N53K	BOLA1_ENST00000369152.5_Missense_Mutation_p.N53K|BOLA1_ENST00000369150.1_Missense_Mutation_p.N53K|BOLA1_ENST00000476344.1_3'UTR			Q9Y3E2	BOLA1_HUMAN	bolA family member 1	53						extracellular region (GO:0005576)|mitochondrion (GO:0005739)		p.N53K(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	10	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			AGCTTCGCAACGAGAGCGGTG	0.682																																							uc001etf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(157-159)AAC>AAG		bolA-like 1							37.0	37.0	37.0					1																	149871771		2203	4299	6502	SO:0001583	missense	51027					extracellular region	protein binding	g.chr1:149871771C>G	AF151901	CCDS939.1	1q21	2013-09-02	2013-09-02		ENSG00000178096	ENSG00000178096			24263	protein-coding gene	gene with protein product		613181	"""bolA-like 1 (E. coli)"", ""bolA homolog 1 (E. coli)"""			14718656	Standard	NM_016074		Approved	CGI-143	uc001etf.3	Q9Y3E2	OTTHUMG00000012087	ENST00000369153.2:c.159C>G	1.37:g.149871771C>G	ENSP00000358149:p.Asn53Lys						p.N53K	NM_016074	NP_057158	Q9Y3E2	BOLA1_HUMAN	STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)		2	280	+	Breast(34;0.0124)|all_hematologic(923;0.127)		53					B2R7K2|D3DUZ4|Q5QNY0	Missense_Mutation	SNP	ENST00000369153.2	37	c.159C>G	CCDS939.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826436	0.71143	.	.	ENSG00000178096	ENST00000369153;ENST00000369152;ENST00000369150	T;T;T	0.66638	-0.22;-0.22;-0.22	5.09	-6.56	0.01848	.	0.000000	0.85682	D	0.000000	D	0.82291	0.5005	H	0.98133	4.155	0.51482	D	0.999923	D	0.89917	1.0	D	0.91635	0.999	D	0.87718	0.2571	10	0.87932	D	0	0.0372	15.5531	0.76170	0.0:0.2881:0.0:0.7119	.	53	Q9Y3E2	BOLA1_HUMAN	K	53	ENSP00000358149:N53K;ENSP00000358148:N53K;ENSP00000358146:N53K	ENSP00000358146:N53K	N	+	3	2	BOLA1	148138395	0.183000	0.23186	0.767000	0.31495	0.789000	0.44602	-0.663000	0.05299	-1.408000	0.02040	-0.448000	0.05591	AAC		0.682	BOLA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033443.2	NM_016074		4	66	0	0	0	0.000602	0	4	66				
FLG	2312	broad.mit.edu	37	1	152277028	152277028	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:152277028C>T	ENST00000368799.1	-	3	10369	c.10334G>A	c.(10333-10335)aGg>aAg	p.R3445K	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3445	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R3445K(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGATCCCTGCCTTCCTCTTCT	0.612									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(10333-10335)AGG>AAG		filaggrin							355.0	339.0	345.0					1																	152277028		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152277028C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10334G>A	1.37:g.152277028C>T	ENSP00000357789:p.Arg3445Lys						p.R3445K	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	10370	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		3445			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.10334G>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	7.482	0.648899	0.14516	.	.	ENSG00000143631	ENST00000368799	T	0.03920	3.76	3.76	-1.65	0.08291	.	.	.	.	.	T	0.02193	0.0068	M	0.79805	2.47	0.09310	N	1	P	0.50710	0.938	P	0.47162	0.54	T	0.34750	-0.9816	9	0.07482	T	0.82	.	4.2993	0.10916	0.0:0.4834:0.1618:0.3548	.	3445	P20930	FILA_HUMAN	K	3445	ENSP00000357789:R3445K	ENSP00000357789:R3445K	R	-	2	0	FLG	150543652	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.243000	0.08915	-0.668000	0.05296	-0.507000	0.04495	AGG		0.612	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		40	656	0	0	0	0.00874	0	40	656				
FLG	2312	broad.mit.edu	37	1	152281162	152281162	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:152281162G>T	ENST00000368799.1	-	3	6235	c.6200C>A	c.(6199-6201)cCc>cAc	p.P2067H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2067	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.P2067H(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTGATGGGGCCCAGCTTT	0.557									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(6199-6201)CCC>CAC		filaggrin							363.0	294.0	318.0					1																	152281162		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152281162G>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6200C>A	1.37:g.152281162G>T	ENSP00000357789:p.Pro2067His						p.P2067H	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6236	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2067			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.6200C>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	1.908	-0.451496	0.04572	.	.	ENSG00000143631	ENST00000368799	T	0.01051	5.4	2.13	-2.86	0.05717	.	.	.	.	.	T	0.00300	0.0009	L	0.31294	0.92	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40040	-0.9584	9	0.34782	T	0.22	.	2.5021	0.04636	0.2775:0.0:0.3435:0.3789	.	2067	P20930	FILA_HUMAN	H	2067	ENSP00000357789:P2067H	ENSP00000357789:P2067H	P	-	2	0	FLG	150547786	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	1.394000	0.34509	-0.753000	0.04721	-0.748000	0.03510	CCC		0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		92	482	1	0	2.0191e-50	0.01441	3.75354e-50	92	482				
FLG2	388698	broad.mit.edu	37	1	152323527	152323527	+	Silent	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:152323527G>C	ENST00000388718.5	-	3	6807	c.6735C>G	c.(6733-6735)tcC>tcG	p.S2245S	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2245					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S2245S(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGTTGTCCTGGACCCTCTCT	0.527																																							uc001ezw.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(6733-6735)TCC>TCG		filaggrin family member 2							367.0	346.0	353.0					1																	152323527		2203	4300	6503	SO:0001819	synonymous_variant	388698						calcium ion binding|structural molecule activity	g.chr1:152323527G>C	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6735C>G	1.37:g.152323527G>C						uc001ezv.2_Intron	p.S2245S	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6808	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2245					Q9H4U1	Silent	SNP	ENST00000388718.5	37	c.6735C>G	CCDS30861.1																																																																																				0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		73	483	0	0	0	0.01441	0	73	483				
FLG2	388698	broad.mit.edu	37	1	152331316	152331316	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:152331316G>C	ENST00000388718.5	-	2	117	c.45C>G	c.(43-45)ttC>ttG	p.F15L	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	15	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.|S-100-like. {ECO:0000250}.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.F15L(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTATTTGTAGAAAACATCAA	0.423																																							uc001ezw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(43-45)TTC>TTG		filaggrin family member 2							118.0	110.0	113.0					1																	152331316		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152331316G>C	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.45C>G	1.37:g.152331316G>C	ENSP00000373370:p.Phe15Leu					uc001ezv.2_Intron	p.F15L	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	118	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		15			S-100-like (By similarity).|EF-hand 1.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.45C>G	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630001	0.67015	.	.	ENSG00000143520	ENST00000388718	T	0.46063	0.88	5.26	5.26	0.73747	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	.	.	.	.	T	0.67144	0.2862	M	0.93241	3.395	0.35747	D	0.819098	D	0.65815	0.995	D	0.71870	0.975	T	0.77474	-0.2574	9	0.87932	D	0	-10.2172	14.7321	0.69388	0.0:0.0:1.0:0.0	.	15	Q5D862	FILA2_HUMAN	L	15	ENSP00000373370:F15L	ENSP00000373370:F15L	F	-	3	2	FLG2	150597940	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	2.876000	0.48498	2.619000	0.88677	0.650000	0.86243	TTC		0.423	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		20	147	0	0	0	0.008871	0	20	147				
ARHGEF2	9181	broad.mit.edu	37	1	155921320	155921320	+	Missense_Mutation	SNP	G	G	A	rs138090439	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:155921320G>A	ENST00000361247.4	-	19	2312	c.2213C>T	c.(2212-2214)gCg>gTg	p.A738V	ARHGEF2_ENST00000368316.1_Missense_Mutation_p.A710V|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.A737V|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.A783V|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.A739V|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.A710V	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	738					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A710V(1)		breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCGCTGTAACGCCTCCTGAGG	0.562													G|||	2	0.000399361	0.0015	0.0	5008	,	,		20245	0.0		0.0	False		,,,				2504	0.0				Melanoma(178;35 2768 6610 28839)	Melanoma(178;35 2768 6610 28839)	uc001fmt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2212-2214)GCG>GTG		Rho/Rac guanine nucleotide exchange factor 2		G	VAL/ALA,VAL/ALA,VAL/ALA	14,4392	21.2+/-45.6	0,14,2189	117.0	113.0	115.0		2213,2210,2129	1.7	0.5	1	dbSNP_134	115	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	ARHGEF2	NM_001162383.1,NM_001162384.1,NM_004723.3	64,64,64	0,15,6488	AA,AG,GG		0.0116,0.3177,0.1153	benign,benign,benign	738/987,737/986,710/959	155921320	15,12991	2203	4300	6503	SO:0001583	missense	9181				actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding	g.chr1:155921320G>A	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.2213C>T	1.37:g.155921320G>A	ENSP00000354837:p.Ala738Val					ARHGEF2_uc001fmq.2_5'Flank|ARHGEF2_uc001fmr.2_Missense_Mutation_p.A710V|ARHGEF2_uc001fms.2_Missense_Mutation_p.A737V|ARHGEF2_uc001fmu.2_Missense_Mutation_p.A782V	p.A738V	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN			19	2331	-	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		738					D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	37	c.2213C>T	CCDS53376.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	1.138	-0.650248	0.03506	0.003177	1.16E-4	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07	5.23	1.71	0.24356	.	0.346678	0.20773	N	0.085944	T	0.01627	0.0052	N	0.03154	-0.405	0.22728	N	0.998807	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.47368	-0.9123	10	0.02654	T	1	-8.8371	7.7957	0.29146	0.3627:0.0:0.6373:0.0	.	782;738;737	D3DVA5;Q92974;Q92974-2	.;ARHG2_HUMAN;.	V	710;738;739;710;737	ENSP00000315325:A710V;ENSP00000354837:A738V;ENSP00000357298:A739V;ENSP00000357299:A710V;ENSP00000314787:A737V	ENSP00000314787:A737V	A	-	2	0	ARHGEF2	154187944	0.148000	0.22702	0.490000	0.27465	0.619000	0.37552	0.622000	0.24433	0.085000	0.17107	0.655000	0.94253	GCG		0.562	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723		18	151	0	0	0	0.010504	0	18	151				
PEAR1	375033	broad.mit.edu	37	1	156877441	156877441	+	Silent	SNP	C	C	T	rs148520058		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:156877441C>T	ENST00000338302.3	+	8	909	c.684C>T	c.(682-684)ttC>ttT	p.F228F	PEAR1_ENST00000292357.7_Silent_p.F228F			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	228	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.F228F(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGGCTTCTTCTGCCCCAGCA	0.582																																							uc001fqj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(682-684)TTC>TTT		platelet endothelial aggregation receptor 1							157.0	152.0	153.0					1																	156877441		2203	4300	6503	SO:0001819	synonymous_variant	375033					integral to membrane		g.chr1:156877441C>T	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.684C>T	1.37:g.156877441C>T						PEAR1_uc009wsl.1_Silent_p.F29F|PEAR1_uc001fqk.1_5'UTR	p.F228F	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN			7	800	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		228			EGF-like 2.		Q8TEK2	Silent	SNP	ENST00000338302.3	37	c.684C>T	CCDS30892.1																																																																																				0.582	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471		85	321	0	0	0	0.01441	0	85	321				
PEAR1	375033	broad.mit.edu	37	1	156880491	156880491	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:156880491C>A	ENST00000338302.3	+	16	2132	c.1907C>A	c.(1906-1908)aCc>aAc	p.T636N	PEAR1_ENST00000292357.7_Missense_Mutation_p.T636N			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	636	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.T636N(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCGAACGGGACCTGCTACTGC	0.622																																							uc001fqj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1906-1908)ACC>AAC		platelet endothelial aggregation receptor 1							66.0	53.0	58.0					1																	156880491		2203	4300	6503	SO:0001583	missense	375033					integral to membrane		g.chr1:156880491C>A	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.1907C>A	1.37:g.156880491C>A	ENSP00000344465:p.Thr636Asn					PEAR1_uc001fqk.1_Missense_Mutation_p.T261N	p.T636N	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN			15	2023	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		636			EGF-like 8.		Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	c.1907C>A	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.666301	0.67814	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.50548	0.74;0.74	5.21	4.26	0.50523	EGF-like, laminin (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.129829	0.35262	N	0.003323	T	0.25938	0.0632	L	0.39898	1.24	0.29101	N	0.881492	P	0.41080	0.737	B	0.40702	0.338	T	0.07028	-1.0794	10	0.33940	T	0.23	.	13.6088	0.62063	0.0:0.8319:0.1681:0.0	.	636	Q5VY43	PEAR1_HUMAN	N	636	ENSP00000344465:T636N;ENSP00000292357:T636N	ENSP00000292357:T636N	T	+	2	0	PEAR1	155147115	0.859000	0.29813	1.000000	0.80357	0.932000	0.56968	1.235000	0.32671	2.702000	0.92279	0.655000	0.94253	ACC		0.622	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471		5	31	1	0	2.17888e-05	0.006214	2.56312e-05	5	31				
FCRL3	115352	broad.mit.edu	37	1	157650837	157650837	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:157650837C>G	ENST00000368184.3	-	12	2182	c.1891G>C	c.(1891-1893)Gac>Cac	p.D631H	FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Missense_Mutation_p.D631H	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	631						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D631H(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					TCTTGAGGGTCTATCCTGGAA	0.537																																							uc001frb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1891-1893)GAC>CAC		Fc receptor-like 3 precursor							90.0	80.0	83.0					1																	157650837		2203	4300	6503	SO:0001583	missense	115352					integral to membrane|plasma membrane	receptor activity	g.chr1:157650837C>G	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1891G>C	1.37:g.157650837C>G	ENSP00000357167:p.Asp631His					FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.D631H|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Missense_Mutation_p.D357H|FCRL3_uc001frc.1_Missense_Mutation_p.D631H	p.D631H	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN			12	2183	-	all_hematologic(112;0.0378)		631			Cytoplasmic (Potential).		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	ENST00000368184.3	37	c.1891G>C	CCDS1167.1	.	.	.	.	.	.	.	.	.	.	C	9.243	1.038669	0.19669	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.52526	0.67;0.66	4.68	-2.01	0.07410	.	.	.	.	.	T	0.20170	0.0485	L	0.58101	1.795	0.09310	N	1	B;B;B	0.24132	0.059;0.064;0.098	B;B;B	0.27715	0.052;0.082;0.077	T	0.39440	-0.9614	9	0.51188	T	0.08	.	4.6805	0.12732	0.0:0.2774:0.3358:0.3869	.	631;536;631	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	H	631	ENSP00000357169:D631H;ENSP00000357167:D631H	ENSP00000292392:D631H	D	-	1	0	FCRL3	155917461	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.912000	0.04046	-0.031000	0.13781	0.650000	0.86243	GAC		0.537	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939		5	56	0	0	0	0.000602	0	5	56				
FCRL2	79368	broad.mit.edu	37	1	157739662	157739662	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:157739662C>A	ENST00000361516.3	-	4	637	c.589G>T	c.(589-591)Gtg>Ttg	p.V197L	FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000392274.3_Missense_Mutation_p.V197L|FCRL2_ENST00000469986.1_5'Flank	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	197					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.V197L(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TTGCTCTGCACGTGAATCTGG	0.473																																							uc001fre.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(589-591)GTG>TTG		Fc receptor-like 2 precursor							81.0	79.0	80.0					1																	157739662		2203	4300	6503	SO:0001583	missense	79368				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity	g.chr1:157739662C>A	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.589G>T	1.37:g.157739662C>A	ENSP00000355157:p.Val197Leu					FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Missense_Mutation_p.V197L|FCRL2_uc009wsp.2_Intron|FCRL2_uc010pia.1_Missense_Mutation_p.V197L	p.V197L	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		4	648	-	all_hematologic(112;0.0378)		197			Extracellular (Potential).		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	c.589G>T	CCDS1168.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.061763	0.55432	.	.	ENSG00000132704	ENST00000361516;ENST00000392274	T;T	0.33438	1.41;1.41	4.03	4.03	0.46877	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	5.544760	0.00911	N	0.002473	T	0.45175	0.1329	M	0.83312	2.635	0.09310	N	1	D;P;D	0.71674	0.988;0.791;0.998	P;P;P	0.58013	0.831;0.562;0.831	T	0.35400	-0.9790	10	0.56958	D	0.05	.	11.9937	0.53189	0.0:1.0:0.0:0.0	.	197;197;197	B4E0W2;B4DVJ9;Q96LA5	.;.;FCRL2_HUMAN	L	197	ENSP00000355157:V197L;ENSP00000376100:V197L	ENSP00000355157:V197L	V	-	1	0	FCRL2	156006286	0.321000	0.24625	0.006000	0.13384	0.006000	0.05464	3.353000	0.52247	2.532000	0.85374	0.655000	0.94253	GTG		0.473	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764		12	137	1	0	4.14922e-12	0.004007	6.29039e-12	12	137				
CD1E	913	broad.mit.edu	37	1	158325255	158325255	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:158325255G>T	ENST00000368167.3	+	3	760	c.521G>T	c.(520-522)cGc>cTc	p.R174L	CD1E_ENST00000368165.3_Intron|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368163.3_Missense_Mutation_p.R174L|CD1E_ENST00000368156.1_Intron|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.R174L|CD1E_ENST00000444681.2_Missense_Mutation_p.R75L|CD1E_ENST00000368160.3_Missense_Mutation_p.R174L|CD1E_ENST00000434258.1_Missense_Mutation_p.R172L|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368154.1_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	174					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.R174L(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					GTGCTCAATCGCTACCTAGAT	0.507																																							uc001fse.2		NA																	2	Substitution - Missense(2)		prostate(1)|lung(1)	skin(3)	3						c.(520-522)CGC>CTC		CD1E antigen isoform a precursor							78.0	78.0	78.0					1																	158325255		1890	4122	6012	SO:0001583	missense	913				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen		g.chr1:158325255G>T	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.521G>T	1.37:g.158325255G>T	ENSP00000357149:p.Arg174Leu					CD1E_uc010pid.1_Missense_Mutation_p.R172L|CD1E_uc010pie.1_Missense_Mutation_p.R75L|CD1E_uc010pif.1_Intron|CD1E_uc001fsd.2_Missense_Mutation_p.R174L|CD1E_uc001fsk.2_Intron|CD1E_uc001fsj.2_Intron|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Missense_Mutation_p.R174L|CD1E_uc001fry.2_Missense_Mutation_p.R174L|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Missense_Mutation_p.R174L|CD1E_uc009wsv.2_Missense_Mutation_p.R75L|CD1E_uc001frz.2_Intron|CD1E_uc009wsw.2_5'Flank	p.R174L	NM_030893	NP_112155	P15812	CD1E_HUMAN			3	760	+	all_hematologic(112;0.0378)		174					B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	c.521G>T	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	G	4.243	0.043976	0.08196	.	.	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000368163;ENST00000368160;ENST00000368161	T;T;T;T;T;T	0.19105	2.17;3.3;2.17;2.17;2.17;2.17	4.53	-9.07	0.00724	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	3.060610	0.01167	N	0.006772	T	0.02047	0.0064	N	0.04203	-0.255	0.09310	N	1	B;B;B;B;B;B;B	0.09022	0.0;0.002;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.0;0.001;0.001	T	0.15206	-1.0445	10	0.30854	T	0.27	1.2295	7.0812	0.25231	0.2833:0.0971:0.5237:0.0959	.	75;172;75;174;174;174;174	B4E042;E7ET31;E7EP01;P15812-2;P15812;P15812-3;P15812-4	.;.;.;.;CD1E_HUMAN;.;.	L	172;75;174;174;174;174	ENSP00000401957:R172L;ENSP00000402906:R75L;ENSP00000357149:R174L;ENSP00000357145:R174L;ENSP00000357142:R174L;ENSP00000357143:R174L	ENSP00000357142:R174L	R	+	2	0	CD1E	156591879	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.102000	0.00603	-2.758000	0.00371	-1.987000	0.00451	CGC		0.507	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893		16	134	1	0	0.000422831	0.004007	0.000472871	16	134				
OR10K2	391107	broad.mit.edu	37	1	158390597	158390597	+	Silent	SNP	C	C	A	rs138054803		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:158390597C>A	ENST00000314902.2	-	1	59	c.60G>T	c.(58-60)ctG>ctT	p.L20L		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L20L(1)		NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					GCAGCCTGGCCAGGGATGAGA	0.522																																							uc010pii.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(58-60)CTG>CTT		olfactory receptor, family 10, subfamily K,							71.0	60.0	64.0					1																	158390597		2203	4300	6503	SO:0001819	synonymous_variant	391107				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158390597C>A	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.60G>T	1.37:g.158390597C>A							p.L20L	NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN			1	60	-	all_hematologic(112;0.0378)		20			Extracellular (Potential).			Silent	SNP	ENST00000314902.2	37	c.60G>T	CCDS30896.1																																																																																				0.522	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476		8	40	1	0	3.86212e-05	0.008291	4.45086e-05	8	40				
SPTA1	6708	broad.mit.edu	37	1	158609396	158609396	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:158609396C>A	ENST00000368147.4	-	35	5136	c.4956G>T	c.(4954-4956)ttG>ttT	p.L1652F		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1652					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L1652F(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCTCTCTCTCCAATAGCTGAT	0.483																																							uc001fst.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(4954-4956)TTG>TTT		spectrin, alpha, erythrocytic 1							177.0	168.0	171.0					1																	158609396		1915	4136	6051	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158609396C>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4956G>T	1.37:g.158609396C>A	ENSP00000357129:p.Leu1652Phe						p.L1652F	NM_003126	NP_003117	P02549	SPTA1_HUMAN			35	5155	-	all_hematologic(112;0.0378)		1652			Spectrin 16.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.4956G>T	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.006150	0.74932	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.37058	1.22;1.22	5.34	4.42	0.53409	.	0.000000	0.26692	N	0.022995	T	0.48943	0.1528	M	0.76574	2.34	0.48185	D	0.999605	D	0.76494	0.999	D	0.68483	0.958	T	0.56432	-0.7980	10	0.72032	D	0.01	.	13.1151	0.59295	0.0:0.9222:0.0:0.0778	.	1652	P02549	SPTA1_HUMAN	F	1652	ENSP00000357130:L1652F;ENSP00000357129:L1652F	ENSP00000357129:L1652F	L	-	3	2	SPTA1	156876020	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	2.178000	0.42519	1.617000	0.50277	0.650000	0.86243	TTG		0.483	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		18	139	1	0	1.96895e-08	0.00278	2.6084e-08	18	139				
OR6K6	128371	broad.mit.edu	37	1	158725239	158725239	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:158725239G>T	ENST00000368144.2	+	1	730	c.634G>T	c.(634-636)Gtg>Ttg	p.V212L		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V212L(1)		endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					TTTCACACCTGTGCTGAGCTT	0.493																																							uc001fsw.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(634-636)GTG>TTG		olfactory receptor, family 6, subfamily K,							123.0	104.0	110.0					1																	158725239		2203	4300	6503	SO:0001583	missense	128371				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158725239G>T	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.634G>T	1.37:g.158725239G>T	ENSP00000357126:p.Val212Leu						p.V212L	NM_001005184	NP_001005184	Q8NGW6	OR6K6_HUMAN			1	634	+	all_hematologic(112;0.0378)		212			Extracellular (Potential).		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	c.634G>T	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	G	5.394	0.257983	0.10239	.	.	ENSG00000180433	ENST00000368144	T	0.00099	8.73	5.48	4.54	0.55810	GPCR, rhodopsin-like superfamily (1);	0.191013	0.25490	N	0.030302	T	0.00039	0.0001	N	0.11673	0.155	0.27320	N	0.957064	B	0.23377	0.084	B	0.31016	0.123	T	0.33189	-0.9878	10	0.02654	T	1	-9.0744	15.0788	0.72099	0.0:0.1428:0.8572:0.0	.	212	Q8NGW6	OR6K6_HUMAN	L	212	ENSP00000357126:V212L	ENSP00000357126:V212L	V	+	1	0	OR6K6	156991863	0.001000	0.12720	1.000000	0.80357	0.993000	0.82548	-0.255000	0.08769	1.485000	0.48380	0.655000	0.94253	GTG		0.493	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184		11	87	1	0	3.86212e-05	0.008291	4.45086e-05	11	87				
ADAMTS4	9507	broad.mit.edu	37	1	161161242	161161242	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:161161242C>A	ENST00000367996.5	-	9	2628	c.2200G>T	c.(2200-2202)Ggc>Tgc	p.G734C	ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	734	Spacer.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)	p.G734C(2)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	GCATAGGAGCCATCTGGCAGC	0.622																																							uc001fyt.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)	5						c.(2200-2202)GGC>TGC		ADAM metallopeptidase with thrombospondin type 1							67.0	67.0	67.0					1																	161161242		2203	4300	6503	SO:0001583	missense	9507				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding	g.chr1:161161242C>A	AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.2200G>T	1.37:g.161161242C>A	ENSP00000356975:p.Gly734Cys						p.G734C	NM_005099	NP_005090	O75173	ATS4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00275)		9	2628	-	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		734			Spacer.		Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	ENST00000367996.5	37	c.2200G>T	CCDS1223.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.685314	0.68157	.	.	ENSG00000158859	ENST00000367996	T	0.58210	0.35	4.39	4.39	0.52855	ADAM-TS Spacer 1 (1);	0.085627	0.48767	D	0.000178	T	0.69006	0.3063	M	0.87827	2.91	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.74864	-0.3519	10	0.87932	D	0	.	12.6931	0.56988	0.0:0.8325:0.1675:0.0	.	734	O75173	ATS4_HUMAN	C	734	ENSP00000356975:G734C	ENSP00000356975:G734C	G	-	1	0	ADAMTS4	159427866	1.000000	0.71417	0.969000	0.41365	0.875000	0.50365	5.304000	0.65744	2.428000	0.82296	0.561000	0.74099	GGC		0.622	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099		13	107	1	0	1.05317e-09	0.00245	1.45291e-09	13	107				
OLFML2B	25903	broad.mit.edu	37	1	161953664	161953664	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:161953664G>A	ENST00000294794.3	-	8	2477	c.2054C>T	c.(2053-2055)gCc>gTc	p.A685V	OLFML2B_ENST00000367940.2_Missense_Mutation_p.A686V|OLFML2B_ENST00000367938.1_Missense_Mutation_p.A168V	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	685	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.A685V(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			GCTATCCACGGCATACAGCAC	0.562																																							uc001gbu.2		NA																	2	Substitution - Missense(2)		lung(1)|prostate(1)	skin(1)	1						c.(2053-2055)GCC>GTC		olfactomedin-like 2B precursor							267.0	245.0	252.0					1																	161953664		2203	4300	6503	SO:0001583	missense	25903							g.chr1:161953664G>A	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.2054C>T	1.37:g.161953664G>A	ENSP00000294794:p.Ala685Val					OLFML2B_uc001gbt.2_Missense_Mutation_p.A168V|OLFML2B_uc010pkq.1_Missense_Mutation_p.A686V	p.A685V	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0172)		8	2478	-	all_hematologic(112;0.156)		685			Olfactomedin-like.		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	37	c.2054C>T	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.009105	0.75046	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.87179	-2.22;-2.22;-2.22	5.36	5.36	0.76844	Olfactomedin-like (3);	.	.	.	.	D	0.88709	0.6510	L	0.46741	1.465	0.44373	D	0.997279	D;P	0.89917	1.0;0.917	D;P	0.87578	0.998;0.817	D	0.86127	0.1572	8	0.25106	T	0.35	.	16.5695	0.84607	0.0:0.0:1.0:0.0	.	686;685	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	V	685;686;168	ENSP00000294794:A685V;ENSP00000356917:A686V;ENSP00000356915:A168V	ENSP00000294794:A685V	A	-	2	0	OLFML2B	160220288	1.000000	0.71417	0.766000	0.31476	0.396000	0.30629	9.726000	0.98782	2.491000	0.84063	0.561000	0.74099	GCC		0.562	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441		6	226	0	0	0	0.001168	0	6	226				
UAP1	6675	broad.mit.edu	37	1	162536099	162536099	+	Missense_Mutation	SNP	A	A	T	rs375954138		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:162536099A>T	ENST00000367925.1	+	1	273	c.241A>T	c.(241-243)Aca>Tca	p.T81S	UAP1_ENST00000271469.3_Missense_Mutation_p.T81S|UAP1_ENST00000367926.4_Missense_Mutation_p.T81S|UAP1_ENST00000367924.1_Missense_Mutation_p.T81S			Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1	81					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|UDP-N-acetylglucosamine diphosphorylase activity (GO:0003977)	p.T81S(1)		breast(2)|cervix(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)|skin(2)|stomach(1)	22	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			AGGCAGTGCTACAAGGGATCA	0.423																																							uc001gce.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|kidney(1)	5						c.(241-243)ACA>TCA		UDP-N-acetylglucosamine pyrophosphorylase 1		A	SER/THR	0,4406		0,0,2203	85.0	75.0	78.0		241	5.2	0.9	1		78	1,8599	1.2+/-3.3	0,1,4299	no	missense	UAP1	NM_003115.4	58	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	benign	81/506	162536099	1,13005	2203	4300	6503	SO:0001583	missense	6675				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol|nucleus|plasma membrane	UDP-N-acetylglucosamine diphosphorylase activity	g.chr1:162536099A>T	AB011004	CCDS1240.1	1q23.2	2014-07-31	2014-07-31		ENSG00000117143	ENSG00000117143	2.7.7.23		12457	protein-coding gene	gene with protein product		602862		SPAG2		9603950, 8025165	Standard	NM_003115		Approved	AGX1, AgX	uc001gce.4	Q16222	OTTHUMG00000034419	ENST00000367925.1:c.241A>T	1.37:g.162536099A>T	ENSP00000356902:p.Thr81Ser						p.T81S	NM_003115	NP_003106	Q16222	UAP1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.126)		2	570	+	all_hematologic(112;0.115)		81					B2R6R8|Q5VTA9|Q5VTB0|Q5VTB1|Q96GM2	Missense_Mutation	SNP	ENST00000367925.1	37	c.241A>T		.	.	.	.	.	.	.	.	.	.	A	13.21	2.167811	0.38315	0.0	1.16E-4	ENSG00000117143	ENST00000412525;ENST00000367926;ENST00000271469;ENST00000367925;ENST00000367924	T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27	5.24	5.24	0.73138	.	0.050302	0.85682	D	0.000000	T	0.03783	0.0107	N	0.16790	0.44	0.37283	D	0.907927	B	0.06786	0.001	B	0.04013	0.001	T	0.31752	-0.9932	9	0.12766	T	0.61	-17.9093	13.1225	0.59336	1.0:0.0:0.0:0.0	.	81	Q16222-2	.	S	81	ENSP00000395648:T81S;ENSP00000356903:T81S;ENSP00000271469:T81S;ENSP00000356902:T81S;ENSP00000356901:T81S	ENSP00000271469:T81S	T	+	1	0	UAP1	160802723	0.981000	0.34729	0.942000	0.38095	0.957000	0.61999	5.132000	0.64758	1.958000	0.56883	0.533000	0.62120	ACA		0.423	UAP1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000083203.1	NM_003115		8	45	0	0	0	0.006214	0	8	45				
RGS4	5999	broad.mit.edu	37	1	163039278	163039278	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:163039278T>A	ENST00000367909.6	+	1	344	c.4T>A	c.(4-6)Tgc>Agc	p.C2S	RGS4_ENST00000367906.3_5'Flank|RGS4_ENST00000531057.1_Missense_Mutation_p.C2S|RGS4_ENST00000527809.1_Intron|RGS4_ENST00000421743.2_Missense_Mutation_p.C99S|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000367908.4_Missense_Mutation_p.C2S	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	2					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.C99S(1)|p.C2S(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						AAATAAGATGTGCAAAGGGCT	0.458											OREG0013952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Ovarian(76;1257 1738 3039 6086)	Ovarian(76;1257 1738 3039 6086)	uc009wuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(4-6)TGC>AGC		regulator of G-protein signaling 4 isoform 2							68.0	64.0	65.0					1																	163039278		2203	4300	6503	SO:0001583	missense	5999				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity	g.chr1:163039278T>A	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.4T>A	1.37:g.163039278T>A	ENSP00000356885:p.Cys2Ser		OREG0013952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1828	RGS4_uc001gcl.3_Missense_Mutation_p.C99S|RGS4_uc009wuz.2_Missense_Mutation_p.C2S|RGS4_uc009wva.2_5'Flank	p.C2S	NM_005613	NP_005604	P49798	RGS4_HUMAN			1	515	+			2					A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	ENST00000367909.6	37	c.4T>A	CCDS1243.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.443078	0.83993	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000531057;ENST00000367908	T;T;D	0.92911	-0.82;-0.42;-3.13	4.57	4.57	0.56435	.	0.339356	0.35151	N	0.003401	D	0.94032	0.8088	M	0.75264	2.295	.	.	.	D;D;D	0.89917	0.999;0.997;1.0	D;P;D	0.78314	0.991;0.829;0.987	D	0.94918	0.8071	9	0.87932	D	0	.	10.5049	0.44828	0.0:0.0:0.0:1.0	.	2;2;99	B1APZ3;P49798;A7XA59	.;RGS4_HUMAN;.	S	99;2;2;2	ENSP00000397181:C99S;ENSP00000356885:C2S;ENSP00000436106:C2S	ENSP00000356884:C2S	C	+	1	0	RGS4	161305902	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.735000	0.68587	2.036000	0.60181	0.533000	0.62120	TGC		0.458	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613		11	57	0	0	0	0.00245	0	11	57				
NUF2	83540	broad.mit.edu	37	1	163309231	163309231	+	Silent	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:163309231A>G	ENST00000271452.3	+	8	849	c.570A>G	c.(568-570)ctA>ctG	p.L190L	NUF2_ENST00000524800.1_Silent_p.L190L|NUF2_ENST00000367900.3_Silent_p.L190L	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	190	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.L190L(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					TTCAGGAGCTACAACAATCAC	0.353																																							uc001gcq.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(1)	4						c.(568-570)CTA>CTG		NUF2, NDC80 kinetochore complex component							96.0	94.0	94.0					1																	163309231		2203	4300	6503	SO:0001819	synonymous_variant	83540				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding	g.chr1:163309231A>G	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.570A>G	1.37:g.163309231A>G						NUF2_uc001gcp.2_Silent_p.L190L|NUF2_uc001gcr.1_Silent_p.L190L|NUF2_uc009wvc.1_Silent_p.L190L	p.L190L	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN			8	870	+	all_hematologic(923;0.101)		190			Interaction with the N-terminus of NDC80.|Potential.		Q8WU69|Q96HJ4|Q96Q78	Silent	SNP	ENST00000271452.3	37	c.570A>G	CCDS1245.1																																																																																				0.353	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697		5	61	0	0	0	0.000602	0	5	61				
XCL1	6375	broad.mit.edu	37	1	168550395	168550395	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:168550395G>T	ENST00000367818.3	+	3	447	c.282G>T	c.(280-282)atG>atT	p.M94I		NM_002995.2	NP_002986.1	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	94					cell-cell signaling (GO:0007267)|cellular response to interleukin-4 (GO:0071353)|cellular response to transforming growth factor beta stimulus (GO:0071560)|immune response (GO:0006955)|mature natural killer cell chemotaxis (GO:0035782)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T-helper 1 cell activation (GO:2000518)|negative regulation of T-helper 1 type immune response (GO:0002826)|negative regulation of transcription, DNA-templated (GO:0045892)|neutrophil chemotaxis (GO:0030593)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000566)|positive regulation of granzyme A production (GO:2000513)|positive regulation of granzyme B production (GO:0071663)|positive regulation of immunoglobulin production in mucosal tissue (GO:2000558)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 cell cytokine production (GO:2000556)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of thymocyte migration (GO:2000412)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of inflammatory response (GO:0050727)|release of sequestered calcium ion into cytosol (GO:0051209)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|protein homodimerization activity (GO:0042803)	p.M94I(1)		kidney(2)|lung(7)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.208)					GAAATAACATGATCCAGACCA	0.527																																							uc001gfo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(280-282)ATG>ATT		chemokine (C motif) ligand 1							195.0	174.0	181.0					1																	168550395		2203	4297	6500	SO:0001583	missense	6375				CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity	g.chr1:168550395G>T	D43768	CCDS1274.1	1q24.2	2014-01-30	2002-08-22	2002-08-23	ENSG00000143184	ENSG00000143184		"""Endogenous ligands"""	10645	protein-coding gene	gene with protein product		600250	"""small inducible cytokine subfamily C, member 1 (lymphotactin)"""	LTN, SCYC1		7602097, 7875320	Standard	NM_002995		Approved	LPTN, ATAC, SCM-1a, SCM-1, lymphotactin	uc001gfo.2	P47992	OTTHUMG00000034548	ENST00000367818.3:c.282G>T	1.37:g.168550395G>T	ENSP00000356792:p.Met94Ile						p.M94I	NM_002995	NP_002986	P47992	XCL1_HUMAN			3	302	+	all_hematologic(923;0.208)		94					Q52MA8	Missense_Mutation	SNP	ENST00000367818.3	37	c.282G>T	CCDS1274.1	.	.	.	.	.	.	.	.	.	.	G	8.221	0.802437	0.16397	.	.	ENSG00000143184	ENST00000367818	T	0.03745	3.82	4.83	-0.496	0.12027	Chemokine interleukin-8-like domain (1);	1.323410	0.04679	N	0.412052	T	0.01061	0.0035	L	0.43152	1.355	0.26332	N	0.977503	B	0.06786	0.001	B	0.04013	0.001	T	0.48091	-0.9065	9	0.36615	T	0.2	0.4962	1.8375	0.03143	0.1756:0.2955:0.3772:0.1518	.	94	P47992	XCL1_HUMAN	I	94	ENSP00000356792:M94I	ENSP00000356792:M94I	M	+	3	0	XCL1	166817019	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	0.358000	0.20216	-0.160000	0.11002	-0.136000	0.14681	ATG		0.527	XCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083612.1	NM_002995		10	48	1	0	4.68919e-08	0.008291	6.08414e-08	10	48				
SELP	6403	broad.mit.edu	37	1	169566244	169566244	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:169566244G>T	ENST00000263686.6	-	11	1913	c.1876C>A	c.(1876-1878)Cca>Aca	p.P626T	SELP_ENST00000367788.2_Missense_Mutation_p.P564T|SELP_ENST00000367793.2_Missense_Mutation_p.P564T|SELP_ENST00000367792.2_Intron|SELP_ENST00000367786.2_Missense_Mutation_p.P564T|SELP_ENST00000367794.2_Missense_Mutation_p.P564T|SELP_ENST00000367791.2_Intron|SELP_ENST00000458599.2_Intron	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	626	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.P626T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	CAGGTTGGTGGAGTAGCTGAC	0.398																																							uc001ggi.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1876-1878)CCA>ACA		selectin P precursor	Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)						79.0	79.0	79.0					1																	169566244		2203	4300	6503	SO:0001583	missense	6403				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding	g.chr1:169566244G>T	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.1876C>A	1.37:g.169566244G>T	ENSP00000263686:p.Pro626Thr					SELP_uc001ggh.2_Missense_Mutation_p.P461T|SELP_uc009wvr.2_Missense_Mutation_p.P626T	p.P626T	NM_003005	NP_002996	P16109	LYAM3_HUMAN			11	1941	-	all_hematologic(923;0.208)		626			Extracellular (Potential).|Sushi 7.		Q5R344|Q8IVD1	Missense_Mutation	SNP	ENST00000263686.6	37	c.1876C>A	CCDS1282.1	.	.	.	.	.	.	.	.	.	.	G	7.929	0.740298	0.15642	.	.	ENSG00000174175	ENST00000367790;ENST00000426706;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367788;ENST00000367786;ENST00000458599	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	5.14	4.21	0.49690	Complement control module (2);Sushi/SCR/CCP (3);	0.395446	0.21532	N	0.073040	T	0.47600	0.1454	L	0.37697	1.125	0.28853	N	0.895964	D;B;D	0.59357	0.96;0.197;0.985	P;B;P	0.56700	0.742;0.111;0.804	T	0.39187	-0.9626	10	0.23891	T	0.37	-0.3545	11.5995	0.50995	0.0:0.1802:0.8198:0.0	.	626;626;626	Q6NUL9;P16109;G3V1U2	.;LYAM3_HUMAN;.	T	626;625;626;626;564;564;564;564;549	ENSP00000263686:P626T;ENSP00000356767:P564T;ENSP00000356768:P564T;ENSP00000356762:P564T;ENSP00000356760:P564T	ENSP00000263686:P626T	P	-	1	0	SELP	167832868	0.008000	0.16893	0.053000	0.19242	0.778000	0.44026	0.768000	0.26590	1.099000	0.41499	0.655000	0.94253	CCA		0.398	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005		11	71	1	0	5.50884e-06	0.013537	6.58968e-06	11	71				
TNN	63923	broad.mit.edu	37	1	175092757	175092757	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:175092757G>A	ENST00000239462.4	+	12	2985	c.2872G>A	c.(2872-2874)Ggg>Agg	p.G958R		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	958	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.G958R(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGCCCAGAAGGGGGCCCAGGA	0.612																																							uc001gkl.1		NA																	1	Substitution - Missense(1)	p.G958V(1)	lung(1)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2872-2874)GGG>AGG		tenascin N precursor							74.0	65.0	68.0					1																	175092757		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175092757G>A	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2872G>A	1.37:g.175092757G>A	ENSP00000239462:p.Gly958Arg						p.G958R	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	12	2985	+		Breast(1374;0.000962)	958			Fibronectin type-III 8.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2872G>A	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.674409	0.67928	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.60672	0.17	5.12	5.12	0.69794	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.176708	0.49305	D	0.000151	T	0.74512	0.3726	M	0.65677	2.01	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	T	0.76302	-0.3009	10	0.59425	D	0.04	.	16.7029	0.85364	0.0:0.0:1.0:0.0	.	958	Q9UQP3	TENN_HUMAN	R	958;781	ENSP00000239462:G958R	ENSP00000239462:G958R	G	+	1	0	TNN	173359380	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	2.736000	0.47385	2.526000	0.85167	0.462000	0.41574	GGG		0.612	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		14	108	0	0	0	0.004007	0	14	108				
TNR	7143	broad.mit.edu	37	1	175362956	175362956	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:175362956G>T	ENST00000367674.2	-	6	2024	c.1316C>A	c.(1315-1317)tCa>tAa	p.S439*	TNR_ENST00000263525.2_Nonsense_Mutation_p.S439*			Q92752	TENR_HUMAN	tenascin R	439	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.S439*(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GAAGGAAAATGAGAAGGGCTC	0.458																																							uc001gkp.1		NA																	1	Substitution - Nonsense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(1315-1317)TCA>TAA		tenascin R precursor							223.0	219.0	221.0					1																	175362956		2203	4300	6503	SO:0001587	stop_gained	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175362956G>T	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1316C>A	1.37:g.175362956G>T	ENSP00000356646:p.Ser439*					TNR_uc009wwu.1_Nonsense_Mutation_p.S439*|TNR_uc010pmz.1_3'UTR	p.S439*	NM_003285	NP_003276	Q92752	TENR_HUMAN			4	1397	-	Renal(580;0.146)		439			Fibronectin type-III 2.		C9J563|Q15568|Q5R3G0	Nonsense_Mutation	SNP	ENST00000367674.2	37	c.1316C>A	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100868	0.56183	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	.	.	.	4.51	4.51	0.55191	.	0.262362	0.32081	N	0.006618	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	10.85	0.46765	0.0894:0.0:0.9106:0.0	.	.	.	.	X	439	.	ENSP00000263525:S439X	S	-	2	0	TNR	173629579	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	5.675000	0.68123	2.202000	0.70862	0.643000	0.83706	TCA		0.458	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		47	281	1	0	9.90819e-18	0.01441	1.64267e-17	47	281				
ASTN1	460	broad.mit.edu	37	1	177001817	177001817	+	Silent	SNP	G	G	T	rs534788724		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:177001817G>T	ENST00000367654.3	-	3	851	c.640C>A	c.(640-642)Cgg>Agg	p.R214R	ASTN1_ENST00000424564.2_Silent_p.R214R|ASTN1_ENST00000367657.3_Silent_p.R214R|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000361833.2_Silent_p.R214R	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	214					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R214R(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AGGCTCTCCCGTCCGTGCCCG	0.622																																							uc001glc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(640-642)CGG>AGG		astrotactin isoform 1							70.0	56.0	61.0					1																	177001817		2203	4300	6503	SO:0001819	synonymous_variant	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:177001817G>T	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.640C>A	1.37:g.177001817G>T						ASTN1_uc001glb.1_Silent_p.R214R|ASTN1_uc001gld.1_Silent_p.R214R|ASTN1_uc009wwx.1_Silent_p.R214R|ASTN1_uc001gle.3_RNA	p.R214R	NM_004319	NP_004310	O14525	ASTN1_HUMAN			3	852	-			214					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	37	c.640C>A																																																																																					0.622	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		5	38	1	0	0.000157383	0.00308	0.000178116	5	38				
TDRD5	163589	broad.mit.edu	37	1	179562680	179562680	+	Missense_Mutation	SNP	G	G	T	rs371196961		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:179562680G>T	ENST00000367614.1	+	3	677	c.318G>T	c.(316-318)aaG>aaT	p.K106N	TDRD5_ENST00000444136.1_Missense_Mutation_p.K106N|TDRD5_ENST00000294848.8_Missense_Mutation_p.K106N|RP11-545A16.4_ENST00000567150.1_RNA	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	106					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)		p.K106N(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						CAATGCATAAGGGAAGACCTA	0.453																																							uc001gnf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|central_nervous_system(1)	5						c.(316-318)AAG>AAT		tudor domain containing 5							112.0	105.0	107.0					1																	179562680		2203	4300	6503	SO:0001583	missense	163589				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding	g.chr1:179562680G>T	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.318G>T	1.37:g.179562680G>T	ENSP00000356586:p.Lys106Asn					TDRD5_uc010pnp.1_Missense_Mutation_p.K106N	p.K106N	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN			3	568	+			106					A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	c.318G>T	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.514253	0.27123	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.13538	2.58;2.58;2.75	5.59	3.5	0.40072	.	0.520107	0.18458	N	0.140601	T	0.19366	0.0465	L	0.27053	0.805	0.30794	N	0.740648	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.937	T	0.05517	-1.0880	10	0.66056	D	0.02	-15.2716	4.9516	0.14017	0.2147:0.0:0.6141:0.1712	.	106;106	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	N	106	ENSP00000356586:K106N;ENSP00000294848:K106N;ENSP00000406052:K106N	ENSP00000294848:K106N	K	+	3	2	TDRD5	177829303	1.000000	0.71417	0.693000	0.30195	0.117000	0.20001	1.202000	0.32271	1.354000	0.45846	0.655000	0.94253	AAG		0.453	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533		21	82	1	0	3.62473e-10	0.012319	5.06213e-10	21	82				
PRG4	10216	broad.mit.edu	37	1	186276759	186276759	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:186276759C>A	ENST00000445192.2	+	7	1953	c.1908C>A	c.(1906-1908)acC>acA	p.T636T	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Silent_p.T593T|PRG4_ENST00000367485.4_Silent_p.T543T|PRG4_ENST00000367483.4_Silent_p.T595T	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	636	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.T636T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CACCCACCACCCCTGAGAAGC	0.682																																							uc001gru.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1906-1908)ACC>ACA		proteoglycan 4 isoform A							28.0	31.0	30.0					1																	186276759		2199	4291	6490	SO:0001819	synonymous_variant	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186276759C>A	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1908C>A	1.37:g.186276759C>A						PRG4_uc001grt.3_Silent_p.T595T|PRG4_uc009wyl.2_Silent_p.T543T|PRG4_uc009wym.2_Silent_p.T502T|PRG4_uc010poo.1_Intron	p.T636T	NM_005807	NP_005798	Q92954	PRG4_HUMAN			7	1959	+			636			59 X 8 AA repeats of K-X-P-X-P-T-T-X.		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	c.1908C>A	CCDS1369.1																																																																																				0.682	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		8	26	1	0	4.68919e-08	0.008291	6.08414e-08	8	26				
BRINP3	339479	broad.mit.edu	37	1	190067913	190067913	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:190067913G>T	ENST00000367462.3	-	8	1767	c.1536C>A	c.(1534-1536)gcC>gcA	p.A512A	BRINP3_ENST00000534846.1_Silent_p.A410A	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	512					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.A512A(1)									TGATAAAAATGGCATGGACTT	0.463																																							uc001gse.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(1534-1536)GCC>GCA		family with sequence similarity 5, member C							153.0	146.0	148.0					1																	190067913		2203	4300	6503	SO:0001819	synonymous_variant	339479					extracellular region		g.chr1:190067913G>T	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1536C>A	1.37:g.190067913G>T						FAM5C_uc010pot.1_Silent_p.A410A	p.A512A	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN			8	1768	-	Prostate(682;0.198)		512					B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	37	c.1536C>A	CCDS1373.1																																																																																				0.463	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		36	186	1	0	2.6416e-12	0.00623	4.02631e-12	36	186				
RGS13	6003	broad.mit.edu	37	1	192613472	192613472	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:192613472G>T	ENST00000391995.2	+	4	296	c.8G>T	c.(7-9)aGg>aTg	p.R3M	RGS13_ENST00000543215.1_Missense_Mutation_p.R3M	NM_002927.4	NP_002918.1	O14921	RGS13_HUMAN	regulator of G-protein signaling 13	3					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.R3M(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|skin(1)	19						AAAATGAGCAGGCGGAATTGT	0.289																																							uc001gsj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(7-9)AGG>ATG		regulator of G-protein signalling 13							106.0	118.0	114.0					1																	192613472		2203	4300	6503	SO:0001583	missense	6003					plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:192613472G>T	AF030107	CCDS1376.1	1q31.2	2008-02-05	2007-08-14		ENSG00000127074	ENSG00000127074		"""Regulators of G-protein signaling"""	9995	protein-coding gene	gene with protein product		607190	"""regulator of G-protein signalling 13"""			11875076	Standard	NM_144766		Approved		uc001gsk.3	O14921	OTTHUMG00000035601	ENST00000391995.2:c.8G>T	1.37:g.192613472G>T	ENSP00000375853:p.Arg3Met					RGS13_uc001gsk.2_Missense_Mutation_p.R3M	p.R3M	NM_002927	NP_002918	O14921	RGS13_HUMAN			4	289	+			3					Q6PGR2|Q8TD63|Q9BX45	Missense_Mutation	SNP	ENST00000391995.2	37	c.8G>T	CCDS1376.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036229	0.35893	.	.	ENSG00000127074	ENST00000391995;ENST00000543215	T;T	0.46451	0.87;0.87	5.62	4.64	0.57946	.	0.630661	0.16883	N	0.195610	T	0.34571	0.0902	N	0.12182	0.205	0.28849	N	0.896143	P	0.50943	0.94	P	0.50231	0.635	T	0.18053	-1.0349	10	0.87932	D	0	.	11.3998	0.49864	0.0:0.2308:0.7692:0.0	.	3	O14921	RGS13_HUMAN	M	3	ENSP00000375853:R3M;ENSP00000442837:R3M	ENSP00000375853:R3M	R	+	2	0	RGS13	190880095	0.997000	0.39634	0.997000	0.53966	0.480000	0.33159	3.258000	0.51507	2.795000	0.96236	0.655000	0.94253	AGG		0.289	RGS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086400.1	NM_002927		23	147	1	0	7.38237e-10	0.00632	1.02093e-09	23	147				
IGFN1	91156	broad.mit.edu	37	1	201195156	201195156	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:201195156G>T	ENST00000335211.4	+	22	10821	c.10691G>T	c.(10690-10692)gGc>gTc	p.G3564V	RP11-567E21.3_ENST00000453155.1_RNA|IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1107						nucleus (GO:0005634)|Z disc (GO:0030018)		p.G3564V(1)|p.G724V(1)		autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ATCCTCCCCGGCCACGAATAC	0.667																																							uc001gwc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(2170-2172)GGC>GTC		RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;							71.0	57.0	62.0					1																	201195156		2203	4300	6503	SO:0001583	missense	91156							g.chr1:201195156G>T	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.10691G>T	1.37:g.201195156G>T	ENSP00000334714:p.Gly3564Val					IGFN1_uc001gwb.2_RNA	p.G724V	NM_178275	NP_840059					11	2943	+								F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	c.2171G>T	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058087	0.55325	.	.	ENSG00000163395	ENST00000335211	T	0.63096	-0.02	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.84211	0.5422	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88446	0.3045	10	0.87932	D	0	.	16.4371	0.83880	0.0:0.0:1.0:0.0	.	3564	F8WAI1	.	V	3564	ENSP00000334714:G3564V	ENSP00000334714:G3564V	G	+	2	0	IGFN1	199461779	1.000000	0.71417	0.739000	0.30968	0.013000	0.08279	9.172000	0.94808	2.548000	0.85928	0.561000	0.74099	GGC		0.667	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275		11	48	1	0	6.72482e-11	0.003163	9.62872e-11	11	48				
C1orf186	440712	broad.mit.edu	37	1	206239421	206239421	+	Silent	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:206239421A>T	ENST00000331555.5	-	6	1115	c.477T>A	c.(475-477)ccT>ccA	p.P159P		NM_001007544.1	NP_001007545.1	Q6ZWK4	CA186_HUMAN	chromosome 1 open reading frame 186	159						integral component of membrane (GO:0016021)		p.P159P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.0754)			CAGACAGAGCAGGGTTGACAA	0.403																																							uc001hdt.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(475-477)CCT>CCA		hypothetical protein LOC440712							117.0	105.0	109.0					1																	206239421		2203	4300	6503	SO:0001819	synonymous_variant	440712					integral to membrane		g.chr1:206239421A>T	AK122631	CCDS73014.1	1q32.1	2014-05-06			ENSG00000196533	ENSG00000263961			25341	protein-coding gene	gene with protein product							Standard	XM_005272738		Approved	FLJ16052	uc001hdt.2	Q6ZWK4	OTTHUMG00000184376	ENST00000331555.5:c.477T>A	1.37:g.206239421A>T							p.P159P	NM_001007544	NP_001007545	Q6ZWK4	CA186_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0754)		6	1116	-			159						Silent	SNP	ENST00000331555.5	37	c.477T>A	CCDS30995.1																																																																																				0.403	C1orf186-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088002.1	NM_001007544		29	100	0	0	0	0.004289	0	29	100				
KCTD3	51133	broad.mit.edu	37	1	215792539	215792539	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:215792539C>T	ENST00000259154.4	+	17	2086	c.1792C>T	c.(1792-1794)Caa>Taa	p.Q598*	KCTD3_ENST00000495537.1_3'UTR	NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	598					protein homooligomerization (GO:0051260)			p.Q598*(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		ATTACTCGATCAATGTGATTT	0.408																																							uc001hks.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(1792-1794)CAA>TAA		potassium channel tetramerisation domain							130.0	132.0	131.0					1																	215792539		2203	4300	6503	SO:0001587	stop_gained	51133					voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr1:215792539C>T	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.1792C>T	1.37:g.215792539C>T	ENSP00000259154:p.Gln598*					KCTD3_uc001hkt.2_Nonsense_Mutation_p.Q596*|KCTD3_uc010pub.1_Nonsense_Mutation_p.Q496*|KCTD3_uc009xdn.2_Nonsense_Mutation_p.Q322*	p.Q598*	NM_016121	NP_057205	Q9Y597	KCTD3_HUMAN		all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)	17	2086	+			598					A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Nonsense_Mutation	SNP	ENST00000259154.4	37	c.1792C>T	CCDS1515.1	.	.	.	.	.	.	.	.	.	.	C	38	7.007979	0.97998	.	.	ENSG00000136636	ENST00000259154	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-17.0476	19.4202	0.94719	0.0:1.0:0.0:0.0	.	.	.	.	X	598	.	ENSP00000259154:Q598X	Q	+	1	0	KCTD3	213859162	1.000000	0.71417	0.995000	0.50966	0.092000	0.18411	7.487000	0.81328	2.577000	0.86979	0.585000	0.79938	CAA		0.408	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121		6	151	0	0	0	0.001984	0	6	151				
USH2A	7399	broad.mit.edu	37	1	216011423	216011423	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:216011423G>T	ENST00000307340.3	-	47	9667	c.9281C>A	c.(9280-9282)gCc>gAc	p.A3094D	USH2A_ENST00000366943.2_Missense_Mutation_p.A3094D	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3094	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.A3094D(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTCACGCAGGCATATATTGT	0.378										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(9280-9282)GCC>GAC		usherin isoform B							212.0	193.0	200.0					1																	216011423		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216011423G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9281C>A	1.37:g.216011423G>T	ENSP00000305941:p.Ala3094Asp	HNSCC(13;0.011)					p.A3094D	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	47	9668	-			3094			Fibronectin type-III 17.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.9281C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.724783	0.68959	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53857	0.6;0.6	5.01	5.01	0.66863	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.44688	D	0.000424	T	0.72061	0.3414	M	0.72479	2.2	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.72773	-0.4192	10	0.44086	T	0.13	.	17.9566	0.89070	0.0:0.0:1.0:0.0	.	3094	O75445	USH2A_HUMAN	D	3094	ENSP00000305941:A3094D;ENSP00000355910:A3094D	ENSP00000305941:A3094D	A	-	2	0	USH2A	214078046	1.000000	0.71417	0.970000	0.41538	0.181000	0.23173	5.784000	0.68990	2.331000	0.79229	0.655000	0.94253	GCC		0.378	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		22	179	1	0	1.55795e-14	0.012319	2.44021e-14	22	179				
HHIPL2	79802	broad.mit.edu	37	1	222717000	222717000	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:222717000G>T	ENST00000343410.6	-	2	911	c.853C>A	c.(853-855)Cac>Aac	p.H285N		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	285					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)	p.H285N(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		TTGCGATTGTGGCGGAATTTG	0.478																																							uc001hnh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(853-855)CAC>AAC		HHIP-like 2 precursor							124.0	140.0	134.0					1																	222717000		2203	4300	6503	SO:0001583	missense	79802				carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding	g.chr1:222717000G>T	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.853C>A	1.37:g.222717000G>T	ENSP00000342118:p.His285Asn						p.H285N	NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN		GBM - Glioblastoma multiforme(131;0.0185)	2	911	-			285					Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	c.853C>A	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	G	3.676	-0.066561	0.07273	.	.	ENSG00000143512	ENST00000343410	T	0.10763	2.84	5.2	3.28	0.37604	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	1.013550	0.07875	N	0.968473	T	0.04092	0.0114	N	0.02379	-0.575	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.46048	-0.9219	10	0.18276	T	0.48	-6.632	3.9837	0.09506	0.0784:0.1268:0.4171:0.3777	.	285	Q6UWX4	HIPL2_HUMAN	N	285	ENSP00000342118:H285N	ENSP00000342118:H285N	H	-	1	0	HHIPL2	220783623	0.000000	0.05858	0.139000	0.22197	0.984000	0.73092	-0.631000	0.05496	0.536000	0.28733	0.467000	0.42956	CAC		0.478	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746		40	324	1	0	1.04594e-18	0.00623	1.7494e-18	40	324				
OBSCN	84033	broad.mit.edu	37	1	228466474	228466474	+	Missense_Mutation	SNP	G	G	T	rs374417116		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:228466474G>T	ENST00000422127.1	+	26	6988	c.6944G>T	c.(6943-6945)cGg>cTg	p.R2315L	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000359599.6_Missense_Mutation_p.R1162L|RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000284548.11_Missense_Mutation_p.R2315L|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000570156.2_Missense_Mutation_p.R2744L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2315	Ig-like 23.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.R2499L(1)|p.R2315L(1)|p.R2369L(1)|p.R2598L(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGGTGTCCCGGGCCAGCGCC	0.652																																							uc009xez.1		NA																	4	Substitution - Missense(4)		lung(4)	stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(6943-6945)CGG>CTG		obscurin, cytoskeletal calmodulin and							38.0	46.0	43.0					1																	228466474		2089	4211	6300	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228466474G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.6944G>T	1.37:g.228466474G>T	ENSP00000409493:p.Arg2315Leu					OBSCN_uc001hsn.2_Missense_Mutation_p.R2315L|OBSCN_uc001hsp.1_Missense_Mutation_p.R14L|OBSCN_uc001hsq.1_5'Flank	p.R2315L	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			26	6988	+		Prostate(94;0.0405)	2315			Ig-like 23.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.6944G>T	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356827	0.82243	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706	T;T;T	0.66815	-0.23;-0.23;-0.23	3.92	3.92	0.45320	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000010	D	0.82761	0.5107	M	0.86573	2.825	0.80722	D	1	P;D;D	0.89917	0.875;1.0;1.0	P;D;D	0.91635	0.491;0.999;0.999	D	0.83433	0.0039	10	0.30078	T	0.28	.	16.1074	0.81234	0.0:0.0:1.0:0.0	.	2315;2315;2315	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	L	2315;2315;1162;14	ENSP00000284548:R2315L;ENSP00000409493:R2315L;ENSP00000352613:R1162L	ENSP00000284548:R2315L	R	+	2	0	OBSCN	226533097	1.000000	0.71417	0.967000	0.41034	0.923000	0.55619	7.608000	0.82898	2.044000	0.60594	0.289000	0.19496	CGG		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		10	50	1	0	0.00829132	0.008291	0.00873825	10	50				
NID1	4811	broad.mit.edu	37	1	236187423	236187423	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:236187423T>A	ENST00000264187.6	-	9	2157	c.2075A>T	c.(2074-2076)cAg>cTg	p.Q692L	NID1_ENST00000366595.3_Missense_Mutation_p.Q692L	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	692	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.Q692L(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GCAGGTGAACTGTGTCCTGGG	0.587																																							uc001hxo.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)	2						c.(2074-2076)CAG>CTG		nidogen 1 precursor	Becaplermin(DB00102)|Urokinase(DB00013)						76.0	66.0	69.0					1																	236187423		2203	4300	6503	SO:0001583	missense	4811				cell-matrix adhesion	basement membrane	calcium ion binding	g.chr1:236187423T>A	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.2075A>T	1.37:g.236187423T>A	ENSP00000264187:p.Gln692Leu					NID1_uc009xgd.2_Missense_Mutation_p.Q692L	p.Q692L	NM_002508	NP_002499	P14543	NID1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		9	2177	-	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	692			EGF-like 2.		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	ENST00000264187.6	37	c.2075A>T	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.803980	0.50315	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	D;D	0.90261	-2.64;-2.64	5.85	3.51	0.40186	EGF domain, merozoite surface protein 1-like (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.239625	0.44902	D	0.000415	D	0.82651	0.5083	L	0.27975	0.815	0.37823	D	0.928442	B;B	0.31548	0.328;0.015	B;B	0.34242	0.178;0.011	T	0.79082	-0.1949	10	0.40728	T	0.16	.	6.3779	0.21517	0.0:0.126:0.1469:0.7271	.	692;692	P14543-2;P14543	.;NID1_HUMAN	L	692	ENSP00000264187:Q692L;ENSP00000355554:Q692L	ENSP00000264187:Q692L	Q	-	2	0	NID1	234254046	1.000000	0.71417	0.932000	0.37286	0.992000	0.81027	2.142000	0.42177	1.006000	0.39211	0.533000	0.62120	CAG		0.587	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508		6	55	0	0	0	0.004482	0	6	55				
RYR2	6262	broad.mit.edu	37	1	237794761	237794762	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:237794761_237794762CC>AG	ENST00000366574.2	+	42	6792_6793	c.6475_6476CC>AG	c.(6475-6477)CCt>AGt	p.P2159S	RYR2_ENST00000542537.1_Missense_Mutation_p.P2143S|RYR2_ENST00000360064.6_Missense_Mutation_p.P2157S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2159	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.P2157S(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTACCAGCACCCTAATCTCATG	0.455																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(6475-6477)CCT>AGT		cardiac muscle ryanodine receptor																																				SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237794761_237794762CC>AG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	Exception_encountered	1.37:g.237794761_237794762delinsAG	ENSP00000355533:p.Pro2159Ser						p.P2159S	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		42	6595_6596	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2159			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	DNP	ENST00000366574.2	37	c.6475_6476CC>AG	CCDS55691.1																																																																																				0.455	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		12	42	0	0	0	0.004672	0	12	42				
OR2G2	81470	broad.mit.edu	37	1	247751927	247751927	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:247751927G>T	ENST00000320065.1	+	1	266	c.266G>T	c.(265-267)tGg>tTg	p.W89L	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W89L(1)		endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GTAAACCTGTGGGAACCCATG	0.522																																							uc010pyy.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(265-267)TGG>TTG		olfactory receptor, family 2, subfamily G,							182.0	151.0	161.0					1																	247751927		2203	4300	6503	SO:0001583	missense	81470				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247751927G>T	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.266G>T	1.37:g.247751927G>T	ENSP00000326349:p.Trp89Leu						p.W89L	NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	266	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		89			Extracellular (Potential).		Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	37	c.266G>T	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	G	3.303	-0.142468	0.06669	.	.	ENSG00000177489	ENST00000320065	T	0.01629	4.72	4.29	2.4	0.29515	GPCR, rhodopsin-like superfamily (1);	0.246837	0.21125	U	0.079752	T	0.00784	0.0026	N	0.05158	-0.105	0.09310	N	1	B	0.33512	0.415	B	0.28465	0.09	T	0.45542	-0.9254	10	0.09843	T	0.71	.	3.9191	0.09236	0.2031:0.0:0.6099:0.187	.	89	Q8NGZ5	OR2G2_HUMAN	L	89	ENSP00000326349:W89L	ENSP00000326349:W89L	W	+	2	0	OR2G2	245818550	0.000000	0.05858	0.006000	0.13384	0.776000	0.43924	0.694000	0.25512	0.444000	0.26612	0.591000	0.81541	TGG		0.522	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1			22	181	1	0	1.50039e-11	0.012319	2.20967e-11	22	181				
OR2T2	401992	broad.mit.edu	37	1	248616384	248616384	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:248616384C>T	ENST00000342927.3	+	1	308	c.286C>T	c.(286-288)Ctg>Ttg	p.L96L		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L96L(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATTTCCTTCCTGGGCTGTGC	0.527																																							uc001iek.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(286-288)CTG>TTG		olfactory receptor, family 2, subfamily T,							242.0	275.0	264.0					1																	248616384		2203	4300	6503	SO:0001819	synonymous_variant	401992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248616384C>T	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.286C>T	1.37:g.248616384C>T							p.L96L	NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	286	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		96			Extracellular (Potential).		B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	c.286C>T	CCDS31116.1																																																																																				0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136		24	341	0	0	0	0.005443	0	24	341				
OR2T34	127068	broad.mit.edu	37	1	248737364	248737364	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:248737364C>A	ENST00000328782.2	-	1	716	c.695G>T	c.(694-696)aGg>aTg	p.R232M		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R232M(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGAATTCATCCTGTGGATGAG	0.547																																							uc001iep.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(694-696)AGG>ATG		olfactory receptor, family 2, subfamily T,							112.0	128.0	122.0					1																	248737364		2176	4300	6476	SO:0001583	missense	127068				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248737364C>A	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.695G>T	1.37:g.248737364C>A	ENSP00000330904:p.Arg232Met						p.R232M	NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	695	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		232			Cytoplasmic (Potential).		B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	c.695G>T	CCDS31120.1	.	.	.	.	.	.	.	.	.	.	.	13.92	2.380634	0.42207	.	.	ENSG00000183310	ENST00000328782	T	0.00265	8.39	2.37	1.38	0.22167	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00552	0.0018	M	0.91818	3.245	0.21325	N	0.999723	D	0.76494	0.999	D	0.72075	0.976	T	0.43877	-0.9364	9	0.87932	D	0	.	4.7767	0.13182	0.0:0.563:0.0:0.437	.	232	Q8NGX1	O2T34_HUMAN	M	232	ENSP00000330904:R232M	ENSP00000330904:R232M	R	-	2	0	OR2T34	246803987	0.000000	0.05858	0.169000	0.22859	0.164000	0.22412	-0.802000	0.04545	1.169000	0.42739	0.123000	0.15791	AGG		0.547	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821		28	145	1	0	2.4375e-19	0.007291	4.10107e-19	28	145				
OR2T11	127077	broad.mit.edu	37	1	248790155	248790155	+	Missense_Mutation	SNP	A	A	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:248790155A>C	ENST00000330803.2	-	1	336	c.275T>G	c.(274-276)gTg>gGg	p.V92G		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V92G(1)		breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCCACAGGCCACAAAGGAAAT	0.498																																							uc001ier.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(274-276)GTG>GGG		olfactory receptor, family 2, subfamily T,							69.0	66.0	67.0					1																	248790155		2050	4230	6280	SO:0001583	missense	127077				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248790155A>C	BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.275T>G	1.37:g.248790155A>C	ENSP00000328934:p.Val92Gly						p.V92G	NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	275	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		92			Extracellular (Potential).		Q6IEY6	Missense_Mutation	SNP	ENST00000330803.2	37	c.275T>G	CCDS31122.1	.	.	.	.	.	.	.	.	.	.	.	8.444	0.851417	0.17034	.	.	ENSG00000183130	ENST00000330803	T	0.02916	4.11	4.62	2.16	0.27623	GPCR, rhodopsin-like superfamily (1);	0.406087	0.17973	N	0.155797	T	0.01976	0.0062	N	0.16478	0.41	0.09310	N	1	B	0.33135	0.399	B	0.35607	0.206	T	0.47195	-0.9136	10	0.32370	T	0.25	.	4.1367	0.10174	0.6732:0.0:0.174:0.1527	.	92	Q8NH01	O2T11_HUMAN	G	92	ENSP00000328934:V92G	ENSP00000328934:V92G	V	-	2	0	OR2T11	246856778	0.000000	0.05858	0.997000	0.53966	0.978000	0.69477	-1.422000	0.02453	0.785000	0.33685	0.533000	0.62120	GTG		0.498	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097134.1	NM_001001964		12	61	0	0	0	0.013537	0	12	61				
SH3BP5L	80851	broad.mit.edu	37	1	249119037	249119037	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:249119037G>C	ENST00000366472.5	-	2	1327	c.98C>G	c.(97-99)gCa>gGa	p.A33G	MIR3124_ENST00000582636.1_RNA|SH3BP5L_ENST00000475978.1_5'UTR	NM_030645.1	NP_085148.1	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	33								p.A33G(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			AGGCTCTTCTGCGACTGGGCT	0.582																																							uc001iew.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(97-99)GCA>GGA		SH3-binding domain protein 5-like							150.0	152.0	151.0					1																	249119037		2203	4300	6503	SO:0001583	missense	80851							g.chr1:249119037G>C	AB051507	CCDS31126.1	1q44	2008-02-05			ENSG00000175137	ENSG00000175137			29360	protein-coding gene	gene with protein product							Standard	NM_030645		Approved	KIAA1720	uc001iew.1	Q7L8J4	OTTHUMG00000040389	ENST00000366472.5:c.98C>G	1.37:g.249119037G>C	ENSP00000355428:p.Ala33Gly					SH3BP5L_uc001iev.1_5'UTR|hsa-mir-3124|MI0014140_5'Flank	p.A33G	NM_030645	NP_085148	Q7L8J4	3BP5L_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00805)		2	650	-	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	33					B4DQ94|Q96FI5|Q9BQH8|Q9C0E3	Missense_Mutation	SNP	ENST00000366472.5	37	c.98C>G	CCDS31126.1	.	.	.	.	.	.	.	.	.	.	G	7.183	0.590010	0.13812	.	.	ENSG00000175137	ENST00000366472	.	.	.	4.19	2.16	0.27623	.	1.252050	0.05704	N	0.594686	T	0.26919	0.0659	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21965	-1.0230	9	0.17369	T	0.5	-0.0944	9.5894	0.39537	0.0:0.0:0.5915:0.4085	.	33	Q7L8J4	3BP5L_HUMAN	G	33	.	ENSP00000355428:A33G	A	-	2	0	SH3BP5L	247085660	0.013000	0.17824	0.057000	0.19452	0.689000	0.40095	0.631000	0.24568	0.429000	0.26202	0.655000	0.94253	GCA		0.582	SH3BP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097140.1	NM_030645		8	355	0	0	0	0.004482	0	8	355				
PFKFB3	5209	broad.mit.edu	37	10	6268204	6268204	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:6268204C>T	ENST00000379775.4	+	14	1721	c.1391C>T	c.(1390-1392)cCg>cTg	p.P464L	PFKFB3_ENST00000379789.4_Missense_Mutation_p.P444L|PFKFB3_ENST00000379782.3_Missense_Mutation_p.P464L|PFKFB3_ENST00000360521.2_Missense_Mutation_p.P464L|PFKFB3_ENST00000540253.1_Missense_Mutation_p.P478L|PFKFB3_ENST00000379785.1_Missense_Mutation_p.P464L|PFKFB3_ENST00000317350.4_Missense_Mutation_p.P464L|PFKFB3_ENST00000536985.1_3'UTR	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	464	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)	p.P464Q(2)|p.P464L(2)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						AGTGTCACCCCGCTAGCCAGC	0.577																																							uc001ije.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)|central_nervous_system(1)	3						c.(1390-1392)CCG>CTG		6-phosphofructo-2-kinase/fructose-2,							100.0	114.0	109.0					10																	6268204		2203	4300	6503	SO:0001583	missense	5209				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding	g.chr10:6268204C>T		CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.1391C>T	10.37:g.6268204C>T	ENSP00000369100:p.Pro464Leu					PFKFB3_uc001ijd.2_Missense_Mutation_p.P444L|PFKFB3_uc009xii.2_RNA|PFKFB3_uc010qaw.1_Missense_Mutation_p.P478L|PFKFB3_uc001ijf.2_Missense_Mutation_p.P464L|PFKFB3_uc001ijg.2_RNA|PFKFB3_uc009xij.2_RNA|PFKFB3_uc009xik.2_RNA|PFKFB3_uc009xil.2_Intron	p.P464L	NM_004566	NP_004557	Q16875	F263_HUMAN			14	1775	+			464			Fructose-2,6-bisphosphatase.		B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	ENST00000379775.4	37	c.1391C>T	CCDS7078.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785271	0.90282	.	.	ENSG00000170525	ENST00000379789;ENST00000540253;ENST00000379781;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499;ENST00000414237	.	.	.	5.24	5.24	0.73138	.	0.051128	0.85682	D	0.000000	T	0.61311	0.2337	L	0.41415	1.275	0.80722	D	1	B;D;B;D	0.61080	0.122;0.989;0.027;0.982	B;P;B;P	0.51170	0.028;0.661;0.014;0.459	T	0.64364	-0.6425	9	0.56958	D	0.05	-3.3951	18.8328	0.92148	0.0:1.0:0.0:0.0	.	478;464;464;444	B7Z955;Q16875-2;Q16875;Q5VX15	.;.;F263_HUMAN;.	L	444;478;58;464;464;464;464;464;464;33	.	ENSP00000369105:P464L	P	+	2	0	PFKFB3	6308210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.229000	0.78088	2.447000	0.82792	0.655000	0.94253	CCG		0.577	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1			10	74	0	0	0	0.00499	0	10	74				
PRKCQ	5588	broad.mit.edu	37	10	6527124	6527124	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:6527124C>T	ENST00000263125.5	-	10	1107	c.1008G>A	c.(1006-1008)ccG>ccA	p.P336P	PRKCQ_ENST00000397176.2_Silent_p.P336P|PRKCQ_ENST00000539722.1_Silent_p.P211P	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	336					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)	p.P336P(3)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CTCTTTTTCCCGGTGTCGGTA	0.433																																					Ovarian(50;572 1126 10530 25349 30594)	Ovarian(50;572 1126 10530 25349 30594)	uc001ijj.1		NA																	3	Substitution - coding silent(3)		lung(2)|endometrium(1)	ovary(3)|lung(2)|large_intestine(1)	6						c.(1006-1008)CCG>CCA		protein kinase C, theta							184.0	179.0	181.0					10																	6527124		2203	4300	6503	SO:0001819	synonymous_variant	5588				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr10:6527124C>T	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1008G>A	10.37:g.6527124C>T						PRKCQ_uc009xim.1_Silent_p.P336P|PRKCQ_uc001iji.1_Silent_p.P369P|PRKCQ_uc009xin.1_Silent_p.P300P|PRKCQ_uc010qax.1_Silent_p.P211P	p.P336P	NM_006257	NP_006248	Q04759	KPCT_HUMAN			10	1083	-			336					B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Silent	SNP	ENST00000263125.5	37	c.1008G>A	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	.	2.627	-0.287236	0.05605	.	.	ENSG00000065675	ENST00000397178	.	.	.	5.22	-10.4	0.00318	.	.	.	.	.	T	0.43853	0.1266	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	T	0.64968	-0.6282	4	.	.	.	.	5.7498	0.18140	0.3034:0.459:0.063:0.1746	.	.	.	.	Q	109	.	.	R	-	2	0	PRKCQ	6567130	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	-1.502000	0.02279	-5.587000	0.00012	-3.011000	0.00075	CGG		0.433	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257		55	164	0	0	0	0.01441	0	55	164				
USP6NL	9712	broad.mit.edu	37	10	11531201	11531201	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:11531201C>A	ENST00000609104.1	-	10	958	c.564G>T	c.(562-564)ggG>ggT	p.G188G	USP6NL_ENST00000277575.5_Silent_p.G205G|USP6NL_ENST00000379237.2_Silent_p.G211G	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	188	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.G205G(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						TCTGGCTCATCCCCTGACAAT	0.483																																							uc001ikt.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(562-564)GGG>GGT		USP6 N-terminal like isoform 1							78.0	81.0	80.0					10																	11531201		1937	4141	6078	SO:0001819	synonymous_variant	9712					intracellular	Rab GTPase activator activity	g.chr10:11531201C>A	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.564G>T	10.37:g.11531201C>A						USP6NL_uc001iks.1_Silent_p.G205G	p.G188G	NM_014688	NP_055503	Q92738	US6NL_HUMAN			10	885	-			188			Rab-GAP TBC.		A8KA79|Q15400|Q5VV10|Q7L0K9	Silent	SNP	ENST00000609104.1	37	c.564G>T	CCDS53492.1																																																																																				0.483	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046764.3	NM_014688		30	72	1	0	1.06801e-11	0.009535	1.58524e-11	30	72				
MYPN	84665	broad.mit.edu	37	10	69881917	69881917	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:69881917C>A	ENST00000358913.5	+	2	1210	c.722C>A	c.(721-723)gCt>gAt	p.A241D	MYPN_ENST00000540630.1_Missense_Mutation_p.A241D|MYPN_ENST00000354393.2_Intron|MYPN_ENST00000373675.3_Missense_Mutation_p.A241D	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	241	Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.A241D(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GCGGAGCAGGCTGCCAGTGAG	0.557																																							uc001jnm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(721-723)GCT>GAT		myopalladin							46.0	45.0	46.0					10																	69881917		2203	4300	6503	SO:0001583	missense	84665					nucleus|sarcomere	actin binding	g.chr10:69881917C>A	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.722C>A	10.37:g.69881917C>A	ENSP00000351790:p.Ala241Asp					MYPN_uc001jnl.1_Missense_Mutation_p.A241D|MYPN_uc001jnn.3_Intron|MYPN_uc001jno.3_Missense_Mutation_p.A241D|MYPN_uc001jnp.1_Missense_Mutation_p.A241D|MYPN_uc009xps.2_Missense_Mutation_p.A241D|MYPN_uc009xpt.2_Missense_Mutation_p.A241D|MYPN_uc010qit.1_Translation_Start_Site|MYPN_uc010qiu.1_RNA	p.A241D	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN			3	907	+			241			Potential.|Interaction with CARP.		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	c.722C>A	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.839513	0.32513	.	.	ENSG00000138347	ENST00000358913;ENST00000540630;ENST00000373675	T;T;T	0.62232	0.44;0.41;0.04	5.65	4.74	0.60224	.	0.499931	0.21337	N	0.076193	T	0.48909	0.1526	N	0.24115	0.695	0.09310	N	1	B;B	0.23735	0.023;0.09	B;B	0.27608	0.081;0.05	T	0.29119	-1.0022	9	.	.	.	.	14.9796	0.71301	0.0:0.9302:0.0:0.0698	.	241;241	Q86TC9-3;Q86TC9	.;MYPN_HUMAN	D	241	ENSP00000351790:A241D;ENSP00000441668:A241D;ENSP00000362779:A241D	.	A	+	2	0	MYPN	69551923	0.660000	0.27420	0.999000	0.59377	0.990000	0.78478	1.076000	0.30729	2.636000	0.89361	0.591000	0.81541	GCT		0.557	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578		12	37	1	0	4.3838e-07	0.001855	5.48701e-07	12	37				
SUPV3L1	6832	broad.mit.edu	37	10	70968563	70968563	+	Silent	SNP	C	C	T	rs183288053		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:70968563C>T	ENST00000359655.4	+	15	2193	c.2133C>T	c.(2131-2133)cgC>cgT	p.R711R		NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	711	Interaction with LAMTOR5, important for protein stability.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.R711R(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GAAGGACACGCGGCACCAAAG	0.532																																							uc001jpe.1		NA																	1	Substitution - coding silent(1)		lung(1)	urinary_tract(1)|ovary(1)	2						c.(2131-2133)CGC>CGT		suppressor of var1, 3-like 1 precursor							80.0	76.0	77.0					10																	70968563		2203	4300	6503	SO:0001819	synonymous_variant	6832				DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding	g.chr10:70968563C>T	AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.2133C>T	10.37:g.70968563C>T						SUPV3L1_uc010qjd.1_Silent_p.R580R	p.R711R	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN			15	2188	+			711			Interaction with HBXIP, important for protein stability.		A8K301|O43630	Silent	SNP	ENST00000359655.4	37	c.2133C>T	CCDS7287.1																																																																																				0.532	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2	NM_003171		4	93	0	0	0	0.009096	0	4	93				
PSAP	5660	broad.mit.edu	37	10	73574861	73574861	+	IGR	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:73574861C>T	ENST00000394936.3	-	0	2866				CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000224721.6_Silent_p.L3302L|CDH23_ENST00000398788.3_Silent_p.L1057L			P07602	SAP_HUMAN	prosaposin						blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)	p.L3302L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						CCACCGACCTCAACAGCCTGC	0.682																																							uc001jrx.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(9889-9891)CTC>CTT		cadherin-like 23 isoform 1 precursor							16.0	24.0	21.0					10																	73574861		2154	4247	6401	SO:0001628	intergenic_variant	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73574861C>T	BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429		10.37:g.73574861C>T						CDH23_uc001jsg.3_Silent_p.L1057L|CDH23_uc001jsh.3_Silent_p.L1022L|CDH23_uc001jsi.3_Silent_p.L1022L|CDH23_uc001jsj.3_Silent_p.L194L|CDH23_uc010qjr.1_Silent_p.L159L	p.L3297L	NM_022124	NP_071407	Q9H251	CAD23_HUMAN			68	10268	+			3297			Cytoplasmic (Potential).		P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Silent	SNP	ENST00000394936.3	37	c.9891C>T	CCDS7311.1																																																																																				0.682	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778		3	15	0	0	0	0.004672	0	3	15				
KCNMA1	3778	broad.mit.edu	37	10	78704598	78704598	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:78704598C>A	ENST00000286628.8	-	23	2834	c.2835G>T	c.(2833-2835)ttG>ttT	p.L945F	KCNMA1_ENST00000354353.5_Missense_Mutation_p.L948F|KCNMA1_ENST00000404771.3_Missense_Mutation_p.L945F|RP11-443A13.5_ENST00000458661.2_RNA|RP11-443A13.5_ENST00000598613.1_RNA|KCNMA1_ENST00000372443.1_Missense_Mutation_p.L887F|KCNMA1_ENST00000404857.1_Missense_Mutation_p.L928F|KCNMA1_ENST00000406533.3_Missense_Mutation_p.L949F|RP11-443A13.5_ENST00000608791.1_RNA|KCNMA1_ENST00000286627.5_Missense_Mutation_p.L887F|RP11-443A13.5_ENST00000600782.1_RNA|RP11-443A13.5_ENST00000426234.1_RNA|KCNMA1_ENST00000372440.1_Missense_Mutation_p.L887F	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	945					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.L949F(1)|p.L887F(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TGAGTGACGCCAAGATGCATT	0.448																																							uc001jxn.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(2)|ovary(1)	3						c.(2833-2835)TTG>TTT		large conductance calcium-activated potassium	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)						187.0	148.0	161.0					10																	78704598		2203	4300	6503	SO:0001583	missense	3778				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity	g.chr10:78704598C>A	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2835G>T	10.37:g.78704598C>A	ENSP00000286628:p.Leu945Phe					KCNMA1_uc001jxj.2_Missense_Mutation_p.L891F|KCNMA1_uc001jxk.1_Missense_Mutation_p.L563F|KCNMA1_uc009xrt.1_Missense_Mutation_p.L736F|KCNMA1_uc001jxl.1_Missense_Mutation_p.L570F|KCNMA1_uc001jxo.2_Missense_Mutation_p.L928F|KCNMA1_uc001jxm.2_Missense_Mutation_p.L887F|KCNMA1_uc001jxq.2_Missense_Mutation_p.L890F	p.L945F	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		23	3012	-	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		945			Cytoplasmic (Potential).		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37	c.2835G>T		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	20.2|20.2|20.2	3.942952|3.942952|3.942952	0.73672|0.73672|0.73672	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372421;ENST00000434208|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372403	.|T;T;T;T;T;T;T;T;T;T|.	.|0.59906|.	.|0.23;0.23;0.23;0.23;0.23;0.23;0.72;0.23;0.23;0.23|.	5.74|5.74|5.74	5.74|5.74|5.74	0.90152|0.90152|0.90152	.|NAD(P)-binding domain (1);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.73560|0.73560|0.73560	0.3602|0.3602|0.3602	L|L|L	0.58669|0.58669|0.58669	1.825|1.825|1.825	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D;D;D;D;D;D|.	.|0.89917|.	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	.|D;D;D;D;D;D;D;D|.	.|0.91635|.	.|0.999;0.992;0.996;0.999;0.997;0.994;0.996;0.994|.	T|T|T	0.69577|0.69577|0.69577	-0.5108|-0.5108|-0.5108	5|10|5	.|0.87932|.	.|D|.	.|0|.	-9.4428|-9.4428|-9.4428	19.9196|19.9196|19.9196	0.97082|0.97082|0.97082	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|916;890;928;945;887;698;948;887|.	.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.|.;.;.;KCMA1_HUMAN;.;.;.;.|.	C|F|L	876;595|887;824;880;919;882;887;887;919;949;948;928;698|838	.|ENSP00000361517:L887F;ENSP00000361485:L824F;ENSP00000361514:L880F;ENSP00000396608:L919F;ENSP00000361520:L887F;ENSP00000286627:L887F;ENSP00000286628:L919F;ENSP00000385552:L949F;ENSP00000346321:L948F;ENSP00000385806:L928F|.	.|ENSP00000286627:L887F|.	G|L|W	-|-|-	1|3|2	0|2|0	KCNMA1|KCNMA1|KCNMA1	78374604|78374604|78374604	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.999000|0.999000|0.999000	0.98932|0.98932|0.98932	5.918000|5.918000|5.918000	0.69996|0.69996|0.69996	2.708000|2.708000|2.708000	0.92522|0.92522|0.92522	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GGC|TTG|TGG		0.448	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247		15	71	1	0	1.49906e-05	0.00245	1.77817e-05	15	71				
POLR3A	11128	broad.mit.edu	37	10	79781687	79781687	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:79781687C>A	ENST00000372371.3	-	7	1116	c.979G>T	c.(979-981)Ggc>Tgc	p.G327C	POLR3A_ENST00000484760.1_5'Flank	NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	327					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)	p.G327C(1)		breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			AGGGGAATGCCCGAGAGCTCA	0.537																																							uc001jzn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(979-981)GGC>TGC		polymerase (RNA) III (DNA directed) polypeptide							79.0	74.0	76.0					10																	79781687		2203	4300	6503	SO:0001583	missense	11128				innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding	g.chr10:79781687C>A	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.979G>T	10.37:g.79781687C>A	ENSP00000361446:p.Gly327Cys						p.G327C	NM_007055	NP_008986	O14802	RPC1_HUMAN	Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)		7	1073	-	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		327					Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	c.979G>T	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290688	0.80914	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.71934	-0.61	5.83	5.83	0.93111	RNA polymerase, N-terminal (1);RNA polymerase Rpb1, domain 1 (1);	0.000000	0.85682	D	0.000000	D	0.90563	0.7042	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.93194	0.6586	9	.	.	.	-24.2933	20.1356	0.98028	0.0:1.0:0.0:0.0	.	327	O14802	RPC1_HUMAN	C	327	ENSP00000361446:G327C	.	G	-	1	0	POLR3A	79451693	1.000000	0.71417	0.988000	0.46212	0.586000	0.36452	7.479000	0.81095	2.755000	0.94549	0.650000	0.86243	GGC		0.537	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055		17	67	1	0	1.2644e-06	0.010504	1.56875e-06	17	67				
NUTM2A	728118	broad.mit.edu	37	10	88994213	88994213	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:88994213G>A	ENST00000381707.2	+	7	2768	c.2385G>A	c.(2383-2385)caG>caA	p.Q795Q	NUTM2A-AS1_ENST00000451940.2_RNA|NUTM2A-AS1_ENST00000456104.1_RNA|NUTM2A_ENST00000381689.4_Intron	NM_001099338.1	NP_001092808.1	Q8IVF1	NTM2A_HUMAN	NUT family member 2A	795								p.Q795Q(1)									GGGGACCCCAGGGAACTCATC	0.597																																							uc001kek.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2383-2385)CAG>CAA		hypothetical protein LOC728118							14.0	13.0	14.0					10																	88994213		1649	3471	5120	SO:0001819	synonymous_variant	728118							g.chr10:88994213G>A		CCDS44452.1	10q23.2	2013-03-15	2013-03-14	2013-03-14	ENSG00000184923	ENSG00000184923			23438	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member A"""	FAM22A			Standard	NM_001099338		Approved		uc001kek.3	Q8IVF1	OTTHUMG00000018670	ENST00000381707.2:c.2385G>A	10.37:g.88994213G>A						LOC728190_uc009xtc.2_Intron|LOC728190_uc009xtd.2_Intron	p.Q795Q	NM_001099338	NP_001092808	Q8IVF1	FA22A_HUMAN			7	2768	+			795					A6NMX5|C9JDI1|Q5VZW1	Silent	SNP	ENST00000381707.2	37	c.2385G>A	CCDS44452.1	.	.	.	.	.	.	.	.	.	.	g	0.232	-1.020521	0.02061	.	.	ENSG00000184923	ENST00000451286	.	.	.	0.861	-0.551	0.11822	.	.	.	.	.	T	0.23330	0.0564	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26503	-1.0101	4	.	.	.	.	4.4149	0.11452	0.0:0.4275:0.5725:0.0	.	.	.	.	R	573	.	.	G	+	1	0	FAM22A	88984193	0.000000	0.05858	0.001000	0.08648	0.211000	0.24417	-0.107000	0.10873	-0.093000	0.12396	0.074000	0.15403	GGG		0.597	NUTM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049198.2	NM_001099338		9	28	0	0	0	0.008291	0	9	28				
C10orf12	26148	broad.mit.edu	37	10	98741739	98741739	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:98741739G>C	ENST00000286067.2	+	1	699	c.592G>C	c.(592-594)Ggt>Cgt	p.G198R		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	198								p.G198R(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CTTTTTCAATGGTGACTGTTG	0.418																																							uc001kmv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(592-594)GGT>CGT		hypothetical protein LOC26148							88.0	88.0	88.0					10																	98741739		2203	4300	6503	SO:0001583	missense	26148							g.chr10:98741739G>C	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.592G>C	10.37:g.98741739G>C	ENSP00000286067:p.Gly198Arg					C10orf12_uc009xvg.1_Missense_Mutation_p.G508R	p.G198R	NM_015652	NP_056467	Q8N655	CJ012_HUMAN		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)	1	699	+		Colorectal(252;0.172)	198					Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	c.592G>C	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.311984	0.81358	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.12879	2.64	5.95	5.95	0.96441	.	0.000000	0.51477	D	0.000095	T	0.28234	0.0697	N	0.24115	0.695	0.51233	D	0.999913	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.02326	-1.1176	10	0.87932	D	0	-13.9611	20.3712	0.98891	0.0:0.0:1.0:0.0	.	32;198	A0PJI9;Q8N655	.;CJ012_HUMAN	R	198;32	ENSP00000286067:G198R	ENSP00000286067:G198R	G	+	1	0	C10orf12	98731729	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.711000	0.91396	2.822000	0.97130	0.655000	0.94253	GGT		0.418	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652		24	102	0	0	0	0.00278	0	24	102				
SLIT1	6585	broad.mit.edu	37	10	98807553	98807553	+	Missense_Mutation	SNP	C	C	A	rs139828471		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:98807553C>A	ENST00000266058.4	-	16	1773	c.1528G>T	c.(1528-1530)Gac>Tac	p.D510Y	SLIT1_ENST00000371070.4_Missense_Mutation_p.D510Y|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	510	LRRNT 3.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.D510Y(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CAGACCACGTCGCTGTTGCAC	0.652																																							uc001kmw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1528-1530)GAC>TAC		slit homolog 1 precursor							70.0	63.0	65.0					10																	98807553		2203	4300	6503	SO:0001583	missense	6585				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding	g.chr10:98807553C>A	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1528G>T	10.37:g.98807553C>A	ENSP00000266058:p.Asp510Tyr					SLIT1_uc009xvh.1_Missense_Mutation_p.D520Y	p.D510Y	NM_003061	NP_003052	O75093	SLIT1_HUMAN		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)	16	1780	-		Colorectal(252;0.162)	510			LRRNT 3.		Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	c.1528G>T	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.444319	0.43429	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	D;D;T	0.81739	-1.53;-1.53;0.34	4.73	3.82	0.43975	.	0.000000	0.85682	D	0.000000	D	0.89283	0.6671	M	0.79805	2.47	0.80722	D	1	D;D	0.76494	0.999;0.969	D;P	0.77557	0.99;0.497	D	0.90796	0.4690	10	0.87932	D	0	.	14.4773	0.67554	0.148:0.852:0.0:0.0	.	520;510	E7EWQ8;O75093	.;SLIT1_HUMAN	Y	510;520;510;503	ENSP00000266058:D510Y;ENSP00000360109:D510Y;ENSP00000315005:D503Y	ENSP00000266058:D510Y	D	-	1	0	SLIT1	98797543	0.999000	0.42202	0.081000	0.20488	0.003000	0.03518	4.260000	0.58835	1.204000	0.43247	-0.475000	0.04921	GAC		0.652	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061		12	81	1	0	0.00010058	0.013537	0.000114746	12	81				
ABLIM1	3983	broad.mit.edu	37	10	116197683	116197683	+	Splice_Site	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:116197683T>A	ENST00000277895.5	-	22	2240	c.2143A>T	c.(2143-2145)Ata>Tta	p.I715L	ABLIM1_ENST00000369253.2_Splice_Site_p.I338L|ABLIM1_ENST00000533213.2_Splice_Site_p.I655L|ABLIM1_ENST00000369252.4_Splice_Site_p.I655L|ABLIM1_ENST00000392952.3_Splice_Site_p.I392L|ABLIM1_ENST00000369266.3_Splice_Site_p.I392L	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	715	HP. {ECO:0000255|PROSITE- ProRule:PRU00595}.				axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.I655L(1)|p.I392L(1)|p.I715L(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		TATGGAAATATCTGAGAAGAA	0.418																																							uc010qsg.1		NA																	3	Substitution - Missense(3)		lung(3)	breast(1)	1						c.(2143-2145)ATA>TTA		actin-binding LIM protein 1 isoform a							142.0	132.0	135.0					10																	116197683		2203	4300	6503	SO:0001630	splice_region_variant	3983				axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding	g.chr10:116197683T>A	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.2143-1A>T	10.37:g.116197683T>A						ABLIM1_uc010qsh.1_Missense_Mutation_p.I683L|ABLIM1_uc010qsi.1_Missense_Mutation_p.I655L|ABLIM1_uc010qsf.1_Missense_Mutation_p.I392L	p.I715L	NM_002313	NP_002304	O14639	ABLM1_HUMAN		Epithelial(162;0.0132)|all cancers(201;0.0383)	21	2242	-		Colorectal(252;0.0373)|Breast(234;0.231)	715			HP.		A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000277895.5	37	c.2143A>T	CCDS7590.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.32|12.32	1.902547|1.902547	0.33628|0.33628	.|.	.|.	ENSG00000099204|ENSG00000099204	ENST00000336585;ENST00000369252;ENST00000392952;ENST00000369257;ENST00000369267;ENST00000533213;ENST00000369262;ENST00000369263;ENST00000369266;ENST00000369256;ENST00000369260;ENST00000277895;ENST00000369253|ENST00000392955	T;T;T;T|.	0.36157|.	1.42;1.27;1.43;1.29|.	5.91|5.91	4.76|4.76	0.60689|0.60689	Villin headpiece (3);|.	0.057875|.	0.64402|.	D|.	0.000001|.	T|T	0.60983|0.60983	0.2311|0.2311	L|L	0.51914|0.51914	1.62|1.62	0.43545|0.43545	D|D	0.99584|0.99584	B;B;B;B|.	0.27117|.	0.097;0.038;0.168;0.028|.	B;B;B;B|.	0.31245|.	0.126;0.013;0.078;0.044|.	T|T	0.57236|0.57236	-0.7846|-0.7846	10|5	0.72032|.	D|.	0.01|.	.|.	12.4506|12.4506	0.55675|0.55675	0.1257:0.0:0.0:0.8743|0.1257:0.0:0.0:0.8743	.|.	655;683;715;392|.	F8W8M4;A6NKJ2;O14639;O14639-5|.	.;.;ABLM1_HUMAN;.|.	L|S	715;655;392;338;683;655;783;639;392;639;592;783;467|588	ENSP00000358256:I655L;ENSP00000376679:I392L;ENSP00000433629:I655L;ENSP00000358270:I392L|.	ENSP00000277895:I783L|.	I|R	-|-	1|3	0|2	ABLIM1|ABLIM1	116187673|116187673	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.062000|0.062000	0.15995|0.15995	3.787000|3.787000	0.55439|0.55439	1.035000|1.035000	0.39972|0.39972	-0.333000|-0.333000	0.08304|0.08304	ATA|AGA		0.418	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3		Missense_Mutation	28	133	0	0	0	0.008361	0	28	133				
SLC18A2	6571	broad.mit.edu	37	10	119015006	119015006	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:119015006G>T	ENST00000298472.5	+	8	950	c.807G>T	c.(805-807)gtG>gtT	p.V269V	SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	269					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)	p.V269V(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	AGCTCTTTGTGCTCCAGCCGT	0.542																																							uc001ldd.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(805-807)GTG>GTT		solute carrier family 18 (vesicular monoamine),	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)						35.0	43.0	40.0					10																	119015006		2203	4300	6503	SO:0001819	synonymous_variant	6571				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity	g.chr10:119015006G>T	L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.807G>T	10.37:g.119015006G>T						SLC18A2_uc009xyy.1_Silent_p.V66V	p.V269V	NM_003054	NP_003045	Q05940	VMAT2_HUMAN		all cancers(201;0.029)	8	838	+		Colorectal(252;0.19)	269			Helical; (Potential).		B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Silent	SNP	ENST00000298472.5	37	c.807G>T	CCDS7599.1																																																																																				0.542	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054		15	59	1	0	1.15088e-07	0.004007	1.45658e-07	15	59				
FAM196A	642938	broad.mit.edu	37	10	128973656	128973656	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr10:128973656G>C	ENST00000522781.1	-	4	1559	c.1004C>G	c.(1003-1005)cCt>cGt	p.P335R	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Missense_Mutation_p.P335R	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	335								p.P335R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TGTGGGACTAGGCTGGTTCCC	0.597																																							uc001lju.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1003-1005)CCT>CGT		hypothetical protein LOC642938							94.0	104.0	101.0					10																	128973656		2203	4300	6503	SO:0001583	missense	642938							g.chr10:128973656G>C		CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.1004C>G	10.37:g.128973656G>C	ENSP00000429763:p.Pro335Arg					DOCK1_uc001ljt.2_Intron|DOCK1_uc010qun.1_Intron|FAM196A_uc010quo.1_Missense_Mutation_p.P335R|FAM196A_uc001ljv.1_Missense_Mutation_p.P335R|FAM196A_uc009yap.1_Missense_Mutation_p.P335R	p.P335R	NM_001039762	NP_001034851	Q6ZSG2	F196A_HUMAN			1	1045	-			335					B2RNT4|B7ZME7	Missense_Mutation	SNP	ENST00000522781.1	37	c.1004C>G	CCDS31312.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922217	0.33908	.	.	ENSG00000188916	ENST00000522781;ENST00000424811	T;T	0.50548	0.74;0.74	5.08	3.23	0.37069	.	0.251682	0.40469	N	0.001097	T	0.56277	0.1974	M	0.62723	1.935	0.43065	D	0.994695	P;D	0.53462	0.919;0.96	P;P	0.54312	0.682;0.748	T	0.58769	-0.7578	10	0.59425	D	0.04	.	11.6785	0.51444	0.1451:0.0:0.8549:0.0	.	335;335	B7ZME7;Q6ZSG2	.;F196A_HUMAN	R	335	ENSP00000429763:P335R;ENSP00000428730:P335R	ENSP00000428730:P335R	P	-	2	0	FAM196A	128863646	1.000000	0.71417	0.367000	0.25926	0.157000	0.22087	4.208000	0.58486	0.662000	0.31006	0.563000	0.77884	CCT		0.597	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762		44	200	0	0	0	0.01441	0	44	200				
MUC2	4583	broad.mit.edu	37	11	1080968	1080968	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:1080968C>A	ENST00000441003.2	+	10	1379	c.1352C>A	c.(1351-1353)gCt>gAt	p.A451D	MUC2_ENST00000359061.5_Missense_Mutation_p.A451D	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	451	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.A451D(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GTGCTGCTGGCTGACAAGAAG	0.637																																							uc001lsx.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)|breast(1)	2						c.(1351-1353)GCT>GAT		mucin 2 precursor	Pranlukast(DB01411)						71.0	81.0	78.0					11																	1080968		2065	4179	6244	SO:0001583	missense	4583					inner mucus layer|outer mucus layer	protein binding	g.chr11:1080968C>A	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.1352C>A	11.37:g.1080968C>A	ENSP00000415183:p.Ala451Asp						p.A451D	NM_002457	NP_002448	Q02817	MUC2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	10	1379	+		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)	451			VWFD 2.		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37	c.1352C>A		.	.	.	.	.	.	.	.	.	.	C	6.957	0.546398	0.13312	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.59772	0.24;0.24	3.57	2.66	0.31614	.	1.385230	0.05449	U	0.549162	T	0.65196	0.2668	L	0.46157	1.445	0.09310	N	1	D	0.54397	0.966	P	0.58780	0.845	T	0.47849	-0.9085	10	0.56958	D	0.05	.	6.4239	0.21758	0.0:0.6973:0.0:0.3027	.	451	E7EUV1	.	D	451	ENSP00000415183:A451D;ENSP00000351956:A451D	ENSP00000351956:A451D	A	+	2	0	MUC2	1070968	0.000000	0.05858	0.004000	0.12327	0.150000	0.21749	0.014000	0.13333	0.730000	0.32425	0.436000	0.28706	GCT		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457		11	78	1	0	4.68919e-08	0.008291	6.08414e-08	11	78				
LSP1	4046	broad.mit.edu	37	11	1908758	1908758	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:1908758G>T	ENST00000311604.3	+	10	1160	c.985G>T	c.(985-987)Gag>Tag	p.E329*	LSP1_ENST00000485341.1_3'UTR|LSP1_ENST00000381775.1_Nonsense_Mutation_p.E457*|LSP1_ENST00000405957.2_Nonsense_Mutation_p.E267*|LSP1_ENST00000406638.2_Nonsense_Mutation_p.E267*	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1	329					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)	p.E329*(1)|p.E267*(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		TGGGAAGTATGAGAAGGTGCT	0.577																																							uc001lui.2		NA																	2	Substitution - Nonsense(2)		lung(2)	large_intestine(1)	1						c.(985-987)GAG>TAG		lymphocyte-specific protein 1 isoform 1							99.0	97.0	98.0					11																	1908758		2202	4299	6501	SO:0001587	stop_gained	4046				cellular component movement|cellular defense response	actin cytoskeleton|Golgi apparatus|plasma membrane	actin binding|signal transducer activity	g.chr11:1908758G>T	M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.985G>T	11.37:g.1908758G>T	ENSP00000308383:p.Glu329*					LSP1_uc001luj.2_Nonsense_Mutation_p.E457*|LSP1_uc001luk.2_Nonsense_Mutation_p.E267*|LSP1_uc001lul.2_Nonsense_Mutation_p.E267*|LSP1_uc001lum.2_Nonsense_Mutation_p.E267*	p.E329*	NM_002339	NP_002330	P33241	LSP1_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)	10	1160	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	329					B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Nonsense_Mutation	SNP	ENST00000311604.3	37	c.985G>T	CCDS31334.1	.	.	.	.	.	.	.	.	.	.	.	47	13.559488	0.99749	.	.	ENSG00000130592	ENST00000311604;ENST00000381775;ENST00000405957;ENST00000406638	.	.	.	4.48	3.48	0.39840	.	0.184416	0.25532	U	0.030033	.	.	.	.	.	.	0.54753	D	0.999982	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-30.9921	7.6354	0.28264	0.0955:0.1703:0.7342:0.0	.	.	.	.	X	329;457;267;267	.	ENSP00000308383:E329X	E	+	1	0	LSP1	1865334	0.996000	0.38824	1.000000	0.80357	0.892000	0.51952	2.559000	0.45888	2.218000	0.71995	0.305000	0.20034	GAG		0.577	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034045.3	NM_002339		13	80	1	0	0.00244969	0.00245	0.00264064	13	80				
OR51E1	143503	broad.mit.edu	37	11	4674576	4674576	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:4674576C>T	ENST00000530215.1	+	2	191	c.150C>T	c.(148-150)cgC>cgT	p.R50R	OR51E1_ENST00000396952.5_Silent_p.L274L			Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L273L(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGACTCTCCGCTGCCCGTCAT	0.498																																							uc001lzi.3		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(3)|pancreas(1)	4						c.(820-822)CTG>TTG		olfactory receptor, family 51, subfamily E,							176.0	166.0	169.0					11																	4674576		2201	4298	6499	SO:0001819	synonymous_variant	143503				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4674576C>T	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000530215.1:c.150C>T	11.37:g.4674576C>T							p.L274L	NM_152430	NP_689643	Q8TCB6	O51E1_HUMAN		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)	2	964	+		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)	273			Extracellular (Potential).		A8KAM6|Q5S4P5|Q66X57|Q6IF93	Silent	SNP	ENST00000530215.1	37	c.820C>T																																																																																					0.498	OR51E1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000385957.1	NM_152430		29	176	0	0	0	0.007291	0	29	176				
OR51M1	390059	broad.mit.edu	37	11	5411262	5411262	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:5411262C>T	ENST00000328611.3	+	1	656	c.634C>T	c.(634-636)Ctg>Ttg	p.L212L	HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	212					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L212L(1)		NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTGTATGGACTGATGGTGGT	0.522																																							uc010qzc.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(634-636)CTG>TTG		olfactory receptor, family 51, subfamily M,							146.0	139.0	141.0					11																	5411262		2035	4193	6228	SO:0001819	synonymous_variant	390059					integral to membrane	olfactory receptor activity	g.chr11:5411262C>T	BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.634C>T	11.37:g.5411262C>T						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	p.L212L	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	634	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	212					Q6IF80	Silent	SNP	ENST00000328611.3	37	c.634C>T	CCDS53596.1																																																																																				0.522	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142981.1	NM_001004756		23	86	0	0	0	0.012319	0	23	86				
UBQLN3	50613	broad.mit.edu	37	11	5529464	5529464	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:5529464G>C	ENST00000311659.4	-	2	1472	c.1325C>G	c.(1324-1326)cCt>cGt	p.P442R	HBG2_ENST00000380252.1_5'Flank|HBE1_ENST00000380237.1_5'Flank|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	442								p.P442R(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GACAAGATCAGGCAAGTTTGT	0.537																																					Ovarian(72;684 1260 12332 41642 52180)	Ovarian(72;684 1260 12332 41642 52180)	uc001may.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1324-1326)CCT>CGT		ubiquilin 3							95.0	101.0	99.0					11																	5529464		2201	4297	6498	SO:0001583	missense	50613							g.chr11:5529464G>C	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1325C>G	11.37:g.5529464G>C	ENSP00000347997:p.Pro442Arg					HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_5'Flank|OR51B5_uc001maq.1_5'Flank	p.P442R	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	1411	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	442					Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	c.1325C>G	CCDS7758.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050909	0.55218	.	.	ENSG00000175520	ENST00000311659	T	0.38722	1.12	5.04	5.04	0.67666	.	0.000000	0.38778	N	0.001561	T	0.61261	0.2333	M	0.80982	2.52	0.33821	D	0.629056	D	0.54047	0.964	P	0.57960	0.83	T	0.75107	-0.3434	10	0.72032	D	0.01	-28.618	13.7585	0.62950	0.0:0.0:1.0:0.0	.	442	Q9H347	UBQL3_HUMAN	R	442	ENSP00000347997:P442R	ENSP00000347997:P442R	P	-	2	0	UBQLN3	5486040	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	2.128000	0.42045	2.609000	0.88269	0.655000	0.94253	CCT		0.537	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481		19	135	0	0	0	0.007413	0	19	135				
OR56A3	390083	broad.mit.edu	37	11	5969145	5969145	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:5969145G>T	ENST00000329564.6	+	1	576	c.569G>T	c.(568-570)aGa>aTa	p.R190I	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R190I(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTGTTTCCAGACTCTCCTGC	0.473																																							uc010qzt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(568-570)AGA>ATA		olfactory receptor, family 56, subfamily A,							112.0	112.0	112.0					11																	5969145		2161	4286	6447	SO:0001583	missense	390083				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5969145G>T		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.569G>T	11.37:g.5969145G>T	ENSP00000331572:p.Arg190Ile						p.R190I	NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	569	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	190			Extracellular (Potential).		A6NN77|Q6IFF7	Missense_Mutation	SNP	ENST00000329564.6	37	c.569G>T	CCDS41614.1	.	.	.	.	.	.	.	.	.	.	G	6.692	0.496295	0.12762	.	.	ENSG00000184478	ENST00000329564	T	0.00145	8.67	5.13	-0.19	0.13256	GPCR, rhodopsin-like superfamily (1);	0.275215	0.31734	N	0.007142	T	0.00178	0.0005	M	0.61703	1.905	0.28105	N	0.93126	B	0.10296	0.003	B	0.20577	0.03	T	0.32771	-0.9894	10	0.87932	D	0	-18.1915	8.1099	0.30909	0.5821:0.0:0.4179:0.0	.	190	Q8NH54	O56A3_HUMAN	I	190	ENSP00000331572:R190I	ENSP00000331572:R190I	R	+	2	0	OR56A3	5925721	0.000000	0.05858	0.988000	0.46212	0.010000	0.07245	-3.058000	0.00624	0.071000	0.16664	-0.201000	0.12746	AGA		0.473	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443		17	130	1	0	2.48551e-13	0.00499	3.82957e-13	17	130				
NLRP10	338322	broad.mit.edu	37	11	7981815	7981815	+	Silent	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:7981815A>G	ENST00000328600.2	-	2	1505	c.1344T>C	c.(1342-1344)agT>agC	p.S448S		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	448	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)	p.S448S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGTCGTTACTACTCAGGAAAG	0.483																																							uc001mfv.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9						c.(1342-1344)AGT>AGC		NLR family, pyrin domain containing 10							100.0	111.0	107.0					11																	7981815		2201	4296	6497	SO:0001819	synonymous_variant	338322						ATP binding	g.chr11:7981815A>G	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1344T>C	11.37:g.7981815A>G							p.S448S	NM_176821	NP_789791	Q86W26	NAL10_HUMAN		Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	1361	-			448			NACHT.		Q2M3C4|Q6JGT0	Silent	SNP	ENST00000328600.2	37	c.1344T>C	CCDS7784.1																																																																																				0.483	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		27	165	0	0	0	0.00632	0	27	165				
PTH	5741	broad.mit.edu	37	11	13514017	13514017	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:13514017C>T	ENST00000282091.1	-	3	397	c.283G>A	c.(283-285)Gaa>Aaa	p.E95K	PTH_ENST00000529816.1_Missense_Mutation_p.E95K	NM_000315.2	NP_000306.1	P01270	PTHY_HUMAN	parathyroid hormone	95					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|bone resorption (GO:0045453)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular macromolecule biosynthetic process (GO:0034645)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to lead ion (GO:0010288)|response to parathyroid hormone (GO:0071107)|response to vitamin D (GO:0033280)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.E95K(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(625;0.00116)|Epithelial(150;0.0357)|LUSC - Lung squamous cell carcinoma(625;0.0836)		AGACTTTTTTCATGGCTCTCA	0.438																																							uc001mlb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(283-285)GAA>AAA		parathyroid hormone preproprotein							122.0	112.0	115.0					11																	13514017		2200	4294	6494	SO:0001583	missense	5741				bone resorption|cAMP metabolic process|cell-cell signaling|cellular calcium ion homeostasis|cellular macromolecule biosynthetic process|induction of apoptosis by hormones|positive regulation of cAMP biosynthetic process|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|skeletal system development		hormone activity|peptide hormone receptor binding	g.chr11:13514017C>T	J00301	CCDS7812.1	11p15.3-p15.1	2013-02-28				ENSG00000152266		"""Endogenous ligands"""	9606	protein-coding gene	gene with protein product	"""parathyrin"", ""parathormone"", ""parathyroid hormone 1"", ""preproparathyroid hormone"", ""prepro-PTH"""	168450				1672845	Standard	NM_000315		Approved	PTH1	uc001mlb.3	P01270		ENST00000282091.1:c.283G>A	11.37:g.13514017C>T	ENSP00000282091:p.Glu95Lys						p.E95K	NM_000315	NP_000306	P01270	PTHY_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00116)|Epithelial(150;0.0357)|LUSC - Lung squamous cell carcinoma(625;0.0836)	3	398	-			95					Q4VB48|Q9UD38	Missense_Mutation	SNP	ENST00000282091.1	37	c.283G>A	CCDS7812.1	.	.	.	.	.	.	.	.	.	.	C	8.093	0.774955	0.16051	.	.	ENSG00000152266	ENST00000282091;ENST00000529816	D;D	0.82255	-1.59;-1.59	5.95	2.83	0.33086	.	0.768860	0.12356	N	0.476081	T	0.68805	0.3041	N	0.14661	0.345	0.09310	N	1	B	0.16396	0.017	B	0.19391	0.025	T	0.50980	-0.8763	10	0.15499	T	0.54	-0.2621	11.7961	0.52100	0.071:0.255:0.674:0.0	.	95	P01270	PTHY_HUMAN	K	95	ENSP00000282091:E95K;ENSP00000433208:E95K	ENSP00000282091:E95K	E	-	1	0	PTH	13470593	0.226000	0.23696	0.619000	0.29118	0.169000	0.22640	1.180000	0.32005	0.832000	0.34804	-0.171000	0.13296	GAA		0.438	PTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386198.1	NM_000315		11	62	0	0	0	0.008291	0	11	62				
PLEKHA7	144100	broad.mit.edu	37	11	16872832	16872832	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:16872832C>A	ENST00000355661.3	-	8	612	c.602G>T	c.(601-603)cGa>cTa	p.R201L	PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000448080.2_Missense_Mutation_p.R201L|PLEKHA7_ENST00000531066.1_Missense_Mutation_p.R201L			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	201	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)	p.R201L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						CGCTTCTTCTCGGCTGTCTTT	0.522																																							uc001mmo.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(601-603)CGA>CTA		pleckstrin homology domain containing, family A							78.0	74.0	75.0					11																	16872832		2200	4294	6494	SO:0001583	missense	144100				epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding	g.chr11:16872832C>A	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.602G>T	11.37:g.16872832C>A	ENSP00000347883:p.Arg201Leu					PLEKHA7_uc010rcu.1_Missense_Mutation_p.R201L	p.R201L	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN			8	617	-			201			PH.		B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	ENST00000355661.3	37	c.602G>T	CCDS31434.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033979	0.93575	.	.	ENSG00000166689	ENST00000531066;ENST00000355661;ENST00000448080;ENST00000528376	T;T;T;T	0.12147	2.71;2.71;2.71;2.71	5.51	5.51	0.81932	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.064467	0.64402	D	0.000004	T	0.20088	0.0483	L	0.42581	1.335	0.51012	D	0.999907	P;D	0.53462	0.534;0.96	P;P	0.50617	0.578;0.646	T	0.00175	-1.1954	10	0.72032	D	0.01	-7.3737	12.7205	0.57140	0.0:0.9249:0.0:0.0751	.	201;201	E9PKC0;Q6IQ23	.;PKHA7_HUMAN	L	201;201;201;95	ENSP00000435389:R201L;ENSP00000347883:R201L;ENSP00000416895:R201L;ENSP00000435806:R95L	ENSP00000347883:R201L	R	-	2	0	PLEKHA7	16829408	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.759000	0.68785	2.605000	0.88082	0.655000	0.94253	CGA		0.522	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058		18	94	1	0	9.16793e-09	0.00499	1.2318e-08	18	94				
RPS13	6207	broad.mit.edu	37	11	17099024	17099025	+	Splice_Site	DNP	CC	CC	AA			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:17099024_17099025CC>AA	ENST00000525634.1	-	2	169	c.24_24GG>TT	c.(22-24)ggGG>ggTTg	p.G8G	SNORD14A_ENST00000606526.1_RNA|RPS13_ENST00000526895.1_Intron|PIK3C2A_ENST00000531428.1_5'Flank|SNORD14B_ENST00000364533.1_RNA|RPS13_ENST00000228140.2_Splice_Site_p.G8G			P62277	RS13_HUMAN	ribosomal protein S13	8					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.?(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)	5						ACAGGCCCTTCCTGGGGAGAGA	0.644																																							uc001mmp.2		NA																	1	Unknown(1)		lung(1)		0						c.e2-1		ribosomal protein S13																																				SO:0001630	splice_region_variant	6207				endocrine pancreas development|negative regulation of RNA splicing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	mRNA binding|protein binding|structural constituent of ribosome	g.chr11:17099024_17099025CC>AA	X79239	CCDS7823.1	11p	2011-04-05			ENSG00000110700	ENSG00000110700		"""S ribosomal proteins"""	10386	protein-coding gene	gene with protein product	"""40S ribosomal protein S13"""	180476				8332508, 9582194	Standard	NM_001017		Approved	S13	uc001mmp.3	P62277	OTTHUMG00000165988	ENST00000525634.1:c.24_24delinsAA	11.37:g.17099024_17099025delinsAA							p.G8_splice	NM_001017	NP_001008	P62277	RS13_HUMAN			2	56	-								B2R549|P19116|Q02546|Q29200|Q498Y0	Splice_Site	DNP	ENST00000525634.1	37	c.24_splice	CCDS7823.1																																																																																				0.644	RPS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387320.2	NM_001017	Silent	4	30	0	0	0	0.004672	0	4	30				
IGSF22	283284	broad.mit.edu	37	11	18740276	18740276	+	Splice_Site	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:18740276C>A	ENST00000513874.1	-	8	836		c.e8-1		RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22									p.?(2)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TCCGGATGGCCTGAGAGATTA	0.468																																							uc009yht.2		NA																	2	Unknown(2)		lung(2)	ovary(4)|large_intestine(2)|kidney(1)	7						c.e8-1		immunoglobulin superfamily, member 22							121.0	122.0	122.0					11																	18740276		1865	4098	5963	SO:0001630	splice_region_variant	283284							g.chr11:18740276C>A	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.697-1G>T	11.37:g.18740276C>A						IGSF22_uc001mpa.2_Splice_Site	p.A233_splice	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN			8	887	-								A6NNA0|D6RGV7	Splice_Site	SNP	ENST00000513874.1	37	c.697_splice	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470276	0.43942	.	.	ENSG00000179057	ENST00000513874	.	.	.	5.16	3.22	0.36961	.	.	.	.	.	.	.	.	.	.	.	0.37093	D	0.899528	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.442	0.32820	0.0:0.7606:0.1539:0.0855	.	.	.	.	.	-1	.	.	.	-	.	.	IGSF22	18696852	1.000000	0.71417	0.003000	0.11579	0.963000	0.63663	5.045000	0.64220	0.529000	0.28599	0.591000	0.81541	.		0.468	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	Intron	23	218	1	0	7.87624e-14	0.00278	1.22017e-13	23	218				
NAT10	55226	broad.mit.edu	37	11	34160792	34160792	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:34160792G>T	ENST00000257829.3	+	22	2472	c.2266G>T	c.(2266-2268)Gat>Tat	p.D756Y	NAT10_ENST00000531159.2_Missense_Mutation_p.D684Y|NAT10_ENST00000527971.1_Intron	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	756	Required for localization to the nucleolus and midbody.					membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)	p.D756Y(1)		endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				CACTGATGAGGATGAGGCTGA	0.557																																							uc001mvk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2266-2268)GAT>TAT		N-acetyltransferase 10 isoform a							101.0	99.0	100.0					11																	34160792		2202	4298	6500	SO:0001583	missense	55226					nucleolus	ATP binding|N-acetyltransferase activity|protein binding	g.chr11:34160792G>T	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.2266G>T	11.37:g.34160792G>T	ENSP00000257829:p.Asp756Tyr					NAT10_uc010ren.1_Missense_Mutation_p.D684Y	p.D756Y	NM_024662	NP_078938	Q9H0A0	NAT10_HUMAN			22	2510	+		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)	756			Required for localization to the nucleolus and midbody.		B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	ENST00000257829.3	37	c.2266G>T	CCDS7889.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075919	0.36662	.	.	ENSG00000135372	ENST00000257829;ENST00000531159	T;T	0.32515	1.45;1.45	5.25	3.39	0.38822	.	0.412994	0.30401	N	0.009713	T	0.36193	0.0958	M	0.77103	2.36	0.80722	D	1	B	0.25772	0.134	B	0.27262	0.078	T	0.23976	-1.0173	10	0.62326	D	0.03	-2.512	11.6274	0.51153	0.145:0.0:0.855:0.0	.	756	Q9H0A0	NAT10_HUMAN	Y	756;684	ENSP00000257829:D756Y;ENSP00000433011:D684Y	ENSP00000257829:D756Y	D	+	1	0	NAT10	34117368	1.000000	0.71417	0.104000	0.21259	0.470000	0.32858	7.686000	0.84128	0.608000	0.30000	0.549000	0.68633	GAT		0.557	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662		21	121	1	0	4.26978e-12	0.00333	6.4559e-12	21	121				
CAT	847	broad.mit.edu	37	11	34478335	34478335	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:34478335A>G	ENST00000241052.4	+	8	1116	c.1027A>G	c.(1027-1029)Att>Gtt	p.I343V		NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase	343					aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.I343V(1)		breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	GCCACCTGGCATTGAGGCCAG	0.478																																							uc001mvm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1027-1029)ATT>GTT		catalase	Fomepizole(DB01213)						89.0	72.0	78.0					11																	34478335		2202	4298	6500	SO:0001583	missense	847				hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity	g.chr11:34478335A>G	AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1027A>G	11.37:g.34478335A>G	ENSP00000241052:p.Ile343Val					CAT_uc009ykc.1_RNA	p.I343V	NM_001752	NP_001743	P04040	CATA_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000995)	8	1110	+		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)	343					A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	Missense_Mutation	SNP	ENST00000241052.4	37	c.1027A>G	CCDS7891.1	.	.	.	.	.	.	.	.	.	.	A	15.74	2.923396	0.52653	.	.	ENSG00000121691	ENST00000241052	D	0.93488	-3.23	6.04	6.04	0.98038	Catalase domain (1);Catalase, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.92241	0.7539	M	0.62088	1.915	0.80722	D	1	B	0.13145	0.007	B	0.19148	0.024	D	0.88672	0.3196	10	0.44086	T	0.13	-32.2348	16.5885	0.84745	1.0:0.0:0.0:0.0	.	343	P04040	CATA_HUMAN	V	343	ENSP00000241052:I343V	ENSP00000241052:I343V	I	+	1	0	CAT	34434911	1.000000	0.71417	1.000000	0.80357	0.530000	0.34684	5.298000	0.65710	2.317000	0.78254	0.460000	0.39030	ATT		0.478	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103197.2	NM_001752		12	75	0	0	0	0.010729	0	12	75				
TTC17	55761	broad.mit.edu	37	11	43413371	43413371	+	Splice_Site	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:43413371G>T	ENST00000039989.4	+	5	546	c.532G>T	c.(532-534)Ggt>Tgt	p.G178C	RP11-484D2.4_ENST00000394183.2_RNA|TTC17_ENST00000299240.6_Splice_Site_p.G178C	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	178					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.G178C(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						TTCTCTTCAGGGTGTACAGGA	0.318																																							uc001mxi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(532-534)GGT>TGT		tetratricopeptide repeat domain 17							82.0	79.0	80.0					11																	43413371		2203	4300	6503	SO:0001630	splice_region_variant	55761						binding	g.chr11:43413371G>T	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.532-1G>T	11.37:g.43413371G>T						TTC17_uc001mxh.2_Missense_Mutation_p.G178C|TTC17_uc010rfj.1_Missense_Mutation_p.G121C	p.G178C	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN			5	546	+			178					G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	c.532G>T	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.870168	0.91587	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.55588	0.87;0.51	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.70072	0.3182	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.68142	-0.5487	9	.	.	.	-12.2162	19.0234	0.92923	0.0:0.0:1.0:0.0	.	178;178;178	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	C	178	ENSP00000299240:G178C;ENSP00000039989:G178C	.	G	+	1	0	TTC17	43369947	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.568000	0.98166	2.571000	0.86741	0.563000	0.77884	GGT		0.318	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	Missense_Mutation	5	73	1	0	0.00116845	0.001168	0.00126917	5	73				
OR5D18	219438	broad.mit.edu	37	11	55587648	55587648	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:55587648G>A	ENST00000333976.4	+	1	563	c.543G>A	c.(541-543)gaG>gaA	p.E181E		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E181E(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				TCTTCTGTGAGTTCTCCTCAC	0.428																																							uc010rin.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(541-543)GAG>GAA		olfactory receptor, family 5, subfamily D,							223.0	202.0	209.0					11																	55587648		2200	4296	6496	SO:0001819	synonymous_variant	219438				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55587648G>A	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.543G>A	11.37:g.55587648G>A							p.E181E	NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN			1	543	+		all_epithelial(135;0.208)	181			Extracellular (Potential).		Q6IF67|Q6IFD3|Q96RB3	Silent	SNP	ENST00000333976.4	37	c.543G>A	CCDS31510.1																																																																																				0.428	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952		28	217	0	0	0	0.007291	0	28	217				
OR5M1	390168	broad.mit.edu	37	11	56380709	56380709	+	Silent	SNP	C	C	T	rs532045516		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:56380709C>T	ENST00000526538.1	-	1	269	c.270G>A	c.(268-270)aaG>aaA	p.K90K		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K90N(1)|p.K90K(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						AGGAGATGGTCTTCTGTTCTG	0.448													C|||	1	0.000199681	0.0008	0.0	5008	,	,		24525	0.0		0.0	False		,,,				2504	0.0						uc001nja.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	central_nervous_system(1)	1						c.(268-270)AAG>AAA		olfactory receptor, family 5, subfamily M,							148.0	139.0	142.0					11																	56380709		1927	4130	6057	SO:0001819	synonymous_variant	390168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56380709C>T	AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.270G>A	11.37:g.56380709C>T							p.K90K	NM_001004740	NP_001004740	Q8NGP8	OR5M1_HUMAN			1	270	-			90			Extracellular (Potential).		Q6IF60|Q96RB6	Silent	SNP	ENST00000526538.1	37	c.270G>A	CCDS53631.1																																																																																				0.448	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391610.1	NM_001004740		12	62	0	0	0	0.001855	0	12	62				
OR9Q2	219957	broad.mit.edu	37	11	57958429	57958429	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:57958429C>A	ENST00000311591.3	+	1	524	c.467C>A	c.(466-468)gCc>gAc	p.A156D		NM_001005283.2	NP_001005283.1	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q, member 2	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A156D(1)		breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(24)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41		Breast(21;0.0589)				TTTTTCAGTGCCTTTGTTCGA	0.502																																							uc010rka.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)	4						c.(466-468)GCC>GAC		olfactory receptor, family 9, subfamily Q,							93.0	77.0	83.0					11																	57958429		2201	4296	6497	SO:0001583	missense	219957				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57958429C>A	AB065859	CCDS31544.1	11q12.1	2012-08-09		2004-03-10	ENSG00000186513	ENSG00000186513		"""GPCR / Class A : Olfactory receptors"""	15328	protein-coding gene	gene with protein product				OR9Q2P			Standard	NM_001005283		Approved		uc010rka.2	Q8NGE9	OTTHUMG00000167414	ENST00000311591.3:c.467C>A	11.37:g.57958429C>A	ENSP00000308714:p.Ala156Asp						p.A156D	NM_001005283	NP_001005283	Q8NGE9	OR9Q2_HUMAN			1	467	+		Breast(21;0.0589)	156			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000311591.3	37	c.467C>A	CCDS31544.1	.	.	.	.	.	.	.	.	.	.	C	12.18	1.859152	0.32884	.	.	ENSG00000186513	ENST00000311591	T	0.42513	0.97	5.08	2.02	0.26589	GPCR, rhodopsin-like superfamily (1);	0.297627	0.24113	N	0.041428	T	0.62938	0.2469	M	0.85630	2.765	0.27922	N	0.93822	D	0.58620	0.983	D	0.68192	0.956	T	0.57843	-0.7741	10	0.87932	D	0	-9.2534	9.5122	0.39085	0.0:0.4906:0.4333:0.0761	.	156	Q8NGE9	OR9Q2_HUMAN	D	156	ENSP00000308714:A156D	ENSP00000308714:A156D	A	+	2	0	OR9Q2	57715005	0.000000	0.05858	0.825000	0.32803	0.120000	0.20174	0.801000	0.27055	0.349000	0.23975	0.655000	0.94253	GCC		0.502	OR9Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394540.1	NM_001005283		18	105	1	0	5.03518e-11	0.007413	7.28303e-11	18	105				
OR10W1	81341	broad.mit.edu	37	11	58034470	58034470	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:58034470C>A	ENST00000395079.2	-	1	1262	c.861G>T	c.(859-861)gaG>gaT	p.E287D		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E287D(1)		kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				CCCCTTTCATCTCACTGTTCC	0.522																																							uc001nmq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(859-861)GAG>GAT		olfactory receptor, family 10, subfamily W,							103.0	99.0	100.0					11																	58034470		2201	4295	6496	SO:0001583	missense	81341				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58034470C>A	AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.861G>T	11.37:g.58034470C>A	ENSP00000378516:p.Glu287Asp						p.E287D	NM_207374	NP_997257	Q8NGF6	O10W1_HUMAN			1	1263	-		Breast(21;0.0589)	287			Cytoplasmic (Potential).		A2RUD2|A8MTE1|Q6UXQ2	Missense_Mutation	SNP	ENST00000395079.2	37	c.861G>T	CCDS7968.1	.	.	.	.	.	.	.	.	.	.	C	4.755	0.140483	0.09083	.	.	ENSG00000172772	ENST00000395079	T	0.37411	1.2	5.7	-0.945	0.10388	.	0.000000	0.50627	D	0.000104	T	0.10337	0.0253	N	0.10945	0.07	0.28156	N	0.929209	B	0.33494	0.414	B	0.25759	0.063	T	0.21999	-1.0229	10	0.07990	T	0.79	.	1.6047	0.02681	0.1318:0.3833:0.2565:0.2284	.	287	Q8NGF6	O10W1_HUMAN	D	287	ENSP00000378516:E287D	ENSP00000378516:E287D	E	-	3	2	OR10W1	57791046	0.000000	0.05858	0.074000	0.20217	0.764000	0.43329	-1.767000	0.01795	-0.133000	0.11537	-0.136000	0.14681	GAG		0.522	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374		23	192	1	0	1.10923e-09	0.00278	1.51916e-09	23	192				
OR5B3	441608	broad.mit.edu	37	11	58170573	58170573	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:58170573C>A	ENST00000309403.2	-	1	309	c.310G>T	c.(310-312)Gct>Tct	p.A104S		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A104S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTGGCAAAAGCTACAAAGATA	0.453																																							uc010rkf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(310-312)GCT>TCT		olfactory receptor, family 5, subfamily B,							135.0	123.0	127.0					11																	58170573		2201	4295	6496	SO:0001583	missense	441608				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58170573C>A	AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.310G>T	11.37:g.58170573C>A	ENSP00000308270:p.Ala104Ser						p.A104S	NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN			1	310	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	104			Helical; Name=3; (Potential).		Q6IEV6	Missense_Mutation	SNP	ENST00000309403.2	37	c.310G>T	CCDS31549.1	.	.	.	.	.	.	.	.	.	.	c	1.923	-0.447911	0.04572	.	.	ENSG00000172769	ENST00000309403	T	0.02085	4.46	3.96	3.02	0.34903	GPCR, rhodopsin-like superfamily (1);	0.292022	0.24549	N	0.037572	T	0.01905	0.0060	N	0.25286	0.73	0.09310	N	1	B	0.14012	0.009	B	0.16289	0.015	T	0.45542	-0.9254	10	0.33940	T	0.23	-2.5053	9.0188	0.36186	0.4003:0.5997:0.0:0.0	.	104	Q8NH48	OR5B3_HUMAN	S	104	ENSP00000308270:A104S	ENSP00000308270:A104S	A	-	1	0	OR5B3	57927149	0.000000	0.05858	0.422000	0.26621	0.216000	0.24613	-1.806000	0.01735	0.985000	0.38656	0.585000	0.79938	GCT		0.453	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1	NM_001005469		25	112	1	0	1.66031e-10	0.003954	2.34761e-10	25	112				
OR4D11	219986	broad.mit.edu	37	11	59271767	59271767	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:59271767G>T	ENST00000313253.1	+	1	719	c.719G>T	c.(718-720)tGc>tTc	p.C240F		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C240F(1)		endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						ATCTCCACTTGCACCTCCCAC	0.552																																							uc001noa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(718-720)TGC>TTC		olfactory receptor, family 4, subfamily D,							228.0	209.0	216.0					11																	59271767		2201	4295	6496	SO:0001583	missense	219986				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59271767G>T	AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.719G>T	11.37:g.59271767G>T	ENSP00000320077:p.Cys240Phe						p.C240F	NM_001004706	NP_001004706	Q8NGI4	OR4DB_HUMAN			1	719	+			240			Helical; Name=6; (Potential).			Missense_Mutation	SNP	ENST00000313253.1	37	c.719G>T	CCDS31563.1	.	.	.	.	.	.	.	.	.	.	g	18.29	3.590810	0.66219	.	.	ENSG00000176200	ENST00000313253	T	0.00368	7.75	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000033	T	0.02083	0.0065	H	0.97390	3.995	0.50313	D	0.999862	D	0.58620	0.983	D	0.75484	0.986	T	0.12604	-1.0541	10	0.87932	D	0	-33.0322	17.8283	0.88673	0.0:0.0:1.0:0.0	.	240	Q8NGI4	OR4DB_HUMAN	F	240	ENSP00000320077:C240F	ENSP00000320077:C240F	C	+	2	0	OR4D11	59028343	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.530000	0.98051	2.554000	0.86153	0.557000	0.71058	TGC		0.552	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394236.1	NM_001004706		37	320	1	0	1.58521e-26	0.005524	2.80004e-26	37	320				
OOSP2	219990	broad.mit.edu	37	11	59807963	59807963	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:59807963G>C	ENST00000278855.2	+	1	216	c.31G>C	c.(31-33)Gtc>Ctc	p.V11L	PLAC1L_ENST00000532905.1_5'UTR	NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		11						extracellular region (GO:0005576)		p.V11L(1)		breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						GCTCCTCGCTGTCTTGATTTG	0.478																																							uc001nol.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(31-33)GTC>CTC		placenta-specific 1-like precursor							197.0	167.0	177.0					11																	59807963		2201	4295	6496	SO:0001583	missense	219990					extracellular region		g.chr11:59807963G>C																												ENST00000278855.2:c.31G>C	11.37:g.59807963G>C	ENSP00000278855:p.Val11Leu						p.V11L	NM_173801	NP_776162	Q86WS3	PLACL_HUMAN			1	216	+			11					E9PJA4|Q8N9U6	Missense_Mutation	SNP	ENST00000278855.2	37	c.31G>C	CCDS7979.1	.	.	.	.	.	.	.	.	.	.	G	2.094	-0.407752	0.04832	.	.	ENSG00000149507	ENST00000278855	.	.	.	3.71	0.626	0.17670	.	1.142800	0.06849	N	0.797062	T	0.25232	0.0613	N	0.22421	0.69	0.23192	N	0.998149	B	0.02656	0.0	B	0.04013	0.001	T	0.24440	-1.0160	9	0.15066	T	0.55	-0.0018	5.1517	0.15013	0.2434:0.1741:0.5824:0.0	.	11	Q86WS3	PLACL_HUMAN	L	11	.	ENSP00000278855:V11L	V	+	1	0	PLAC1L	59564539	0.000000	0.05858	0.013000	0.15412	0.001000	0.01503	0.235000	0.17948	-0.102000	0.12197	-2.479000	0.00199	GTC		0.478	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394411.1			18	139	0	0	0	0.012319	0	18	139				
MS4A5	64232	broad.mit.edu	37	11	60197159	60197159	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:60197159C>A	ENST00000300190.2	+	1	98	c.12C>A	c.(10-12)agC>agA	p.S4R	MS4A5_ENST00000534071.1_3'UTR	NM_023945.2	NP_076434.2	Q9H3V2	MS4A5_HUMAN	membrane-spanning 4-domains, subfamily A, member 5	4						integral component of membrane (GO:0016021)		p.S4R(1)		large_intestine(7)|lung(7)|ovary(1)|skin(1)	16						TGGATTCAAGCACCGCACACA	0.453																																							uc001npo.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(10-12)AGC>AGA		membrane-spanning 4-domains, subfamily A, member							115.0	114.0	114.0					11																	60197159		2203	4300	6503	SO:0001583	missense	64232					integral to membrane	receptor activity	g.chr11:60197159C>A	AB013103	CCDS7987.1	11q12	2008-03-25			ENSG00000166930	ENSG00000166930			13374	protein-coding gene	gene with protein product		606499				11245982, 11401424	Standard	NM_023945		Approved	CD20L2	uc001npo.3	Q9H3V2	OTTHUMG00000167613	ENST00000300190.2:c.12C>A	11.37:g.60197159C>A	ENSP00000300190:p.Ser4Arg						p.S4R	NM_023945	NP_076434	Q9H3V2	MS4A5_HUMAN			1	98	+			4			Cytoplasmic (Potential).		Q9BZH1	Missense_Mutation	SNP	ENST00000300190.2	37	c.12C>A	CCDS7987.1	.	.	.	.	.	.	.	.	.	.	C	6.634	0.485349	0.12641	.	.	ENSG00000166930	ENST00000300190	T	0.09350	2.99	4.66	-8.08	0.01094	.	2.239400	0.01339	N	0.011512	T	0.03695	0.0105	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34825	-0.9813	10	0.15066	T	0.55	0.1204	1.085	0.01650	0.4538:0.138:0.2032:0.205	.	4	Q9H3V2	MS4A5_HUMAN	R	4	ENSP00000300190:S4R	ENSP00000300190:S4R	S	+	3	2	MS4A5	59953735	0.000000	0.05858	0.000000	0.03702	0.219000	0.24729	-1.828000	0.01702	-1.275000	0.02417	0.467000	0.42956	AGC		0.453	MS4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395392.1			30	178	1	0	4.02929e-09	0.010818	5.49184e-09	30	178				
MS4A1	931	broad.mit.edu	37	11	60229879	60229879	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:60229879C>A	ENST00000534668.1	+	2	321	c.32C>A	c.(31-33)aCt>aAt	p.T11N	MS4A1_ENST00000528313.1_Missense_Mutation_p.T11N|MS4A1_ENST00000534503.1_3'UTR|MS4A1_ENST00000345732.4_Missense_Mutation_p.T11N|MS4A1_ENST00000389939.2_Missense_Mutation_p.T11N|MS4A1_ENST00000532073.1_Missense_Mutation_p.T11N	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1	11					B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	GTAAATGGGACTTTCCCGGCA	0.433																																							uc001npp.2		NA																	0				ovary(3)|lung(2)	5						c.(31-33)ACT>AAT		membrane-spanning 4-domains, subfamily A, member	Ibritumomab(DB00078)|Rituximab(DB00073)|Tositumomab(DB00081)						60.0	63.0	62.0					11																	60229879		2203	4300	6503	SO:0001583	missense	931				B cell activation|immune response	integral to plasma membrane		g.chr11:60229879C>A	M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.32C>A	11.37:g.60229879C>A	ENSP00000433277:p.Thr11Asn					MS4A1_uc009ymy.1_Missense_Mutation_p.T11N|MS4A1_uc001npq.2_Missense_Mutation_p.T11N|MS4A1_uc009yna.2_Missense_Mutation_p.T11N|MS4A1_uc009ymz.2_Missense_Mutation_p.T11N|MS4A1_uc010rlc.1_Missense_Mutation_p.T11N	p.T11N	NM_152866	NP_690605	P11836	CD20_HUMAN			3	448	+			11			Cytoplasmic (Potential).		A6NMS4|B4DT24|P08984|Q13963	Missense_Mutation	SNP	ENST00000534668.1	37	c.32C>A	CCDS31570.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125802	0.56721	.	.	ENSG00000156738	ENST00000345732;ENST00000532073;ENST00000534668;ENST00000528313;ENST00000389939	T;T;T;T	0.25414	2.42;1.8;2.42;2.42	5.21	4.28	0.50868	.	1.731700	0.02577	N	0.098385	T	0.25344	0.0616	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.15473	0.009;0.013;0.007;0.007	B;B;B;B	0.16722	0.016;0.006;0.006;0.006	T	0.25847	-1.0120	10	0.44086	T	0.13	-16.3488	10.6647	0.45723	0.2105:0.7895:0.0:0.0	.	11;11;11;11	B4DT24;E9PKH8;A8K803;P11836	.;.;.;CD20_HUMAN	N	11	ENSP00000314620:T11N;ENSP00000433519:T11N;ENSP00000433277:T11N;ENSP00000374589:T11N	ENSP00000314620:T11N	T	+	2	0	MS4A1	59986455	0.003000	0.15002	0.004000	0.12327	0.934000	0.57294	1.331000	0.33793	1.123000	0.41961	0.655000	0.94253	ACT		0.433	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395402.1			11	100	1	0	3.07112e-06	0.010729	3.72874e-06	11	100				
AHNAK	79026	broad.mit.edu	37	11	62284435	62284435	+	Silent	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:62284435C>G	ENST00000378024.4	-	5	17728	c.17454G>C	c.(17452-17454)ggG>ggC	p.G5818G	AHNAK_ENST00000525875.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5818					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.G5818G(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ATTTCAGCTTCCCGTGTTTCC	0.517																																							uc001ntl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(17452-17454)GGG>GGC		AHNAK nucleoprotein isoform 1							169.0	150.0	157.0					11																	62284435		2202	4299	6501	SO:0001819	synonymous_variant	79026				nervous system development	nucleus	protein binding	g.chr11:62284435C>G	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17454G>C	11.37:g.62284435C>G						AHNAK_uc001ntk.1_Intron	p.G5818G	NM_001620	NP_001611	Q09666	AHNK_HUMAN			5	17754	-		Melanoma(852;0.155)	5818					A1A586	Silent	SNP	ENST00000378024.4	37	c.17454G>C	CCDS31584.1																																																																																				0.517	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		32	179	0	0	0	0.010818	0	32	179				
CATSPER1	117144	broad.mit.edu	37	11	65790348	65790348	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:65790348C>A	ENST00000312106.5	-	2	1538	c.1401G>T	c.(1399-1401)caG>caT	p.Q467H		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	467					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.Q467H(1)		breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						CAGCGAAGGTCTGGGCCACCA	0.577											OREG0021092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001ogt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1399-1401)CAG>CAT		sperm-associated cation channel 1							83.0	80.0	81.0					11																	65790348		2201	4296	6497	SO:0001583	missense	117144				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	protein binding	g.chr11:65790348C>A	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1401G>T	11.37:g.65790348C>A	ENSP00000309052:p.Gln467His		OREG0021092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1086		p.Q467H	NM_053054	NP_444282	Q8NEC5	CTSR1_HUMAN			2	1539	-			467			Extracellular (Potential).		Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	c.1401G>T	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.236461	0.58886	.	.	ENSG00000175294	ENST00000312106	D	0.97404	-4.37	5.52	4.6	0.57074	.	0.000000	0.31061	N	0.008334	D	0.97136	0.9064	L	0.47190	1.495	0.32499	N	0.539188	D	0.61080	0.989	D	0.70487	0.969	D	0.97590	1.0116	10	0.87932	D	0	-41.1661	10.0547	0.42237	0.0:0.9072:0.0:0.0928	.	467	Q8NEC5	CTSR1_HUMAN	H	467	ENSP00000309052:Q467H	ENSP00000309052:Q467H	Q	-	3	2	CATSPER1	65546924	1.000000	0.71417	1.000000	0.80357	0.173000	0.22820	2.247000	0.43151	1.332000	0.45431	0.563000	0.77884	CAG		0.577	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054		6	118	1	0	5.9392e-07	0.001168	7.40116e-07	6	118				
SF3B2	10992	broad.mit.edu	37	11	65829421	65829421	+	Silent	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:65829421A>T	ENST00000322535.6	+	16	1978	c.1929A>T	c.(1927-1929)ccA>ccT	p.P643P	SF3B2_ENST00000528302.1_Silent_p.P626P	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	643					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)	p.P643P(1)		breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						GACCACCCCCATCGTATCCCA	0.517																																							uc001ogy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)	3						c.(1927-1929)CCA>CCT		splicing factor 3B subunit 2							107.0	91.0	97.0					11																	65829421		2201	4295	6496	SO:0001819	synonymous_variant	10992				interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding	g.chr11:65829421A>T	U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1929A>T	11.37:g.65829421A>T							p.P643P	NM_006842	NP_006833	Q13435	SF3B2_HUMAN			16	1969	+			643					A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Silent	SNP	ENST00000322535.6	37	c.1929A>T	CCDS31612.1	.	.	.	.	.	.	.	.	.	.	A	4.296	0.054238	0.08291	.	.	ENSG00000087365	ENST00000530981	.	.	.	5.8	-11.6	0.00059	.	.	.	.	.	T	0.43322	0.1242	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55309	-0.8161	4	.	.	.	-18.191	7.5106	0.27571	0.1279:0.1309:0.5826:0.1586	.	.	.	.	L	64	.	.	H	+	2	0	SF3B2	65585997	0.119000	0.22226	0.059000	0.19551	0.436000	0.31835	-0.445000	0.06845	-2.697000	0.00400	-1.167000	0.01749	CAT		0.517	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2			4	38	0	0	0	0.009096	0	4	38				
UCP2	7351	broad.mit.edu	37	11	73686562	73686562	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:73686562C>T	ENST00000310473.3	-	7	1631	c.789G>A	c.(787-789)aaG>aaA	p.K263K	UCP2_ENST00000536983.1_Intron	NM_003355.2	NP_003346.2	P55851	UCP2_HUMAN	uncoupling protein 2 (mitochondrial, proton carrier)	263					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to amino acid starvation (GO:0034198)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|female pregnancy (GO:0007565)|liver regeneration (GO:0097421)|mitochondrial transport (GO:0006839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|positive regulation of cell death (GO:0010942)|proton transport (GO:0015992)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.K263K(1)		large_intestine(1)|lung(3)|prostate(1)	5	Breast(11;0.000112)					GGGGCCCCTCCTTCTGGAGCA	0.587																																					Colon(191;388 2040 43557 45622 48925)	Colon(191;388 2040 43557 45622 48925)	uc001oup.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(787-789)AAG>AAA		uncoupling protein 2							82.0	80.0	81.0					11																	73686562		2200	4293	6493	SO:0001819	synonymous_variant	7351				proton transport|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding	g.chr11:73686562C>T	U76367	CCDS8228.1	11q13	2014-02-12						"""Solute carriers"""	12518	protein-coding gene	gene with protein product		601693	"""body mass index QTL 4"", ""body mass index quantitative trait 4"""	BMIQ4		9196039, 11381268	Standard	NM_003355		Approved	SLC25A8	uc001oup.1	P55851		ENST00000310473.3:c.789G>A	11.37:g.73686562C>T						UCP2_uc001ouq.1_Intron	p.K263K	NM_003355	NP_003346	P55851	UCP2_HUMAN			7	1169	-	Breast(11;0.000112)		263			Solcar 3.		Q4PJH8|Q53HM3	Silent	SNP	ENST00000310473.3	37	c.789G>A	CCDS8228.1																																																																																				0.587	UCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398108.1	NM_003355		27	136	0	0	0	0.010818	0	27	136				
TYR	7299	broad.mit.edu	37	11	88911297	88911297	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:88911297T>A	ENST00000263321.5	+	1	678	c.176T>A	c.(175-177)cTt>cAt	p.L59H	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	59					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.L59H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CAGAATATCCTTCTGTCCAAT	0.547																																							uc001pcs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(175-177)CTT>CAT		tyrosinase precursor	Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)						60.0	50.0	53.0					11																	88911297		2201	4299	6500	SO:0001583	missense	7299	Oculocutaneous_Albinism			eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:88911297T>A	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.176T>A	11.37:g.88911297T>A	ENSP00000263321:p.Leu59His						p.L59H	NM_000372	NP_000363	P14679	TYRO_HUMAN			1	258	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)	59			Lumenal, melanosome (Potential).		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	c.176T>A	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.237030	0.39498	.	.	ENSG00000077498	ENST00000263321	D	0.99136	-5.47	6.07	0.865	0.19074	.	1.336450	0.04318	N	0.350154	D	0.98302	0.9437	M	0.69185	2.1	0.09310	N	0.999996	P	0.42203	0.773	P	0.48089	0.566	D	0.94378	0.7602	9	.	.	.	.	4.4288	0.11517	0.2061:0.0605:0.1069:0.6265	.	59	P14679	TYRO_HUMAN	H	59	ENSP00000263321:L59H	.	L	+	2	0	TYR	88550945	0.004000	0.15560	0.015000	0.15790	0.729000	0.41735	0.290000	0.18975	0.520000	0.28426	0.533000	0.62120	CTT		0.547	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372		11	48	0	0	0	0.010729	0	11	48				
FAT3	120114	broad.mit.edu	37	11	92533884	92533884	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:92533884A>T	ENST00000298047.6	+	9	7722	c.7705A>T	c.(7705-7707)Agt>Tgt	p.S2569C	FAT3_ENST00000409404.2_Missense_Mutation_p.S2569C|FAT3_ENST00000525166.1_Missense_Mutation_p.S2419C			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2569	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S2569C(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGGGGATGTTAGTATTTTTGT	0.473										TCGA Ovarian(4;0.039)																													uc001pdj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(7705-7707)AGT>TGT		FAT tumor suppressor homolog 3							62.0	59.0	60.0					11																	92533884		1923	4146	6069	SO:0001583	missense	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92533884A>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7705A>T	11.37:g.92533884A>T	ENSP00000298047:p.Ser2569Cys	TCGA Ovarian(4;0.039)					p.S2569C	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			9	7722	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2569			Cadherin 23.|Extracellular (Potential).		B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37	c.7705A>T		.	.	.	.	.	.	.	.	.	.	A	10.08	1.252089	0.22880	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.54071	0.59;0.59;0.59	6.17	3.85	0.44370	.	.	.	.	.	T	0.60366	0.2263	M	0.74546	2.27	0.09310	N	1	D	0.53885	0.963	P	0.52267	0.694	T	0.52931	-0.8509	9	0.54805	T	0.06	.	6.8673	0.24100	0.7318:0.1283:0.1398:0.0	.	2569	Q8TDW7-3	.	C	2569;2569;2419	ENSP00000298047:S2569C;ENSP00000387040:S2569C;ENSP00000432586:S2419C	ENSP00000298047:S2569C	S	+	1	0	FAT3	92173532	0.674000	0.27549	0.530000	0.27963	0.243000	0.25628	2.421000	0.44688	0.556000	0.29098	-0.250000	0.11733	AGT		0.473	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		10	50	0	0	0	0.008291	0	10	50				
CNTN5	53942	broad.mit.edu	37	11	99932110	99932110	+	Missense_Mutation	SNP	C	C	A	rs200696545		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:99932110C>A	ENST00000524871.1	+	10	1437	c.1147C>A	c.(1147-1149)Caa>Aaa	p.Q383K	CNTN5_ENST00000527185.1_Missense_Mutation_p.Q383K|CNTN5_ENST00000279463.3_Missense_Mutation_p.Q383K|CNTN5_ENST00000528682.1_Missense_Mutation_p.Q383K|CNTN5_ENST00000418526.2_Missense_Mutation_p.Q309K	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	383	Ig-like C2-type 3.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.Q383K(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CTTTCGTGGACAATTACAAGT	0.383																																							uc001pga.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(1147-1149)CAA>AAA		contactin 5 isoform long		C	LYS/GLN,LYS/GLN	0,3734		0,0,1867	58.0	56.0	56.0		1147,925	5.4	1.0	11		56	1,8183		0,1,4091	no	missense,missense	CNTN5	NM_014361.3,NM_175566.2	53,53	0,1,5958	AA,AC,CC		0.0122,0.0,0.0084	benign,benign	383/1101,309/1027	99932110	1,11917	1867	4092	5959	SO:0001583	missense	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:99932110C>A	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1147C>A	11.37:g.99932110C>A	ENSP00000435637:p.Gln383Lys					CNTN5_uc009ywv.1_Missense_Mutation_p.Q383K|CNTN5_uc001pfz.2_Missense_Mutation_p.Q383K|CNTN5_uc001pgb.2_Missense_Mutation_p.Q309K	p.Q383K	NM_014361	NP_055176	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	10	1486	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	383			Ig-like C2-type 3.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	c.1147C>A	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120709	0.56613	0.0	1.22E-4	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.43	5.43	0.79202	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.050486	0.85682	D	0.000000	T	0.51329	0.1668	N	0.12182	0.205	0.46336	D	0.998991	B;P;B	0.35077	0.183;0.483;0.39	B;B;B	0.39706	0.251;0.128;0.307	T	0.53739	-0.8396	10	0.41790	T	0.15	.	18.5804	0.91168	0.0:1.0:0.0:0.0	.	383;309;383	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	K	383;383;383;309;383	ENSP00000433575:Q383K;ENSP00000436185:Q383K;ENSP00000435637:Q383K;ENSP00000393229:Q309K;ENSP00000279463:Q383K	ENSP00000279463:Q383K	Q	+	1	0	CNTN5	99437320	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.880000	0.69698	2.704000	0.92352	0.585000	0.79938	CAA		0.383	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		14	39	1	0	9.05144e-12	0.001855	1.34703e-11	14	39				
SLN	6588	broad.mit.edu	37	11	107578577	107578577	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:107578577C>A	ENST00000531293.1	-	3	432	c.80G>T	c.(79-81)aGg>aTg	p.R27M	SLN_ENST00000305991.2_Missense_Mutation_p.R27M|SLN_ENST00000525934.1_Missense_Mutation_p.R27M			O00631	SARCO_HUMAN	sarcolipin	27					calcium ion transport (GO:0006816)|negative regulation of calcium ion binding (GO:1901877)|negative regulation of calcium ion import (GO:0090281)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein complex disassembly (GO:0043242)|positive regulation of protein depolymerization (GO:1901881)|regulation of calcium ion transport (GO:0051924)|regulation of calcium-transporting ATPase activity (GO:1901894)|regulation of relaxation of muscle (GO:1901077)|sarcoplasmic reticulum calcium ion transport (GO:0070296)	integral component of membrane (GO:0016021)|sarcoplasmic reticulum (GO:0016529)	ATPase binding (GO:0051117)|enzyme inhibitor activity (GO:0004857)	p.R27M(1)		large_intestine(1)|lung(1)	2		Melanoma(852;1.46e-05)|all_epithelial(67;1.72e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;2.71e-05)|Epithelial(105;0.000112)|all cancers(92;0.00219)		CTGATAGGACCTCACAAGGAG	0.512																																							uc001pjp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(79-81)AGG>ATG		sarcolipin							117.0	114.0	115.0					11																	107578577		2201	4298	6499	SO:0001583	missense	6588				calcium ion transport|regulation of calcium ion transport	integral to membrane|sarcoplasmic reticulum membrane	enzyme regulator activity	g.chr11:107578577C>A	U96094	CCDS31667.1	11q22.3	2014-04-11			ENSG00000170290	ENSG00000170290			11089	protein-coding gene	gene with protein product		602203				9367679	Standard	NM_003063		Approved	MGC12301, MGC125854, MGC125855	uc001pjp.3	O00631	OTTHUMG00000166364	ENST00000531293.1:c.80G>T	11.37:g.107578577C>A	ENSP00000435380:p.Arg27Met						p.R27M	NM_003063	NP_003054	O00631	SARCO_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.71e-05)|Epithelial(105;0.000112)|all cancers(92;0.00219)	2	254	-		Melanoma(852;1.46e-05)|all_epithelial(67;1.72e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)|all_neural(303;0.164)	27					Q6ICV3	Missense_Mutation	SNP	ENST00000531293.1	37	c.80G>T	CCDS31667.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977473	0.53720	.	.	ENSG00000170290	ENST00000531293;ENST00000305991;ENST00000525934	.	.	.	5.66	5.66	0.87406	.	0.000000	0.48767	D	0.000161	T	0.72128	0.3422	.	.	.	0.30422	N	0.778035	D	0.67145	0.996	D	0.79784	0.993	T	0.73613	-0.3927	8	0.87932	D	0	.	15.2536	0.73568	0.0:1.0:0.0:0.0	.	27	O00631	SARCO_HUMAN	M	27	.	ENSP00000304707:R27M	R	-	2	0	SLN	107083787	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	2.818000	0.48041	2.673000	0.90976	0.650000	0.86243	AGG		0.512	SLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389414.1	NM_003063		8	79	1	0	1.06961e-07	0.00308	1.36901e-07	8	79				
DRD2	1813	broad.mit.edu	37	11	113285167	113285168	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:113285167_113285168GG>TT	ENST00000362072.3	-	6	1083_1084	c.739_740CC>AA	c.(739-741)CCc>AAc	p.P247N	DRD2_ENST00000346454.3_Intron|RP11-159N11.3_ENST00000546284.1_RNA|DRD2_ENST00000544518.1_Missense_Mutation_p.P246N|DRD2_ENST00000355319.2_Missense_Mutation_p.P247N|DRD2_ENST00000535984.1_5'UTR|DRD2_ENST00000538967.1_Missense_Mutation_p.P247N|DRD2_ENST00000542968.1_Missense_Mutation_p.P247N	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	247	Interaction with PPP1R9B. {ECO:0000250}.				activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)	p.P247N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CATGTCCTCGGGGTGAGTACAG	0.559																																							uc001pnz.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(739-741)CCC>AAC		dopamine receptor D2 isoform long	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)																																			SO:0001583	missense	1813				activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding	g.chr11:113285167_113285168GG>TT	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.739_740delinsTT	11.37:g.113285167_113285168delinsTT	ENSP00000354859:p.Pro247Asn					DRD2_uc010rwv.1_Missense_Mutation_p.P246N|DRD2_uc001poa.3_Missense_Mutation_p.P247N|DRD2_uc001pob.3_Intron|DRD2_uc009yyr.1_Missense_Mutation_p.P247N	p.P247N	NM_000795	NP_000786	P14416	DRD2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	5	1060_1061	-		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)	247			Cytoplasmic (By similarity).|Interaction with PPP1R9B (By similarity).		Q9NZR3|Q9UPA9	Missense_Mutation	DNP	ENST00000362072.3	37	c.739_740CC>AA	CCDS8361.1																																																																																				0.559	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795		40	212	0	0	0	0.004672	0	40	212				
ARHGEF12	23365	broad.mit.edu	37	11	120308016	120308016	+	Splice_Site	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:120308016G>C	ENST00000397843.2	+	12	1090		c.e12-1		ARHGEF12_ENST00000532993.1_Splice_Site|ARHGEF12_ENST00000356641.3_Splice_Site	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TTTTTCATTAGAGTCCCAAGA	0.348			T	MLL	AML																																		uc001pxl.1		NA		Dom	yes		11	11q23.3	23365	T	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)			L	MLL		AML		0				lung(2)|breast(2)|skin(2)|ovary(1)	7						c.e12-1		Rho guanine nucleotide exchange factor (GEF) 12							88.0	78.0	81.0					11																	120308016		1804	4070	5874	SO:0001630	splice_region_variant	23365				apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr11:120308016G>C	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.925-1G>C	11.37:g.120308016G>C						ARHGEF12_uc009zat.2_Splice_Site_p.S290_splice|ARHGEF12_uc010rzn.1_Splice_Site_p.S206_splice|ARHGEF12_uc009zau.1_Splice_Site_p.S206_splice	p.S309_splice	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)	12	932	+		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)						O15086|Q6P526	Splice_Site	SNP	ENST00000397843.2	37	c.925_splice	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929242	0.73327	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.546	0.91047	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGEF12	119813226	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.336000	0.72954	2.487000	0.83934	0.585000	0.79938	.		0.348	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	Intron	3	65	0	0	0	0.009096	0	3	65				
FEZ1	9638	broad.mit.edu	37	11	125359482	125359482	+	Silent	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:125359482A>G	ENST00000278919.3	-	2	426	c.192T>C	c.(190-192)aaT>aaC	p.N64N	FEZ1_ENST00000366139.3_Silent_p.N64N|FEZ1_ENST00000524435.1_Silent_p.N64N	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	64					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)		p.N64N(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		CATCAAATTCATTTACGAGGT	0.488																																					Melanoma(180;509 2033 10762 15939 24711)	Melanoma(180;509 2033 10762 15939 24711)	uc001qbx.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(3)|ovary(1)	4						c.(190-192)AAT>AAC		zygin 1 isoform 1							94.0	97.0	96.0					11																	125359482		2201	4299	6500	SO:0001819	synonymous_variant	9638				axon guidance|cell adhesion|transport	microtubule|plasma membrane		g.chr11:125359482A>G	U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.192T>C	11.37:g.125359482A>G						FEZ1_uc010sbc.1_Silent_p.N64N|FEZ1_uc001qby.1_Silent_p.N64N	p.N64N	NM_005103	NP_005094	Q99689	FEZ1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)	2	344	-	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	64					O00679|O00728|Q6IBI7	Silent	SNP	ENST00000278919.3	37	c.192T>C	CCDS31716.1																																																																																				0.488	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386875.1	NM_005103		22	115	0	0	0	0.014323	0	22	115				
CLEC12B	387837	broad.mit.edu	37	12	10168296	10168296	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:10168296G>T	ENST00000338896.5	+	5	778	c.650G>T	c.(649-651)tGg>tTg	p.W217L	RP11-133L14.5_ENST00000544225.1_RNA|CLEC1B_ENST00000428126.2_5'Flank|CLEC12B_ENST00000396502.1_Missense_Mutation_p.W217L	NM_001129998.1	NP_001123470.1	Q2HXU8	CL12B_HUMAN	C-type lectin domain family 12, member B	217	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.W217L(2)		central_nervous_system(2)|large_intestine(2)|lung(5)	9						AGTTGGTTCTGGGAAGATGGC	0.418																																							uc001qwz.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(649-651)TGG>TTG		C-type lectin domain family 12, member B isoform							149.0	140.0	143.0					12																	10168296		2203	4300	6503	SO:0001583	missense	387837					integral to membrane|plasma membrane	receptor activity|sugar binding	g.chr12:10168296G>T	AK128243	CCDS8610.1, CCDS44830.1	12p13.2	2010-08-17			ENSG00000256660	ENSG00000256660		"""C-type lectin domain containing"""	31966	protein-coding gene	gene with protein product						17562706	Standard	NM_205852		Approved		uc001qwz.2	Q2HXU8	OTTHUMG00000168397	ENST00000338896.5:c.650G>T	12.37:g.10168296G>T	ENSP00000344563:p.Trp217Leu					CLEC12B_uc001qwx.1_Missense_Mutation_p.W217L|CLEC12B_uc001qwy.1_Missense_Mutation_p.W114L|CLEC12B_uc009zhe.2_RNA	p.W217L	NM_001129998	NP_001123470	Q2HXU8	CL12B_HUMAN			5	778	+			217			Extracellular (Potential).|C-type lectin.		Q6UWF2|Q6ZRG0	Missense_Mutation	SNP	ENST00000338896.5	37	c.650G>T	CCDS44830.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516799	0.64634	.	.	ENSG00000172322;ENSG00000256660;ENSG00000256660	ENST00000396506;ENST00000396502;ENST00000338896	T;T	0.36699	1.24;1.24	4.7	4.7	0.59300	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.761577	0.11512	N	0.556638	T	0.70193	0.3196	M	0.93462	3.42	0.40459	D	0.980228	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.74754	-0.3558	10	0.87932	D	0	.	13.8419	0.63444	0.0:0.0:1.0:0.0	.	217;217	Q2HXU8;Q2HXU8-2	CL12B_HUMAN;.	L	76;217;217	ENSP00000379759:W217L;ENSP00000344563:W217L	ENSP00000379763:W76L	W	+	2	0	CLEC12A;CLEC12B	10059563	1.000000	0.71417	0.996000	0.52242	0.727000	0.41649	3.984000	0.56923	2.548000	0.85928	0.491000	0.48974	TGG		0.418	CLEC12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399554.2	NM_205852		30	101	1	0	2.08457e-15	0.010818	3.35781e-15	30	101				
C2CD5	9847	broad.mit.edu	37	12	22676358	22676358	+	Splice_Site	SNP	A	A	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:22676358A>C	ENST00000333957.4	-	7	1056		c.e7+1		C2CD5_ENST00000396028.2_Splice_Site|C2CD5_ENST00000545552.1_Splice_Site|C2CD5_ENST00000540703.1_Splice_Site|C2CD5_ENST00000544930.1_Splice_Site|C2CD5_ENST00000536386.1_Splice_Site|C2CD5_ENST00000446597.1_Splice_Site|C2CD5_ENST00000542676.1_Splice_Site	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5						cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.?(2)									ATTCATACTTACTCCTTCATT	0.363																																							uc001rfq.2		NA																	2	Unknown(2)		lung(2)	ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						c.e7+1		hypothetical protein LOC9847							74.0	69.0	70.0					12																	22676358		2203	4300	6503	SO:0001630	splice_region_variant	9847						protein binding	g.chr12:22676358A>C	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.800+1T>G	12.37:g.22676358A>C						KIAA0528_uc010sir.1_Splice_Site_p.E69_splice|KIAA0528_uc010sis.1_Splice_Site_p.E267_splice|KIAA0528_uc010sit.1_Splice_Site_p.E267_splice|KIAA0528_uc010siu.1_Splice_Site_p.E267_splice|KIAA0528_uc001rfr.2_Splice_Site_p.E267_splice|KIAA0528_uc009ziy.1_Splice_Site_p.E267_splice	p.E267_splice	NM_014802	NP_055617	Q86YS7	K0528_HUMAN			7	1028	-								B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Splice_Site	SNP	ENST00000333957.4	37	c.800_splice	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	A	19.88	3.909841	0.72983	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930;ENST00000544281	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1252	0.72478	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0528	22567625	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.946000	0.92992	1.964000	0.57103	0.482000	0.46254	.		0.363	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	Intron	8	70	0	0	0	0.004482	0	8	70				
ASUN	55726	broad.mit.edu	37	12	27058465	27058465	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:27058465C>G	ENST00000261191.7	-	17	2622	c.2086G>C	c.(2086-2088)Gag>Cag	p.E696Q	ASUN_ENST00000539625.1_Missense_Mutation_p.E595Q	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	696					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E696Q(1)									TCTGTTGTCTCCATCCTGAAA	0.299																																							uc001rhk.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(2086-2088)GAG>CAG		hypothetical protein LOC55726							66.0	70.0	69.0					12																	27058465		2203	4300	6503	SO:0001583	missense	55726				cell division|mitosis|regulation of mitotic cell cycle		protein binding	g.chr12:27058465C>G	AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.2086G>C	12.37:g.27058465C>G	ENSP00000261191:p.Glu696Gln					C12orf11_uc001rhj.3_Missense_Mutation_p.E264Q|C12orf11_uc010sjk.1_Missense_Mutation_p.E595Q	p.E696Q	NM_018164	NP_060634	Q9NVM9	M89BB_HUMAN			17	2623	-	Colorectal(261;0.0847)		696					B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Missense_Mutation	SNP	ENST00000261191.7	37	c.2086G>C	CCDS8708.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.738292	0.49045	.	.	ENSG00000064102	ENST00000538155;ENST00000261191;ENST00000539625;ENST00000335745	T	0.48836	0.8	5.06	5.06	0.68205	.	0.119981	0.56097	D	0.000028	T	0.35008	0.0917	L	0.29908	0.895	0.40376	D	0.979391	P;P	0.39391	0.627;0.671	B;B	0.32289	0.107;0.143	T	0.25813	-1.0121	10	0.36615	T	0.2	-15.2262	16.995	0.86365	0.0:1.0:0.0:0.0	.	696;595	Q9NVM9;B4DNK1	M89BB_HUMAN;.	Q	343;696;595;283	ENSP00000261191:E696Q	ENSP00000261191:E696Q	E	-	1	0	C12orf11	26949732	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	2.687000	0.46976	2.537000	0.85549	0.563000	0.77884	GAG		0.299	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402819.1	NM_018164		17	116	0	0	0	0.006122	0	17	116				
TMTC1	83857	broad.mit.edu	37	12	29669316	29669316	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:29669316G>A	ENST00000539277.1	-	15	2331	c.2273C>T	c.(2272-2274)tCa>tTa	p.S758L	TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000551659.1_Missense_Mutation_p.S820L|TMTC1_ENST00000256062.5_Missense_Mutation_p.S650L|TMTC1_ENST00000552618.1_Missense_Mutation_p.S782L	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	758						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					ATAGATGGCTGACAAGAGGCG	0.453																																							uc001rjb.2		NA																	0					0						c.(1948-1950)TCA>TTA		transmembrane and tetratricopeptide repeat							158.0	140.0	146.0					12																	29669316		2203	4300	6503	SO:0001583	missense	83857					integral to membrane	binding	g.chr12:29669316G>A		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.2273C>T	12.37:g.29669316G>A	ENSP00000442046:p.Ser758Leu					TMTC1_uc001riz.2_Missense_Mutation_p.S407L|TMTC1_uc001rja.2_Missense_Mutation_p.S494L|TMTC1_uc001riy.2_Missense_Mutation_p.S103L	p.S650L	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN			15	2423	-	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)		758			TPR 8.		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	c.1949C>T	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.823808	0.71143	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277	T;T;T;T	0.53640	0.61;0.61;0.61;1.13	5.26	5.26	0.73747	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.127931	0.56097	D	0.000035	T	0.69477	0.3115	M	0.74647	2.275	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.997	D;D;P	0.79784	0.961;0.993;0.876	T	0.72184	-0.4367	10	0.72032	D	0.01	-19.5884	17.6163	0.88068	0.0:0.0:1.0:0.0	.	758;820;103	Q8IUR5;F8VTQ9;Q8IUR5-4	TMTC1_HUMAN;.;.	L	521;650;820;782;758	ENSP00000256062:S650L;ENSP00000448112:S820L;ENSP00000449043:S782L;ENSP00000442046:S758L	ENSP00000256062:S650L	S	-	2	0	TMTC1	29560583	1.000000	0.71417	0.956000	0.39512	0.795000	0.44927	8.742000	0.91588	2.733000	0.93635	0.655000	0.94253	TCA		0.453	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920		5	142	0	0	0	0.000602	0	5	142				
PKP2	5318	broad.mit.edu	37	12	33031935	33031935	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:33031935C>A	ENST00000070846.6	-	2	279	c.255G>T	c.(253-255)gaG>gaT	p.E85D	PKP2_ENST00000340811.4_Missense_Mutation_p.E85D	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	85					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)	p.E85D(1)		NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TGTAGACATACTCAGGAACAC	0.363																																							uc001rlj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(253-255)GAG>GAT		plakophilin 2 isoform 2b							94.0	88.0	90.0					12																	33031935		2203	4300	6503	SO:0001583	missense	5318				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding	g.chr12:33031935C>A	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.255G>T	12.37:g.33031935C>A	ENSP00000070846:p.Glu85Asp					PKP2_uc001rlk.3_Missense_Mutation_p.E85D|PKP2_uc010skj.1_Missense_Mutation_p.E85D	p.E85D	NM_004572	NP_004563	Q99959	PKP2_HUMAN			2	370	-	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)		85					A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	37	c.255G>T	CCDS8731.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803097	0.70682	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.86694	-2.16;-2.14	5.7	-1.84	0.07809	.	0.350989	0.24189	N	0.040730	D	0.89993	0.6876	M	0.63843	1.955	0.34803	D	0.736906	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.985;0.991	D	0.88972	0.3401	10	0.38643	T	0.18	0.9966	12.1479	0.54034	0.0:0.4105:0.0:0.5895	.	85;85;85	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	D	85	ENSP00000342800:E85D;ENSP00000070846:E85D	ENSP00000070846:E85D	E	-	3	2	PKP2	32923202	0.427000	0.25514	0.982000	0.44146	0.982000	0.71751	-0.712000	0.05013	-0.401000	0.07644	-0.813000	0.03139	GAG		0.363	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572		17	130	1	0	7.45023e-12	0.010504	1.11753e-11	17	130				
LRRK2	120892	broad.mit.edu	37	12	40692296	40692296	+	Splice_Site	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:40692296G>T	ENST00000298910.7	+	24	3405		c.e24+1		LRRK2_ENST00000343742.2_Splice_Site	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.?(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTTTAGAAGGGTAAGAAAGAG	0.358																																							uc001rmg.3		NA																	2	Unknown(2)		lung(2)	ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24						c.e24+1		leucine-rich repeat kinase 2							89.0	91.0	90.0					12																	40692296		2203	4300	6503	SO:0001630	splice_region_variant	120892				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding	g.chr12:40692296G>T	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3347+1G>T	12.37:g.40692296G>T						LRRK2_uc001rmh.1_Splice_Site_p.G738_splice|LRRK2_uc009zjw.2_Splice_Site	p.G1116_splice	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN			24	3468	+	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)						A6NJU2|Q6ZS50|Q8NCX9	Splice_Site	SNP	ENST00000298910.7	37	c.3347_splice	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.821214	0.71028	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9635	0.97259	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRK2	38978563	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	8.899000	0.92544	2.714000	0.92807	0.591000	0.81541	.		0.358	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	Intron	21	109	1	0	2.70639e-06	0.014323	3.32148e-06	21	109				
CNTN1	1272	broad.mit.edu	37	12	41337888	41337888	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:41337888C>A	ENST00000551295.2	+	14	1716	c.1599C>A	c.(1597-1599)gcC>gcA	p.A533A	CNTN1_ENST00000547849.1_Silent_p.A533A|CNTN1_ENST00000347616.1_Silent_p.A533A|CNTN1_ENST00000348761.2_Silent_p.A522A|CNTN1_ENST00000360099.3_Silent_p.A533A|CNTN1_ENST00000547702.1_Silent_p.A533A	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	533	Ig-like C2-type 6.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.A533A(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TTGATCCTGCCTTGGATCTCA	0.393																																							uc001rmm.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(3)|large_intestine(1)|skin(1)	9						c.(1597-1599)GCC>GCA		contactin 1 isoform 1 precursor							156.0	125.0	135.0					12																	41337888		2203	4299	6502	SO:0001819	synonymous_variant	1272				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane		g.chr12:41337888C>A	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1599C>A	12.37:g.41337888C>A						CNTN1_uc009zjy.1_Silent_p.A533A|CNTN1_uc001rmn.1_Silent_p.A522A|CNTN1_uc001rmo.2_Silent_p.A533A	p.A533A	NM_001843	NP_001834	Q12860	CNTN1_HUMAN			14	1712	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	533			Ig-like C2-type 6.		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	ENST00000551295.2	37	c.1599C>A	CCDS8737.1																																																																																				0.393	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843		22	50	1	0	1.50039e-11	0.012319	2.20967e-11	22	50				
ARID2	196528	broad.mit.edu	37	12	46245363	46245363	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:46245363G>T	ENST00000334344.6	+	15	3629	c.3457G>T	c.(3457-3459)Ggt>Tgt	p.G1153C	ARID2_ENST00000422737.1_Missense_Mutation_p.G1004C|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000444670.1_Missense_Mutation_p.G763C|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1153					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1153C(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AATATTGCCAGGTCCACTGAT	0.478			"""N, S, F"""		hepatocellular carcinoma																																		uc001ros.1		NA		Rec	yes		12	12q12	196528		AT rich interactive domain 2			E					1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10						c.(3457-3459)GGT>TGT		AT rich interactive domain 2 (ARID, RFX-like)							94.0	91.0	92.0					12																	46245363		2203	4300	6503	SO:0001583	missense	196528				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:46245363G>T		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3457G>T	12.37:g.46245363G>T	ENSP00000335044:p.Gly1153Cys					ARID2_uc001ror.2_Missense_Mutation_p.G1153C|ARID2_uc009zkg.1_Missense_Mutation_p.G609C|ARID2_uc009zkh.1_Missense_Mutation_p.G780C|ARID2_uc001rou.1_Missense_Mutation_p.G487C	p.G1153C	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)	15	3457	+	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	1153					Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	c.3457G>T	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397158	0.62177	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	T	0.65178	-0.14	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.72779	0.3503	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.74074	-0.3782	10	0.87932	D	0	-6.2011	20.5948	0.99439	0.0:0.0:1.0:0.0	.	1153;763;1153	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	C	1153;270;270;1004;763	ENSP00000335044:G1153C	ENSP00000335044:G1153C	G	+	1	0	ARID2	44531630	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.188000	0.94921	2.873000	0.98535	0.563000	0.77884	GGT		0.478	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		24	136	1	0	2.79863e-10	0.004656	3.93753e-10	24	136				
ASIC1	41	broad.mit.edu	37	12	50471085	50471085	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:50471085T>A	ENST00000447966.2	+	4	877	c.648T>A	c.(646-648)aaT>aaA	p.N216K	ASIC1_ENST00000552438.1_Missense_Mutation_p.N250K|ASIC1_ENST00000228468.4_Missense_Mutation_p.N216K	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1	216					associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)	p.N216K(1)								Amiloride(DB00594)|Diclofenac(DB00586)	GGACGGGCAATGGGCTGGAAA	0.617																																							uc001rvw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(646-648)AAT>AAA		amiloride-sensitive cation channel 2, neuronal	Amiloride(DB00594)						76.0	63.0	67.0					12																	50471085		2203	4300	6503	SO:0001583	missense	41				calcium ion transport|response to pH|signal transduction	integral to plasma membrane	ligand-gated sodium channel activity|protein binding	g.chr12:50471085T>A	U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.648T>A	12.37:g.50471085T>A	ENSP00000400228:p.Asn216Lys					ACCN2_uc001rvv.2_Missense_Mutation_p.N216K|ACCN2_uc009zln.2_Missense_Mutation_p.N7K|ACCN2_uc009zlo.2_Missense_Mutation_p.N216K	p.N216K	NM_001095	NP_001086	P78348	ACCN2_HUMAN			4	877	+			216			Extracellular (By similarity).		A3KN86|E5KBL7|P78349|Q96CV2	Missense_Mutation	SNP	ENST00000447966.2	37	c.648T>A	CCDS44876.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.45|11.45	1.641375|1.641375	0.29157|0.29157	.|.	.|.	ENSG00000110881|ENSG00000110881	ENST00000453327|ENST00000228468;ENST00000447966;ENST00000552438	.|T;T;T	.|0.65916	.|-0.18;-0.18;-0.18	4.03|4.03	-2.29|-2.29	0.06805|0.06805	.|.	.|0.319446	.|0.28577	.|N	.|0.014858	T|T	0.81230|0.81230	0.4779|0.4779	H|H	0.95224|0.95224	3.64|3.64	0.49687|0.49687	D|D	0.99981|0.99981	.|D;D	.|0.71674	.|0.998;0.991	.|D;D	.|0.72338	.|0.977;0.91	T|T	0.83037|0.83037	-0.0159|-0.0159	5|10	.|0.87932	.|D	.|0	-20.6705|-20.6705	11.4254|11.4254	0.50007|0.50007	0.0:0.4905:0.0:0.5095|0.0:0.4905:0.0:0.5095	.|.	.|216;216	.|P78348;P78348-1	.|ACCN2_HUMAN;.	K|K	84|216;216;250	.|ENSP00000228468:N216K;ENSP00000400228:N216K;ENSP00000450247:N250K	.|ENSP00000228468:N216K	M|N	+|+	2|3	0|2	ACCN2|ACCN2	48757352|48757352	0.001000|0.001000	0.12720|0.12720	0.995000|0.995000	0.50966|0.50966	0.996000|0.996000	0.88848|0.88848	-1.597000|-1.597000	0.02089|0.02089	-0.337000|-0.337000	0.08426|0.08426	0.459000|0.459000	0.35465|0.35465	ATG|AAT		0.617	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406004.2	NM_020039		4	100	0	0	0	0.009096	0	4	100				
KRT6B	3854	broad.mit.edu	37	12	52841600	52841600	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:52841600G>A	ENST00000252252.3	-	7	1433	c.1386C>T	c.(1384-1386)atC>atT	p.I462I		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	462	Coil 2.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.I462I(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		GGTAGGTGGCGATCTCCACAT	0.612																																							uc001sak.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1384-1386)ATC>ATT		keratin 6B							129.0	117.0	121.0					12																	52841600		2203	4300	6503	SO:0001819	synonymous_variant	3854				ectoderm development	keratin filament	structural constituent of cytoskeleton	g.chr12:52841600G>A	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1386C>T	12.37:g.52841600G>A							p.I462I	NM_005555	NP_005546	P04259	K2C6B_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.083)	7	1434	-			462			Rod.|Coil 2.		P48669	Silent	SNP	ENST00000252252.3	37	c.1386C>T	CCDS8828.1																																																																																				0.612	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555		13	186	0	0	0	0.00245	0	13	186				
PDE1B	5153	broad.mit.edu	37	12	54943667	54943667	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:54943667C>A	ENST00000243052.3	+	2	447	c.11C>A	c.(10-12)tCc>tAc	p.S4Y	PDE1B_ENST00000538346.1_5'Flank	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	4					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.S4Y(1)		endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	ATGGAGCTGTCCCCCCGCAGT	0.627																																							uc001sgd.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(10-12)TCC>TAC		phosphodiesterase 1B isoform 1							57.0	54.0	55.0					12																	54943667		2203	4300	6503	SO:0001583	missense	5153				activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:54943667C>A	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.11C>A	12.37:g.54943667C>A	ENSP00000243052:p.Ser4Tyr					PDE1B_uc010soz.1_5'UTR|PDE1B_uc010spa.1_5'Flank	p.S4Y	NM_000924	NP_000915	Q01064	PDE1B_HUMAN			2	177	+			4					Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	c.11C>A	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413582	0.62511	.	.	ENSG00000123360	ENST00000243052	T	0.70516	-0.49	4.15	4.15	0.48705	.	1.932320	0.03004	N	0.148638	T	0.75700	0.3885	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	P	0.57679	0.825	T	0.65195	-0.6227	10	0.66056	D	0.02	.	11.7893	0.52059	0.0:1.0:0.0:0.0	.	4	Q01064	PDE1B_HUMAN	Y	4	ENSP00000243052:S4Y	ENSP00000243052:S4Y	S	+	2	0	PDE1B	53229934	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.779000	0.55379	2.124000	0.65301	0.561000	0.74099	TCC		0.627	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1			14	85	1	0	6.49762e-13	0.006122	9.93032e-13	14	85				
AVPR1A	552	broad.mit.edu	37	12	63544585	63544585	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:63544585G>T	ENST00000299178.2	-	1	137	c.32C>A	c.(31-33)cCc>cAc	p.P11H		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	11					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.P11H(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	GTTGCCCGAGGGCCCCGCGTC	0.731																																							uc001sro.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(31-33)CCC>CAC		arginine vasopressin receptor 1A	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)						12.0	13.0	12.0					12																	63544585		1800	3590	5390	SO:0001583	missense	552				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity	g.chr12:63544585G>T	L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.32C>A	12.37:g.63544585G>T	ENSP00000299178:p.Pro11His						p.P11H	NM_000706	NP_000697	P37288	V1AR_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	1	2006	-			11			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000299178.2	37	c.32C>A	CCDS8965.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.999756	0.54147	.	.	ENSG00000166148	ENST00000299178	T	0.60040	0.22	5.19	2.14	0.27477	.	2.537350	0.01258	N	0.009090	T	0.47710	0.1460	L	0.36672	1.1	0.09310	N	1	P	0.36837	0.571	B	0.33568	0.166	T	0.35251	-0.9796	9	.	.	.	-3.0347	6.6053	0.22721	0.0961:0.3527:0.5512:0.0	.	11	P37288	V1AR_HUMAN	H	11	ENSP00000299178:P11H	.	P	-	2	0	AVPR1A	61830852	0.000000	0.05858	0.001000	0.08648	0.356000	0.29392	0.517000	0.22832	0.554000	0.29061	0.561000	0.74099	CCC		0.731	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406734.1			25	35	1	0	7.92952e-12	0.003954	1.18317e-11	25	35				
SYCP3	50511	broad.mit.edu	37	12	102131692	102131692	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:102131692A>T	ENST00000392927.3	-	2	153	c.22T>A	c.(22-24)Tat>Aat	p.Y8N	SYCP3_ENST00000266743.2_Missense_Mutation_p.Y8N|SYCP3_ENST00000392924.1_Missense_Mutation_p.Y8N	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	8					male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Y8N(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TTCCTGGAATACTTTTTTCCG	0.378																																							uc001tiq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(22-24)TAT>AAT		synaptonemal complex protein 3							158.0	157.0	157.0					12																	102131692		2203	4300	6503	SO:0001583	missense	50511				cell division|male meiosis I|spermatogenesis, exchange of chromosomal proteins	nucleus	DNA binding	g.chr12:102131692A>T	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.22T>A	12.37:g.102131692A>T	ENSP00000376658:p.Tyr8Asn					SYCP3_uc001tir.2_Missense_Mutation_p.Y8N|SYCP3_uc001tis.2_Missense_Mutation_p.Y8N	p.Y8N	NM_153694	NP_710161	Q8IZU3	SYCP3_HUMAN			2	154	-			8						Missense_Mutation	SNP	ENST00000392927.3	37	c.22T>A	CCDS9087.1	.	.	.	.	.	.	.	.	.	.	A	8.239	0.806384	0.16467	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.23	2.35	0.29111	.	1.175260	0.06055	N	0.657353	T	0.19565	0.0470	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.29212	-1.0019	9	0.19590	T	0.45	-20.3707	7.1902	0.25821	0.1534:0.3974:0.4492:0.0	.	8	Q8IZU3	SYCP3_HUMAN	N	8	.	ENSP00000266743:Y8N	Y	-	1	0	SYCP3	100655823	0.011000	0.17503	0.000000	0.03702	0.096000	0.18686	1.211000	0.32382	0.195000	0.20347	-0.242000	0.12053	TAT		0.378	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2	NM_153694		60	208	0	0	0	0.01441	0	60	208				
ABCB9	23457	broad.mit.edu	37	12	123444365	123444365	+	Missense_Mutation	SNP	C	C	T	rs370168137		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:123444365C>T	ENST00000542678.1	-	2	3256	c.418G>A	c.(418-420)Gtg>Atg	p.V140M	ABCB9_ENST00000442028.2_Missense_Mutation_p.V140M|ABCB9_ENST00000540285.1_Missense_Mutation_p.V140M|ABCB9_ENST00000280560.8_Missense_Mutation_p.V140M|ABCB9_ENST00000346530.5_Missense_Mutation_p.V140M|ABCB9_ENST00000442833.2_Missense_Mutation_p.V140M|ABCB9_ENST00000344275.7_Missense_Mutation_p.V140M|ABCB9_ENST00000392439.3_Missense_Mutation_p.V140M			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	140					peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)	p.V140M(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		CCTGGCCGCACGGTGGACAGC	0.716																																					Ovarian(49;786 1333 9175 38236)	Ovarian(49;786 1333 9175 38236)	uc001udm.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(418-420)GTG>ATG		ATP-binding cassette, sub-family B (MDR/TAP),		C	MET/VAL,MET/VAL,MET/VAL	1,4397		0,1,2198	22.0	24.0	23.0		418,418,418	5.6	0.9	12		23	1,8591		0,1,4295	no	missense,missense,missense	ABCB9	NM_019624.3,NM_019625.3,NM_203444.3	21,21,21	0,2,6493	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	140/724,140/767,140/767	123444365	2,12988	2199	4296	6495	SO:0001583	missense	23457				positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding	g.chr12:123444365C>T	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.418G>A	12.37:g.123444365C>T	ENSP00000440288:p.Val140Met					ABCB9_uc009zxr.2_Intron|ABCB9_uc001udo.3_Missense_Mutation_p.V140M|ABCB9_uc010taj.1_Missense_Mutation_p.V140M|ABCB9_uc001udp.2_Missense_Mutation_p.V140M|ABCB9_uc001udq.2_Translation_Start_Site|ABCB9_uc001udr.2_Missense_Mutation_p.V140M	p.V140M	NM_019625	NP_062571	Q9NP78	ABCB9_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)	2	728	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		140					B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Missense_Mutation	SNP	ENST00000542678.1	37	c.418G>A	CCDS9241.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529923	0.45073	2.27E-4	1.16E-4	ENSG00000150967	ENST00000280560;ENST00000540285;ENST00000346530;ENST00000392439;ENST00000542678;ENST00000442028	D;D;D;D;D;D	0.90069	-2.31;-2.61;-2.5;-2.31;-2.31;-2.29	5.6	5.6	0.85130	.	0.247806	0.34580	N	0.003853	D	0.91023	0.7176	L	0.50333	1.59	0.31344	N	0.68328	D;D;P;D	0.69078	0.988;0.997;0.884;0.993	P;D;B;P	0.63283	0.818;0.913;0.23;0.773	D	0.89140	0.3516	10	0.31617	T	0.26	-32.723	12.8827	0.58026	0.0:0.9258:0.0:0.0742	.	140;140;140;140	B4E2J0;Q9NP78-3;Q9NP78-2;Q9NP78	.;.;.;ABCB9_HUMAN	M	140	ENSP00000280560:V140M;ENSP00000441734:V140M;ENSP00000280559:V140M;ENSP00000376234:V140M;ENSP00000440288:V140M;ENSP00000394898:V140M	ENSP00000280560:V140M	V	-	1	0	ABCB9	122010318	0.992000	0.36948	0.908000	0.35775	0.077000	0.17291	3.753000	0.55180	2.653000	0.90120	0.561000	0.74099	GTG		0.716	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624		4	17	0	0	0	0.001168	0	4	17				
ULK1	8408	broad.mit.edu	37	12	132399719	132399719	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr12:132399719G>T	ENST00000321867.4	+	17	1816	c.1465G>T	c.(1465-1467)Gtc>Ttc	p.V489F		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	489					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)	p.V489F(1)		breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GCATGGAGGCGTCCTGGCCAG	0.682																																							uc001uje.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(1465-1467)GTC>TTC		Unc-51-like kinase 1							23.0	23.0	23.0					12																	132399719		2190	4292	6482	SO:0001583	missense	8408				autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity	g.chr12:132399719G>T	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.1465G>T	12.37:g.132399719G>T	ENSP00000324560:p.Val489Phe						p.V489F	NM_003565	NP_003556	O75385	ULK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)	17	1733	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		489					Q9UQ28	Missense_Mutation	SNP	ENST00000321867.4	37	c.1465G>T	CCDS9274.1	.	.	.	.	.	.	.	.	.	.	G	2.567	-0.300424	0.05532	.	.	ENSG00000177169	ENST00000321867	T	0.30448	1.53	4.36	-2.96	0.05547	.	0.995321	0.08142	N	0.991411	T	0.15825	0.0381	N	0.14661	0.345	0.18873	N	0.999989	B	0.32188	0.359	B	0.31337	0.128	T	0.27571	-1.0070	10	0.51188	T	0.08	-8.308	6.5833	0.22607	0.5653:0.1308:0.3039:0.0	.	489	O75385	ULK1_HUMAN	F	489	ENSP00000324560:V489F	ENSP00000324560:V489F	V	+	1	0	ULK1	130965672	0.001000	0.12720	0.140000	0.22221	0.536000	0.34869	0.417000	0.21214	-0.391000	0.07763	0.462000	0.41574	GTC		0.682	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3			8	15	1	0	0.000157383	0.00308	0.000178116	8	15				
PARP4	143	broad.mit.edu	37	13	25029154	25029154	+	Splice_Site	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:25029154C>A	ENST00000381989.3	-	22	2864		c.e22+1		PARP4_ENST00000480576.1_5'Flank	NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.?(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AGCGCACTCACCTGTGCCGAA	0.532																																							uc001upl.2		NA																	1	Unknown(1)		lung(1)	ovary(3)|skin(1)	4						c.e22+1		poly (ADP-ribose) polymerase family, member 4							209.0	179.0	189.0					13																	25029154		2203	4300	6503	SO:0001630	splice_region_variant	143				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity	g.chr13:25029154C>A	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.2758+1G>T	13.37:g.25029154C>A						PARP4_uc010tdc.1_Splice_Site_p.G920_splice	p.G920_splice	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)	22	2864	-		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)						O75903|Q14682|Q5QNZ9|Q9H1M6	Splice_Site	SNP	ENST00000381989.3	37	c.2758_splice	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	C	19.01	3.743482	0.69418	.	.	ENSG00000102699	ENST00000381989	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2852	0.73822	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PARP4	23927154	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.868000	0.69605	2.481000	0.83766	0.573000	0.79308	.		0.532	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	Intron	26	206	1	0	6.07407e-21	0.007291	1.04364e-20	26	206				
AMER2	219287	broad.mit.edu	37	13	25744119	25744119	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:25744119G>T	ENST00000515384.1	-	1	2306	c.1639C>A	c.(1639-1641)Cgg>Agg	p.R547R	AMER2-AS1_ENST00000413501.1_lincRNA|AMER2_ENST00000357816.2_Silent_p.R428R|AMER2_ENST00000381853.3_Silent_p.R428R			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	547					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.R428R(1)|p.R547R(1)									TAGCTATCCCGGGGGATGCCC	0.642																																							uc001uqb.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|large_intestine(1)|lung(1)	4						c.(1639-1641)CGG>AGG		hypothetical protein LOC219287 isoform 1							58.0	57.0	58.0					13																	25744119		2203	4300	6503	SO:0001819	synonymous_variant	219287							g.chr13:25744119G>T	AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1639C>A	13.37:g.25744119G>T						FAM123A_uc001uqa.2_Silent_p.R428R|FAM123A_uc001uqc.2_Silent_p.R428R	p.R547R	NM_152704	NP_689917	Q8N7J2	F123A_HUMAN		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)	1	1739	-		Lung SC(185;0.0225)|Breast(139;0.0602)	547					Q5RL80|Q5VX56|Q8N593|Q96NN5	Silent	SNP	ENST00000515384.1	37	c.1639C>A	CCDS53859.1																																																																																				0.642	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704		14	94	1	0	4.36969e-10	0.001855	6.07258e-10	14	94				
TRPC4	7223	broad.mit.edu	37	13	38225593	38225593	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:38225593G>C	ENST00000379705.3	-	8	2745	c.1888C>G	c.(1888-1890)Cat>Gat	p.H630D	TRPC4_ENST00000379679.1_Missense_Mutation_p.H457D|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000338947.5_Missense_Mutation_p.H457D|TRPC4_ENST00000355779.2_Missense_Mutation_p.H630D|TRPC4_ENST00000358477.2_Missense_Mutation_p.H630D|TRPC4_ENST00000447043.1_Missense_Mutation_p.H630D|TRPC4_ENST00000379681.3_Missense_Mutation_p.H630D			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	630	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.H630D(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		ATATCTGCATGGTCCTGAACA	0.428																																							uc001uws.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|breast(1)	6						c.(1888-1890)CAT>GAT		transient receptor potential cation channel,							93.0	90.0	91.0					13																	38225593		2203	4300	6503	SO:0001583	missense	7223				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity	g.chr13:38225593G>C	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1888C>G	13.37:g.38225593G>C	ENSP00000369027:p.His630Asp					TRPC4_uc010abv.2_Missense_Mutation_p.H210D|TRPC4_uc001uwt.2_Missense_Mutation_p.H630D|TRPC4_uc010tey.1_Missense_Mutation_p.H630D|TRPC4_uc010abw.2_Missense_Mutation_p.H457D|TRPC4_uc010abx.2_Missense_Mutation_p.H630D|TRPC4_uc010aby.2_Intron	p.H630D	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN		all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)	8	2123	-			630			Binds to ITPR1, ITPR2 and ITPR3.|Cytoplasmic (Potential).		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	c.1888C>G	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318964	0.81469	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000447043	D;D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.85826	0.5787	N	0.25825	0.765	0.80722	D	1	P;D;D;D;D	0.89917	0.726;0.989;1.0;0.992;0.999	P;D;D;D;D	0.80764	0.613;0.985;0.994;0.931;0.971	T	0.82325	-0.0513	10	0.22109	T	0.4	-27.6807	19.757	0.96298	0.0:0.0:1.0:0.0	.	630;630;457;630;630	Q9UBN4-3;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;TRPC4_HUMAN	D	630;630;457;457;630;630;630	ENSP00000369027:H630D;ENSP00000369003:H630D;ENSP00000342580:H457D;ENSP00000369001:H457D;ENSP00000348025:H630D;ENSP00000351264:H630D;ENSP00000414316:H630D	ENSP00000342580:H457D	H	-	1	0	TRPC4	37123593	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	9.813000	0.99286	2.758000	0.94735	0.561000	0.74099	CAT		0.428	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		7	97	0	0	0	0.00308	0	7	97				
NEK5	341676	broad.mit.edu	37	13	52663447	52663447	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:52663447G>T	ENST00000355568.4	-	14	1350	c.1211C>A	c.(1210-1212)cCt>cAt	p.P404H		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	404					positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.P461H(1)|p.P404H(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		GTACTCAGCAGGCCTTAGAAA	0.328																																							uc001vge.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)	1						c.(1210-1212)CCT>CAT		NIMA-related kinase 5							57.0	56.0	57.0					13																	52663447		2202	4299	6501	SO:0001583	missense	341676						ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr13:52663447G>T	BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.1211C>A	13.37:g.52663447G>T	ENSP00000347767:p.Pro404His						p.P404H	NM_199289	NP_954983	Q6P3R8	NEK5_HUMAN		GBM - Glioblastoma multiforme(99;3.7e-08)	14	1351	-		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)	404					Q5TAP5	Missense_Mutation	SNP	ENST00000355568.4	37	c.1211C>A	CCDS31979.1	.	.	.	.	.	.	.	.	.	.	G	11.95	1.791943	0.31685	.	.	ENSG00000197168	ENST00000355568	T	0.71817	-0.6	5.27	4.37	0.52481	.	0.261954	0.32736	N	0.005716	T	0.73171	0.3553	L	0.46157	1.445	0.27183	N	0.960616	D	0.67145	0.996	P	0.57371	0.819	T	0.65545	-0.6142	10	0.40728	T	0.16	.	10.4993	0.44796	0.0962:0.0:0.9038:0.0	.	404	Q6P3R8	NEK5_HUMAN	H	404	ENSP00000347767:P404H	ENSP00000347767:P404H	P	-	2	0	NEK5	51561448	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	3.243000	0.51392	1.116000	0.41820	0.505000	0.49811	CCT		0.328	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045045.3	NM_199289		8	28	1	0	1.58986e-06	0.008291	1.95543e-06	8	28				
PCDH8	5100	broad.mit.edu	37	13	53422541	53422541	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:53422541A>T	ENST00000377942.3	-	1	234	c.31T>A	c.(31-33)Tgc>Agc	p.C11S	PCDH8_ENST00000338862.4_Missense_Mutation_p.C11S	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	11					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.C11S(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		GGGAAAAGGCAGGGGCTGCCC	0.602																																					GBM(36;25 841 9273 49207)	GBM(36;25 841 9273 49207)	uc001vhi.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(31-33)TGC>AGC		protocadherin 8 isoform 1 precursor							42.0	42.0	42.0					13																	53422541		2203	4300	6503	SO:0001583	missense	5100				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding	g.chr13:53422541A>T	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.31T>A	13.37:g.53422541A>T	ENSP00000367177:p.Cys11Ser					PCDH8_uc001vhj.2_Missense_Mutation_p.C11S	p.C11S	NM_002590	NP_002581	O95206	PCDH8_HUMAN		GBM - Glioblastoma multiforme(99;2.19e-08)	1	234	-		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	11					B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	c.31T>A	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.357244	0.41801	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.50813	0.75;0.73	5.43	4.22	0.49857	.	0.452045	0.19013	N	0.125039	T	0.26122	0.0637	N	0.08118	0	0.31900	N	0.616117	B;B	0.16166	0.016;0.009	B;B	0.20384	0.029;0.008	T	0.22977	-1.0201	10	0.23891	T	0.37	.	9.1417	0.36908	0.9153:0.0:0.0847:0.0	.	11;11	O95206-2;O95206	.;PCDH8_HUMAN	S	11	ENSP00000367177:C11S;ENSP00000341350:C11S	ENSP00000341350:C11S	C	-	1	0	PCDH8	52320542	0.999000	0.42202	0.998000	0.56505	0.946000	0.59487	1.547000	0.36190	0.869000	0.35703	0.533000	0.62120	TGC		0.602	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590		10	84	0	0	0	0.010729	0	10	84				
SLITRK1	114798	broad.mit.edu	37	13	84455027	84455027	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:84455027C>T	ENST00000377084.2	-	1	1501	c.616G>A	c.(616-618)Gag>Aag	p.E206K		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	206					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.E206K(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		AGCAGGATCTCCGCAATACCA	0.547																																							uc001vlk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(616-618)GAG>AAG		slit and trk like 1 protein precursor							74.0	71.0	72.0					13																	84455027		2203	4300	6503	SO:0001583	missense	114798					integral to membrane		g.chr13:84455027C>T	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.616G>A	13.37:g.84455027C>T	ENSP00000366288:p.Glu206Lys						p.E206K	NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	1502	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	206			Extracellular (Potential).		Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	c.616G>A	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.211934	0.58452	.	.	ENSG00000178235	ENST00000377084	T	0.52754	0.65	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.45816	0.1361	N	0.25485	0.75	0.80722	D	1	P	0.50369	0.934	P	0.49799	0.622	T	0.45011	-0.9290	10	0.48119	T	0.1	-14.349	16.4091	0.83701	0.0:1.0:0.0:0.0	.	206	Q96PX8	SLIK1_HUMAN	K	206	ENSP00000366288:E206K	ENSP00000366288:E206K	E	-	1	0	SLITRK1	83353028	1.000000	0.71417	0.968000	0.41197	0.987000	0.75469	7.651000	0.83577	2.461000	0.83175	0.561000	0.74099	GAG		0.547	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		12	90	0	0	0	0.010729	0	12	90				
SLITRK5	26050	broad.mit.edu	37	13	88327846	88327846	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:88327846G>T	ENST00000325089.6	+	2	422	c.203G>T	c.(202-204)cGg>cTg	p.R68L	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	68					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.R68L(2)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TGTGAAAACCGGGGGATCATC	0.458																																							uc001vln.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(202-204)CGG>CTG		SLIT and NTRK-like family, member 5 precursor							168.0	155.0	159.0					13																	88327846		2203	4300	6503	SO:0001583	missense	26050					integral to membrane		g.chr13:88327846G>T	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.203G>T	13.37:g.88327846G>T	ENSP00000366283:p.Arg68Leu					SLITRK5_uc010tic.1_Intron	p.R68L	NM_015567	NP_056382	O94991	SLIK5_HUMAN			2	422	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		68			Extracellular (Potential).		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	c.203G>T	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058711	0.55325	.	.	ENSG00000165300	ENST00000325089	T	0.60797	0.16	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.60637	0.2284	L	0.49571	1.57	0.80722	D	1	P	0.43633	0.813	P	0.46253	0.509	T	0.56257	-0.8009	9	.	.	.	-11.7514	17.8571	0.88767	0.0:0.0:1.0:0.0	.	68	O94991	SLIK5_HUMAN	L	68	ENSP00000366283:R68L	.	R	+	2	0	SLITRK5	87125847	1.000000	0.71417	0.992000	0.48379	0.599000	0.36880	9.869000	0.99810	2.826000	0.97356	0.561000	0.74099	CGG		0.458	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			69	261	1	0	1.72039e-30	0.01441	3.0967e-30	69	261				
COL4A2	1284	broad.mit.edu	37	13	111132690	111132690	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:111132690C>A	ENST00000360467.5	+	31	3017	c.2711C>A	c.(2710-2712)cCt>cAt	p.P904H		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	904	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)	p.P904H(1)		NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CCAGGAAGCCCTGGATTTAAA	0.577																																							uc001vqx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|central_nervous_system(2)|ovary(1)	6						c.(2710-2712)CCT>CAT		alpha 2 type IV collagen preproprotein							62.0	68.0	66.0					13																	111132690		1900	4112	6012	SO:0001583	missense	1284				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding	g.chr13:111132690C>A	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.2711C>A	13.37:g.111132690C>A	ENSP00000353654:p.Pro904His						p.P904H	NM_001846	NP_001837	P08572	CO4A2_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)		31	3000	+	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	904			Triple-helical region.		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	c.2711C>A	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.116285	0.37339	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.97772	-4.53	4.84	3.99	0.46301	.	0.236558	0.29956	N	0.010769	D	0.98579	0.9525	M	0.87381	2.88	0.38519	D	0.948689	D	0.89917	1.0	D	0.83275	0.996	D	0.99885	1.1120	10	0.72032	D	0.01	.	10.5116	0.44866	0.0:0.9069:0.0:0.0931	.	904	P08572	CO4A2_HUMAN	H	904	ENSP00000353654:P904H	ENSP00000257309:P904H	P	+	2	0	COL4A2	109930691	0.994000	0.37717	0.311000	0.25182	0.244000	0.25665	4.790000	0.62453	1.019000	0.39547	0.462000	0.41574	CCT		0.577	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846		12	123	1	0	3.27435e-08	0.00245	4.29759e-08	12	123				
ATP11A	23250	broad.mit.edu	37	13	113527887	113527887	+	Splice_Site	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:113527887C>G	ENST00000487903.1	+	27	3146	c.3058C>G	c.(3058-3060)Ctt>Gtt	p.L1020V	ATP11A_ENST00000375645.3_Splice_Site_p.L1020V|ATP11A_ENST00000375630.2_Splice_Site_p.L1020V|ATP11A_ENST00000283558.8_Splice_Site_p.L1020V			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	1020					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.L1020V(2)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TTCCTTTTAGCTTGCATTGGA	0.488											OREG0003854	type=REGULATORY REGION|Gene=ATP11A|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc001vsi.3		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(2)|ovary(2)	4						c.(3058-3060)CTT>GTT		ATPase, class VI, type 11A isoform a							160.0	135.0	144.0					13																	113527887		2203	4300	6503	SO:0001630	splice_region_variant	23250				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:113527887C>G	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.3058-1C>G	13.37:g.113527887C>G			OREG0003854	type=REGULATORY REGION|Gene=ATP11A|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1451	ATP11A_uc001vsj.3_Missense_Mutation_p.L1020V|ATP11A_uc010ago.2_RNA	p.L1020V	NM_015205	NP_056020	P98196	AT11A_HUMAN			27	3146	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)	1020			Helical; (Potential).		Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	37	c.3058C>G	CCDS32011.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.914175	0.33815	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558;ENST00000419631	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	4.3	4.3	0.51218	.	0.000000	0.64402	D	0.000001	T	0.40886	0.1135	L	0.41236	1.265	0.80722	D	1	P;B	0.37122	0.583;0.377	B;B	0.36335	0.222;0.145	T	0.31888	-0.9927	10	0.30078	T	0.28	.	17.1131	0.86681	0.0:1.0:0.0:0.0	.	1020;1020	E9PEJ6;P98196	.;AT11A_HUMAN	V	1020;1020;1020;1020;12	ENSP00000420387:L1020V;ENSP00000364781:L1020V;ENSP00000364796:L1020V;ENSP00000283558:L1020V;ENSP00000410824:L12V	ENSP00000283558:L1020V	L	+	1	0	ATP11A	112575888	1.000000	0.71417	0.910000	0.35882	0.046000	0.14306	4.601000	0.61090	2.107000	0.64212	0.462000	0.41574	CTT		0.488	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	Missense_Mutation	17	98	0	0	0	0.00499	0	17	98				
TFDP1	7027	broad.mit.edu	37	13	114287464	114287464	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr13:114287464G>A	ENST00000375370.5	+	6	550	c.338G>A	c.(337-339)gGc>gAc	p.G113D	TFDP1_ENST00000544902.1_Missense_Mutation_p.G18D|TFDP1_ENST00000538138.1_Missense_Mutation_p.G18D|TFDP1_ENST00000465174.1_3'UTR	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1	113					anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.G113D(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			GAGAAGAATGGCAAGGGCCTA	0.517										TSP Lung(29;0.18)																													uc001vtw.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(2)|skin(1)	7						c.(337-339)GGC>GAC		transcription factor Dp-1							63.0	59.0	61.0					13																	114287464		2203	4300	6503	SO:0001583	missense	7027				cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|regulation of transcription from RNA polymerase II promoter	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding	g.chr13:114287464G>A	BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.338G>A	13.37:g.114287464G>A	ENSP00000364519:p.Gly113Asp	TSP Lung(29;0.18)				TFDP1_uc010tkd.1_Missense_Mutation_p.G18D|TFDP1_uc010tke.1_Missense_Mutation_p.G18D|TFDP1_uc001vty.3_Missense_Mutation_p.G113D|TFDP1_uc001vtx.2_5'UTR|TFDP1_uc010agx.2_Missense_Mutation_p.G113D	p.G113D	NM_007111	NP_009042	Q14186	TFDP1_HUMAN	all cancers(43;0.0576)		6	550	+	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	113			Potential.		B4DLQ9|Q5JSB4|Q8IZL5	Missense_Mutation	SNP	ENST00000375370.5	37	c.338G>A	CCDS9538.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687554	0.88639	.	.	ENSG00000198176	ENST00000538138;ENST00000375370;ENST00000544902;ENST00000408980;ENST00000453989	T;T;T;T;T	0.47869	0.83;1.76;0.88;1.4;1.17	4.12	4.12	0.48240	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.048523	0.85682	D	0.000000	T	0.74831	0.3768	M	0.91872	3.25	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.998;1.0;0.987;0.99	T	0.82333	-0.0509	10	0.62326	D	0.03	.	16.3801	0.83458	0.0:0.0:1.0:0.0	.	18;18;113;113;113	F5H452;B4DLQ9;Q5JSB5;Q5JSB6;Q14186	.;.;.;.;TFDP1_HUMAN	D	18;113;18;113;113	ENSP00000443878:G18D;ENSP00000364519:G113D;ENSP00000438450:G18D;ENSP00000386145:G113D;ENSP00000401389:G113D	ENSP00000364519:G113D	G	+	2	0	TFDP1	113335465	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.252000	0.95491	1.844000	0.53588	0.491000	0.48974	GGC		0.517	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045918.3	NM_007111		12	61	0	0	0	0.001855	0	12	61				
METTL17	64745	broad.mit.edu	37	14	21458201	21458201	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:21458201T>C	ENST00000339374.6	+	1	273	c.40T>C	c.(40-42)Tgg>Cgg	p.W14R	METTL17_ENST00000382985.4_Missense_Mutation_p.W14R|METTL17_ENST00000556670.2_Missense_Mutation_p.W14R|METTL17_ENST00000555177.1_3'UTR	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	14					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)	p.W14R(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						ATTAGGAAGATGGTGCCCCGG	0.622																																							uc001vyn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(40-42)TGG>CGG		methyltransferase 11 domain containing 1 isoform							56.0	63.0	61.0					14																	21458201		2203	4300	6503	SO:0001583	missense	64745				translation	mitochondrion|ribosome	copper ion binding|methyltransferase activity	g.chr14:21458201T>C	AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.40T>C	14.37:g.21458201T>C	ENSP00000343041:p.Trp14Arg					METT11D1_uc010tlk.1_Missense_Mutation_p.W14R|METT11D1_uc001vym.2_Missense_Mutation_p.W14R|METT11D1_uc001vyo.2_Missense_Mutation_p.W14R|METT11D1_uc001vyp.2_5'UTR|METT11D1_uc001vyq.2_5'UTR	p.W14R	NM_022734	NP_073571	Q9H7H0	MET17_HUMAN	OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0191)	1	237	+	all_cancers(95;0.00267)		14					Q9BSH1|Q9BZH2|Q9BZH3	Missense_Mutation	SNP	ENST00000339374.6	37	c.40T>C	CCDS9562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.29|13.29	2.192261|2.192261	0.38707|0.38707	.|.	.|.	ENSG00000165792|ENSG00000165792	ENST00000536700;ENST00000554283|ENST00000339374;ENST00000382985	.|T;T	.|0.33654	.|1.5;1.4	5.55|5.55	4.39|4.39	0.52855|0.52855	.|.	.|0.619727	.|0.16118	.|N	.|0.228783	T|T	0.36552|0.36552	0.0971|0.0971	L|L	0.36672|0.36672	1.1|1.1	0.21604|0.21604	N|N	0.999628|0.999628	.|P;P;B;P	.|0.50617	.|0.937;0.573;0.437;0.573	.|P;B;B;B	.|0.51385	.|0.668;0.366;0.156;0.297	T|T	0.09707|0.09707	-1.0662|-1.0662	6|10	0.87932|0.27082	D|T	0|0.32	.|.	9.5852|9.5852	0.39512|0.39512	0.0:0.0:0.1762:0.8238|0.0:0.0:0.1762:0.8238	.|.	.|14;14;14;14	.|B4E298;Q9H7H0-3;Q9H7H0;Q9H7H0-2	.|.;.;MET17_HUMAN;.	T|R	1|14	.|ENSP00000343041:W14R;ENSP00000372445:W14R	ENSP00000440779:M1T|ENSP00000343041:W14R	M|W	+|+	2|1	0|0	METTL17|METTL17	20528041|20528041	0.513000|0.513000	0.26194|0.26194	0.835000|0.835000	0.33067|0.33067	0.037000|0.037000	0.13140|0.13140	1.208000|1.208000	0.32345|0.32345	1.094000|1.094000	0.41399|0.41399	0.533000|0.533000	0.62120|0.62120	ATG|TGG		0.622	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073804.4	NM_022734		11	66	0	0	0	0.004656	0	11	66				
CHD8	57680	broad.mit.edu	37	14	21870599	21870599	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:21870599G>A	ENST00000557364.1	-	19	4041	c.3778C>T	c.(3778-3780)Cgt>Tgt	p.R1260C	CHD8_ENST00000430710.3_Missense_Mutation_p.R981C|CHD8_ENST00000555962.1_5'UTR|CHD8_ENST00000399982.2_Missense_Mutation_p.R1260C			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1260	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.R1260C(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TAGGAATTACGAGTGATGAGG	0.473																																							uc001was.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10						c.(2941-2943)CGT>TGT		chromodomain helicase DNA binding protein 8							84.0	82.0	83.0					14																	21870599		2203	4300	6503	SO:0001583	missense	57680				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding	g.chr14:21870599G>A	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3778C>T	14.37:g.21870599G>A	ENSP00000451601:p.Arg1260Cys					CHD8_uc001war.1_Missense_Mutation_p.R877C|CHD8_uc001wav.1_Missense_Mutation_p.R423C	p.R981C	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)	19	3035	-	all_cancers(95;0.00121)		1260			Helicase C-terminal.		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	c.2941C>T	CCDS53885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.84|18.84	3.709016|3.709016	0.68615|0.68615	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364|ENST00000555935	D;D;D|.	0.96232|.	-3.95;-3.95;-3.95|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Helicase, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73783|0.73783	0.3631|0.3631	M|M	0.62209|0.62209	1.925|1.925	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.995;0.997|.	T|T	0.69785|0.69785	-0.5051|-0.5051	10|5	0.72032|.	D|.	0.01|.	-6.5941|-6.5941	18.6545|18.6545	0.91445|0.91445	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1260;981|.	Q9HCK8;Q9HCK8-2|.	CHD8_HUMAN;.|.	C|L	981;1260;980;1260|485	ENSP00000406288:R981C;ENSP00000382863:R1260C;ENSP00000451601:R1260C|.	ENSP00000262707:R980C|.	R|S	-|-	1|2	0|0	CHD8|CHD8	20940439|20940439	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	2.303000|2.303000	0.43646|0.43646	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CGT|TCG		0.473	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920		4	75	0	0	0	0.009096	0	4	75				
NOVA1	4857	broad.mit.edu	37	14	26917950	26917950	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:26917950T>A	ENST00000539517.2	-	5	1056	c.739A>T	c.(739-741)Agt>Tgt	p.S247C	NOVA1_ENST00000267422.7_Missense_Mutation_p.S125C|NOVA1_ENST00000465357.2_Missense_Mutation_p.S223C	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	250					locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S247C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		CAGCTGCCACTTTGTGGATCC	0.448																																							uc001wpy.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5						c.(739-741)AGT>TGT		neuro-oncological ventral antigen 1 isoform 1							207.0	188.0	194.0					14																	26917950		2203	4300	6503	SO:0001583	missense	4857				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding	g.chr14:26917950T>A	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.739A>T	14.37:g.26917950T>A	ENSP00000438875:p.Ser247Cys					NOVA1_uc001wpz.2_Missense_Mutation_p.S223C|NOVA1_uc001wqa.2_Missense_Mutation_p.S125C	p.S247C	NM_002515	NP_002506	P51513	NOVA1_HUMAN		GBM - Glioblastoma multiforme(265;0.0135)	5	1057	-			250					A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Missense_Mutation	SNP	ENST00000539517.2	37	c.739A>T	CCDS32061.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.822444	0.71028	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000267422;ENST00000449198;ENST00000347476	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;1.42	5.73	5.73	0.89815	.	0.124327	0.64402	D	0.000018	T	0.77818	0.4187	M	0.66297	2.02	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.76071	0.986;0.971;0.987	T	0.80238	-0.1465	10	0.87932	D	0	5.0E-4	16.0142	0.80425	0.0:0.0:0.0:1.0	.	250;223;247	P51513;D3DS81;P51513-4	NOVA1_HUMAN;.;.	C	223;247;125;206;101	ENSP00000447391:S223C;ENSP00000438875:S247C;ENSP00000267422:S125C;ENSP00000408914:S206C;ENSP00000299472:S101C	ENSP00000267422:S125C	S	-	1	0	NOVA1	25987790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.005000	0.88553	2.187000	0.69744	0.460000	0.39030	AGT		0.448	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	NM_006491		29	119	0	0	0	0.007835	0	29	119				
RALGAPA1	253959	broad.mit.edu	37	14	36097026	36097026	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:36097026G>A	ENST00000389698.3	-	33	4999	c.4609C>T	c.(4609-4611)Cac>Tac	p.H1537Y	RALGAPA1_ENST00000307138.6_Missense_Mutation_p.H1537Y|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.H1584Y|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.H1550Y	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1537	Minimal domain that binds to TCF3/E12. {ECO:0000250}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.H1537Y(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGATTGTCGTGATTTTCACAC	0.413																																							uc001wti.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(1)	4						c.(4609-4611)CAC>TAC		Ral GTPase activating protein, alpha subunit 1							37.0	36.0	37.0					14																	36097026		2202	4278	6480	SO:0001583	missense	253959				activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity	g.chr14:36097026G>A	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.4609C>T	14.37:g.36097026G>A	ENSP00000374348:p.His1537Tyr					RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Missense_Mutation_p.H1537Y|RALGAPA1_uc010tpv.1_Missense_Mutation_p.H1550Y|RALGAPA1_uc010tpw.1_Missense_Mutation_p.H1584Y	p.H1537Y	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN			33	5000	-			1537			Minimal domain that binds to TCF3/E12 (By similarity).		A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	c.4609C>T	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.903876	0.52333	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	D;D;D;D;D;D	0.97232	-3.58;-3.59;-3.59;-4.3;-3.59;-3.59	5.55	5.55	0.83447	.	0.144353	0.64402	D	0.000005	D	0.95809	0.8636	L	0.55213	1.73	0.45554	D	0.998504	P;B;P;P	0.35944	0.49;0.242;0.49;0.529	B;B;B;B	0.39590	0.247;0.285;0.221;0.304	D	0.95502	0.8578	10	0.66056	D	0.02	-16.1228	14.6057	0.68478	0.0:0.0:0.8199:0.1801	.	1584;1550;1537;1537	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	Y	1537;1537;1537;1584;175;1550;1584	ENSP00000374348:H1537Y;ENSP00000302647:H1537Y;ENSP00000258840:H1584Y;ENSP00000451133:H175Y;ENSP00000371803:H1550Y;ENSP00000451877:H1584Y	ENSP00000258840:H1584Y	H	-	1	0	RALGAPA1	35166777	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.506000	0.81665	2.761000	0.94854	0.655000	0.94253	CAC		0.413	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022		26	78	0	0	0	0.012213	0	26	78				
LRFN5	145581	broad.mit.edu	37	14	42356876	42356876	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:42356876A>T	ENST00000298119.4	+	3	2237	c.1048A>T	c.(1048-1050)Aag>Tag	p.K350*	LRFN5_ENST00000554120.1_Nonsense_Mutation_p.K350*|LRFN5_ENST00000554171.1_Nonsense_Mutation_p.K350*	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	350	Ig-like.					integral component of membrane (GO:0016021)		p.K350*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CACAACTGTAAAGGATACAGG	0.393										HNSCC(30;0.082)																													uc001wvm.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(1048-1050)AAG>TAG		leucine rich repeat and fibronectin type III							103.0	101.0	102.0					14																	42356876		2203	4300	6503	SO:0001587	stop_gained	145581					integral to membrane		g.chr14:42356876A>T	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1048A>T	14.37:g.42356876A>T	ENSP00000298119:p.Lys350*	HNSCC(30;0.082)				LRFN5_uc010ana.2_Nonsense_Mutation_p.K350*	p.K350*	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	3	2246	+			350			Extracellular (Potential).|Ig-like.		B3KU78|Q86XL2	Nonsense_Mutation	SNP	ENST00000298119.4	37	c.1048A>T	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	A	47	13.157270	0.99723	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	.	.	.	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6708	0.62424	1.0:0.0:0.0:0.0	.	.	.	.	X	350	.	ENSP00000298119:K350X	K	+	1	0	LRFN5	41426626	1.000000	0.71417	0.889000	0.34880	0.994000	0.84299	7.420000	0.80191	2.165000	0.68154	0.460000	0.39030	AAG		0.393	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		33	149	0	0	0	0.012213	0	33	149				
VCPKMT	79609	broad.mit.edu	37	14	50583010	50583010	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:50583010G>A	ENST00000395860.2	-	1	265	c.261C>T	c.(259-261)acC>acT	p.T87T	VCPKMT_ENST00000395859.2_Silent_p.T87T	NM_024558.2	NP_078834.2	Q9H867	MT21D_HUMAN	valosin containing protein lysine (K) methyltransferase	87					peptidyl-lysine trimethylation (GO:0018023)	cytoplasm (GO:0005737)	protein-lysine N-methyltransferase activity (GO:0016279)	p.T87T(1)									CTTACCCGAGGGTAGCAGCCA	0.687																																							uc001wxo.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(259-261)ACC>ACT		hypothetical protein LOC79609 isoform a							6.0	9.0	8.0					14																	50583010		2136	4235	6371	SO:0001819	synonymous_variant	79609						methyltransferase activity	g.chr14:50583010G>A	AK023982	CCDS9696.2, CCDS41951.1	14q21.3	2013-09-30	2013-09-30	2013-09-30	ENSG00000100483	ENSG00000100483			20352	protein-coding gene	gene with protein product		615260	"""chromosome 14 open reading frame 138"", ""methyltransferase like 21D"""	C14orf138, METTL21D		22948820	Standard	NR_049738		Approved	VCP-KMT	uc001wxo.1	Q9H867	OTTHUMG00000029531	ENST00000395860.2:c.261C>T	14.37:g.50583010G>A						C14orf138_uc001wxn.1_5'Flank|C14orf138_uc001wxp.1_Silent_p.T87T|C14orf138_uc001wxq.1_RNA	p.T87T	NM_024558	NP_078834	Q9H867	MT21D_HUMAN			1	288	-	all_epithelial(31;0.000822)|Breast(41;0.0065)		87					B7ZLA3|B7ZLA4|Q2M2X3|Q86T12	Silent	SNP	ENST00000395860.2	37	c.261C>T	CCDS9696.2																																																																																				0.687	VCPKMT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276877.1	NM_024558		3	8	0	0	0	0.004672	0	3	8				
ATL1	51062	broad.mit.edu	37	14	51058280	51058280	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:51058280G>A	ENST00000358385.6	+	4	686	c.445G>A	c.(445-447)Gga>Aga	p.G149R	ATL1_ENST00000354525.4_Missense_Mutation_p.G149R|ATL1_ENST00000441560.2_Missense_Mutation_p.G149R|ATL1_ENST00000357032.3_Missense_Mutation_p.G149R	NM_015915.4	NP_056999.2	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1	149	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.G149R(1)		central_nervous_system(1)|cervix(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(3)	18						GGATACTCAGGGAACCTTTGA	0.358																																							uc001wyf.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|central_nervous_system(1)	4						c.(445-447)GGA>AGA		atlastin GTPase 1 isoform a							143.0	134.0	137.0					14																	51058280		2203	4300	6503	SO:0001583	missense	51062				axonogenesis|cell death|endoplasmic reticulum organization|protein homooligomerization	axon|endoplasmic reticulum membrane|Golgi cis cisterna|Golgi membrane|integral to membrane|microsome	GTP binding|GTPase activity|identical protein binding	g.chr14:51058280G>A	AF131801	CCDS9700.1, CCDS32077.1	14q21.3	2014-09-17	2008-09-17	2008-09-17	ENSG00000198513	ENSG00000198513			11231	protein-coding gene	gene with protein product	"""atlastin"""	606439	"""spastic paraplegia 3A (autosomal dominant)"""	SPG3, SPG3A		8252041, 7825576	Standard	NM_015915		Approved	FSP1, AD-FSP	uc001wyd.4	Q8WXF7	OTTHUMG00000140297	ENST00000358385.6:c.445G>A	14.37:g.51058280G>A	ENSP00000351155:p.Gly149Arg					ATL1_uc001wyd.3_Missense_Mutation_p.G149R|ATL1_uc001wye.3_Missense_Mutation_p.G149R	p.G149R	NM_015915	NP_056999	Q8WXF7	ATLA1_HUMAN			4	686	+			149			GTP (Potential).|Cytoplasmic.		A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	ENST00000358385.6	37	c.445G>A	CCDS9700.1	.	.	.	.	.	.	.	.	.	.	G	32	5.149369	0.94645	.	.	ENSG00000198513	ENST00000441560;ENST00000358385;ENST00000357032;ENST00000354525;ENST00000554886	D;D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3;-4.3	5.49	5.49	0.81192	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98943	0.9641	H	0.94847	3.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99597	1.0977	10	0.87932	D	0	-14.5455	18.3741	0.90430	0.0:0.0:1.0:0.0	.	149;149	Q8WXF7;G5E9T1	ATLA1_HUMAN;.	R	149;149;149;149;5	ENSP00000413675:G149R;ENSP00000351155:G149R;ENSP00000349534:G149R;ENSP00000346522:G149R;ENSP00000452074:G5R	ENSP00000346522:G149R	G	+	1	0	ATL1	50128030	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.743000	0.98849	2.583000	0.87209	0.585000	0.79938	GGA		0.358	ATL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276884.2			5	132	0	0	0	0.001168	0	5	132				
PSMC6	5706	broad.mit.edu	37	14	53180639	53180639	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:53180639G>T	ENST00000606149.1	+	7	498	c.482G>T	c.(481-483)cGt>cTt	p.R161L	PSMC6_ENST00000445930.2_Missense_Mutation_p.R175L	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	161					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)	p.R175L(1)|p.R161L(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					TTATTTCAGCGTGTAGGAATA	0.308																																							uc010tqx.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)	1						c.(523-525)CGT>CTT		proteasome 26S ATPase subunit 6							87.0	90.0	89.0					14																	53180639		2203	4298	6501	SO:0001583	missense	5706				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding, bridging	g.chr14:53180639G>T		CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.482G>T	14.37:g.53180639G>T	ENSP00000475721:p.Arg161Leu					PSMC6_uc010tqw.1_Missense_Mutation_p.R141L	p.R175L	NM_002806	NP_002797	P62333	PRS10_HUMAN			7	524	+	Breast(41;0.176)		161					B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	ENST00000606149.1	37	c.524G>T		.	.	.	.	.	.	.	.	.	.	G	34	5.315777	0.95655	.	.	ENSG00000100519	ENST00000445930	D	0.95069	-3.6	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.98191	0.9402	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;0.987	D;P	0.74674	0.984;0.82	D	0.99264	1.0891	10	0.87932	D	0	.	19.1305	0.93404	0.0:0.0:1.0:0.0	.	161;141	P62333;B4DR91	PRS10_HUMAN;.	L	175	ENSP00000401802:R175L	ENSP00000401802:R175L	R	+	2	0	PSMC6	52250389	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.647000	0.83462	2.590000	0.87494	0.467000	0.42956	CGT		0.308	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470741.1	NM_002806		19	118	1	0	2.39187e-15	0.008871	3.8419e-15	19	118				
GCH1	2643	broad.mit.edu	37	14	55310797	55310797	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:55310797A>T	ENST00000491895.2	-	6	879	c.691T>A	c.(691-693)Ttg>Atg	p.L231M	GCH1_ENST00000536224.2_Intron|GCH1_ENST00000395514.1_Missense_Mutation_p.L231M|GCH1_ENST00000254299.4_5'UTR|GCH1_ENST00000543643.2_Intron	NM_000161.2	NP_000152.1	P30793	GCH1_HUMAN	GTP cyclohydrolase 1	231					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|dopamine biosynthetic process (GO:0042416)|GTP catabolic process (GO:0006184)|metabolic process (GO:0008152)|negative regulation of blood pressure (GO:0045776)|neuromuscular process controlling posture (GO:0050884)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric-oxide synthase activity (GO:0051000)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|pteridine-containing compound biosynthetic process (GO:0042559)|regulation of blood pressure (GO:0008217)|regulation of lung blood pressure (GO:0014916)|regulation of nitric-oxide synthase activity (GO:0050999)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to pain (GO:0048265)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|tetrahydrofolate biosynthetic process (GO:0046654)|vasodilation (GO:0042311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|coenzyme binding (GO:0050662)|GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.L231M(1)		endometrium(2)|lung(7)|skin(2)	11						AACACACCCAACATTGTGCTG	0.463																																					Pancreas(198;1245 2204 4807 21567 38372)	Pancreas(198;1245 2204 4807 21567 38372)	uc001xbh.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(691-693)TTG>ATG		GTP cyclohydrolase 1 isoform 1							196.0	158.0	171.0					14																	55310797		2203	4300	6503	SO:0001583	missense	2643				dopamine biosynthetic process|GTP catabolic process|neuromuscular process controlling posture|nitric oxide biosynthetic process|positive regulation of nitric-oxide synthase activity|protein homooligomerization|response to interferon-gamma|response to lipopolysaccharide|response to pain|response to tumor necrosis factor|tetrahydrobiopterin biosynthetic process|tetrahydrofolate biosynthetic process	cytoplasmic vesicle|cytosol|nuclear membrane|protein complex	GTP binding|GTP cyclohydrolase I activity|protein homodimerization activity|zinc ion binding	g.chr14:55310797A>T	U19523	CCDS9720.1, CCDS41954.1, CCDS45110.1	14q22.1-q22.2	2014-04-01	2008-08-01		ENSG00000131979	ENSG00000131979	3.5.4.16		4193	protein-coding gene	gene with protein product	"""dopa-responsive dystonia"""	600225	"""dystonia 14"""	GCH, DYT5, DYT14		7874165, 8695054	Standard	XM_005267530		Approved	GTPCH1, DYT5a	uc001xbi.1	P30793	OTTHUMG00000029754	ENST00000491895.2:c.691T>A	14.37:g.55310797A>T	ENSP00000419045:p.Leu231Met					GCH1_uc001xbi.1_Missense_Mutation_p.L231M|GCH1_uc001xbj.1_Intron|GCH1_uc001xbk.1_Intron|GCH1_uc010aol.1_Intron	p.L231M	NM_001024024	NP_001019195	P30793	GCH1_HUMAN			6	852	-			231					Q6FHY7|Q9Y4I8	Missense_Mutation	SNP	ENST00000491895.2	37	c.691T>A	CCDS9720.1	.	.	.	.	.	.	.	.	.	.	A	18.35	3.603700	0.66445	.	.	ENSG00000131979	ENST00000395514;ENST00000491895	D;D	0.99751	-6.63;-6.63	5.93	-4.92	0.03075	GTP cyclohydrolase I/Nitrile oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.99444	0.9803	M	0.84082	2.675	0.54753	D	0.999988	P	0.46220	0.874	P	0.50590	0.645	D	0.97514	1.0068	10	0.66056	D	0.02	-9.0189	15.8945	0.79325	0.5723:0.0:0.4277:0.0	.	231	P30793	GCH1_HUMAN	M	231	ENSP00000378890:L231M;ENSP00000419045:L231M	ENSP00000378890:L231M	L	-	1	2	GCH1	54380547	0.452000	0.25713	0.651000	0.29564	0.919000	0.55068	-0.263000	0.08670	-0.816000	0.04340	-0.912000	0.02778	TTG		0.463	GCH1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276895.3			18	170	0	0	0	0.006122	0	18	170				
DACT1	51339	broad.mit.edu	37	14	59112403	59112403	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:59112403G>T	ENST00000335867.4	+	4	1086	c.1062G>T	c.(1060-1062)agG>agT	p.R354S	DACT1_ENST00000395153.3_Missense_Mutation_p.R317S|DACT1_ENST00000541264.2_Missense_Mutation_p.R73S|DACT1_ENST00000556859.1_Missense_Mutation_p.R73S			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	354					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)	p.R354S(1)		endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						ACCCTGTAAGGACCAACAAAC	0.552																																							uc001xdw.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|lung(2)|ovary(1)	5						c.(1060-1062)AGG>AGT		dapper 1 isoform 1							66.0	62.0	63.0					14																	59112403		2203	4300	6503	SO:0001583	missense	51339				multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus		g.chr14:59112403G>T	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1062G>T	14.37:g.59112403G>T	ENSP00000337439:p.Arg354Ser					DACT1_uc010trv.1_Missense_Mutation_p.R73S|DACT1_uc001xdx.2_Missense_Mutation_p.R317S|DACT1_uc010trw.1_Missense_Mutation_p.R73S	p.R354S	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN			4	1226	+			354					A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	37	c.1062G>T	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486016	0.84854	.	.	ENSG00000165617	ENST00000556859;ENST00000421793;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.70491	0.3230	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.71771	-0.4492	10	0.54805	T	0.06	-24.1523	19.2917	0.94102	0.0:0.0:1.0:0.0	.	317;354	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	S	73;73;73;317;354;73	ENSP00000451598:R73S;ENSP00000404297:R73S;ENSP00000378581:R73S;ENSP00000378582:R317S;ENSP00000337439:R354S;ENSP00000442850:R73S	ENSP00000337439:R354S	R	+	3	2	DACT1	58182156	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.246000	0.78247	2.577000	0.86979	0.563000	0.77884	AGG		0.552	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651		14	67	1	0	0.00244969	0.00245	0.00264064	14	67				
SYNE2	23224	broad.mit.edu	37	14	64557634	64557634	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:64557634G>T	ENST00000344113.4	+	60	12056	c.11844G>T	c.(11842-11844)gtG>gtT	p.V3948V	SYNE2_ENST00000357395.3_Silent_p.V333V|SYNE2_ENST00000394768.2_Silent_p.V333V|SYNE2_ENST00000554584.1_Silent_p.V3981V|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000358025.3_Silent_p.V3948V|SYNE2_ENST00000555002.1_Silent_p.V582V	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3948					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.V3948V(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CTGAGATAGTGTCTTACCAAG	0.383																																							uc001xgm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(11842-11844)GTG>GTT		spectrin repeat containing, nuclear envelope 2							78.0	74.0	76.0					14																	64557634		2203	4300	6503	SO:0001819	synonymous_variant	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64557634G>T	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.11844G>T	14.37:g.64557634G>T						SYNE2_uc001xgl.2_Silent_p.V3948V|SYNE2_uc010apy.2_Silent_p.V333V|SYNE2_uc010apx.1_Silent_p.V340V	p.V3948V	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	60	12074	+			3948			Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	c.11844G>T	CCDS41963.1																																																																																				0.383	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		19	92	1	0	7.45023e-12	0.010504	1.11753e-11	19	92				
SYNE2	23224	broad.mit.edu	37	14	64591827	64591827	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:64591827G>T	ENST00000344113.4	+	71	13665	c.13453G>T	c.(13453-13455)Gtg>Ttg	p.V4485L	SYNE2_ENST00000357395.3_Missense_Mutation_p.V870L|SYNE2_ENST00000394768.2_Missense_Mutation_p.V870L|SYNE2_ENST00000554584.1_Intron|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000358025.3_Missense_Mutation_p.V4485L|SYNE2_ENST00000555002.1_Missense_Mutation_p.V1119L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4485					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.V4485L(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCTACCCAGCGTGACTATGTA	0.373																																							uc001xgm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(13453-13455)GTG>TTG		spectrin repeat containing, nuclear envelope 2							106.0	100.0	102.0					14																	64591827		2203	4300	6503	SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64591827G>T	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13453G>T	14.37:g.64591827G>T	ENSP00000341781:p.Val4485Leu					SYNE2_uc001xgl.2_Missense_Mutation_p.V4485L|SYNE2_uc010apy.2_Missense_Mutation_p.V870L|SYNE2_uc010apz.1_Missense_Mutation_p.V377L	p.V4485L	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	71	13683	+			4485			Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.13453G>T	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	7.693	0.691481	0.15039	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000555002;ENST00000394768	T;T;T;T;T	0.51071	0.72;4.02;0.72;4.06;4.02	5.84	4.02	0.46733	.	0.302220	0.22957	N	0.053586	T	0.32793	0.0841	L	0.29908	0.895	0.80722	D	1	B;P;P	0.48589	0.214;0.857;0.912	B;B;B	0.41466	0.07;0.196;0.358	T	0.06770	-1.0808	10	0.39692	T	0.17	.	7.066	0.25151	0.1418:0.0:0.718:0.1401	.	870;4485;4485	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	L	4485;870;4485;1119;870	ENSP00000350719:V4485L;ENSP00000349969:V870L;ENSP00000341781:V4485L;ENSP00000450831:V1119L;ENSP00000378249:V870L	ENSP00000341781:V4485L	V	+	1	0	SYNE2	63661580	1.000000	0.71417	0.984000	0.44739	0.139000	0.21198	2.193000	0.42658	1.479000	0.48272	-0.152000	0.13540	GTG		0.373	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		13	83	1	0	4.3838e-07	0.001855	5.48701e-07	13	83				
ZFYVE26	23503	broad.mit.edu	37	14	68249881	68249881	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:68249881T>A	ENST00000347230.4	-	21	4126	c.3988A>T	c.(3988-3990)Agc>Tgc	p.S1330C	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.S1330C	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1330					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.S1330C(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CTGGGTTTGCTGACCTTTAAC	0.597																																							uc001xka.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(2)	11						c.(3988-3990)AGC>TGC		zinc finger, FYVE domain containing 26							76.0	86.0	83.0					14																	68249881		2203	4300	6503	SO:0001583	missense	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68249881T>A	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.3988A>T	14.37:g.68249881T>A	ENSP00000251119:p.Ser1330Cys					ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.S1330C	p.S1330C	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	21	4127	-			1330					B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	c.3988A>T	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	T	17.03	3.285870	0.59867	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.29142	1.73;1.58	5.51	0.0163	0.14107	.	0.858421	0.10250	N	0.697222	T	0.20333	0.0489	N	0.22421	0.69	0.24373	N	0.994823	P;B	0.48016	0.904;0.412	P;B	0.47162	0.54;0.237	T	0.12218	-1.0556	10	0.42905	T	0.14	-5.7355	0.9814	0.01437	0.1906:0.1539:0.1958:0.4597	.	1330;1330	G3V2D8;Q68DK2	.;ZFY26_HUMAN	C	1330;1309;1330	ENSP00000251119:S1330C;ENSP00000450603:S1330C	ENSP00000251119:S1330C	S	-	1	0	ZFYVE26	67319634	0.280000	0.24249	0.993000	0.49108	0.843000	0.47879	0.421000	0.21280	0.385000	0.24970	-0.375000	0.07067	AGC		0.597	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		18	192	0	0	0	0.012319	0	18	192				
YLPM1	56252	broad.mit.edu	37	14	75265213	75265213	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:75265213G>T	ENST00000325680.7	+	5	3337	c.3213G>T	c.(3211-3213)aaG>aaT	p.K1071N	YLPM1_ENST00000238571.3_Missense_Mutation_p.K876N|YLPM1_ENST00000552421.1_Intron	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	876	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.K1071N(1)|p.K876N(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GTCGAGAGAAGATGAACAGAG	0.557																																							uc001xqj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|pancreas(1)	3						c.(3211-3213)AAG>AAT		YLP motif containing 1							94.0	104.0	101.0					14																	75265213		1986	4162	6148	SO:0001583	missense	56252				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck		g.chr14:75265213G>T	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3213G>T	14.37:g.75265213G>T	ENSP00000324463:p.Lys1071Asn					YLPM1_uc001xql.3_RNA	p.K1071N	NM_019589	NP_062535	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)	5	3337	+			876			Arg-rich.		P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000325680.7	37	c.3213G>T	CCDS45135.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474040	0.43942	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.69	4.79	0.61399	.	0.162937	0.43579	D	0.000558	T	0.44117	0.1278	L	0.58101	1.795	0.28056	N	0.933173	B	0.17852	0.024	B	0.17098	0.017	T	0.46789	-0.9166	9	0.66056	D	0.02	-13.4752	10.1815	0.42970	0.0728:0.0:0.7909:0.1363	.	1071	P49750-4	.	N	1071;876;784	.	ENSP00000238571:K876N	K	+	3	2	YLPM1	74334966	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.196000	0.42686	1.382000	0.46385	0.643000	0.83706	AAG		0.557	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589		18	97	1	0	5.3912e-06	0.006122	6.4763e-06	18	97				
SERPINA4	5267	broad.mit.edu	37	14	95030082	95030082	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:95030082T>C	ENST00000557004.1	+	2	684	c.263T>C	c.(262-264)aTg>aCg	p.M88T	SERPINA4_ENST00000298841.5_Missense_Mutation_p.M88T|SERPINA4_ENST00000555095.1_Missense_Mutation_p.M88T|SERPINA5_ENST00000553780.1_Intron			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	88					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.M88T(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		GCCTACGCCATGCTTTCCCTG	0.597																																							uc001ydk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(262-264)ATG>ACG		serine (or cysteine) proteinase inhibitor, clade							40.0	42.0	41.0					14																	95030082		2203	4300	6503	SO:0001583	missense	5267				regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity	g.chr14:95030082T>C	L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.263T>C	14.37:g.95030082T>C	ENSP00000450838:p.Met88Thr					SERPINA4_uc010avd.2_Missense_Mutation_p.M125T|SERPINA4_uc001ydl.2_Missense_Mutation_p.M88T	p.M88T	NM_006215	NP_006206	P29622	KAIN_HUMAN		COAD - Colon adenocarcinoma(157;0.211)	2	329	+			88					Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	ENST00000557004.1	37	c.263T>C	CCDS9927.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.373588	0.61624	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.85861	-2.04;-2.04;-2.04	4.38	4.38	0.52667	Serpin domain (3);	0.078475	0.51477	D	0.000091	D	0.92038	0.7477	M	0.82630	2.6	0.80722	D	1	D;P	0.76494	0.999;0.901	D;P	0.76575	0.988;0.733	D	0.93121	0.6525	10	0.87932	D	0	.	13.0925	0.59174	0.0:0.0:0.0:1.0	.	88;88	B2R815;P29622	.;KAIN_HUMAN	T	88	ENSP00000450838:M88T;ENSP00000451172:M88T;ENSP00000298841:M88T	ENSP00000298841:M88T	M	+	2	0	SERPINA4	94099835	1.000000	0.71417	0.259000	0.24435	0.530000	0.34684	5.608000	0.67654	1.750000	0.51863	0.460000	0.39030	ATG		0.597	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215		11	55	0	0	0	0.013537	0	11	55				
BCL11B	64919	broad.mit.edu	37	14	99641785	99641785	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:99641785G>A	ENST00000357195.3	-	4	1397	c.1388C>T	c.(1387-1389)gCg>gTg	p.A463V	BCL11B_ENST00000443726.2_Missense_Mutation_p.A269V|BCL11B_ENST00000345514.2_Missense_Mutation_p.A392V	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	463					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CTGCGAGCACGCGTGGTCGCA	0.657			T	TLX3	T-ALL																																		uc001yga.2		NA		Dom	yes		14	14q32.1	64919	T	B-cell CLL/lymphoma 11B  (CTIP2)			L	TLX3		T-ALL		0				central_nervous_system(8)|large_intestine(1)|lung(1)	10						c.(1387-1389)GCG>GTG		B-cell CLL/lymphoma 11B isoform 1							26.0	26.0	26.0					14																	99641785		2202	4300	6502	SO:0001583	missense	64919					nucleus	zinc ion binding	g.chr14:99641785G>A	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1388C>T	14.37:g.99641785G>A	ENSP00000349723:p.Ala463Val					BCL11B_uc001ygb.2_Missense_Mutation_p.A392V	p.A463V	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN		COAD - Colon adenocarcinoma(157;0.103)	4	1655	-		Melanoma(154;0.0866)|all_epithelial(191;0.241)	463			C2H2-type 3.		Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	c.1388C>T	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267982	0.80469	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.01059	5.39;5.39;5.39	3.72	3.72	0.42706	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000004	T	0.04679	0.0127	L	0.48877	1.53	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.49725	-0.8909	10	0.87932	D	0	-15.0213	15.8637	0.79047	0.0:0.0:1.0:0.0	.	392;463	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	V	463;392;269	ENSP00000349723:A463V;ENSP00000280435:A392V;ENSP00000387419:A269V	ENSP00000280435:A392V	A	-	2	0	BCL11B	98711538	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.465000	0.97660	1.794000	0.52575	0.462000	0.41574	GCG		0.657	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576		3	34	0	0	0	0.004672	0	3	34				
HSP90AA1	3320	broad.mit.edu	37	14	102549392	102549392	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:102549392T>C	ENST00000216281.8	-	9	1939	c.1734A>G	c.(1732-1734)atA>atG	p.I578M	HSP90AA1_ENST00000441629.2_Missense_Mutation_p.I399M|HSP90AA1_ENST00000334701.7_Missense_Mutation_p.I700M	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	578					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)	p.I700M(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	TTTTCTCCAATatgtctttca	0.373																																							uc001yku.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7						c.(1732-1734)ATA>ATG		heat shock 90kDa protein 1, alpha isoform 2	Rifabutin(DB00615)						89.0	81.0	84.0					14																	102549392		2203	4300	6503	SO:0001583	missense	3320				axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding	g.chr14:102549392T>C	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.1734A>G	14.37:g.102549392T>C	ENSP00000216281:p.Ile578Met					HSP90AA1_uc001ykv.3_Missense_Mutation_p.I700M|HSP90AA1_uc001ykw.1_Missense_Mutation_p.I399M|HSP90AA1_uc001ykx.1_Missense_Mutation_p.I567M	p.I578M	NM_005348	NP_005339	P07900	HS90A_HUMAN			9	1924	-			578					A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	ENST00000216281.8	37	c.1734A>G	CCDS9967.1	.	.	.	.	.	.	.	.	.	.	t	16.66	3.184051	0.57800	.	.	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000441629	T;T;T	0.12465	2.68;2.68;2.68	4.44	-6.75	0.01738	.	0.000000	0.85682	U	0.000000	T	0.30166	0.0756	M	0.93375	3.41	0.58432	D	0.999998	P;D;P	0.54772	0.7;0.968;0.87	P;P;P	0.59056	0.851;0.816;0.773	T	0.40590	-0.9555	10	0.87932	D	0	-26.1868	5.1887	0.15197	0.4075:0.0:0.1847:0.4078	.	399;700;578	Q86U12;P07900-2;P07900	.;.;HS90A_HUMAN	M	578;700;399	ENSP00000216281:I578M;ENSP00000335153:I700M;ENSP00000396189:I399M	ENSP00000216281:I578M	I	-	3	3	HSP90AA1	101619145	0.920000	0.31207	0.316000	0.25252	0.821000	0.46438	0.009000	0.13219	-1.278000	0.02408	-0.213000	0.12676	ATA		0.373	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348		20	63	0	0	0	0.010504	0	20	63				
HSP90AA1	3320	broad.mit.edu	37	14	102551666	102551666	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:102551666G>A	ENST00000216281.8	-	4	837	c.632C>T	c.(631-633)tCt>tTt	p.S211F	HSP90AA1_ENST00000441629.2_Missense_Mutation_p.S32F|HSP90AA1_ENST00000334701.7_Missense_Mutation_p.S333F	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	211					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)	p.S333F(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	AATAAACTGAGAATGTTTCTT	0.378																																							uc001yku.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7						c.(631-633)TCT>TTT		heat shock 90kDa protein 1, alpha isoform 2	Rifabutin(DB00615)						88.0	73.0	78.0					14																	102551666		2203	4300	6503	SO:0001583	missense	3320				axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding	g.chr14:102551666G>A	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.632C>T	14.37:g.102551666G>A	ENSP00000216281:p.Ser211Phe					HSP90AA1_uc001ykv.3_Missense_Mutation_p.S333F|HSP90AA1_uc001ykw.1_Missense_Mutation_p.S32F|HSP90AA1_uc001ykx.1_Missense_Mutation_p.S200F	p.S211F	NM_005348	NP_005339	P07900	HS90A_HUMAN			4	822	-			211					A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	ENST00000216281.8	37	c.632C>T	CCDS9967.1	.	.	.	.	.	.	.	.	.	.	g	19.85	3.903900	0.72754	.	.	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000441629;ENST00000553585	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	4.29	4.29	0.51040	Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (2);	0.000000	0.64402	U	0.000001	T	0.65995	0.2745	H	0.99935	4.985	0.80722	D	1	D;D;D	0.89917	0.987;1.0;1.0	D;D;D	0.97110	0.99;1.0;1.0	D	0.85003	0.0901	10	0.87932	D	0	-16.6556	17.1172	0.86692	0.0:0.0:1.0:0.0	.	32;333;211	Q86U12;P07900-2;P07900	.;.;HS90A_HUMAN	F	211;333;32;142	ENSP00000216281:S211F;ENSP00000335153:S333F;ENSP00000396189:S32F;ENSP00000450712:S142F	ENSP00000216281:S211F	S	-	2	0	HSP90AA1	101621419	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	7.745000	0.85046	2.121000	0.65114	0.650000	0.86243	TCT		0.378	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348		9	47	0	0	0	0.006214	0	9	47				
NPAP1	23742	broad.mit.edu	37	15	24921196	24921196	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr15:24921196C>A	ENST00000329468.2	+	1	656	c.182C>A	c.(181-183)gCa>gAa	p.A61E		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	61					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A61E(1)									AGGCCTTCAGCAGCCAGCATC	0.736																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(181-183)GCA>GAA		hypothetical protein LOC23742							17.0	21.0	19.0					15																	24921196		2184	4268	6452	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24921196C>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.182C>A	15.37:g.24921196C>A	ENSP00000333735:p.Ala61Glu						p.A61E	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	656	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	61						Missense_Mutation	SNP	ENST00000329468.2	37	c.182C>A	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	9.931	1.214879	0.22373	.	.	ENSG00000185823	ENST00000329468	T	0.05925	3.37	2.45	0.322	0.15888	.	.	.	.	.	T	0.02688	0.0081	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.48681	-0.9014	9	0.15499	T	0.54	.	4.6089	0.12391	0.255:0.496:0.2491:0.0	.	61	Q9NZP6	CO002_HUMAN	E	61	ENSP00000333735:A61E	ENSP00000333735:A61E	A	+	2	0	C15orf2	22472289	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.245000	0.18142	0.101000	0.17610	-0.494000	0.04653	GCA		0.736	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		5	26	1	0	0.00448238	0.004482	0.00478627	5	26				
HERC2	8924	broad.mit.edu	37	15	28389295	28389295	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr15:28389295G>A	ENST00000261609.7	-	73	11335	c.11227C>T	c.(11227-11229)Ctt>Ttt	p.L3743F		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.L3743F(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTAGAGGCAAGGTTGAGTCGG	0.542																																							uc001zbj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(11227-11229)CTT>TTT		hect domain and RLD 2							126.0	110.0	115.0					15																	28389295		2203	4300	6503	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28389295G>A	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.11227C>T	15.37:g.28389295G>A	ENSP00000261609:p.Leu3743Phe						p.L3743F	NM_004667	NP_004658	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	73	11333	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	3743						Missense_Mutation	SNP	ENST00000261609.7	37	c.11227C>T	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408610	0.42715	.	.	ENSG00000128731	ENST00000261609	T	0.39056	1.1	5.66	3.42	0.39159	.	0.067480	0.64402	D	0.000017	T	0.18923	0.0454	N	0.14661	0.345	0.35953	D	0.834049	B	0.02656	0.0	B	0.01281	0.0	T	0.13150	-1.0520	10	0.09338	T	0.73	.	4.5262	0.11983	0.423:0.0:0.577:0.0	.	3743	O95714	HERC2_HUMAN	F	3743	ENSP00000261609:L3743F	ENSP00000261609:L3743F	L	-	1	0	HERC2	26062890	1.000000	0.71417	0.531000	0.27976	0.965000	0.64279	6.099000	0.71466	1.523000	0.49018	0.655000	0.94253	CTT		0.542	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		11	163	0	0	0	0.001855	0	11	163				
TNFAIP8L3	388121	broad.mit.edu	37	15	51350211	51350211	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr15:51350211A>T	ENST00000327536.5	-	3	845	c.746T>A	c.(745-747)aTc>aAc	p.I249N	RP11-108K3.1_ENST00000559909.1_lincRNA	NM_207381.2	NP_997264.2	Q5GJ75	TP8L3_HUMAN	tumor necrosis factor, alpha-induced protein 8-like 3	249								p.I249N(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	11				all cancers(107;0.000389)|GBM - Glioblastoma multiforme(94;0.00338)		GACGTGGTTGATGCGCCCGTG	0.552																																							uc001zyy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(745-747)ATC>AAC		tumor necrosis factor, alpha-induced protein							77.0	66.0	70.0					15																	51350211		2196	4293	6489	SO:0001583	missense	388121							g.chr15:51350211A>T	AK123281	CCDS32241.1	15q21.2	2005-08-09				ENSG00000183578			20620	protein-coding gene	gene with protein product							Standard	XM_005254367		Approved	FLJ41287	uc001zyy.3	Q5GJ75		ENST00000327536.5:c.746T>A	15.37:g.51350211A>T	ENSP00000328016:p.Ile249Asn						p.I249N	NM_207381	NP_997264	Q5GJ75	TP8L3_HUMAN		all cancers(107;0.000389)|GBM - Glioblastoma multiforme(94;0.00338)	3	846	-			249					Q6ZWD1	Missense_Mutation	SNP	ENST00000327536.5	37	c.746T>A	CCDS32241.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.459758	0.84317	.	.	ENSG00000183578	ENST00000327536	T	0.42513	0.97	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.67692	0.2920	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73235	-0.4047	10	0.87932	D	0	-18.91	15.0304	0.71701	1.0:0.0:0.0:0.0	.	249	Q5GJ75	TP8L3_HUMAN	N	249	ENSP00000328016:I249N	ENSP00000328016:I249N	I	-	2	0	TNFAIP8L3	49137503	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.244000	0.95423	2.143000	0.66587	0.445000	0.29226	ATC		0.552	TNFAIP8L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418661.1	NM_207381		12	51	0	0	0	0.013537	0	12	51				
UNC13C	440279	broad.mit.edu	37	15	54914593	54914593	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr15:54914593G>A	ENST00000260323.11	+	30	6175	c.6175G>A	c.(6175-6177)Gga>Aga	p.G2059R	UNC13C_ENST00000545554.1_Missense_Mutation_p.G2059R|UNC13C_ENST00000539562.2_5'UTR|UNC13C_ENST00000537900.1_Missense_Mutation_p.G2057R	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2059	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.G2059R(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CCCAGGAACGGGAGATCATAA	0.443																																							uc002ack.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|pancreas(2)	7						c.(6175-6177)GGA>AGA		unc-13 homolog C							104.0	103.0	103.0					15																	54914593		1932	4144	6076	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54914593G>A	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6175G>A	15.37:g.54914593G>A	ENSP00000260323:p.Gly2059Arg					UNC13C_uc002acm.2_5'UTR	p.G2059R	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	29	6175	+			2059			C2 2.		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.6175G>A	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095639	0.36952	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.76316	-1.01;-1.01;-1.01	4.96	4.03	0.46877	C2 calcium/lipid-binding domain, CaLB (1);	0.120774	0.56097	D	0.000032	D	0.89626	0.6769	M	0.88906	2.99	0.44523	D	0.997475	D	0.89917	1.0	D	0.83275	0.996	D	0.90993	0.4836	10	0.87932	D	0	.	15.8037	0.78477	0.0742:0.0:0.9258:0.0	.	2059	Q8NB66	UN13C_HUMAN	R	2059;2059;2057	ENSP00000260323:G2059R;ENSP00000438156:G2059R;ENSP00000442569:G2057R	ENSP00000260323:G2059R	G	+	1	0	UNC13C	52701885	1.000000	0.71417	0.190000	0.23270	0.032000	0.12392	6.646000	0.74348	0.609000	0.30018	-1.128000	0.01989	GGA		0.443	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		17	52	0	0	0	0.007413	0	17	52				
ADAMTS7	11173	broad.mit.edu	37	15	79063993	79063993	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr15:79063993G>A	ENST00000388820.4	-	15	2520	c.2310C>T	c.(2308-2310)taC>taT	p.Y770Y	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	770	Spacer.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Y770Y(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CCCTGCGTGCGTATGTGAAGG	0.657																																							uc002bej.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2308-2310)TAC>TAT		ADAM metallopeptidase with thrombospondin type 1							62.0	49.0	54.0					15																	79063993		2196	4291	6487	SO:0001819	synonymous_variant	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79063993G>A	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.2310C>T	15.37:g.79063993G>A						ADAMTS7_uc010und.1_Intron|ADAMTS7_uc002bek.1_Silent_p.Y770Y	p.Y770Y	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN			15	2521	-			770			Spacer.		Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	c.2310C>T	CCDS32303.1																																																																																				0.657	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		4	37	0	0	0	0.009096	0	4	37				
RASGRF1	5923	broad.mit.edu	37	15	79298770	79298770	+	Silent	SNP	G	G	A	rs141856364	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr15:79298770G>A	ENST00000419573.3	-	15	2146	c.1872C>T	c.(1870-1872)gaC>gaT	p.D624D	RASGRF1_ENST00000394745.3_5'Flank|RASGRF1_ENST00000558480.2_Silent_p.D611D|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	624					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D624D(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						ATAAGGAGGCGTCGGACCTGA	0.552																																							uc002beq.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(1)|central_nervous_system(1)	6						c.(1870-1872)GAC>GAT		Ras protein-specific guanine		G	,	1,4391	2.1+/-5.4	0,1,2195	71.0	63.0	66.0		1833,1872	-0.5	0.9	15	dbSNP_134	66	1,8585	1.2+/-3.3	0,1,4292	no	coding-synonymous,coding-synonymous	RASGRF1	NM_001145648.1,NM_002891.4	,	0,2,6487	AA,AG,GG		0.0116,0.0228,0.0154	,	611/1258,624/1274	79298770	2,12976	2196	4293	6489	SO:0001819	synonymous_variant	5923				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity	g.chr15:79298770G>A	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1872C>T	15.37:g.79298770G>A						RASGRF1_uc002bep.2_Silent_p.D611D|RASGRF1_uc010blm.1_Silent_p.D533D|RASGRF1_uc002ber.3_Silent_p.D611D|RASGRF1_uc010unh.1_Silent_p.D19D	p.D624D	NM_002891	NP_002882	Q13972	RGRF1_HUMAN			15	2247	-			624					F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	37	c.1872C>T	CCDS10309.1																																																																																				0.552	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891		5	74	0	0	0	0.001168	0	5	74				
GP2	2813	broad.mit.edu	37	16	20331623	20331623	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr16:20331623G>T	ENST00000381362.4	-	6	904	c.828C>A	c.(826-828)acC>acA	p.T276T	GP2_ENST00000381360.5_Silent_p.T129T|GP2_ENST00000341642.5_Silent_p.T126T|GP2_ENST00000302555.5_Silent_p.T273T|GP2_ENST00000573897.1_5'UTR	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	276	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)	p.T273T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						GGACGGGGCTGGTCACAGATA	0.567																																							uc002dgv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(826-828)ACC>ACA		zymogen granule membrane glycoprotein 2 isoform							121.0	104.0	110.0					16																	20331623		2203	4300	6503	SO:0001819	synonymous_variant	2813					anchored to membrane|extracellular region|plasma membrane		g.chr16:20331623G>T	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.828C>A	16.37:g.20331623G>T						GP2_uc002dgw.2_Silent_p.T273T|GP2_uc002dgx.2_Silent_p.T129T|GP2_uc002dgy.2_Silent_p.T126T	p.T276T	NM_001007240	NP_001007241	P55259	GP2_HUMAN			6	911	-			276			ZP.		A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	ENST00000381362.4	37	c.828C>A	CCDS42128.1																																																																																				0.567	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295		12	129	1	0	0.000308642	0.003163	0.000346535	12	129				
CLN3	1201	broad.mit.edu	37	16	28488846	28488846	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr16:28488846C>T	ENST00000569430.1	-	17	2127	c.1308G>A	c.(1306-1308)caG>caA	p.Q436Q	CLN3_ENST00000355477.5_Silent_p.Q388Q|CLN3_ENST00000567963.1_Silent_p.Q339Q|CLN3_ENST00000395653.4_Silent_p.Q336Q|CLN3_ENST00000360019.2_Silent_p.Q436Q|CLN3_ENST00000357857.9_Silent_p.Q382Q|CLN3_ENST00000354630.5_Silent_p.Q419Q|CLN3_ENST00000565316.1_Silent_p.Q419Q|CLN3_ENST00000357806.7_Silent_p.Q337Q|CLN3_ENST00000359984.7_Silent_p.Q436Q|CLN3_ENST00000333496.9_Silent_p.Q412Q|CLN3_ENST00000568224.1_Silent_p.Q358Q|CLN3_ENST00000535392.1_Silent_p.Q358Q			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	436					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)	p.Q436Q(1)		breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						ATCAGGAGAGCTGGCAGAGGA	0.612																																							uc002dpo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1306-1308)CAG>CAA		ceroid-lipofuscinosis, neuronal 3							53.0	59.0	57.0					16																	28488846		2197	4300	6497	SO:0001819	synonymous_variant	1201				amyloid precursor protein catabolic process|arginine transport|associative learning|autophagic vacuole fusion|cell death|cellular amino acid metabolic process|cytosolic calcium ion homeostasis|galactosylceramide metabolic process|globoside metabolic process|glucosylceramide metabolic process|ionotropic glutamate receptor signaling pathway|lysosomal lumen acidification|lysosomal lumen pH elevation|negative regulation of catalytic activity|negative regulation of macroautophagy|negative regulation of neuron apoptosis|negative regulation of proteolysis|neuromuscular process controlling balance|neurotransmitter metabolic process|protein catabolic process|protein folding|protein processing|receptor-mediated endocytosis|regulation of action potential|sphingomyelin metabolic process|vacuolar transport	autophagic vacuole|caveola|cytosol|early endosome|Golgi membrane|Golgi stack|integral to endoplasmic reticulum membrane|late endosome|lysosomal membrane|membrane fraction|mitochondrion|neuron projection|nucleus|synaptic vesicle|trans-Golgi network	unfolded protein binding	g.chr16:28488846C>T	U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.1308G>A	16.37:g.28488846C>T						uc010vct.1_Intron|CLN3_uc002dpl.2_Silent_p.Q358Q|CLN3_uc010vcu.1_Silent_p.Q336Q|CLN3_uc002dpn.2_Silent_p.Q337Q|CLN3_uc002dpm.2_Silent_p.Q382Q|CLN3_uc010vcv.1_Silent_p.Q412Q|CLN3_uc010byd.2_Silent_p.Q339Q|CLN3_uc002dpp.2_Silent_p.Q436Q|CLN3_uc002dpt.1_Silent_p.Q336Q|CLN3_uc002dpq.1_Silent_p.Q388Q|CLN3_uc010bye.1_Silent_p.Q419Q|CLN3_uc002dpr.1_RNA|CLN3_uc010byf.1_RNA|CLN3_uc002dps.1_Silent_p.Q309Q|CLN3_uc002dpu.1_Silent_p.Q334Q	p.Q436Q	NM_000086	NP_000077	Q13286	CLN3_HUMAN			15	1631	-			436					B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Silent	SNP	ENST00000569430.1	37	c.1308G>A	CCDS10632.1																																																																																				0.612	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214115.2			16	73	0	0	0	0.004007	0	16	73				
ITGAX	3687	broad.mit.edu	37	16	31384696	31384696	+	Silent	SNP	C	C	T	rs146985733		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr16:31384696C>T	ENST00000268296.4	+	20	2614	c.2493C>T	c.(2491-2493)taC>taT	p.Y831Y	ITGAX_ENST00000562522.1_Silent_p.Y831Y	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	831					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.Y831Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCTACCGCTACGTGGCAGAGG	0.627													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16568	0.0		0.0	False		,,,				2504	0.0						uc002ebu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(2491-2493)TAC>TAT		integrin alpha X precursor		C		0,4394		0,0,2197	94.0	63.0	74.0		2493	-10.3	0.0	16	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ITGAX	NM_000887.3		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		831/1164	31384696	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	3687				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity	g.chr16:31384696C>T	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2493C>T	16.37:g.31384696C>T						ITGAX_uc002ebt.2_Silent_p.Y831Y	p.Y831Y	NM_000887	NP_000878	P20702	ITAX_HUMAN			20	2560	+			831			Extracellular (Potential).		Q8IVA6	Silent	SNP	ENST00000268296.4	37	c.2493C>T	CCDS10711.1																																																																																				0.627	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887		19	82	0	0	0	0.00278	0	19	82				
NETO2	81831	broad.mit.edu	37	16	47162416	47162416	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr16:47162416G>A	ENST00000562435.1	-	4	685	c.301C>T	c.(301-303)Cgg>Tgg	p.R101W	NETO2_ENST00000303155.5_Missense_Mutation_p.R101W	NM_018092.4	NP_060562.3	Q8NC67	NETO2_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 2	101	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				regulation of kainate selective glutamate receptor activity (GO:2000312)	kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)		p.R101W(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	29		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				TGATCAAACCGACACTCAAAT	0.398										HNSCC(25;0.065)																													uc002eer.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(301-303)CGG>TGG		neuropilin- and tolloid-like protein 2							169.0	173.0	172.0					16																	47162416		2202	4300	6502	SO:0001583	missense	81831					integral to membrane	receptor activity	g.chr16:47162416G>A	AK001292	CCDS10727.1, CCDS58460.1	16q11.2	2008-08-04			ENSG00000171208	ENSG00000171208			14644	protein-coding gene	gene with protein product		607974				11943477	Standard	NM_018092		Approved	FLJ10430, NEOT2	uc002eer.2	Q8NC67	OTTHUMG00000133101	ENST00000562435.1:c.301C>T	16.37:g.47162416G>A	ENSP00000455169:p.Arg101Trp	HNSCC(25;0.065)				NETO2_uc010vgf.1_5'UTR|NETO2_uc002ees.1_Missense_Mutation_p.R101W	p.R101W	NM_018092	NP_060562	Q8NC67	NETO2_HUMAN			4	686	-		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)	101			Extracellular (Potential).|CUB 1.		J3KNF1|Q7Z381|Q8ND51|Q96SP4|Q9NVY8	Missense_Mutation	SNP	ENST00000562435.1	37	c.301C>T	CCDS10727.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314235	0.81358	.	.	ENSG00000171208	ENST00000303155	T	0.29397	1.57	5.72	5.72	0.89469	CUB (5);	0.055638	0.64402	D	0.000001	T	0.54271	0.1848	L	0.58302	1.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.42481	-0.9449	10	0.37606	T	0.19	.	19.88	0.96892	0.0:0.0:1.0:0.0	.	101;101	Q32NC3;Q8NC67	.;NETO2_HUMAN	W	101	ENSP00000306726:R101W	ENSP00000306726:R101W	R	-	1	2	NETO2	45719917	1.000000	0.71417	0.996000	0.52242	0.433000	0.31745	7.863000	0.87023	2.703000	0.92315	0.655000	0.94253	CGG		0.398	NETO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256766.2	NM_018092		18	214	0	0	0	0.00499	0	18	214				
CDH8	1006	broad.mit.edu	37	16	61851398	61851398	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr16:61851398G>A	ENST00000577390.1	-	7	2216	c.1262C>T	c.(1261-1263)aCt>aTt	p.T421I	CDH8_ENST00000299345.6_Missense_Mutation_p.T421I|CDH8_ENST00000584337.1_Missense_Mutation_p.T421I|CDH8_ENST00000577730.1_Missense_Mutation_p.T421I	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	421	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.T421I(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AGGACTGGAAGTGATATCAGG	0.433																																							uc002eog.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(2)|breast(1)	9						c.(1261-1263)ACT>ATT		cadherin 8, type 2 preproprotein							69.0	66.0	67.0					16																	61851398		2203	4300	6503	SO:0001583	missense	1006				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:61851398G>A	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1262C>T	16.37:g.61851398G>A	ENSP00000462701:p.Thr421Ile					CDH8_uc002eoh.2_Missense_Mutation_p.T190I	p.T421I	NM_001796	NP_001787	P55286	CADH8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)	7	1514	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	421			Extracellular (Potential).|Cadherin 4.		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	c.1262C>T	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317730	0.40996	.	.	ENSG00000150394	ENST00000299345	T	0.61158	0.13	6.08	6.08	0.98989	Cadherin (4);Cadherin-like (1);	0.190689	0.56097	D	0.000028	T	0.60327	0.2260	L	0.41573	1.285	0.49483	D	0.999793	B;B	0.27765	0.188;0.001	B;B	0.39971	0.315;0.009	T	0.51537	-0.8693	10	0.27785	T	0.31	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	237;421	Q3LID3;P55286	.;CADH8_HUMAN	I	421	ENSP00000299345:T421I	ENSP00000299345:T421I	T	-	2	0	CDH8	60408899	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	5.327000	0.65881	2.894000	0.99253	0.655000	0.94253	ACT		0.433	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		7	43	0	0	0	0.00308	0	7	43				
PMFBP1	83449	broad.mit.edu	37	16	72188209	72188209	+	Missense_Mutation	SNP	C	C	A	rs199738157		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr16:72188209C>A	ENST00000237353.10	-	4	576	c.315G>T	c.(313-315)caG>caT	p.Q105H	PMFBP1_ENST00000355636.6_5'UTR|PMFBP1_ENST00000543746.1_5'UTR|PMFBP1_ENST00000537465.1_Missense_Mutation_p.Q105H	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	105						cytoplasm (GO:0005737)		p.Q105H(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				AGTAAGAAGTCTGCAACTCCT	0.458																																							uc002fcc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(313-315)CAG>CAT		polyamine modulated factor 1 binding protein 1							205.0	185.0	192.0					16																	72188209		2198	4300	6498	SO:0001583	missense	83449							g.chr16:72188209C>A	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.315G>T	16.37:g.72188209C>A	ENSP00000237353:p.Gln105His					PMFBP1_uc002fcd.2_Missense_Mutation_p.Q105H|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_5'UTR	p.Q105H	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN			4	487	-		Ovarian(137;0.179)	105			Potential.		B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	c.315G>T	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.931390	0.52866	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000535461;ENST00000539172	T;T	0.78364	-1.17;-1.17	5.63	2.6	0.31112	.	0.000000	0.44902	D	0.000404	T	0.77294	0.4109	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.76399	-0.2973	10	0.66056	D	0.02	-25.0242	8.0818	0.30750	0.0:0.7411:0.0:0.2589	.	105;105	Q8TBY8-2;G3V1Q7	.;.	H	105	ENSP00000443817:Q105H;ENSP00000237353:Q105H	ENSP00000237353:Q105H	Q	-	3	2	PMFBP1	70745710	0.968000	0.33430	0.986000	0.45419	0.889000	0.51656	0.289000	0.18957	0.747000	0.32809	-0.140000	0.14226	CAG		0.458	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293		40	182	1	0	4.32679e-17	0.006999	7.13166e-17	40	182				
JPH3	57338	broad.mit.edu	37	16	87678552	87678552	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr16:87678552C>G	ENST00000284262.2	+	2	1313	c.1071C>G	c.(1069-1071)agC>agG	p.S357R		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	357					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)	p.S357R(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		TGCGGGCCAGCAAGATCCGCG	0.662																																							uc002fkd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1069-1071)AGC>AGG		junctophilin 3							32.0	38.0	36.0					16																	87678552		2198	4300	6498	SO:0001583	missense	57338				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding	g.chr16:87678552C>G	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.1071C>G	16.37:g.87678552C>G	ENSP00000284262:p.Ser357Arg					JPH3_uc010vou.1_RNA	p.S357R	NM_020655	NP_065706	Q8WXH2	JPH3_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0287)	2	1325	+			357			Cytoplasmic (Potential).		D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Missense_Mutation	SNP	ENST00000284262.2	37	c.1071C>G	CCDS10962.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841902	0.71488	.	.	ENSG00000154118	ENST00000537256;ENST00000284262	T	0.48836	0.8	4.56	4.56	0.56223	.	0.039429	0.85682	D	0.000000	T	0.52025	0.1709	L	0.58810	1.83	0.80722	D	1	B	0.33904	0.431	B	0.41466	0.358	T	0.53450	-0.8437	10	0.38643	T	0.18	.	16.3368	0.83067	0.0:1.0:0.0:0.0	.	357	Q8WXH2	JPH3_HUMAN	R	220;357	ENSP00000284262:S357R	ENSP00000284262:S357R	S	+	3	2	JPH3	86236053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.994000	0.29693	2.098000	0.63641	0.561000	0.74099	AGC		0.662	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2			3	58	0	0	0	0.004672	0	3	58				
SCARF1	8578	broad.mit.edu	37	17	1551212	1551212	+	5'Flank	SNP	G	G	A	rs538993568	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:1551212G>A	ENST00000263071.4	-	0	0				SCARF1_ENST00000348987.3_5'Flank|RILP_ENST00000301336.6_Silent_p.L287L|SCARF1_ENST00000571272.1_5'Flank	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1						cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.L287L(1)		cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TCATGGCCTCGAGCAGAAGGC	0.607													G|||	2	0.000399361	0.0	0.0	5008	,	,		20222	0.0		0.0	False		,,,				2504	0.002						uc002ftd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(859-861)CTC>CTT		Rab interacting lysosomal protein							104.0	79.0	88.0					17																	1551212		2203	4300	6503	SO:0001631	upstream_gene_variant	83547				endosome to lysosome transport|protein transport	late endosome membrane|lysosomal membrane|phagocytic vesicle membrane	Rab GTPase binding	g.chr17:1551212G>A	D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555		17.37:g.1551212G>A	Exception_encountered					SCARF1_uc002fsy.1_5'Flank|SCARF1_uc002fsz.1_5'Flank|SCARF1_uc002fta.1_5'Flank|SCARF1_uc010cjv.1_5'Flank	p.L287L	NM_031430	NP_113618	Q96NA2	RILP_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	6	1155	-			287			Necessary for the interaction with RAB7 and RAB34, lysosomal distribution and morphology.		A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Silent	SNP	ENST00000263071.4	37	c.861C>T	CCDS11007.1																																																																																				0.607	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693		5	88	0	0	0	0.00308	0	5	88				
WSCD1	23302	broad.mit.edu	37	17	5993675	5993675	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:5993675G>C	ENST00000574946.1	+	4	967	c.577G>C	c.(577-579)Gag>Cag	p.E193Q	WSCD1_ENST00000573634.1_Missense_Mutation_p.E77Q|WSCD1_ENST00000317744.5_Missense_Mutation_p.E193Q|WSCD1_ENST00000574232.1_Missense_Mutation_p.E193Q|WSCD1_ENST00000539421.1_Missense_Mutation_p.E193Q			Q658N2	WSCD1_HUMAN	WSC domain containing 1	193	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.E193Q(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						GGCCGGGGCGGAGTGTTACTG	0.647																																							uc010cli.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(577-579)GAG>CAG		WSC domain containing 1							50.0	50.0	50.0					17																	5993675		2203	4299	6502	SO:0001583	missense	23302					integral to membrane	sulfotransferase activity	g.chr17:5993675G>C		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.577G>C	17.37:g.5993675G>C	ENSP00000460825:p.Glu193Gln					WSCD1_uc002gcn.2_Missense_Mutation_p.E193Q|WSCD1_uc002gco.2_Missense_Mutation_p.E193Q|WSCD1_uc010clj.2_5'UTR	p.E193Q	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN			4	956	+			193			WSC 1.		A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	ENST00000574946.1	37	c.577G>C	CCDS32538.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.799771	0.70567	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.56275	0.47;0.47	6.04	6.04	0.98038	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.103520	0.64402	D	0.000005	T	0.73361	0.3577	M	0.76938	2.355	0.53688	D	0.999978	D	0.76494	0.999	D	0.71184	0.972	T	0.71606	-0.4542	10	0.42905	T	0.14	-30.1448	18.0887	0.89466	0.0:0.0:1.0:0.0	.	193	Q658N2	WSCD1_HUMAN	Q	193	ENSP00000323087:E193Q;ENSP00000446032:E193Q	ENSP00000323087:E193Q	E	+	1	0	WSCD1	5934399	1.000000	0.71417	0.963000	0.40424	0.029000	0.11900	8.914000	0.92735	2.873000	0.98535	0.563000	0.77884	GAG		0.647	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253		4	47	0	0	0	0.008291	0	4	47				
DHRS7C	201140	broad.mit.edu	37	17	9674829	9674829	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:9674829C>A	ENST00000330255.5	-	6	927	c.915G>T	c.(913-915)aaG>aaT	p.K305N	DHRS7C_ENST00000571134.1_Missense_Mutation_p.K304N	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	305					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)	p.K305N(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						GGACATTGAGCTTCTCCTTCA	0.582																																							uc010vvb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(913-915)AAG>AAT		dehydrogenase/reductase (SDR family) member 7C							43.0	48.0	46.0					17																	9674829		2010	4163	6173	SO:0001583	missense	201140					extracellular region	binding|oxidoreductase activity	g.chr17:9674829C>A		CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.915G>T	17.37:g.9674829C>A	ENSP00000327975:p.Lys305Asn					DHRS7C_uc010cof.2_Missense_Mutation_p.K304N	p.K305N	NM_001105571	NP_001099041	A6NNS2	DRS7C_HUMAN			6	915	-			305					B7ZW74|B9EJH3	Missense_Mutation	SNP	ENST00000330255.5	37	c.915G>T	CCDS56020.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615404	0.28801	.	.	ENSG00000184544	ENST00000330255	D	0.87491	-2.26	5.5	1.04	0.20106	.	0.461316	0.26092	N	0.026398	T	0.78559	0.4302	L	0.44542	1.39	0.31373	N	0.679947	B;B	0.28128	0.201;0.201	B;B	0.19148	0.024;0.024	T	0.73288	-0.4030	10	0.44086	T	0.13	.	8.4457	0.32841	0.0:0.5918:0.0:0.4082	.	305;301	A6NNS2;B9EJH3	DRS7C_HUMAN;.	N	305	ENSP00000327975:K305N	ENSP00000327975:K305N	K	-	3	2	DHRS7C	9615554	0.982000	0.34865	0.997000	0.53966	0.876000	0.50452	0.334000	0.19787	0.366000	0.24427	0.655000	0.94253	AAG		0.582	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439863.1	XM_113912		6	24	1	0	0.00116845	0.001168	0.00126917	6	24				
DNAH9	1770	broad.mit.edu	37	17	11554419	11554419	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:11554419G>T	ENST00000262442.4	+	13	2199	c.2131G>T	c.(2131-2133)Gaa>Taa	p.E711*	DNAH9_ENST00000454412.2_Nonsense_Mutation_p.E711*	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	711	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.E711*(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAGCTATCTTGAACCCAGAGA	0.438																																							uc002gne.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(2131-2133)GAA>TAA		dynein, axonemal, heavy chain 9 isoform 2							124.0	123.0	123.0					17																	11554419		2203	4300	6503	SO:0001587	stop_gained	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11554419G>T	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.2131G>T	17.37:g.11554419G>T	ENSP00000262442:p.Glu711*					DNAH9_uc010coo.2_Nonsense_Mutation_p.E5*	p.E711*	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	13	2199	+		Breast(5;0.0122)|all_epithelial(5;0.131)	711			Stem (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Nonsense_Mutation	SNP	ENST00000262442.4	37	c.2131G>T	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	35	5.590149	0.96590	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	.	.	.	5.53	-0.377	0.12501	.	2.088770	0.01638	N	0.023901	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	11.9647	0.53027	0.0615:0.5924:0.2612:0.0849	.	.	.	.	X	711	.	ENSP00000262442:E711X	E	+	1	0	DNAH9	11495144	0.000000	0.05858	0.020000	0.16555	0.470000	0.32858	-0.258000	0.08733	0.048000	0.15891	0.655000	0.94253	GAA		0.438	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		45	163	1	0	8.00217e-19	0.01441	1.34238e-18	45	163				
MYOCD	93649	broad.mit.edu	37	17	12666878	12666878	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:12666878C>A	ENST00000343344.4	+	13	2734	c.2734C>A	c.(2734-2736)Ccc>Acc	p.P912T	MYOCD_ENST00000425538.1_Missense_Mutation_p.P960T|RP11-1090M7.1_ENST00000584772.1_RNA			Q8IZQ8	MYCD_HUMAN	myocardin	912					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.P960T(1)|p.P912T(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CACCAGCAGCCCCAGCATCTT	0.517																																							uc002gnn.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|skin(2)|ovary(1)	5						c.(2734-2736)CCC>ACC		myocardin isoform 2							58.0	54.0	55.0					17																	12666878		2203	4300	6503	SO:0001583	missense	93649				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding	g.chr17:12666878C>A	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2734C>A	17.37:g.12666878C>A	ENSP00000341835:p.Pro912Thr					MYOCD_uc002gno.2_Missense_Mutation_p.P960T|MYOCD_uc002gnq.2_Missense_Mutation_p.P636T	p.P912T	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)	13	3033	+			912					Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	c.2734C>A	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621796	0.46840	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000443061	T;T	0.60299	0.2;0.25	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.77751	0.4177	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.993;0.997;0.971	T	0.77983	-0.2382	10	0.72032	D	0.01	-34.1786	19.4349	0.94788	0.0:1.0:0.0:0.0	.	636;960;912	E9PEP9;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	T	636;960;912;622	ENSP00000341835:P912T;ENSP00000400148:P622T	ENSP00000341835:P912T	P	+	1	0	MYOCD	12607603	1.000000	0.71417	0.989000	0.46669	0.215000	0.24574	5.696000	0.68287	2.894000	0.99253	0.655000	0.94253	CCC		0.517	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		11	60	1	0	1.58986e-06	0.008291	1.95543e-06	11	60				
CDRT1	374286	broad.mit.edu	37	17	15499942	15499942	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:15499942C>T	ENST00000395906.3	-	9	1589	c.1590G>A	c.(1588-1590)acG>acA	p.T530T	CDRT1_ENST00000354433.3_Silent_p.T30T|RP11-385D13.1_ENST00000455584.2_Silent_p.T840T|CDRT1_ENST00000583965.1_Silent_p.T30T	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	530								p.T30T(2)|p.T530T(2)		endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		TGTGTCTAAACGTCTTCAGGC	0.507																																							uc002gor.1		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(2)|skin(1)	3						c.(2518-2520)ACG>ACA		SubName: Full=Putative uncharacterized protein; Flags: Fragment;							49.0	51.0	50.0					17																	15499942		2203	4300	6503	SO:0001819	synonymous_variant	10626				histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding	g.chr17:15499942C>T	U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.1590G>A	17.37:g.15499942C>T						CDRT1_uc010vvy.1_5'UTR|CDRT1_uc010vvz.1_Silent_p.T30T|CDRT1_uc002gov.3_Silent_p.T530T|CDRT1_uc002gou.2_Silent_p.T138T|CDRT1_uc010cos.1_Silent_p.T30T	p.T840T			O95361	TRI16_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)	15	2857	-			Error:Variant_position_missing_in_O95361_after_alignment					O43848|O95611	Silent	SNP	ENST00000395906.3	37	c.2520G>A	CCDS45619.1	.	.	.	.	.	.	.	.	.	.	C	8.722	0.914662	0.17907	.	.	ENSG00000251537	ENST00000455584	.	.	.	4.78	-9.56	0.00566	.	.	.	.	.	T	0.41026	0.1141	.	.	.	0.53005	D	0.999969	.	.	.	.	.	.	T	0.48410	-0.9038	4	.	.	.	.	4.1855	0.10395	0.1878:0.2714:0.4206:0.1203	.	.	.	.	H	855	.	.	R	-	2	0	RP11-385D13.1	15440667	0.000000	0.05858	0.451000	0.26982	0.993000	0.82548	-4.472000	0.00228	-3.024000	0.00268	-0.162000	0.13425	CGT		0.507	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448127.1	NM_006382		5	47	0	0	0	0.001168	0	5	47				
LRRC75A	388341	broad.mit.edu	37	17	16347377	16347377	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:16347377G>A	ENST00000470794.1	-	4	587	c.560C>T	c.(559-561)tCc>tTc	p.S187F	C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000487066.1_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|FAM211A_ENST00000409083.3_Silent_p.L148L|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA	NM_001113567.2	NP_001107039.1												p.S187F(2)|p.L101L(1)		lung(1)	1						CAGGTCTCGGGAGGTCAGTGG	0.622																																							uc010cph.1		NA																	3	Substitution - Missense(2)|Substitution - coding silent(1)		lung(3)		0						c.(559-561)TCC>TTC		hypothetical protein LOC388341 isoform 1							29.0	26.0	27.0					17																	16347377		2203	4300	6503	SO:0001583	missense	388341							g.chr17:16347377G>A																												ENST00000470794.1:c.560C>T	17.37:g.16347377G>A	ENSP00000419502:p.Ser187Phe					C17orf76_uc002gqh.2_Silent_p.L148L|NCRNA00188_uc010vwl.1_Intron|NCRNA00188_uc010vwm.1_Intron|NCRNA00188_uc010vwn.1_Intron|NCRNA00188_uc010cpe.2_Intron|NCRNA00188_uc010vwo.1_Intron|NCRNA00188_uc010vwp.1_Intron|C17orf76_uc002gqg.1_3'UTR	p.S187F	NM_001113567	NP_001107039	Q8NAA5	CQ076_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)	4	736	-			187						Missense_Mutation	SNP	ENST00000470794.1	37	c.560C>T	CCDS45620.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.619324	0.46736	.	.	ENSG00000181350	ENST00000470794	T	0.54866	0.55	5.34	4.3	0.51218	.	.	.	.	.	T	0.27798	0.0684	.	.	.	0.09310	N	1	P	0.43352	0.804	B	0.36608	0.229	T	0.04427	-1.0952	8	0.10111	T	0.7	.	7.0467	0.25050	0.091:0.1758:0.7332:0.0	.	187	Q8NAA5	CQ076_HUMAN	F	187	ENSP00000419502:S187F	ENSP00000419502:S187F	S	-	2	0	C17orf76	16288102	0.003000	0.15002	0.890000	0.34922	0.993000	0.82548	1.377000	0.34317	2.680000	0.91292	0.561000	0.74099	TCC		0.622	FAM211A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130463.3			4	24	0	0	0	0.009096	0	4	24				
FLII	2314	broad.mit.edu	37	17	18150366	18150366	+	Splice_Site	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:18150366C>G	ENST00000327031.4	-	22	2902	c.2677G>C	c.(2677-2679)Gcg>Ccg	p.A893P	FLII_ENST00000578558.1_Intron|FLII_ENST00000579294.1_Splice_Site_p.A882P|FLII_ENST00000379450.4_Splice_Site_p.A807P|FLII_ENST00000545457.2_Splice_Site_p.A838P	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	893	Glu-rich.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.A893P(1)		central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					AGCTGCTCCGCCTGCAGGTGA	0.706																																							uc002gsr.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(2677-2679)GCG>CCG		flightless I homolog							48.0	49.0	49.0					17																	18150366		2203	4300	6503	SO:0001630	splice_region_variant	2314				multicellular organismal development|muscle contraction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	actin binding	g.chr17:18150366C>G	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.2677-1G>C	17.37:g.18150366C>G						FLII_uc002gsq.1_Missense_Mutation_p.A764P|FLII_uc010cpy.1_Missense_Mutation_p.A882P|FLII_uc010vxn.1_Missense_Mutation_p.A862P|FLII_uc010vxo.1_Missense_Mutation_p.A838P|FLII_uc002gss.1_Missense_Mutation_p.A892P	p.A893P	NM_002018	NP_002009	Q13045	FLII_HUMAN			22	2728	-	all_neural(463;0.228)		893			Glu-rich.		B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	ENST00000327031.4	37	c.2677G>C	CCDS11192.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863539	0.51482	.	.	ENSG00000177731	ENST00000327031;ENST00000545457;ENST00000379450	T;T	0.40476	1.03;1.12	4.83	3.85	0.44370	.	0.053602	0.64402	D	0.000001	T	0.67392	0.2888	M	0.85197	2.74	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.846;1.0;0.999	D;D;P;D;D	0.85130	0.997;0.997;0.598;0.987;0.996	T	0.73839	-0.3856	10	0.72032	D	0.01	-17.5678	14.4413	0.67321	0.1486:0.8514:0.0:0.0	.	807;807;772;893;862	E7EPM0;B4DIL0;F5H407;Q13045;B4DIX0	.;.;.;FLII_HUMAN;.	P	893;772;807	ENSP00000324573:A893P;ENSP00000368763:A807P	ENSP00000324573:A893P	A	-	1	0	FLII	18091091	1.000000	0.71417	0.771000	0.31576	0.002000	0.02628	7.148000	0.77389	1.026000	0.39733	-0.169000	0.13324	GCG		0.706	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018	Missense_Mutation	8	55	0	0	0	0.001855	0	8	55				
NF1	4763	broad.mit.edu	37	17	29653005	29653005	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:29653005G>T	ENST00000358273.4	+	37	5386	c.5003G>T	c.(5002-5004)gGc>gTc	p.G1668V	NF1_ENST00000356175.3_Missense_Mutation_p.G1647V|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1668	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.G1668V(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTTTTTCCTGGCTTTGCTTAC	0.453			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		13	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(2)		soft_tissue(7)|lung(3)|autonomic_ganglia(2)|central_nervous_system(1)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(5002-5004)GGC>GTC		neurofibromin isoform 1							147.0	134.0	138.0					17																	29653005		2203	4300	6503	SO:0001583	missense	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29653005G>T		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5003G>T	17.37:g.29653005G>T	ENSP00000351015:p.Gly1668Val	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_uc002hgh.2_Missense_Mutation_p.G1647V|NF1_uc002hgi.1_Missense_Mutation_p.G680V|NF1_uc010cso.2_5'UTR	p.G1668V	NM_001042492	NP_001035957	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	37	5336	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	1668			CRAL-TRIO.		O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	c.5003G>T	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087119	0.76642	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.62941	-0.01;-0.01;-0.01	5.83	4.86	0.63082	Cellular retinaldehyde-binding/triple function, C-terminal (2);Armadillo-type fold (1);	0.053408	0.85682	D	0.000000	T	0.52677	0.1749	N	0.22421	0.69	0.80722	D	1	B;P;B	0.49696	0.429;0.927;0.199	B;P;B	0.46049	0.076;0.502;0.108	T	0.52711	-0.8539	10	0.35671	T	0.21	.	13.9349	0.64020	0.0726:0.0:0.9274:0.0	.	697;1647;1668	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	V	1668;1647;1313	ENSP00000351015:G1668V;ENSP00000348498:G1647V;ENSP00000389907:G1313V	ENSP00000348498:G1647V	G	+	2	0	NF1	26677131	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.571000	0.82399	1.478000	0.48253	0.650000	0.86243	GGC		0.453	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		48	146	1	0	6.27289e-28	0.01441	1.11148e-27	48	146				
UTP6	55813	broad.mit.edu	37	17	30207635	30207635	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:30207635C>A	ENST00000261708.4	-	11	1061	c.924G>T	c.(922-924)agG>agT	p.R308S	CTC-542B22.2_ENST00000583236.1_lincRNA	NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	308					rRNA processing (GO:0006364)	nucleolus (GO:0005730)		p.R308S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				CAGCACAGCACCTCTCCTCCT	0.478																																							uc002hgr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(922-924)AGG>AGT		hepatocellular carcinoma-associated antigen 66							215.0	186.0	196.0					17																	30207635		2203	4300	6503	SO:0001583	missense	55813				rRNA processing	nucleolus	binding	g.chr17:30207635C>A	AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.924G>T	17.37:g.30207635C>A	ENSP00000261708:p.Arg308Ser					UTP6_uc002hgq.2_Missense_Mutation_p.R124S|UTP6_uc010cst.2_Missense_Mutation_p.R157S|UTP6_uc010wbw.1_Missense_Mutation_p.R308S	p.R308S	NM_018428	NP_060898	Q9NYH9	UTP6_HUMAN			11	1007	-		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)	308			HAT 3.		Q8IX96|Q96BL2|Q9NQ91	Missense_Mutation	SNP	ENST00000261708.4	37	c.924G>T	CCDS11269.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.729718	0.30684	.	.	ENSG00000108651	ENST00000261708	T	0.32988	1.43	5.16	-0.886	0.10590	.	0.000000	0.85682	D	0.000000	T	0.26991	0.0661	M	0.71581	2.175	0.54753	D	0.999981	P;P;P	0.50617	0.839;0.937;0.937	B;B;B	0.43680	0.164;0.427;0.427	T	0.06058	-1.0848	10	0.40728	T	0.16	-20.7988	3.5142	0.07719	0.0941:0.4689:0.1853:0.2517	.	308;308;308	B4DSL9;B3KQ21;Q9NYH9	.;.;UTP6_HUMAN	S	308	ENSP00000261708:R308S	ENSP00000261708:R308S	R	-	3	2	UTP6	27231748	0.996000	0.38824	0.993000	0.49108	0.133000	0.20885	0.269000	0.18589	-0.190000	0.10465	-2.010000	0.00438	AGG		0.478	UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256265.2	NM_018428		53	231	1	0	1.33661e-31	0.01441	2.42903e-31	53	231				
GAS2L2	246176	broad.mit.edu	37	17	34072787	34072787	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:34072787C>A	ENST00000254466.6	-	6	1756	c.1729G>T	c.(1729-1731)Gac>Tac	p.D577Y	GAS2L2_ENST00000587565.1_Missense_Mutation_p.D561Y	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	577					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)	p.D577Y(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGGCCCAGGTCCCAGGACTCT	0.617																																							uc002hjv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1729-1731)GAC>TAC		growth arrest-specific 2 like 2							58.0	59.0	59.0					17																	34072787		2203	4300	6503	SO:0001583	missense	246176				cell cycle arrest	cytoplasm|cytoskeleton		g.chr17:34072787C>A	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1729G>T	17.37:g.34072787C>A	ENSP00000254466:p.Asp577Tyr						p.D577Y	NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	6	1757	-		Ovarian(249;0.17)	577					Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	c.1729G>T	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627494	0.28978	.	.	ENSG00000132139	ENST00000254466	T	0.18810	2.19	4.66	-0.00704	0.14011	.	1.495060	0.04121	N	0.316283	T	0.09992	0.0245	N	0.08118	0	0.09310	N	1	B	0.33135	0.399	B	0.29353	0.101	T	0.22417	-1.0217	10	0.66056	D	0.02	-6.6383	2.4957	0.04621	0.1424:0.5065:0.1573:0.1938	.	577	Q8NHY3	GA2L2_HUMAN	Y	577	ENSP00000254466:D577Y	ENSP00000254466:D577Y	D	-	1	0	GAS2L2	31096900	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-0.030000	0.12308	0.192000	0.20272	-0.718000	0.03613	GAC		0.617	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285		29	87	1	0	5.61819e-17	0.005443	9.20668e-17	29	87				
KRTAP4-11	653240	broad.mit.edu	37	17	39274415	39274415	+	Silent	SNP	C	C	T	rs425487		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:39274415C>T	ENST00000391413.2	-	1	191	c.153G>A	c.(151-153)agG>agA	p.R51R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)		p.R51R(6)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCACTGGGGCCTGCAGCAGC	0.667																																							uc002hvz.2		NA																	6	Substitution - coding silent(6)		endometrium(3)|kidney(2)|lung(1)		0						c.(151-153)AGG>AGA		keratin associated protein 4-11							9.0	15.0	13.0					17																	39274415		682	1579	2261	SO:0001819	synonymous_variant	653240					keratin filament		g.chr17:39274415C>T	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.153G>A	17.37:g.39274415C>T							p.R51R	NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	192	-		Breast(137;0.000496)	51		Missing (in allele KAP4.14).	6.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		A0AUY2	Silent	SNP	ENST00000391413.2	37	c.153G>A	CCDS45675.1																																																																																				0.667	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1			5	51	0	0	0	0.001984	0	5	51				
FMNL1	752	broad.mit.edu	37	17	43323891	43323891	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:43323891C>T	ENST00000331495.3	+	26	3567	c.3231C>T	c.(3229-3231)ttC>ttT	p.F1077F	FMNL1_ENST00000328118.3_Intron|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|CTD-2020K17.4_ENST00000420431.2_RNA|FMNL1_ENST00000587489.1_Intron|CTD-2020K17.4_ENST00000591361.1_RNA|CTD-2020K17.4_ENST00000589518.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	1077	DAD. {ECO:0000255|PROSITE- ProRule:PRU00577}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)	p.F1077F(2)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						CGGTGCCCTTCACGGCCCGCA	0.582											OREG0024478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(164;1247 1997 8702 11086 51972)	GBM(164;1247 1997 8702 11086 51972)	uc002iin.2		NA																	2	Substitution - coding silent(2)		urinary_tract(1)|lung(1)	pancreas(1)	1						c.(3229-3231)TTC>TTT		formin-like 1							41.0	42.0	42.0					17																	43323891		2203	4300	6503	SO:0001819	synonymous_variant	752				actin cytoskeleton organization		actin binding|Rho GTPase binding	g.chr17:43323891C>T	AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.3231C>T	17.37:g.43323891C>T			OREG0024478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	915	FMNL1_uc002iiq.2_Intron|FMNL1_uc010dag.2_Intron|LOC100133991_uc010dah.2_5'Flank	p.F1077F	NM_005892	NP_005883	O95466	FMNL_HUMAN			26	3431	+			1077			DAD.		D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Silent	SNP	ENST00000331495.3	37	c.3231C>T	CCDS11497.1																																																																																				0.582	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450198.1	NM_005892		7	81	0	0	0	0.008291	0	7	81				
MRC2	9902	broad.mit.edu	37	17	60765739	60765739	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:60765739C>T	ENST00000303375.5	+	21	3438	c.3036C>T	c.(3034-3036)gtC>gtT	p.V1012V	MRC2_ENST00000446119.2_5'UTR	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1012	C-type lectin 6. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.V1012V(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CCCAGCTGGTCACCATCACAA	0.582																																							uc002jad.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(3034-3036)GTC>GTT		mannose receptor, C type 2							65.0	59.0	61.0					17																	60765739		2203	4300	6503	SO:0001819	synonymous_variant	9902				endocytosis	integral to membrane	receptor activity|sugar binding	g.chr17:60765739C>T	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3036C>T	17.37:g.60765739C>T						MRC2_uc002jae.2_Silent_p.V83V|MRC2_uc002jaf.2_5'UTR	p.V1012V	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN			21	3438	+			1012			Extracellular (Potential).|C-type lectin 6.		A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Silent	SNP	ENST00000303375.5	37	c.3036C>T	CCDS11634.1																																																																																				0.582	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1			20	90	0	0	0	0.010504	0	20	90				
ACE	1636	broad.mit.edu	37	17	61568578	61568578	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:61568578G>T	ENST00000290866.4	+	19	2772	c.2748G>T	c.(2746-2748)acG>acT	p.T916T	ACE_ENST00000421982.2_Silent_p.T162T|ACE_ENST00000428043.1_Silent_p.T916T|ACE_ENST00000413513.3_Silent_p.T342T|ACE_ENST00000577647.1_Silent_p.T342T|ACE_ENST00000490216.2_Silent_p.T342T|ACE_ENST00000290863.6_Silent_p.T342T	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	916	Peptidase M2 2.		T -> M (in dbSNP:rs3730043).		angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)	p.T916T(1)|p.T342T(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	AGGGCTGGACGCCCAGGAGGA	0.617																																							uc002jau.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(2746-2748)ACG>ACT		angiotensin I converting enzyme 1 isoform 1	Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)						48.0	48.0	48.0					17																	61568578		2203	4300	6503	SO:0001819	synonymous_variant	1636				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding	g.chr17:61568578G>T	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.2748G>T	17.37:g.61568578G>T						ACE_uc002jav.1_Silent_p.T342T|ACE_uc010ddv.1_Silent_p.T143T|ACE_uc010wpj.1_Silent_p.T342T|ACE_uc002jaw.1_RNA|ACE_uc010wpk.1_Silent_p.T162T	p.T916T	NM_000789	NP_000780	P12821	ACE_HUMAN			19	2770	+			916			Extracellular (Potential).|Peptidase M2 2.		B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Silent	SNP	ENST00000290866.4	37	c.2748G>T	CCDS11637.1																																																																																				0.617	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2			16	54	1	0	0.006122	0.006122	0.00648818	16	54				
CCDC47	57003	broad.mit.edu	37	17	61842180	61842180	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:61842180C>T	ENST00000225726.5	-	3	674	c.292G>A	c.(292-294)Gat>Aat	p.D98N	CCDC47_ENST00000582252.1_Missense_Mutation_p.D98N|CCDC47_ENST00000403162.3_Missense_Mutation_p.D98N	NM_020198.2	NP_064583.2	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47	98					calcium ion homeostasis (GO:0055074)|ER overload response (GO:0006983)|osteoblast differentiation (GO:0001649)|post-embryonic development (GO:0009791)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.D98N(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	18						TCTTCATCATCATATGGTTCA	0.388																																							uc002jbs.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(292-294)GAT>AAT		coiled-coil domain containing 47 precursor							217.0	184.0	195.0					17																	61842180		2202	4299	6501	SO:0001583	missense	57003					integral to membrane	protein binding	g.chr17:61842180C>T	AF226054	CCDS11643.1	17q23.3	2005-12-19				ENSG00000108588			24856	protein-coding gene	gene with protein product						12477932	Standard	NM_020198		Approved	GK001	uc002jbs.4	Q96A33		ENST00000225726.5:c.292G>A	17.37:g.61842180C>T	ENSP00000225726:p.Asp98Asn					CCDC47_uc010ddx.2_Missense_Mutation_p.D98N|CCDC47_uc002jbt.2_Missense_Mutation_p.D98N	p.D98N	NM_020198	NP_064583	Q96A33	CCD47_HUMAN			3	628	-			98					B2RAS8|D3DU20|Q96D00|Q96JZ7|Q9H3E4|Q9NRG3	Missense_Mutation	SNP	ENST00000225726.5	37	c.292G>A	CCDS11643.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294656	0.60086	.	.	ENSG00000108588	ENST00000225726;ENST00000403162	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.67505	0.2900	M	0.66939	2.045	0.80722	D	1	B;B	0.23540	0.087;0.053	B;B	0.20384	0.029;0.013	T	0.64993	-0.6276	9	0.52906	T	0.07	-23.2724	18.5385	0.91019	0.0:1.0:0.0:0.0	.	98;98	Q96A33-2;Q96A33	.;CCD47_HUMAN	N	98	.	ENSP00000225726:D98N	D	-	1	0	CCDC47	59195912	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.399000	0.66314	2.859000	0.98148	0.591000	0.81541	GAT		0.388	CCDC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444016.2	NM_020198		18	141	0	0	0	0.008871	0	18	141				
SCN4A	6329	broad.mit.edu	37	17	62049513	62049513	+	Silent	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:62049513G>C	ENST00000435607.1	-	3	541	c.465C>G	c.(463-465)ccC>ccG	p.P155P	SCN4A_ENST00000578147.1_Silent_p.P155P|CTC-264K15.6_ENST00000577329.1_lincRNA	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	155					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.P155P(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTGGACCAGGGAGGCGGGT	0.552																																							uc002jds.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(463-465)CCC>CCG		voltage-gated sodium channel type 4 alpha	Lamotrigine(DB00555)						66.0	67.0	67.0					17																	62049513		2083	4206	6289	SO:0001819	synonymous_variant	6329				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr17:62049513G>C	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.465C>G	17.37:g.62049513G>C							p.P155P	NM_000334	NP_000325	P35499	SCN4A_HUMAN			3	542	-			155			I.		Q15478|Q16447|Q7Z6B1	Silent	SNP	ENST00000435607.1	37	c.465C>G	CCDS45761.1																																																																																				0.552	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334		4	24	0	0	0	0.001168	0	4	24				
PSMD12	5718	broad.mit.edu	37	17	65340804	65340804	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:65340804T>C	ENST00000356126.3	-	9	1108	c.1001A>G	c.(1000-1002)gAg>gGg	p.E334G	PSMD12_ENST00000357146.4_Missense_Mutation_p.E314G	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	334	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.E334G(1)		breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					TGCAGGACTCTCAAGGGAACC	0.393																																							uc002jfy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1000-1002)GAG>GGG		proteasome 26S non-ATPase subunit 12 isoform 1							89.0	87.0	88.0					17																	65340804		2203	4300	6503	SO:0001583	missense	5718				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding	g.chr17:65340804T>C	AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.1001A>G	17.37:g.65340804T>C	ENSP00000348442:p.Glu334Gly					PSMD12_uc002jga.2_Missense_Mutation_p.E314G|PSMD12_uc002jfz.2_Missense_Mutation_p.E275G	p.E334G	NM_002816	NP_002807	O00232	PSD12_HUMAN			9	1087	-	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)		334			PCI.		A6NP15|Q53HA2|Q6P053	Missense_Mutation	SNP	ENST00000356126.3	37	c.1001A>G	CCDS11669.1	.	.	.	.	.	.	.	.	.	.	T	13.27	2.186666	0.38609	.	.	ENSG00000197170	ENST00000356126;ENST00000357146	T;T	0.31510	1.49;1.49	5.68	4.61	0.57282	Proteasome component (PCI) domain (1);	0.192676	0.56097	D	0.000039	T	0.13586	0.0329	N	0.03608	-0.345	0.43313	D	0.995323	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10965	-1.0607	10	0.23891	T	0.37	-17.5644	11.0806	0.48057	0.0:0.072:0.0:0.928	.	314;334	A6NP15;O00232	.;PSD12_HUMAN	G	334;314	ENSP00000348442:E334G;ENSP00000349667:E314G	ENSP00000348442:E334G	E	-	2	0	PSMD12	62771266	1.000000	0.71417	0.990000	0.47175	0.941000	0.58515	4.741000	0.62095	2.158000	0.67659	0.454000	0.30748	GAG		0.393	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277103.1	NM_002816, NM_174871		15	90	0	0	0	0.004007	0	15	90				
CARD14	79092	broad.mit.edu	37	17	78165189	78165189	+	Missense_Mutation	SNP	G	G	T	rs535721220		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr17:78165189G>T	ENST00000573882.1	+	10	1693	c.1157G>T	c.(1156-1158)cGc>cTc	p.R386L	CARD14_ENST00000392434.2_Missense_Mutation_p.R149L|CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000344227.2_Missense_Mutation_p.R386L|CARD14_ENST00000570421.1_Missense_Mutation_p.R386L			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	386					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)	p.R386L(1)|p.R149L(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GACTCCCTCCGCAGGCAGGTG	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		19329	0.0		0.0	False		,,,				2504	0.001						uc002jxw.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(1156-1158)CGC>CTC		caspase recruitment domain protein 14 isoform 1							71.0	64.0	66.0					17																	78165189		2203	4300	6503	SO:0001583	missense	79092				activation of NF-kappaB-inducing kinase activity|positive regulation of protein phosphorylation|regulation of apoptosis	aggresome|cytoplasm|plasma membrane	CARD domain binding	g.chr17:78165189G>T	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1157G>T	17.37:g.78165189G>T	ENSP00000458715:p.Arg386Leu					CARD14_uc002jxt.1_RNA|CARD14_uc002jxv.2_Missense_Mutation_p.R386L|CARD14_uc010wud.1_RNA|CARD14_uc002jxx.2_Missense_Mutation_p.R149L|CARD14_uc010dhu.1_Missense_Mutation_p.R184L	p.R386L	NM_024110	NP_077015	Q9BXL6	CAR14_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)		8	1352	+	all_neural(118;0.0952)		386			Potential.		B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	37	c.1157G>T	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554765	0.86231	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.36520	1.25;1.25	4.2	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.62146	0.2404	M	0.80616	2.505	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.99;0.997;0.995	T	0.69672	-0.5082	10	0.87932	D	0	-30.1133	15.3297	0.74196	0.0:0.0:1.0:0.0	.	386;149;386	B8QQJ3;E7ETJ2;Q9BXL6	.;.;CAR14_HUMAN	L	386;149;149	ENSP00000344549:R386L;ENSP00000376229:R149L	ENSP00000308507:R149L	R	+	2	0	CARD14	75779784	1.000000	0.71417	0.999000	0.59377	0.772000	0.43724	7.990000	0.88215	1.887000	0.54652	0.655000	0.94253	CGC		0.662	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1			22	115	1	0	1.22574e-08	0.014323	1.63914e-08	22	115				
DSC2	1824	broad.mit.edu	37	18	28648013	28648013	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr18:28648013T>C	ENST00000280904.6	-	16	3117	c.2674A>G	c.(2674-2676)Agg>Ggg	p.R892G	DSC2_ENST00000251081.6_3'UTR	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	892					bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R892G(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			GCTAGTGTCCTAAATTTGGGC	0.398																																							uc002kwl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(2674-2676)AGG>GGG		desmocollin 2 isoform Dsc2a preproprotein							82.0	73.0	77.0					18																	28648013		2203	4300	6503	SO:0001583	missense	1824				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28648013T>C	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.2674A>G	18.37:g.28648013T>C	ENSP00000280904:p.Arg892Gly					DSC2_uc002kwk.3_3'UTR	p.R892G	NM_024422	NP_077740	Q02487	DSC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.0241)		16	3128	-			892			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000280904.6	37	c.2674A>G	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.616904	0.87359	.	.	ENSG00000134755	ENST00000280904;ENST00000438199;ENST00000399347	T	0.78481	-1.18	5.87	5.87	0.94306	Cadherin, cytoplasmic domain (1);	0.798569	0.10264	N	0.695535	D	0.88157	0.6361	M	0.85197	2.74	0.49798	D	0.999829	P	0.49783	0.928	P	0.55260	0.772	D	0.86627	0.1883	10	0.72032	D	0.01	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	892	Q02487	DSC2_HUMAN	G	892;658;905	ENSP00000280904:R892G	ENSP00000280904:R892G	R	-	1	2	DSC2	26902011	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	6.508000	0.73721	2.371000	0.80710	0.533000	0.62120	AGG		0.398	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949		3	86	0	0	0	0.009096	0	3	86				
B4GALT6	9331	broad.mit.edu	37	18	29206276	29206276	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr18:29206276T>A	ENST00000306851.5	-	8	1267	c.971A>T	c.(970-972)cAc>cTc	p.H324L	B4GALT6_ENST00000237019.7_Missense_Mutation_p.H285L|B4GALT6_ENST00000383131.3_Missense_Mutation_p.H285L	NM_004775.3	NP_004766.2	Q9UBX8	B4GT6_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6	324	UDP-alpha-D-galactose binding. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)	p.H324L(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(6)|pancreas(1)	20			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			ACCTCTATGGTGATGAGGAAT	0.353																																							uc002kwz.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(970-972)CAC>CTC		beta-1,4-galactosyltransferase 6							119.0	99.0	106.0					18																	29206276		2203	4300	6503	SO:0001583	missense	9331				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding	g.chr18:29206276T>A	AF038664	CCDS11900.1	18q11	2013-02-19			ENSG00000118276	ENSG00000118276		"""Beta 4-glycosyltransferases"""	929	protein-coding gene	gene with protein product	"""UDP-Gal:glucosylceramide beta-1,4-galactosyltransferase"""	604017				9597550, 12180132	Standard	NM_004775		Approved	beta4GalT-VI	uc002kwz.4	Q9UBX8	OTTHUMG00000131980	ENST00000306851.5:c.971A>T	18.37:g.29206276T>A	ENSP00000306459:p.His324Leu					B4GALT6_uc010dma.2_Missense_Mutation_p.H285L|B4GALT6_uc010dmb.2_Missense_Mutation_p.H285L|B4GALT6_uc002kwy.3_RNA	p.H324L	NM_004775	NP_004766	Q9UBX8	B4GT6_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00791)		8	1268	-			324			Lumenal (Potential).		O60514|Q6NT09	Missense_Mutation	SNP	ENST00000306851.5	37	c.971A>T	CCDS11900.1	.	.	.	.	.	.	.	.	.	.	T	33	5.215710	0.95104	.	.	ENSG00000118276	ENST00000306851;ENST00000237019;ENST00000383131	T;T;T	0.33654	1.4;1.4;1.4	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.52419	0.1733	L	0.41356	1.27	0.80722	D	1	D;D;D	0.76494	0.999;0.984;0.987	D;P;D	0.75484	0.986;0.879;0.949	T	0.51348	-0.8717	10	0.54805	T	0.06	-24.8607	16.4277	0.83824	0.0:0.0:0.0:1.0	.	285;285;324	Q6NT09;G3XA83;Q9UBX8	.;.;B4GT6_HUMAN	L	324;285;285	ENSP00000306459:H324L;ENSP00000237019:H285L;ENSP00000372613:H285L	ENSP00000237019:H285L	H	-	2	0	B4GALT6	27460274	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	CAC		0.353	B4GALT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254942.2	NM_004775		8	37	0	0	0	0.004482	0	8	37				
SETBP1	26040	broad.mit.edu	37	18	42530897	42530897	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr18:42530897G>T	ENST00000282030.5	+	4	1888	c.1592G>T	c.(1591-1593)aGg>aTg	p.R531M		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	531						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R477M(1)|p.R531M(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GCAAAACGAAGGTGGACTTGC	0.517									Schinzel-Giedion syndrome																														uc010dni.2		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(1591-1593)AGG>ATG		SET binding protein 1 isoform a							123.0	123.0	123.0					18																	42530897		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42530897G>T	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1592G>T	18.37:g.42530897G>T	ENSP00000282030:p.Arg531Met						p.R531M	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	1888	+			531					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.1592G>T	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445227	0.63178	.	.	ENSG00000152217	ENST00000282030	T	0.74315	-0.83	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.82144	0.4973	L	0.34521	1.04	0.45995	D	0.998805	D	0.89917	1.0	D	0.87578	0.998	T	0.82470	-0.0441	10	0.72032	D	0.01	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	531	Q9Y6X0	SETBP_HUMAN	M	531	ENSP00000282030:R531M	ENSP00000282030:R531M	R	+	2	0	SETBP1	40784895	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.808000	0.91939	2.894000	0.99253	0.655000	0.94253	AGG		0.517	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		44	179	1	0	2.52991e-16	0.01441	4.13388e-16	44	179				
ONECUT2	9480	broad.mit.edu	37	18	55103683	55103683	+	Silent	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr18:55103683T>C	ENST00000491143.2	+	1	767	c.735T>C	c.(733-735)agT>agC	p.S245S	AC090340.1_ENST00000581316.1_RNA	NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	245					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.S245S(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		CGCAGCAGAGTCTGCCCAACT	0.677																																							uc002lgo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(733-735)AGT>AGC		one cut domain, family member 2							32.0	38.0	36.0					18																	55103683		2165	4256	6421	SO:0001819	synonymous_variant	9480				organ morphogenesis	nucleus	sequence-specific DNA binding	g.chr18:55103683T>C	Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.735T>C	18.37:g.55103683T>C							p.S245S	NM_004852	NP_004843	O95948	ONEC2_HUMAN		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)	1	767	+		Colorectal(73;0.234)	245						Silent	SNP	ENST00000491143.2	37	c.735T>C	CCDS42440.1																																																																																				0.677	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357264.3			9	54	0	0	0	0.013537	0	9	54				
SERPINB13	5275	broad.mit.edu	37	18	61262397	61262397	+	Silent	SNP	C	C	T	rs368658099		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr18:61262397C>T	ENST00000344731.5	+	7	852	c.750C>T	c.(748-750)aaC>aaT	p.N250N	SERPINB13_ENST00000269489.5_Intron	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	250					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.N250N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						TTCTGCCCAACGACATCGATG	0.458																																							uc002ljc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(748-750)AAC>AAT		serine (or cysteine) proteinase inhibitor, clade		C		0,4406		0,0,2203	152.0	140.0	144.0		750	1.5	1.0	18		144	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SERPINB13	NM_012397.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		250/392	61262397	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5275				regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity	g.chr18:61262397C>T	AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.750C>T	18.37:g.61262397C>T						SERPINB13_uc002ljd.2_Silent_p.N114N|SERPINB13_uc010xep.1_Silent_p.N259N|SERPINB13_uc010xeq.1_Silent_p.N71N|SERPINB13_uc010xer.1_Silent_p.N71N	p.N250N	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN			7	918	+			250					A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Silent	SNP	ENST00000344731.5	37	c.750C>T	CCDS11985.1																																																																																				0.458	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1	NM_012397		10	226	0	0	0	0.00245	0	10	226				
CBLN2	147381	broad.mit.edu	37	18	70205991	70205992	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr18:70205991_70205992CC>AA	ENST00000269503.4	-	4	1146_1147	c.373_374GG>TT	c.(373-375)GGc>TTc	p.G125F	CBLN2_ENST00000583651.1_5'UTR|CBLN2_ENST00000581073.1_Missense_Mutation_p.G11F|CBLN2_ENST00000584764.1_Missense_Mutation_p.G9F|CBLN2_ENST00000585159.1_Missense_Mutation_p.G125F	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	125	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)		p.G125F(1)		endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				AAAGTGGTTGCCAATATTTACT	0.421																																							uc002lku.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(373-375)GGC>TTC		cerebellin 2 precursor																																				SO:0001583	missense	147381					integral to membrane		g.chr18:70205991_70205992CC>AA	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.373_374delinsAA	18.37:g.70205991_70205992delinsAA	ENSP00000269503:p.Gly125Phe					CBLN2_uc002lkv.2_Missense_Mutation_p.G125F	p.G125F	NM_182511	NP_872317	Q8IUK8	CBLN2_HUMAN			3	608_609	-		Esophageal squamous(42;0.131)	125			C1q.		Q53Z56	Missense_Mutation	DNP	ENST00000269503.4	37	c.373_374GG>TT	CCDS11999.1																																																																																				0.421	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511		14	98	0	0	0	0.004672	0	14	98				
GALR1	2587	broad.mit.edu	37	18	74962576	74962576	+	Silent	SNP	G	G	A	rs565505361	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr18:74962576G>A	ENST00000299727.3	+	1	72	c.72G>A	c.(70-72)ggG>ggA	p.G24G		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	24					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.G24G(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CGGAGCCCGGGCCGCTGTTCG	0.721													G|||	2	0.000399361	0.0	0.0	5008	,	,		11227	0.0		0.0	False		,,,				2504	0.002						uc002lms.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)	1						c.(70-72)GGG>GGA		galanin receptor 1							8.0	8.0	8.0					18																	74962576		2174	4269	6443	SO:0001819	synonymous_variant	2587				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity	g.chr18:74962576G>A	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.72G>A	18.37:g.74962576G>A							p.G24G	NM_001480	NP_001471	P47211	GALR1_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)	1	569	+		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)	24			Extracellular (Potential).		Q4VBL7	Silent	SNP	ENST00000299727.3	37	c.72G>A	CCDS12012.1																																																																																				0.721	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256362.1			3	6	0	0	0	0.004672	0	3	6				
GIPC3	126326	broad.mit.edu	37	19	3589536	3589536	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:3589536G>T	ENST00000322315.5	+	4	733	c.688G>T	c.(688-690)Gcc>Tcc	p.A230S		NM_133261.2	NP_573568.1	Q8TF64	GIPC3_HUMAN	GIPC PDZ domain containing family, member 3	230								p.A230S(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGGGGGCTGCCACagtgga	0.597																																							uc002lyd.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(688-690)GCC>TCC		GIPC PDZ domain containing family, member 3							32.0	37.0	35.0					19																	3589536		2202	4300	6502	SO:0001583	missense	126326							g.chr19:3589536G>T	AB073738	CCDS32871.1	19p13.3	2011-11-29				ENSG00000179855			18183	protein-coding gene	gene with protein product		608792	"""chromosome 19 open reading frame 64"", ""deafness, autosomal recessive 72"", ""deafness, autosomal recessive 15"""	C19orf64, DFNB72, DFNB15		11836571, 21326233	Standard	NM_133261		Approved	DFNB95	uc002lyd.4	Q8TF64		ENST00000322315.5:c.688G>T	19.37:g.3589536G>T	ENSP00000319254:p.Ala230Ser						p.A230S	NM_133261	NP_573568	Q8TF64	GIPC3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)	4	715	+			230					O75227	Missense_Mutation	SNP	ENST00000322315.5	37	c.688G>T	CCDS32871.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171540	0.78452	.	.	ENSG00000179855	ENST00000322315	D	0.82893	-1.66	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.91002	0.7170	M	0.82323	2.585	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	D	0.92522	0.6026	10	0.87932	D	0	-24.5972	14.6376	0.68702	0.0:0.0:1.0:0.0	.	230	Q8TF64	GIPC3_HUMAN	S	230	ENSP00000319254:A230S	ENSP00000319254:A230S	A	+	1	0	GIPC3	3540536	1.000000	0.71417	0.995000	0.50966	0.720000	0.41350	8.033000	0.88852	2.034000	0.60081	0.484000	0.47621	GCC		0.597	GIPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394577.1	NM_133261		24	34	1	0	1.39806e-14	0.008361	2.20807e-14	24	34				
LONP1	9361	broad.mit.edu	37	19	5705941	5705941	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:5705941G>A	ENST00000360614.3	-	8	1366	c.1209C>T	c.(1207-1209)atC>atT	p.I403I	LONP1_ENST00000590729.1_Silent_p.I273I|LONP1_ENST00000593119.1_Silent_p.I339I|LONP1_ENST00000540670.2_Silent_p.I207I|LONP1_ENST00000585374.1_Silent_p.I289I	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial									p.I403I(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCTCCTTCTTGATGATCTTTA	0.597																																							uc002mcx.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1207-1209)ATC>ATT		mitochondrial lon peptidase 1 precursor							146.0	127.0	133.0					19																	5705941		2203	4300	6503	SO:0001819	synonymous_variant	9361				cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding	g.chr19:5705941G>A	U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1209C>T	19.37:g.5705941G>A						LONP1_uc002mcy.2_Silent_p.I339I|LONP1_uc010duh.2_Silent_p.I144I|LONP1_uc010dui.2_Silent_p.I387I|LONP1_uc002mcz.2_Silent_p.I207I	p.I403I	NM_004793	NP_004784	P36776	LONM_HUMAN			8	1242	-			403						Silent	SNP	ENST00000360614.3	37	c.1209C>T	CCDS12148.1																																																																																				0.597	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451662.1	NM_004793		42	153	0	0	0	0.01441	0	42	153				
PPAN	56342	broad.mit.edu	37	19	10220370	10220370	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:10220370G>T	ENST00000253107.7	+	6	683	c.577G>T	c.(577-579)Gac>Tac	p.D193Y	SNORD105B_ENST00000458770.1_RNA|PPAN_ENST00000556468.1_Missense_Mutation_p.D193Y|P2RY11_ENST00000321826.4_5'Flank|PPAN_ENST00000393793.1_Missense_Mutation_p.D140Y|PPAN-P2RY11_ENST00000428358.1_Missense_Mutation_p.D193Y|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.D193Y|SNORD105_ENST00000386910.1_RNA	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	193	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.D193Y(2)		endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			CCAGGAGCTGGACTTCCGCCA	0.607																																							uc002mna.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(577-579)GAC>TAC		PPAN-P2RY11 protein							116.0	131.0	126.0					19																	10220370		2203	4300	6503	SO:0001583	missense	692312				RNA splicing	nucleolus	protein binding	g.chr19:10220370G>T	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.577G>T	19.37:g.10220370G>T	ENSP00000253107:p.Asp193Tyr					PPAN-P2RY11_uc010xla.1_Missense_Mutation_p.D193Y|P2RY11_uc002mnc.2_5'Flank|PPAN_uc002mmz.1_Missense_Mutation_p.D193Y|PPAN_uc002mnb.1_Missense_Mutation_p.D140Y|SNORD105B_uc010dwz.1_5'Flank	p.D193Y	NM_001040664	NP_001035754	Q9NQ55	SSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)		6	577	+			193			Brix.		C9J3F9|Q9BW97|Q9H170	Missense_Mutation	SNP	ENST00000253107.7	37	c.577G>T	CCDS12225.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.922703	0.73213	.	.	ENSG00000243207;ENSG00000243207;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810	ENST00000428358;ENST00000393796;ENST00000253107;ENST00000556468;ENST00000342696;ENST00000393793;ENST00000446223	T;T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02;2.02	5.29	4.17	0.49024	Brix domain (3);	.	.	.	.	T	0.41213	0.1149	L	0.58354	1.805	0.50313	D	0.999862	D;D;D	0.76494	0.999;0.996;0.996	D;D;D	0.71184	0.972;0.951;0.951	T	0.11717	-1.0576	9	0.34782	T	0.22	-38.9586	16.5248	0.84328	0.0:0.1428:0.8572:0.0	.	193;193;193	C9J3F9;C9JW41;Q9NQ55	.;.;SSF1_HUMAN	Y	193;193;193;193;193;140;131	ENSP00000411918:D193Y;ENSP00000377385:D193Y;ENSP00000253107:D193Y;ENSP00000450710:D193Y;ENSP00000377382:D140Y;ENSP00000410485:D131Y	ENSP00000253107:D193Y	D	+	1	0	PPAN;PPAN-P2RY11	10081370	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.811000	0.55620	2.476000	0.83614	0.561000	0.74099	GAC		0.607	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	NM_020230		73	151	1	0	1.43872e-54	0.01441	2.68341e-54	73	151				
OR10H4	126541	broad.mit.edu	37	19	16060156	16060156	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:16060156C>A	ENST00000322107.1	+	1	339	c.339C>A	c.(337-339)tcC>tcA	p.S113S		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S113S(1)		breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						TCACTCACTCCTTCCTTCTCC	0.532																																							uc010xov.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(337-339)TCC>TCA		olfactory receptor, family 10, subfamily H,							384.0	331.0	349.0					19																	16060156		2203	4300	6503	SO:0001819	synonymous_variant	126541				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:16060156C>A	AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.339C>A	19.37:g.16060156C>A							p.S113S	NM_001004465	NP_001004465	Q8NGA5	O10H4_HUMAN			1	339	+			113			Helical; Name=3; (Potential).		Q6IFJ2|Q96R57	Silent	SNP	ENST00000322107.1	37	c.339C>A	CCDS32941.1																																																																																				0.532	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460311.1			82	360	1	0	1.11057e-38	0.01441	2.04446e-38	82	360				
FAM32A	26017	broad.mit.edu	37	19	16301759	16301759	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:16301759C>T	ENST00000263384.7	+	4	357	c.332C>T	c.(331-333)aCg>aTg	p.T111M	FAM32A_ENST00000588367.1_Missense_Mutation_p.T93M|CTD-2562J15.4_ENST00000591038.1_RNA|FAM32A_ENST00000589852.1_Missense_Mutation_p.T91M	NM_014077.2	NP_054796.1	Q9Y421	FA32A_HUMAN	family with sequence similarity 32, member A	111					apoptotic process (GO:0006915)|cell cycle (GO:0007049)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.T111M(1)		lung(1)	1						GTCAGCTGGACGAAGTAGCCG	0.557																																							uc002ndt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(331-333)ACG>ATG		hypothetical protein LOC26017							73.0	61.0	65.0					19																	16301759		2203	4300	6503	SO:0001583	missense	26017					nucleolus		g.chr19:16301759C>T	BC000639	CCDS12341.1	19p13.12-p13.11	2013-09-19			ENSG00000105058	ENSG00000105058			24563	protein-coding gene	gene with protein product		614554				11230166, 10810093	Standard	NM_014077		Approved	DKFZP586O0120	uc002ndt.3	Q9Y421	OTTHUMG00000182279	ENST00000263384.7:c.332C>T	19.37:g.16301759C>T	ENSP00000263384:p.Thr111Met						p.T111M	NM_014077	NP_054796	Q9Y421	FA32A_HUMAN			4	351	+			111					Q9BT02	Missense_Mutation	SNP	ENST00000263384.7	37	c.332C>T	CCDS12341.1	.	.	.	.	.	.	.	.	.	.	C	16.01	2.999969	0.54147	.	.	ENSG00000105058	ENST00000263384	.	.	.	3.99	2.94	0.34122	.	0.000000	0.85682	D	0.000000	T	0.44307	0.1287	M	0.72576	2.205	0.80722	D	1	P	0.40144	0.704	B	0.28465	0.09	T	0.48747	-0.9008	9	0.66056	D	0.02	-16.2628	9.4497	0.38719	0.0:0.8985:0.0:0.1015	.	111	Q9Y421	FA32A_HUMAN	M	111	.	ENSP00000263384:T111M	T	+	2	0	FAM32A	16162759	1.000000	0.71417	0.841000	0.33234	0.578000	0.36192	5.807000	0.69157	0.793000	0.33875	0.462000	0.41574	ACG		0.557	FAM32A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460346.1	NM_014077		7	64	0	0	0	0.00308	0	7	64				
UNC13A	23025	broad.mit.edu	37	19	17759401	17759401	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:17759401G>T	ENST00000519716.2	-	16	1654	c.1655C>A	c.(1654-1656)aCg>aAg	p.T552K	UNC13A_ENST00000428389.2_Missense_Mutation_p.T640K|UNC13A_ENST00000551649.1_Missense_Mutation_p.T552K|UNC13A_ENST00000252773.7_Missense_Mutation_p.T552K|UNC13A_ENST00000550896.1_Missense_Mutation_p.T550K|UNC13A_ENST00000552293.1_Missense_Mutation_p.T552K	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	552					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.T552K(1)|p.T640K(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GTTGTGTGGCGTCGTGCACGA	0.617																																							uc002nhd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1918-1920)ACG>AAG		unc-13 homolog A							166.0	183.0	177.0					19																	17759401		2188	4295	6483	SO:0001583	missense	23025				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr19:17759401G>T	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1655C>A	19.37:g.17759401G>T	ENSP00000429562:p.Thr552Lys						p.T640K	NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN			16	1919	-			552					E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	37	c.1919C>A	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	G	25.4	4.639369	0.87760	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	D;D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78;-1.78	4.35	4.35	0.52113	.	0.000000	0.85682	U	0.000000	D	0.86573	0.5965	M	0.83384	2.64	0.53005	D	0.999969	P	0.42961	0.795	P	0.45753	0.492	D	0.89357	0.3665	10	0.87932	D	0	-17.8403	14.6907	0.69083	0.0:0.0:1.0:0.0	.	552	Q9UPW8	UN13A_HUMAN	K	552;640;552;552;552;550	ENSP00000429562:T552K;ENSP00000400409:T640K;ENSP00000252773:T552K;ENSP00000447236:T552K;ENSP00000447572:T552K;ENSP00000446831:T550K	ENSP00000252773:T552K	T	-	2	0	UNC13A	17620401	1.000000	0.71417	0.985000	0.45067	0.846000	0.48090	9.575000	0.98187	2.126000	0.65437	0.486000	0.48141	ACG		0.617	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604		36	102	1	0	1.6237e-14	0.013114	2.53619e-14	36	102				
JAK3	3718	broad.mit.edu	37	19	17943472	17943472	+	Missense_Mutation	SNP	C	C	T	rs1052526		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:17943472C>T	ENST00000527670.1	-	18	2565	c.2536G>A	c.(2536-2538)Gac>Aac	p.D846N	JAK3_ENST00000458235.1_Missense_Mutation_p.D846N|JAK3_ENST00000534444.1_Missense_Mutation_p.D846N			P52333	JAK3_HUMAN	Janus kinase 3	846	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.			GD -> AH (in Ref. 1; AAA19626). {ECO:0000305}.	B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.D846N(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CCTGTATTGTCGCCTAGCGGG	0.617		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																		uc002nhn.3		2		Dom	yes		19	19p13.1	3718	Mis	Janus kinase 3			L			acute megakaryocytic leukemia|		1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						c.(2536-2538)GAC>AAC		Janus kinase 3							82.0	74.0	77.0					19																	17943472		2203	4300	6503	SO:0001583	missense	3718				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr19:17943472C>T	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2536G>A	19.37:g.17943472C>T	ENSP00000432511:p.Asp846Asn					JAK3_uc010ebh.2_Intron|JAK3_uc002nho.2_Missense_Mutation_p.D846N	p.D846N	NM_000215	NP_000206	P52333	JAK3_HUMAN			19	2636	-			846	GD -> AH (in Ref. 1; AAA19626).		Protein kinase 2.		Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	c.2536G>A	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.960105	0.92791	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	D;D;D	0.82711	-1.64;-1.64;-1.64	4.9	4.9	0.64082	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.054388	0.64402	D	0.000001	D	0.82706	0.5095	N	0.11255	0.115	0.80722	D	1	D;P	0.89917	1.0;0.497	D;B	0.74348	0.983;0.049	D	0.86646	0.1895	10	0.87932	D	0	-41.0259	15.9055	0.79427	0.0:1.0:0.0:0.0	.	846;846	P52333-2;P52333	.;JAK3_HUMAN	N	846	ENSP00000391676:D846N;ENSP00000432511:D846N;ENSP00000436421:D846N	ENSP00000391676:D846N	D	-	1	0	JAK3	17804472	0.994000	0.37717	0.953000	0.39169	0.823000	0.46562	7.332000	0.79203	2.433000	0.82419	0.549000	0.68633	GAC		0.617	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215		10	187	0	0	0	0.010729	0	10	187				
GATAD2A	54815	broad.mit.edu	37	19	19576209	19576209	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:19576209C>G	ENST00000360315.3	+	2	367	c.55C>G	c.(55-57)Cca>Gca	p.P19A	GATAD2A_ENST00000429563.2_5'Flank|GATAD2A_ENST00000537887.1_5'UTR|GATAD2A_ENST00000404158.1_Missense_Mutation_p.P19A|GATAD2A_ENST00000252577.5_Missense_Mutation_p.P19A|GATAD2A_ENST00000358713.3_Missense_Mutation_p.P19A	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	19					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P19A(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						TGAACGGGACCCAACAGAGGA	0.493																																							uc010xqt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(55-57)CCA>GCA		GATA zinc finger domain containing 2A							125.0	122.0	123.0					19																	19576209		1568	3582	5150	SO:0001583	missense	54815				DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:19576209C>G	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.55C>G	19.37:g.19576209C>G	ENSP00000353463:p.Pro19Ala					GATAD2A_uc010xqu.1_5'UTR|GATAD2A_uc010xqv.1_Missense_Mutation_p.P38A|GATAD2A_uc010xqw.1_5'UTR	p.P19A	NM_017660	NP_060130	Q86YP4	P66A_HUMAN			2	367	+			19					B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	37	c.55C>G	CCDS12402.2	.	.	.	.	.	.	.	.	.	.	C	2.062	-0.415205	0.04766	.	.	ENSG00000167491	ENST00000417582;ENST00000360315;ENST00000252577;ENST00000457895;ENST00000432704;ENST00000404158;ENST00000429242;ENST00000358713;ENST00000444839	T;T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.52	3.34	0.38264	.	0.637398	0.15759	N	0.246019	T	0.16300	0.0392	N	0.08118	0	0.22571	N	0.998976	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.0	T	0.25950	-1.0117	10	0.07482	T	0.82	-26.0679	2.9582	0.05883	0.2018:0.4631:0.2423:0.0928	.	38;19	B5MC40;Q86YP4	.;P66A_HUMAN	A	19;19;19;19;19;38;19;19;19	ENSP00000403703:P19A;ENSP00000353463:P19A;ENSP00000252577:P19A;ENSP00000404212:P19A;ENSP00000390495:P19A;ENSP00000414252:P19A;ENSP00000351552:P19A;ENSP00000407293:P19A	ENSP00000252577:P19A	P	+	1	0	GATAD2A	19437209	0.292000	0.24362	0.674000	0.29902	0.880000	0.50808	0.981000	0.29526	1.345000	0.45676	-0.136000	0.14681	CCA		0.493	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660		26	134	0	0	0	0.005443	0	26	134				
CILP2	148113	broad.mit.edu	37	19	19655874	19655874	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:19655874C>A	ENST00000291495.5	+	8	2605	c.2520C>A	c.(2518-2520)gaC>gaA	p.D840E	CILP2_ENST00000586018.1_Missense_Mutation_p.D846E	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	840						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.D840E(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CCTACCTGGACAGGCTGGGGT	0.721																																							uc002nmv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2518-2520)GAC>GAA		cartilage intermediate layer protein 2							19.0	20.0	19.0					19																	19655874		2103	4089	6192	SO:0001583	missense	148113					proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity	g.chr19:19655874C>A	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2520C>A	19.37:g.19655874C>A	ENSP00000291495:p.Asp840Glu					CILP2_uc002nmw.3_Missense_Mutation_p.D846E	p.D840E	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN			8	2605	+			840					Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	c.2520C>A	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750592	0.31046	.	.	ENSG00000160161	ENST00000291495	T	0.09817	2.94	5.2	1.67	0.24075	.	0.391377	0.28284	N	0.015903	T	0.05914	0.0154	N	0.14661	0.345	0.22226	N	0.999275	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.35748	-0.9776	10	0.34782	T	0.22	-26.5403	8.666	0.34121	0.0:0.4421:0.4729:0.0851	.	840;840	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	E	840	ENSP00000291495:D840E	ENSP00000291495:D840E	D	+	3	2	CILP2	19516874	1.000000	0.71417	0.161000	0.22692	0.996000	0.88848	1.092000	0.30927	0.159000	0.19401	0.555000	0.69702	GAC		0.721	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221		10	23	1	0	0.00010058	0.013537	0.000114746	10	23				
ARHGAP33	115703	broad.mit.edu	37	19	36271365	36271365	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:36271365G>C	ENST00000007510.4	+	8	811	c.667G>C	c.(667-669)Gat>Cat	p.D223H	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.D223H|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.D87H			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	223	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)	p.D223H(1)		endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						ACCCACAGAGGATCGGAGCTG	0.667																																							uc002obr.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|pancreas(1)	4						c.(667-669)GAT>CAT		sorting nexin 26							26.0	30.0	29.0					19																	36271365		2203	4300	6503	SO:0001583	missense	115703				cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding	g.chr19:36271365G>C	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.667G>C	19.37:g.36271365G>C	ENSP00000007510:p.Asp223His					ARHGAP33_uc002obs.1_Missense_Mutation_p.D223H|ARHGAP33_uc002obt.1_Missense_Mutation_p.D87H|ARHGAP33_uc010eel.2_5'Flank|ARHGAP33_uc002obv.1_5'Flank	p.D223H	NM_052948	NP_443180	O14559	RHG33_HUMAN			8	752	+			223			SH3.		O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37	c.667G>C		.	.	.	.	.	.	.	.	.	.	G	15.58	2.876706	0.51801	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.36878	1.23;1.23;1.23	5.23	4.18	0.49190	.	0.070231	0.53938	D	0.000050	T	0.53818	0.1820	L	0.58810	1.83	0.49299	D	0.999772	D;D	0.69078	0.997;0.982	D;P	0.69307	0.963;0.719	T	0.54105	-0.8343	10	0.46703	T	0.11	.	14.1312	0.65255	0.0:0.0:0.8483:0.1517	.	87;223	O14559-10;O14559-11	.;.	H	223;223;87	ENSP00000007510:D223H;ENSP00000320038:D223H;ENSP00000368227:D87H	ENSP00000007510:D223H	D	+	1	0	ARHGAP33	40963205	1.000000	0.71417	0.979000	0.43373	0.027000	0.11550	6.129000	0.71657	1.170000	0.42753	-0.310000	0.09108	GAT		0.667	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948		4	37	0	0	0	0.000602	0	4	37				
RYR1	6261	broad.mit.edu	37	19	39075606	39075606	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:39075606G>T	ENST00000359596.3	+	102	14670	c.14670G>T	c.(14668-14670)gtG>gtT	p.V4890V	RYR1_ENST00000355481.4_Silent_p.V4885V|RYR1_ENST00000360985.3_Silent_p.V4885V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4890					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.V4890V(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACATGTACGTGGGTGTCCGGG	0.577																																							uc002oit.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(14668-14670)GTG>GTT		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						188.0	163.0	171.0					19																	39075606		2203	4300	6503	SO:0001819	synonymous_variant	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:39075606G>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14670G>T	19.37:g.39075606G>T						RYR1_uc002oiu.2_Silent_p.V4885V	p.V4890V	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		102	14800	+	all_cancers(60;7.91e-06)		4890			Helical; Name=M9; (Potential).		Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	c.14670G>T	CCDS33011.1																																																																																				0.577	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			35	77	1	0	1.66425e-11	0.004878	2.44464e-11	35	77				
NCCRP1	342897	broad.mit.edu	37	19	39691004	39691004	+	Silent	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:39691004G>C	ENST00000339852.4	+	5	589	c.567G>C	c.(565-567)ctG>ctC	p.L189L		NM_001001414.1	NP_001001414.1	Q6ZVX7	FBX50_HUMAN	non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)	189	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.L189L(1)		kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	10						ACAGCCGGCTGGATGCGTGCG	0.652																																					Melanoma(107;1207 1556 14956 29427 52130)	Melanoma(107;1207 1556 14956 29427 52130)	uc002okq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(565-567)CTG>CTC		non-specific cytotoxic cell receptor protein 1							75.0	85.0	82.0					19																	39691004		2203	4300	6503	SO:0001819	synonymous_variant	342897				protein catabolic process			g.chr19:39691004G>C	AK123941, BC067874	CCDS12529.1	19q13.2	2013-07-31	2008-11-19		ENSG00000188505	ENSG00000188505			33739	protein-coding gene	gene with protein product		615901					Standard	NM_001001414		Approved	LOC342897, NCCRP-1, FBXO50	uc002okq.1	Q6ZVX7		ENST00000339852.4:c.567G>C	19.37:g.39691004G>C							p.L189L	NM_001001414	NP_001001414	Q6ZVX7	NCRP1_HUMAN			5	586	+			189			FBA.		Q6NVV5	Silent	SNP	ENST00000339852.4	37	c.567G>C	CCDS12529.1																																																																																				0.652	NCCRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463829.1	NM_001001414		41	108	0	0	0	0.01441	0	41	108				
ZNF780A	284323	broad.mit.edu	37	19	40580836	40580836	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:40580836C>A	ENST00000595687.2	-	6	1722	c.1513G>T	c.(1513-1515)Gag>Tag	p.E505*	ZNF780A_ENST00000455521.1_Nonsense_Mutation_p.E506*|ZNF780A_ENST00000594395.1_Nonsense_Mutation_p.E506*|ZNF780A_ENST00000414720.2_Intron|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000340963.5_Nonsense_Mutation_p.E505*|ZNF780A_ENST00000450241.2_Nonsense_Mutation_p.E471*	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	505					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E471*(1)|p.E506*(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TTCCCACACTCCTTACATTCA	0.423																																							uc002omy.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(1513-1515)GAG>TAG		zinc finger protein 780A isoform b							84.0	85.0	85.0					19																	40580836		2203	4300	6503	SO:0001587	stop_gained	284323				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:40580836C>A	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.1513G>T	19.37:g.40580836C>A	ENSP00000472189:p.Glu505*					ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Nonsense_Mutation_p.E505*|ZNF780A_uc010xvh.1_Nonsense_Mutation_p.E506*	p.E505*	NM_001010880	NP_001010880	O75290	Z780A_HUMAN			6	1738	-	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		505			C2H2-type 13.		E9PB48|Q6ZN87	Nonsense_Mutation	SNP	ENST00000595687.2	37	c.1513G>T	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	c	34	5.401546	0.96030	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	.	.	.	1.93	0.755	0.18415	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	8.0317	0.30470	0.0:0.7462:0.2538:0.0	.	.	.	.	X	505;506;505	.	ENSP00000341507:E505X	E	-	1	0	ZNF780A	45272676	0.000000	0.05858	0.350000	0.25708	0.392000	0.30506	-0.024000	0.12435	0.099000	0.17552	0.313000	0.20887	GAG		0.423	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880		27	93	1	0	0.000117367	0.005443	0.000133629	27	93				
KCNA7	3743	broad.mit.edu	37	19	49573799	49573799	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:49573799G>T	ENST00000221444.1	-	2	1247	c.892C>A	c.(892-894)Ctg>Atg	p.L298M		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	298					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.L298M(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	AAGATTTGCAGGCCCTTTGAG	0.597																																					Colon(74;686 1235 3793 23366 48562)	Colon(74;686 1235 3793 23366 48562)	uc002pmg.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(892-894)CTG>ATG		potassium voltage-gated channel, shaker-related							64.0	61.0	62.0					19																	49573799		2203	4300	6503	SO:0001583	missense	3743					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr19:49573799G>T	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.892C>A	19.37:g.49573799G>T	ENSP00000221444:p.Leu298Met						p.L298M	NM_031886	NP_114092	Q96RP8	KCNA7_HUMAN		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	2	1248	-		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	298					A1KYX7|Q9BYS4	Missense_Mutation	SNP	ENST00000221444.1	37	c.892C>A	CCDS12755.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397873	0.42512	.	.	ENSG00000104848	ENST00000221444	D	0.98978	-5.29	4.54	2.35	0.29111	Ion transport (1);	0.076919	0.53938	D	0.000056	D	0.98717	0.9569	M	0.73372	2.23	0.37651	D	0.922422	D	0.64830	0.994	D	0.68039	0.955	D	0.99421	1.0933	10	0.87932	D	0	.	6.932	0.24447	0.354:0.0:0.646:0.0	.	298	Q96RP8	KCNA7_HUMAN	M	298	ENSP00000221444:L298M	ENSP00000221444:L298M	L	-	1	2	KCNA7	54265611	0.998000	0.40836	0.996000	0.52242	0.693000	0.40251	1.967000	0.40491	1.067000	0.40740	-0.333000	0.08304	CTG		0.597	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886		22	72	1	0	4.35082e-09	0.010504	5.90171e-09	22	72				
KLK15	55554	broad.mit.edu	37	19	51330248	51330248	+	Missense_Mutation	SNP	G	G	T	rs571715638		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:51330248G>T	ENST00000598239.1	-	3	397	c.367C>A	c.(367-369)Cgc>Agc	p.R123S	KLK15_ENST00000416184.1_Intron|KLK15_ENST00000301421.2_Missense_Mutation_p.R123S|KLK15_ENST00000326856.4_Missense_Mutation_p.R122S|KLK15_ENST00000596931.1_Missense_Mutation_p.R122S	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	123	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R123S(1)		breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		ACCGCGGGGCGCACCTGGGGG	0.701																																					Pancreas(140;10 2513 7143 9246)	Pancreas(140;10 2513 7143 9246)	uc002ptl.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(367-369)CGC>AGC		kallikrein-related peptidase 15 isoform 4							41.0	41.0	41.0					19																	51330248		2203	4300	6503	SO:0001583	missense	55554				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr19:51330248G>T	AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.367C>A	19.37:g.51330248G>T	ENSP00000469315:p.Arg123Ser					KLK15_uc002ptm.2_Intron|KLK15_uc002ptn.2_Missense_Mutation_p.R123S|KLK15_uc002pto.2_Missense_Mutation_p.R122S|KLK15_uc010ych.1_Intron|KLK15_uc010yci.1_Missense_Mutation_p.R122S|KLK15_uc010eod.2_RNA	p.R123S	NM_017509	NP_059979	Q9H2R5	KLK15_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)	3	398	-		all_neural(266;0.057)	123			Peptidase S1.		A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	ENST00000598239.1	37	c.367C>A	CCDS12805.1	.	.	.	.	.	.	.	.	.	.	g	15.71	2.912533	0.52439	.	.	ENSG00000174562	ENST00000326856;ENST00000301421;ENST00000544946	D	0.88896	-2.44	4.5	2.32	0.28847	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.509034	0.17019	N	0.190199	D	0.85605	0.5735	L	0.39397	1.21	0.28411	N	0.918187	B;P;P	0.51057	0.06;0.941;0.897	B;P;P	0.56088	0.053;0.791;0.73	T	0.75611	-0.3258	10	0.07030	T	0.85	.	5.4883	0.16761	0.096:0.0:0.5293:0.3747	.	123;122;123	Q6UBM2;Q6ISI0;Q9H2R5	.;.;KLK15_HUMAN	S	123	ENSP00000301421:R123S	ENSP00000301421:R123S	R	-	1	0	KLK15	56022060	0.005000	0.15991	0.488000	0.27440	0.285000	0.27093	1.134000	0.31442	0.608000	0.30000	0.555000	0.69702	CGC		0.701	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465160.1	NM_017509		29	87	1	0	4.34311e-12	0.003271	6.54931e-12	29	87				
HAS1	3036	broad.mit.edu	37	19	52222512	52222512	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:52222512C>A	ENST00000222115.1	-	2	683	c.649G>T	c.(649-651)Gag>Tag	p.E217*	HAS1_ENST00000594621.1_Nonsense_Mutation_p.E71*|HAS1_ENST00000601714.1_Nonsense_Mutation_p.E224*|HAS1_ENST00000540069.2_Nonsense_Mutation_p.E216*	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	217					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.E217*(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TACATGACCTCGCGCTTGCCG	0.662																																					NSCLC(132;636 2450 45807 47979)	NSCLC(132;636 2450 45807 47979)	uc002pxo.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(649-651)GAG>TAG		hyaluronan synthase 1							44.0	38.0	40.0					19																	52222512		2202	4298	6500	SO:0001587	stop_gained	3036				cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding	g.chr19:52222512C>A	U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.649G>T	19.37:g.52222512C>A	ENSP00000222115:p.Glu217*					HAS1_uc010epc.1_5'Flank|HAS1_uc010epd.1_Nonsense_Mutation_p.E182*|HAS1_uc002pxn.1_Nonsense_Mutation_p.E224*|HAS1_uc002pxp.1_Nonsense_Mutation_p.E216*	p.E217*	NM_001523	NP_001514	Q92839	HAS1_HUMAN		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)	2	684	-		all_neural(266;0.0189)|Medulloblastoma(540;0.146)	217			Cytoplasmic (Potential).		Q14470|Q9NS49	Nonsense_Mutation	SNP	ENST00000222115.1	37	c.649G>T	CCDS12838.1	.	.	.	.	.	.	.	.	.	.	.	37	6.196850	0.97367	.	.	ENSG00000105509	ENST00000540069;ENST00000222115;ENST00000376737;ENST00000376738	.	.	.	3.79	2.72	0.32119	.	0.063674	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-11.8049	11.2039	0.48758	0.0:0.8114:0.1886:0.0	.	.	.	.	X	216;217;71;71	.	ENSP00000222115:E217X	E	-	1	0	HAS1	56914324	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.712000	0.68407	0.677000	0.31305	0.423000	0.28283	GAG		0.662	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523		5	43	1	0	0.000602214	0.000602	0.00066431	5	43				
BRSK1	84446	broad.mit.edu	37	19	55816254	55816254	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:55816254G>A	ENST00000309383.1	+	14	1960	c.1683G>A	c.(1681-1683)ctG>ctA	p.L561L	BRSK1_ENST00000326848.7_Silent_p.L256L|BRSK1_ENST00000588584.1_3'UTR|BRSK1_ENST00000590333.1_Silent_p.L577L	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	561					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.L561L(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		ACAGCTTCCTGGGCTCCCCTC	0.657																																							uc002qkg.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6						c.(1681-1683)CTG>CTA		BR serine/threonine kinase 1							26.0	27.0	27.0					19																	55816254		2199	4294	6493	SO:0001819	synonymous_variant	84446				establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity	g.chr19:55816254G>A	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1683G>A	19.37:g.55816254G>A						BRSK1_uc002qkf.2_Silent_p.L577L|BRSK1_uc002qkh.2_Silent_p.L256L	p.L561L	NM_032430	NP_115806	Q8TDC3	BRSK1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)	14	1960	+		Renal(1328;0.245)	561					F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	37	c.1683G>A	CCDS12921.1																																																																																				0.657	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430		20	42	0	0	0	0.014323	0	20	42				
EPN1	29924	broad.mit.edu	37	19	56203235	56203235	+	Missense_Mutation	SNP	C	C	G	rs369456197		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr19:56203235C>G	ENST00000270460.6	+	7	1189	c.878C>G	c.(877-879)tCg>tGg	p.S293W	EPN1_ENST00000411543.2_Missense_Mutation_p.S379W|AC010525.4_ENST00000585559.1_RNA|EPN1_ENST00000085079.7_Missense_Mutation_p.S268W	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	293	8 X 3 AA repeats of [ED]-P-W.|Ala/Gly/Pro-rich.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.S379W(1)|p.S293W(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		GCCCCCACCTCGGACCCCTGG	0.751																																							uc002qlw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(877-879)TCG>TGG		epsin 1 isoform b							18.0	22.0	21.0					19																	56203235		1805	4042	5847	SO:0001583	missense	29924				endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|cytoplasm|nucleus|plasma membrane	lipid binding	g.chr19:56203235C>G	AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.878C>G	19.37:g.56203235C>G	ENSP00000270460:p.Ser293Trp					EPN1_uc002qlv.2_Missense_Mutation_p.S268W|EPN1_uc010etd.2_Missense_Mutation_p.S293W|EPN1_uc002qlx.2_Missense_Mutation_p.S379W	p.S293W	NM_001130072	NP_001123544	Q9Y6I3	EPN1_HUMAN		GBM - Glioblastoma multiforme(193;0.112)	7	1220	+		Colorectal(82;0.00244)|Ovarian(87;0.133)	293			Ala/Gly/Pro-rich.|8 X 3 AA repeats of [ED]-P-W.		Q86ST3|Q9HA18	Missense_Mutation	SNP	ENST00000270460.6	37	c.878C>G	CCDS46199.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.516941	0.44763	.	.	ENSG00000063245	ENST00000270460;ENST00000085079;ENST00000544375;ENST00000411543	T;T;T	0.16324	2.39;2.36;2.35	3.05	3.05	0.35203	.	0.402839	0.24511	N	0.037894	T	0.32734	0.0839	L	0.49126	1.545	0.80722	D	1	D;D;D;D	0.67145	0.993;0.985;0.993;0.996	P;P;P;D	0.65684	0.867;0.821;0.867;0.937	T	0.14172	-1.0482	10	0.66056	D	0.02	-10.8893	14.0049	0.64456	0.0:1.0:0.0:0.0	.	254;379;293;268	B4DU91;Q9Y6I3-1;Q9Y6I3;Q9Y6I3-3	.;.;EPN1_HUMAN;.	W	293;268;254;379	ENSP00000270460:S293W;ENSP00000085079:S268W;ENSP00000406209:S379W	ENSP00000085079:S268W	S	+	2	0	EPN1	60895047	0.438000	0.25602	0.785000	0.31869	0.609000	0.37215	3.541000	0.53618	2.030000	0.59900	0.462000	0.41574	TCG		0.751	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453610.1	NM_013333		4	59	0	0	0	0.001168	0	4	59				
APOB	338	broad.mit.edu	37	2	21255418	21255419	+	Missense_Mutation	DNP	TG	TG	GT			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:21255418_21255419TG>GT	ENST00000233242.1	-	10	1286_1287	c.1159_1160CA>AC	c.(1159-1161)CAg>ACg	p.Q387T	APOB_ENST00000399256.4_Missense_Mutation_p.Q387T	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	387	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.Q387T(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCACTGAGGCTGTCCACACTGA	0.51																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(1159-1161)CAG>ACG		apolipoprotein B precursor	Atorvastatin(DB01076)																																			SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21255418_21255419TG>GT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1159_1160delinsGT	2.37:g.21255418_21255419delinsGT	ENSP00000233242:p.Gln387Thr						p.Q387T	NM_000384	NP_000375	P04114	APOB_HUMAN			10	1287_1288	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		387			Vitellogenin.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	DNP	ENST00000233242.1	37	c.1159_1160CA>AC	CCDS1703.1																																																																																				0.510	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			12	51	0	0	0	0.004672	0	12	51				
EPT1	85465	broad.mit.edu	37	2	26587740	26587740	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:26587740C>T	ENST00000260585.7	+	3	286	c.167C>T	c.(166-168)tCt>tTt	p.S56F		NM_033505.2	NP_277040.1	Q9C0D9	EPT1_HUMAN	ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)	56					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)	p.S56F(1)									ATAACTTTTTCTGGCTTTCTG	0.318																																							uc010ykz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(166-168)TCT>TTT		selenoprotein I							103.0	93.0	96.0					2																	26587740		1804	4062	5866	SO:0001583	missense	85465				phospholipid biosynthetic process	integral to membrane	ethanolaminephosphotransferase activity|metal ion binding	g.chr2:26587740C>T		CCDS46240.1	2p23.3	2012-03-01			ENSG00000138018	ENSG00000138018	2.7.8.1		29361	protein-coding gene	gene with protein product	"""selenoprotein I"""	607915				11214970, 17132865	Standard	NM_033505		Approved	KIAA1724, SELI, SEPI	uc021veu.1	Q9C0D9	OTTHUMG00000151931	ENST00000260585.7:c.167C>T	2.37:g.26587740C>T	ENSP00000260585:p.Ser56Phe					EPT1_uc010eyl.1_RNA	p.S56F	NM_033505	NP_277040	Q9C0D9	EPT1_HUMAN			3	314	+			56			Helical; (Potential).		Q63ZE3	Missense_Mutation	SNP	ENST00000260585.7	37	c.167C>T	CCDS46240.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839717	0.71488	.	.	ENSG00000138018	ENST00000442141;ENST00000260585;ENST00000447170	T;T	0.38887	1.11;1.11	5.96	5.96	0.96718	.	0.097213	0.64402	D	0.000001	T	0.62853	0.2462	M	0.75615	2.305	0.48185	D	0.999601	D	0.63880	0.993	D	0.67103	0.949	T	0.60964	-0.7158	10	0.42905	T	0.14	-26.7901	14.5785	0.68268	0.0:0.8541:0.1458:0.0	.	56	Q9C0D9	EPT1_HUMAN	F	24;56;56	ENSP00000415280:S24F;ENSP00000260585:S56F	ENSP00000260585:S56F	S	+	2	0	EPT1	26441244	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	3.350000	0.52224	2.832000	0.97577	0.655000	0.94253	TCT		0.318	EPT1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000324484.3	NM_033505.2		14	61	0	0	0	0.008871	0	14	61				
MDH1	4190	broad.mit.edu	37	2	63824683	63824683	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:63824683A>G	ENST00000233114.8	+	4	785	c.350A>G	c.(349-351)gAt>gGt	p.D117G	MDH1_ENST00000409476.1_Intron|MDH1_ENST00000544381.1_Missense_Mutation_p.D28G|MDH1_ENST00000409908.1_Intron|MDH1_ENST00000539945.1_Missense_Mutation_p.D135G|MDH1_ENST00000394423.1_Missense_Mutation_p.D117G	NM_005917.3	NP_005908.1	P40925	MDHC_HUMAN	malate dehydrogenase 1, NAD (soluble)	117					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|malate metabolic process (GO:0006108)|NADH metabolic process (GO:0006734)|oxaloacetate metabolic process (GO:0006107)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	diiodophenylpyruvate reductase activity (GO:0047860)|L-malate dehydrogenase activity (GO:0030060)|malic enzyme activity (GO:0004470)|NAD binding (GO:0051287)	p.D117G(1)		endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(4)	13						GCAGCCTTAGATAAATACGCC	0.383																																							uc002scj.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)	2						c.(349-351)GAT>GGT		cytosolic malate dehydrogenase	NADH(DB00157)						79.0	79.0	79.0					2																	63824683		2203	4300	6503	SO:0001583	missense	4190				gluconeogenesis|tricarboxylic acid cycle	centrosome|cytosol	L-malate dehydrogenase activity|malic enzyme activity	g.chr2:63824683A>G		CCDS1874.1, CCDS56121.1, CCDS56122.1	2p23	2012-10-02			ENSG00000014641	ENSG00000014641	1.1.1.37		6970	protein-coding gene	gene with protein product		154200					Standard	NM_005917		Approved		uc010ypv.2	P40925	OTTHUMG00000129512	ENST00000233114.8:c.350A>G	2.37:g.63824683A>G	ENSP00000233114:p.Asp117Gly					MDH1_uc010ypv.1_Missense_Mutation_p.D135G|MDH1_uc010ypw.1_Missense_Mutation_p.D22G	p.D117G	NM_005917	NP_005908	P40925	MDHC_HUMAN			4	406	+			117					B2R5V5|B4DUN2|B7Z3I7|F5H098|Q6I9V0	Missense_Mutation	SNP	ENST00000233114.8	37	c.350A>G	CCDS1874.1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.131027	0.56828	.	.	ENSG00000014641	ENST00000233114;ENST00000436321;ENST00000432309;ENST00000539945;ENST00000544381;ENST00000394423	D;D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37;-2.37	5.42	5.42	0.78866	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.402814	0.31347	N	0.007820	D	0.91030	0.7178	L	0.52823	1.66	0.58432	D	0.999991	B;B	0.30281	0.142;0.275	B;P	0.46076	0.2;0.503	D	0.90508	0.4479	10	0.56958	D	0.05	-11.3572	15.7558	0.78021	1.0:0.0:0.0:0.0	.	135;117	F5H098;P40925	.;MDHC_HUMAN	G	117;72;135;135;28;117	ENSP00000233114:D117G;ENSP00000394504:D72G;ENSP00000410073:D135G;ENSP00000438144:D135G;ENSP00000446395:D28G;ENSP00000377945:D117G	ENSP00000233114:D117G	D	+	2	0	MDH1	63678187	1.000000	0.71417	0.924000	0.36721	0.567000	0.35839	9.229000	0.95273	2.183000	0.69458	0.533000	0.62120	GAT		0.383	MDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251687.1			3	41	0	0	0	0.004672	0	3	41				
ETAA1	54465	broad.mit.edu	37	2	67630780	67630780	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:67630780G>A	ENST00000272342.5	+	5	1096	c.966G>A	c.(964-966)gaG>gaA	p.E322E	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	322						cytoplasm (GO:0005737)		p.E322E(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						TGAAAGAGGAGAAAATCATTA	0.373																																							uc002sdz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(1)	4						c.(964-966)GAG>GAA		ETAA16 protein							53.0	57.0	55.0					2																	67630780		2203	4300	6503	SO:0001819	synonymous_variant	54465					cytoplasm|nucleus		g.chr2:67630780G>A	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.966G>A	2.37:g.67630780G>A							p.E322E	NM_019002	NP_061875	Q9NY74	ETAA1_HUMAN			5	1105	+			322					Q05BT7|Q53SC4	Silent	SNP	ENST00000272342.5	37	c.966G>A	CCDS1882.1																																																																																				0.373	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002		4	84	0	0	0	0.000602	0	4	84				
BMP10	27302	broad.mit.edu	37	2	69093486	69093486	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:69093486C>A	ENST00000295379.1	-	2	710	c.552G>T	c.(550-552)ctG>ctT	p.L184L		NM_014482.1	NP_055297.1	O95393	BMP10_HUMAN	bone morphogenetic protein 10	184					activin receptor signaling pathway (GO:0032924)|adult heart development (GO:0007512)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heart trabecula formation (GO:0060347)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction (GO:0055117)|sarcomere organization (GO:0045214)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Z disc (GO:0030018)	hormone activity (GO:0005179)|receptor serine/threonine kinase binding (GO:0033612)	p.L184L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(15)|ovary(2)	27						ACACCAAGACCAGCATGTTTC	0.463																																							uc002sez.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(550-552)CTG>CTT		bone morphogenetic protein 10 preproprotein							138.0	110.0	120.0					2																	69093486		2203	4300	6503	SO:0001819	synonymous_variant	27302				activin receptor signaling pathway|adult heart development|atrial cardiac muscle tissue morphogenesis|BMP signaling pathway|cardiac muscle cell proliferation|heart trabecula formation|negative regulation of cardiac muscle hypertrophy|negative regulation of cell growth|negative regulation of endothelial cell migration|Notch signaling pathway|pathway-restricted SMAD protein phosphorylation|positive regulation of cardiac muscle cell proliferation|positive regulation of cardiac muscle hypertrophy|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent|sarcomere organization|ventricular cardiac muscle cell development|ventricular cardiac muscle tissue morphogenesis	cell surface|extracellular space|Z disc	cytokine activity|growth factor activity|receptor serine/threonine kinase binding	g.chr2:69093486C>A	AF101441	CCDS1890.1	2p13.2	2014-09-17			ENSG00000163217	ENSG00000163217		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	20869	protein-coding gene	gene with protein product		608748				10072785	Standard	NM_014482		Approved		uc002sez.1	O95393	OTTHUMG00000129573	ENST00000295379.1:c.552G>T	2.37:g.69093486C>A							p.L184L	NM_014482	NP_055297	O95393	BMP10_HUMAN			2	711	-			184					Q53R17|Q6NTE0	Silent	SNP	ENST00000295379.1	37	c.552G>T	CCDS1890.1																																																																																				0.463	BMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251768.1	NM_014482		14	99	1	0	4.3838e-07	0.001855	5.48701e-07	14	99				
GKN1	56287	broad.mit.edu	37	2	69206066	69206066	+	Missense_Mutation	SNP	G	G	T	rs188500710	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:69206066G>T	ENST00000377938.2	+	4	373	c.310G>T	c.(310-312)Gtc>Ttc	p.V104F		NM_019617.3	NP_062563.3	Q9NS71	GKN1_HUMAN	gastrokine 1	104	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				digestion (GO:0007586)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)	extracellular region (GO:0005576)|secretory granule (GO:0030141)		p.V104F(1)		breast(2)|large_intestine(4)|lung(5)	11						GAACAAGGAAGTCATGCCCTC	0.408																																							uc002sfc.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(310-312)GTC>TTC		18 kDa antrum mucosa protein precursor		G	PHE/VAL	1,4405	2.1+/-5.4	0,1,2202	97.0	87.0	91.0		310	3.8	0.0	2		91	0,8600		0,0,4300	yes	missense	GKN1	NM_019617.3	50	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	probably-damaging	104/200	69206066	1,13005	2203	4300	6503	SO:0001583	missense	56287				digestion|positive regulation of cell division	extracellular region		g.chr2:69206066G>T	AY139182	CCDS1891.2	2p13.3	2012-10-10			ENSG00000169605	ENSG00000169605		"""BRICHOS domain containing"""	23217	protein-coding gene	gene with protein product	"""BRICHOS domain containing 1"""	606402				12851218, 11562744	Standard	NM_019617		Approved	AMP18, CA11, BRICD1	uc002sfc.3	Q9NS71	OTTHUMG00000129574	ENST00000377938.2:c.310G>T	2.37:g.69206066G>T	ENSP00000367172:p.Val104Phe						p.V104F	NM_019617	NP_062563	Q9NS71	GKN1_HUMAN			4	373	+			104			BRICHOS.		Q8IUA9	Missense_Mutation	SNP	ENST00000377938.2	37	c.310G>T	CCDS1891.2	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931644	0.34096	2.27E-4	0.0	ENSG00000169605	ENST00000377938	T	0.79749	-1.3	5.61	3.8	0.43715	BRICHOS (2);	0.954853	0.08775	N	0.895734	D	0.84524	0.5491	M	0.70275	2.135	0.09310	N	1	D	0.54397	0.966	P	0.55455	0.776	T	0.70872	-0.4754	10	0.72032	D	0.01	-1.6714	4.4899	0.11808	0.0813:0.1543:0.6046:0.1598	.	104	Q9NS71	GKN1_HUMAN	F	104	ENSP00000367172:V104F	ENSP00000367172:V104F	V	+	1	0	GKN1	69059570	0.015000	0.18098	0.001000	0.08648	0.337000	0.28794	2.030000	0.41108	0.917000	0.36895	0.650000	0.86243	GTC		0.408	GKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251769.2	NM_019617		13	68	1	0	3.45872e-05	0.004007	4.03517e-05	13	68				
ZNF638	27332	broad.mit.edu	37	2	71592757	71592757	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:71592757G>T	ENST00000409544.1	+	6	2546	c.1916G>T	c.(1915-1917)tGt>tTt	p.C639F	ZNF638_ENST00000355812.3_Missense_Mutation_p.C639F|ZNF638_ENST00000264447.4_Missense_Mutation_p.C639F|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000377802.2_Missense_Mutation_p.C639F	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	639					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.C639F(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TCTATTCGTTGTAAATCAAAG	0.358																																							uc002shx.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(1915-1917)TGT>TTT		zinc finger protein 638							68.0	67.0	67.0					2																	71592757		2203	4300	6503	SO:0001583	missense	27332				RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr2:71592757G>T	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1916G>T	2.37:g.71592757G>T	ENSP00000386433:p.Cys639Phe					ZNF638_uc010fec.2_Missense_Mutation_p.C745F|ZNF638_uc010yqw.1_Missense_Mutation_p.C218F|ZNF638_uc002shw.2_Missense_Mutation_p.C639F|ZNF638_uc002shy.2_Missense_Mutation_p.C639F|ZNF638_uc002shz.2_Missense_Mutation_p.C639F|ZNF638_uc002sia.2_Missense_Mutation_p.C639F|ZNF638_uc002sib.1_Missense_Mutation_p.C639F|ZNF638_uc010fed.2_RNA	p.C639F	NM_014497	NP_055312	Q14966	ZN638_HUMAN			6	2235	+			639					B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	c.1916G>T	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	6.141	0.394170	0.11638	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000394137;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.72051	-0.03;-0.62;0.58;-0.02;1.58;1.58	3.93	1.46	0.22682	.	0.882556	0.09693	N	0.768098	T	0.42562	0.1208	N	0.08118	0	0.24437	N	0.994544	B;B;B;B;B;B	0.18610	0.004;0.029;0.009;0.004;0.002;0.003	B;B;B;B;B;B	0.11329	0.002;0.006;0.004;0.003;0.001;0.004	T	0.26360	-1.0105	10	0.10111	T	0.7	.	3.4575	0.07521	0.6355:0.2338:0.1307:0.0	.	639;745;639;639;639;639	A8K583;F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;.;ZN638_HUMAN;.	F	639;745;218;639;639;639;639	ENSP00000386669:C639F;ENSP00000438189:C745F;ENSP00000348066:C639F;ENSP00000367033:C639F;ENSP00000264447:C639F;ENSP00000386433:C639F	ENSP00000264447:C639F	C	+	2	0	ZNF638	71446265	0.975000	0.34042	0.979000	0.43373	0.971000	0.66376	1.589000	0.36644	0.117000	0.18138	-0.471000	0.05019	TGT		0.358	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		16	52	1	0	3.45872e-05	0.004007	4.03517e-05	16	52				
REG1B	5968	broad.mit.edu	37	2	79314006	79314006	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:79314006C>A	ENST00000305089.3	-	3	195	c.115G>T	c.(115-117)Ggc>Tgc	p.G39C		NM_006507.3	NP_006498.1	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta	39	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell proliferation (GO:0008283)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)	p.G39C(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(40)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	51						GCATTGGTGCCTTCTGGGCAG	0.517																																							uc002sny.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(115-117)GGC>TGC		regenerating islet-derived 1 beta precursor							147.0	145.0	146.0					2																	79314006		2203	4300	6503	SO:0001583	missense	5968				cell proliferation	extracellular region	sugar binding	g.chr2:79314006C>A		CCDS1963.1	2p12	2008-06-04	2008-06-04		ENSG00000172023	ENSG00000172023			9952	protein-coding gene	gene with protein product	"""lithostathine 1 beta"", ""secretory pancreatic stone protein 2"""	167771	"""regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein)"""			8110835	Standard	NM_006507		Approved	REGL, PSPS2, REGH, REGI-BETA	uc002sny.2	P48304	OTTHUMG00000130019	ENST00000305089.3:c.115G>T	2.37:g.79314006C>A	ENSP00000303206:p.Gly39Cys					REG1B_uc010ffv.1_Missense_Mutation_p.G39C|REG1B_uc010ffw.2_Missense_Mutation_p.G39C	p.G39C	NM_006507	NP_006498	P48304	REG1B_HUMAN			3	227	-			39			C-type lectin.			Missense_Mutation	SNP	ENST00000305089.3	37	c.115G>T	CCDS1963.1	.	.	.	.	.	.	.	.	.	.	c	17.51	3.408537	0.62399	.	.	ENSG00000172023	ENST00000305089	T	0.12672	2.66	3.74	3.74	0.42951	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.000000	0.39687	N	0.001281	T	0.46014	0.1371	H	0.94503	3.545	0.34649	D	0.721479	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.68360	-0.5429	10	0.87932	D	0	.	11.2197	0.48846	0.0:1.0:0.0:0.0	.	39;39	Q6ICS1;P48304	.;REG1B_HUMAN	C	39	ENSP00000303206:G39C	ENSP00000303206:G39C	G	-	1	0	REG1B	79167514	0.169000	0.23002	0.898000	0.35279	0.975000	0.68041	2.976000	0.49289	2.087000	0.62958	0.561000	0.74099	GGC		0.517	REG1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252292.2	NM_006507		53	232	1	0	2.14255e-21	0.01441	3.69248e-21	53	232				
REG3A	5068	broad.mit.edu	37	2	79385822	79385822	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:79385822G>C	ENST00000409839.3	-	3	186	c.150C>G	c.(148-150)caC>caG	p.H50Q	REG3A_ENST00000305165.2_Missense_Mutation_p.H50Q|AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000393878.1_Missense_Mutation_p.H50Q	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	50	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)	p.H50Q(1)		breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						AGGCATAGCAGTGGGAGCCAT	0.572																																							uc002sod.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(148-150)CAC>CAG		pancreatitis-associated protein precursor							109.0	98.0	101.0					2																	79385822		2203	4300	6503	SO:0001583	missense	5068				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding	g.chr2:79385822G>C	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.150C>G	2.37:g.79385822G>C	ENSP00000386630:p.His50Gln					REG3A_uc002soe.1_Missense_Mutation_p.H50Q|REG3A_uc002sof.1_Missense_Mutation_p.H50Q	p.H50Q	NM_138938	NP_620355	Q06141	REG3A_HUMAN			2	405	-			50			C-type lectin.			Missense_Mutation	SNP	ENST00000409839.3	37	c.150C>G	CCDS1965.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987460	0.35036	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.14893	2.47;2.47;2.47	3.87	2.07	0.26955	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.576639	0.15737	N	0.247095	T	0.23965	0.0580	M	0.86420	2.815	0.25133	N	0.990559	P	0.40578	0.722	B	0.39738	0.308	T	0.17319	-1.0373	10	0.66056	D	0.02	.	5.9472	0.19225	0.2362:0.0:0.7638:0.0	.	50	Q06141	REG3A_HUMAN	Q	50	ENSP00000386630:H50Q;ENSP00000377456:H50Q;ENSP00000304311:H50Q	ENSP00000304311:H50Q	H	-	3	2	REG3A	79239330	0.957000	0.32711	0.818000	0.32626	0.035000	0.12851	0.631000	0.24568	0.607000	0.29982	0.603000	0.83216	CAC		0.572	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252290.2	NM_002580		5	61	0	0	0	0.000602	0	5	61				
TCF7L1	83439	broad.mit.edu	37	2	85533621	85533621	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:85533621C>T	ENST00000282111.3	+	10	1471	c.1196C>T	c.(1195-1197)gCc>gTc	p.A399V		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	399					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A399V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						TACGAGCTGGCCCGGAAGGAG	0.612																																							uc002soy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)|central_nervous_system(1)	3						c.(1195-1197)GCC>GTC		HMG-box transcription factor TCF-3							71.0	66.0	68.0					2																	85533621		2203	4300	6503	SO:0001583	missense	83439				chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:85533621C>T	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.1196C>T	2.37:g.85533621C>T	ENSP00000282111:p.Ala399Val						p.A399V	NM_031283	NP_112573	Q9HCS4	TF7L1_HUMAN			10	1270	+			399			HMG box.		Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000282111.3	37	c.1196C>T	CCDS1971.1	.	.	.	.	.	.	.	.	.	.	C	32	5.115886	0.94339	.	.	ENSG00000152284	ENST00000282111	D	0.98732	-5.1	4.74	4.74	0.60224	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.99513	0.9826	H	0.98769	4.325	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	D	0.97805	1.0247	10	0.87932	D	0	.	15.271	0.73702	0.0:1.0:0.0:0.0	.	399	Q9HCS4	TF7L1_HUMAN	V	399	ENSP00000282111:A399V	ENSP00000282111:A399V	A	+	2	0	TCF7L1	85387132	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	7.613000	0.82986	2.461000	0.83175	0.579000	0.79373	GCC		0.612	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283		13	55	0	0	0	0.00499	0	13	55				
ARID5A	10865	broad.mit.edu	37	2	97217674	97217674	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:97217674A>T	ENST00000357485.3	+	7	1487	c.1409A>T	c.(1408-1410)gAt>gTt	p.D470V	ARID5A_ENST00000454558.2_Missense_Mutation_p.D402V	NM_212481.1	NP_997646.1	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A (MRF1-like)	470					chondrocyte differentiation (GO:0002062)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.D470V(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(2)	14						AAGGAGGCGGATGCCAAGAAG	0.672																																							uc002swe.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1408-1410)GAT>GTT		AT rich interactive domain 5A							26.0	27.0	26.0					2																	97217674		2199	4297	6496	SO:0001583	missense	10865				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding	g.chr2:97217674A>T	M62324	CCDS33251.1	2p11.1	2013-02-07			ENSG00000196843	ENSG00000196843		"""-"""	17361	protein-coding gene	gene with protein product	"""modulator recognition factor 1"""	611583				8649988	Standard	NM_212481		Approved	MRF-1, RP11-363D14	uc002swe.3	Q03989	OTTHUMG00000155229	ENST00000357485.3:c.1409A>T	2.37:g.97217674A>T	ENSP00000350078:p.Asp470Val					ARID5A_uc010yuq.1_Missense_Mutation_p.D418V|ARID5A_uc002swf.2_Missense_Mutation_p.D306V|ARID5A_uc002swg.2_Missense_Mutation_p.D418V	p.D470V	NM_212481	NP_997646	Q03989	ARI5A_HUMAN			7	1509	+			470					Q6NX37	Missense_Mutation	SNP	ENST00000357485.3	37	c.1409A>T	CCDS33251.1	.	.	.	.	.	.	.	.	.	.	A	12.31	1.899130	0.33535	.	.	ENSG00000196843	ENST00000357485;ENST00000359765;ENST00000454558	T	0.69806	-0.43	5.31	4.15	0.48705	.	17.086600	0.00357	N	0.000036	T	0.68906	0.3052	L	0.51422	1.61	0.39216	D	0.963405	D;P;P	0.54397	0.966;0.808;0.895	P;B;B	0.47299	0.543;0.368;0.368	T	0.66460	-0.5918	10	0.87932	D	0	-11.1415	7.3017	0.26424	0.9024:0.0:0.0976:0.0	.	470;402;470	A6NM59;C9J1Q0;Q03989	.;.;ARI5A_HUMAN	V	470;470;402	ENSP00000350078:D470V	ENSP00000350078:D470V	D	+	2	0	ARID5A	96581401	0.946000	0.32159	0.027000	0.17364	0.020000	0.10135	3.039000	0.49791	2.134000	0.65973	0.528000	0.53228	GAT		0.672	ARID5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338888.2	NM_212481		9	30	0	0	0	0.008291	0	9	30				
SLC9A2	6549	broad.mit.edu	37	2	103311549	103311549	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:103311549G>C	ENST00000233969.2	+	7	1705	c.1563G>C	c.(1561-1563)tgG>tgC	p.W521C	SLC9A2_ENST00000469286.1_3'UTR	NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	521					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.W521C(1)		breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						GTGGACATTGGGGTCACAACT	0.373																																							uc002tca.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|skin(3)|breast(2)	8						c.(1561-1563)TGG>TGC		solute carrier family 9 (sodium/hydrogen							225.0	223.0	224.0					2																	103311549		2203	4300	6503	SO:0001583	missense	6549					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity	g.chr2:103311549G>C		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1563G>C	2.37:g.103311549G>C	ENSP00000233969:p.Trp521Cys						p.W521C	NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN			7	1705	+			521			Cytoplasmic (Potential).		B2RMS2	Missense_Mutation	SNP	ENST00000233969.2	37	c.1563G>C	CCDS2062.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180320	0.78677	.	.	ENSG00000115616	ENST00000233969	T	0.57273	0.41	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.71178	0.3309	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	P	0.62491	0.903	T	0.68569	-0.5374	10	0.42905	T	0.14	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	521	Q9UBY0	SL9A2_HUMAN	C	521	ENSP00000233969:W521C	ENSP00000233969:W521C	W	+	3	0	SLC9A2	102677981	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.583000	0.82559	2.793000	0.96121	0.655000	0.94253	TGG		0.373	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2			13	219	0	0	0	0.003163	0	13	219				
C2orf49	79074	broad.mit.edu	37	2	105959478	105959478	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:105959478C>G	ENST00000258457.2	+	3	669	c.440C>G	c.(439-441)tCg>tGg	p.S147W	C2orf49_ENST00000410049.1_Intron|C2orf49_ENST00000437250.2_Intron			Q9BVC5	ASHWN_HUMAN	chromosome 2 open reading frame 49	147					embryonic morphogenesis (GO:0048598)	tRNA-splicing ligase complex (GO:0072669)				endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6						AATTCCTCTTCGAGTGTTTCA	0.393																																							uc002tcs.1		NA																	0					0						c.(439-441)TCG>TGG		ashwin							110.0	109.0	109.0					2																	105959478		2203	4300	6503	SO:0001583	missense	79074					tRNA-splicing ligase complex		g.chr2:105959478C>G	BC001310	CCDS2068.1, CCDS74550.1	2q12.2	2009-04-22			ENSG00000135974	ENSG00000135974			28772	protein-coding gene	gene with protein product	"""ashwin"""					12477932	Standard	NM_001286537		Approved	MGC5509, asw	uc002tcs.1	Q9BVC5	OTTHUMG00000130808	ENST00000258457.2:c.440C>G	2.37:g.105959478C>G	ENSP00000258457:p.Ser147Trp					C2orf49_uc010fjd.1_Intron	p.S147W	NM_024093	NP_076998	Q9BVC5	ASHWN_HUMAN			3	472	+			147					B3KXN3|B4E2G9	Missense_Mutation	SNP	ENST00000258457.2	37	c.440C>G	CCDS2068.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993746	0.74703	.	.	ENSG00000135974	ENST00000258457	T	0.47869	0.83	4.6	4.6	0.57074	.	0.907716	0.09219	N	0.832121	T	0.67002	0.2847	L	0.54323	1.7	0.80722	D	1	D	0.59357	0.985	D	0.67548	0.952	T	0.64575	-0.6375	10	0.87932	D	0	-0.3198	17.622	0.88084	0.0:1.0:0.0:0.0	.	147	Q9BVC5	ASHWN_HUMAN	W	147	ENSP00000258457:S147W	ENSP00000258457:S147W	S	+	2	0	C2orf49	105325910	0.821000	0.29204	0.892000	0.35008	0.985000	0.73830	3.918000	0.56432	2.366000	0.80165	0.650000	0.86243	TCG		0.393	C2orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253353.2	NM_024093		4	151	0	0	0	0.000602	0	4	151				
SULT1C4	27233	broad.mit.edu	37	2	108998221	108998221	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:108998221C>A	ENST00000272452.2	+	2	499	c.173C>A	c.(172-174)aCa>aAa	p.T58K	SULT1C4_ENST00000409309.3_Missense_Mutation_p.T58K	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	58					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)	p.T58K(1)		endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						ACGTAAGGAACAACATGGACT	0.353																																							uc002tea.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(172-174)ACA>AAA		sulfotransferase family, cytosolic, 1C, member							113.0	101.0	105.0					2																	108998221		2203	4300	6503	SO:0001583	missense	27233				3'-phosphoadenosine 5'-phosphosulfate metabolic process|sulfation|xenobiotic metabolic process	cytosol	sulfotransferase activity	g.chr2:108998221C>A	AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.173C>A	2.37:g.108998221C>A	ENSP00000272452:p.Thr58Lys					SULT1C4_uc002tdz.2_Missense_Mutation_p.T58K|SULT1C4_uc010ywr.1_RNA|SULT1C4_uc002teb.1_Missense_Mutation_p.T58K	p.T58K	NM_006588	NP_006579	O75897	ST1C4_HUMAN			2	546	+			58			PAPS.		Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000272452.2	37	c.173C>A	CCDS2077.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516166	0.85495	.	.	ENSG00000198075	ENST00000272452;ENST00000409309	T;T	0.05199	3.48;3.48	4.33	4.33	0.51752	Sulfotransferase domain (1);	0.000000	0.52532	D	0.000061	T	0.42177	0.1191	H	0.98682	4.3	0.45118	D	0.998134	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.998	T	0.66504	-0.5907	10	0.87932	D	0	.	16.3402	0.83080	0.0:1.0:0.0:0.0	.	58;58;58	Q08AS5;O75897;Q6PD90	.;ST1C4_HUMAN;.	K	58	ENSP00000272452:T58K;ENSP00000387225:T58K	ENSP00000272452:T58K	T	+	2	0	SULT1C4	108364653	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	5.842000	0.69417	2.393000	0.81446	0.609000	0.83330	ACA		0.353	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588		19	94	1	0	1.01871e-10	0.008871	1.44764e-10	19	94				
CNTNAP5	129684	broad.mit.edu	37	2	125660630	125660630	+	Missense_Mutation	SNP	T	T	C	rs371254240		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:125660630T>C	ENST00000431078.1	+	22	3969	c.3605T>C	c.(3604-3606)aTg>aCg	p.M1202T		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1202					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.M1202T(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGTGGCTTCATGGTGGACTCA	0.532																																							uc002tno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(10)	10						c.(3604-3606)ATG>ACG		contactin associated protein-like 5 precursor		T	THR/MET	0,4220		0,0,2110	60.0	59.0	59.0		3605	2.8	0.0	2		59	2,8462		0,2,4230	no	missense	CNTNAP5	NM_130773.2	81	0,2,6340	CC,CT,TT		0.0236,0.0,0.0158	benign	1202/1307	125660630	2,12682	2110	4232	6342	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125660630T>C	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3605T>C	2.37:g.125660630T>C	ENSP00000399013:p.Met1202Thr					CNTNAP5_uc010flu.2_Missense_Mutation_p.M1203T	p.M1202T	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	22	3969	+			1202			Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.3605T>C	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	T	1.496	-0.553432	0.03996	0.0	2.36E-4	ENSG00000155052	ENST00000431078	D	0.87179	-2.22	5.26	2.76	0.32466	.	0.605156	0.14798	N	0.297797	T	0.75613	0.3873	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.56257	-0.8009	10	0.13108	T	0.6	.	7.6401	0.28288	0.0:0.0746:0.1405:0.7849	.	1202	Q8WYK1	CNTP5_HUMAN	T	1202	ENSP00000399013:M1202T	ENSP00000399013:M1202T	M	+	2	0	CNTNAP5	125377100	0.038000	0.19896	0.001000	0.08648	0.618000	0.37518	2.610000	0.46325	0.278000	0.22164	0.459000	0.35465	ATG		0.532	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			3	17	0	0	0	0.009096	0	3	17				
ZEB2	9839	broad.mit.edu	37	2	145157678	145157678	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:145157678G>C	ENST00000558170.2	-	8	2260	c.1076C>G	c.(1075-1077)tCt>tGt	p.S359C	ZEB2_ENST00000409487.3_Missense_Mutation_p.S359C|ZEB2_ENST00000303660.4_Missense_Mutation_p.S359C|ZEB2_ENST00000539609.3_Missense_Mutation_p.S335C	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	359					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.S359C(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		AGTAGGAGAAGAAGAAACAGA	0.373																																					Melanoma(33;1235 1264 5755 16332)	Melanoma(33;1235 1264 5755 16332)	uc002tvu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9						c.(1075-1077)TCT>TGT		zinc finger homeobox 1b							74.0	73.0	73.0					2																	145157678		2203	4300	6503	SO:0001583	missense	9839					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding	g.chr2:145157678G>C	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.1076C>G	2.37:g.145157678G>C	ENSP00000454157:p.Ser359Cys					ZEB2_uc002tvv.2_Missense_Mutation_p.S353C|ZEB2_uc010zbm.1_Missense_Mutation_p.S330C|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.S388C	p.S359C	NM_014795	NP_055610	O60315	ZEB2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	8	1556	-			359					A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	c.1076C>G	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.014230	0.54468	.	.	ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861	T;T;T;T;T	0.14516	2.51;2.5;2.5;2.62;2.57	5.64	5.64	0.86602	.	0.095838	0.85682	D	0.000000	T	0.33933	0.0880	L	0.50333	1.59	0.80722	D	1	D;D;P;D	0.63880	0.993;0.992;0.94;0.969	D;P;P;P	0.67548	0.952;0.751;0.62;0.873	T	0.01290	-1.1394	10	0.87932	D	0	-7.8099	19.7156	0.96119	0.0:0.0:1.0:0.0	.	335;224;358;359	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	C	354;335;359;359;359;359	ENSP00000443792:S335C;ENSP00000302501:S359C;ENSP00000386854:S359C;ENSP00000395496:S359C;ENSP00000376601:S359C	ENSP00000302501:S359C	S	-	2	0	ZEB2	144874148	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.658000	0.90341	0.655000	0.94253	TCT		0.373	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795		18	61	0	0	0	0.006122	0	18	61				
NEB	4703	broad.mit.edu	37	2	152387542	152387542	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:152387542A>T	ENST00000172853.10	-	117	16640	c.16493T>A	c.(16492-16494)cTg>cAg	p.L5498Q	NEB_ENST00000427231.2_Missense_Mutation_p.L7199Q|NEB_ENST00000604864.1_Missense_Mutation_p.L7199Q|NEB_ENST00000397345.3_Missense_Mutation_p.L7199Q|NEB_ENST00000409198.1_Missense_Mutation_p.L5498Q|NEB_ENST00000603639.1_Missense_Mutation_p.L7199Q			P20929	NEBU_HUMAN	nebulin	5498					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.L7199Q(1)|p.L5498Q(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCGGACATGCAGCAACATGGG	0.423																																							uc010fnx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(16492-16494)CTG>CAG		nebulin isoform 3							182.0	183.0	183.0					2																	152387542		2024	4180	6204	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152387542A>T	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.16493T>A	2.37:g.152387542A>T	ENSP00000172853:p.Leu5498Gln					NEB_uc002txr.2_Missense_Mutation_p.L1921Q|NEB_uc002txt.3_Missense_Mutation_p.L3Q	p.L5498Q	NM_004543	NP_004534	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	117	16684	-			5498			Nebulin 150.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.16493T>A		.	.	.	.	.	.	.	.	.	.	A	21.7	4.184408	0.78677	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	6.07	6.07	0.98685	.	0.062767	0.64402	D	0.000004	T	0.47322	0.1439	N	0.05383	-0.06	0.80722	D	1	P;P;D	0.69078	0.756;0.542;0.997	P;P;D	0.81914	0.456;0.451;0.995	T	0.46205	-0.9208	10	0.12430	T	0.62	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	5498;7199;1929	P20929;F8WCP0;Q14215	NEBU_HUMAN;.;.	Q	5498;7199;7199;1547;1929;5498	ENSP00000386259:L5498Q;ENSP00000380505:L7199Q;ENSP00000416578:L7199Q;ENSP00000410961:L1929Q;ENSP00000172853:L5498Q	ENSP00000172853:L5498Q	L	-	2	0	NEB	152095788	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.402000	0.66332	2.326000	0.78906	0.533000	0.62120	CTG		0.423	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		8	50	0	0	0	0.004482	0	8	50				
IFIH1	64135	broad.mit.edu	37	2	163133444	163133444	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:163133444A>G	ENST00000263642.2	-	11	2452	c.2057T>C	c.(2056-2058)aTg>aCg	p.M686T		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	686					cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.M686T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						CCTTTTCAACATTTTATTGTT	0.318																																							uc002uce.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2056-2058)ATG>ACG		interferon induced with helicase C domain 1							71.0	71.0	71.0					2																	163133444		2203	4299	6502	SO:0001583	missense	64135				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding	g.chr2:163133444A>G	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2057T>C	2.37:g.163133444A>G	ENSP00000263642:p.Met686Thr						p.M686T	NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN			11	2279	-			686					Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	37	c.2057T>C	CCDS2217.1	.	.	.	.	.	.	.	.	.	.	A	1.843	-0.466941	0.04476	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.04454	3.62	5.08	-0.983	0.10263	.	0.390569	0.33382	N	0.004969	T	0.03053	0.0090	L	0.29908	0.895	0.27013	N	0.964634	B	0.15473	0.013	B	0.10450	0.005	T	0.44697	-0.9311	10	0.18276	T	0.48	-0.3759	6.9903	0.24751	0.3819:0.0962:0.0:0.5219	.	686	Q9BYX4	IFIH1_HUMAN	T	686	ENSP00000263642:M686T	ENSP00000263642:M686T	M	-	2	0	IFIH1	162841690	0.003000	0.15002	0.932000	0.37286	0.155000	0.21991	0.284000	0.18864	-0.043000	0.13513	-0.323000	0.08544	ATG		0.318	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168		17	98	0	0	0	0.00499	0	17	98				
KCNH7	90134	broad.mit.edu	37	2	163230172	163230172	+	Splice_Site	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:163230172C>A	ENST00000332142.5	-	15	3231	c.3132G>T	c.(3130-3132)agG>agT	p.R1044S		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	1044					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.R1044S(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GGGATTCAAGCCTACAGAACA	0.423																																					GBM(196;1492 2208 17507 24132 45496)	GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(3130-3132)AGG>AGT		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						89.0	80.0	83.0					2																	163230172		2203	4300	6503	SO:0001630	splice_region_variant	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163230172C>A	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.3132-1G>T	2.37:g.163230172C>A							p.R1044S	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN			15	3344	-			1044			Cytoplasmic (Potential).		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	c.3132G>T	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449159	0.63178	.	.	ENSG00000184611	ENST00000332142	D	0.90385	-2.66	5.99	2.47	0.30058	.	0.000000	0.85682	D	0.000000	D	0.93032	0.7782	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.90702	0.4621	10	0.51188	T	0.08	.	6.8056	0.23777	0.0:0.4732:0.0:0.5268	.	1044	Q9NS40	KCNH7_HUMAN	S	1044	ENSP00000331727:R1044S	ENSP00000331727:R1044S	R	-	3	2	KCNH7	162938418	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	1.761000	0.38440	0.532000	0.28657	-0.302000	0.09304	AGG		0.423	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	Missense_Mutation	7	44	1	0	5.18039e-06	0.00308	6.23627e-06	7	44				
XIRP2	129446	broad.mit.edu	37	2	168106328	168106328	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:168106328G>T	ENST00000409195.1	+	9	8515	c.8426G>T	c.(8425-8427)gGa>gTa	p.G2809V	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.G2587V|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.G2809V|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2634					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.G2809V(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GAATTTAGCGGATCTGACAGA	0.398																																							uc002udx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(8425-8427)GGA>GTA		xin actin-binding repeat containing 2 isoform 1							69.0	68.0	68.0					2																	168106328		1855	4096	5951	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168106328G>T	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.8426G>T	2.37:g.168106328G>T	ENSP00000386840:p.Gly2809Val					XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.G2634V|XIRP2_uc010fpq.2_Missense_Mutation_p.G2587V|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.G155V	p.G2809V	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	8444	+			2634					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.8426G>T	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	3.636	-0.074626	0.07184	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02421	4.3;4.3;4.31	6.02	2.04	0.26737	.	0.737730	0.13531	N	0.380944	T	0.02083	0.0065	N	0.22421	0.69	0.09310	N	1	B;B;B	0.23442	0.051;0.085;0.085	B;B;B	0.21917	0.016;0.037;0.037	T	0.47873	-0.9083	10	0.34782	T	0.22	-2.1874	3.4651	0.07547	0.655:0.1343:0.082:0.1286	.	2634;2634;2587	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	V	2809;2809;2587;223	ENSP00000386840:G2809V;ENSP00000295237:G2809V;ENSP00000387255:G2587V	ENSP00000295237:G2809V	G	+	2	0	XIRP2	167814574	0.113000	0.22115	0.001000	0.08648	0.001000	0.01503	3.299000	0.51826	0.090000	0.17273	-0.345000	0.07892	GGA		0.398	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		24	96	1	0	3.6726e-16	0.003954	5.98381e-16	24	96				
PDE1A	5136	broad.mit.edu	37	2	183053786	183053786	+	Splice_Site	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:183053786C>A	ENST00000410103.1	-	12	1258	c.1175G>T	c.(1174-1176)gGa>gTa	p.G392V	PDE1A_ENST00000331935.6_Splice_Site_p.G392V|PDE1A_ENST00000435564.1_Splice_Site_p.G392V|PDE1A_ENST00000358139.2_Splice_Site_p.G392V|PDE1A_ENST00000346717.4_Splice_Site_p.G358V|PDE1A_ENST00000351439.5_Splice_Site_p.G376V|PDE1A_ENST00000409365.1_Splice_Site_p.G376V|PDE1A_ENST00000456212.1_Splice_Site_p.G392V|PDE1A_ENST00000536095.1_Splice_Site_p.G288V	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent	392	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.G392E(2)|p.G392V(2)		endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TTCTTTATCTCCCTGGAGAAA	0.393																																							uc002uos.2		NA																	4	Substitution - Missense(4)		lung(2)|pancreas(2)	skin(2)|ovary(1)	3						c.(1174-1176)GGA>GTA		phosphodiesterase 1A isoform 2							105.0	114.0	111.0					2																	183053786		2203	4300	6503	SO:0001630	splice_region_variant	5136				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr2:183053786C>A		CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.1174-1G>T	2.37:g.183053786C>A						PDE1A_uc010zfp.1_Missense_Mutation_p.G288V|PDE1A_uc002uoq.1_Missense_Mutation_p.G392V|PDE1A_uc010zfq.1_Missense_Mutation_p.G392V|PDE1A_uc002uor.2_Missense_Mutation_p.G376V|PDE1A_uc002uou.2_Missense_Mutation_p.G358V	p.G392V	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.061)		12	1259	-			392			Catalytic (By similarity).		D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	Missense_Mutation	SNP	ENST00000410103.1	37	c.1175G>T	CCDS33344.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592140	0.86953	.	.	ENSG00000115252	ENST00000435564;ENST00000346717;ENST00000536095;ENST00000409365;ENST00000331935;ENST00000351439;ENST00000410103;ENST00000358139;ENST00000456212	D;D;D;D;D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16;-2.16	5.6	5.6	0.85130	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.104407	0.64402	D	0.000003	D	0.95802	0.8634	H	0.95151	3.63	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;1.0;0.999;0.999	D	0.96581	0.9430	10	0.87932	D	0	.	18.9615	0.92679	0.0:1.0:0.0:0.0	.	288;358;392;376;392	B7Z3A7;P54750-3;P54750;P54750-2;P54750-4	.;.;PDE1A_HUMAN;.;.	V	392;358;288;376;392;376;392;392;392	ENSP00000410309:G392V;ENSP00000329112:G358V;ENSP00000439938:G288V;ENSP00000386767:G376V;ENSP00000331574:G392V;ENSP00000309269:G376V;ENSP00000387037:G392V;ENSP00000350858:G392V;ENSP00000408874:G392V	ENSP00000331574:G392V	G	-	2	0	PDE1A	182762031	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.142000	0.77339	2.793000	0.96121	0.591000	0.81541	GGA		0.393	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334356.1		Missense_Mutation	32	183	1	0	3.90053e-15	0.012213	6.22986e-15	32	183				
DNAJC10	54431	broad.mit.edu	37	2	183582814	183582814	+	Start_Codon_SNP	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:183582814A>G	ENST00000264065.7	+	3	416	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	DNAJC10_ENST00000537515.1_Start_Codon_SNP_p.M1V|DNAJC10_ENST00000469118.1_Intron	NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	1					cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)	p.M1V(1)		breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AAGAAAGAGAATGGGAGTCTG	0.348																																					Pancreas(56;860 1183 25669 35822 48585)	Pancreas(56;860 1183 25669 35822 48585)	uc002uow.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|breast(1)|skin(1)	4						c.(1-3)ATG>GTG		DnaJ (Hsp40) homolog, subfamily C, member 10							75.0	78.0	77.0					2																	183582814		2203	4300	6503	SO:0001582	initiator_codon_variant	54431				apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding	g.chr2:183582814A>G		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.1A>G	2.37:g.183582814A>G	ENSP00000264065:p.Met1Val					DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Missense_Mutation_p.M1V|DNAJC10_uc010fro.1_RNA	p.M1V	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)		3	416	+			1					Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Missense_Mutation	SNP	ENST00000264065.7	37	c.1A>G	CCDS33345.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.107888	0.56291	.	.	ENSG00000077232	ENST00000264065;ENST00000392392;ENST00000537410;ENST00000537515	T;T	0.39787	1.45;1.06	5.62	5.62	0.85841	.	0.043338	0.85682	D	0.000000	T	0.37892	0.1020	.	.	.	0.80722	D	1	B;B	0.32968	0.392;0.272	B;B	0.28553	0.091;0.042	T	0.33471	-0.9867	9	0.87932	D	0	.	15.002	0.71479	1.0:0.0:0.0:0.0	.	1;1	Q8IXB1-2;Q8IXB1	.;DJC10_HUMAN	V	1	ENSP00000264065:M1V;ENSP00000441560:M1V	ENSP00000264065:M1V	M	+	1	0	DNAJC10	183291059	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.097000	0.71452	2.142000	0.66516	0.528000	0.53228	ATG		0.348	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2	NM_018981	Missense_Mutation	3	89	0	0	0	0.004672	0	3	89				
GULP1	51454	broad.mit.edu	37	2	189406035	189406035	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:189406035G>T	ENST00000409580.1	+	8	1103	c.389G>T	c.(388-390)aGc>aTc	p.S130I	GULP1_ENST00000409637.3_Missense_Mutation_p.S130I|GULP1_ENST00000409805.1_Intron|GULP1_ENST00000410051.1_Missense_Mutation_p.S130I|GULP1_ENST00000409843.1_Missense_Mutation_p.S130I|GULP1_ENST00000409609.1_Missense_Mutation_p.S130I|GULP1_ENST00000359135.3_Missense_Mutation_p.S130I|GULP1_ENST00000479019.1_3'UTR|GULP1_ENST00000409830.1_Missense_Mutation_p.S130I			Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing 1	130	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|lipid transport (GO:0006869)|phagocytosis, engulfment (GO:0006911)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)	p.S130I(1)		endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			GTATTTGACAGCGAAAAGTGT	0.348																																					Pancreas(178;563 2065 20199 42378 52815)	Pancreas(178;563 2065 20199 42378 52815)	uc010fru.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(388-390)AGC>ATC		GULP, engulfment adaptor PTB domain containing							124.0	117.0	119.0					2																	189406035		2203	4299	6502	SO:0001583	missense	51454				apoptosis|lipid transport|phagocytosis, engulfment	cytoplasm|intracellular membrane-bounded organelle	signal transducer activity	g.chr2:189406035G>T	AF191771	CCDS2295.1, CCDS58742.1, CCDS58743.1	2q32.3-q33	2008-02-05			ENSG00000144366	ENSG00000144366			18649	protein-coding gene	gene with protein product		608165				11729193	Standard	NM_001252668		Approved	CED6, CED-6, GULP	uc010fru.3	Q9UBP9	OTTHUMG00000132647	ENST00000409580.1:c.389G>T	2.37:g.189406035G>T	ENSP00000386289:p.Ser130Ile					GULP1_uc002uqc.3_Missense_Mutation_p.S130I|GULP1_uc002uqd.2_Missense_Mutation_p.S130I|GULP1_uc010zfw.1_Intron|GULP1_uc002uqe.2_Missense_Mutation_p.S130I|GULP1_uc002uqf.2_Missense_Mutation_p.S130I|GULP1_uc002uqg.2_Missense_Mutation_p.S130I	p.S130I	NM_016315	NP_057399	Q9UBP9	GULP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)		7	850	+			130			PID.		B2RB51|B4DQ40|B8ZZ72|D3DPH1|E9PB86|Q53PC1|Q53RF3|Q9BVL3	Missense_Mutation	SNP	ENST00000409580.1	37	c.389G>T	CCDS2295.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.925389	0.92319	.	.	ENSG00000144366	ENST00000409843;ENST00000409830;ENST00000410051;ENST00000359135;ENST00000409580;ENST00000409637;ENST00000409609	T;T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7;1.7;1.7	5.72	5.72	0.89469	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.086818	0.85682	D	0.000000	T	0.63307	0.2500	M	0.92412	3.305	0.80722	D	1	D;D;P	0.89917	0.999;1.0;0.879	D;D;P	0.87578	0.99;0.998;0.494	T	0.70949	-0.4733	10	0.72032	D	0.01	-7.0106	19.2284	0.93827	0.0:0.0:1.0:0.0	.	130;130;130	Q9UBP9;B8ZZ72;Q9UBP9-2	GULP1_HUMAN;.;.	I	130	ENSP00000387144:S130I;ENSP00000386732:S130I;ENSP00000387013:S130I;ENSP00000352047:S130I;ENSP00000386289:S130I;ENSP00000386402:S130I;ENSP00000386867:S130I	ENSP00000352047:S130I	S	+	2	0	GULP1	189114280	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	9.789000	0.99068	2.857000	0.98124	0.650000	0.86243	AGC		0.348	GULP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335722.1	NM_016315		17	134	1	0	2.35188e-11	0.006122	3.41927e-11	17	134				
ICA1L	130026	broad.mit.edu	37	2	203682164	203682164	+	Missense_Mutation	SNP	A	A	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:203682164A>C	ENST00000392237.2	-	7	818	c.661T>G	c.(661-663)Tct>Gct	p.S221A	ICA1L_ENST00000358299.2_Missense_Mutation_p.S221A	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like	221	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.							p.S221A(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGCGAATGAGATAGCATATTG	0.408																																							uc002uzh.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(661-663)TCT>GCT		islet cell autoantigen 1,69kDa-like isoform 1							129.0	118.0	121.0					2																	203682164		2203	4300	6503	SO:0001583	missense	130026							g.chr2:203682164A>C	AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.661T>G	2.37:g.203682164A>C	ENSP00000376070:p.Ser221Ala					ICA1L_uc002uzi.1_Missense_Mutation_p.S221A	p.S221A	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN			7	825	-			221			AH.		B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	Missense_Mutation	SNP	ENST00000392237.2	37	c.661T>G	CCDS2354.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.957984	0.92726	.	.	ENSG00000163596	ENST00000392237;ENST00000358299	T;T	0.76968	-1.06;-1.06	5.96	5.96	0.96718	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.88771	0.6527	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89421	0.3710	10	0.49607	T	0.09	.	14.3798	0.66905	1.0:0.0:0.0:0.0	.	221	Q8NDH6	ICA1L_HUMAN	A	221	ENSP00000376070:S221A;ENSP00000351047:S221A	ENSP00000351047:S221A	S	-	1	0	ICA1L	203390409	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	8.341000	0.90046	2.279000	0.76181	0.533000	0.62120	TCT		0.408	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256330.1	NM_138468		4	103	0	0	0	0.000602	0	4	103				
DYTN	391475	broad.mit.edu	37	2	207527706	207527706	+	Silent	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:207527706T>C	ENST00000452335.2	-	11	1670	c.1554A>G	c.(1552-1554)agA>agG	p.R518R		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	518						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.R518R(2)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		GCTCATCCTTTCTCTCCTTGA	0.463																																							uc002vbr.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(1552-1554)AGA>AGG		dystrotelin							221.0	214.0	216.0					2																	207527706		1969	4156	6125	SO:0001819	synonymous_variant	391475					plasma membrane	zinc ion binding	g.chr2:207527706T>C	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1554A>G	2.37:g.207527706T>C							p.R518R	NM_001093730	NP_001087199	A2CJ06	DYTN_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)	11	1671	-			518			Potential.			Silent	SNP	ENST00000452335.2	37	c.1554A>G	CCDS46502.1																																																																																				0.463	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1			10	162	0	0	0	0.010729	0	10	162				
CPS1	1373	broad.mit.edu	37	2	211527847	211527847	+	Splice_Site	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:211527847G>T	ENST00000233072.5	+	33	4124	c.3928G>T	c.(3928-3930)Gct>Tct	p.A1310S	CPS1_ENST00000430249.2_Splice_Site_p.A1316S|CPS1_ENST00000451903.2_Splice_Site_p.A859S	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1310					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.A1316S(1)|p.A1310S(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TTTCCAACAGGCTCCCATGTT	0.408																																							uc002vee.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(3928-3930)GCT>TCT		carbamoyl-phosphate synthetase 1 isoform b							37.0	41.0	40.0					2																	211527847		2203	4300	6503	SO:0001630	splice_region_variant	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211527847G>T	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3928-1G>T	2.37:g.211527847G>T						CPS1_uc010fur.2_Missense_Mutation_p.A1316S|CPS1_uc010fus.2_Missense_Mutation_p.A859S	p.A1310S	NM_001875	NP_001866	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	33	4060	+			1310					B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	c.3928G>T	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719163	0.89205	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	T;T;T	0.64085	-0.08;-0.08;-0.08	5.43	5.43	0.79202	ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.68311	0.2987	L	0.58669	1.825	0.80722	D	1	D;P	0.55800	0.973;0.948	P;P	0.49528	0.614;0.46	T	0.67280	-0.5710	9	.	.	.	-10.4625	19.5994	0.95554	0.0:0.0:1.0:0.0	.	1320;1310	Q59HF8;P31327	.;CPSM_HUMAN	S	1316;1318;1310;859	ENSP00000402608:A1316S;ENSP00000233072:A1310S;ENSP00000406136:A859S	.	A	+	1	0	CPS1	211236092	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.396000	0.97270	2.699000	0.92147	0.655000	0.94253	GCT		0.408	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		Missense_Mutation	14	56	1	0	2.31682e-05	0.003163	2.71975e-05	14	56				
PLCD4	84812	broad.mit.edu	37	2	219495489	219495489	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:219495489G>A	ENST00000450993.2	+	9	1575	c.1236G>A	c.(1234-1236)ttG>ttA	p.L412L	PLCD4_ENST00000417849.1_Silent_p.L412L|RP11-548H3.1_ENST00000607946.1_RNA|PLCD4_ENST00000432688.1_Silent_p.L412L	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	412	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.L412L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GCACCACCTTGGATGGGGTGC	0.637																																							uc002vij.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(1234-1236)TTG>TTA		phospholipase C, delta 4							32.0	34.0	33.0					2																	219495489		2014	4170	6184	SO:0001819	synonymous_variant	84812				intracellular signal transduction|lipid catabolic process	endoplasmic reticulum|membrane|nucleus	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr2:219495489G>A	AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.1236G>A	2.37:g.219495489G>A						PLCD4_uc010zkk.1_Intron	p.L412L	NM_032726	NP_116115	Q9BRC7	PLCD4_HUMAN		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	9	1431	+		Renal(207;0.0915)	412			PI-PLC X-box.		Q53FS8	Silent	SNP	ENST00000450993.2	37	c.1236G>A	CCDS46516.1																																																																																				0.637	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336876.1			6	52	0	0	0	0.001168	0	6	52				
STK36	27148	broad.mit.edu	37	2	219553476	219553476	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:219553476G>T	ENST00000295709.3	+	12	1716	c.1437G>T	c.(1435-1437)ctG>ctT	p.L479L	STK36_ENST00000440309.1_Silent_p.L479L|STK36_ENST00000392105.3_Silent_p.L479L|STK36_ENST00000392106.2_Silent_p.L479L	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.L479L(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		TCCGGGTCCTGAGCAGTCTTC	0.547																																							uc002viu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11						c.(1435-1437)CTG>CTT		serine/threonine kinase 36							196.0	177.0	184.0					2																	219553476		2203	4300	6503	SO:0001819	synonymous_variant	27148				cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding	g.chr2:219553476G>T	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.1437G>T	2.37:g.219553476G>T						STK36_uc002viv.2_Silent_p.L479L	p.L479L	NM_015690	NP_056505	Q9NRP7	STK36_HUMAN		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)	12	1703	+		Renal(207;0.0915)	479						Silent	SNP	ENST00000295709.3	37	c.1437G>T	CCDS2421.1																																																																																				0.547	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2			48	296	1	0	3.94638e-17	0.01441	6.5236e-17	48	296				
CYP27A1	1593	broad.mit.edu	37	2	219679287	219679287	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:219679287A>T	ENST00000258415.4	+	8	1710	c.1283A>T	c.(1282-1284)cAc>cTc	p.H428L		NM_000784.3	NP_000775.1	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A, polypeptide 1	428					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cholestanetriol 26-monooxygenase activity (GO:0047749)|cholesterol 26-hydroxylase activity (GO:0031073)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)|vitamin D3 25-hydroxylase activity (GO:0030343)	p.H428L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(3)|urinary_tract(1)	26		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Chenodeoxycholic acid(DB06777)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Pegvisomant(DB00082)	GTGTTCTGCCACTATGTGGTG	0.592																																							uc002viz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1282-1284)CAC>CTC		cytochrome P450, family 27, subfamily A,	Cholecalciferol(DB00169)						63.0	71.0	68.0					2																	219679287		2203	4300	6503	SO:0001583	missense	1593				bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding	g.chr2:219679287A>T	BC017044	CCDS2423.1	2q35	2013-09-19	2003-01-14		ENSG00000135929	ENSG00000135929		"""Cytochrome P450s"""	2605	protein-coding gene	gene with protein product	"""cerebrotendinous xanthomatosis"""	606530	"""cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1"""	CYP27		2019602	Standard	NM_000784		Approved	CTX, CP27	uc002viz.4	Q02318	OTTHUMG00000048238	ENST00000258415.4:c.1283A>T	2.37:g.219679287A>T	ENSP00000258415:p.His428Leu						p.H428L	NM_000784	NP_000775	Q02318	CP27A_HUMAN		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	8	1717	+		Renal(207;0.0474)	428					A8K303|Q6LDB4|Q86YQ6	Missense_Mutation	SNP	ENST00000258415.4	37	c.1283A>T	CCDS2423.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.427799	0.83667	.	.	ENSG00000135929	ENST00000258415	T	0.62105	0.05	5.23	5.23	0.72850	.	0.046724	0.85682	N	0.000000	T	0.61035	0.2315	N	0.20845	0.615	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.57294	-0.7836	10	0.02654	T	1	-31.2411	14.2946	0.66302	1.0:0.0:0.0:0.0	.	428	Q02318	CP27A_HUMAN	L	428	ENSP00000258415:H428L	ENSP00000258415:H428L	H	+	2	0	CYP27A1	219387531	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	6.039000	0.70972	1.952000	0.56665	0.459000	0.35465	CAC		0.592	CYP27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109734.4			29	140	0	0	0	0.00632	0	29	140				
CCDC108	255101	broad.mit.edu	37	2	219896345	219896345	+	Silent	SNP	C	C	T	rs551813462		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:219896345C>T	ENST00000341552.5	-	7	764	c.681G>A	c.(679-681)gcG>gcA	p.A227A	CCDC108_ENST00000453220.1_Silent_p.A227A|CCDC108_ENST00000410037.1_Silent_p.A162A|CCDC108_ENST00000441968.1_Silent_p.A227A|CCDC108_ENST00000409865.3_Silent_p.A216A	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	227						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.A227A(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACATCCCCTCCGCTTTCTCAA	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		14763	0.001		0.0	False		,,,				2504	0.0						uc002vjl.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(679-681)GCG>GCA		coiled-coil domain containing 108 isoform 1							109.0	113.0	111.0					2																	219896345		2203	4300	6503	SO:0001819	synonymous_variant	255101					integral to membrane	structural molecule activity	g.chr2:219896345C>T	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.681G>A	2.37:g.219896345C>T						CCDC108_uc010fwa.1_5'Flank|CCDC108_uc010zkp.1_Silent_p.A216A|CCDC108_uc010zkq.1_Silent_p.A162A	p.A227A	NM_194302	NP_919278	Q6ZU64	CC108_HUMAN		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	7	765	-		Renal(207;0.0915)	227					A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	37	c.681G>A	CCDS2430.2																																																																																				0.627	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302		36	159	0	0	0	0.004289	0	36	159				
DOCK10	55619	broad.mit.edu	37	2	225688308	225688308	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:225688308G>T	ENST00000258390.7	-	28	3160	c.3093C>A	c.(3091-3093)gtC>gtA	p.V1031V	DOCK10_ENST00000409592.3_Silent_p.V1025V	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1031					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V1029V(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATAGGACCATGACAAGATTGT	0.413																																							uc010fwz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(3091-3093)GTC>GTA		dedicator of cytokinesis 10							144.0	134.0	137.0					2																	225688308		1906	4121	6027	SO:0001819	synonymous_variant	55619						GTP binding	g.chr2:225688308G>T	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.3093C>A	2.37:g.225688308G>T						DOCK10_uc002vob.2_Silent_p.V1025V	p.V1031V	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)	28	3332	-		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)	1031					B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	ENST00000258390.7	37	c.3093C>A	CCDS46528.1																																																																																				0.413	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			17	91	1	0	1.67942e-08	0.006122	2.23528e-08	17	91				
SLC19A3	80704	broad.mit.edu	37	2	228552161	228552161	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:228552161C>A	ENST00000258403.3	-	6	1514	c.1443G>T	c.(1441-1443)gtG>gtT	p.V481V	SLC19A3_ENST00000541617.1_Silent_p.V477V|SLC19A3_ENST00000409287.1_Intron	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	481					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.V481V(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	CTGGGTGAGACACATCTGGAT	0.403																																							uc002vpi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1441-1443)GTG>GTT		solute carrier family 19, member 3	L-Cysteine(DB00151)						160.0	156.0	157.0					2																	228552161		2203	4300	6503	SO:0001819	synonymous_variant	80704				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|reduced folate carrier activity|thiamine uptake transmembrane transporter activity	g.chr2:228552161C>A	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.1443G>T	2.37:g.228552161C>A						SLC19A3_uc002vpj.2_RNA|SLC19A3_uc010zlv.1_Silent_p.V477V	p.V481V	NM_025243	NP_079519	Q9BZV2	S19A3_HUMAN		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	6	1532	-		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)	481			Cytoplasmic (Potential).			Silent	SNP	ENST00000258403.3	37	c.1443G>T	CCDS2468.1																																																																																				0.403	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1			26	129	1	0	3.65163e-15	0.00632	5.84879e-15	26	129				
ESPNL	339768	broad.mit.edu	37	2	239013434	239013434	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr2:239013434C>G	ENST00000343063.3	+	3	886	c.623C>G	c.(622-624)gCc>gGc	p.A208G	ESPNL_ENST00000409169.1_Missense_Mutation_p.A208G	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	208								p.A208G(1)		endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GGCATGAGCGCCCTGCACGCT	0.672																																							uc002vxq.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(622-624)GCC>GGC		espin-like							32.0	25.0	27.0					2																	239013434		2194	4296	6490	SO:0001583	missense	339768							g.chr2:239013434C>G	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.623C>G	2.37:g.239013434C>G	ENSP00000339115:p.Ala208Gly					ESPNL_uc010fyw.2_5'Flank	p.A208G	NM_194312	NP_919288	Q6ZVH7	ESPNL_HUMAN		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)	3	733	+		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)	208			ANK 7.		Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	c.623C>G	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	C	7.330	0.618795	0.14129	.	.	ENSG00000144488	ENST00000343063;ENST00000409169	T;T	0.59224	0.3;0.28	4.8	2.58	0.30949	Ankyrin repeat-containing domain (3);	1.209900	0.06098	N	0.664932	T	0.64011	0.2560	M	0.90309	3.105	0.09310	N	1	B	0.30146	0.27	B	0.28916	0.096	T	0.55503	-0.8131	10	0.49607	T	0.09	-4.3641	6.272	0.20959	0.0:0.6227:0.0:0.3773	.	208	Q6ZVH7	ESPNL_HUMAN	G	208	ENSP00000339115:A208G;ENSP00000386577:A208G	ENSP00000339115:A208G	A	+	2	0	ESPNL	238678173	0.000000	0.05858	0.809000	0.32408	0.048000	0.14542	0.421000	0.21280	0.962000	0.38057	0.462000	0.41574	GCC		0.672	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312		3	7	0	0	0	0.004672	0	3	7				
PLCB4	5332	broad.mit.edu	37	20	9416206	9416206	+	Splice_Site	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:9416206G>T	ENST00000378493.1	+	25	2503		c.e25-1		PLCB4_ENST00000278655.4_Splice_Site|PLCB4_ENST00000334005.3_Splice_Site|PLCB4_ENST00000414679.2_Splice_Site|PLCB4_ENST00000492632.1_Splice_Site|PLCB4_ENST00000378501.2_Splice_Site|PLCB4_ENST00000378473.3_Splice_Site			Q15147	PLCB4_HUMAN	phospholipase C, beta 4						inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.?(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						TTTTCCCCTAGATATCGTGGA	0.348																																							uc002wnf.2		NA																	1	Unknown(1)		lung(1)	skin(11)|ovary(3)|pancreas(1)	15						c.e27-1		phospholipase C beta 4 isoform b							78.0	84.0	82.0					20																	9416206		2203	4300	6503	SO:0001630	splice_region_variant	5332				intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity	g.chr20:9416206G>T		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.2489-1G>T	20.37:g.9416206G>T						PLCB4_uc010gbw.1_Splice_Site_p.D830_splice|PLCB4_uc010gbx.2_Splice_Site_p.D842_splice|PLCB4_uc002wne.2_Splice_Site_p.D830_splice|PLCB4_uc002wnh.2_Splice_Site_p.D677_splice	p.D830_splice	NM_182797	NP_877949	Q15147	PLCB4_HUMAN			27	2625	+								B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Splice_Site	SNP	ENST00000378493.1	37	c.2489_splice	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039548	0.55003	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLCB4	9364206	1.000000	0.71417	0.999000	0.59377	0.361000	0.29550	9.243000	0.95416	2.835000	0.97688	0.650000	0.86243	.		0.348	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		Intron	8	63	1	0	0.000274275	0.004482	0.00030856	8	63				
PAK7	57144	broad.mit.edu	37	20	9523281	9523281	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:9523281C>A	ENST00000378429.3	-	10	2502	c.1956G>T	c.(1954-1956)atG>atT	p.M652I	PAK7_ENST00000353224.5_Missense_Mutation_p.M652I|PAK7_ENST00000378423.1_Missense_Mutation_p.M652I	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	652	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.M652I(1)		NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			GGATCCTCCGCATCGCCTGGA	0.512																																							uc002wnl.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23						c.(1954-1956)ATG>ATT		p21-activated kinase 7							142.0	139.0	140.0					20																	9523281		2203	4300	6503	SO:0001583	missense	57144						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr20:9523281C>A	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1956G>T	20.37:g.9523281C>A	ENSP00000367686:p.Met652Ile					PAK7_uc002wnk.2_Missense_Mutation_p.M652I|PAK7_uc002wnj.2_Missense_Mutation_p.M652I|PAK7_uc010gby.1_Intron	p.M652I	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		10	2501	-			652			Protein kinase.		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	c.1956G>T	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	C	32	5.139374	0.94560	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423	T;T;T	0.12879	2.64;2.64;2.64	5.48	5.48	0.80851	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.22399	0.0540	N	0.13168	0.305	0.80722	D	1	D	0.58620	0.983	D	0.71656	0.974	T	0.11891	-1.0569	9	.	.	.	.	19.3557	0.94412	0.0:1.0:0.0:0.0	.	652	Q9P286	PAK7_HUMAN	I	652	ENSP00000367686:M652I;ENSP00000322957:M652I;ENSP00000367679:M652I	.	M	-	3	0	PAK7	9471281	1.000000	0.71417	0.997000	0.53966	0.952000	0.60782	7.818000	0.86416	2.597000	0.87782	0.655000	0.94253	ATG		0.512	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1			23	137	1	0	9.95505e-16	0.014323	1.61734e-15	23	137				
BTBD3	22903	broad.mit.edu	37	20	11903469	11903469	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:11903469C>T	ENST00000405977.1	+	5	1349	c.724C>T	c.(724-726)Cag>Tag	p.Q242*	BTBD3_ENST00000254977.3_Nonsense_Mutation_p.Q181*|BTBD3_ENST00000378226.2_Nonsense_Mutation_p.Q242*|BTBD3_ENST00000399006.2_Nonsense_Mutation_p.Q181*|BTBD3_ENST00000488503.1_3'UTR	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	242	BACK.				cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.Q242*(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						AGACCTGACCCAGCGTTGCTG	0.537																																							uc002wnz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(724-726)CAG>TAG		BTB/POZ domain containing protein 3 isoform a							67.0	71.0	70.0					20																	11903469		2203	4300	6503	SO:0001587	stop_gained	22903							g.chr20:11903469C>T	AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.724C>T	20.37:g.11903469C>T	ENSP00000384545:p.Gln242*					BTBD3_uc002wny.2_Nonsense_Mutation_p.Q181*|BTBD3_uc002woa.2_Nonsense_Mutation_p.Q181*|BTBD3_uc010zrf.1_Nonsense_Mutation_p.Q91*|BTBD3_uc010zrg.1_Nonsense_Mutation_p.Q91*|BTBD3_uc010zrh.1_Nonsense_Mutation_p.Q91*	p.Q242*	NM_014962	NP_055777	Q9Y2F9	BTBD3_HUMAN			4	1083	+			242					D3DW19|Q5JY73	Nonsense_Mutation	SNP	ENST00000405977.1	37	c.724C>T	CCDS13113.1	.	.	.	.	.	.	.	.	.	.	C	38	6.704841	0.97776	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000378226;ENST00000455911	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	19.3906	0.94581	0.0:1.0:0.0:0.0	.	.	.	.	X	181;181;242;242;131	.	ENSP00000254977:Q181X	Q	+	1	0	BTBD3	11851469	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.035000	0.70940	2.827000	0.97445	0.650000	0.86243	CAG		0.537	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078021.3			21	92	0	0	0	0.012319	0	21	92				
DLGAP4	22839	broad.mit.edu	37	20	35060939	35060939	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:35060939C>A	ENST00000373907.2	+	2	1018	c.819C>A	c.(817-819)ccC>ccA	p.P273P	DLGAP4_ENST00000401952.2_Silent_p.P273P|DLGAP4_ENST00000373913.3_Silent_p.P273P|DLGAP4_ENST00000339266.5_Silent_p.P273P			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	273	Poly-Pro.				cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)		p.P273P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CGCCCGCACCCCCAGCCACCT	0.627																																							uc002xff.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(817-819)CCC>CCA		disks large-associated protein 4 isoform a							12.0	14.0	13.0					20																	35060939		2200	4286	6486	SO:0001819	synonymous_variant	22839				cell-cell signaling	membrane	protein binding	g.chr20:35060939C>A	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.819C>A	20.37:g.35060939C>A						DLGAP4_uc010zvp.1_Silent_p.P273P	p.P273P	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN			3	1254	+	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)	273			Poly-Pro.		E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Silent	SNP	ENST00000373907.2	37	c.819C>A																																																																																					0.627	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902		8	18	1	0	0.000673444	0.008291	0.000741442	8	18				
SLA2	84174	broad.mit.edu	37	20	35262953	35262953	+	Missense_Mutation	SNP	G	G	A	rs145656453	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:35262953G>A	ENST00000262866.4	-	3	553	c.131C>T	c.(130-132)cCg>cTg	p.P44L	SLA2_ENST00000360672.2_Missense_Mutation_p.P44L	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	44	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)	p.P44L(1)		endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GCCACCTGCCGGGAAACTGCC	0.567													G|||	5	0.000998403	0.0	0.0	5008	,	,		17881	0.0		0.002	False		,,,				2504	0.0031				Ovarian(59;720 1165 26994 46188 51693)	Ovarian(59;720 1165 26994 46188 51693)	uc002xfv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(130-132)CCG>CTG		Src-like-adaptor 2 isoform a		G	LEU/PRO,LEU/PRO	0,4406		0,0,2203	41.0	41.0	41.0		131,131	4.9	1.0	20	dbSNP_134	41	33,8567	22.8+/-68.1	0,33,4267	yes	missense,missense	SLA2	NM_032214.2,NM_175077.1	98,98	0,33,6470	AA,AG,GG		0.3837,0.0,0.2537	probably-damaging,probably-damaging	44/262,44/211	35262953	33,12973	2203	4300	6503	SO:0001583	missense	84174				antigen receptor-mediated signaling pathway|B cell mediated immunity|intracellular receptor mediated signaling pathway|negative regulation of B cell activation|negative regulation of calcium-mediated signaling|negative regulation of transcription from RNA polymerase II promoter|T cell activation	cytoplasmic membrane-bounded vesicle|endosome membrane|plasma membrane	protein N-terminus binding|SH3/SH2 adaptor activity	g.chr20:35262953G>A	AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.131C>T	20.37:g.35262953G>A	ENSP00000262866:p.Pro44Leu					SLA2_uc002xfu.2_Missense_Mutation_p.P44L	p.P44L	NM_032214	NP_115590	Q9H6Q3	SLAP2_HUMAN			3	493	-	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)	44			SH3.		A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Missense_Mutation	SNP	ENST00000262866.4	37	c.131C>T	CCDS13282.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	19.62	3.861663	0.71949	0.0	0.003837	ENSG00000101082	ENST00000262866;ENST00000360672	T;T	0.49720	0.77;0.77	4.94	4.94	0.65067	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.64182	0.2575	L	0.53249	1.67	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.65063	-0.6259	10	0.56958	D	0.05	-25.499	15.7053	0.77573	0.0:0.0:1.0:0.0	.	44;44	Q9H6Q3;Q9H6Q3-2	SLAP2_HUMAN;.	L	44	ENSP00000262866:P44L;ENSP00000353890:P44L	ENSP00000262866:P44L	P	-	2	0	SLA2	34696367	1.000000	0.71417	0.956000	0.39512	0.496000	0.33645	6.049000	0.71053	2.566000	0.86566	0.555000	0.69702	CCG		0.567	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079037.2	NM_175077		4	54	0	0	0	0.001168	0	4	54				
RBL1	5933	broad.mit.edu	37	20	35632118	35632119	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:35632118_35632119CC>AA	ENST00000373664.3	-	21	3088_3089	c.3022_3023GG>TT	c.(3022-3024)GGc>TTc	p.G1008F	RBL1_ENST00000344359.3_Missense_Mutation_p.G1008F	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	1008					chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)	p.G1008F(1)		NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				AGAAGGGCTGCCATTGAACTTG	0.441																																							uc002xgi.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|skin(3)|ovary(2)	10						c.(3022-3024)GGC>TTC		retinoblastoma-like protein 1 isoform a																																				SO:0001583	missense	5933				cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding	g.chr20:35632118_35632119CC>AA	L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.3022_3023delinsAA	20.37:g.35632118_35632119delinsAA	ENSP00000362768:p.Gly1008Phe					RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Missense_Mutation_p.G1008F	p.G1008F	NM_002895	NP_002886	P28749	RBL1_HUMAN			21	3101_3102	-		Myeloproliferative disorder(115;0.00878)	1008					A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	DNP	ENST00000373664.3	37	c.3022_3023GG>TT	CCDS13289.1																																																																																				0.441	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2	NM_002895		23	141	0	0	0	0.004672	0	23	141				
MROH8	140699	broad.mit.edu	37	20	35737068	35737068	+	Splice_Site	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:35737068C>A	ENST00000400441.3	-	23	2914		c.e23-1		MROH8_ENST00000441008.2_Splice_Site|MROH8_ENST00000466091.1_5'Flank|MROH8_ENST00000217333.8_Splice_Site			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8									p.?(3)									GATAAAAGGCCTAAAGGCAGG	0.423																																							uc010zvu.1		NA																	3	Unknown(3)		lung(3)		0						c.e25-1		hypothetical protein LOC140699 isoform 1							77.0	73.0	74.0					20																	35737068		1938	4138	6076	SO:0001630	splice_region_variant	140699							g.chr20:35737068C>A	AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.2915-1G>T	20.37:g.35737068C>A						C20orf132_uc002xgk.2_Splice_Site_p.G604_splice	p.G982_splice	NM_152503	NP_689716	Q9H579	CT132_HUMAN			25	3036	-		Myeloproliferative disorder(115;0.00878)						Q5JYQ6	Splice_Site	SNP	ENST00000400441.3	37	c.2945_splice		.	.	.	.	.	.	.	.	.	.	C	11.64	1.698641	0.30142	.	.	ENSG00000101353	ENST00000343811;ENST00000417458;ENST00000400441;ENST00000217333	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0166	0.71591	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C20orf132	35170482	1.000000	0.71417	1.000000	0.80357	0.396000	0.30629	3.453000	0.52978	2.626000	0.88956	0.609000	0.83330	.		0.423	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503	Intron	6	35	1	0	1.06961e-07	0.00308	1.36901e-07	6	35				
CTNNBL1	56259	broad.mit.edu	37	20	36488711	36488711	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:36488711G>A	ENST00000361383.6	+	15	1685	c.1568G>A	c.(1567-1569)gGa>gAa	p.G523E	CTNNBL1_ENST00000473857.1_3'UTR|CTNNBL1_ENST00000405275.2_Missense_Mutation_p.G496E|CTNNBL1_ENST00000373473.1_Missense_Mutation_p.G336E|CTNNBL1_ENST00000373469.1_Missense_Mutation_p.G271E	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	523					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				AACATGCGAGGAAGCTCCATC	0.448																																					Ovarian(184;582 2038 3273 4106 42608)	Ovarian(184;582 2038 3273 4106 42608)	uc010zvw.1		NA																	0				ovary(2)	2						c.(1567-1569)GGA>GAA		beta catenin-like 1							197.0	171.0	180.0					20																	36488711		2203	4300	6503	SO:0001583	missense	56259				apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding	g.chr20:36488711G>A	AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1568G>A	20.37:g.36488711G>A	ENSP00000355050:p.Gly523Glu					CTNNBL1_uc002xhh.2_Missense_Mutation_p.G336E|CTNNBL1_uc002xhi.2_RNA|CTNNBL1_uc002xhj.2_Missense_Mutation_p.G271E	p.G523E	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN			16	1659	+		Myeloproliferative disorder(115;0.00878)	523					B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	ENST00000361383.6	37	c.1568G>A	CCDS13298.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299473	0.81136	.	.	ENSG00000132792	ENST00000361383;ENST00000405275;ENST00000373473;ENST00000373469	T;T;T;T	0.44083	0.93;0.94;0.94;0.94	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.65842	0.2730	M	0.76838	2.35	0.80722	D	1	D;D	0.71674	0.984;0.998	P;D	0.70935	0.855;0.971	T	0.66240	-0.5973	10	0.42905	T	0.14	-18.1222	18.0467	0.89335	0.0:0.0:1.0:0.0	.	523;336	Q8WYA6;Q8WYA6-2	CTBL1_HUMAN;.	E	523;496;336;271	ENSP00000355050:G523E;ENSP00000384355:G496E;ENSP00000362572:G336E;ENSP00000362568:G271E	ENSP00000355050:G523E	G	+	2	0	CTNNBL1	35922125	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.375000	0.97178	2.488000	0.83962	0.655000	0.94253	GGA		0.448	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877		7	225	0	0	0	0.004482	0	7	225				
KIAA1755	85449	broad.mit.edu	37	20	36869629	36869629	+	Missense_Mutation	SNP	A	A	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:36869629A>C	ENST00000279024.4	-	3	1175	c.904T>G	c.(904-906)Tct>Gct	p.S302A		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	302								p.S302A(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				AGTGCCCCAGAAGTACACCCA	0.522																																							uc002xhy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(904-906)TCT>GCT		hypothetical protein LOC85449							112.0	119.0	117.0					20																	36869629		2203	4300	6503	SO:0001583	missense	85449							g.chr20:36869629A>C	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.904T>G	20.37:g.36869629A>C	ENSP00000279024:p.Ser302Ala					KIAA1755_uc002xhz.1_Missense_Mutation_p.S302A	p.S302A	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN			3	1176	-		Myeloproliferative disorder(115;0.00874)	302					Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	c.904T>G	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	A	5.202	0.222835	0.09863	.	.	ENSG00000149633	ENST00000279024	T	0.06608	3.28	4.98	-0.28	0.12886	.	2.490660	0.01841	N	0.035356	T	0.05181	0.0138	L	0.29908	0.895	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.38243	-0.9670	10	0.09338	T	0.73	.	5.6512	0.17616	0.4129:0.1625:0.4246:0.0	.	302	Q5JYT7	K1755_HUMAN	A	302	ENSP00000279024:S302A	ENSP00000279024:S302A	S	-	1	0	KIAA1755	36303043	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.081000	0.14823	0.014000	0.14944	-0.256000	0.11100	TCT		0.522	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864		20	337	0	0	0	0.008871	0	20	337				
SLC32A1	140679	broad.mit.edu	37	20	37353584	37353584	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:37353584G>A	ENST00000217420.1	+	1	480	c.217G>A	c.(217-219)Gag>Aag	p.E73K		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	73					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.E73K(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CTGCGGGGACGAGGGCGCTGA	0.677																																							uc002xjc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(217-219)GAG>AAG		solute carrier family 32, member 1	Glycine(DB00145)						22.0	29.0	27.0					20																	37353584		2190	4282	6472	SO:0001583	missense	140679				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity	g.chr20:37353584G>A	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.217G>A	20.37:g.37353584G>A	ENSP00000217420:p.Glu73Lys						p.E73K	NM_080552	NP_542119	Q9H598	VIAAT_HUMAN			1	480	+		Myeloproliferative disorder(115;0.00878)	73			Cytoplasmic (Potential).		Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	c.217G>A	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.415041	0.42817	.	.	ENSG00000101438	ENST00000217420	T	0.06933	3.24	4.97	4.97	0.65823	.	0.534882	0.19077	N	0.123357	T	0.04318	0.0119	N	0.08118	0	0.41145	D	0.985981	B	0.14805	0.011	B	0.08055	0.003	T	0.23797	-1.0178	10	0.06494	T	0.89	-23.4952	13.7079	0.62651	0.0:0.0:1.0:0.0	.	73	Q9H598	VIAAT_HUMAN	K	73	ENSP00000217420:E73K	ENSP00000217420:E73K	E	+	1	0	SLC32A1	36786998	1.000000	0.71417	1.000000	0.80357	0.434000	0.31775	7.244000	0.78228	2.300000	0.77407	0.561000	0.74099	GAG		0.677	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552		12	88	0	0	0	0.003163	0	12	88				
MYBL2	4605	broad.mit.edu	37	20	42340215	42340215	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:42340215C>T	ENST00000217026.4	+	11	1820	c.1693C>T	c.(1693-1695)Ccc>Tcc	p.P565S	MYBL2_ENST00000396863.4_Missense_Mutation_p.P541S	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	565					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P565S(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CGACATCAGGCCCGAGAAGCA	0.632																																							uc002xlb.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|kidney(2)	5						c.(1693-1695)CCC>TCC		MYB-related protein B							67.0	57.0	60.0					20																	42340215		2203	4300	6503	SO:0001583	missense	4605					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:42340215C>T		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1693C>T	20.37:g.42340215C>T	ENSP00000217026:p.Pro565Ser					MYBL2_uc010zwj.1_Missense_Mutation_p.P541S	p.P565S	NM_002466	NP_002457	P10244	MYBB_HUMAN	COAD - Colon adenocarcinoma(18;0.0031)		11	1908	+		Myeloproliferative disorder(115;0.00452)	565			Bipartite nuclear localization signal.		B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	37	c.1693C>T	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	C	9.538	1.112531	0.20795	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.33865	1.39;1.39	3.63	2.67	0.31697	C-myb, C-terminal (1);	0.310946	0.35646	N	0.003061	T	0.41050	0.1142	L	0.28458	0.855	0.37322	D	0.909613	B;D	0.62365	0.295;0.991	B;P	0.62089	0.204;0.898	T	0.25117	-1.0141	10	0.18710	T	0.47	-8.1652	13.8858	0.63708	0.0:0.9115:0.0:0.0885	.	541;565	F8W6N6;P10244	.;MYBB_HUMAN	S	541;565	ENSP00000380072:P541S;ENSP00000217026:P565S	ENSP00000217026:P565S	P	+	1	0	MYBL2	41773629	1.000000	0.71417	0.267000	0.24556	0.005000	0.04900	2.970000	0.49240	0.530000	0.28619	-0.797000	0.03246	CCC		0.632	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466		6	28	0	0	0	0.001984	0	6	28				
JPH2	57158	broad.mit.edu	37	20	42815297	42815297	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:42815297C>A	ENST00000372980.3	-	1	921	c.49G>T	c.(49-51)Ggc>Tgc	p.G17C	JPH2_ENST00000342272.3_Missense_Mutation_p.G17C	NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	17	Gly-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)	p.G17C(2)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCCTCCCAGCCCCCGCAGTAC	0.642																																							uc002xli.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(49-51)GGC>TGC		junctophilin 2 isoform 1							39.0	40.0	40.0					20																	42815297		2203	4300	6503	SO:0001583	missense	57158				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane		g.chr20:42815297C>A	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.49G>T	20.37:g.42815297C>A	ENSP00000362071:p.Gly17Cys					JPH2_uc002xlj.2_Missense_Mutation_p.G17C	p.G17C	NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		1	922	-		Myeloproliferative disorder(115;0.0122)	17			MORN 1.|Gly-rich.|Cytoplasmic (Potential).		E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	ENST00000372980.3	37	c.49G>T	CCDS13325.1	.	.	.	.	.	.	.	.	.	.	c	23.3	4.394131	0.83011	.	.	ENSG00000149596	ENST00000372980;ENST00000342272	T;T	0.55234	0.53;0.53	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.73621	0.3610	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.97110	0.967;1.0	T	0.78051	-0.2355	10	0.62326	D	0.03	.	17.4267	0.87528	0.0:1.0:0.0:0.0	.	17;17	Q9BR39-2;Q9BR39	.;JPH2_HUMAN	C	17	ENSP00000362071:G17C;ENSP00000344590:G17C	ENSP00000344590:G17C	G	-	1	0	JPH2	42248711	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.408000	0.80041	2.100000	0.63781	0.556000	0.70494	GGC		0.642	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1			25	90	1	0	2.44723e-14	0.004656	3.80159e-14	25	90				
WISP2	8839	broad.mit.edu	37	20	43353577	43353577	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:43353577C>A	ENST00000372868.2	+	4	819	c.476C>A	c.(475-477)cCt>cAt	p.P159H	WISP2_ENST00000372865.4_Intron|RP11-445H22.4_ENST00000427598.1_RNA|WISP2_ENST00000471629.1_3'UTR|WISP2_ENST00000190983.4_Missense_Mutation_p.P159H|RP11-445H22.4_ENST00000427303.1_RNA|RP11-445H22.4_ENST00000445420.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	159	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.P159H(1)		skin(1)	1		Myeloproliferative disorder(115;0.0122)				AAGTGCTGCCCTGAGTGGGTG	0.716																																							uc002xmn.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(475-477)CCT>CAT		WNT1 inducible signaling pathway protein 2							15.0	15.0	15.0					20																	43353577		2194	4285	6479	SO:0001583	missense	8839				cell adhesion|cell-cell signaling|signal transduction	extracellular region|soluble fraction	insulin-like growth factor binding	g.chr20:43353577C>A	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.476C>A	20.37:g.43353577C>A	ENSP00000361959:p.Pro159His					uc002xml.1_Intron|uc002xmm.1_Intron|WISP2_uc002xmp.2_Missense_Mutation_p.P159H|WISP2_uc002xmq.2_Intron	p.P159H	NM_003881	NP_003872	O76076	WISP2_HUMAN			4	829	+		Myeloproliferative disorder(115;0.0122)	159			VWFC.		B2R9N4|E1P612|Q6PEG3	Missense_Mutation	SNP	ENST00000372868.2	37	c.476C>A	CCDS13336.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.117704	0.37339	.	.	ENSG00000064205	ENST00000372868;ENST00000190983	T;T	0.73152	-0.72;-0.72	4.46	3.36	0.38483	von Willebrand factor, type C (4);	0.239777	0.41097	D	0.000951	T	0.81044	0.4741	M	0.66378	2.025	0.40836	D	0.983635	D	0.89917	1.0	D	0.77557	0.99	D	0.83712	0.0188	10	0.66056	D	0.02	-31.2694	13.3752	0.60734	0.2262:0.7737:0.0:0.0	.	159	O76076	WISP2_HUMAN	H	159	ENSP00000361959:P159H;ENSP00000190983:P159H	ENSP00000190983:P159H	P	+	2	0	WISP2	42786991	0.775000	0.28604	0.971000	0.41717	0.109000	0.19521	1.636000	0.37144	2.199000	0.70637	0.455000	0.32223	CCT		0.716	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881		3	14	1	0	0.004672	0.004672	0.00496072	3	14				
SEMG2	6407	broad.mit.edu	37	20	43851907	43851907	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:43851907G>T	ENST00000372769.3	+	2	1724	c.1634G>T	c.(1633-1635)aGa>aTa	p.R545I		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	545	Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.R545I(1)		autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				CAAAAAGGCAGATACAAACAG	0.373																																							uc010ggz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1633-1635)AGA>ATA		semenogelin II precursor							100.0	84.0	90.0					20																	43851907		2203	4300	6503	SO:0001583	missense	6407				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity	g.chr20:43851907G>T		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.1634G>T	20.37:g.43851907G>T	ENSP00000361855:p.Arg545Ile					SEMG2_uc002xnk.2_Missense_Mutation_p.R545I|SEMG2_uc002xnl.2_Missense_Mutation_p.R425I	p.R545I	NM_003008	NP_002999	Q02383	SEMG2_HUMAN			2	1691	+		Myeloproliferative disorder(115;0.0122)	545			Repeat-rich region.|3-2.		Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	c.1634G>T	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.163238	0.00318	.	.	ENSG00000124157	ENST00000372769	T	0.14391	2.51	1.38	-2.41	0.06562	.	.	.	.	.	T	0.25158	0.0611	L	0.56769	1.78	0.09310	N	1	D;D	0.69078	0.996;0.997	D;D	0.83275	0.985;0.996	T	0.10636	-1.0621	9	0.38643	T	0.18	.	5.2581	0.15558	0.5759:0.0:0.4241:0.0	.	545;545	A8K6Z6;Q02383	.;SEMG2_HUMAN	I	545	ENSP00000361855:R545I	ENSP00000361855:R545I	R	+	2	0	SEMG2	43285321	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.204000	0.17335	-0.782000	0.04541	-0.793000	0.03317	AGA		0.373	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008		17	98	1	0	1.37285e-15	0.004007	2.21769e-15	17	98				
KCNG1	3755	broad.mit.edu	37	20	49626462	49626462	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:49626462C>A	ENST00000371571.4	-	2	699	c.414G>T	c.(412-414)ctG>ctT	p.L138L	KCNG1_ENST00000396017.3_Silent_p.L138L|RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000506387.1_5'Flank	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	138					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.L138L(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						TCTCGCGCAGCAGCCGCAGCT	0.657																																							uc002xwa.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(412-414)CTG>CTT		potassium voltage-gated channel, subfamily G,							32.0	32.0	32.0					20																	49626462		2202	4299	6501	SO:0001819	synonymous_variant	3755					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr20:49626462C>A	AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.414G>T	20.37:g.49626462C>A						KCNG1_uc002xwb.2_Silent_p.L138L	p.L138L	NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN			2	709	-			138			Cytoplasmic (Potential).		A8K3S4|O43528|Q5JXL5|Q9BRC1	Silent	SNP	ENST00000371571.4	37	c.414G>T	CCDS13436.1																																																																																				0.657	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079726.4	NM_002237		9	53	1	0	1.08611e-07	0.010729	1.38077e-07	9	53				
KCNG1	3755	broad.mit.edu	37	20	49626477	49626477	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:49626477C>A	ENST00000371571.4	-	2	684	c.399G>T	c.(397-399)gcG>gcT	p.A133A	KCNG1_ENST00000396017.3_Silent_p.A133A|RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000506387.1_5'Flank	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	133					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.A133A(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GCAGCTTGCCCGCGCGCAGGA	0.642																																							uc002xwa.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(397-399)GCG>GCT		potassium voltage-gated channel, subfamily G,							35.0	34.0	34.0					20																	49626477		2203	4298	6501	SO:0001819	synonymous_variant	3755					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr20:49626477C>A	AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.399G>T	20.37:g.49626477C>A						KCNG1_uc002xwb.2_Silent_p.A133A	p.A133A	NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN			2	694	-			133			Cytoplasmic (Potential).		A8K3S4|O43528|Q5JXL5|Q9BRC1	Silent	SNP	ENST00000371571.4	37	c.399G>T	CCDS13436.1																																																																																				0.642	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079726.4	NM_002237		8	60	1	0	1.58986e-06	0.008291	1.95543e-06	8	60				
TSHZ2	128553	broad.mit.edu	37	20	51872757	51872757	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:51872757C>T	ENST00000371497.5	+	2	3647	c.2760C>T	c.(2758-2760)gaC>gaT	p.D920D	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Silent_p.D917D|TSHZ2_ENST00000603338.2_Silent_p.D917D	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	920					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D920D(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAAACATGGACAAAGGCCACC	0.473																																							uc002xwo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6						c.(2758-2760)GAC>GAT		teashirt zinc finger homeobox 2							69.0	71.0	70.0					20																	51872757		2203	4300	6503	SO:0001819	synonymous_variant	128553				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:51872757C>T	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2760C>T	20.37:g.51872757C>T							p.D920D	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)		2	3716	+			920					B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	ENST00000371497.5	37	c.2760C>T	CCDS33490.1																																																																																				0.473	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		17	82	0	0	0	0.006122	0	17	82				
ZNF512B	57473	broad.mit.edu	37	20	62612636	62612636	+	Intron	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:62612636C>T	ENST00000450537.1	-	2	56				SAMD10_ENST00000498830.1_5'Flank|ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Missense_Mutation_p.A13V|SAMD10_ENST00000369886.3_5'Flank			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A13V(1)		NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGGATGCCCGCGCCCCTCGGC	0.677																																							uc002yho.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(37-39)GCG>GTG		PRP6 pre-mRNA processing factor 6 homolog							21.0	20.0	20.0					20																	62612636		2191	4287	6478	SO:0001627	intron_variant	24148				assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity	g.chr20:62612636C>T	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-13328G>A	20.37:g.62612636C>T						PRPF6_uc002yhp.2_Missense_Mutation_p.A13V|SAMD10_uc002yhm.2_5'Flank|SAMD10_uc002yhn.2_5'Flank	p.A13V	NM_012469	NP_036601	O94906	PRP6_HUMAN			1	206	+	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)		13					Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	c.38C>T	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	C	32	5.183674	0.94885	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	D;D	0.82711	-1.56;-1.64	4.46	3.52	0.40303	PRP1 splicing factor, N-terminal (1);	0.051368	0.85682	D	0.000000	D	0.92189	0.7523	M	0.93808	3.46	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70716	0.947;0.97	D	0.92699	0.6173	10	0.66056	D	0.02	-13.4305	11.6195	0.51108	0.0:0.9109:0.0:0.0891	.	13;13	O94906-2;O94906	.;PRP6_HUMAN	V	13	ENSP00000266079:A13V;ENSP00000446216:A13V	ENSP00000266079:A13V	A	+	2	0	PRPF6	62083080	1.000000	0.71417	0.943000	0.38184	0.807000	0.45602	3.654000	0.54453	0.854000	0.35336	0.491000	0.48974	GCG		0.677	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713		5	15	0	0	0	0.004482	0	5	15				
CYYR1	116159	broad.mit.edu	37	21	27945240	27945240	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr21:27945240G>T	ENST00000299340.4	-	1	363	c.20C>A	c.(19-21)cCc>cAc	p.P7H	CYYR1_ENST00000435845.2_Missense_Mutation_p.P115H|CYYR1_ENST00000400043.3_Missense_Mutation_p.P7H	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1	7						integral component of membrane (GO:0016021)		p.P7H(1)		large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						TGGACGCACGGGTAGCCTCGG	0.662																																							uc002ymd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(19-21)CCC>CAC		cysteine and tyrosine-rich 1 protein precursor							58.0	57.0	57.0					21																	27945240		2203	4300	6503	SO:0001583	missense	116159					integral to membrane		g.chr21:27945240G>T	AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.20C>A	21.37:g.27945240G>T	ENSP00000299340:p.Pro7His					CYYR1_uc011ack.1_RNA|CYYR1_uc002yme.2_Missense_Mutation_p.P7H	p.P7H	NM_052954	NP_443186	Q96J86	CYYR1_HUMAN			1	342	-			7					A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Missense_Mutation	SNP	ENST00000299340.4	37	c.20C>A	CCDS13578.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611190	0.46631	.	.	ENSG00000166265	ENST00000299340;ENST00000435845;ENST00000400043	T;T;T	0.32272	1.46;1.46;1.46	4.59	2.78	0.32641	.	0.619070	0.16163	N	0.226679	T	0.36413	0.0966	L	0.44542	1.39	0.29074	N	0.883088	P;D	0.54047	0.956;0.964	P;P	0.57152	0.717;0.814	T	0.13575	-1.0504	10	0.48119	T	0.1	-6.4124	6.568	0.22523	0.0959:0.181:0.7231:0.0	.	7;7	Q96J86-2;Q96J86	.;CYYR1_HUMAN	H	7;115;7	ENSP00000299340:P7H;ENSP00000401313:P115H;ENSP00000382918:P7H	ENSP00000299340:P7H	P	-	2	0	CYYR1	26867111	0.990000	0.36364	0.994000	0.49952	0.815000	0.46073	0.744000	0.26245	0.851000	0.35264	0.650000	0.86243	CCC		0.662	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171654.2	NM_052954		11	72	1	0	3.07112e-06	0.010729	3.72874e-06	11	72				
GRIK1	2897	broad.mit.edu	37	21	30934151	30934151	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr21:30934151T>A	ENST00000399907.1	-	15	2561	c.2150A>T	c.(2149-2151)tAt>tTt	p.Y717F	GRIK1_ENST00000327783.4_Missense_Mutation_p.Y717F|GRIK1_ENST00000399909.1_Missense_Mutation_p.Y702F|GRIK1_ENST00000535441.1_Missense_Mutation_p.Y719F|GRIK1_ENST00000399914.1_Missense_Mutation_p.Y702F|GRIK1_ENST00000389125.3_Missense_Mutation_p.Y702F|GRIK1_ENST00000309434.7_Missense_Mutation_p.Y719F|GRIK1_ENST00000399913.1_Missense_Mutation_p.Y717F|GRIK1_ENST00000389124.2_Missense_Mutation_p.Y717F	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	717					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.Y717F(1)|p.Y702F(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CATCTTCTCATAGGTGGAGAT	0.493																																							uc002yno.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)|skin(1)	3						c.(2149-2151)TAT>TTT		glutamate receptor, ionotropic, kainate 1	L-Glutamic Acid(DB00142)|Topiramate(DB00273)						67.0	59.0	62.0					21																	30934151		2203	4300	6503	SO:0001583	missense	2897				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity	g.chr21:30934151T>A		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2150A>T	21.37:g.30934151T>A	ENSP00000382791:p.Tyr717Phe					GRIK1_uc002ynn.2_Missense_Mutation_p.Y702F|GRIK1_uc011acs.1_Missense_Mutation_p.Y717F|GRIK1_uc011act.1_Missense_Mutation_p.Y578F	p.Y717F	NM_000830	NP_000821	P39086	GRIK1_HUMAN			15	2614	-			717			Extracellular (Potential).		Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	c.2150A>T	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	T	16.33	3.092874	0.56075	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71	4.96	4.96	0.65561	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.17704	0.0425	L	0.53561	1.675	0.80722	D	1	B;B;B;B	0.18013	0.025;0.025;0.025;0.02	B;B;B;B	0.30943	0.122;0.122;0.122;0.074	T	0.03651	-1.1016	10	0.27785	T	0.31	.	14.7613	0.69607	0.0:0.0:0.0:1.0	.	702;717;717;702	E7EPY9;E9PD61;P39086;P39086-2	.;.;GRIK1_HUMAN;.	F	717;702;717;702;719;578;717;717;702;719	ENSP00000327687:Y717F;ENSP00000373777:Y702F;ENSP00000382797:Y717F;ENSP00000382798:Y702F;ENSP00000446326:Y719F;ENSP00000373776:Y717F;ENSP00000382791:Y717F;ENSP00000382793:Y702F;ENSP00000311646:Y719F	ENSP00000311646:Y719F	Y	-	2	0	GRIK1	29856022	1.000000	0.71417	0.840000	0.33206	0.982000	0.71751	4.936000	0.63506	2.207000	0.71202	0.533000	0.62120	TAT		0.493	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1			4	33	0	0	0	0.009096	0	4	33				
SETD4	54093	broad.mit.edu	37	21	37429497	37429497	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr21:37429497C>A	ENST00000399215.1	-	2	1451	c.79G>T	c.(79-81)Gag>Tag	p.E27*	SETD4_ENST00000399201.1_Nonsense_Mutation_p.E3*|SETD4_ENST00000399205.1_Nonsense_Mutation_p.E3*|SETD4_ENST00000481477.1_5'UTR|SETD4_ENST00000399207.1_Nonsense_Mutation_p.E27*|SETD4_ENST00000332131.4_Nonsense_Mutation_p.E27*|SETD4_ENST00000399212.1_Nonsense_Mutation_p.E3*|SETD4_ENST00000399208.2_Nonsense_Mutation_p.E27*			Q9NVD3	SETD4_HUMAN	SET domain containing 4	27							methyltransferase activity (GO:0008168)	p.E27*(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	15						TTGTGGCTCTCATTCACTATC	0.383																																							uc002yuw.1		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(79-81)GAG>TAG		SET domain containing 4 isoform a							98.0	93.0	95.0					21																	37429497		2203	4300	6503	SO:0001587	stop_gained	54093							g.chr21:37429497C>A	AK001660	CCDS13640.1, CCDS42923.1, CCDS74791.1, CCDS74792.1	21q22.13	2006-02-15	2006-02-15	2006-02-15	ENSG00000185917	ENSG00000185917			1258	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 27"", ""chromosome 21 open reading frame 18"""	C21orf27, C21orf18			Standard	XM_005261000		Approved		uc021wiy.1	Q9NVD3	OTTHUMG00000086483	ENST00000399215.1:c.79G>T	21.37:g.37429497C>A	ENSP00000382163:p.Glu27*					SETD4_uc002yux.1_Nonsense_Mutation_p.E3*|SETD4_uc002yuu.2_RNA|SETD4_uc002yuv.2_Nonsense_Mutation_p.E27*|SETD4_uc002yuy.2_Nonsense_Mutation_p.E27*|SETD4_uc002yuz.2_Nonsense_Mutation_p.E3*|SETD4_uc002yva.2_Nonsense_Mutation_p.E3*	p.E27*	NM_017438	NP_059134	Q9NVD3	SETD4_HUMAN			2	1452	-			27					B4DT14|D3DSG2|D3DSG4|Q8NE19|Q9BU46	Nonsense_Mutation	SNP	ENST00000399215.1	37	c.79G>T	CCDS13640.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.032063	0.93575	.	.	ENSG00000185917	ENST00000399215;ENST00000399212;ENST00000332131;ENST00000399205;ENST00000399208;ENST00000399201;ENST00000399207;ENST00000424303;ENST00000429161;ENST00000446166;ENST00000442559;ENST00000443703	.	.	.	5.13	5.13	0.70059	.	0.425083	0.24102	N	0.041539	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-24.0196	11.2673	0.49118	0.1822:0.8178:0.0:0.0	.	.	.	.	X	27;3;27;3;27;3;27;27;27;3;3;27	.	ENSP00000329189:E27X	E	-	1	0	SETD4	36351367	1.000000	0.71417	1.000000	0.80357	0.200000	0.23975	1.700000	0.37815	2.402000	0.81655	0.655000	0.94253	GAG		0.383	SETD4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194456.1	NM_017438		19	109	1	0	4.96729e-08	0.008871	6.43026e-08	19	109				
IGSF5	150084	broad.mit.edu	37	21	41165524	41165524	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr21:41165524G>A	ENST00000380588.4	+	8	1215	c.1112G>A	c.(1111-1113)tGt>tAt	p.C371Y		NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5	371					single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.C371Y(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				AACAGTAGCTGTGGCCCTCCT	0.418																																							uc002yyo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1111-1113)TGT>TAT		immunoglobulin superfamily 5 like							149.0	154.0	152.0					21																	41165524		2203	4300	6503	SO:0001583	missense	150084					integral to membrane|tight junction		g.chr21:41165524G>A		CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.1112G>A	21.37:g.41165524G>A	ENSP00000369962:p.Cys371Tyr						p.C371Y	NM_001080444	NP_001073913	Q9NSI5	IGSF5_HUMAN			8	1215	+		Prostate(19;5.35e-06)	371			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000380588.4	37	c.1112G>A	CCDS33562.1	.	.	.	.	.	.	.	.	.	.	G	0.099	-1.155129	0.01700	.	.	ENSG00000183067	ENST00000380588	T	0.06068	3.35	0.882	-0.161	0.13371	.	2.964900	0.02988	U	0.146549	T	0.03783	0.0107	N	0.22421	0.69	0.09310	N	1	B	0.22480	0.07	B	0.06405	0.002	T	0.31392	-0.9945	10	0.02654	T	1	.	3.8708	0.09036	0.0:0.0:0.5808:0.4192	.	371	Q9NSI5	IGSF5_HUMAN	Y	371	ENSP00000369962:C371Y	ENSP00000369962:C371Y	C	+	2	0	IGSF5	40087394	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.285000	0.08410	-0.073000	0.12842	0.313000	0.20887	TGT		0.418	IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195005.1			21	145	0	0	0	0.014323	0	21	145				
PFKL	5211	broad.mit.edu	37	21	45730918	45730918	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr21:45730918G>A	ENST00000349048.4	+	3	244	c.189G>A	c.(187-189)gaG>gaA	p.E63E	PFKL_ENST00000403390.1_Silent_p.E110E|PFKL_ENST00000496824.1_3'UTR	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	63	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)	p.E110E(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		AGGGAGGTGAGAACATCAAGC	0.602																																							uc002zel.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(187-189)GAG>GAA		liver phosphofructokinase							157.0	115.0	129.0					21																	45730918		2203	4299	6502	SO:0001819	synonymous_variant	5211				fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding	g.chr21:45730918G>A		CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.189G>A	21.37:g.45730918G>A						PFKL_uc002zek.2_Silent_p.E110E|PFKL_uc011afd.1_Silent_p.E110E	p.E63E	NM_002626	NP_002617	P17858	K6PL_HUMAN		Colorectal(79;0.0811)	3	248	+			63					Q96A64|Q96IH4|Q9BR91	Silent	SNP	ENST00000349048.4	37	c.189G>A	CCDS33582.1																																																																																				0.602	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195805.1			12	92	0	0	0	0.010729	0	12	92				
TRPM2	7226	broad.mit.edu	37	21	45825813	45825813	+	Missense_Mutation	SNP	G	G	T	rs147919263		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr21:45825813G>T	ENST00000397928.1	+	18	3128	c.2683G>T	c.(2683-2685)Ggg>Tgg	p.G895W	TRPM2_ENST00000300482.5_Missense_Mutation_p.G895W|TRPM2_ENST00000397932.2_Missense_Mutation_p.G895W|TRPM2_ENST00000300481.9_Missense_Mutation_p.G875W|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	895					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)	p.G895W(1)		breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GCTGTACCCCGGGCGCGTCAT	0.617																																							uc002zet.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2683-2685)GGG>TGG		transient receptor potential cation channel,							81.0	84.0	83.0					21																	45825813		2203	4299	6502	SO:0001583	missense	7226					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity	g.chr21:45825813G>T	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2683G>T	21.37:g.45825813G>T	ENSP00000381023:p.Gly895Trp					TRPM2_uc002zeu.1_Missense_Mutation_p.G895W|TRPM2_uc002zew.1_Missense_Mutation_p.G895W|TRPM2_uc010gpt.1_Missense_Mutation_p.G895W|TRPM2_uc002zex.1_Missense_Mutation_p.G681W|TRPM2_uc002zey.1_Missense_Mutation_p.G408W	p.G895W	NM_003307	NP_003298	O94759	TRPM2_HUMAN			19	2896	+			895			Extracellular (Potential).		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	c.2683G>T	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	g	16.10	3.027050	0.54683	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	4.3	4.3	0.51218	Ion transport (1);	0.139126	0.47852	D	0.000212	D	0.87229	0.6125	M	0.91818	3.245	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.90766	0.4668	10	0.87932	D	0	-21.7358	16.8112	0.85720	0.0:0.0:1.0:0.0	.	895;681;895	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	W	895;895;875;895	ENSP00000300482:G895W;ENSP00000381023:G895W;ENSP00000300481:G875W;ENSP00000381026:G895W	ENSP00000300481:G875W	G	+	1	0	TRPM2	44650241	1.000000	0.71417	0.998000	0.56505	0.050000	0.14768	7.346000	0.79347	2.131000	0.65755	0.536000	0.68110	GGG		0.617	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307		42	180	1	0	6.68952e-21	0.013114	1.14246e-20	42	180				
COL6A2	1292	broad.mit.edu	37	21	47542060	47542060	+	Silent	SNP	C	C	T	rs112197239	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr21:47542060C>T	ENST00000300527.4	+	19	1664	c.1560C>T	c.(1558-1560)ccC>ccT	p.P520P	COL6A2_ENST00000310645.5_Silent_p.P520P|COL6A2_ENST00000409416.1_Silent_p.P520P|COL6A2_ENST00000357838.4_Silent_p.P520P|COL6A2_ENST00000397763.1_Silent_p.P520P	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	520	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		ACCCAGGACCCCGAGGAGCAC	0.642																																							uc002zia.1		NA																	0				central_nervous_system(7)|ovary(1)	8						c.(1558-1560)CCC>CCT		alpha 2 type VI collagen isoform 2C2 precursor							37.0	38.0	38.0					21																	47542060		2198	4297	6495	SO:0001819	synonymous_variant	1292				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	g.chr21:47542060C>T	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1560C>T	21.37:g.47542060C>T						COL6A2_uc002zhy.1_Silent_p.P520P|COL6A2_uc002zhz.1_Silent_p.P520P|COL6A2_uc002zib.1_Intron	p.P520P	NM_001849	NP_001840	P12110	CO6A2_HUMAN		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	19	1642	+	Breast(49;0.245)		520			Triple-helical region.		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	ENST00000300527.4	37	c.1560C>T	CCDS13728.1																																																																																				0.642	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			3	35	0	0	0	0.004672	0	3	35				
DIP2A	23181	broad.mit.edu	37	21	47976893	47976893	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr21:47976893G>C	ENST00000417564.2	+	30	3561	c.3540G>C	c.(3538-3540)aaG>aaC	p.K1180N	DIP2A_ENST00000318711.7_Missense_Mutation_p.K1181N|DIP2A_ENST00000400274.1_Missense_Mutation_p.K1176N			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1180					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.K1180N(1)|p.K1181N(1)		cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GCTCCATAAAGCTGCAGTGTG	0.522																																							uc002zjo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(3538-3540)AAG>AAC		disco-interacting protein 2A isoform a							29.0	31.0	30.0					21																	47976893		2084	4255	6339	SO:0001583	missense	23181				multicellular organismal development	nucleus	catalytic activity|transcription factor binding	g.chr21:47976893G>C	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3540G>C	21.37:g.47976893G>C	ENSP00000392066:p.Lys1180Asn					DIP2A_uc011afz.1_Missense_Mutation_p.K1176N|DIP2A_uc002zjr.2_Missense_Mutation_p.K147N	p.K1180N	NM_015151	NP_055966	Q14689	DIP2A_HUMAN		Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)	30	3723	+	Breast(49;0.0933)		1180					A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	c.3540G>C	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.958878	0.74016	.	.	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000417564	T;T;T	0.43294	0.95;0.95;0.95	6.06	3.29	0.37713	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.59418	0.2192	M	0.86343	2.81	0.80722	D	1	P;P	0.44478	0.836;0.578	P;P	0.52386	0.697;0.551	T	0.65162	-0.6235	10	0.66056	D	0.02	-31.3027	11.1472	0.48436	0.2014:0.0:0.7986:0.0	.	1181;1180	E9PER1;Q14689	.;DIP2A_HUMAN	N	1176;1181;1180	ENSP00000383133:K1176N;ENSP00000323633:K1181N;ENSP00000392066:K1180N	ENSP00000323633:K1181N	K	+	3	2	DIP2A	46801321	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.123000	0.41996	0.910000	0.36722	-0.145000	0.13849	AAG		0.522	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151		7	8	0	0	0	0.00308	0	7	8				
MICAL3	57553	broad.mit.edu	37	22	18300618	18300618	+	Silent	SNP	G	G	A	rs558369380		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:18300618G>A	ENST00000441493.2	-	26	5161	c.4809C>T	c.(4807-4809)tcC>tcT	p.S1603S	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1603					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.S1603S(1)		large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GGCTCTTCACGGACTTCTCCC	0.692													G|||	1	0.000199681	0.0	0.0	5008	,	,		13306	0.0		0.0	False		,,,				2504	0.001						uc002zng.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(4807-4809)TCC>TCT		microtubule associated monoxygenase, calponin							16.0	19.0	18.0					22																	18300618		2080	4232	6312	SO:0001819	synonymous_variant	57553					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr22:18300618G>A	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4809C>T	22.37:g.18300618G>A						MICAL3_uc011agl.1_Silent_p.S1519S|MICAL3_uc010gre.1_5'Flank	p.S1603S	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN		Lung(27;0.0427)	26	5162	-		all_epithelial(15;0.198)	1603					B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	37	c.4809C>T	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	G	9.541	1.113302	0.20795	.	.	ENSG00000093100	ENST00000252134	.	.	.	4.9	-3.83	0.04269	.	.	.	.	.	T	0.39200	0.1069	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30149	-0.9988	4	.	.	.	.	2.8303	0.05497	0.4111:0.1195:0.3536:0.1157	.	.	.	.	L	585	.	.	P	-	2	0	XXbac-B461K10.4	16680618	0.017000	0.18338	0.888000	0.34837	0.973000	0.67179	-0.643000	0.05421	-1.039000	0.03275	-0.367000	0.07326	CCG		0.692	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			6	25	0	0	0	0.001984	0	6	25				
MICAL3	57553	broad.mit.edu	37	22	18301586	18301586	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:18301586G>A	ENST00000441493.2	-	26	4193	c.3841C>T	c.(3841-3843)Cgc>Tgc	p.R1281C		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1281	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.R1281C(1)		large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GGCTGGAAGCGTATGGGGGAC	0.672																																							uc002zng.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3841-3843)CGC>TGC		microtubule associated monoxygenase, calponin							39.0	46.0	44.0					22																	18301586		1942	4120	6062	SO:0001583	missense	57553					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr22:18301586G>A	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3841C>T	22.37:g.18301586G>A	ENSP00000416015:p.Arg1281Cys					MICAL3_uc011agl.1_Missense_Mutation_p.R1197C	p.R1281C	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN		Lung(27;0.0427)	26	4194	-		all_epithelial(15;0.198)	1281			Pro-rich.		B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	c.3841C>T	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	G	2.510	-0.313221	0.05422	.	.	ENSG00000093100	ENST00000441493	T	0.64260	-0.09	4.59	0.494	0.16884	.	.	.	.	.	T	0.47893	0.1470	L	0.41710	1.295	0.80722	D	1	B	0.19445	0.036	B	0.09377	0.004	T	0.35871	-0.9771	9	0.41790	T	0.15	.	8.5282	0.33317	0.449:0.0:0.551:0.0	.	1281	Q7RTP6	MICA3_HUMAN	C	1281	ENSP00000416015:R1281C	ENSP00000416015:R1281C	R	-	1	0	XXbac-B461K10.4	16681586	0.179000	0.23135	0.981000	0.43875	0.480000	0.33159	0.465000	0.22004	0.288000	0.22398	0.462000	0.41574	CGC		0.672	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			15	100	0	0	0	0.004007	0	15	100				
HIRA	7290	broad.mit.edu	37	22	19365548	19365549	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:19365548_19365549CC>AA	ENST00000263208.5	-	14	1712_1713	c.1456_1457GG>TT	c.(1456-1458)GGc>TTc	p.G486F	HIRA_ENST00000546308.1_Missense_Mutation_p.G442F|HIRA_ENST00000340170.4_Missense_Mutation_p.G486F|HIRA_ENST00000541063.1_Missense_Mutation_p.G442F	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	486	Interaction with CCNA1.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.G486F(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					CGCCAGGGAGCCCGAGAGGGGG	0.54																																							uc002zpf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1456-1458)GGC>TTC		HIR histone cell cycle regulation defective																																				SO:0001583	missense	7290				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr22:19365548_19365549CC>AA	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.1456_1457delinsAA	22.37:g.19365548_19365549delinsAA	ENSP00000263208:p.Gly486Phe					HIRA_uc011agx.1_Missense_Mutation_p.G352F|HIRA_uc010grn.1_Missense_Mutation_p.G486F|HIRA_uc010gro.1_Missense_Mutation_p.G442F|HIRA_uc010grp.2_RNA	p.G486F	NM_003325	NP_003316	P54198	HIRA_HUMAN			14	1676_1677	-	Colorectal(54;0.0993)		486			Interaction with CCNA1.		Q05BU9|Q8IXN2	Missense_Mutation	DNP	ENST00000263208.5	37	c.1456_1457GG>TT	CCDS13759.1																																																																																				0.540	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325		20	237	0	0	0	0.004672	0	20	237				
PIWIL3	440822	broad.mit.edu	37	22	25121445	25121445	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:25121445C>G	ENST00000332271.5	-	17	2490	c.2074G>C	c.(2074-2076)Gag>Cag	p.E692Q	PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_Missense_Mutation_p.E574Q|PIWIL3_ENST00000527701.1_Missense_Mutation_p.E574Q	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	692	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)	p.E692Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						TTCACAAGCTCTTCTCCTGTT	0.438																																							uc003abd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(2074-2076)GAG>CAG		piwi-like 3							106.0	98.0	101.0					22																	25121445		2203	4300	6503	SO:0001583	missense	440822				cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding	g.chr22:25121445C>G	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.2074G>C	22.37:g.25121445C>G	ENSP00000330031:p.Glu692Gln					PIWIL3_uc011ajx.1_Missense_Mutation_p.E574Q|PIWIL3_uc011ajy.1_Missense_Mutation_p.E574Q|PIWIL3_uc010gut.1_Missense_Mutation_p.E683Q	p.E692Q	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN			17	2491	-			692			Piwi.			Missense_Mutation	SNP	ENST00000332271.5	37	c.2074G>C	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449077	0.63178	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.35789	1.29;1.29;1.29	3.24	3.24	0.37175	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	U	0.000000	T	0.69424	0.3109	H	0.96111	3.77	0.54753	D	0.999987	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.994;0.997	T	0.79603	-0.1735	10	0.87932	D	0	-24.2232	12.3445	0.55114	0.0:1.0:0.0:0.0	.	574;683;692	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	Q	692;574;574	ENSP00000330031:E692Q;ENSP00000431843:E574Q;ENSP00000435718:E574Q	ENSP00000330031:E692Q	E	-	1	0	PIWIL3	23451445	1.000000	0.71417	0.123000	0.21794	0.011000	0.07611	5.242000	0.65389	1.829000	0.53265	0.561000	0.74099	GAG		0.438	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496		17	116	0	0	0	0.00499	0	17	116				
MYO18B	84700	broad.mit.edu	37	22	26164338	26164338	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:26164338A>T	ENST00000407587.2	+	4	624	c.455A>T	c.(454-456)gAt>gTt	p.D152V	MYO18B_ENST00000536101.1_Missense_Mutation_p.D152V|MYO18B_ENST00000335473.7_Missense_Mutation_p.D152V			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	152						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D152V(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AGGAGGGGTGATGTGTTGTTG	0.597																																							uc003abz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						c.(454-456)GAT>GTT		myosin XVIIIB							34.0	41.0	39.0					22																	26164338		2052	4195	6247	SO:0001583	missense	84700					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity	g.chr22:26164338A>T	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.455A>T	22.37:g.26164338A>T	ENSP00000386096:p.Asp152Val					MYO18B_uc003aca.1_Missense_Mutation_p.D33V|MYO18B_uc010guy.1_Missense_Mutation_p.D33V|MYO18B_uc010guz.1_Missense_Mutation_p.D33V|MYO18B_uc011aka.1_5'UTR|MYO18B_uc011akb.1_5'Flank	p.D152V	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN			4	705	+			152					B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37	c.455A>T		.	.	.	.	.	.	.	.	.	.	A	15.30	2.792878	0.50102	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.92249	-2.98;-2.98;-3.0	5.01	3.98	0.46160	.	0.000000	0.38381	N	0.001714	D	0.93818	0.8023	M	0.65975	2.015	0.18873	N	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	D	0.86322	0.1693	10	0.87932	D	0	.	4.6485	0.12584	0.7049:0.1964:0.0987:0.0	.	152;152;152	Q8IUG5;F5GXR6;F5GYU7	MY18B_HUMAN;.;.	V	152	ENSP00000441229:D152V;ENSP00000334563:D152V;ENSP00000386096:D152V	ENSP00000334563:D152V	D	+	2	0	MYO18B	24494338	0.905000	0.30787	0.374000	0.26016	0.812000	0.45895	3.175000	0.50855	1.895000	0.54865	0.397000	0.26171	GAT		0.597	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		9	44	0	0	0	0.004482	0	9	44				
SEZ6L	23544	broad.mit.edu	37	22	26706764	26706764	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:26706764A>T	ENST00000248933.6	+	7	1738	c.1643A>T	c.(1642-1644)cAg>cTg	p.Q548L	SEZ6L_ENST00000360929.3_Missense_Mutation_p.Q548L|SEZ6L_ENST00000343706.4_Missense_Mutation_p.Q548L|SEZ6L_ENST00000404234.3_Missense_Mutation_p.Q548L|SEZ6L_ENST00000403121.1_Missense_Mutation_p.Q321L|SEZ6L_ENST00000402979.1_Missense_Mutation_p.Q321L|SEZ6L_ENST00000529632.2_Missense_Mutation_p.Q548L			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	548	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.Q548L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						ACGTCCGACCAGGCCCGGGCG	0.597																																							uc003acb.2		NA																	1	Substitution - Missense(1)	p.Q548K(1)	lung(1)	ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(1642-1644)CAG>CTG		seizure related 6 homolog (mouse)-like							101.0	88.0	93.0					22																	26706764		2203	4300	6503	SO:0001583	missense	23544					endoplasmic reticulum membrane|integral to membrane		g.chr22:26706764A>T	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1643A>T	22.37:g.26706764A>T	ENSP00000248933:p.Gln548Leu					SEZ6L_uc003acc.2_Missense_Mutation_p.Q548L|SEZ6L_uc011akc.1_Missense_Mutation_p.Q548L|SEZ6L_uc003acd.2_Missense_Mutation_p.Q548L|SEZ6L_uc011akd.1_Missense_Mutation_p.Q548L|SEZ6L_uc003ace.2_Missense_Mutation_p.Q548L|SEZ6L_uc003acf.1_Missense_Mutation_p.Q321L|SEZ6L_uc010gvc.1_Missense_Mutation_p.Q321L	p.Q548L	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN			7	1799	+			548			CUB 2.|Extracellular (Potential).		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	c.1643A>T	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	A	10.22	1.289995	0.23478	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24;2.24;2.24	5.04	1.64	0.23874	CUB (5);	0.228496	0.28624	N	0.014681	T	0.11367	0.0277	N	0.17723	0.515	0.80722	D	1	P;P;P;P;P;P;P	0.45715	0.837;0.737;0.833;0.865;0.865;0.737;0.737	B;B;B;B;P;B;B	0.46026	0.334;0.338;0.257;0.423;0.501;0.338;0.338	T	0.13656	-1.0501	10	0.42905	T	0.14	.	4.8126	0.13351	0.7053:0.0:0.1554:0.1393	.	548;548;321;548;548;548;548	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	L	548;548;548;548;548;321;321	ENSP00000384772:Q548L;ENSP00000437037:Q548L;ENSP00000354185:Q548L;ENSP00000248933:Q548L;ENSP00000342661:Q548L;ENSP00000384838:Q321L;ENSP00000384733:Q321L	ENSP00000248933:Q548L	Q	+	2	0	SEZ6L	25036764	1.000000	0.71417	0.007000	0.13788	0.047000	0.14425	2.545000	0.45769	0.318000	0.23185	0.459000	0.35465	CAG		0.597	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3			13	140	0	0	0	0.00499	0	13	140				
TBC1D10A	83874	broad.mit.edu	37	22	30691010	30691010	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:30691010T>A	ENST00000215790.7	-	5	723	c.559A>T	c.(559-561)Acg>Tcg	p.T187S	RP1-130H16.18_ENST00000447976.1_Missense_Mutation_p.T61S|TBC1D10A_ENST00000403477.3_Missense_Mutation_p.T194S|TBC1D10A_ENST00000403362.1_Missense_Mutation_p.T99S	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	187	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)	p.T187S(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						CGGTACAGCGTGTAGGCCTTC	0.647																																							uc011akt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(559-561)ACG>TCG		TBC1 domain family, member 10A							60.0	60.0	60.0					22																	30691010		2203	4300	6503	SO:0001583	missense	83874					intracellular|microvillus	guanyl-nucleotide exchange factor activity|PDZ domain binding|Rab GTPase activator activity	g.chr22:30691010T>A	AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.559A>T	22.37:g.30691010T>A	ENSP00000215790:p.Thr187Ser					GATSL3_uc003ahf.2_RNA|GATSL3_uc003ahg.2_RNA|GATSL3_uc003ahh.2_RNA|GATSL3_uc010gvq.2_RNA|GATSL3_uc003ahi.2_Missense_Mutation_p.T45S|TBC1D10A_uc003ahj.3_Missense_Mutation_p.T99S|TBC1D10A_uc010gvu.2_Missense_Mutation_p.T194S|TBC1D10A_uc003ahk.3_Missense_Mutation_p.T187S	p.T187S	NM_031937	NP_114143	Q9BXI6	TB10A_HUMAN			5	583	-			187			Rab-GAP TBC.		B3KXT8|O76053|Q20WK7|Q543A2	Missense_Mutation	SNP	ENST00000215790.7	37	c.559A>T	CCDS13874.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.003662	0.74932	.	.	ENSG00000248751;ENSG00000099992;ENSG00000099992;ENSG00000099992;ENSG00000099992	ENST00000434291;ENST00000215790;ENST00000403477;ENST00000403362;ENST00000393906	T;T;T;T;T	0.03441	3.93;3.93;3.93;3.93;3.93	4.33	4.33	0.51752	Rab-GAP/TBC domain (4);	0.050430	0.85682	D	0.000000	T	0.02047	0.0064	N	0.00864	-1.135	0.80722	D	1	P;B;P;P	0.40032	0.699;0.041;0.699;0.526	P;B;P;P	0.47786	0.557;0.124;0.557;0.557	T	0.64989	-0.6277	10	0.09843	T	0.71	.	12.7794	0.57469	0.0:0.0:0.0:1.0	.	187;194;187;187	Q20WK7;B3KXT8;Q9BXI6;A7E244	.;.;TB10A_HUMAN;.	S	61;187;194;99;99	ENSP00000401535:T61S;ENSP00000215790:T187S;ENSP00000384996:T194S;ENSP00000385050:T99S;ENSP00000377484:T99S	ENSP00000331267:T48S	T	-	1	0	TBC1D10A;RP1-130H16.18	29021010	1.000000	0.71417	0.994000	0.49952	0.917000	0.54804	5.933000	0.70130	1.952000	0.56665	0.459000	0.35465	ACG		0.647	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320550.1	NM_031937		15	92	0	0	0	0.00499	0	15	92				
TRIOBP	11078	broad.mit.edu	37	22	38121216	38121216	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:38121216C>T	ENST00000406386.3	+	7	2908	c.2653C>T	c.(2653-2655)Cgc>Tgc	p.R885C		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	885					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.R885C(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					ATCTCCCCACCGCTCCACTCA	0.532																																							uc003atr.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(2653-2655)CGC>TGC		TRIO and F-actin binding protein isoform 6							138.0	152.0	147.0					22																	38121216		2032	4160	6192	SO:0001583	missense	11078				actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding	g.chr22:38121216C>T	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.2653C>T	22.37:g.38121216C>T	ENSP00000384312:p.Arg885Cys					TRIOBP_uc003atu.2_Missense_Mutation_p.R713C|TRIOBP_uc003atq.1_Missense_Mutation_p.R885C|TRIOBP_uc003ats.1_Missense_Mutation_p.R713C	p.R885C	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN			7	2924	+	Melanoma(58;0.0574)		885					B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	c.2653C>T	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192902	0.78902	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.35421	1.31	4.72	2.54	0.30619	.	.	.	.	.	T	0.34424	0.0897	M	0.68317	2.08	0.09310	N	0.999999	B	0.18610	0.029	B	0.12156	0.007	T	0.34925	-0.9809	9	0.72032	D	0.01	.	6.2873	0.21041	0.1799:0.723:0.0:0.0971	.	885	Q9H2D6	TARA_HUMAN	C	885	ENSP00000384312:R885C	ENSP00000384312:R885C	R	+	1	0	TRIOBP	36451162	0.001000	0.12720	0.012000	0.15200	0.799000	0.45148	0.501000	0.22578	0.496000	0.27904	0.460000	0.39030	CGC		0.532	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			15	330	0	0	0	0.003163	0	15	330				
CACNA1I	8911	broad.mit.edu	37	22	40055839	40055839	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:40055839G>T	ENST00000402142.3	+	14	2586	c.2586G>T	c.(2584-2586)gtG>gtT	p.V862V	CACNA1I_ENST00000407673.1_Silent_p.V827V|CACNA1I_ENST00000404898.1_Silent_p.V827V|CACNA1I_ENST00000336649.4_Silent_p.V868V|CACNA1I_ENST00000401624.1_Silent_p.V862V|CACNA1I_ENST00000400164.3_Silent_p.V827V	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	862					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.V862V(1)|p.V827V(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CCATCCTGGTGGAGGGCTTCC	0.622																																							uc003ayc.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(2584-2586)GTG>GTT		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)						69.0	68.0	68.0					22																	40055839		2043	4195	6238	SO:0001819	synonymous_variant	8911				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding	g.chr22:40055839G>T	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.2586G>T	22.37:g.40055839G>T						CACNA1I_uc003ayd.2_Silent_p.V827V|CACNA1I_uc003aye.2_Silent_p.V777V|CACNA1I_uc003ayf.2_Silent_p.V742V	p.V862V	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN			14	2586	+	Melanoma(58;0.0749)		862			Helical; Name=S6 of repeat II; (Potential).|II.		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	37	c.2586G>T	CCDS46710.1																																																																																				0.622	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406		13	97	1	0	7.03913e-09	0.013537	9.48025e-09	13	97				
ZBED4	9889	broad.mit.edu	37	22	50277987	50277987	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr22:50277987C>G	ENST00000216268.5	+	2	1154	c.677C>G	c.(676-678)tCt>tGt	p.S226C		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	226						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S226C(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		ACAGAGGAGTCTGTGTCTGTA	0.557																																							uc003bix.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(676-678)TCT>TGT		zinc finger, BED-type containing 4							59.0	60.0	59.0					22																	50277987		2203	4300	6503	SO:0001583	missense	9889					cytoplasm|nucleus	DNA binding|metal ion binding|protein dimerization activity	g.chr22:50277987C>G	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.677C>G	22.37:g.50277987C>G	ENSP00000216268:p.Ser226Cys						p.S226C	NM_014838	NP_055653	O75132	ZBED4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)	2	1147	+		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)	226					B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	ENST00000216268.5	37	c.677C>G	CCDS33677.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.095238	0.36952	.	.	ENSG00000100426	ENST00000216268	T	0.50548	0.74	5.31	3.22	0.36961	.	0.443402	0.22255	N	0.062495	T	0.34600	0.0903	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.34453	-0.9828	10	0.87932	D	0	-5.0645	10.9649	0.47406	0.0:0.7999:0.1301:0.07	.	226	O75132	ZBED4_HUMAN	C	226	ENSP00000216268:S226C	ENSP00000216268:S226C	S	+	2	0	ZBED4	48663991	0.242000	0.23868	0.002000	0.10522	0.277000	0.26821	1.973000	0.40550	0.799000	0.34018	0.650000	0.86243	TCT		0.557	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	NM_014838		15	103	0	0	0	0.004007	0	15	103				
CHL1	10752	broad.mit.edu	37	3	440019	440019	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:440019G>T	ENST00000256509.2	+	25	3846	c.3204G>T	c.(3202-3204)tgG>tgT	p.W1068C	CHL1_ENST00000397491.2_Missense_Mutation_p.W1052C	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.W1068C(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CTAAGAATTGGGGCGATAATG	0.393																																							uc003bou.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12						c.(3154-3156)TGG>TGT		cell adhesion molecule with homology to L1CAM							87.0	85.0	86.0					3																	440019		2203	4300	6503	SO:0001583	missense	10752				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr3:440019G>T	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3204G>T	3.37:g.440019G>T	ENSP00000256509:p.Trp1068Cys					CHL1_uc003bot.2_Missense_Mutation_p.W1068C|CHL1_uc003bow.1_Missense_Mutation_p.W1052C|CHL1_uc011asi.1_Intron	p.W1052C	NM_006614	NP_006605	O00533	CHL1_HUMAN		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)	24	3427	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	1052			Extracellular (Potential).		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	c.3156G>T	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863809	0.51482	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.59083	0.29;0.3	5.45	5.45	0.79879	.	0.076649	0.56097	D	0.000023	T	0.64450	0.2599	L	0.27053	0.805	0.80722	D	1	P;D	0.76494	0.915;0.999	P;D	0.65573	0.719;0.936	T	0.65446	-0.6166	10	0.48119	T	0.1	.	17.4608	0.87620	0.0:0.0:1.0:0.0	.	1052;1068	O00533;O00533-2	CHL1_HUMAN;.	C	1068;1052	ENSP00000256509:W1068C;ENSP00000380628:W1052C	ENSP00000256509:W1068C	W	+	3	0	CHL1	415019	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.519000	0.73768	2.562000	0.86427	0.650000	0.86243	TGG		0.393	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614		6	89	1	0	3.27435e-08	0.00245	4.29759e-08	6	89				
DCLK3	85443	broad.mit.edu	37	3	36779841	36779841	+	Missense_Mutation	SNP	G	G	T	rs184188797	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:36779841G>T	ENST00000416516.2	-	2	800	c.310C>A	c.(310-312)Ccc>Acc	p.P104T		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	104						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P104T(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						TTGCTACTGGGTTCTGGCTCC	0.577																																							uc003cgi.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						c.(310-312)CCC>ACC		doublecortin-like kinase 3							117.0	123.0	121.0					3																	36779841		1899	4098	5997	SO:0001583	missense	85443					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	g.chr3:36779841G>T	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.310C>A	3.37:g.36779841G>T	ENSP00000394484:p.Pro104Thr						p.P104T	NM_033403	NP_208382	Q9C098	DCLK3_HUMAN			2	801	-			104						Missense_Mutation	SNP	ENST00000416516.2	37	c.310C>A	CCDS43064.1	.	.	.	.	.	.	.	.	.	.	G	3.017	-0.202706	0.06219	.	.	ENSG00000163673	ENST00000416516	T	0.65732	-0.17	4.7	-4.5	0.03493	.	0.906000	0.08969	N	0.867477	T	0.38295	0.1035	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.20940	-1.0260	10	0.44086	T	0.13	.	0.5915	0.00728	0.2084:0.1994:0.2913:0.3009	.	104	Q9C098	DCLK3_HUMAN	T	104	ENSP00000394484:P104T	ENSP00000394484:P104T	P	-	1	0	DCLK3	36754845	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	0.199000	0.17237	-0.788000	0.04504	0.655000	0.94253	CCC		0.577	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355		21	222	1	0	1.01871e-10	0.008871	1.44764e-10	21	222				
SCN10A	6336	broad.mit.edu	37	3	38764936	38764936	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:38764936C>A	ENST00000449082.2	-	18	3336	c.3337G>T	c.(3337-3339)Gac>Tac	p.D1113Y		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1113					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.D1113Y(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GTGAAGCAGTCATCTGGTTCT	0.552																																							uc003ciq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(3337-3339)GAC>TAC		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						119.0	101.0	107.0					3																	38764936		2203	4300	6503	SO:0001583	missense	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38764936C>A	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3337G>T	3.37:g.38764936C>A	ENSP00000390600:p.Asp1113Tyr						p.D1113Y	NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	18	3337	-			1113					A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	c.3337G>T	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.945375	0.53079	.	.	ENSG00000185313	ENST00000449082	D	0.86097	-2.07	4.65	4.65	0.58169	Sodium ion transport-associated (1);	0.334391	0.34959	N	0.003541	D	0.88680	0.6502	M	0.73962	2.25	0.44595	D	0.997567	D	0.60160	0.987	P	0.57204	0.815	D	0.88746	0.3247	10	0.56958	D	0.05	.	9.2948	0.37808	0.0:0.8633:0.0:0.1367	.	1113	Q9Y5Y9	SCNAA_HUMAN	Y	1113	ENSP00000390600:D1113Y	ENSP00000390600:D1113Y	D	-	1	0	SCN10A	38739940	0.007000	0.16637	0.972000	0.41901	0.625000	0.37756	1.407000	0.34657	2.429000	0.82318	0.555000	0.69702	GAC		0.552	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		11	89	1	0	2.27111e-07	0.013537	2.86797e-07	11	89				
ZNF445	353274	broad.mit.edu	37	3	44489616	44489616	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:44489616C>G	ENST00000396077.2	-	8	1894	c.1547G>C	c.(1546-1548)aGg>aCg	p.R516T	ZNF445_ENST00000425708.2_Missense_Mutation_p.R516T	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	516					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R516T(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CCCACACACCCTACATTTAAA	0.448																																							uc003cnf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1546-1548)AGG>ACG		zinc finger protein 445							99.0	102.0	101.0					3																	44489616		2203	4300	6503	SO:0001583	missense	353274				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:44489616C>G	AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.1547G>C	3.37:g.44489616C>G	ENSP00000379387:p.Arg516Thr					ZNF445_uc011azv.1_Missense_Mutation_p.R504T|ZNF445_uc011azw.1_Missense_Mutation_p.R516T	p.R516T	NM_181489	NP_852466	P59923	ZN445_HUMAN		KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)	8	1895	-			516			C2H2-type 2.		Q3MJD1	Missense_Mutation	SNP	ENST00000396077.2	37	c.1547G>C	CCDS2713.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.878135	0.51801	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.17370	2.28;2.28	3.72	2.84	0.33178	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.118290	0.39146	N	0.001457	T	0.08133	0.0203	N	0.03881	-0.34	0.09310	N	1	B;B	0.34349	0.45;0.45	B;B	0.37346	0.247;0.247	T	0.27331	-1.0077	10	0.38643	T	0.18	.	9.7681	0.40574	0.0:0.894:0.0:0.106	.	504;516	B7ZKX2;P59923	.;ZN445_HUMAN	T	516	ENSP00000413073:R516T;ENSP00000379387:R516T	ENSP00000379387:R516T	R	-	2	0	ZNF445	44464620	0.000000	0.05858	0.081000	0.20488	0.916000	0.54674	-1.289000	0.02780	1.144000	0.42321	0.591000	0.81541	AGG		0.448	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2	NM_181489		7	140	0	0	0	0.008291	0	7	140				
ZKSCAN7	55888	broad.mit.edu	37	3	44611702	44611702	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:44611702C>G	ENST00000273320.3	+	6	1529	c.1100C>G	c.(1099-1101)tCt>tGt	p.S367C	ZKSCAN7_ENST00000341840.3_Intron|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000426540.1_Missense_Mutation_p.S367C|ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	367					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S367C(1)									CCACCTCTGTCTTCCAGTCCT	0.378																																						Esophageal Squamous(121;907 1626 38429 48584 52774)	uc010hin.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1099-1101)TCT>TGT		zinc finger protein 167 isoform 1							85.0	90.0	88.0					3																	44611702		2203	4300	6503	SO:0001583	missense	55888				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:44611702C>G	L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1100C>G	3.37:g.44611702C>G	ENSP00000273320:p.Ser367Cys					ZNF167_uc003cnh.2_RNA|ZNF167_uc003cni.2_Intron|ZNF167_uc010hio.2_Missense_Mutation_p.S216C|ZNF167_uc003cnj.2_Missense_Mutation_p.S367C|ZNF167_uc003cnk.2_Intron	p.S367C	NM_018651	NP_061121	Q9P0L1	ZN167_HUMAN		KIRC - Kidney renal clear cell carcinoma(197;0.0486)|Kidney(197;0.0609)	6	1488	+			367					A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Missense_Mutation	SNP	ENST00000273320.3	37	c.1100C>G	CCDS2715.1	.	.	.	.	.	.	.	.	.	.	.	15.77	2.930497	0.52866	.	.	ENSG00000196345	ENST00000426540;ENST00000273320;ENST00000447279	T;T;T	0.06449	3.3;3.3;3.31	3.99	3.99	0.46301	.	.	.	.	.	T	0.08223	0.0205	N	0.08118	0	0.09310	N	0.999993	D;D	0.76494	0.999;0.997	P;P	0.58873	0.847;0.737	T	0.40572	-0.9556	9	0.41790	T	0.15	-3.0207	11.4778	0.50308	0.0:1.0:0.0:0.0	.	237;367	A7MAY2;Q9P0L1	.;ZN167_HUMAN	C	367;367;216	ENSP00000395524:S367C;ENSP00000273320:S367C;ENSP00000405034:S216C	ENSP00000273320:S367C	S	+	2	0	ZNF167	44586706	0.002000	0.14202	0.098000	0.21074	0.025000	0.11179	-0.358000	0.07641	2.073000	0.62155	0.650000	0.86243	TCT		0.378	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651		17	156	0	0	0	0.007413	0	17	156				
TGM4	7047	broad.mit.edu	37	3	44943081	44943081	+	Silent	SNP	A	A	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:44943081A>C	ENST00000296125.4	+	7	791	c.723A>C	c.(721-723)acA>acC	p.T241T	RP11-272D20.2_ENST00000427258.1_RNA	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	241					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.T241T(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	AAGGTGGCACAGCCCCATACA	0.592																																							uc003coc.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(721-723)ACA>ACC		transglutaminase 4 (prostate)	L-Glutamine(DB00130)						106.0	96.0	99.0					3																	44943081		2203	4300	6503	SO:0001819	synonymous_variant	7047				peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr3:44943081A>C	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.723A>C	3.37:g.44943081A>C						TGM4_uc003cob.2_RNA	p.T241T	NM_003241	NP_003232	P49221	TGM4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	7	796	+			241					Q16707|Q96QN4	Silent	SNP	ENST00000296125.4	37	c.723A>C	CCDS2723.1																																																																																				0.592	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241		4	30	0	0	0	0.000602	0	4	30				
FYCO1	79443	broad.mit.edu	37	3	46006595	46006595	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:46006595C>A	ENST00000296137.2	-	9	3285	c.3080G>T	c.(3079-3081)aGc>aTc	p.S1027I	FYCO1_ENST00000535325.1_Missense_Mutation_p.S1027I	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1027					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)	p.S1027I(1)		NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		GCCCCTGAGGCTCTTGCACTC	0.562																																							uc003cpb.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(3079-3081)AGC>ATC		FYVE and coiled-coil domain containing 1							50.0	49.0	50.0					3																	46006595		2203	4300	6503	SO:0001583	missense	79443				transport	integral to membrane	metal ion binding|protein binding	g.chr3:46006595C>A	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3080G>T	3.37:g.46006595C>A	ENSP00000296137:p.Ser1027Ile					FYCO1_uc011bal.1_Missense_Mutation_p.S1027I	p.S1027I	NM_024513	NP_078789	Q9BQS8	FYCO1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)	9	3286	-			1027			Potential.		B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	c.3080G>T	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	C	9.785	1.176297	0.21704	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.77358	-1.09;-1.09	5.79	0.847	0.18961	.	0.516357	0.22714	N	0.056525	T	0.60881	0.2303	L	0.29908	0.895	0.09310	N	1	B;B	0.23540	0.087;0.07	B;B	0.23852	0.049;0.027	T	0.50566	-0.8813	10	0.45353	T	0.12	-9.1735	4.7395	0.13005	0.0:0.4656:0.1562:0.3782	.	1027;1027	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	I	1027	ENSP00000296137:S1027I;ENSP00000441178:S1027I	ENSP00000296137:S1027I	S	-	2	0	FYCO1	45981599	0.287000	0.24315	0.740000	0.30986	0.285000	0.27093	0.243000	0.18106	0.357000	0.24183	-0.137000	0.14449	AGC		0.562	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513		5	56	1	0	0.00116845	0.001168	0.00126917	5	56				
FYCO1	79443	broad.mit.edu	37	3	46023127	46023127	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:46023127C>A	ENST00000296137.2	-	3	302	c.97G>T	c.(97-99)Gaa>Taa	p.E33*	FYCO1_ENST00000535325.1_Nonsense_Mutation_p.E33*	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	33					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)	p.E33*(1)		NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		GTGATGGGTTCCCCTGCTTCC	0.398																																							uc003cpb.3		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(97-99)GAA>TAA		FYVE and coiled-coil domain containing 1							154.0	152.0	153.0					3																	46023127		2203	4300	6503	SO:0001587	stop_gained	79443				transport	integral to membrane	metal ion binding|protein binding	g.chr3:46023127C>A	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.97G>T	3.37:g.46023127C>A	ENSP00000296137:p.Glu33*					FYCO1_uc011bal.1_Nonsense_Mutation_p.E33*	p.E33*	NM_024513	NP_078789	Q9BQS8	FYCO1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)	3	303	-			33			Potential.		B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Nonsense_Mutation	SNP	ENST00000296137.2	37	c.97G>T	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	C	38	6.881835	0.97908	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.3327	18.3055	0.90179	0.0:1.0:0.0:0.0	.	.	.	.	X	33	.	ENSP00000296137:E33X	E	-	1	0	FYCO1	45998131	1.000000	0.71417	0.996000	0.52242	0.761000	0.43186	7.446000	0.80609	2.832000	0.97577	0.655000	0.94253	GAA		0.398	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513		15	136	1	0	1.37285e-15	0.004007	2.21769e-15	15	136				
LTF	4057	broad.mit.edu	37	3	46485038	46485038	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:46485038C>A	ENST00000231751.4	-	13	1844	c.1549G>T	c.(1549-1551)Gac>Tac	p.D517Y	LTF_ENST00000493056.1_5'Flank|LTF_ENST00000417439.1_Missense_Mutation_p.D515Y|LTF_ENST00000426532.2_Missense_Mutation_p.D473Y	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	517	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)	p.D517Y(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		GATCTCGGGTCAGACCCAGGG	0.517																																							uc003cpq.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)|lung(1)	4						c.(1549-1551)GAC>TAC		lactotransferrin precursor	Pefloxacin(DB00487)						148.0	152.0	150.0					3																	46485038		2203	4296	6499	SO:0001583	missense	4057				cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity	g.chr3:46485038C>A		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.1549G>T	3.37:g.46485038C>A	ENSP00000231751:p.Asp517Tyr					LTF_uc003fzr.2_Missense_Mutation_p.D473Y|LTF_uc010hjh.2_Missense_Mutation_p.D515Y|LTF_uc003cpr.2_Missense_Mutation_p.D504Y	p.D517Y	NM_002343	NP_002334	P02788	TRFL_HUMAN		all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	13	1587	-			517			Transferrin-like 2.		A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	37	c.1549G>T	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.441365	0.83993	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	5.42	2.63	0.31362	.	0.673531	0.15233	N	0.273303	T	0.51686	0.1689	M	0.76433	2.335	0.18873	N	0.999985	P;D;P	0.61697	0.625;0.99;0.952	P;P;P	0.61003	0.757;0.882;0.757	T	0.39099	-0.9630	10	0.72032	D	0.01	-14.5603	6.826	0.23883	0.1422:0.7024:0.0:0.1555	.	515;504;517	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	Y	517;473;515;504	ENSP00000231751:D517Y;ENSP00000405719:D473Y;ENSP00000405546:D515Y;ENSP00000397427:D504Y	ENSP00000231751:D517Y	D	-	1	0	LTF	46460042	0.004000	0.15560	0.001000	0.08648	0.772000	0.43724	0.878000	0.28126	0.347000	0.23924	0.655000	0.94253	GAC		0.517	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343		16	169	1	0	4.7546e-09	0.004007	6.41872e-09	16	169				
SPINK8	646424	broad.mit.edu	37	3	48362530	48362530	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:48362530C>G	ENST00000434006.1	-	2	101	c.102G>C	c.(100-102)caG>caC	p.Q34H		NM_001080525.1	NP_001073994.1	P0C7L1	ISK8_HUMAN	serine peptidase inhibitor, Kazal type 8 (putative)	34						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TTTTGTCTAGCTGACCTCTTT	0.478																																							uc003csq.1		NA																	0					0						c.(100-102)CAG>CAC		serine peptidase inhibitor, Kazal type 8							59.0	53.0	55.0					3																	48362530		1868	4113	5981	SO:0001583	missense	646424					extracellular region	serine-type endopeptidase inhibitor activity	g.chr3:48362530C>G		CCDS46822.1	3p21.31	2011-08-31			ENSG00000229453	ENSG00000229453		"""Serine peptidase inhibitors, Kazal type"""	33160	protein-coding gene	gene with protein product						16930550	Standard	NM_001080525		Approved		uc003csq.1	P0C7L1	OTTHUMG00000156832	ENST00000434006.1:c.102G>C	3.37:g.48362530C>G	ENSP00000407497:p.Gln34His						p.Q34H	NM_001080525	NP_001073994	P0C7L1	ISK8_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)	2	102	-			34						Missense_Mutation	SNP	ENST00000434006.1	37	c.102G>C	CCDS46822.1	.	.	.	.	.	.	.	.	.	.	C	3.941	-0.014211	0.07681	.	.	ENSG00000229453	ENST00000434006	T	0.23950	1.88	3.31	0.466	0.16716	.	.	.	.	.	T	0.16428	0.0395	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	8	0.72032	D	0.01	.	3.2125	0.06687	0.2826:0.2484:0.469:0.0	.	34	P0C7L1	ISK8_HUMAN	H	34	ENSP00000407497:Q34H	ENSP00000407497:Q34H	Q	-	3	2	SPINK8	48337534	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.074000	0.14662	0.083000	0.17047	-0.171000	0.13296	CAG		0.478	SPINK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346123.1	NM_001080525		2	8	0	0	0	0.004672	0	2	8				
RFT1	91869	broad.mit.edu	37	3	53160012	53160012	+	Splice_Site	SNP	T	T	A	rs554732067		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:53160012T>A	ENST00000296292.3	-	2	125		c.e2-2		RFT1_ENST00000394738.3_Splice_Site	NM_052859.3	NP_443091.1	Q96AA3	RFT1_HUMAN	RFT1 homolog (S. cerevisiae)						carbohydrate transport (GO:0008643)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)	lipid transporter activity (GO:0005319)	p.?(1)		NS(1)|breast(1)|kidney(1)|lung(5)|skin(2)|urinary_tract(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		AAACAACACCTATAGAAAAAG	0.368																																							uc003dgj.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e2-1		RFT1 homolog							71.0	61.0	65.0					3																	53160012		2203	4300	6503	SO:0001630	splice_region_variant	91869				carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity	g.chr3:53160012T>A	AJ318099	CCDS2869.1	3p21.1	2014-02-06	2005-01-26		ENSG00000163933	ENSG00000163933			30220	protein-coding gene	gene with protein product	"""congenital disorder of glycosylation 1N"""	611908	"""RFT1, requiring fifty three 1 homolog (S. cerevisiae)"""			12477932	Standard	NM_052859		Approved	CDG1N	uc003dgj.3	Q96AA3	OTTHUMG00000074035	ENST00000296292.3:c.64-2A>T	3.37:g.53160012T>A						RFT1_uc003dgk.2_Splice_Site_p.V22_splice	p.V22_splice	NM_052859	NP_443091	Q96AA3	RFT1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)	2	118	-								Q96J03	Splice_Site	SNP	ENST00000296292.3	37	c.64_splice	CCDS2869.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.442167	0.63067	.	.	ENSG00000163933	ENST00000296292;ENST00000394738;ENST00000467048	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5246	0.75894	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RFT1	53135052	1.000000	0.71417	0.976000	0.42696	0.568000	0.35870	7.286000	0.78671	2.304000	0.77564	0.528000	0.53228	.		0.368	RFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157136.2	NM_052859	Intron	4	23	0	0	0	0.009096	0	4	23				
EPHA3	2042	broad.mit.edu	37	3	89445045	89445045	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:89445045G>C	ENST00000336596.2	+	6	1590	c.1365G>C	c.(1363-1365)ttG>ttC	p.L455F	EPHA3_ENST00000452448.2_Missense_Mutation_p.L455F|EPHA3_ENST00000494014.1_Missense_Mutation_p.L455F	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	455	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.L455F(2)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GCATCTCTTTGTCCTGGCAAG	0.453										TSP Lung(6;0.00050)																													uc003dqy.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(1363-1365)TTG>TTC		ephrin receptor EphA3 isoform a precursor							186.0	175.0	178.0					3																	89445045		2203	4300	6503	SO:0001583	missense	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89445045G>C	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1365G>C	3.37:g.89445045G>C	ENSP00000337451:p.Leu455Phe	TSP Lung(6;0.00050)				EPHA3_uc003dqx.1_Missense_Mutation_p.L455F|EPHA3_uc010hon.1_RNA	p.L455F	NM_005233	NP_005224	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	6	1590	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	455			Extracellular (Potential).|Fibronectin type-III 2.		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	c.1365G>C	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438845	0.62955	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.64260	-0.09;-0.09;-0.09	5.96	1.09	0.20402	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.77377	0.4121	M	0.89214	3.015	0.58432	D	0.999994	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.988	T	0.74598	-0.3612	9	.	.	.	.	6.3386	0.21310	0.3745:0.149:0.4764:0.0	.	455;455	P29320;P29320-2	EPHA3_HUMAN;.	F	455	ENSP00000337451:L455F;ENSP00000399926:L455F;ENSP00000419190:L455F	.	L	+	3	2	EPHA3	89527735	0.999000	0.42202	0.999000	0.59377	0.992000	0.81027	0.629000	0.24538	0.163000	0.19507	-0.136000	0.14681	TTG		0.453	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		48	242	0	0	0	0.01441	0	48	242				
CCDC54	84692	broad.mit.edu	37	3	107096514	107096514	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:107096514C>A	ENST00000261058.1	+	1	327	c.80C>A	c.(79-81)tCt>tAt	p.S27Y		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	27								p.S27Y(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						GTCAGACAGTCTCTTAAAAAT	0.398																																							uc003dwi.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(79-81)TCT>TAT		coiled-coil domain containing 54							122.0	122.0	122.0					3																	107096514		2203	4300	6503	SO:0001583	missense	84692							g.chr3:107096514C>A	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.80C>A	3.37:g.107096514C>A	ENSP00000261058:p.Ser27Tyr						p.S27Y	NM_032600	NP_115989	Q8NEL0	CCD54_HUMAN			1	327	+			27					Q96A43	Missense_Mutation	SNP	ENST00000261058.1	37	c.80C>A	CCDS2949.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669791	0.29693	.	.	ENSG00000138483	ENST00000261058	T	0.51574	0.7	5.55	2.44	0.29823	.	0.149328	0.31031	N	0.008396	T	0.32315	0.0825	L	0.35854	1.095	0.09310	N	1	B	0.22909	0.077	B	0.23419	0.046	T	0.15037	-1.0451	10	0.36615	T	0.2	-4.9386	5.1038	0.14773	0.1559:0.6217:0.1358:0.0866	.	27	Q8NEL0	CCD54_HUMAN	Y	27	ENSP00000261058:S27Y	ENSP00000261058:S27Y	S	+	2	0	CCDC54	108579204	0.791000	0.28800	0.807000	0.32361	0.267000	0.26476	0.782000	0.26788	0.701000	0.31803	0.591000	0.81541	TCT		0.398	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353651.1	NM_032600		45	157	1	0	5.34276e-22	0.01441	9.2358e-22	45	157				
CD96	10225	broad.mit.edu	37	3	111343207	111343207	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:111343207G>T	ENST00000283285.5	+	11	1456	c.1325G>T	c.(1324-1326)gGc>gTc	p.G442V	CD96_ENST00000352690.4_Missense_Mutation_p.G426V	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	442	Pro/Ser/Thr-rich.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.G442V(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						ACTACCCGAGGCTTCAACTAT	0.418									Opitz Trigonocephaly syndrome																														uc003dxw.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(1324-1326)GGC>GTC		CD96 antigen isoform 1 precursor							105.0	104.0	104.0					3																	111343207		2203	4300	6503	SO:0001583	missense	10225	Opitz_Trigonocephaly_syndrome	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	cell adhesion|immune response|regulation of immune response	integral to plasma membrane		g.chr3:111343207G>T	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.1325G>T	3.37:g.111343207G>T	ENSP00000283285:p.Gly442Val					CD96_uc003dxx.2_Missense_Mutation_p.G426V|CD96_uc010hpy.1_Missense_Mutation_p.G426V	p.G442V	NM_198196	NP_937839	P40200	TACT_HUMAN			11	1495	+			442			Extracellular (Potential).|Pro/Ser/Thr-rich.		Q5JPB3	Missense_Mutation	SNP	ENST00000283285.5	37	c.1325G>T	CCDS2959.1	.	.	.	.	.	.	.	.	.	.	G	2.496	-0.316312	0.05422	.	.	ENSG00000153283	ENST00000352690;ENST00000283285	T;T	0.65178	-0.13;-0.14	4.19	0.542	0.17174	.	0.788665	0.11276	N	0.580857	T	0.51652	0.1687	N	0.24115	0.695	0.19575	N	0.999968	P;P;P	0.39250	0.535;0.665;0.535	B;P;B	0.45428	0.287;0.48;0.403	T	0.44726	-0.9309	10	0.51188	T	0.08	-0.1218	8.0931	0.30811	0.3843:0.0:0.6157:0.0	.	426;426;442	E9PEJ1;P40200-2;P40200	.;.;TACT_HUMAN	V	426;442	ENSP00000342040:G426V;ENSP00000283285:G442V	ENSP00000283285:G442V	G	+	2	0	CD96	112825897	0.292000	0.24362	0.203000	0.23512	0.004000	0.04260	-0.043000	0.12043	-0.113000	0.11958	-1.119000	0.02030	GGC		0.418	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2			41	153	1	0	1.30916e-28	0.01441	2.32695e-28	41	153				
DRD3	1814	broad.mit.edu	37	3	113858370	113858370	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:113858370C>A	ENST00000460779.1	-	6	989	c.700G>T	c.(700-702)Gtc>Ttc	p.V234F	DRD3_ENST00000295881.7_Missense_Mutation_p.V234F|DRD3_ENST00000467632.1_Missense_Mutation_p.V234F|DRD3_ENST00000383673.2_Missense_Mutation_p.V234F	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	234					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)	p.V234F(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CCAGGCCTGACACTGTTGCAC	0.527																																							uc003ebd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(700-702)GTC>TTC		dopamine receptor D3 isoform a	Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)						174.0	173.0	173.0					3																	113858370		2203	4300	6503	SO:0001583	missense	1814				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding	g.chr3:113858370C>A		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.700G>T	3.37:g.113858370C>A	ENSP00000419402:p.Val234Phe					DRD3_uc010hqn.1_Missense_Mutation_p.V234F|DRD3_uc003ebb.1_Missense_Mutation_p.V234F|DRD3_uc003ebc.1_Missense_Mutation_p.V234F	p.V234F	NM_000796	NP_000787	P35462	DRD3_HUMAN			6	1123	-			234			Cytoplasmic.		A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	37	c.700G>T	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448543	0.43429	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.67	4.97	2.18	0.27775	GPCR, rhodopsin-like superfamily (1);	0.267032	0.37955	N	0.001878	T	0.66509	0.2796	L	0.58302	1.8	0.32185	N	0.579832	B;B;B;B	0.30193	0.087;0.096;0.096;0.272	B;B;B;B	0.36766	0.195;0.195;0.155;0.232	T	0.69091	-0.5237	10	0.62326	D	0.03	.	8.4284	0.32742	0.0:0.6737:0.0:0.3263	.	234;234;234;234	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	F	234	ENSP00000419402:V234F;ENSP00000420662:V234F;ENSP00000373169:V234F;ENSP00000295881:V234F	ENSP00000281274:V234F	V	-	1	0	DRD3	115341060	0.986000	0.35501	0.939000	0.37840	0.966000	0.64601	0.310000	0.19356	0.275000	0.22094	0.655000	0.94253	GTC		0.527	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3		55	211	1	0	4.46115e-38	0.01441	8.18599e-38	55	211				
FSTL1	11167	broad.mit.edu	37	3	120122105	120122105	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:120122105G>T	ENST00000295633.3	-	8	1034	c.678C>A	c.(676-678)ttC>ttA	p.F226L	FSTL1_ENST00000424703.2_Missense_Mutation_p.F191L	NM_007085.4	NP_009016.1	Q12841	FSTL1_HUMAN	follistatin-like 1	226	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.			F -> S (in Ref. 4; BAF83827). {ECO:0000305}.	BMP signaling pathway (GO:0030509)|response to starvation (GO:0042594)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.F226L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(1)	20				GBM - Glioblastoma multiforme(114;0.189)		CAGGAGGGTTGAAAGATGGGT	0.448																																							uc003eds.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(676-678)TTC>TTA		follistatin-like 1 precursor							101.0	101.0	101.0					3																	120122105		2203	4300	6503	SO:0001583	missense	11167				BMP signaling pathway	extracellular space	calcium ion binding|heparin binding	g.chr3:120122105G>T	U06863	CCDS2998.1	3q13.33	2013-01-10			ENSG00000163430	ENSG00000163430		"""EF-hand domain containing"""	3972	protein-coding gene	gene with protein product		605547				7957230, 9786430	Standard	NM_007085		Approved	FRP, FSL1	uc003eds.3	Q12841	OTTHUMG00000159440	ENST00000295633.3:c.678C>A	3.37:g.120122105G>T	ENSP00000295633:p.Phe226Leu					FSTL1_uc011bjh.1_Missense_Mutation_p.F191L	p.F226L	NM_007085	NP_009016	Q12841	FSTL1_HUMAN		GBM - Glioblastoma multiforme(114;0.189)	8	853	-			226			EF-hand 2.		A8K523|B4DTT5|D3DN90|Q549Z0	Missense_Mutation	SNP	ENST00000295633.3	37	c.678C>A	CCDS2998.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.37|14.37	2.516353|2.516353	0.44763|0.44763	.|.	.|.	ENSG00000163430|ENSG00000163430	ENST00000295633;ENST00000539471;ENST00000424703|ENST00000480823	T;T|.	0.25749|.	2.51;1.78|.	6.16|6.16	5.3|5.3	0.74995|0.74995	.|.	0.086648|.	0.85682|.	D|.	0.000000|.	T|T	0.62073|0.62073	0.2398|0.2398	L|L	0.52573|0.52573	1.65|1.65	0.54753|0.54753	D|D	0.999983|0.999983	D;D|.	0.59357|.	0.985;0.963|.	P;P|.	0.55055|.	0.767;0.578|.	T|T	0.60156|0.60156	-0.7318|-0.7318	10|5	0.20519|.	T|.	0.43|.	-30.9097|-30.9097	13.0016|13.0016	0.58679|0.58679	0.0735:0.0:0.9265:0.0|0.0735:0.0:0.9265:0.0	.|.	191;226|.	B4DTT5;Q12841|.	.;FSTL1_HUMAN|.	L|K	226;169;191|14	ENSP00000295633:F226L;ENSP00000394355:F191L|.	ENSP00000295633:F226L|.	F|Q	-|-	3|1	2|0	FSTL1|FSTL1	121604795|121604795	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.336000|6.336000	0.72954|0.72954	1.633000|1.633000	0.50488|0.50488	0.650000|0.650000	0.86243|0.86243	TTC|CAA		0.448	FSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355399.1	NM_007085		10	100	1	0	0.00829132	0.008291	0.00873825	10	100				
MYLK	4638	broad.mit.edu	37	3	123419703	123419703	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:123419703C>A	ENST00000475616.1	-	15	2611	c.2612G>T	c.(2611-2613)gGg>gTg	p.G871V	MYLK_ENST00000359169.1_Missense_Mutation_p.G871V|MYLK_ENST00000360304.3_Missense_Mutation_p.G871V|MYLK_ENST00000346322.5_Missense_Mutation_p.G802V|MYLK_ENST00000360772.3_Missense_Mutation_p.G871V|MYLK_ENST00000510775.1_5'Flank			Q15746	MYLK_HUMAN	myosin light chain kinase	871	5 X 28 AA approximate tandem repeats.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.G871V(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CTTCAGCACCCCTCGCACGTC	0.652																																							uc003ego.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(2)|stomach(1)	9						c.(2611-2613)GGG>GTG		myosin light chain kinase isoform 1							72.0	74.0	73.0					3																	123419703		2203	4300	6503	SO:0001583	missense	4638				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity	g.chr3:123419703C>A	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.2612G>T	3.37:g.123419703C>A	ENSP00000418335:p.Gly871Val					MYLK_uc011bjw.1_Missense_Mutation_p.G871V|MYLK_uc003egp.2_Missense_Mutation_p.G802V|MYLK_uc003egq.2_Missense_Mutation_p.G871V|MYLK_uc003egr.2_Missense_Mutation_p.G802V|MYLK_uc003egs.2_Missense_Mutation_p.G695V|MYLK_uc003egt.2_Missense_Mutation_p.G62V	p.G871V	NM_053025	NP_444253	Q15746	MYLK_HUMAN		GBM - Glioblastoma multiforme(114;0.0736)	18	2894	-		Lung NSC(201;0.0496)	871			5 X 28 AA approximate tandem repeats.|1-1.		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	c.2612G>T	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618867	0.66787	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.69175	-0.38;-0.27;-0.38;-0.31;-0.27	4.62	4.62	0.57501	.	.	.	.	.	T	0.78091	0.4229	M	0.64997	1.995	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.995;0.995;0.993;0.983;0.989	T	0.73347	-0.4011	9	0.16420	T	0.52	.	17.6414	0.88137	0.0:1.0:0.0:0.0	.	871;802;871;802;871	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	V	871;871;871;802;871	ENSP00000354004:G871V;ENSP00000353452:G871V;ENSP00000352088:G871V;ENSP00000320622:G802V;ENSP00000418335:G871V	ENSP00000320622:G802V	G	-	2	0	MYLK	124902393	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.264000	0.65513	2.410000	0.81850	0.561000	0.74099	GGG		0.652	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		28	130	1	0	1.1423e-28	0.009535	2.03675e-28	28	130				
PIK3R4	30849	broad.mit.edu	37	3	130463491	130463491	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:130463491C>A	ENST00000356763.3	-	2	1129	c.572G>T	c.(571-573)cGg>cTg	p.R191L		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	191	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R191L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						AGTTCTCCTCCGTGATGTGTC	0.413																																							uc003enj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						c.(571-573)CGG>CTG		phosphoinositide-3-kinase, regulatory subunit 4							89.0	86.0	87.0					3																	130463491		2203	4300	6503	SO:0001583	missense	30849				fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr3:130463491C>A	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.572G>T	3.37:g.130463491C>A	ENSP00000349205:p.Arg191Leu						p.R191L	NM_014602	NP_055417	Q99570	PI3R4_HUMAN			2	1153	-			191			Protein kinase.		Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	37	c.572G>T	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	C	32	5.133216	0.94517	.	.	ENSG00000196455	ENST00000356763	T	0.10763	2.84	5.42	5.42	0.78866	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	L	0.61036	1.89	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.00436	-1.1740	10	0.28530	T	0.3	-17.2531	19.578	0.95452	0.0:1.0:0.0:0.0	.	191	Q99570	PI3R4_HUMAN	L	191	ENSP00000349205:R191L	ENSP00000349205:R191L	R	-	2	0	PIK3R4	131946181	1.000000	0.71417	0.974000	0.42286	0.931000	0.56810	7.741000	0.84997	2.705000	0.92388	0.462000	0.41574	CGG		0.413	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602		11	86	1	0	3.07112e-06	0.010729	3.72874e-06	11	86				
A4GNT	51146	broad.mit.edu	37	3	137843529	137843529	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:137843529G>T	ENST00000236709.3	-	3	801	c.600C>A	c.(598-600)caC>caA	p.H200Q		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	200					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)	p.H200Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						AAAAGGGGTGGTGGGGGAGGA	0.493																																							uc003ers.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(598-600)CAC>CAA		alpha-1,4-N-acetylglucosaminyltransferase							87.0	98.0	94.0					3																	137843529		2203	4300	6503	SO:0001583	missense	51146				protein O-linked glycosylation	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	acetylglucosaminyltransferase activity|galactosyltransferase activity	g.chr3:137843529G>T	AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.600C>A	3.37:g.137843529G>T	ENSP00000236709:p.His200Gln						p.H200Q	NM_016161	NP_057245	Q9UNA3	A4GCT_HUMAN			3	802	-			200			Lumenal (Potential).		Q0VDK1|Q0VDK2	Missense_Mutation	SNP	ENST00000236709.3	37	c.600C>A	CCDS3097.1	.	.	.	.	.	.	.	.	.	.	G	0.289	-0.981260	0.02197	.	.	ENSG00000118017	ENST00000236709	T	0.80304	-1.36	4.87	-2.48	0.06423	Alpha 1,4-glycosyltransferase domain (1);	0.507715	0.20190	N	0.097335	T	0.68357	0.2992	L	0.45698	1.435	0.19300	N	0.999971	B	0.10296	0.003	B	0.13407	0.009	T	0.52223	-0.8604	10	0.22706	T	0.39	-6.0784	9.1355	0.36872	0.2522:0.2807:0.4671:0.0	.	200	Q9UNA3	A4GCT_HUMAN	Q	200	ENSP00000236709:H200Q	ENSP00000236709:H200Q	H	-	3	2	A4GNT	139326219	0.050000	0.20438	0.583000	0.28640	0.014000	0.08584	-0.188000	0.09642	-0.786000	0.04516	-1.255000	0.01485	CAC		0.493	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	NM_016161		18	162	1	0	1.67942e-08	0.006122	2.23528e-08	18	162				
PRR23B	389151	broad.mit.edu	37	3	138738865	138738865	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:138738865G>T	ENST00000329447.5	-	1	903	c.639C>A	c.(637-639)ccC>ccA	p.P213P	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	213	Pro-rich.							p.P213P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGTCAAAGATGGGGCGTGGAG	0.627																																							uc003esy.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(637-639)CCC>CCA		proline rich 23B							41.0	44.0	43.0					3																	138738865		2203	4300	6503	SO:0001819	synonymous_variant	389151							g.chr3:138738865G>T	BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.639C>A	3.37:g.138738865G>T							p.P213P	NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN			1	904	-			213			Pro-rich.		B2RNV9	Silent	SNP	ENST00000329447.5	37	c.639C>A	CCDS33868.1																																																																																				0.627	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361501.1	NM_001013650		4	84	1	0	0.00024832	0.009096	0.000280473	4	84				
TFDP2	7029	broad.mit.edu	37	3	141671484	141671484	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:141671484G>A	ENST00000489671.1	-	13	1642	c.1212C>T	c.(1210-1212)ttC>ttT	p.F404F	TFDP2_ENST00000467072.1_Silent_p.F344F|TFDP2_ENST00000499676.2_Silent_p.F344F|TFDP2_ENST00000486111.1_Silent_p.F344F|TFDP2_ENST00000397991.4_Silent_p.F376F|TFDP2_ENST00000477292.1_Silent_p.F268F|TFDP2_ENST00000495310.1_Silent_p.F307F|TFDP2_ENST00000310282.6_Silent_p.F344F|TFDP2_ENST00000479040.1_Silent_p.F343F|TFDP2_ENST00000317104.7_Silent_p.F328F			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)	404					gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.G402fs*22(1)|p.F404F(1)		kidney(1)|upper_aerodigestive_tract(2)	3						TTGGGGCCAGGAACTGCCCAG	0.502																																							uc003eun.3		NA																	2	Deletion - Frameshift(1)|Substitution - coding silent(1)		lung(1)|breast(1)	kidney(1)	1						c.(1210-1212)TTC>TTT		transcription factor Dp-2 (E2F dimerization							63.0	67.0	66.0					3																	141671484		1970	4144	6114	SO:0001819	synonymous_variant	7029				cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding	g.chr3:141671484G>A	U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.1212C>T	3.37:g.141671484G>A						TFDP2_uc003euk.3_Silent_p.F317F|TFDP2_uc010hur.2_Silent_p.F344F|TFDP2_uc003eul.3_Silent_p.F344F|TFDP2_uc011bnf.1_Silent_p.F307F|TFDP2_uc011bng.1_Silent_p.F268F|TFDP2_uc003eum.3_Silent_p.F344F	p.F404F	NM_006286	NP_006277	Q14188	TFDP2_HUMAN			13	1591	-			404					B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Silent	SNP	ENST00000489671.1	37	c.1212C>T	CCDS54650.1																																																																																				0.502	TFDP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353294.4	NM_006286		12	84	0	0	0	0.010729	0	12	84				
CPA3	1359	broad.mit.edu	37	3	148586769	148586769	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:148586769G>A	ENST00000296046.3	+	3	264	c.212G>A	c.(211-213)aGt>aAt	p.S71N	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	71					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.S71N(1)		NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TTCCGAGTTAGTGAGAAGGAA	0.418																																							uc003ewm.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(211-213)AGT>AAT		carboxypeptidase A3 precursor							134.0	111.0	119.0					3																	148586769		2203	4300	6503	SO:0001583	missense	1359				proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding	g.chr3:148586769G>A		CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.212G>A	3.37:g.148586769G>A	ENSP00000296046:p.Ser71Asn						p.S71N	NM_001870	NP_001861	P15088	CBPA3_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)		3	264	+			71					Q96E94	Missense_Mutation	SNP	ENST00000296046.3	37	c.212G>A	CCDS3138.1	.	.	.	.	.	.	.	.	.	.	G	4.093	0.015331	0.07959	.	.	ENSG00000163751	ENST00000296046	T	0.14766	2.48	5.45	3.61	0.41365	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.711166	0.14772	N	0.299334	T	0.09335	0.0230	L	0.31926	0.97	0.24939	N	0.991864	B	0.10296	0.003	B	0.14578	0.011	T	0.40887	-0.9539	10	0.07175	T	0.84	.	9.0415	0.36321	0.0762:0.2819:0.6418:0.0	.	71	P15088	CBPA3_HUMAN	N	71	ENSP00000296046:S71N	ENSP00000296046:S71N	S	+	2	0	CPA3	150069459	0.996000	0.38824	0.979000	0.43373	0.981000	0.71138	1.667000	0.37471	0.615000	0.30124	0.655000	0.94253	AGT		0.418	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355974.1	NM_001870		7	69	0	0	0	0.001984	0	7	69				
SI	6476	broad.mit.edu	37	3	164710138	164710138	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:164710138C>A	ENST00000264382.3	-	42	4951	c.4889G>T	c.(4888-4890)tGg>tTg	p.W1630L		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1630	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.W1630L(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TGCTGGACCCCATAAGAACTG	0.323										HNSCC(35;0.089)																													uc003fei.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(4888-4890)TGG>TTG		sucrase-isomaltase	Acarbose(DB00284)						57.0	59.0	58.0					3																	164710138		2202	4300	6502	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164710138C>A	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4889G>T	3.37:g.164710138C>A	ENSP00000264382:p.Trp1630Leu	HNSCC(35;0.089)					p.W1630L	NM_001041	NP_001032	P14410	SUIS_HUMAN			42	4951	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	1630			Sucrase.|Lumenal.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.4889G>T	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092671	0.36952	.	.	ENSG00000090402	ENST00000264382	D	0.90133	-2.62	4.88	3.98	0.46160	.	0.121046	0.64402	D	0.000011	D	0.86785	0.6016	L	0.37561	1.115	0.51233	D	0.999916	B	0.20164	0.042	B	0.34038	0.174	T	0.80677	-0.1276	10	0.15952	T	0.53	.	14.296	0.66314	0.15:0.85:0.0:0.0	.	1630	P14410	SUIS_HUMAN	L	1630	ENSP00000264382:W1630L	ENSP00000264382:W1630L	W	-	2	0	SI	166192832	1.000000	0.71417	0.992000	0.48379	0.922000	0.55478	4.181000	0.58303	1.355000	0.45865	0.655000	0.94253	TGG		0.323	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		4	28	1	0	0.000602214	0.000602	0.00066431	4	28				
ZBBX	79740	broad.mit.edu	37	3	167051729	167051729	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:167051729C>G	ENST00000392766.2	-	10	913	c.573G>C	c.(571-573)caG>caC	p.Q191H	ZBBX_ENST00000469220.1_Intron|ZBBX_ENST00000455345.2_Missense_Mutation_p.Q191H|ZBBX_ENST00000392764.1_Missense_Mutation_p.Q162H|ZBBX_ENST00000307529.5_Missense_Mutation_p.Q191H|ZBBX_ENST00000392767.2_Missense_Mutation_p.Q191H	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	191						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.Q191H(2)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CCTTTATAAACTGATGGGCAA	0.299																																							uc003fep.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(571-573)CAG>CAC		zinc finger, B-box domain containing							109.0	95.0	99.0					3																	167051729		1795	4071	5866	SO:0001583	missense	79740					intracellular	zinc ion binding	g.chr3:167051729C>G	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.573G>C	3.37:g.167051729C>G	ENSP00000376519:p.Gln191His					ZBBX_uc011bpc.1_Missense_Mutation_p.Q191H|ZBBX_uc003feq.2_Missense_Mutation_p.Q162H	p.Q191H	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN			10	896	-			191					A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	c.573G>C	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	C	9.739	1.164294	0.21538	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.11277	2.96;2.96;2.96;2.96;2.79	4.79	-2.94	0.05581	.	0.278687	0.18487	U	0.139760	T	0.07863	0.0197	L	0.46157	1.445	0.18873	N	0.999982	B;B	0.23249	0.082;0.049	B;B	0.17433	0.018;0.008	T	0.19095	-1.0316	10	0.54805	T	0.06	1.4726	5.767	0.18231	0.1287:0.4325:0.0:0.4388	.	191;191	A8MT70-2;A8MT70	.;ZBBX_HUMAN	H	191;191;191;191;162	ENSP00000376519:Q191H;ENSP00000376520:Q191H;ENSP00000390232:Q191H;ENSP00000305065:Q191H;ENSP00000376517:Q162H	ENSP00000305065:Q191H	Q	-	3	2	ZBBX	168534423	0.000000	0.05858	0.012000	0.15200	0.103000	0.19146	-1.099000	0.03343	-0.591000	0.05859	0.650000	0.86243	CAG		0.299	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687		9	65	0	0	0	0.006214	0	9	65				
SLC7A14	57709	broad.mit.edu	37	3	170219103	170219103	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:170219103G>A	ENST00000231706.5	-	3	651	c.336C>T	c.(334-336)gtC>gtT	p.V112V	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	112					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.V112V(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TGGTCTTGGGGACTCGAACTC	0.502																																							uc003fgz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5						c.(334-336)GTC>GTT		solute carrier family 7 (cationic amino acid							75.0	73.0	74.0					3																	170219103		2203	4300	6503	SO:0001819	synonymous_variant	57709					integral to membrane	amino acid transmembrane transporter activity	g.chr3:170219103G>A	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.336C>T	3.37:g.170219103G>A						CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	p.V112V	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)		3	652	-	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		112					B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	37	c.336C>T	CCDS33892.1																																																																																				0.502	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949		6	43	0	0	0	0.001168	0	6	43				
FXR1	8087	broad.mit.edu	37	3	180685989	180685989	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:180685989C>T	ENST00000357559.4	+	14	1733	c.1349C>T	c.(1348-1350)tCa>tTa	p.S450L	FXR1_ENST00000468861.1_Missense_Mutation_p.S365L|FXR1_ENST00000480918.1_Missense_Mutation_p.S437L|FXR1_ENST00000445140.2_Missense_Mutation_p.S450L|FXR1_ENST00000305586.7_Missense_Mutation_p.S365L|FXR1_ENST00000491062.1_Missense_Mutation_p.S401L	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	450	RNA-binding RGG-box.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S450L(1)		breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			AGAAGTGTTTCAGGGGGTCGA	0.512																																							uc003fkq.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1348-1350)TCA>TTA		fragile X mental retardation-related protein 1							116.0	99.0	105.0					3																	180685989		2203	4300	6503	SO:0001583	missense	8087				apoptosis|cell differentiation|muscle organ development	nucleolus|polysome		g.chr3:180685989C>T	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1349C>T	3.37:g.180685989C>T	ENSP00000350170:p.Ser450Leu					FXR1_uc003fkp.2_Missense_Mutation_p.S365L|FXR1_uc003fkr.2_Missense_Mutation_p.S450L|FXR1_uc011bqj.1_Missense_Mutation_p.S364L|FXR1_uc003fks.2_Missense_Mutation_p.S393L|FXR1_uc011bqk.1_Missense_Mutation_p.S401L|FXR1_uc011bql.1_Missense_Mutation_p.S437L	p.S450L	NM_005087	NP_005078	P51114	FXR1_HUMAN	Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)		14	1371	+	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		450			RNA-binding RGG-box.		A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	ENST00000357559.4	37	c.1349C>T	CCDS3238.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.455719|4.455719	0.84209|0.84209	.|.	.|.	ENSG00000114416|ENSG00000114416	ENST00000482125|ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000480918	.|T;T;T;T;T;T	.|0.37584	.|1.87;1.69;1.2;1.19;1.2;1.68	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.291219	.|0.34460	.|N	.|0.003941	.|T	.|0.37210	.|0.0995	L|L	0.38175|0.38175	1.15|1.15	0.41741|0.41741	D|D	0.989615|0.989615	.|B;P;P;P;P;P	.|0.43826	.|0.27;0.584;0.714;0.571;0.818;0.611	.|B;B;B;B;B;B	.|0.43123	.|0.096;0.338;0.338;0.409;0.228;0.187	.|T	.|0.11966	.|-1.0566	.|10	.|0.48119	.|T	.|0.1	-12.3401|-12.3401	19.7945|19.7945	0.96474|0.96474	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|437;401;365;394;450;450	.|B4DXZ6;E9PFF5;E7EU85;E7ERF5;P51114-2;P51114	.|.;.;.;.;.;FXR1_HUMAN	X|L	51|450;365;401;365;450;437	.|ENSP00000350170:S450L;ENSP00000307633:S365L;ENSP00000420643:S401L;ENSP00000420515:S365L;ENSP00000388828:S450L;ENSP00000418097:S437L	.|ENSP00000307633:S365L	Q|S	+|+	1|2	0|0	FXR1|FXR1	182168683|182168683	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.507000|4.507000	0.60434|0.60434	2.746000|2.746000	0.94184|0.94184	0.591000|0.591000	0.81541|0.81541	CAG|TCA		0.512	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5			13	48	0	0	0	0.00245	0	13	48				
HTR3C	170572	broad.mit.edu	37	3	183773977	183773977	+	Missense_Mutation	SNP	C	C	A	rs149370364		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:183773977C>A	ENST00000318351.1	+	4	326	c.292C>A	c.(292-294)Cct>Act	p.P98T		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	98					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)	p.P98T(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	ATGGGACAATCCTTTCATTAA	0.478																																							uc003fmk.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|central_nervous_system(1)	3						c.(292-294)CCT>ACT		5-hydroxytryptamine receptor 3 subunit C							131.0	125.0	127.0					3																	183773977		2203	4300	6503	SO:0001583	missense	170572					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity	g.chr3:183773977C>A	AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	ENST00000318351.1:c.292C>A	3.37:g.183773977C>A	ENSP00000322617:p.Pro98Thr						p.P98T	NM_130770	NP_570126	Q8WXA8	5HT3C_HUMAN	Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		4	326	+	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		98			Extracellular (Potential).		A2RRR5	Missense_Mutation	SNP	ENST00000318351.1	37	c.292C>A	CCDS3250.1	.	.	.	.	.	.	.	.	.	.	.	13.51	2.259782	0.39995	.	.	ENSG00000178084	ENST00000318351	T	0.79352	-1.26	4.68	0.614	0.17603	Neurotransmitter-gated ion-channel ligand-binding (3);	0.318126	0.29908	N	0.010881	D	0.82999	0.5159	M	0.83852	2.665	0.09310	N	1	D	0.61080	0.989	D	0.65140	0.932	T	0.70766	-0.4783	10	0.26408	T	0.33	-4.7736	5.3058	0.15803	0.0:0.4998:0.3159:0.1843	.	98	Q8WXA8	5HT3C_HUMAN	T	98	ENSP00000322617:P98T	ENSP00000322617:P98T	P	+	1	0	HTR3C	185256671	0.076000	0.21285	0.622000	0.29159	0.674000	0.39518	0.403000	0.20982	0.221000	0.20879	0.650000	0.86243	CCT		0.478	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346296.1	NM_130770		12	129	1	0	0.00010058	0.013537	0.000114746	12	129				
SST	6750	broad.mit.edu	37	3	187387015	187387015	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:187387015C>T	ENST00000287641.3	-	2	296	c.189G>A	c.(187-189)acG>acA	p.T63T		NM_001048.3	NP_001039.1	P61278	SMS_HUMAN	somatostatin	63					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hyperosmotic response (GO:0006972)|negative regulation of cell proliferation (GO:0008285)|regulation of cell migration (GO:0030334)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to heat (GO:0009408)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)	p.T63T(2)		kidney(1)|large_intestine(1)|lung(6)|pancreas(1)	9	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	Cysteamine(DB00847)	CATCATTCTCCGTCTGGTTGG	0.517																																							uc003frn.2		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(187-189)ACG>ACA		somatostatin preproprotein	Bromocriptine(DB01200)|Cysteamine(DB00847)						242.0	222.0	229.0					3																	187387015		2203	4300	6503	SO:0001819	synonymous_variant	6750				digestion|G-protein coupled receptor protein signaling pathway|induction of apoptosis by hormones|negative regulation of cell proliferation|response to nutrient|synaptic transmission	extracellular space	hormone activity	g.chr3:187387015C>T		CCDS3288.1	3q28	2013-02-28			ENSG00000157005	ENSG00000157005		"""Endogenous ligands"""	11329	protein-coding gene	gene with protein product	"""somatostatin-14"", ""somatostatin-28"", ""prepro-somatostatin"""	182450				6126875, 6142531	Standard	NM_001048		Approved	SMST	uc003frn.3	P61278	OTTHUMG00000156462	ENST00000287641.3:c.189G>A	3.37:g.187387015C>T							p.T63T	NM_001048	NP_001039	P61278	SMS_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	2	311	-	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		63					B2R5G3|P01166	Silent	SNP	ENST00000287641.3	37	c.189G>A	CCDS3288.1																																																																																				0.517	SST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344278.1	NM_001048		48	443	0	0	0	0.01441	0	48	443				
NRROS	375387	broad.mit.edu	37	3	196388131	196388131	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr3:196388131G>T	ENST00000328557.4	+	3	1820	c.1617G>T	c.(1615-1617)agG>agT	p.R539S		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	539					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R539S(1)									GGAATCTCAGGGACTTAGATC	0.567																																							uc003fwv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1615-1617)AGG>AGT		leucine rich repeat containing 33 precursor							116.0	117.0	117.0					3																	196388131		2203	4300	6503	SO:0001583	missense	375387					integral to membrane		g.chr3:196388131G>T	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1617G>T	3.37:g.196388131G>T	ENSP00000328625:p.Arg539Ser						p.R539S	NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)	3	1721	+	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		539			Extracellular (Potential).|LRR 19.			Missense_Mutation	SNP	ENST00000328557.4	37	c.1617G>T	CCDS3319.1	.	.	.	.	.	.	.	.	.	.	G	3.019	-0.202206	0.06219	.	.	ENSG00000174004	ENST00000328557	T	0.53640	0.61	5.97	-0.71	0.11234	.	0.427964	0.26058	N	0.026599	T	0.31638	0.0803	L	0.42632	1.34	0.09310	N	1	B	0.32010	0.351	B	0.31946	0.138	T	0.14952	-1.0454	10	0.51188	T	0.08	.	3.516	0.07725	0.3779:0.1011:0.418:0.103	.	539	Q86YC3	LRC33_HUMAN	S	539	ENSP00000328625:R539S	ENSP00000328625:R539S	R	+	3	2	LRRC33	197872528	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.068000	0.11561	-0.066000	0.12998	-0.137000	0.14449	AGG		0.567	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565		23	217	1	0	2.44723e-14	0.004656	3.80159e-14	23	217				
CLNK	116449	broad.mit.edu	37	4	10492234	10492234	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:10492234A>G	ENST00000226951.6	-	19	1383	c.1144T>C	c.(1144-1146)Ttt>Ctt	p.F382L	CLNK_ENST00000515667.1_Missense_Mutation_p.F120L	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	382	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)	p.F382L(2)		NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						ACTGAATCAAACTTCTGAAAC	0.363																																					GBM(87;402 1286 6949 13902 35851)	GBM(87;402 1286 6949 13902 35851)	uc003gmo.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1144-1146)TTT>CTT		mast cell immunoreceptor signal transducer							71.0	70.0	71.0					4																	10492234		1856	4079	5935	SO:0001583	missense	116449				immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity	g.chr4:10492234A>G	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.1144T>C	4.37:g.10492234A>G	ENSP00000226951:p.Phe382Leu						p.F382L	NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN			19	1281	-			382			SH2.		Q05C27|Q9P2U9	Missense_Mutation	SNP	ENST00000226951.6	37	c.1144T>C	CCDS47024.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.392543	0.83011	.	.	ENSG00000109684	ENST00000226951;ENST00000515667;ENST00000429087	D;D	0.81821	-1.54;-1.54	4.93	4.93	0.64822	SH2 motif (5);	0.071621	0.56097	D	0.000034	D	0.91653	0.7362	M	0.94142	3.5	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93202	0.6592	10	0.87932	D	0	-17.1706	11.2621	0.49089	1.0:0.0:0.0:0.0	.	382	Q7Z7G1	CLNK_HUMAN	L	382;120;346	ENSP00000226951:F382L;ENSP00000427256:F120L	ENSP00000226951:F382L	F	-	1	0	CLNK	10101332	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.209000	0.65208	1.973000	0.57446	0.533000	0.62120	TTT		0.363	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359047.1	NM_052964		2	10	0	0	0	0.004672	0	2	10				
KLHL5	51088	broad.mit.edu	37	4	39116892	39116892	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:39116892G>T	ENST00000504108.1	+	10	2436	c.2153G>T	c.(2152-2154)gGa>gTa	p.G718V	KLHL5_ENST00000508137.2_Missense_Mutation_p.G531V|KLHL5_ENST00000381930.3_Missense_Mutation_p.G718V|RP11-360F5.1_ENST00000509449.1_RNA|KLHL5_ENST00000261425.3_Missense_Mutation_p.G672V|KLHL5_ENST00000261426.5_Missense_Mutation_p.G657V|KLHL5_ENST00000359687.2_Missense_Mutation_p.G718V	NM_015990.4	NP_057074.3	Q96PQ7	KLHL5_HUMAN	kelch-like family member 5	718						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G718V(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29						GGGTATGATGGACAGGCATAC	0.448																																							uc003gts.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2152-2154)GGA>GTA		kelch-like 5 isoform 1							114.0	101.0	105.0					4																	39116892		2203	4300	6503	SO:0001583	missense	51088					cytoplasm|cytoskeleton	actin binding	g.chr4:39116892G>T	AF272976	CCDS3449.1, CCDS33974.1, CCDS33975.1, CCDS54756.1	4p15.1	2013-01-30	2013-01-30		ENSG00000109790	ENSG00000109790		"""Kelch-like"", ""BTB/POZ domain containing"""	6356	protein-coding gene	gene with protein product		608064	"""kelch (Drosophila)-like 5"", ""kelch-like 5 (Drosophila)"""			11590829, 14672410	Standard	NM_001007075		Approved		uc003gtp.3	Q96PQ7	OTTHUMG00000097819	ENST00000504108.1:c.2153G>T	4.37:g.39116892G>T	ENSP00000423897:p.Gly718Val					KLHL5_uc003gtp.2_Missense_Mutation_p.G672V|KLHL5_uc003gtq.2_Missense_Mutation_p.G531V|KLHL5_uc003gtr.1_Missense_Mutation_p.G718V|KLHL5_uc003gtt.2_Missense_Mutation_p.G657V	p.G718V	NM_015990	NP_057074	Q96PQ7	KLHL5_HUMAN			10	2228	+			718			Kelch 6.		A8K170|B7WP68|E9PCF4|F8WAE7|G3XA92|Q6Y881|Q86XW0|Q9NUK3|Q9NV27|Q9NVA9|Q9Y2X2	Missense_Mutation	SNP	ENST00000504108.1	37	c.2153G>T	CCDS33974.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.7|23.7	4.445612|4.445612	0.84101|0.84101	.|.	.|.	ENSG00000109790|ENSG00000109790	ENST00000544221;ENST00000261425;ENST00000508137;ENST00000504108;ENST00000359687;ENST00000381930;ENST00000261426;ENST00000546147|ENST00000515612	T;T;T;T;T;T|.	0.71341|.	-0.56;-0.56;-0.56;-0.47;-0.47;-0.56|.	6.06|6.06	6.06|6.06	0.98353|0.98353	Kelch-type beta propeller (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84014|0.84014	0.5379|0.5379	M|M	0.85299|0.85299	2.745|2.745	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;1.0;1.0|.	D|D	0.83931|0.83931	0.0306|0.0306	10|5	0.87932|.	D|.	0|.	.|.	20.6208|20.6208	0.99490|0.99490	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	657;718;718|.	F8WAE7;Q96PQ7;Q96PQ7-2|.	.;KLHL5_HUMAN;.|.	V|C	752;672;531;718;718;718;657;312|229	ENSP00000261425:G672V;ENSP00000423080:G531V;ENSP00000423897:G718V;ENSP00000352716:G718V;ENSP00000371355:G718V;ENSP00000261426:G657V|.	ENSP00000261425:G672V|.	G|W	+|+	2|3	0|0	KLHL5|KLHL5	38793287|38793287	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.472000|0.472000	0.32918|0.32918	9.623000|9.623000	0.98386|0.98386	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GGA|TGG		0.448	KLHL5-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360604.1			7	71	1	0	5.18039e-06	0.00308	6.23627e-06	7	71				
KCTD8	386617	broad.mit.edu	37	4	44177010	44177010	+	Missense_Mutation	SNP	G	G	A	rs143160739		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:44177010G>A	ENST00000360029.3	-	2	1502	c.1219C>T	c.(1219-1221)Cgc>Tgc	p.R407C		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	407					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)		p.R407S(1)|p.R407C(1)		central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						CTGTTTCTGCGTTTGTCTGGT	0.463										HNSCC(17;0.042)																													uc003gwu.2		NA																	2	Substitution - Missense(2)	p.R407C(1)	upper_aerodigestive_tract(1)|ovary(1)	central_nervous_system(2)|ovary(1)	3						c.(1219-1221)CGC>TGC		potassium channel tetramerisation domain		G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	208.0	214.0	212.0		1219	3.9	1.0	4	dbSNP_134	212	0,8600		0,0,4300	no	missense	KCTD8	NM_198353.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	407/474	44177010	1,13005	2203	4300	6503	SO:0001583	missense	386617					cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr4:44177010G>A	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1219C>T	4.37:g.44177010G>A	ENSP00000353129:p.Arg407Cys	HNSCC(17;0.042)					p.R407C	NM_198353	NP_938167	Q6ZWB6	KCTD8_HUMAN			2	1503	-			407					A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	c.1219C>T	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692140	0.30052	2.27E-4	0.0	ENSG00000183783	ENST00000360029	T	0.44881	0.91	4.76	3.9	0.45041	.	0.120720	0.35151	N	0.003420	T	0.52092	0.1713	L	0.32530	0.975	0.50813	D	0.999892	D	0.89917	1.0	D	0.75020	0.985	T	0.56739	-0.7929	10	0.87932	D	0	.	13.8329	0.63391	0.0:0.0:0.846:0.154	.	407	Q6ZWB6	KCTD8_HUMAN	C	407	ENSP00000353129:R407C	ENSP00000353129:R407C	R	-	1	0	KCTD8	43871767	1.000000	0.71417	1.000000	0.80357	0.063000	0.16089	4.675000	0.61619	1.338000	0.45544	0.650000	0.86243	CGC		0.463	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1			46	276	0	0	0	0.01441	0	46	276				
SCFD2	152579	broad.mit.edu	37	4	54232058	54232058	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:54232058C>A	ENST00000401642.3	-	1	184	c.51G>T	c.(49-51)gtG>gtT	p.V17V	SCFD2_ENST00000388940.4_Silent_p.V17V	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	17					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)			p.V17V(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CTTTGGCCAGCACCTGCTCCC	0.627																																							uc003gzu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(49-51)GTG>GTT		sec1 family domain containing 2							46.0	51.0	49.0					4																	54232058		2203	4300	6503	SO:0001819	synonymous_variant	152579				protein transport|vesicle docking involved in exocytosis			g.chr4:54232058C>A	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.51G>T	4.37:g.54232058C>A						SCFD2_uc010igm.2_Silent_p.V17V	p.V17V	NM_152540	NP_689753	Q8WU76	SCFD2_HUMAN	GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)		1	185	-			17					Q8N5F3|Q8N8H0|Q96ED3	Silent	SNP	ENST00000401642.3	37	c.51G>T	CCDS33984.1																																																																																				0.627	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540		16	75	1	0	3.45872e-05	0.004007	4.03517e-05	16	75				
LPHN3	23284	broad.mit.edu	37	4	62758472	62758472	+	Missense_Mutation	SNP	G	G	T	rs376190861		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:62758472G>T	ENST00000514591.1	+	9	1704	c.1375G>T	c.(1375-1377)Gtg>Ttg	p.V459L	LPHN3_ENST00000514996.1_Missense_Mutation_p.V459L|LPHN3_ENST00000509896.1_Missense_Mutation_p.V527L|LPHN3_ENST00000508946.1_Missense_Mutation_p.V459L|LPHN3_ENST00000506720.1_Missense_Mutation_p.V527L|LPHN3_ENST00000506700.1_Missense_Mutation_p.V459L|LPHN3_ENST00000512091.2_Missense_Mutation_p.V459L|LPHN3_ENST00000545650.1_Missense_Mutation_p.V459L|LPHN3_ENST00000508693.1_Missense_Mutation_p.V527L|LPHN3_ENST00000504896.1_Missense_Mutation_p.V459L|LPHN3_ENST00000511324.1_Missense_Mutation_p.V527L|LPHN3_ENST00000514157.1_Missense_Mutation_p.V459L|LPHN3_ENST00000507164.1_Missense_Mutation_p.V527L|LPHN3_ENST00000507625.1_Missense_Mutation_p.V527L|LPHN3_ENST00000506746.1_Missense_Mutation_p.V527L			Q9HAR2	LPHN3_HUMAN	latrophilin 3	459					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.V459L(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CACCCCGTCAGTGTCAGGAAG	0.532																																							uc010ihh.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(1375-1377)GTG>TTG		latrophilin 3 precursor							124.0	119.0	121.0					4																	62758472		2021	4168	6189	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62758472G>T	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1375G>T	4.37:g.62758472G>T	ENSP00000422533:p.Val459Leu					LPHN3_uc003hcq.3_Missense_Mutation_p.V459L|LPHN3_uc003hcs.1_Missense_Mutation_p.V288L	p.V459L	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			7	1548	+			459			Extracellular (Potential).		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.1375G>T	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	0.879	-0.729299	0.03135	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.83	-0.161	0.13371	.	0.973510	0.08445	N	0.944850	T	0.18299	0.0439	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21793	-1.0235	10	0.21014	T	0.42	.	2.488	0.04603	0.2652:0.1126:0.5002:0.1221	.	459;459	E9PE04;Q9HAR2-2	.;.	L	459;459;527;527;459;459;459;459;459;527;527;527;459;459;459;527;527;459	ENSP00000423388:V459L;ENSP00000422533:V459L;ENSP00000423787:V527L;ENSP00000425033:V527L;ENSP00000424120:V459L;ENSP00000439831:V459L;ENSP00000421476:V527L;ENSP00000424030:V527L;ENSP00000421372:V527L;ENSP00000425201:V459L;ENSP00000423434:V459L;ENSP00000421627:V459L;ENSP00000420931:V527L;ENSP00000425884:V527L;ENSP00000424258:V459L	ENSP00000280009:V459L	V	+	1	0	LPHN3	62441067	0.000000	0.05858	0.000000	0.03702	0.541000	0.35023	0.718000	0.25866	-0.389000	0.07786	0.563000	0.77884	GTG		0.532	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			14	89	1	0	1.3612e-06	0.003163	1.68516e-06	14	89				
SHROOM3	57619	broad.mit.edu	37	4	77680773	77680773	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:77680773G>A	ENST00000296043.6	+	9	6227	c.5274G>A	c.(5272-5274)gaG>gaA	p.E1758E	RP11-359D14.3_ENST00000449007.1_RNA|RP11-359D14.2_ENST00000452412.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1758	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)		p.E1757E(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCAAGGCTGAGCTACTGAACA	0.453																																							uc011cbx.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(5272-5274)GAG>GAA		shroom family member 3 protein							131.0	115.0	120.0					4																	77680773		2203	4300	6503	SO:0001819	synonymous_variant	57619				apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding	g.chr4:77680773G>A	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.5274G>A	4.37:g.77680773G>A						SHROOM3_uc003hkg.2_Silent_p.E1536E	p.E1758E	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	Lung(101;0.0903)		9	6227	+			1758			ASD2.		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	c.5274G>A	CCDS3579.2																																																																																				0.453	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859		9	73	0	0	0	0.004482	0	9	73				
FRAS1	80144	broad.mit.edu	37	4	79207579	79207579	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:79207579A>T	ENST00000325942.6	+	14	1860	c.1420A>T	c.(1420-1422)Acg>Tcg	p.T474S	FRAS1_ENST00000264899.6_Missense_Mutation_p.T474S|FRAS1_ENST00000264895.6_Missense_Mutation_p.T474S	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	474					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.T474S(3)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CCAGTGCTCCACGTGTACCAG	0.567																																							uc003hlb.2		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(5)	5						c.(1420-1422)ACG>TCG		Fraser syndrome 1							85.0	94.0	91.0					4																	79207579		2176	4276	6452	SO:0001583	missense	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79207579A>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.1420A>T	4.37:g.79207579A>T	ENSP00000326330:p.Thr474Ser					FRAS1_uc003hkw.2_Missense_Mutation_p.T474S|FRAS1_uc003hky.1_Missense_Mutation_p.T178S|FRAS1_uc003hkz.2_Missense_Mutation_p.T178S|FRAS1_uc003hla.1_5'UTR	p.T474S	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN			14	1860	+			474			FU 2.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	c.1420A>T	CCDS54772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.567|9.567	1.119928|1.119928	0.20877|0.20877	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000508900;ENST00000534913|ENST00000325942;ENST00000264895;ENST00000264899	.|T;T;T	.|0.53206	.|0.63;0.63;0.63	5.2|5.2	3.99|3.99	0.46301|0.46301	.|Growth factor, receptor (1);	.|0.190202	.|0.44097	.|D	.|0.000491	T|T	0.37320|0.37320	0.0999|0.0999	L|L	0.42487|0.42487	1.325|1.325	0.33283|0.33283	D|D	0.562473|0.562473	.|B;B;B;B	.|0.29188	.|0.026;0.199;0.188;0.236	.|B;B;B;B	.|0.29176	.|0.025;0.049;0.077;0.099	T|T	0.46470|0.46470	-0.9189|-0.9189	5|10	.|0.32370	.|T	.|0.25	.|.	8.956|8.956	0.35818|0.35818	0.8338:0.0:0.1662:0.0|0.8338:0.0:0.1662:0.0	.|.	.|474;474;474;474	.|E9PHH6;Q86XX4;E7EWM9;A2RRR8	.|.;FRAS1_HUMAN;.;.	L|S	316;218|474	.|ENSP00000326330:T474S;ENSP00000264895:T474S;ENSP00000264899:T474S	.|ENSP00000264895:T474S	H|T	+|+	2|1	0|0	FRAS1|FRAS1	79426603|79426603	0.746000|0.746000	0.28272|0.28272	0.888000|0.888000	0.34837|0.34837	0.108000|0.108000	0.19459|0.19459	1.737000|1.737000	0.38197|0.38197	0.796000|0.796000	0.33947|0.33947	0.455000|0.455000	0.32223|0.32223	CAC|ACG		0.567	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2			21	150	0	0	0	0.003954	0	21	150				
C4orf36	132989	broad.mit.edu	37	4	87808958	87808958	+	Silent	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:87808958C>G	ENST00000473559.1	-	7	972	c.309G>C	c.(307-309)ctG>ctC	p.L103L	C4orf36_ENST00000295898.3_Silent_p.L103L|C4orf36_ENST00000503001.1_5'Flank			Q96KX1	CD036_HUMAN	chromosome 4 open reading frame 36	103								p.L103L(1)		breast(1)|kidney(1)|lung(1)|prostate(1)	4		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00141)		GCCTTTCCCTCAGGAGAAGCT	0.413																																							uc003hqe.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(307-309)CTG>CTC		hypothetical protein LOC132989							123.0	116.0	118.0					4																	87808958		2203	4300	6503	SO:0001819	synonymous_variant	132989							g.chr4:87808958C>G	BC016746	CCDS3615.1	4q21.3	2008-02-05			ENSG00000163633	ENSG00000163633			28386	protein-coding gene	gene with protein product						12477932	Standard	NM_144645		Approved	MGC26744	uc003hqe.4	Q96KX1	OTTHUMG00000130597	ENST00000473559.1:c.309G>C	4.37:g.87808958C>G							p.L103L	NM_144645	NP_653246	Q96KX1	CD036_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00141)	4	622	-		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	103						Silent	SNP	ENST00000473559.1	37	c.309G>C	CCDS3615.1																																																																																				0.413	C4orf36-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253045.2	NM_144645		13	63	0	0	0	0.001855	0	13	63				
ADH6	130	broad.mit.edu	37	4	100129927	100129927	+	Silent	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:100129927G>C	ENST00000237653.7	-	6	1110	c.726C>G	c.(724-726)ctC>ctG	p.L242L	ADH6_ENST00000394897.1_Silent_p.L242L|ADH6_ENST00000504257.1_5'UTR|ADH6_ENST00000407820.2_Silent_p.L33L|RP11-696N14.1_ENST00000500358.2_RNA|RP11-696N14.1_ENST00000506160.1_RNA|RP11-696N14.1_ENST00000506454.1_RNA|ADH6_ENST00000394899.2_Silent_p.L242L	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)	242					ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)	p.L242L(2)		breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	CCTGAGGGTTGAGGCACTCAG	0.443																																							uc003hup.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|kidney(1)|skin(1)	3						c.(724-726)CTC>CTG		class V alcohol dehydrogenase isoform 2	Abacavir(DB01048)|NADH(DB00157)						309.0	316.0	314.0					4																	100129927		2203	4300	6503	SO:0001819	synonymous_variant	130				ethanol oxidation|response to ethanol|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|electron carrier activity|zinc ion binding	g.chr4:100129927G>C	AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.726C>G	4.37:g.100129927G>C						uc003hum.1_Intron|ADH6_uc003huo.2_Silent_p.L242L|ADH6_uc011cef.1_Silent_p.L33L|ADH6_uc010ile.2_Silent_p.L242L	p.L242L	NM_000672	NP_000663	P28332	ADH6_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	6	820	-			242					B3KS45|Q58F53	Silent	SNP	ENST00000237653.7	37	c.726C>G	CCDS3647.1																																																																																				0.443	ADH6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253665.1	NM_000672		90	482	0	0	0	0.01441	0	90	482				
ADH1B	125	broad.mit.edu	37	4	100239987	100239987	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:100239987C>A	ENST00000394887.3	-	0	142				ADH1B_ENST00000504498.1_5'UTR|ADH1B_ENST00000305046.8_Missense_Mutation_p.E25D	NM_000668.4	NP_000659.2	P00325	ADH1B_HUMAN	alcohol dehydrogenase 1B (class I), beta polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)	p.E25D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	33				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	CCTCCACATCCTCAATGGAAA	0.368																																							uc003hus.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(73-75)GAG>GAT		class I alcohol dehydrogenase, beta subunit	Fomepizole(DB01213)|NADH(DB00157)						100.0	96.0	97.0					4																	100239987		2203	4300	6503			125				ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|zinc ion binding	g.chr4:100239987C>A	AF153821	CCDS34033.1, CCDS68761.1	4q23	2008-02-05	2007-11-06		ENSG00000196616	ENSG00000196616	1.1.1.1	"""Alcohol dehydrogenases"""	250	protein-coding gene	gene with protein product		103720		ADH2		3006456	Standard	NM_000668		Approved		uc003hus.4	P00325	OTTHUMG00000161413	ENST00000394887.3:c.-46G>T	4.37:g.100239987C>A						ADH1A_uc011ceg.1_Intron|ADH1B_uc003hut.3_Translation_Start_Site|ADH1B_uc011ceh.1_Translation_Start_Site|ADH1B_uc011cei.1_Translation_Start_Site	p.E25D	NM_000668	NP_000659	P00325	ADH1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	2	159	-			25					A8MYN5|B4DRS9|B4DVC3|Q13711|Q4ZGI9|Q96KI7	Missense_Mutation	SNP	ENST00000394887.3	37	c.75G>T		.	.	.	.	.	.	.	.	.	.	C	19.12	3.766737	0.69878	.	.	ENSG00000196616	ENST00000305046;ENST00000412614	T	0.04275	3.66	3.6	1.8	0.24995	GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.20129	0.0484	H	0.94264	3.515	0.80722	D	1	P	0.47302	0.893	P	0.53760	0.734	T	0.03945	-1.0990	10	0.66056	D	0.02	-15.8061	9.3611	0.38197	0.0:0.8182:0.0:0.1818	.	25	P00325	ADH1B_HUMAN	D	25	ENSP00000306606:E25D	ENSP00000306606:E25D	E	-	3	2	ADH1B	100459010	0.993000	0.37304	1.000000	0.80357	0.928000	0.56348	0.336000	0.19823	0.713000	0.32060	0.555000	0.69702	GAG		0.368	ADH1B-201	KNOWN	basic	protein_coding	protein_coding		NM_000668		21	108	1	0	1.50039e-11	0.012319	2.20967e-11	21	108				
EEF1A1P9	441032	broad.mit.edu	37	4	106406332	106406332	+	IGR	SNP	T	T	A	rs200987817		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:106406332T>A								PPA2 (11094 upstream) : AC004066.3 (55014 downstream)																							TGAGCCACCCTACAGCCATAA	0.453																																							uc003hxt.1		NA																	0					0						c.(340-342)TAC>AAC		SubName: Full=Eukaryotic translation elongation factor 1 alpha; Flags: Fragment;																																				SO:0001628	intergenic_variant	441032							g.chr4:106406332T>A																													4.37:g.106406332T>A							p.Y114N	NR_003586						1	470	+									Missense_Mutation	SNP		37	c.340T>A																																																																																				0	0.453									12	102	0	0	0	0.001855	0	12	102				
NDST4	64579	broad.mit.edu	37	4	115997479	115997479	+	Silent	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:115997479T>C	ENST00000264363.2	-	2	1392	c.714A>G	c.(712-714)ttA>ttG	p.L238L		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	238	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.L238L(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TTTCTGTCTGTAACTCAGTTA	0.438																																							uc003ibu.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(1)	4						c.(712-714)TTA>TTG		heparan sulfate N-deacetylase/N-sulfotransferase							107.0	108.0	108.0					4																	115997479		2203	4300	6503	SO:0001819	synonymous_variant	64579					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:115997479T>C	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.714A>G	4.37:g.115997479T>C						NDST4_uc010imw.2_Intron	p.L238L	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000562)	2	1393	-		Ovarian(17;0.156)	238			Lumenal (Potential).|Heparan sulfate N-deacetylase 4.		Q2KHM8	Silent	SNP	ENST00000264363.2	37	c.714A>G	CCDS3706.1																																																																																				0.438	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569		24	132	0	0	0	0.004656	0	24	132				
FAT4	79633	broad.mit.edu	37	4	126372425	126372425	+	Silent	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:126372425A>T	ENST00000394329.3	+	9	10267	c.10254A>T	c.(10252-10254)ccA>ccT	p.P3418P	FAT4_ENST00000335110.5_Silent_p.P1716P	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3418	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P3418P(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AAGGGGTCCCAATAGGAACTC	0.453																																							uc003ifj.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(10252-10254)CCA>CCT		FAT tumor suppressor homolog 4 precursor							155.0	151.0	153.0					4																	126372425		2203	4300	6503	SO:0001819	synonymous_variant	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126372425A>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10254A>T	4.37:g.126372425A>T						FAT4_uc011cgp.1_Silent_p.P1716P|FAT4_uc003ifi.1_Silent_p.P896P	p.P3418P	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN			9	10254	+			3418			Cadherin 33.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	c.10254A>T	CCDS3732.3																																																																																				0.453	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		37	220	0	0	0	0.004289	0	37	220				
PCDH10	57575	broad.mit.edu	37	4	134071779	134071779	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:134071779A>T	ENST00000264360.5	+	1	1310	c.484A>T	c.(484-486)Acc>Tcc	p.T162S	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	162	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T162S(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CTACGAGATCACCCCCAACAG	0.622																																							uc003iha.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(484-486)ACC>TCC		protocadherin 10 isoform 1 precursor							72.0	68.0	69.0					4																	134071779		2203	4300	6503	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134071779A>T	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.484A>T	4.37:g.134071779A>T	ENSP00000264360:p.Thr162Ser					uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.T162S	p.T162S	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	1310	+			162			Extracellular (Potential).|Cadherin 2.		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.484A>T	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	A	2.845	-0.239498	0.05944	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.19394	2.15	4.78	4.78	0.61160	Cadherin (3);Cadherin-like (1);	0.146153	0.31809	N	0.007024	T	0.10294	0.0252	N	0.00155	-1.965	0.49915	D	0.999838	D;B	0.71674	0.998;0.041	D;B	0.72625	0.978;0.023	T	0.47368	-0.9123	10	0.02654	T	1	.	14.1037	0.65075	1.0:0.0:0.0:0.0	.	162;162	Q9P2E7;Q96SF0	PCD10_HUMAN;.	S	162	ENSP00000264360:T162S	ENSP00000264360:T162S	T	+	1	0	PCDH10	134291229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.188000	0.72045	1.995000	0.58328	0.454000	0.30748	ACC		0.622	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		18	115	0	0	0	0.007413	0	18	115				
C4orf51	646603	broad.mit.edu	37	4	146601435	146601435	+	Missense_Mutation	SNP	G	G	C	rs545069205		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:146601435G>C	ENST00000438731.1	+	1	80	c.80G>C	c.(79-81)aGa>aCa	p.R27T		NM_001080531.1	NP_001074000.1	C9J302	CD051_HUMAN	chromosome 4 open reading frame 51	27								p.R27T(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	6						GATCTGATCAGACGCAAGGCT	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21664	0.0		0.0	False		,,,				2504	0.0						uc003ikk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(79-81)AGA>ACA		chromosome 4 open reading frame 51							166.0	160.0	162.0					4																	146601435		1956	4155	6111	SO:0001583	missense	646603							g.chr4:146601435G>C		CCDS47140.1	4q31.21	2009-09-09			ENSG00000237136	ENSG00000237136			37264	protein-coding gene	gene with protein product							Standard	NM_001080531		Approved		uc003ikk.3	C9J302	OTTHUMG00000161367	ENST00000438731.1:c.80G>C	4.37:g.146601435G>C	ENSP00000391404:p.Arg27Thr						p.R27T	NM_001080531	NP_001074000	C9J302	CD051_HUMAN			1	80	+			27						Missense_Mutation	SNP	ENST00000438731.1	37	c.80G>C	CCDS47140.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.101150	0.76983	.	.	ENSG00000237136	ENST00000438731	.	.	.	5.75	4.91	0.64330	.	.	.	.	.	T	0.49133	0.1539	N	0.24115	0.695	0.28115	N	0.930858	D	0.89917	1.0	D	0.79784	0.993	T	0.43442	-0.9391	8	0.87932	D	0	.	10.6009	0.45367	0.0878:0.0:0.9122:0.0	.	27	C9J302	CD051_HUMAN	T	27	.	ENSP00000391404:R27T	R	+	2	0	C4orf51	146820885	0.910000	0.30920	0.862000	0.33874	0.995000	0.86356	2.428000	0.44749	1.435000	0.47434	0.655000	0.94253	AGA		0.468	C4orf51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080531		26	141	0	0	0	0.005443	0	26	141				
LRBA	987	broad.mit.edu	37	4	151792559	151792559	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:151792559C>A	ENST00000357115.3	-	19	2548	c.2305G>T	c.(2305-2307)Gct>Tct	p.A769S	LRBA_ENST00000535741.1_Missense_Mutation_p.A769S|LRBA_ENST00000510413.1_Missense_Mutation_p.A769S|LRBA_ENST00000507224.1_Missense_Mutation_p.A769S	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	769						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A769S(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGCCTTTCAGCTAGCAATGAA	0.363																																							uc010ipj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(3)|skin(1)	7						c.(2305-2307)GCT>TCT		LPS-responsive vesicle trafficking, beach and							173.0	166.0	169.0					4																	151792559		2203	4300	6503	SO:0001583	missense	987					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding	g.chr4:151792559C>A	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.2305G>T	4.37:g.151792559C>A	ENSP00000349629:p.Ala769Ser					LRBA_uc003ilu.3_Missense_Mutation_p.A769S	p.A769S	NM_006726	NP_006717	P50851	LRBA_HUMAN			19	2779	-	all_hematologic(180;0.151)		769					Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	c.2305G>T	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.922033	0.73213	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	6.17	5.32	0.75619	Armadillo-like helical (1);Armadillo-type fold (1);	0.275088	0.35207	N	0.003364	T	0.64494	0.2603	L	0.34521	1.04	0.41659	D	0.98917	D;B	0.54964	0.969;0.084	P;B	0.55260	0.772;0.022	T	0.61959	-0.6955	10	0.25751	T	0.34	.	16.7611	0.85512	0.1301:0.8699:0.0:0.0	.	769;769	P50851;P50851-2	LRBA_HUMAN;.	S	769	ENSP00000446299:A769S;ENSP00000421552:A769S;ENSP00000349629:A769S;ENSP00000422180:A769S	ENSP00000349629:A769S	A	-	1	0	LRBA	152012009	0.988000	0.35896	1.000000	0.80357	0.997000	0.91878	2.349000	0.44054	1.582000	0.49881	0.655000	0.94253	GCT		0.363	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			33	179	1	0	1.04352e-10	0.003755	1.47918e-10	33	179				
KLHL2	11275	broad.mit.edu	37	4	166231704	166231704	+	Splice_Site	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:166231704G>T	ENST00000226725.6	+	10	1298		c.e10-1		KLHL2_ENST00000506761.1_Splice_Site|KLHL2_ENST00000514860.1_Splice_Site|KLHL2_ENST00000509028.1_Splice_Site|KLHL2_ENST00000538127.1_Splice_Site|KLHL2_ENST00000421009.2_Splice_Site	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2						protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)	p.?(1)		endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		TCCTTTTGCAGGCATGGTCTA	0.423																																							uc003irb.2		NA																	1	Unknown(1)		lung(1)		0						c.e10-1		kelch-like 2, Mayven isoform 1							229.0	231.0	231.0					4																	166231704		2203	4300	6503	SO:0001630	splice_region_variant	11275				intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity	g.chr4:166231704G>T	AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.1040-1G>T	4.37:g.166231704G>T						KLHL2_uc011cjm.1_Splice_Site_p.G351_splice|KLHL2_uc003irc.2_Splice_Site_p.G259_splice|KLHL2_uc010ira.2_Splice_Site	p.G347_splice	NM_007246	NP_009177	O95198	KLHL2_HUMAN		GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)	10	1299	+	all_hematologic(180;0.221)							A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Splice_Site	SNP	ENST00000226725.6	37	c.1040_splice	CCDS34094.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063257	0.76187	.	.	ENSG00000109466	ENST00000226725;ENST00000514860;ENST00000538127;ENST00000421009;ENST00000506761	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5427	0.95280	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KLHL2	166451154	1.000000	0.71417	0.998000	0.56505	0.751000	0.42716	9.827000	0.99397	2.604000	0.88044	0.650000	0.86243	.		0.423	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1		Intron	61	317	1	0	7.07328e-35	0.01441	1.28957e-34	61	317				
DDX60	55601	broad.mit.edu	37	4	169201524	169201524	+	Missense_Mutation	SNP	C	C	A	rs137933604		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:169201524C>A	ENST00000393743.3	-	14	2231	c.1940G>T	c.(1939-1941)tGc>tTc	p.C647F		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	647					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.C647F(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GGCTTTCAAGCAAGCAGTTAA	0.358													C|||	1	0.000199681	0.0	0.0	5008	,	,		18417	0.001		0.0	False		,,,				2504	0.0						uc003irp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(1939-1941)TGC>TTC		DEAD (Asp-Glu-Ala-Asp) box polypeptide 60							89.0	85.0	87.0					4																	169201524		2203	4300	6503	SO:0001583	missense	55601						ATP binding|ATP-dependent helicase activity|RNA binding	g.chr4:169201524C>A	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.1940G>T	4.37:g.169201524C>A	ENSP00000377344:p.Cys647Phe						p.C647F	NM_017631	NP_060101	Q8IY21	DDX60_HUMAN		GBM - Glioblastoma multiforme(119;0.0485)	14	2232	-		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)	647					Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	c.1940G>T	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985408	0.35036	.	.	ENSG00000137628	ENST00000393743	T	0.18174	2.23	5.48	4.63	0.57726	.	0.244990	0.36555	N	0.002524	T	0.19485	0.0468	M	0.70275	2.135	0.34385	D	0.693555	P	0.35745	0.518	B	0.30646	0.118	T	0.27331	-1.0077	10	0.24483	T	0.36	.	14.4174	0.67160	0.0:0.719:0.281:0.0	.	647	Q8IY21	DDX60_HUMAN	F	647	ENSP00000377344:C647F	ENSP00000377344:C647F	C	-	2	0	DDX60	169438099	0.996000	0.38824	0.840000	0.33206	0.059000	0.15707	2.258000	0.43249	1.309000	0.44985	0.563000	0.77884	TGC		0.358	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631		18	164	1	0	1.45105e-14	0.006122	2.28541e-14	18	164				
GLRA3	8001	broad.mit.edu	37	4	175636673	175636673	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:175636673C>A	ENST00000274093.3	-	5	1042	c.540G>T	c.(538-540)atG>atT	p.M180I	GLRA3_ENST00000340217.5_Missense_Mutation_p.M180I	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	180					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.M180I(1)		endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	TTTGTACATCCATGGGAAAAT	0.274																																							uc003ity.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(538-540)ATG>ATT		glycine receptor, alpha 3 isoform a	Glycine(DB00145)						78.0	81.0	80.0					4																	175636673		2203	4294	6497	SO:0001583	missense	8001				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity	g.chr4:175636673C>A	AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.540G>T	4.37:g.175636673C>A	ENSP00000274093:p.Met180Ile					GLRA3_uc003itz.1_Missense_Mutation_p.M180I	p.M180I	NM_006529	NP_006520	O75311	GLRA3_HUMAN		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	5	1043	-		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)	180			Extracellular (Probable).		D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	ENST00000274093.3	37	c.540G>T	CCDS3822.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.921309	0.92249	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	T;T	0.79454	-1.27;-1.27	5.49	5.49	0.81192	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.90532	0.7033	M	0.91768	3.24	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.70227	0.966;0.968	D	0.92387	0.5918	10	0.87932	D	0	.	18.1615	0.89709	0.0:1.0:0.0:0.0	.	180;180	O75311-2;O75311	.;GLRA3_HUMAN	I	180	ENSP00000274093:M180I;ENSP00000345284:M180I	ENSP00000274093:M180I	M	-	3	0	GLRA3	175873248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.468000	0.80943	2.583000	0.87209	0.650000	0.86243	ATG		0.274	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313427.1			6	62	1	0	5.18039e-06	0.00308	6.23627e-06	6	62				
FAT1	2195	broad.mit.edu	37	4	187538323	187538323	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr4:187538323T>C	ENST00000441802.2	-	11	9120	c.8911A>G	c.(8911-8913)Act>Gct	p.T2971A		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2971	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T2974A(1)|p.T2971A(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTCTGTATAGTTTCAACGGCA	0.358										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(8911-8913)ACT>GCT		FAT tumor suppressor 1 precursor							131.0	119.0	123.0					4																	187538323		1836	4086	5922	SO:0001583	missense	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187538323T>C	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8911A>G	4.37:g.187538323T>C	ENSP00000406229:p.Thr2971Ala	HNSCC(5;0.00058)					p.T2971A	NM_005245	NP_005236	Q14517	FAT1_HUMAN			11	9099	-			2971			Extracellular (Potential).|Cadherin 27.			Missense_Mutation	SNP	ENST00000441802.2	37	c.8911A>G	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	T	4.461	0.085411	0.08583	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.53857	0.6	4.37	4.37	0.52481	Cadherin (4);Cadherin-like (1);	0.052055	0.85682	D	0.000000	T	0.33235	0.0856	N	0.16656	0.425	0.18873	N	0.999987	B	0.06786	0.001	B	0.04013	0.001	T	0.08330	-1.0727	10	0.08179	T	0.78	.	14.02	0.64547	0.0:0.0:0.0:1.0	.	2971	Q14517	FAT1_HUMAN	A	2971;2973	ENSP00000406229:T2971A	ENSP00000260147:T2973A	T	-	1	0	FAT1	187775317	1.000000	0.71417	0.988000	0.46212	0.919000	0.55068	5.091000	0.64505	1.964000	0.57103	0.455000	0.32223	ACT		0.358	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		16	65	0	0	0	0.00499	0	16	65				
TERT	7015	broad.mit.edu	37	5	1264701	1264701	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:1264701C>A	ENST00000310581.5	-	11	2718	c.2661G>T	c.(2659-2661)ctG>ctT	p.L887L	TERT_ENST00000334602.6_Intron|TERT_ENST00000296820.5_3'UTR	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	887	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)	p.L875L(1)|p.L887L(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	CACCTCGGACCAGGGTCCTAA	0.582									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																														uc003jcb.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12						c.(2659-2661)CTG>CTT		telomerase reverse transcriptase isoform 1							71.0	76.0	74.0					5																	1264701		2092	4225	6317	SO:0001819	synonymous_variant	7015	TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity	g.chr5:1264701C>A	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.2661G>T	5.37:g.1264701C>A						TERT_uc003jbz.1_Silent_p.L83L|TERT_uc003jca.1_Silent_p.L875L|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	p.L887L	NM_198253	NP_937983	O14746	TERT_HUMAN	Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		11	2719	-	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		887			Reverse transcriptase.		O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Silent	SNP	ENST00000310581.5	37	c.2661G>T	CCDS3861.2																																																																																				0.582	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2			20	135	1	0	1.10923e-09	0.00278	1.51916e-09	20	135				
ADAMTS16	170690	broad.mit.edu	37	5	5146362	5146362	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:5146362C>A	ENST00000274181.7	+	3	433	c.295C>A	c.(295-297)Ctt>Att	p.L99I	CTD-2297D10.1_ENST00000514848.1_RNA|ADAMTS16_ENST00000511368.1_Missense_Mutation_p.L99I	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	99					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L99I(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTCTCTTCACCTTCGGCTGAA	0.562																																							uc003jdl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.(295-297)CTT>ATT		ADAM metallopeptidase with thrombospondin type 1							68.0	70.0	69.0					5																	5146362		2017	4178	6195	SO:0001583	missense	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5146362C>A	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.295C>A	5.37:g.5146362C>A	ENSP00000274181:p.Leu99Ile					ADAMTS16_uc003jdk.1_Missense_Mutation_p.L99I|ADAMTS16_uc003jdj.1_Missense_Mutation_p.L99I	p.L99I	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN			3	433	+			99					C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	c.295C>A	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412700	0.83340	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.06528	3.29;3.29	5.55	5.55	0.83447	Peptidase M12B, propeptide (1);	0.076409	0.53938	D	0.000051	T	0.16214	0.0390	M	0.64567	1.98	0.46631	D	0.99913	D;P;P	0.53619	0.961;0.798;0.831	P;B;P	0.49922	0.626;0.406;0.542	T	0.00049	-1.2199	10	0.87932	D	0	.	18.6279	0.91347	0.0:1.0:0.0:0.0	.	99;99;99	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	I	99	ENSP00000274181:L99I;ENSP00000421631:L99I	ENSP00000274181:L99I	L	+	1	0	ADAMTS16	5199362	1.000000	0.71417	0.973000	0.42090	0.806000	0.45545	2.599000	0.46231	2.767000	0.95098	0.563000	0.77884	CTT		0.562	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056		46	98	1	0	1.62263e-30	0.01441	2.93003e-30	46	98				
PRDM9	56979	broad.mit.edu	37	5	23509208	23509208	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:23509208C>A	ENST00000296682.3	+	2	248	c.66C>A	c.(64-66)ccC>ccA	p.P22P		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	22					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.P22P(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGCGGAAGCCCATGGTGAGAA	0.562										HNSCC(3;0.000094)																													uc003jgo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|large_intestine(2)|pancreas(1)	6						c.(64-66)CCC>CCA		PR domain containing 9							77.0	87.0	84.0					5																	23509208		1986	4160	6146	SO:0001819	synonymous_variant	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23509208C>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.66C>A	5.37:g.23509208C>A		HNSCC(3;0.000094)					p.P22P	NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN			2	248	+			22					B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	c.66C>A	CCDS43307.1																																																																																				0.562	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		17	52	1	0	1.01871e-10	0.008871	1.44764e-10	17	52				
CDH10	1008	broad.mit.edu	37	5	24491831	24491831	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:24491831C>T	ENST00000264463.4	-	11	2237	c.1730G>A	c.(1729-1731)aGc>aAc	p.S577N	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	577	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S577N(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		GCCTGTGCTGCTCTGAATTGG	0.488										HNSCC(23;0.051)																													uc003jgr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(1729-1731)AGC>AAC		cadherin 10, type 2 preproprotein							143.0	122.0	129.0					5																	24491831		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24491831C>T	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1730G>A	5.37:g.24491831C>T	ENSP00000264463:p.Ser577Asn	HNSCC(23;0.051)				CDH10_uc011cnu.1_RNA	p.S577N	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	11	2062	-			577			Cadherin 5.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1730G>A	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945794	0.73672	.	.	ENSG00000040731	ENST00000264463	T	0.55413	0.52	6.02	6.02	0.97574	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.80623	0.4658	M	0.92459	3.31	0.48185	D	0.9996	D	0.89917	1.0	D	0.91635	0.999	D	0.84089	0.0389	10	0.87932	D	0	.	19.5254	0.95203	0.0:1.0:0.0:0.0	.	577	Q9Y6N8	CAD10_HUMAN	N	577	ENSP00000264463:S577N	ENSP00000264463:S577N	S	-	2	0	CDH10	24527588	1.000000	0.71417	1.000000	0.80357	0.584000	0.36387	5.956000	0.70315	2.857000	0.98124	0.650000	0.86243	AGC		0.488	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		7	86	0	0	0	0.00308	0	7	86				
CDH9	1007	broad.mit.edu	37	5	26881265	26881265	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:26881265C>A	ENST00000231021.4	-	12	2522	c.2350G>T	c.(2350-2352)Gat>Tat	p.D784Y		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	784					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D784Y(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TCACTATCATCACCCCCATAC	0.418																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(2350-2352)GAT>TAT		cadherin 9, type 2 preproprotein							144.0	138.0	140.0					5																	26881265		2203	4300	6503	SO:0001583	missense	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26881265C>A	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2350G>T	5.37:g.26881265C>A	ENSP00000231021:p.Asp784Tyr					CDH9_uc011cnv.1_Missense_Mutation_p.D377Y	p.D784Y	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN			12	2519	-			784			Cytoplasmic (Potential).		Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	c.2350G>T	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.651788	0.47362	.	.	ENSG00000113100	ENST00000231021	T	0.56611	0.45	5.26	4.38	0.52667	.	0.402195	0.29908	N	0.010890	T	0.52853	0.1760	L	0.49126	1.545	0.29085	N	0.882434	P;B	0.37176	0.586;0.404	P;P	0.46419	0.516;0.516	T	0.51228	-0.8732	9	.	.	.	.	8.8548	0.35221	0.0:0.7689:0.1494:0.0817	.	377;784	B4DFP0;Q9ULB4	.;CADH9_HUMAN	Y	784	ENSP00000231021:D784Y	.	D	-	1	0	CDH9	26917022	0.973000	0.33851	1.000000	0.80357	0.980000	0.70556	2.343000	0.44001	1.180000	0.42898	0.557000	0.71058	GAT		0.418	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		36	204	1	0	6.2361e-21	0.007835	1.06824e-20	36	204				
PDZD2	23037	broad.mit.edu	37	5	32089086	32089086	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:32089086C>T	ENST00000438447.1	+	20	5920	c.5532C>T	c.(5530-5532)ggC>ggT	p.G1844G	PDZD2_ENST00000282493.3_Silent_p.G1844G			O15018	PDZD2_HUMAN	PDZ domain containing 2	1844					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.G1844G(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AAAAAAAGGGCGTTACTGTGC	0.478																																							uc003jhl.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						c.(5530-5532)GGC>GGT		PDZ domain containing 2							96.0	99.0	98.0					5																	32089086		2203	4300	6503	SO:0001819	synonymous_variant	23037				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus		g.chr5:32089086C>T	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.5532C>T	5.37:g.32089086C>T						PDZD2_uc003jhm.2_Silent_p.G1844G	p.G1844G	NM_178140	NP_835260	O15018	PDZD2_HUMAN			20	5920	+			1844					Q9BXD4	Silent	SNP	ENST00000438447.1	37	c.5532C>T	CCDS34137.1																																																																																				0.478	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			27	149	0	0	0	0.008361	0	27	149				
NPR3	4883	broad.mit.edu	37	5	32712141	32712141	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:32712141G>T	ENST00000265074.8	+	1	602	c.259G>T	c.(259-261)Ggg>Tgg	p.G87W	NPR3_ENST00000415685.2_Intron|NPR3_ENST00000415167.2_Missense_Mutation_p.G87W|NPR3_ENST00000434067.2_Intron	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	87					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)	p.G87W(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	GGAGGGCAACGGGACTGGGAG	0.637																																							uc003jhv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(259-261)GGG>TGG		natriuretic peptide receptor C/guanylate cyclase	Nesiritide(DB04899)						29.0	35.0	33.0					5																	32712141		1966	4151	6117	SO:0001583	missense	4883				osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity	g.chr5:32712141G>T		CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.259G>T	5.37:g.32712141G>T	ENSP00000265074:p.Gly87Trp					NPR3_uc010iuo.2_Intron|NPR3_uc011cnz.1_Intron|NPR3_uc003jhu.2_Missense_Mutation_p.G87W	p.G87W	NM_000908	NP_000899	P17342	ANPRC_HUMAN			1	477	+			87			Extracellular (Potential).		A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	37	c.259G>T	CCDS56357.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460770	0.63513	.	.	ENSG00000113389	ENST00000265074;ENST00000415167	T;T	0.27890	1.64;1.64	5.37	3.59	0.41128	Extracellular ligand-binding receptor (1);	0.467045	0.25453	N	0.030561	T	0.41949	0.1181	L	0.58810	1.83	0.80722	D	1	D;D	0.67145	0.996;0.996	P;P	0.58266	0.836;0.836	T	0.24190	-1.0167	10	0.66056	D	0.02	-12.7781	7.1121	0.25396	0.1521:0.141:0.7069:0.0	.	87;87	P17342;Q60I31	ANPRC_HUMAN;.	W	87	ENSP00000265074:G87W;ENSP00000398028:G87W	ENSP00000265074:G87W	G	+	1	0	NPR3	32747898	1.000000	0.71417	0.998000	0.56505	0.922000	0.55478	3.823000	0.55715	0.664000	0.31047	0.561000	0.74099	GGG		0.637	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908		14	61	1	0	5.03518e-11	0.007413	7.28303e-11	14	61				
SPEF2	79925	broad.mit.edu	37	5	35659145	35659145	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:35659145A>T	ENST00000356031.3	+	8	1157	c.1003A>T	c.(1003-1005)Att>Ttt	p.I335F	SPEF2_ENST00000440995.2_Missense_Mutation_p.I335F|SPEF2_ENST00000282469.6_Missense_Mutation_p.I335F|SPEF2_ENST00000509059.1_Missense_Mutation_p.I335F	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	335					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.I335F(2)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGAACAGCTGATTAACCGGCT	0.478																																							uc003jjo.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1003-1005)ATT>TTT		KPL2 protein isoform 1							48.0	48.0	48.0					5																	35659145		2203	4300	6503	SO:0001583	missense	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35659145A>T	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1003A>T	5.37:g.35659145A>T	ENSP00000348314:p.Ile335Phe					SPEF2_uc003jjn.1_Missense_Mutation_p.I335F|SPEF2_uc003jjq.3_Missense_Mutation_p.I335F	p.I335F	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		8	1114	+	all_lung(31;7.56e-05)		335			Potential.		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	c.1003A>T	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.496792	0.85069	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000440995	T;T;T;T	0.16897	2.31;2.31;2.31;2.31	5.55	5.55	0.83447	.	0.059542	0.64402	D	0.000002	T	0.32793	0.0841	L	0.54323	1.7	0.80722	D	1	D;D;D	0.57257	0.961;0.979;0.979	P;P;P	0.61800	0.522;0.786;0.894	T	0.03278	-1.1053	10	0.72032	D	0.01	.	11.6421	0.51240	0.9285:0.0:0.0715:0.0	.	335;335;335	D6REZ4;Q9C093;Q9C093-3	.;SPEF2_HUMAN;.	F	335	ENSP00000282469:I335F;ENSP00000348314:I335F;ENSP00000421593:I335F;ENSP00000412125:I335F	ENSP00000282469:I335F	I	+	1	0	SPEF2	35694902	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.499000	0.60380	2.108000	0.64289	0.402000	0.26972	ATT		0.478	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		4	28	0	0	0	0.004482	0	4	28				
IL31RA	133396	broad.mit.edu	37	5	55212479	55212479	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:55212479T>A	ENST00000447346.2	+	15	1891	c.1826T>A	c.(1825-1827)cTa>cAa	p.L609Q	IL31RA_ENST00000359040.5_Missense_Mutation_p.L609Q|IL31RA_ENST00000354961.4_Missense_Mutation_p.L590Q|IL31RA_ENST00000490985.1_Missense_Mutation_p.L467Q|IL31RA_ENST00000396834.1_Missense_Mutation_p.L590Q	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	577					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)	p.L609Q(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				CAGGATAAGCTAAACCTGAAG	0.448																																							uc003jql.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1825-1827)CTA>CAA		gp130-like monocyte receptor							92.0	91.0	92.0					5																	55212479		2203	4300	6503	SO:0001583	missense	133396				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity	g.chr5:55212479T>A	AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.1826T>A	5.37:g.55212479T>A	ENSP00000415900:p.Leu609Gln					IL31RA_uc003jqm.2_Missense_Mutation_p.L577Q|IL31RA_uc003jqn.2_Missense_Mutation_p.L609Q|IL31RA_uc003jqo.2_Missense_Mutation_p.L467Q	p.L609Q	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN			15	1891	+		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)	577			Cytoplasmic (Potential).		A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	ENST00000447346.2	37	c.1826T>A	CCDS3970.2	.	.	.	.	.	.	.	.	.	.	T	15.05	2.717274	0.48622	.	.	ENSG00000164509	ENST00000396834;ENST00000447346;ENST00000359040;ENST00000490985;ENST00000354961	T;T;T;T;T	0.47177	1.06;1.04;1.04;0.85;1.06	5.78	-2.82	0.05787	.	1.425840	0.04211	N	0.331660	T	0.35885	0.0947	M	0.63428	1.95	0.09310	N	1	B;B;B	0.33171	0.4;0.4;0.4	B;B;B	0.26969	0.075;0.075;0.075	T	0.18808	-1.0325	10	0.35671	T	0.21	-1.0078	0.2931	0.00261	0.2701:0.2433:0.139:0.3475	.	609;590;609	Q8NI17-5;Q8NI17-3;Q8NI17-2	.;.;.	Q	590;609;609;467;590	ENSP00000380046:L590Q;ENSP00000415900:L609Q;ENSP00000351935:L609Q;ENSP00000427533:L467Q;ENSP00000347047:L590Q	ENSP00000347047:L590Q	L	+	2	0	IL31RA	55248236	0.001000	0.12720	0.131000	0.22000	0.698000	0.40448	-0.057000	0.11768	-0.267000	0.09325	-0.250000	0.11733	CTA		0.448	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1	NM_139017		23	136	0	0	0	0.009535	0	23	136				
SPZ1	84654	broad.mit.edu	37	5	79617271	79617271	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:79617271C>A	ENST00000296739.4	+	1	1482	c.1237C>A	c.(1237-1239)Cat>Aat	p.H413N		NM_032567.3	NP_115956.3	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	413					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H413N(1)		endometrium(2)|kidney(5)|large_intestine(4)|lung(12)|ovary(1)|skin(2)	26		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		GTTCAATATTCATGTTGCAAG	0.373																																							uc003kgn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1237-1239)CAT>AAT		spermatogenic leucine zipper 1							65.0	64.0	65.0					5																	79617271		1818	4079	5897	SO:0001583	missense	84654				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr5:79617271C>A		CCDS43336.1	5q14.1	2014-06-13				ENSG00000164299			30721	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 148"""					11165476, 12778315, 15226296, 15829580, 15899793	Standard	NM_032567		Approved	NYD-TSP1, FLJ25709, PPP1R148	uc003kgn.3	Q9BXG8		ENST00000296739.4:c.1237C>A	5.37:g.79617271C>A	ENSP00000369611:p.His413Asn					uc011ctk.1_RNA	p.H413N	NM_032567	NP_115956	Q9BXG8	SPZ1_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)	1	1482	+		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)	413					B2RA21|Q8N4P1|Q8N7E9	Missense_Mutation	SNP	ENST00000296739.4	37	c.1237C>A	CCDS43336.1	.	.	.	.	.	.	.	.	.	.	C	9.713	1.157641	0.21454	.	.	ENSG00000164299	ENST00000296739	T	0.30448	1.53	4.07	3.2	0.36748	.	0.780110	0.11321	N	0.576076	T	0.25232	0.0613	L	0.38175	1.15	0.09310	N	1	P	0.41910	0.764	B	0.40256	0.324	T	0.12192	-1.0557	10	0.72032	D	0.01	-3.8649	7.8711	0.29567	0.0:0.8886:0.0:0.1114	.	413	Q9BXG8	SPZ1_HUMAN	N	413	ENSP00000369611:H413N	ENSP00000369611:H413N	H	+	1	0	SPZ1	79653027	0.004000	0.15560	0.001000	0.08648	0.036000	0.12997	0.637000	0.24659	1.303000	0.44873	0.557000	0.71058	CAT		0.373	SPZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369322.1	NM_032567		22	127	1	0	1.55795e-14	0.012319	2.44021e-14	22	127				
SLC27A6	28965	broad.mit.edu	37	5	128321030	128321030	+	Splice_Site	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:128321030G>A	ENST00000262462.4	+	2	1695		c.e2+1		SLC27A6_ENST00000395266.1_Splice_Site|SLC27A6_ENST00000506176.1_Splice_Site			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6						long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.?(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		GGAACAACAGGTATGATCCAA	0.438																																							uc003kuy.2		NA																	1	Unknown(1)		lung(1)		0						c.e3+1		solute carrier family 27 (fatty acid							88.0	74.0	79.0					5																	128321030		2203	4300	6503	SO:0001630	splice_region_variant	28965				long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding	g.chr5:128321030G>A	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.685+1G>A	5.37:g.128321030G>A						SLC27A6_uc003kuz.2_Splice_Site_p.G229_splice	p.G229_splice	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)	3	1081	+		all_cancers(142;0.0483)|Prostate(80;0.055)						Q6IAM5|Q7Z6E6|Q86YF6	Splice_Site	SNP	ENST00000262462.4	37	c.685_splice	CCDS4145.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341459	0.81911	.	.	ENSG00000113396	ENST00000508645;ENST00000262462;ENST00000395266;ENST00000506176	.	.	.	4.47	4.47	0.54385	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4447	0.90680	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC27A6	128348929	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.814000	0.86154	2.761000	0.94854	0.655000	0.94253	.		0.438	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1	NM_014031	Intron	10	39	0	0	0	0.008291	0	10	39				
FAM13B	51306	broad.mit.edu	37	5	137346774	137346774	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:137346774G>A	ENST00000033079.3	-	6	1064	c.613C>T	c.(613-615)Ctg>Ttg	p.L205L	FAM13B_ENST00000420893.2_Silent_p.L205L|FAM13B_ENST00000425075.2_Silent_p.L87L	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	205	Glu-rich.|Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.L87L(1)|p.L205L(1)		endometrium(4)|kidney(2)|lung(5)	11						TAGTTTTCCAGAAGTCCAGCC	0.348																																							uc003lbz.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(613-615)CTG>TTG		hypothetical protein LOC51306 isoform 1							128.0	124.0	125.0					5																	137346774		2203	4300	6503	SO:0001819	synonymous_variant	51306				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr5:137346774G>A	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.613C>T	5.37:g.137346774G>A						FAM13B_uc003lcb.2_Silent_p.L87L|FAM13B_uc003lca.2_Silent_p.L205L	p.L205L	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN			6	1147	-			205			Rho-GAP.|Glu-rich.		D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Silent	SNP	ENST00000033079.3	37	c.613C>T	CCDS4195.1																																																																																				0.348	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1			15	122	0	0	0	0.00245	0	15	122				
BRD8	10902	broad.mit.edu	37	5	137488440	137488440	+	Missense_Mutation	SNP	C	C	G	rs148605042	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:137488440C>G	ENST00000254900.5	-	21	2958	c.2587G>C	c.(2587-2589)Gag>Cag	p.E863Q		NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	863					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)	p.E863Q(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CAAACCCACTCGTGTCCCATC	0.438																																							uc003lcf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2587-2589)GAG>CAG		bromodomain containing 8 isoform 2							93.0	93.0	93.0					5																	137488440		2203	4300	6503	SO:0001583	missense	10902				cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity	g.chr5:137488440C>G	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.2587G>C	5.37:g.137488440C>G	ENSP00000254900:p.Glu863Gln					BRD8_uc003lcc.1_Intron	p.E863Q	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		21	2642	-			863					O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	c.2587G>C	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	C	8.073	0.770709	0.15983	.	.	ENSG00000112983	ENST00000254900	T	0.26373	1.74	5.18	4.31	0.51392	.	0.308515	0.25535	N	0.030008	T	0.13713	0.0332	N	0.08118	0	0.80722	D	1	B	0.18610	0.029	B	0.19946	0.027	T	0.06516	-1.0822	10	0.14656	T	0.56	0.4872	13.9583	0.64164	0.0:0.9202:0.0:0.0798	.	863	Q9H0E9	BRD8_HUMAN	Q	863	ENSP00000254900:E863Q	ENSP00000254900:E863Q	E	-	1	0	BRD8	137516339	0.798000	0.28890	0.859000	0.33776	0.547000	0.35210	0.593000	0.23999	0.772000	0.33382	-0.797000	0.03246	GAG		0.438	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696		33	147	0	0	0	0.003755	0	33	147				
SLC23A1	9963	broad.mit.edu	37	5	138714949	138714949	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:138714949G>A	ENST00000348729.3	-	9	1066	c.1020C>T	c.(1018-1020)taC>taT	p.Y340Y	SLC23A1_ENST00000353963.3_Silent_p.Y344Y|SLC23A1_ENST00000503919.1_5'Flank	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	340					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)	p.Y344Y(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	GGGCACAGGCGTAGTAATCTC	0.617																																							uc003leh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1018-1020)TAC>TAT		solute carrier family 23 (nucleobase	Vitamin C(DB00126)						106.0	98.0	101.0					5																	138714949		2203	4300	6503	SO:0001819	synonymous_variant	9963				brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity	g.chr5:138714949G>A	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1020C>T	5.37:g.138714949G>A						SLC23A1_uc003leg.2_Silent_p.Y344Y	p.Y340Y	NM_005847	NP_005838	Q9UHI7	S23A1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		9	1117	-			340					O95191|Q8WWB6|Q9UGH4|Q9UI39	Silent	SNP	ENST00000348729.3	37	c.1020C>T	CCDS4212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.560|6.560	0.471560|0.471560	0.12461|0.12461	.|.	.|.	ENSG00000170482|ENSG00000170482	ENST00000504513|ENST00000453898	.|.	.|.	.|.	5.26|5.26	1.62|1.62	0.23740|0.23740	.|.	.|.	.|.	.|.	.|.	T|T	0.62877|0.62877	0.2464|0.2464	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.61327|0.61327	-0.7085|-0.7085	4|5	.|0.87932	.|D	.|0	-0.062|-0.062	7.9174|7.9174	0.29827|0.29827	0.6641:0.0:0.3359:0.0|0.6641:0.0:0.3359:0.0	.|.	.|.	.|.	.|.	C|M	87|295	.|.	.|ENSP00000406720:T295M	R|T	-|-	1|2	0|0	SLC23A1|SLC23A1	138742848|138742848	0.049000|0.049000	0.20398|0.20398	0.999000|0.999000	0.59377|0.59377	0.779000|0.779000	0.44077|0.44077	-0.479000|-0.479000	0.06567|0.06567	0.121000|0.121000	0.18284|0.18284	-0.258000|-0.258000	0.10820|0.10820	CGC|ACG		0.617	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685		26	115	0	0	0	0.00632	0	26	115				
PCDHA6	56142	broad.mit.edu	37	5	140209948	140209948	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:140209948G>T	ENST00000529310.1	+	1	2386	c.2272G>T	c.(2272-2274)Gtg>Ttg	p.V758L	PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	758					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V758L(2)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGCAGAGGGTGTGCTCCGG	0.637																																							uc003lho.2		NA																	2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(2272-2274)GTG>TTG		protocadherin alpha 6 isoform 1 precursor							45.0	47.0	46.0					5																	140209948		2203	4300	6503	SO:0001583	missense	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140209948G>T	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2272G>T	5.37:g.140209948G>T	ENSP00000433378:p.Val758Leu					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Missense_Mutation_p.V758L	p.V758L	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2299	+			758			Cytoplasmic (Potential).		O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	c.2272G>T	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	G	5.806	0.332935	0.11013	.	.	ENSG00000081842	ENST00000529310	T	0.16457	2.34	4.02	4.02	0.46733	.	0.247567	0.20145	U	0.098293	T	0.30727	0.0774	M	0.91663	3.23	0.80722	D	1	B;B	0.18013	0.025;0.009	B;B	0.25291	0.059;0.008	T	0.23226	-1.0194	10	0.41790	T	0.15	.	12.883	0.58028	0.0:0.2168:0.7832:0.0	.	758;758	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	L	758	ENSP00000433378:V758L	ENSP00000433378:V758L	V	+	1	0	PCDHA6	140190132	.	.	1.000000	0.80357	0.079000	0.17450	.	.	2.221000	0.72209	0.313000	0.20887	GTG		0.637	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		12	43	1	0	2.80697e-09	0.010729	3.83507e-09	12	43				
PCDHB4	56131	broad.mit.edu	37	5	140503451	140503451	+	Missense_Mutation	SNP	G	G	T	rs149487286		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:140503451G>T	ENST00000194152.1	+	1	1871	c.1871G>T	c.(1870-1872)cGc>cTc	p.R624L		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R624L(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCGAGGTGCGCACCGCCAGG	0.697																																							uc003lip.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1870-1872)CGC>CTC		protocadherin beta 4 precursor							27.0	27.0	27.0					5																	140503451		2013	4015	6028	SO:0001583	missense	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140503451G>T	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1871G>T	5.37:g.140503451G>T	ENSP00000194152:p.Arg624Leu						p.R624L	NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1871	+			624			Cadherin 6.|Extracellular (Potential).		Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	c.1871G>T	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090424	0.76756	.	.	ENSG00000081818	ENST00000194152	T	0.52754	0.65	4.12	4.12	0.48240	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.70666	0.3250	M	0.88450	2.955	0.42055	D	0.991134	D	0.76494	0.999	D	0.77004	0.989	T	0.76558	-0.2915	9	0.87932	D	0	.	11.2798	0.49188	0.091:0.0:0.909:0.0	.	624	Q9Y5E5	PCDB4_HUMAN	L	624	ENSP00000194152:R624L	ENSP00000194152:R624L	R	+	2	0	PCDHB4	140483635	0.959000	0.32827	1.000000	0.80357	0.997000	0.91878	4.348000	0.59379	2.307000	0.77673	0.485000	0.47835	CGC		0.697	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		21	103	1	0	1.96895e-08	0.00278	2.6084e-08	21	103				
PCDHB7	56129	broad.mit.edu	37	5	140553151	140553151	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:140553151G>A	ENST00000231137.3	+	1	909	c.735G>A	c.(733-735)tcG>tcA	p.S245S		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	245					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S245S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGTGCGGTCGCTCTACAAGG	0.542																																							uc003lit.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(733-735)TCG>TCA		protocadherin beta 7 precursor							62.0	66.0	65.0					5																	140553151		2203	4300	6503	SO:0001819	synonymous_variant	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140553151G>A	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.735G>A	5.37:g.140553151G>A							p.S245S	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	909	+			245			Extracellular (Potential).		A1L3Y8	Silent	SNP	ENST00000231137.3	37	c.735G>A	CCDS4249.1																																																																																				0.542	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		20	112	0	0	0	0.007413	0	20	112				
PCDHB10	56126	broad.mit.edu	37	5	140573608	140573608	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:140573608G>T	ENST00000239446.4	+	1	1667	c.1483G>T	c.(1483-1485)Gac>Tac	p.D495Y		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	495	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D495Y(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCGCCCCAAGACCCGCACCT	0.672																																							uc003lix.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1483-1485)GAC>TAC		protocadherin beta 10 precursor							103.0	118.0	113.0					5																	140573608		2203	4298	6501	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140573608G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1483G>T	5.37:g.140573608G>T	ENSP00000239446:p.Asp495Tyr						p.D495Y	NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1657	+			495			Cadherin 5.|Extracellular (Potential).		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.1483G>T	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	g	7.010	0.556672	0.13436	.	.	ENSG00000120324	ENST00000239446	T	0.03663	3.85	3.32	2.44	0.29823	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.06005	0.0156	L	0.51422	1.61	0.09310	N	1	P	0.44429	0.835	P	0.49477	0.612	T	0.33420	-0.9869	9	0.19590	T	0.45	.	5.1711	0.15110	0.1124:0.0:0.6849:0.2026	.	495	Q9UN67	PCDBA_HUMAN	Y	495	ENSP00000239446:D495Y	ENSP00000239446:D495Y	D	+	1	0	PCDHB10	140553792	.	.	0.024000	0.17045	0.050000	0.14768	.	.	0.746000	0.32786	0.549000	0.68633	GAC		0.672	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		13	185	1	0	6.31663e-08	0.003163	8.15838e-08	13	185				
PCDHB12	56124	broad.mit.edu	37	5	140588987	140588987	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:140588987T>C	ENST00000239450.2	+	1	697	c.508T>C	c.(508-510)Tac>Cac	p.Y170H	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	170	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.Y170H(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTAAAAAGCTACACAATAAA	0.393																																							uc003liz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(508-510)TAC>CAC		protocadherin beta 12 precursor							77.0	78.0	77.0					5																	140588987		2203	4300	6503	SO:0001583	missense	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140588987T>C	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.508T>C	5.37:g.140588987T>C	ENSP00000239450:p.Tyr170His					PCDHB12_uc011dak.1_Intron	p.Y170H	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	697	+			170			Extracellular (Potential).|Cadherin 2.		B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	c.508T>C	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.237240	0.39498	.	.	ENSG00000120328	ENST00000239450	T	0.62941	-0.01	4.29	4.29	0.51040	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.88768	0.6526	H	0.99909	4.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93266	0.6647	9	0.87932	D	0	.	13.3883	0.60809	0.0:0.0:0.0:1.0	.	170	Q9Y5F1	PCDBC_HUMAN	H	170	ENSP00000239450:Y170H	ENSP00000239450:Y170H	Y	+	1	0	PCDHB12	140569171	1.000000	0.71417	0.205000	0.23548	0.003000	0.03518	7.912000	0.87465	1.705000	0.51264	0.482000	0.46254	TAC		0.393	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		22	120	0	0	0	0.010504	0	22	120				
PCDHB13	56123	broad.mit.edu	37	5	140594338	140594338	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:140594338G>T	ENST00000341948.4	+	1	830	c.643G>T	c.(643-645)Gca>Tca	p.A215S		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	215	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A215S(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACACTCACAGCACTGGATGG	0.547																																							uc003lja.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(643-645)GCA>TCA		protocadherin beta 13 precursor							77.0	82.0	81.0					5																	140594338		2203	4297	6500	SO:0001583	missense	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140594338G>T	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.643G>T	5.37:g.140594338G>T	ENSP00000345491:p.Ala215Ser						p.A215S	NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	830	+			215			Cadherin 2.|Extracellular (Potential).		A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	c.643G>T	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	g	28.8	4.951004	0.92660	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.37235	1.21	3.51	3.51	0.40186	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.74084	0.3670	H	0.98388	4.22	0.48452	D	0.999657	D	0.89917	1.0	D	0.97110	1.0	D	0.85779	0.1360	9	0.87932	D	0	.	15.0392	0.71774	0.0:0.0:1.0:0.0	.	215	Q9Y5F0	PCDBD_HUMAN	S	215	ENSP00000345491:A215S	ENSP00000345491:A215S	A	+	1	0	PCDHB13	140574522	1.000000	0.71417	0.010000	0.14722	0.364000	0.29643	9.790000	0.99075	1.675000	0.50919	0.306000	0.20318	GCA		0.547	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		28	119	1	0	2.4375e-19	0.007291	4.10107e-19	28	119				
PCDHGC5	56097	broad.mit.edu	37	5	140869878	140869878	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:140869878C>A	ENST00000252087.1	+	1	1071	c.1071C>A	c.(1069-1071)aaC>aaA	p.N357K	PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	357	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N357K(2)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGGCCAACCCTGTCCTAG	0.542																																							uc003lla.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1069-1071)AAC>AAA		protocadherin gamma subfamily C, 5 isoform 1							93.0	94.0	93.0					5																	140869878		2203	4300	6503	SO:0001583	missense	56097				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140869878C>A	AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.1071C>A	5.37:g.140869878C>A	ENSP00000252087:p.Asn357Lys					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Missense_Mutation_p.N357K	p.N357K	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1071	+			357			Extracellular (Potential).|Cadherin 4.		Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	37	c.1071C>A	CCDS4263.1	.	.	.	.	.	.	.	.	.	.	C	5.550	0.286378	0.10513	.	.	ENSG00000240764	ENST00000252087	T	0.67171	-0.25	5.56	1.87	0.25490	Cadherin (1);Cadherin-like (1);	0.000000	0.64402	D	0.000007	T	0.55114	0.1900	L	0.48642	1.525	0.33236	D	0.556584	B;B	0.26935	0.164;0.044	B;B	0.26310	0.041;0.068	T	0.56938	-0.7896	10	0.37606	T	0.19	.	8.833	0.35096	0.0:0.5593:0.0:0.4407	.	357;357	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	K	357	ENSP00000252087:N357K	ENSP00000252087:N357K	N	+	3	2	PCDHGC5	140850062	0.040000	0.19996	0.999000	0.59377	0.911000	0.54048	-0.074000	0.11450	0.164000	0.19529	-0.136000	0.14681	AAC		0.542	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929		14	86	1	0	2.35188e-11	0.006122	3.41927e-11	14	86				
JAKMIP2	9832	broad.mit.edu	37	5	147040887	147040887	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:147040887T>C	ENST00000265272.5	-	3	718	c.251A>G	c.(250-252)gAg>gGg	p.E84G	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.E42G|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.E84G	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	84						Golgi apparatus (GO:0005794)		p.E84G(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCTGCAGCTCCTTCATCTT	0.532																																							uc003loq.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(250-252)GAG>GGG		janus kinase and microtubule interacting protein							174.0	161.0	165.0					5																	147040887		2203	4300	6503	SO:0001583	missense	9832					Golgi apparatus		g.chr5:147040887T>C	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.251A>G	5.37:g.147040887T>C	ENSP00000265272:p.Glu84Gly					JAKMIP2_uc011dbx.1_Missense_Mutation_p.E42G|JAKMIP2_uc003lor.1_Missense_Mutation_p.E84G|uc003lop.1_3'UTR|JAKMIP2_uc010jgo.1_Missense_Mutation_p.E84G	p.E84G	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		3	633	-			84			Potential.		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	c.251A>G	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.479947	0.84747	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.09073	3.02;3.02;3.02	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.28267	0.0698	M	0.76170	2.325	0.80722	D	1	D;D;D;D	0.61080	0.989;0.989;0.989;0.989	D;D;D;D	0.70487	0.969;0.969;0.969;0.969	T	0.02457	-1.1156	10	0.72032	D	0.01	.	14.8123	0.70006	0.0:0.0:0.0:1.0	.	42;84;84;84	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	G	84;84;42;84	ENSP00000421398:E84G;ENSP00000265272:E84G;ENSP00000328989:E42G	ENSP00000265272:E84G	E	-	2	0	JAKMIP2	147021080	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.655000	0.83696	2.046000	0.60703	0.460000	0.39030	GAG		0.532	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790		70	348	0	0	0	0.01441	0	70	348				
FAT2	2196	broad.mit.edu	37	5	150923860	150923860	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:150923860G>T	ENST00000261800.5	-	9	6840	c.6828C>A	c.(6826-6828)gtC>gtA	p.V2276V		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2276	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V2276V(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGTGGTATAGACCAATTGGG	0.517																																							uc003lue.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(6826-6828)GTC>GTA		FAT tumor suppressor 2 precursor							104.0	103.0	103.0					5																	150923860		2203	4300	6503	SO:0001819	synonymous_variant	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150923860G>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.6828C>A	5.37:g.150923860G>T						GM2A_uc011dcs.1_Intron	p.V2276V	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		9	6841	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	2276			Extracellular (Potential).|Cadherin 20.		O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	c.6828C>A	CCDS4317.1																																																																																				0.517	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		28	133	1	0	5.61819e-17	0.005443	9.20668e-17	28	133				
DOCK2	1794	broad.mit.edu	37	5	169509814	169509814	+	Silent	SNP	G	G	A	rs200128185	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:169509814G>A	ENST00000256935.8	+	52	5525	c.5445G>A	c.(5443-5445)tcG>tcA	p.S1815S	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Silent_p.S876S|DOCK2_ENST00000520908.1_Silent_p.S1307S	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1815					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.S1815S(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCAGCAAATCGGCTGAAGAAG	0.507													G|||	9	0.00179712	0.0	0.0	5008	,	,		22777	0.0079		0.0	False		,,,				2504	0.001						uc003maf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|pancreas(2)	7						c.(5443-5445)TCG>TCA		dedicator of cytokinesis 2		G		1,4405	2.1+/-5.4	0,1,2202	91.0	87.0	88.0		5445	-5.4	0.0	5	dbSNP_134	88	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DOCK2	NM_004946.2		0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231		1815/1831	169509814	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	1794				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding	g.chr5:169509814G>A	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5445G>A	5.37:g.169509814G>A						DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.S1307S|DOCK2_uc003mah.2_Silent_p.S371S	p.S1815S	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		52	5525	+	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	1815					Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	c.5445G>A	CCDS4371.1																																																																																				0.507	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		11	61	0	0	0	0.010729	0	11	61				
FOXI1	2299	broad.mit.edu	37	5	169535126	169535126	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:169535126G>C	ENST00000306268.6	+	2	709	c.648G>C	c.(646-648)agG>agC	p.R216S	FOXI1_ENST00000449804.2_Intron			Q12951	FOXI1_HUMAN	forkhead box I1	216					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R216S(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCAGGAAAAGGAAGAGAAAAT	0.498									Pendred syndrome																														uc003mai.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|central_nervous_system(1)	4						c.(646-648)AGG>AGC		forkhead box I1 isoform a							74.0	74.0	74.0					5																	169535126		2203	4300	6503	SO:0001583	missense	2299	Pendred_syndrome	Familial Cancer Database	Goiter-Deafness syndrome	epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding	g.chr5:169535126G>C	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.648G>C	5.37:g.169535126G>C	ENSP00000304286:p.Arg216Ser					FOXI1_uc003maj.3_Intron	p.R216S	NM_012188	NP_036320	Q12951	FOXI1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		2	693	+	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	216			Fork-head.		Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	37	c.648G>C	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.366167	0.61513	.	.	ENSG00000168269	ENST00000306268	D	0.95622	-3.76	4.91	0.356	0.16074	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (2);	0.053759	0.64402	D	0.000001	D	0.96216	0.8766	M	0.80332	2.49	0.80722	D	1	D	0.52996	0.957	P	0.55749	0.783	D	0.95108	0.8236	10	0.87932	D	0	.	11.2878	0.49232	0.3054:0.0:0.6946:0.0	.	216	Q12951	FOXI1_HUMAN	S	216	ENSP00000304286:R216S	ENSP00000304286:R216S	R	+	3	2	FOXI1	169467704	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	0.799000	0.27028	0.121000	0.18284	0.455000	0.32223	AGG		0.498	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188		15	129	0	0	0	0.004007	0	15	129				
NPM1	4869	broad.mit.edu	37	5	170819801	170819801	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:170819801G>A	ENST00000296930.5	+	5	741	c.440G>A	c.(439-441)gGt>gAt	p.G147D	NPM1_ENST00000393820.2_Missense_Mutation_p.G147D|NPM1_ENST00000517671.1_Missense_Mutation_p.G147D|NPM1_ENST00000351986.6_Missense_Mutation_p.G147D	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	147	Required for interaction with SENP3.				cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)	p.G147D(2)	NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCCCCTGGAGGTGGTAGCAAG	0.408			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																		uc011dex.1		NA		Dom	yes		5	5q35	4869	T|F 	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""			L	ALK|RARA|MLF1		NHL|APL|AML	NPM1/ALK(632)	2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(3109)|skin(1)	3110						c.(439-441)GGT>GAT		nucleophosmin 1 isoform 1							131.0	154.0	146.0					5																	170819801		2202	4300	6502	SO:0001583	missense	4869				anti-apoptosis|cell aging|CenH3-containing nucleosome assembly at centromere|centrosome cycle|DNA repair|interspecies interaction between organisms|intracellular protein transport|negative regulation of cell proliferation|negative regulation of centrosome duplication|nucleocytoplasmic transport|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|regulation of endodeoxyribonuclease activity|regulation of endoribonuclease activity|ribosome assembly|signal transduction	nucleolus|nucleoplasm|ribonucleoprotein complex|spindle pole centrosome	histone binding|NF-kappaB binding|protein binding|protein heterodimerization activity|protein homodimerization activity|ribosomal large subunit binding|ribosomal small subunit binding|RNA binding|Tat protein binding|transcription coactivator activity|unfolded protein binding	g.chr5:170819801G>A	M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.440G>A	5.37:g.170819801G>A	ENSP00000296930:p.Gly147Asp					NPM1_uc003mbh.2_Missense_Mutation_p.G147D|NPM1_uc003mbi.2_Missense_Mutation_p.G147D|NPM1_uc003mbj.2_Missense_Mutation_p.G147D	p.G147D	NM_002520	NP_002511	P06748	NPM_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		6	575	+	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	147			Required for interaction with SENP3.		A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Missense_Mutation	SNP	ENST00000296930.5	37	c.440G>A	CCDS4376.1	.	.	.	.	.	.	.	.	.	.	G	9.970	1.225338	0.22457	.	.	ENSG00000181163	ENST00000517671;ENST00000296930;ENST00000521672;ENST00000351986;ENST00000393820	T;T;T;T	0.46063	0.91;0.91;0.88;0.88	3.73	1.29	0.21616	.	1.477350	0.05053	U	0.478499	T	0.47967	0.1474	M	0.68952	2.095	0.25146	N	0.99046	B;B;P	0.42620	0.365;0.013;0.785	P;B;P	0.45794	0.462;0.072;0.493	T	0.39210	-0.9625	10	0.35671	T	0.21	.	8.1015	0.30859	0.0:0.3604:0.4553:0.1843	.	147;147;147	P06748-2;P06748;Q9BYG9	.;NPM_HUMAN;.	D	147;147;83;147;147	ENSP00000428755:G147D;ENSP00000296930:G147D;ENSP00000341168:G147D;ENSP00000377408:G147D	ENSP00000296930:G147D	G	+	2	0	NPM1	170752406	0.996000	0.38824	0.999000	0.59377	0.986000	0.74619	1.202000	0.32271	0.664000	0.31047	0.484000	0.47621	GGT		0.408	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252858.2	NM_002520		18	264	0	0	0	0.00333	0	18	264				
STK10	6793	broad.mit.edu	37	5	171479999	171479999	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:171479999C>A	ENST00000176763.5	-	18	3043	c.2700G>T	c.(2698-2700)aaG>aaT	p.K900N		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	900					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.K900N(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CATCCAGGGCCTTCAGTTTCT	0.542																																							uc003mbo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8						c.(2698-2700)AAG>AAT		serine/threonine kinase 10							111.0	97.0	102.0					5																	171479999		2203	4300	6503	SO:0001583	missense	6793						ATP binding|protein serine/threonine kinase activity	g.chr5:171479999C>A	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.2700G>T	5.37:g.171479999C>A	ENSP00000176763:p.Lys900Asn						p.K900N	NM_005990	NP_005981	O94804	STK10_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		18	3000	-	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	900			Potential.		A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	ENST00000176763.5	37	c.2700G>T	CCDS34290.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.27|18.27	3.586233|3.586233	0.66105|0.66105	.|.	.|.	ENSG00000072786|ENSG00000072786	ENST00000176763;ENST00000545839|ENST00000520476	T|.	0.74421|.	-0.84|.	4.24|4.24	2.42|2.42	0.29668|0.29668	.|.	0.120982|.	0.53938|.	D|.	0.000060|.	T|T	0.64193|0.64193	0.2576|0.2576	M|M	0.81497|0.81497	2.545|2.545	0.47374|0.47374	D|D	0.999405|0.999405	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.60890|0.60890	-0.7173|-0.7173	10|5	0.87932|.	D|.	0|.	.|.	4.1872|4.1872	0.10404|0.10404	0.186:0.6156:0.0:0.1984|0.186:0.6156:0.0:0.1984	.|.	900|.	O94804|.	STK10_HUMAN|.	N|M	900|173	ENSP00000176763:K900N|.	ENSP00000176763:K900N|.	K|R	-|-	3|2	2|0	STK10|STK10	171412604|171412604	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	3.994000|3.994000	0.56994|0.56994	0.509000|0.509000	0.28195|0.28195	0.555000|0.555000	0.69702|0.69702	AAG|AGG		0.542	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990		17	66	1	0	3.62473e-10	0.012319	5.06213e-10	17	66				
SH3PXD2B	285590	broad.mit.edu	37	5	171766609	171766609	+	Silent	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:171766609T>A	ENST00000311601.5	-	13	1670	c.1500A>T	c.(1498-1500)tcA>tcT	p.S500S	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	500					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)	p.S500S(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAGACATGTCTGAAGATGCCT	0.592																																							uc003mbr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(1498-1500)TCA>TCT		SH3 and PX domains 2B							105.0	94.0	98.0					5																	171766609		2203	4300	6503	SO:0001819	synonymous_variant	285590				adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding	g.chr5:171766609T>A	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1500A>T	5.37:g.171766609T>A							p.S500S	NM_001017995	NP_001017995	A1X283	SPD2B_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		13	1671	-	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	500					B6F0V2|Q9P2Q1	Silent	SNP	ENST00000311601.5	37	c.1500A>T	CCDS34291.1																																																																																				0.592	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963		33	156	0	0	0	0.004289	0	33	156				
HK3	3101	broad.mit.edu	37	5	176308746	176308746	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:176308746C>T	ENST00000292432.5	-	17	2431	c.2340G>A	c.(2338-2340)caG>caA	p.Q780Q		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	780	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)	p.Q780Q(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCTGAAGGCGCTGGATCTGCT	0.542																																							uc003mfa.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7						c.(2338-2340)CAG>CAA		hexokinase 3							128.0	133.0	132.0					5																	176308746		2203	4300	6503	SO:0001819	synonymous_variant	3101				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity	g.chr5:176308746C>T		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2340G>A	5.37:g.176308746C>T						HK3_uc003mez.2_Silent_p.Q336Q	p.Q780Q	NM_002115	NP_002106	P52790	HXK3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		17	2432	-	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	780			Catalytic.		Q8N1E7	Silent	SNP	ENST00000292432.5	37	c.2340G>A	CCDS4407.1																																																																																				0.542	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1			33	171	0	0	0	0.003271	0	33	171				
FLT4	2324	broad.mit.edu	37	5	180048156	180048156	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:180048156G>T	ENST00000261937.6	-	14	2195	c.2117C>A	c.(2116-2118)gCg>gAg	p.A706E	FLT4_ENST00000393347.3_Missense_Mutation_p.A706E|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.A706E	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	706	Ig-like C2-type 7.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.A706E(2)|p.A516E(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GATGCTGGGCGCGTGCGCTCC	0.667																																					Colon(97;1075 1466 27033 27547 35871)	Colon(97;1075 1466 27033 27547 35871)	uc003mma.3		NA																	3	Substitution - Missense(3)		lung(3)	lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15						c.(2116-2118)GCG>GAG		fms-related tyrosine kinase 4 isoform 2	Sorafenib(DB00398)|Sunitinib(DB01268)						32.0	32.0	32.0					5																	180048156		2202	4296	6498	SO:0001583	missense	2324	Congenital_Hereditary_Lymphedema			positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity	g.chr5:180048156G>T	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2117C>A	5.37:g.180048156G>T	ENSP00000261937:p.Ala706Glu					FLT4_uc003mlz.3_Missense_Mutation_p.A706E|FLT4_uc003mmb.1_Missense_Mutation_p.A239E|FLT4_uc011dgy.1_Missense_Mutation_p.A706E	p.A706E	NM_002020	NP_002011	P35916	VGFR3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	14	2196	-	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	706			Ig-like C2-type 7.|Extracellular (Potential).		A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	c.2117C>A	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	G	1.350	-0.591689	0.03799	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.65178	-0.14;-0.14;-0.14	4.4	1.7	0.24286	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31702	0.0805	N	0.11427	0.14	0.09310	N	1	B;B;B;B	0.11235	0.004;0.0;0.0;0.0	B;B;B;B	0.14023	0.01;0.007;0.004;0.004	T	0.28332	-1.0047	9	0.02654	T	1	.	2.7248	0.05211	0.6213:0.1517:0.0812:0.1458	.	706;516;706;706	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	E	706;706;706;516	ENSP00000261937:A706E;ENSP00000377016:A706E;ENSP00000426057:A706E	ENSP00000261937:A706E	A	-	2	0	FLT4	179980762	0.018000	0.18449	0.236000	0.24074	0.905000	0.53344	2.591000	0.46163	0.176000	0.19873	-0.672000	0.03802	GCG		0.667	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4			8	58	1	0	2.17888e-05	0.006214	2.56312e-05	8	58				
DUSP22	56940	broad.mit.edu	37	6	348228	348228	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:348228G>A	ENST00000344450.5	+	6	832	c.389G>A	c.(388-390)gGc>gAc	p.G130D	DUSP22_ENST00000605315.1_Missense_Mutation_p.G27D|DUSP22_ENST00000605035.1_Missense_Mutation_p.G27D|DUSP22_ENST00000605863.1_Missense_Mutation_p.G27D|DUSP22_ENST00000604971.1_Missense_Mutation_p.G27D|DUSP22_ENST00000603453.1_Missense_Mutation_p.G27D|DUSP22_ENST00000419235.2_Missense_Mutation_p.G130D	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	130	Tyrosine-protein phosphatase.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.G130D(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		CCCAACGTGGGCTTCCAGAGA	0.572																																							uc003msx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(388-390)GGC>GAC		dual specificity phosphatase 22							127.0	115.0	119.0					6																	348228		2203	4300	6503	SO:0001583	missense	56940				apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr6:348228G>A	AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.389G>A	6.37:g.348228G>A	ENSP00000345281:p.Gly130Asp					DUSP22_uc011dhn.1_Missense_Mutation_p.G130D|DUSP22_uc003msy.1_Missense_Mutation_p.G87D	p.G130D	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)	6	828	+	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)	130			Tyrosine-protein phosphatase.		B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	ENST00000344450.5	37	c.389G>A	CCDS4468.1	.	.	.	.	.	.	.	.	.	.	G	36	5.602667	0.96614	.	.	ENSG00000112679	ENST00000344450	D	0.86366	-2.11	5.82	5.82	0.92795	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.95730	0.8611	H	0.95260	3.645	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96151	0.9108	10	0.72032	D	0.01	.	20.0852	0.97797	0.0:0.0:1.0:0.0	.	130;87;130	Q9NRW4-2;B3KSA8;Q9NRW4	.;.;DUS22_HUMAN	D	130	ENSP00000345281:G130D	ENSP00000345281:G130D	G	+	2	0	DUSP22	293228	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.807000	0.99171	2.752000	0.94435	0.655000	0.94253	GGC		0.572	DUSP22-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000039621.1	NM_020185		12	240	0	0	0	0.00245	0	12	240				
HIST1H1B	3009	broad.mit.edu	37	6	27835222	27835222	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:27835222G>C	ENST00000331442.3	-	1	137	c.86C>G	c.(85-87)gCc>gGc	p.A29G		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	29					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)	p.A29G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						GCCGGCGCCGGCAGCCTTCTT	0.612																																							uc003njx.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|lung(1)	3						c.(85-87)GCC>GGC		histone cluster 1, H1b							30.0	36.0	34.0					6																	27835222		2200	4293	6493	SO:0001583	missense	3009				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27835222G>C	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.86C>G	6.37:g.27835222G>C	ENSP00000330074:p.Ala29Gly						p.A29G	NM_005322	NP_005313	P16401	H15_HUMAN			1	138	-			29					Q14529|Q3MJ42	Missense_Mutation	SNP	ENST00000331442.3	37	c.86C>G	CCDS4635.1	.	.	.	.	.	.	.	.	.	.	G	5.739	0.320795	0.10845	.	.	ENSG00000184357	ENST00000331442	T	0.12774	2.65	4.55	3.67	0.42095	.	0.416500	0.26035	N	0.026735	T	0.02230	0.0069	N	0.08118	0	0.19775	N	0.99996	B	0.02656	0.0	B	0.01281	0.0	T	0.43925	-0.9361	10	0.20046	T	0.44	-5.6354	14.0792	0.64909	0.0:0.1516:0.8484:0.0	.	29	P16401	H15_HUMAN	G	29	ENSP00000330074:A29G	ENSP00000330074:A29G	A	-	2	0	HIST1H1B	27943201	.	.	0.008000	0.14137	0.059000	0.15707	.	.	1.005000	0.39183	0.563000	0.77884	GCC		0.612	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322		8	120	0	0	0	0.004482	0	8	120				
PRRC2A	7916	broad.mit.edu	37	6	31597577	31597577	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:31597577G>T	ENST00000376033.2	+	14	2443	c.2209G>T	c.(2209-2211)Ggt>Tgt	p.G737C	PRRC2A_ENST00000376007.4_Missense_Mutation_p.G737C	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	737	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G737C(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						GCTCCTCCAGGGTCGTCCCCC	0.592																																							uc003nvb.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2209-2211)GGT>TGT		HLA-B associated transcript-2							44.0	47.0	46.0					6																	31597577		2111	4105	6216	SO:0001583	missense	7916					cytoplasm|nucleus	protein binding	g.chr6:31597577G>T	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.2209G>T	6.37:g.31597577G>T	ENSP00000365201:p.Gly737Cys					BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Missense_Mutation_p.G737C	p.G737C	NM_080686	NP_542417	P48634	PRC2A_HUMAN			14	2458	+			737			4 X 57 AA type A repeats.		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	c.2209G>T	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916214	0.52546	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.08193	3.12;3.12	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000018	T	0.20373	0.0490	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00128	-1.2017	10	0.87932	D	0	-13.3682	18.5093	0.90910	0.0:0.0:1.0:0.0	.	737	P48634	PRC2A_HUMAN	C	737;726;737;737	ENSP00000365175:G737C;ENSP00000365201:G737C	ENSP00000365175:G737C	G	+	1	0	PRRC2A	31705556	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.180000	0.65048	2.906000	0.99361	0.655000	0.94253	GGT		0.592	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686		16	99	1	0	4.7546e-09	0.004007	6.41872e-09	16	99				
BAG6	7917	broad.mit.edu	37	6	31612763	31612763	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:31612763C>T	ENST00000375964.6	-	10	1660	c.1347G>A	c.(1345-1347)caG>caA	p.Q449Q	BAG6_ENST00000211379.5_Silent_p.Q443Q|BAG6_ENST00000470875.1_5'Flank|BAG6_ENST00000362049.6_Silent_p.Q443Q|BAG6_ENST00000404765.2_Silent_p.Q443Q|BAG6_ENST00000375976.4_Silent_p.Q443Q|BAG6_ENST00000439687.2_Silent_p.Q443Q	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	449	4 X 29 AA approximate repeats.|Pro-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)	p.Q443Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						GTTCCACACTCTGGTGGGAAA	0.587																																							uc003nvg.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1345-1347)CAG>CAA		HLA-B associated transcript-3 isoform a							164.0	188.0	179.0					6																	31612763		1509	2709	4218	SO:0001819	synonymous_variant	7917				apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding	g.chr6:31612763C>T	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.1347G>A	6.37:g.31612763C>T						BAT3_uc003nvf.3_Silent_p.Q443Q|BAT3_uc003nvh.3_Silent_p.Q443Q|BAT3_uc003nvi.3_Silent_p.Q443Q|BAT3_uc011dnw.1_Silent_p.Q443Q|BAT3_uc011dnx.1_Silent_p.Q443Q|BAT3_uc003nvj.1_Silent_p.Q443Q	p.Q449Q	NM_004639	NP_004630	P46379	BAG6_HUMAN			10	1661	-			449			Pro-rich.|4 X 29 AA approximate repeats.		A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Silent	SNP	ENST00000375964.6	37	c.1347G>A	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	c	9.316	1.056833	0.19907	.	.	ENSG00000204463	ENST00000453833	.	.	.	5.19	4.32	0.51571	.	.	.	.	.	T	0.57403	0.2051	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58584	-0.7611	4	.	.	.	.	12.8744	0.57982	0.0:0.9193:0.0:0.0807	.	.	.	.	K	104	.	.	E	-	1	0	BAG6	31720742	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.444000	0.73452	1.178000	0.42870	-0.161000	0.13427	GAG		0.587	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703		21	360	0	0	0	0.00278	0	21	360				
GRM4	2914	broad.mit.edu	37	6	33995926	33995926	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:33995926G>T	ENST00000538487.2	-	10	3103	c.2660C>A	c.(2659-2661)tCt>tAt	p.S887Y	GRM4_ENST00000455714.2_Missense_Mutation_p.S747Y|GRM4_ENST00000609222.1_Missense_Mutation_p.S754Y|GRM4_ENST00000374181.4_Missense_Mutation_p.S887Y|GRM4_ENST00000374177.3_Missense_Mutation_p.S771Y|GRM4_ENST00000544773.2_Missense_Mutation_p.S718Y|GRM4_ENST00000535756.1_Missense_Mutation_p.S754Y|GRM4_ENST00000545715.1_5'UTR	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	887					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.S887Y(2)|p.S771Y(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GCAGAGCTCAGACTTGGCCTC	0.652																																							uc003oir.3		NA																	3	Substitution - Missense(3)		lung(3)	lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6						c.(2659-2661)TCT>TAT		glutamate receptor, metabotropic 4 precursor	L-Glutamic Acid(DB00142)						51.0	49.0	50.0					6																	33995926		2203	4300	6503	SO:0001583	missense	2914				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:33995926G>T	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.2660C>A	6.37:g.33995926G>T	ENSP00000440556:p.Ser887Tyr					GRM4_uc011dsn.1_Missense_Mutation_p.S840Y|GRM4_uc010jvh.2_Missense_Mutation_p.S887Y|GRM4_uc010jvi.2_Missense_Mutation_p.S579Y|GRM4_uc003oio.2_Missense_Mutation_p.S579Y|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.S747Y|GRM4_uc003oiq.2_Missense_Mutation_p.S754Y|GRM4_uc011dsm.1_Missense_Mutation_p.S718Y	p.S887Y	NM_000841	NP_000832	Q14833	GRM4_HUMAN			9	2830	-			887			Cytoplasmic (Potential).		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	c.2660C>A	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.369057	0.42003	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.88896	-2.43;-2.44;-2.2;-2.22;-2.25;-2.43;-2.26	4.36	4.36	0.52297	.	0.430494	0.22753	N	0.056044	D	0.83418	0.5250	L	0.40543	1.245	0.50467	D	0.999877	P;B;P;P;B	0.49447	0.529;0.239;0.924;0.875;0.444	B;B;P;B;B	0.44811	0.206;0.212;0.461;0.202;0.212	D	0.86817	0.2002	10	0.87932	D	0	.	17.0839	0.86605	0.0:0.0:1.0:0.0	.	840;718;747;887;754	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	Y	887;771;579;754;718;887;747	ENSP00000363296:S887Y;ENSP00000363292:S771Y;ENSP00000445533:S579Y;ENSP00000437925:S754Y;ENSP00000437730:S718Y;ENSP00000440556:S887Y;ENSP00000398456:S747Y	ENSP00000363292:S771Y	S	-	2	0	GRM4	34103904	1.000000	0.71417	0.758000	0.31321	0.202000	0.24057	4.601000	0.61090	2.262000	0.75019	0.478000	0.44815	TCT		0.652	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2			11	56	1	0	1.08611e-07	0.010729	1.38077e-07	11	56				
BRPF3	27154	broad.mit.edu	37	6	36198206	36198206	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:36198206G>T	ENST00000357641.6	+	13	3691	c.3438G>T	c.(3436-3438)caG>caT	p.Q1146H	BRPF3_ENST00000534694.1_Missense_Mutation_p.Q812H|BRPF3_ENST00000534400.1_3'UTR|BRPF3_ENST00000339717.7_Missense_Mutation_p.Q876H|BRPF3_ENST00000543502.1_Missense_Mutation_p.Q876H|BRPF3_ENST00000443324.2_Missense_Mutation_p.Q812H	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	1146	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.Q1146H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						ATTTCAGGCAGTGGCTTCCAA	0.607																																							uc003olv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(3436-3438)CAG>CAT		bromodomain and PHD finger containing, 3							75.0	68.0	70.0					6																	36198206		2203	4300	6503	SO:0001583	missense	27154				histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding	g.chr6:36198206G>T	AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.3438G>T	6.37:g.36198206G>T	ENSP00000350267:p.Gln1146His					BRPF3_uc010jwb.2_Missense_Mutation_p.Q876H|BRPF3_uc011dtj.1_RNA|BRPF3_uc010jwc.2_RNA|BRPF3_uc011dtk.1_Missense_Mutation_p.Q812H|BRPF3_uc010jwd.2_Missense_Mutation_p.Q48H	p.Q1146H	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN			13	3662	+			1146			PWWP.		A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	ENST00000357641.6	37	c.3438G>T	CCDS34437.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.757535	0.89843	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	5.81	4.94	0.65067	PWWP (3);	0.000000	0.85682	D	0.000000	T	0.50939	0.1645	M	0.88377	2.95	0.80722	D	1	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.87578	0.979;0.993;0.998	T	0.58493	-0.7627	10	0.87932	D	0	.	15.1744	0.72899	0.0683:0.0:0.9317:0.0	.	812;876;1146	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	H	1146;876;812;876;812	ENSP00000350267:Q1146H;ENSP00000345419:Q876H;ENSP00000434501:Q812H;ENSP00000445352:Q876H;ENSP00000387368:Q812H	ENSP00000345419:Q876H	Q	+	3	2	BRPF3	36306184	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.809000	0.47971	2.756000	0.94617	0.655000	0.94253	CAG		0.607	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695		12	70	1	0	9.31168e-06	0.001855	1.11152e-05	12	70				
DNAH8	1769	broad.mit.edu	37	6	38843557	38843557	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:38843557C>A	ENST00000359357.3	+	51	7414	c.7160C>A	c.(7159-7161)cCt>cAt	p.P2387H	DNAH8_ENST00000449981.2_Missense_Mutation_p.P2604H|DNAH8_ENST00000441566.1_Missense_Mutation_p.P2351H			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2387					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P2387H(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CCAGAAATACCTAAAGGCTCA	0.368																																							uc003ooe.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(7159-7161)CCT>CAT		dynein, axonemal, heavy polypeptide 8							97.0	96.0	96.0					6																	38843557		2203	4300	6503	SO:0001583	missense	1769							g.chr6:38843557C>A	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7160C>A	6.37:g.38843557C>A	ENSP00000352312:p.Pro2387His						p.P2387H	NM_001371	NP_001362					51	7760	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37	c.7160C>A		.	.	.	.	.	.	.	.	.	.	C	14.28	2.489726	0.44249	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.59224	0.28;0.28;0.28	5.83	4.94	0.65067	.	0.311157	0.31450	N	0.007639	T	0.34337	0.0894	L	0.34521	1.04	0.39330	D	0.9654	B	0.02656	0.0	B	0.06405	0.002	T	0.31641	-0.9936	10	0.72032	D	0.01	.	16.0717	0.80940	0.135:0.865:0.0:0.0	.	2387	Q96JB1	DYH8_HUMAN	H	2592;2592;2387;2351	ENSP00000333363:P2592H;ENSP00000352312:P2387H;ENSP00000402294:P2351H	ENSP00000333363:P2592H	P	+	2	0	DNAH8	38951535	0.005000	0.15991	0.850000	0.33497	0.973000	0.67179	1.101000	0.31037	1.415000	0.47037	0.655000	0.94253	CCT		0.368	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		15	61	1	0	3.27435e-08	0.00245	4.29759e-08	15	61				
CUL7	9820	broad.mit.edu	37	6	43020118	43020118	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:43020118G>C	ENST00000265348.3	-	2	494	c.409C>G	c.(409-411)Cta>Gta	p.L137V	CUL7_ENST00000535468.1_Missense_Mutation_p.L189V			Q14999	CUL7_HUMAN	cullin 7	137					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.L137V(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GTGTGAAGTAGAGGAGCAGGA	0.557																																							uc003otq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|kidney(1)	4						c.(409-411)CTA>GTA		cullin 7							84.0	67.0	73.0					6																	43020118		2203	4300	6503	SO:0001583	missense	9820				interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding	g.chr6:43020118G>C	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.409C>G	6.37:g.43020118G>C	ENSP00000265348:p.Leu137Val					CUL7_uc011dvb.1_Missense_Mutation_p.L189V|CUL7_uc010jyh.2_Intron|KLC4_uc003otr.1_Intron	p.L137V	NM_014780	NP_055595	Q14999	CUL7_HUMAN	all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)		2	712	-			137					B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	c.409C>G	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	G	7.409	0.634268	0.14322	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.64618	-0.11;0.01	5.51	2.57	0.30868	Armadillo-like helical (1);	0.168552	0.42682	D	0.000673	T	0.11110	0.0271	N	0.02247	-0.625	0.80722	D	1	B;B	0.31459	0.2;0.324	B;B	0.27076	0.069;0.076	T	0.04961	-1.0915	10	0.17369	T	0.5	-17.8779	2.4845	0.04595	0.1584:0.1944:0.4616:0.1857	.	189;137	F5H0L1;Q14999	.;CUL7_HUMAN	V	137;189	ENSP00000265348:L137V;ENSP00000438788:L189V	ENSP00000265348:L137V	L	-	1	2	CUL7	43128096	0.942000	0.31987	0.999000	0.59377	0.964000	0.63967	0.421000	0.21280	0.698000	0.31739	0.561000	0.74099	CTA		0.557	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780		12	73	0	0	0	0.010729	0	12	73				
GPR116	221395	broad.mit.edu	37	6	46826344	46826344	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:46826344C>A	ENST00000283296.7	-	17	3584	c.3296G>T	c.(3295-3297)aGc>aTc	p.S1099I	GPR116_ENST00000545669.1_Missense_Mutation_p.S528I|GPR116_ENST00000456426.2_Missense_Mutation_p.S957I|GPR116_ENST00000362015.4_Missense_Mutation_p.S1099I|GPR116_ENST00000265417.7_Missense_Mutation_p.S1099I	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	1099					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S1099I(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			GAAGAAGACGCTGAGGTAGAA	0.512																																					NSCLC(59;410 1274 8751 36715 50546)	NSCLC(59;410 1274 8751 36715 50546)	uc003oyo.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(3295-3297)AGC>ATC		G-protein coupled receptor 116 precursor							54.0	55.0	55.0					6																	46826344		2203	4300	6503	SO:0001583	missense	221395				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:46826344C>A	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.3296G>T	6.37:g.46826344C>A	ENSP00000283296:p.Ser1099Ile					GPR116_uc011dwj.1_Missense_Mutation_p.S654I|GPR116_uc011dwk.1_Missense_Mutation_p.S528I|GPR116_uc003oyp.3_Missense_Mutation_p.S957I|GPR116_uc003oyq.3_Missense_Mutation_p.S1099I|GPR116_uc010jzi.1_Missense_Mutation_p.S771I	p.S1099I	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	Lung(136;0.192)		17	3585	-			1099			Helical; Name=3; (Potential).		O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	37	c.3296G>T	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243960	0.58995	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17	5.16	4.29	0.51040	GPCR, family 2-like (1);	0.163224	0.43416	D	0.000578	T	0.45617	0.1351	M	0.82132	2.575	0.22240	N	0.999269	P;D;D;D;D	0.71674	0.936;0.996;0.998;0.995;0.998	P;D;D;D;D	0.73708	0.758;0.979;0.959;0.981;0.959	T	0.42949	-0.9421	10	0.72032	D	0.01	-13.4132	9.1252	0.36810	0.1448:0.7808:0.0:0.0744	.	528;654;1099;957;1099	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	I	1099;1099;1099;957;470;1099;528	ENSP00000283296:S1099I;ENSP00000354563:S1099I;ENSP00000412866:S957I;ENSP00000265417:S1099I;ENSP00000441581:S528I	ENSP00000265417:S1099I	S	-	2	0	GPR116	46934303	0.992000	0.36948	0.783000	0.31826	0.902000	0.53008	5.397000	0.66302	1.303000	0.44873	0.650000	0.86243	AGC		0.512	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234		5	45	1	0	0.00116845	0.001168	0.00126917	5	45				
TNFRSF21	27242	broad.mit.edu	37	6	47251938	47251938	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:47251938G>C	ENST00000296861.2	-	3	1372	c.979C>G	c.(979-981)Ccc>Gcc	p.P327A		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	327					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)		p.P327A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			CCCTTGATGGGCGTGCTGGAC	0.552																																							uc003oyv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(979-981)CCC>GCC		tumor necrosis factor receptor superfamily,							185.0	174.0	178.0					6																	47251938		2203	4300	6503	SO:0001583	missense	27242				cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity	g.chr6:47251938G>C	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.979C>G	6.37:g.47251938G>C	ENSP00000296861:p.Pro327Ala						p.P327A	NM_014452	NP_055267	O75509	TNR21_HUMAN	Lung(136;0.189)		3	1412	-			327			Extracellular (Potential).		B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	c.979C>G	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082557	0.36758	.	.	ENSG00000146072	ENST00000296861	T	0.62941	-0.01	5.91	4.09	0.47781	.	0.444016	0.27735	N	0.018080	T	0.34629	0.0904	L	0.29908	0.895	0.36797	D	0.885137	B	0.09022	0.002	B	0.09377	0.004	T	0.08289	-1.0729	10	0.35671	T	0.21	.	16.3554	0.83234	0.0:0.2725:0.7275:0.0	.	327	O75509	TNR21_HUMAN	A	327	ENSP00000296861:P327A	ENSP00000296861:P327A	P	-	1	0	TNFRSF21	47359897	0.997000	0.39634	0.965000	0.40720	0.998000	0.95712	2.657000	0.46724	0.792000	0.33850	0.655000	0.94253	CCC		0.552	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452		30	243	0	0	0	0.009535	0	30	243				
GCM1	8521	broad.mit.edu	37	6	52993667	52993667	+	Silent	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:52993667A>T	ENST00000259803.7	-	6	859	c.648T>A	c.(646-648)ggT>ggA	p.G216G	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	216					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.G216G(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					CACTGTAACTACCAGGCAATT	0.438																																							uc003pbp.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(646-648)GGT>GGA		glial cells missing homolog a							96.0	94.0	94.0					6																	52993667		2203	4300	6503	SO:0001819	synonymous_variant	8521					transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr6:52993667A>T	D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.648T>A	6.37:g.52993667A>T							p.G216G	NM_003643	NP_003634	Q9NP62	GCM1_HUMAN			6	857	-	Lung NSC(77;0.0755)		216					Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Silent	SNP	ENST00000259803.7	37	c.648T>A	CCDS4950.1																																																																																				0.438	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1			29	148	0	0	0	0.008361	0	29	148				
BMP5	653	broad.mit.edu	37	6	55638990	55638990	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:55638990T>C	ENST00000370830.3	-	4	1582	c.884A>G	c.(883-885)cAg>cGg	p.Q295R	BMP5_ENST00000446683.2_Missense_Mutation_p.Q295R	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	295					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)	p.Q295R(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			TTGTTTTGACTGAGGTCCCTG	0.418																																							uc003pcq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(883-885)CAG>CGG		bone morphogenetic protein 5 preproprotein							199.0	178.0	185.0					6																	55638990		2203	4300	6503	SO:0001583	missense	653				cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity	g.chr6:55638990T>C		CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.884A>G	6.37:g.55638990T>C	ENSP00000359866:p.Gln295Arg					BMP5_uc011dxf.1_Missense_Mutation_p.Q295R	p.Q295R	NM_021073	NP_066551	P22003	BMP5_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)		4	1596	-	Lung NSC(77;0.0462)		295					B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	37	c.884A>G	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	T	10.60	1.394608	0.25205	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	T;T	0.64991	-0.13;-0.13	5.74	5.74	0.90152	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.34687	0.0906	N	0.25332	0.735	0.80722	D	1	B;B	0.32324	0.364;0.364	B;B	0.37943	0.188;0.261	T	0.34153	-0.9840	10	0.07644	T	0.81	.	16.0486	0.80740	0.0:0.0:0.0:1.0	.	295;295	B4E0Y4;P22003	.;BMP5_HUMAN	R	295	ENSP00000359866:Q295R;ENSP00000391818:Q295R	ENSP00000359866:Q295R	Q	-	2	0	BMP5	55746949	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.850000	0.69473	2.183000	0.69458	0.533000	0.62120	CAG		0.418	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1			18	101	0	0	0	0.007413	0	18	101				
BAI3	577	broad.mit.edu	37	6	70034795	70034795	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:70034795A>T	ENST00000370598.1	+	21	3667	c.2846A>T	c.(2845-2847)cAc>cTc	p.H949L	BAI3_ENST00000238918.8_Missense_Mutation_p.H155L	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	949					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.H949R(1)|p.H949L(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GCATTTTTGCACTTTTTCTTC	0.423																																							uc003pev.3		NA																	2	Substitution - Missense(2)		prostate(1)|lung(1)	lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(2845-2847)CAC>CTC		brain-specific angiogenesis inhibitor 3							153.0	140.0	145.0					6																	70034795		2203	4300	6503	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:70034795A>T	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2846A>T	6.37:g.70034795A>T	ENSP00000359630:p.His949Leu					BAI3_uc010kak.2_Missense_Mutation_p.H949L|BAI3_uc011dxx.1_Missense_Mutation_p.H155L|BAI3_uc003pex.1_Missense_Mutation_p.H79L	p.H949L	NM_001704	NP_001695	O60242	BAI3_HUMAN			21	3294	+		all_lung(197;0.212)	949			Helical; Name=3; (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.2846A>T	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	A	31	5.081662	0.94050	.	.	ENSG00000135298	ENST00000370598;ENST00000238918	T;T	0.49432	0.78;0.78	6.07	6.07	0.98685	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.75852	0.3906	H	0.96239	3.79	0.80722	D	1	D;D;D	0.89917	0.997;0.968;1.0	D;D;D	0.91635	0.995;0.969;0.999	D	0.84319	0.0515	10	0.87932	D	0	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	155;949;949	B7Z356;A8K0Y1;O60242	.;.;BAI3_HUMAN	L	949;155	ENSP00000359630:H949L;ENSP00000238918:H155L	ENSP00000238918:H155L	H	+	2	0	BAI3	70091516	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.307000	0.96226	2.326000	0.78906	0.533000	0.62120	CAC		0.423	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			19	85	0	0	0	0.010504	0	19	85				
FUT9	10690	broad.mit.edu	37	6	96651063	96651063	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:96651063C>A	ENST00000302103.5	+	3	358	c.32C>A	c.(31-33)cCa>cAa	p.P11Q		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	11					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)	p.P11Q(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		ATTCTTCGCCCATTTTTAATT	0.403																																					Melanoma(98;1369 1476 6592 22940 26587)	Melanoma(98;1369 1476 6592 22940 26587)	uc003pop.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(1)	5						c.(31-33)CCA>CAA		fucosyltransferase 9 (alpha (1,3)							91.0	94.0	93.0					6																	96651063		2202	4300	6502	SO:0001583	missense	10690				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity	g.chr6:96651063C>A	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.32C>A	6.37:g.96651063C>A	ENSP00000302599:p.Pro11Gln						p.P11Q	NM_006581	NP_006572	Q9Y231	FUT9_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.08)	3	373	+		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)	11			Cytoplasmic (Potential).		Q5T0W4	Missense_Mutation	SNP	ENST00000302103.5	37	c.32C>A	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512117	0.44660	.	.	ENSG00000172461	ENST00000302103	T	0.22743	1.94	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.18425	0.0442	M	0.78916	2.43	0.80722	D	1	P	0.36027	0.533	B	0.34452	0.183	T	0.02617	-1.1133	10	0.29301	T	0.29	-11.1112	18.9098	0.92479	0.0:1.0:0.0:0.0	.	11	Q9Y231	FUT9_HUMAN	Q	11	ENSP00000302599:P11Q	ENSP00000302599:P11Q	P	+	2	0	FUT9	96757784	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.438000	0.80431	2.780000	0.95670	0.655000	0.94253	CCA		0.403	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581		9	151	1	0	1.12685e-05	0.004482	1.34228e-05	9	151				
SLC22A16	85413	broad.mit.edu	37	6	110763908	110763908	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:110763908C>A	ENST00000368919.3	-	4	788	c.722G>T	c.(721-723)tGg>tTg	p.W241L	SLC22A16_ENST00000456137.2_3'UTR|RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000439654.1_Missense_Mutation_p.W241L|SLC22A16_ENST00000330550.4_Missense_Mutation_p.W207L	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	241					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)	p.W241L(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	GACAGACGCCCATGTCCGAGA	0.453																																							uc003puf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(721-723)TGG>TTG		solute carrier family 22, member 16							83.0	80.0	81.0					6																	110763908		2203	4300	6503	SO:0001583	missense	85413				acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity	g.chr6:110763908C>A		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.722G>T	6.37:g.110763908C>A	ENSP00000357915:p.Trp241Leu					SLC22A16_uc003pue.2_Missense_Mutation_p.W222L	p.W241L	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	4	789	-		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)	241					O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	ENST00000368919.3	37	c.722G>T	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.545366	0.45280	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654;ENST00000434949;ENST00000437378	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	4.74	3.84	0.44239	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.122110	0.64402	D	0.000012	T	0.43787	0.1263	N	0.25485	0.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.33701	-0.9858	10	0.14252	T	0.57	.	14.572	0.68218	0.0:0.8525:0.1475:0.0	.	241;207	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	L	241;158;207;241;71;198	ENSP00000357915:W241L;ENSP00000395642:W158L;ENSP00000328583:W207L;ENSP00000408799:W241L;ENSP00000409306:W71L;ENSP00000416310:W198L	ENSP00000328583:W207L	W	-	2	0	SLC22A16	110870601	1.000000	0.71417	0.131000	0.22000	0.026000	0.11368	5.388000	0.66249	0.917000	0.36895	0.655000	0.94253	TGG		0.453	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125		20	79	1	0	4.35082e-09	0.010504	5.90171e-09	20	79				
AKAP12	9590	broad.mit.edu	37	6	151669913	151669913	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:151669913G>A	ENST00000253332.1	+	3	576	c.387G>A	c.(385-387)gcG>gcA	p.A129A	AKAP12_ENST00000354675.6_Silent_p.A31A|snoU13_ENST00000458767.1_RNA|AKAP12_ENST00000359755.5_Silent_p.A24A|AKAP12_ENST00000402676.2_Silent_p.A129A|AKAP12_ENST00000490177.1_3'UTR			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	129					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.A129A(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CTAAGTCAGCGGTTGTTCACG	0.468																																					Melanoma(141;1616 1805 10049 24534 51979)	Melanoma(141;1616 1805 10049 24534 51979)	uc011eep.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8						c.(385-387)GCG>GCA		A kinase (PRKA) anchor protein 12 isoform 1							67.0	63.0	64.0					6																	151669913		2203	4300	6503	SO:0001819	synonymous_variant	9590				G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding	g.chr6:151669913G>A	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.387G>A	6.37:g.151669913G>A						AKAP12_uc003qoe.2_Silent_p.A129A|AKAP12_uc003qof.2_Silent_p.A31A|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Silent_p.A24A	p.A129A	NM_005100	NP_005091	Q02952	AKA12_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)	4	627	+		Ovarian(120;0.125)	129					O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	37	c.387G>A	CCDS5229.1																																																																																				0.468	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1			8	86	0	0	0	0.006214	0	8	86				
TMEM181	57583	broad.mit.edu	37	6	159028287	159028287	+	Silent	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:159028287G>C	ENST00000367090.3	+	8	1007	c.996G>C	c.(994-996)gcG>gcC	p.A332A		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	332					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)	p.A332A(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		GCCTGTTTGCGCATTCCCTCC	0.532																																							uc003qrm.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(994-996)GCG>GCC		G protein-coupled receptor 178							99.0	108.0	105.0					6																	159028287		2034	4183	6217	SO:0001819	synonymous_variant	57583				pathogenesis	integral to membrane	toxin binding	g.chr6:159028287G>C	AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.996G>C	6.37:g.159028287G>C						TMEM181_uc010kjr.1_Silent_p.A163A	p.A332A	NM_020823	NP_065874	Q9P2C4	TM181_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)	8	1007	+		Breast(66;0.000776)|Ovarian(120;0.0303)	332			Helical; (Potential).		Q5VTU1	Silent	SNP	ENST00000367090.3	37	c.996G>C	CCDS43520.1																																																																																				0.532	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042873.1	NM_020823		14	87	0	0	0	0.003163	0	14	87				
SLC22A3	6581	broad.mit.edu	37	6	160864687	160864687	+	Missense_Mutation	SNP	G	G	T	rs9365165	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:160864687G>T	ENST00000275300.2	+	9	1575	c.1423G>T	c.(1423-1425)Ggt>Tgt	p.G475C	SLC22A3_ENST00000392145.1_Missense_Mutation_p.G476C	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	475					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)	p.G475C(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	GCTCTGTTCAGGTCTGTGTGA	0.388																																							uc003qti.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1423-1425)GGT>TGT		solute carrier family 22 member 3							124.0	112.0	116.0					6																	160864687		2203	4300	6503	SO:0001583	missense	6581					integral to plasma membrane|membrane fraction	protein binding|quaternary ammonium group transmembrane transporter activity	g.chr6:160864687G>T	AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.1423G>T	6.37:g.160864687G>T	ENSP00000275300:p.Gly475Cys					SLC22A3_uc011efx.1_RNA	p.G475C	NM_021977	NP_068812	O75751	S22A3_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	9	1450	+		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)	475			Helical; (Potential).		Q5SYN6|Q9UP02	Missense_Mutation	SNP	ENST00000275300.2	37	c.1423G>T	CCDS5277.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278753	0.40294	.	.	ENSG00000146477	ENST00000275300;ENST00000392145	T;T	0.58358	0.34;0.34	5.46	5.46	0.80206	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.240655	0.37483	N	0.002074	T	0.40719	0.1128	N	0.14661	0.345	0.39283	D	0.96459	D	0.58970	0.984	P	0.61275	0.886	T	0.41805	-0.9488	10	0.41790	T	0.15	.	11.664	0.51363	0.0888:0.0:0.9112:0.0	.	475	O75751	S22A3_HUMAN	C	475;476	ENSP00000275300:G475C;ENSP00000375989:G476C	ENSP00000275300:G475C	G	+	1	0	SLC22A3	160784677	0.997000	0.39634	0.410000	0.26471	0.760000	0.43138	3.023000	0.49666	2.724000	0.93272	0.462000	0.41574	GGT		0.388	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042953.1	NM_021977		8	88	1	0	2.74318e-10	0.006214	3.86911e-10	8	88				
PDCD2	5134	broad.mit.edu	37	6	170887973	170887973	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr6:170887973C>G	ENST00000541970.1	-	5	926	c.848G>C	c.(847-849)tGt>tCt	p.C283S	PDCD2_ENST00000542896.1_Missense_Mutation_p.C283S|PDCD2_ENST00000392090.2_Missense_Mutation_p.C250S	NM_001199462.1|NM_002598.3	NP_001186391.1|NP_002589.2	Q16342	PDCD2_HUMAN	programmed cell death 2	283					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)	p.C283S(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(5)	9		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|BRCA - Breast invasive adenocarcinoma(81;4.82e-06)|GBM - Glioblastoma multiforme(31;0.142)		CTTGGCACCACAGGGGCAATC	0.363																																					Colon(60;1476 1726 39478)	Colon(60;1476 1726 39478)	uc003qxw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(847-849)TGT>TCT		programmed cell death 2 isoform 1							117.0	116.0	116.0					6																	170887973		2203	4300	6503	SO:0001583	missense	5134				apoptosis	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:170887973C>G	AJ420535	CCDS5316.1, CCDS47521.1, CCDS56460.1, CCDS56461.1, CCDS56462.1, CCDS75557.1	6q27	2008-02-05			ENSG00000071994	ENSG00000071994		"""Zinc fingers, MYND-type"""	8762	protein-coding gene	gene with protein product		600866				7606924	Standard	NM_002598		Approved	ZMYND7, RP8	uc003qxw.3	Q16342	OTTHUMG00000016083	ENST00000541970.1:c.848G>C	6.37:g.170887973C>G	ENSP00000439467:p.Cys283Ser					PDCD2_uc003qxv.2_Missense_Mutation_p.C250S|PDCD2_uc003qxx.1_Missense_Mutation_p.C283S	p.C283S	NM_002598	NP_002589	Q16342	PDCD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|BRCA - Breast invasive adenocarcinoma(81;4.82e-06)|GBM - Glioblastoma multiforme(31;0.142)	5	927	-		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)	283					E9PCU7|F5GYS7|Q58HM9|Q58HN0|Q9UH12	Missense_Mutation	SNP	ENST00000541970.1	37	c.848G>C	CCDS5316.1	.	.	.	.	.	.	.	.	.	.	C	32	5.171784	0.94807	.	.	ENSG00000071994	ENST00000541970;ENST00000392090;ENST00000542896	.	.	.	5.38	5.38	0.77491	Programmed cell death protein 2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85522	0.5716	M	0.93898	3.47	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.89059	0.3461	8	.	.	.	-12.5981	19.1645	0.93548	0.0:1.0:0.0:0.0	.	283;283;250	F5H4V9;Q16342;Q58HN0	.;PDCD2_HUMAN;.	S	283;250;283	.	.	C	-	2	0	PDCD2	170729898	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.220000	0.78008	2.532000	0.85374	0.650000	0.86243	TGT		0.363	PDCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043269.2	NM_002598		6	108	0	0	0	0.00308	0	6	108				
MIOS	54468	broad.mit.edu	37	7	7613232	7613232	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:7613232G>C	ENST00000340080.4	+	4	1547	c.1126G>C	c.(1126-1128)Gaa>Caa	p.E376Q	MIOS_ENST00000405785.1_Missense_Mutation_p.E376Q	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	376						lysosomal membrane (GO:0005765)		p.E376Q(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCATTTATATGAATGTACGGA	0.393																																							uc003srf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1126-1128)GAA>CAA		missing oocyte, meiosis regulator, homolog							82.0	79.0	80.0					7																	7613232		1840	4087	5927	SO:0001583	missense	54468							g.chr7:7613232G>C		CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.1126G>C	7.37:g.7613232G>C	ENSP00000339881:p.Glu376Gln					MIOS_uc010ktp.1_Missense_Mutation_p.E376Q	p.E376Q	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN			4	1434	+			376					B2RTV6|O75216|Q7L551|Q9H092	Missense_Mutation	SNP	ENST00000340080.4	37	c.1126G>C	CCDS43554.1	.	.	.	.	.	.	.	.	.	.	G	7.031	0.560556	0.13498	.	.	ENSG00000164654	ENST00000340080;ENST00000405785	T;T	0.46451	0.87;0.87	5.49	5.49	0.81192	.	0.111782	0.64402	D	0.000012	T	0.32496	0.0831	N	0.22421	0.69	0.58432	D	0.999994	B	0.14012	0.009	B	0.11329	0.006	T	0.08452	-1.0721	10	0.17832	T	0.49	-27.6122	19.7592	0.96308	0.0:0.0:1.0:0.0	.	376	Q9NXC5	MIO_HUMAN	Q	376	ENSP00000339881:E376Q;ENSP00000384088:E376Q	ENSP00000339881:E376Q	E	+	1	0	MIOS	7579757	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.275000	0.65575	2.736000	0.93811	0.650000	0.86243	GAA		0.393	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326218.1	NM_019005		22	130	0	0	0	0.012319	0	22	130				
HOXA3	3200	broad.mit.edu	37	7	27149789	27149789	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:27149789G>T	ENST00000396352.4	-	2	670	c.471C>A	c.(469-471)ccC>ccA	p.P157P	HOXA3_ENST00000521401.1_5'Flank|HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000317201.2_Silent_p.P157P	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	157					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P157P(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						CTTTCATCCAGGGGAAGATTT	0.572																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	Esophageal Squamous(136;1368 1743 5685 7935 50360)	uc011jzl.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(469-471)CCC>CCA		homeobox A3 isoform a							112.0	113.0	112.0					7																	27149789		2203	4300	6503	SO:0001819	synonymous_variant	3200				angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27149789G>T		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.471C>A	7.37:g.27149789G>T						HOXA3_uc011jzk.1_Translation_Start_Site|HOXA3_uc003syk.2_Silent_p.P157P	p.P157P	NM_030661	NP_109377	O43365	HXA3_HUMAN			2	671	-			157			Antp-type hexapeptide.		A4D181	Silent	SNP	ENST00000396352.4	37	c.471C>A	CCDS5404.1																																																																																				0.572	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2			23	188	1	0	5.60225e-13	0.009535	8.58507e-13	23	188				
GLI3	2737	broad.mit.edu	37	7	42088288	42088288	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:42088288C>A	ENST00000395925.3	-	5	565	c.481G>T	c.(481-483)Gcc>Tcc	p.A161S	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	161					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A161S(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CTAGATAAGGCGGAAGTCCTG	0.498									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																														uc011kbh.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						c.(481-483)GCC>TCC		GLI-Kruppel family member GLI3							60.0	63.0	62.0					7																	42088288		2203	4300	6503	SO:0001583	missense	2737	Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome	Familial Cancer Database	;	negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:42088288C>A		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.481G>T	7.37:g.42088288C>A	ENSP00000379258:p.Ala161Ser					GLI3_uc011kbg.1_Missense_Mutation_p.A102S	p.A161S	NM_000168	NP_000159	P10071	GLI3_HUMAN			5	572	-			161					A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	c.481G>T	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059114	0.55325	.	.	ENSG00000106571	ENST00000395925;ENST00000448703	T;T	0.70516	-0.49;-0.49	5.55	4.61	0.57282	.	0.208186	0.49305	D	0.000153	T	0.67335	0.2882	L	0.55481	1.735	0.80722	D	1	B	0.23854	0.092	B	0.21708	0.036	T	0.67158	-0.5741	10	0.56958	D	0.05	.	16.2165	0.82231	0.0:0.8672:0.1328:0.0	.	161	P10071	GLI3_HUMAN	S	161	ENSP00000379258:A161S;ENSP00000406135:A161S	ENSP00000379258:A161S	A	-	1	0	GLI3	42054813	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	3.252000	0.51461	2.785000	0.95823	0.591000	0.81541	GCC		0.498	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168		10	42	1	0	2.17888e-05	0.006214	2.56312e-05	10	42				
ADCY1	107	broad.mit.edu	37	7	45744158	45744158	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:45744158G>T	ENST00000297323.7	+	17	2782	c.2760G>T	c.(2758-2760)aaG>aaT	p.K920N		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	920					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.K920N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AGAAGATCAAGACCATCGGGA	0.502																																							uc003tne.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(2758-2760)AAG>AAT		adenylate cyclase 1	Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						79.0	82.0	81.0					7																	45744158		2203	4300	6503	SO:0001583	missense	107				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding	g.chr7:45744158G>T	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.2760G>T	7.37:g.45744158G>T	ENSP00000297323:p.Lys920Asn						p.K920N	NM_021116	NP_066939	Q08828	ADCY1_HUMAN			17	2778	+			920			Cytoplasmic (Potential).		A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	c.2760G>T	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550871	0.65311	.	.	ENSG00000164742	ENST00000297323;ENST00000545300	D	0.85861	-2.04	5.19	3.3	0.37823	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.94837	0.8332	H	0.98901	4.365	0.49915	D	0.999834	D	0.89917	1.0	D	0.91635	0.999	D	0.94056	0.7322	10	0.87932	D	0	.	9.1431	0.36917	0.1887:0.0:0.8113:0.0	.	920	Q08828	ADCY1_HUMAN	N	920	ENSP00000297323:K920N	ENSP00000297323:K920N	K	+	3	2	ADCY1	45710683	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.746000	0.38288	0.809000	0.34255	-0.345000	0.07892	AAG		0.502	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116		27	170	1	0	1.74807e-11	0.010818	2.56112e-11	27	170				
IGFBP3	3486	broad.mit.edu	37	7	45957004	45957004	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:45957004G>T	ENST00000275521.6	-	2	571	c.438C>A	c.(436-438)gcC>gcA	p.A146A	IGFBP3_ENST00000381083.4_Silent_p.A152A|IGFBP3_ENST00000465642.1_5'UTR|IGFBP3_ENST00000381086.5_Silent_p.A49A	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	146	Ser/Thr-rich.				apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)	p.A146A(1)		large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	CCACACTGCCGGCGCTGCGGT	0.498											OREG0018049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003tns.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|lung(1)	3						c.(436-438)GCC>GCA		insulin-like growth factor binding protein 3	Mecasermin(DB01277)						55.0	55.0	55.0					7																	45957004		2203	4300	6503	SO:0001819	synonymous_variant	3486				negative regulation of protein phosphorylation|negative regulation of signal transduction|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of apoptosis|positive regulation of myoblast differentiation|protein phosphorylation|regulation of cell growth	nucleus	insulin-like growth factor I binding|metal ion binding|protein tyrosine phosphatase activator activity	g.chr7:45957004G>T		CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.438C>A	7.37:g.45957004G>T			OREG0018049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	935	IGFBP3_uc003tnq.2_RNA|IGFBP3_uc003tnr.2_Silent_p.A152A|IGFBP3_uc003tnt.2_Silent_p.A49A	p.A146A	NM_000598	NP_000589	P17936	IBP3_HUMAN			2	570	-			146			Ser/Thr-rich.		A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Silent	SNP	ENST00000275521.6	37	c.438C>A	CCDS5505.1																																																																																				0.498	IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251356.3	NM_001013398		18	109	1	0	2.94398e-08	0.007413	3.891e-08	18	109				
PKD1L1	168507	broad.mit.edu	37	7	47897406	47897406	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:47897406T>A	ENST00000289672.2	-	28	4437	c.4387A>T	c.(4387-4389)Agc>Tgc	p.S1463C		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1463	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.S1463C(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TGCCCAGTGCTAACATGGTTC	0.478																																							uc003tny.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(4387-4389)AGC>TGC		polycystin-1L1							53.0	53.0	53.0					7																	47897406		2203	4300	6503	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47897406T>A	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.4387A>T	7.37:g.47897406T>A	ENSP00000289672:p.Ser1463Cys						p.S1463C	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN			28	4387	-			1463			Extracellular (Potential).|REJ.		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.4387A>T	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.812281	0.70912	.	.	ENSG00000158683	ENST00000289672	T	0.25912	1.77	5.12	-1.65	0.08291	Egg jelly receptor, REJ-like (1);	0.586313	0.16916	N	0.194317	T	0.36193	0.0958	M	0.62723	1.935	0.09310	N	1	D	0.76494	0.999	D	0.64042	0.921	T	0.15407	-1.0438	10	0.59425	D	0.04	-6.091	5.0708	0.14606	0.0:0.2018:0.2744:0.5238	.	1463	Q8TDX9	PK1L1_HUMAN	C	1463	ENSP00000289672:S1463C	ENSP00000289672:S1463C	S	-	1	0	PKD1L1	47863931	0.024000	0.19004	0.000000	0.03702	0.662000	0.39071	0.934000	0.28910	-0.401000	0.07644	0.460000	0.39030	AGC		0.478	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		17	67	0	0	0	0.010504	0	17	67				
FKBP6	8468	broad.mit.edu	37	7	72756806	72756806	+	Splice_Site	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:72756806G>C	ENST00000252037.4	+	8	962		c.e8-1		FKBP6_ENST00000413573.2_Splice_Site|FKBP6_ENST00000431982.2_Splice_Site	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa						cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.?(2)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				TCCCTCTCCAGCTGTTACAGG	0.478											OREG0018106	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003tya.2		NA																	2	Unknown(2)		lung(2)		0						c.e8-1		FK506 binding protein 6 isoform a							129.0	130.0	130.0					7																	72756806		2010	4184	6194	SO:0001630	splice_region_variant	8468				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr7:72756806G>C	AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.894-1G>C	7.37:g.72756806G>C			OREG0018106	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1140	FKBP6_uc003twz.2_Splice_Site_p.S268_splice|FKBP6_uc011kew.1_Splice_Site_p.S293_splice	p.S298_splice	NM_003602	NP_003593	O75344	FKBP6_HUMAN			8	1026	+		Lung NSC(55;0.0908)|all_lung(88;0.198)						B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Splice_Site	SNP	ENST00000252037.4	37	c.894_splice	CCDS43595.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223491	0.58668	.	.	ENSG00000077800	ENST00000431982;ENST00000413573;ENST00000252037	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7747	0.85548	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FKBP6	72394742	1.000000	0.71417	0.558000	0.28319	0.151000	0.21798	7.013000	0.76373	2.816000	0.96949	0.644000	0.83932	.		0.478	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318723.1	NM_003602	Intron	13	298	0	0	0	0.004007	0	13	298				
HIP1	3092	broad.mit.edu	37	7	75189162	75189162	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:75189162C>T	ENST00000336926.6	-	14	1275	c.1249G>A	c.(1249-1251)Gcc>Acc	p.A417T	HIP1_ENST00000434438.2_Missense_Mutation_p.A417T	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	417	pDED.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.A417T(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGCTGCTCGGCCAGATCTGCT	0.672			T	PDGFRB	CMML																																		uc003uds.1		NA		Dom	yes		7	7q11.23	3092	T	huntingtin interacting protein 1			L	PDGFRB		CMML		1	Substitution - Missense(1)		lung(1)	lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						c.(1249-1251)GCC>ACC		huntingtin interacting protein 1							20.0	21.0	21.0					7																	75189162		2203	4298	6501	SO:0001583	missense	3092				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton	g.chr7:75189162C>T	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.1249G>A	7.37:g.75189162C>T	ENSP00000336747:p.Ala417Thr					HIP1_uc011kfz.1_Missense_Mutation_p.A294T	p.A417T	NM_005338	NP_005329	O00291	HIP1_HUMAN			14	1290	-			417			Potential.|pDED.		B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	c.1249G>A	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293278	0.60086	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.15372	2.67;2.43	5.62	5.62	0.85841	.	0.046277	0.85682	D	0.000000	T	0.30696	0.0773	M	0.72479	2.2	0.80722	D	1	D;D	0.53745	0.962;0.96	P;P	0.50490	0.489;0.642	T	0.03296	-1.1051	10	0.16896	T	0.51	-15.2668	18.6492	0.91423	0.0:1.0:0.0:0.0	.	417;417	E7ES17;O00291	.;HIP1_HUMAN	T	417	ENSP00000336747:A417T;ENSP00000410300:A417T	ENSP00000336747:A417T	A	-	1	0	HIP1	75027098	1.000000	0.71417	0.998000	0.56505	0.193000	0.23685	5.847000	0.69451	2.659000	0.90383	0.655000	0.94253	GCC		0.672	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338		3	11	0	0	0	0.001984	0	3	11				
CCDC146	57639	broad.mit.edu	37	7	76891577	76891577	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:76891577G>A	ENST00000285871.4	+	9	1253	c.1126G>A	c.(1126-1128)Gat>Aat	p.D376N	CCDC146_ENST00000431197.1_Missense_Mutation_p.D122N|CCDC146_ENST00000415740.2_3'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	376								p.D376N(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AGTGTCCTGGGATGCACTTAG	0.408																																							uc003uga.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1126-1128)GAT>AAT		coiled-coil domain containing 146							90.0	89.0	89.0					7																	76891577		2203	4300	6503	SO:0001583	missense	57639							g.chr7:76891577G>A	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.1126G>A	7.37:g.76891577G>A	ENSP00000285871:p.Asp376Asn					CCDC146_uc010ldp.2_Missense_Mutation_p.D122N	p.D376N	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN			9	1253	+		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)	376					A8K8X6|Q9P223	Missense_Mutation	SNP	ENST00000285871.4	37	c.1126G>A	CCDS34671.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995534	0.74703	.	.	ENSG00000135205	ENST00000285871;ENST00000431197	T;T	0.51325	0.71;0.71	5.78	5.78	0.91487	.	0.148047	0.64402	D	0.000011	T	0.59649	0.2209	L	0.55481	1.735	0.53005	D	0.99996	D;D	0.60575	0.985;0.988	P;P	0.57324	0.802;0.818	T	0.50482	-0.8823	10	0.23891	T	0.37	-17.5394	18.7832	0.91942	0.0:0.0:1.0:0.0	.	122;376	Q8IYE0-2;Q8IYE0	.;CC146_HUMAN	N	376;122	ENSP00000285871:D376N;ENSP00000413885:D122N	ENSP00000285871:D376N	D	+	1	0	AC007000.1	76729513	1.000000	0.71417	0.227000	0.23927	0.558000	0.35554	6.309000	0.72825	2.744000	0.94065	0.563000	0.77884	GAT		0.408	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879		27	141	0	0	0	0.00632	0	27	141				
HGF	3082	broad.mit.edu	37	7	81335060	81335060	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:81335060G>T	ENST00000222390.5	-	16	1993	c.1767C>A	c.(1765-1767)gtC>gtA	p.V589V	HGF_ENST00000457544.2_Silent_p.V584V	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	589	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)	p.V589V(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						AATCATCCAGGACAGCAGGCC	0.363																																							uc003uhl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(1765-1767)GTC>GTA		hepatocyte growth factor isoform 1							79.0	71.0	73.0					7																	81335060		2203	4300	6503	SO:0001819	synonymous_variant	3082				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity	g.chr7:81335060G>T		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1767C>A	7.37:g.81335060G>T						HGF_uc003uhm.2_Silent_p.V584V	p.V589V	NM_000601	NP_000592	P14210	HGF_HUMAN			16	1932	-			589			Peptidase S1.		A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Silent	SNP	ENST00000222390.5	37	c.1767C>A	CCDS5597.1																																																																																				0.363	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601		8	76	1	0	3.09899e-07	0.004482	3.90472e-07	8	76				
ABCB1	5243	broad.mit.edu	37	7	87144598	87144598	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:87144598G>T	ENST00000265724.3	-	26	3648	c.3231C>A	c.(3229-3231)agC>agA	p.S1077R	ABCB1_ENST00000488737.2_5'UTR|ABCB1_ENST00000543898.1_Missense_Mutation_p.S1013R	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	1077	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)	p.S1077R(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	GGACCACTGTGCTCTTCCCAC	0.572																																							uc003uiz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(3229-3231)AGC>AGA		ATP-binding cassette, subfamily B, member 1	Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)						66.0	61.0	63.0					7																	87144598		2203	4300	6503	SO:0001583	missense	5243				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity	g.chr7:87144598G>T	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.3231C>A	7.37:g.87144598G>T	ENSP00000265724:p.Ser1077Arg					ABCB1_uc011khc.1_Missense_Mutation_p.S1013R	p.S1077R	NM_000927	NP_000918	P08183	MDR1_HUMAN			26	3649	-	Esophageal squamous(14;0.00164)		1077			Cytoplasmic (Potential).|ABC transporter 2.|ATP 2 (By similarity).		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	c.3231C>A	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.747941	0.89663	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.97870	-4.58;-4.58	6.06	5.01	0.66863	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.116215	0.85682	D	0.000000	D	0.99260	0.9742	H	0.98629	4.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.98463	1.0597	10	0.87932	D	0	-16.6208	15.3369	0.74263	0.0775:0.0:0.9225:0.0	.	1013;1077	B5AK60;P08183	.;MDR1_HUMAN	R	858;1077;1013	ENSP00000265724:S1077R;ENSP00000444095:S1013R	ENSP00000265724:S1077R	S	-	3	2	ABCB1	86982534	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.733000	0.68571	2.882000	0.98803	0.655000	0.94253	AGC		0.572	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927		5	44	1	0	1.23904e-05	0.000602	1.47282e-05	5	44				
ABCB1	5243	broad.mit.edu	37	7	87179275	87179275	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:87179275G>T	ENST00000265724.3	-	14	1863	c.1446C>A	c.(1444-1446)acC>acA	p.T482T	ABCB1_ENST00000543898.1_Silent_p.T418T	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	482	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)	p.T482T(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CAGCTATCGTGGTGGCAAACA	0.433																																							uc003uiz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7						c.(1444-1446)ACC>ACA		ATP-binding cassette, subfamily B, member 1	Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)						214.0	194.0	201.0					7																	87179275		2203	4300	6503	SO:0001819	synonymous_variant	5243				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity	g.chr7:87179275G>T	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.1446C>A	7.37:g.87179275G>T						ABCB1_uc011khc.1_Silent_p.T418T	p.T482T	NM_000927	NP_000918	P08183	MDR1_HUMAN			14	1864	-	Esophageal squamous(14;0.00164)		482			ABC transporter 1.|Cytoplasmic (Potential).		A8K294|B5AK60|Q12755|Q14812	Silent	SNP	ENST00000265724.3	37	c.1446C>A	CCDS5608.1																																																																																				0.433	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927		45	240	1	0	5.7616e-29	0.01441	1.03054e-28	45	240				
PON3	5446	broad.mit.edu	37	7	95001637	95001637	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:95001637G>A	ENST00000265627.5	-	4	225	c.215C>T	c.(214-216)cCa>cTa	p.P72L	PON3_ENST00000451904.1_Missense_Mutation_p.P72L|PON1_ENST00000542556.1_Intron|PON3_ENST00000427422.1_Missense_Mutation_p.P72L	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	72					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)	p.P72L(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	TGGCATGCCTGGATATTTTAA	0.348																																							uc003unt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(214-216)CCA>CTA		paraoxonase 3							99.0	94.0	96.0					7																	95001637		2203	4300	6503	SO:0001583	missense	5446				aromatic compound catabolic process|carboxylic acid catabolic process|response to external stimulus	extracellular space	aryldialkylphosphatase activity|arylesterase activity|metal ion binding|protein homodimerization activity	g.chr7:95001637G>A	L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.215C>T	7.37:g.95001637G>A	ENSP00000265627:p.Pro72Leu					PON1_uc011kih.1_Intron|PON3_uc011kii.1_Missense_Mutation_p.P120L	p.P72L	NM_000940	NP_000931	Q15166	PON3_HUMAN	STAD - Stomach adenocarcinoma(171;0.0151)		4	240	-	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		72					A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	ENST00000265627.5	37	c.215C>T	CCDS5639.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.580243	0.65992	.	.	ENSG00000105852	ENST00000265627;ENST00000427422	T;T	0.56444	0.46;0.46	4.82	4.82	0.62117	Six-bladed beta-propeller, TolB-like (1);	0.112865	0.64402	D	0.000010	T	0.69369	0.3103	M	0.63208	1.945	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.72625	0.899;0.978	T	0.66404	-0.5932	10	0.34782	T	0.22	-8.107	18.0823	0.89444	0.0:0.0:1.0:0.0	.	120;72	B4E2I0;Q15166	.;PON3_HUMAN	L	72	ENSP00000265627:P72L;ENSP00000413276:P72L	ENSP00000265627:P72L	P	-	2	0	PON3	94839573	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	4.376000	0.59556	2.694000	0.91930	0.555000	0.69702	CCA		0.348	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333007.1	NM_000940		11	93	0	0	0	0.010729	0	11	93				
SLC12A9	56996	broad.mit.edu	37	7	100454719	100454719	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:100454719C>T	ENST00000354161.3	+	5	803	c.678C>T	c.(676-678)ggC>ggT	p.G226G	SLC12A9_ENST00000540482.1_Silent_p.G226G|SLC12A9_ENST00000428758.1_Silent_p.G226G|SLC12A9_ENST00000415287.1_Silent_p.G137G|SLC12A9_ENST00000275729.3_Silent_p.G137G	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	226					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)	p.G226G(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTAGGCCTGGCCCCAATGGCT	0.627																																							uc003uwp.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(676-678)GGC>GGT		solute carrier family 12 (potassium/chloride							93.0	85.0	88.0					7																	100454719		2203	4300	6503	SO:0001819	synonymous_variant	56996					integral to membrane|plasma membrane	cation:chloride symporter activity	g.chr7:100454719C>T	AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.678C>T	7.37:g.100454719C>T						SLC12A9_uc003uwo.1_Silent_p.G137G|SLC12A9_uc003uwq.2_Silent_p.G137G|SLC12A9_uc011kki.1_Intron|SLC12A9_uc003uwr.2_5'UTR|SLC12A9_uc003uws.2_5'UTR|SLC12A9_uc003uwt.2_5'UTR|SLC12A9_uc003uwv.2_5'Flank	p.G226G	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN			5	820	+	Lung NSC(181;0.041)|all_lung(186;0.0581)		226			Extracellular (Potential).		B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Silent	SNP	ENST00000354161.3	37	c.678C>T	CCDS5707.1																																																																																				0.627	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246		7	150	0	0	0	0.00308	0	7	150				
MUC17	140453	broad.mit.edu	37	7	100680394	100680395	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:100680394_100680395CA>AC	ENST00000306151.4	+	3	5761_5762	c.5697_5698CA>AC	c.(5695-5700)acCAct>acACct	p.T1900P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1900	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T1900P(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACCTGTGACCACTTATGCTCA	0.495																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(5695-5700)ACCACT>ACACCT		mucin 17 precursor																																				SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100680394_100680395CA>AC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	Exception_encountered	7.37:g.100680394_100680395delinsAC	ENSP00000302716:p.Thr1900Pro					MUC17_uc010lho.1_RNA	p.T1900P	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	5750_5751	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1900			Extracellular (Potential).|30.|59 X approximate tandem repeats.|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	DNP	ENST00000306151.4	37	c.5697_5698CA>AC	CCDS34711.1																																																																																				0.495	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		60	446	0	0	0	0.004672	0	60	446				
MUC17	140453	broad.mit.edu	37	7	100683336	100683336	+	Missense_Mutation	SNP	C	C	A	rs142042551	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:100683336C>A	ENST00000306151.4	+	3	8703	c.8639C>A	c.(8638-8640)cCg>cAg	p.P2880Q		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2880	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.P2880Q(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGCACCACGCCGGTGGCCAGT	0.488																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(8638-8640)CCG>CAG		mucin 17 precursor							259.0	271.0	267.0					7																	100683336		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100683336C>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8639C>A	7.37:g.100683336C>A	ENSP00000302716:p.Pro2880Gln					MUC17_uc010lho.1_RNA	p.P2880Q	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	8692	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2880			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|46.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.8639C>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	3.401	-0.122186	0.06795	.	.	ENSG00000169876	ENST00000306151	T	0.03272	3.99	0.478	-0.57	0.11753	.	.	.	.	.	T	0.03348	0.0097	L	0.27053	0.805	0.09310	N	1	D	0.60160	0.987	P	0.48840	0.592	T	0.41378	-0.9512	9	0.12430	T	0.62	.	6.0812	0.19942	0.0:0.6745:0.3255:0.0	.	2880	Q685J3	MUC17_HUMAN	Q	2880	ENSP00000302716:P2880Q	ENSP00000302716:P2880Q	P	+	2	0	MUC17	100470056	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.583000	0.05807	-0.240000	0.09696	-1.421000	0.01109	CCG		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		87	235	1	0	9.24773e-40	0.01441	1.70797e-39	87	235				
MUC17	140453	broad.mit.edu	37	7	100683920	100683920	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:100683920A>T	ENST00000306151.4	+	3	9287	c.9223A>T	c.(9223-9225)Agt>Tgt	p.S3075C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3075	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S3075C(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TGACTCCAACAGTCCTGTGGT	0.473																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(9223-9225)AGT>TGT		mucin 17 precursor							262.0	263.0	263.0					7																	100683920		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100683920A>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9223A>T	7.37:g.100683920A>T	ENSP00000302716:p.Ser3075Cys					MUC17_uc010lho.1_RNA	p.S3075C	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	9276	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3075			Extracellular (Potential).|Ser-rich.|50.|59 X approximate tandem repeats.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.9223A>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	a	5.737	0.320485	0.10845	.	.	ENSG00000169876	ENST00000306151	T	0.02032	4.49	0.902	-0.691	0.11305	.	.	.	.	.	T	0.02230	0.0069	L	0.27053	0.805	0.09310	N	1	D	0.54964	0.969	P	0.47162	0.54	T	0.46638	-0.9177	9	0.56958	D	0.05	.	3.5721	0.07921	0.5809:0.4191:0.0:0.0	.	3075	Q685J3	MUC17_HUMAN	C	3075	ENSP00000302716:S3075C	ENSP00000302716:S3075C	S	+	1	0	MUC17	100470640	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.480000	0.22244	-0.171000	0.10797	0.102000	0.15555	AGT		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		88	210	0	0	0	0.01441	0	88	210				
MUC17	140453	broad.mit.edu	37	7	100685523	100685523	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:100685523C>A	ENST00000306151.4	+	3	10890	c.10826C>A	c.(10825-10827)aCt>aAt	p.T3609N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3609	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T3609N(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTGTGACCACTTCTACTCAG	0.463																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(10825-10827)ACT>AAT		mucin 17 precursor							154.0	145.0	148.0					7																	100685523		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100685523C>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.10826C>A	7.37:g.100685523C>A	ENSP00000302716:p.Thr3609Asn					MUC17_uc010lho.1_RNA	p.T3609N	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	10879	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3609			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|58.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.10826C>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	8.408	0.843571	0.16963	.	.	ENSG00000169876	ENST00000306151	T	0.02890	4.12	1.48	-2.96	0.05547	.	.	.	.	.	T	0.04543	0.0124	N	0.24115	0.695	0.09310	N	1	P	0.51653	0.947	D	0.79108	0.992	T	0.28681	-1.0036	9	0.18276	T	0.48	.	4.4391	0.11564	0.2475:0.5083:0.2442:0.0	.	3609	Q685J3	MUC17_HUMAN	N	3609	ENSP00000302716:T3609N	ENSP00000302716:T3609N	T	+	2	0	MUC17	100472243	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.314000	0.08092	-1.008000	0.03404	0.186000	0.17326	ACT		0.463	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		23	189	1	0	1.04121e-07	0.005443	1.3387e-07	23	189				
IFT22	64792	broad.mit.edu	37	7	100958530	100958530	+	Nonsense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:100958530G>C	ENST00000315322.4	-	5	536	c.443C>G	c.(442-444)tCa>tGa	p.S148*	RABL5_ENST00000437644.2_Nonsense_Mutation_p.S118*|RABL5_ENST00000517481.1_Nonsense_Mutation_p.S71*|RABL5_ENST00000498704.2_Nonsense_Mutation_p.S71*|RABL5_ENST00000495166.1_5'UTR	NM_022777.2	NP_073614.1	Q9H7X7	IFT22_HUMAN		148					small GTPase mediated signal transduction (GO:0007264)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)	GTP binding (GO:0005525)	p.S148*(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7	Lung NSC(181;0.215)					TTCCAGGTTTGAGTGCACCAG	0.443											OREG0018221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003uyl.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(442-444)TCA>TGA		RAB, member RAS oncogene family-like 5 isoform							95.0	89.0	91.0					7																	100958530		2203	4300	6503	SO:0001587	stop_gained	64792						GTP binding	g.chr7:100958530G>C																												ENST00000315322.4:c.443C>G	7.37:g.100958530G>C	ENSP00000320359:p.Ser148*		OREG0018221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1355	RABL5_uc011kkk.1_Nonsense_Mutation_p.S71*|RABL5_uc011kkl.1_Nonsense_Mutation_p.S71*|RABL5_uc003uym.2_Nonsense_Mutation_p.S118*|RABL5_uc010lhw.2_RNA	p.S148*	NM_022777	NP_073614	Q9H7X7	RABL5_HUMAN			5	546	-	Lung NSC(181;0.215)		148					Q49AG1|Q69YV5|Q9BSW4	Nonsense_Mutation	SNP	ENST00000315322.4	37	c.443C>G	CCDS5719.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.949290	0.92660	.	.	ENSG00000128581	ENST00000517481;ENST00000315322;ENST00000498704;ENST00000437644	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-16.6737	16.678	0.85284	0.0:0.0:1.0:0.0	.	.	.	.	X	71;148;71;118	.	ENSP00000320359:S148X	S	-	2	0	RABL5	100745250	1.000000	0.71417	0.950000	0.38849	0.809000	0.45718	9.678000	0.98647	2.525000	0.85131	0.655000	0.94253	TCA		0.443	RABL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347565.1			12	118	0	0	0	0.010729	0	12	118				
PIK3CG	5294	broad.mit.edu	37	7	106509707	106509707	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:106509707C>T	ENST00000359195.3	+	2	2011	c.1701C>T	c.(1699-1701)ctC>ctT	p.L567L	PIK3CG_ENST00000440650.2_Silent_p.L567L|PIK3CG_ENST00000496166.1_Silent_p.L567L	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	567	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L567L(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						TTAACCCTCTCACAGCAGAGG	0.502																																							uc003vdv.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						c.(1699-1701)CTC>CTT		phosphoinositide-3-kinase, catalytic, gamma							69.0	63.0	65.0					7																	106509707		2203	4300	6503	SO:0001819	synonymous_variant	5294				G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding	g.chr7:106509707C>T		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1701C>T	7.37:g.106509707C>T						PIK3CG_uc003vdu.2_Silent_p.L567L|PIK3CG_uc003vdw.2_Silent_p.L567L	p.L567L	NM_002649	NP_002640	P48736	PK3CG_HUMAN			2	1786	+			567					A4D0Q6|Q8IV23|Q9BZC8	Silent	SNP	ENST00000359195.3	37	c.1701C>T	CCDS5739.1																																																																																				0.502	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1			24	90	0	0	0	0.00278	0	24	90				
EIF3IP1	442720	broad.mit.edu	37	7	109599700	109599700	+	IGR	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:109599700T>C								AC073071.1 (362477 upstream) : AC003088.1 (472595 downstream)																							CTCCTTAATATTCACCAACAC	0.488																																							uc003vfp.1		NA																	0					0						c.(397-399)AAT>AGT		Homo sapiens eukaryotic translation initiation factor 3, subunit I pseudogene 1 (EIF3IP1), non-coding RNA.																																				SO:0001628	intergenic_variant	442720							g.chr7:109599700T>C																													7.37:g.109599700T>C							p.N133S	NR_003024						1	571	-									Missense_Mutation	SNP		37	c.398A>G																																																																																				0	0.488									4	71	0	0	0	0.000602	0	4	71				
MET	4233	broad.mit.edu	37	7	116340082	116340082	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:116340082A>G	ENST00000318493.6	+	2	1131	c.944A>G	c.(943-945)aAt>aGt	p.N315S	MET_ENST00000436117.2_Missense_Mutation_p.N315S|MET_ENST00000397752.3_Missense_Mutation_p.N315S			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.N315S(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GAAGTGTTTAATATACTTCAG	0.443			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.(943-945)AAT>AGT		met proto-oncogene isoform b precursor							51.0	50.0	51.0					7																	116340082		1860	4094	5954	SO:0001583	missense	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116340082A>G	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.944A>G	7.37:g.116340082A>G	ENSP00000317272:p.Asn315Ser					MET_uc010lkh.2_Missense_Mutation_p.N315S|MET_uc011knc.1_Missense_Mutation_p.N315S|MET_uc011knd.1_Missense_Mutation_p.N315S|MET_uc011kne.1_Missense_Mutation_p.N315S|MET_uc011knf.1_Missense_Mutation_p.N315S|MET_uc011kng.1_Missense_Mutation_p.N315S|MET_uc011knh.1_Missense_Mutation_p.N315S|MET_uc011kni.1_Missense_Mutation_p.N315S|MET_uc003vii.1_Missense_Mutation_p.N334S|MET_uc010lkg.2_Missense_Mutation_p.N315S|MET_uc011kmz.1_Missense_Mutation_p.N315S|MET_uc011kna.1_Missense_Mutation_p.N315S|MET_uc011knb.1_Missense_Mutation_p.N315S	p.N315S	NM_000245	NP_000236	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		2	1131	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	315			Extracellular (Potential).|Sema.		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	c.944A>G	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	A	18.42	3.621143	0.66787	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.16897	2.31;2.31;2.31	6.04	6.04	0.98038	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.49372	0.1553	M	0.86651	2.83	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.998;0.999;0.999;0.998;0.999;0.999;0.999;0.999;0.998;0.999;0.999;0.998;0.998	T	0.56238	-0.8012	10	0.72032	D	0.01	.	16.5885	0.84745	1.0:0.0:0.0:0.0	.	315;315;315;315;315;315;315;315;315;315;315;315;315	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	S	315	ENSP00000380860:N315S;ENSP00000317272:N315S;ENSP00000410980:N315S	ENSP00000317272:N315S	N	+	2	0	MET	116127318	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.887000	0.92456	2.317000	0.78254	0.460000	0.39030	AAT		0.443	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			12	72	0	0	0	0.010729	0	12	72				
ASB15	142685	broad.mit.edu	37	7	123254559	123254559	+	Start_Codon_SNP	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:123254559G>T	ENST00000451558.1	+	6	524	c.3G>T	c.(1-3)atG>atT	p.M1I	ASB15_ENST00000434204.1_Start_Codon_SNP_p.M1I|ASB15_ENST00000540573.1_Start_Codon_SNP_p.M1I|RP11-390E23.3_ENST00000440504.1_RNA|ASB15_ENST00000451215.1_Start_Codon_SNP_p.M1I|RP11-390E23.3_ENST00000418409.1_RNA|ASB15_ENST00000275699.3_Start_Codon_SNP_p.M1I|RP11-390E23.3_ENST00000422401.1_RNA			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	1					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.M1I(2)		breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						ATGCAGGAATGGATACTAATG	0.348																																							uc003vku.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|lung(1)	3						c.(1-3)ATG>ATT		ankyrin repeat and SOCS box-containing 15							166.0	170.0	169.0					7																	123254559		2203	4300	6503	SO:0001582	initiator_codon_variant	142685				intracellular signal transduction			g.chr7:123254559G>T	AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.3G>T	7.37:g.123254559G>T	ENSP00000397655:p.Met1Ile					ASB15_uc003vkv.1_Missense_Mutation_p.M1I|ASB15_uc003vkw.1_Missense_Mutation_p.M1I	p.M1I	NM_080928	NP_563616	Q8WXK1	ASB15_HUMAN			4	295	+			1					Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	ENST00000451558.1	37	c.3G>T	CCDS34742.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722694	0.68959	.	.	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000437535;ENST00000451215;ENST00000540573;ENST00000447789;ENST00000275699	T;T;T;T;T;T;T	0.67865	-0.26;-0.26;0.84;-0.26;-0.26;-0.29;-0.26	6.04	5.17	0.71159	.	0.080412	0.52532	D	0.000061	T	0.57695	0.2071	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.57400	-0.7818	9	0.87932	D	0	0.1802	9.8627	0.41125	0.07:0.0:0.7915:0.1386	.	1	Q8WXK1	ASB15_HUMAN	I	1	ENSP00000397655:M1I;ENSP00000390963:M1I;ENSP00000406163:M1I;ENSP00000416433:M1I;ENSP00000438643:M1I;ENSP00000401166:M1I;ENSP00000275699:M1I	ENSP00000275699:M1I	M	+	3	0	ASB15	123041795	1.000000	0.71417	0.998000	0.56505	0.613000	0.37349	5.481000	0.66826	1.568000	0.49683	0.563000	0.77884	ATG		0.348	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1		Missense_Mutation	41	199	1	0	3.43241e-23	0.009718	5.96987e-23	41	199				
FLNC	2318	broad.mit.edu	37	7	128477288	128477288	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:128477288G>T	ENST00000325888.8	+	3	937	c.676G>T	c.(676-678)Gac>Tac	p.D226Y	FLNC_ENST00000346177.6_Missense_Mutation_p.D226Y	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	226	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.D226Y(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GCAGCAGGCCGACGACTGGCT	0.672																																							uc003vnz.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(676-678)GAC>TAC		gamma filamin isoform a							10.0	12.0	12.0					7																	128477288		1857	4092	5949	SO:0001583	missense	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128477288G>T	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.676G>T	7.37:g.128477288G>T	ENSP00000327145:p.Asp226Tyr					FLNC_uc003voa.3_Missense_Mutation_p.D226Y	p.D226Y	NM_001458	NP_001449	Q14315	FLNC_HUMAN			3	885	+			226			CH 2.|Actin-binding.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	c.676G>T	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	32	5.182231	0.94885	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	T;T	0.60040	0.22;0.22	6.08	6.08	0.98989	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.79191	0.4404	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.80065	-0.1538	10	0.87932	D	0	.	19.6516	0.95815	0.0:0.0:1.0:0.0	.	226;226	Q14315-2;Q14315	.;FLNC_HUMAN	Y	226	ENSP00000327145:D226Y;ENSP00000344002:D226Y	ENSP00000327145:D226Y	D	+	1	0	FLNC	128264524	1.000000	0.71417	0.723000	0.30687	0.909000	0.53808	9.869000	0.99810	2.894000	0.99253	0.655000	0.94253	GAC		0.672	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			3	11	1	0	1.024e-07	0.000602	1.31956e-07	3	11				
PLXNA4	91584	broad.mit.edu	37	7	131872244	131872244	+	Silent	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:131872244G>T	ENST00000359827.3	-	15	3941	c.2979C>A	c.(2977-2979)ccC>ccA	p.P993P	PLXNA4_ENST00000321063.4_Silent_p.P993P			Q9HCM2	PLXA4_HUMAN	plexin A4	993	IPT/TIG 2.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.P993P(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGAAGAGACAGGGCTGCTTTC	0.547																																							uc003vra.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2977-2979)CCC>CCA		plexin A4 isoform 1							220.0	239.0	233.0					7																	131872244		2083	4222	6305	SO:0001819	synonymous_variant	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131872244G>T	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2979C>A	7.37:g.131872244G>T							p.P993P	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN			15	3208	-			993			IPT/TIG 2.|Extracellular (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	c.2979C>A	CCDS43646.1																																																																																				0.547	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		84	561	1	0	3.99893e-49	0.01441	7.40977e-49	84	561				
CNTNAP2	26047	broad.mit.edu	37	7	146818215	146818215	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:146818215G>T	ENST00000361727.3	+	6	1415	c.899G>T	c.(898-900)cGt>cTt	p.R300L		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	300	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.R300L(1)|p.R300H(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAGCACTTCCGTACCAATGGA	0.483										HNSCC(39;0.1)																													uc003weu.1		NA																	2	Substitution - Missense(2)	p.R300H(1)	ovary(1)|lung(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(898-900)CGT>CTT		cell recognition molecule Caspr2 precursor							181.0	142.0	155.0					7																	146818215		2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:146818215G>T	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.899G>T	7.37:g.146818215G>T	ENSP00000354778:p.Arg300Leu	HNSCC(39;0.1)					p.R300L	NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		6	1415	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	300			Laminin G-like 1.|Extracellular (Potential).		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.899G>T	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.972852	0.92919	.	.	ENSG00000174469	ENST00000361727	T	0.78364	-1.17	5.82	5.82	0.92795	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.64402	D	0.000010	D	0.83041	0.5168	M	0.69248	2.105	0.80722	D	1	D	0.57899	0.981	P	0.61397	0.888	T	0.78640	-0.2125	10	0.16896	T	0.51	.	12.0642	0.53578	0.0788:0.0:0.9212:0.0	.	300	Q9UHC6	CNTP2_HUMAN	L	300	ENSP00000354778:R300L	ENSP00000354778:R300L	R	+	2	0	CNTNAP2	146449148	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.913000	0.87471	2.756000	0.94617	0.563000	0.77884	CGT		0.483	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			12	61	1	0	1.36491e-13	0.001855	2.10873e-13	12	61				
KMT2C	58508	broad.mit.edu	37	7	151874497	151874497	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:151874497G>C	ENST00000262189.6	-	38	8259	c.8041C>G	c.(8041-8043)Cct>Gct	p.P2681A	KMT2C_ENST00000355193.2_Missense_Mutation_p.P2681A	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2681					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P2681A(2)									CCATCAGAAGGCTGGGTGGTT	0.428																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(8041-8043)CCT>GCT		myeloid/lymphoid or mixed-lineage leukemia 3							76.0	75.0	76.0					7																	151874497		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151874497G>C	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8041C>G	7.37:g.151874497G>C	ENSP00000262189:p.Pro2681Ala					MLL3_uc003wkz.2_Missense_Mutation_p.P1742A|MLL3_uc003wky.2_Missense_Mutation_p.P190A	p.P2681A	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	38	8260	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	2681					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.8041C>G	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.067|0.067	-1.211311|-1.211311	0.01555|0.01555	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000360104|ENST00000262189;ENST00000355193	.|D;D	.|0.84873	.|-1.91;-1.86	5.63|5.63	-1.06|-1.06	0.10002|0.10002	.|.	.|0.502377	.|0.16685	.|N	.|0.203785	T|T	0.68357|0.68357	0.2992|0.2992	N|N	0.22421|0.22421	0.69|0.69	0.19300|0.19300	N|N	0.999978|0.999978	.|B;B;B	.|0.17667	.|0.0;0.023;0.002	.|B;B;B	.|0.11329	.|0.0;0.006;0.002	T|T	0.53563|0.53563	-0.8421|-0.8421	5|10	.|0.38643	.|T	.|0.18	.|.	2.4148|2.4148	0.04433|0.04433	0.26:0.112:0.4124:0.2156|0.26:0.112:0.4124:0.2156	.|.	.|2681;1742;2681	.|Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	.|MLL3_HUMAN;.;.	G|A	186|2681	.|ENSP00000262189:P2681A;ENSP00000347325:P2681A	.|ENSP00000262189:P2681A	A|P	-|-	2|1	0|0	MLL3|MLL3	151505430|151505430	0.062000|0.062000	0.20869|0.20869	0.056000|0.056000	0.19401|0.19401	0.142000|0.142000	0.21351|0.21351	-0.003000|-0.003000	0.12901|0.12901	-0.136000|-0.136000	0.11475|0.11475	-0.312000|-0.312000	0.09012|0.09012	GCC|CCT		0.428	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			12	112	0	0	0	0.00245	0	12	112				
KMT2C	58508	broad.mit.edu	37	7	151960177	151960177	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr7:151960177G>A	ENST00000262189.6	-	9	1441	c.1223C>T	c.(1222-1224)aCg>aTg	p.T408M	KMT2C_ENST00000355193.2_Missense_Mutation_p.T408M	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	408					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.T408M(2)									TTTGTCACACGTATCACACAC	0.313																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(1222-1224)ACG>ATG		myeloid/lymphoid or mixed-lineage leukemia 3							105.0	93.0	97.0					7																	151960177		2203	4299	6502	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151960177G>A	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1223C>T	7.37:g.151960177G>A	ENSP00000262189:p.Thr408Met						p.T408M	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	9	1442	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	408			PHD-type 2.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.1223C>T	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.004565	0.54254	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.85171	-1.95;-1.95	4.65	4.65	0.58169	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.46145	D	0.000309	D	0.86443	0.5934	L	0.60957	1.885	0.80722	D	1	D	0.56968	0.978	P	0.48270	0.572	D	0.88134	0.2840	10	0.56958	D	0.05	.	17.923	0.88973	0.0:0.0:1.0:0.0	.	408	Q8NEZ4	MLL3_HUMAN	M	408	ENSP00000262189:T408M;ENSP00000347325:T408M	ENSP00000262189:T408M	T	-	2	0	MLL3	151591110	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.425000	0.80255	2.300000	0.77407	0.557000	0.71058	ACG		0.313	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			25	112	0	0	0	0.00333	0	25	112				
CSMD1	64478	broad.mit.edu	37	8	2855596	2855596	+	Missense_Mutation	SNP	C	C	T	rs201814026		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:2855596C>T	ENST00000520002.1	-	55	8872	c.8317G>A	c.(8317-8319)Ggc>Agc	p.G2773S	CSMD1_ENST00000537824.1_Missense_Mutation_p.G2772S|CSMD1_ENST00000602557.1_Missense_Mutation_p.G2773S|CSMD1_ENST00000602723.1_Missense_Mutation_p.G2715S|CSMD1_ENST00000400186.3_Missense_Mutation_p.G2715S|CSMD1_ENST00000542608.1_Missense_Mutation_p.G2714S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2773	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.G2501S(1)|p.G2772S(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGAGACACGCCCTGCAGCAAA	0.562																																							uc011kwk.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(8317-8319)GGC>AGC		CUB and Sushi multiple domains 1 precursor		C	SER/GLY	1,4111		0,1,2055	95.0	95.0	95.0		8314	6.1	1.0	8		95	2,8400		0,2,4199	yes	missense	CSMD1	NM_033225.5	56	0,3,6254	TT,TC,CC		0.0238,0.0243,0.024	possibly-damaging	2772/3565	2855596	3,12511	2056	4201	6257	SO:0001583	missense	64478					integral to membrane		g.chr8:2855596C>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8317G>A	8.37:g.2855596C>T	ENSP00000430733:p.Gly2773Ser					CSMD1_uc011kwj.1_Missense_Mutation_p.G2102S|CSMD1_uc010lrg.2_Missense_Mutation_p.G783S	p.G2773S	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	54	8707	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2773			Extracellular (Potential).|Sushi 19.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.8317G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.9|25.9	4.690017|4.690017	0.88735|0.88735	2.43E-4|2.43E-4	2.38E-4|2.38E-4	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.|T;T;T;T	.|0.71698	.|-0.59;-0.59;-0.59;-0.59	6.07|6.07	6.07|6.07	0.98685|0.98685	.|Complement control module (2);Sushi/SCR/CCP (3);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.89873|0.89873	0.6841|0.6841	H|H	0.95079|0.95079	3.62|3.62	0.80722|0.80722	D|D	1|1	.|D;D;P	.|0.89917	.|1.0;0.99;0.911	.|D;D;P	.|0.87578	.|0.998;0.946;0.755	D|D	0.91645|0.91645	0.5330|0.5330	6|10	.|0.87932	.|D	.|0	.|.	20.6439|20.6439	0.99570|0.99570	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2773;2773;2714	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	E|S	2189|2715;2773;2634;2772;2714	.|ENSP00000383047:G2715S;ENSP00000430733:G2773S;ENSP00000441462:G2772S;ENSP00000446243:G2714S	.|ENSP00000320445:G2634S	G|G	-|-	2|1	0|0	CSMD1|CSMD1	2843003|2843003	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.194000|0.194000	0.23727|0.23727	7.642000|7.642000	0.83385|0.83385	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GGG|GGC		0.562	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		20	79	0	0	0	0.012319	0	20	79				
VPS37A	137492	broad.mit.edu	37	8	17125803	17125803	+	Silent	SNP	G	G	C	rs369575319		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:17125803G>C	ENST00000324849.4	+	3	911	c.237G>C	c.(235-237)gtG>gtC	p.V79V	VPS37A_ENST00000521829.1_Silent_p.V54V|VPS37A_ENST00000324815.3_Silent_p.V79V	NM_001145152.1|NM_152415.2	NP_001138624.1|NP_689628.2	Q8NEZ2	VP37A_HUMAN	vacuolar protein sorting 37 homolog A (S. cerevisiae)	79					cell death (GO:0008219)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.V79V(1)		autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)	10				Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)		AAAAACCAGTGATCAGTGTTT	0.343																																							uc003wxj.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(235-237)GTG>GTC		hepatocellular carcinoma related protein 1		G	,	1,4405	2.1+/-5.4	0,1,2202	121.0	116.0	118.0		162,237	1.7	1.0	8		118	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	VPS37A	NM_001145152.1,NM_152415.2	,	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	,	54/373,79/398	17125803	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	137492				cellular membrane organization|endosome transport|protein transport	centrosome|late endosome membrane|nucleus		g.chr8:17125803G>C		CCDS6001.1, CCDS47811.1	8p22	2012-06-29	2006-04-04		ENSG00000155975	ENSG00000155975			24928	protein-coding gene	gene with protein product	"""hepatocellular carcinoma related protein 1"""	609927	"""vacuolar protein sorting 37A (yeast)"", ""polyglutamine binding protein 2"""	PQBP2		15240819, 15218037, 22717650	Standard	NM_152415		Approved	FLJ32642, HCRP1, SPG53	uc003wxj.3	Q8NEZ2	OTTHUMG00000130785	ENST00000324849.4:c.237G>C	8.37:g.17125803G>C						VPS37A_uc003wxk.2_Silent_p.V54V	p.V79V	NM_152415	NP_689628	Q8NEZ2	VP37A_HUMAN		Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)	3	590	+			79					Q336D5|Q6NW27|Q8N3D7|Q8TBL7|Q96DL9	Silent	SNP	ENST00000324849.4	37	c.237G>C	CCDS6001.1																																																																																				0.343	VPS37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253301.2	NM_152415		3	93	0	0	0	0.004672	0	3	93				
CLVS1	157807	broad.mit.edu	37	8	62212572	62212572	+	Silent	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:62212572C>G	ENST00000519846.1	+	3	658	c.186C>G	c.(184-186)acC>acG	p.T62T	RP11-787D18.1_ENST00000518064.1_RNA|CLVS1_ENST00000518592.1_Intron|RP11-787D18.1_ENST00000521801.1_RNA|CLVS1_ENST00000325897.4_Silent_p.T62T			Q8IUQ0	CLVS1_HUMAN	clavesin 1	62					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.T62T(1)		endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						TGATCATCACCAGGCCTGACA	0.473																																							uc003xuh.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(1)	5						c.(184-186)ACC>ACG		retinaldehyde binding protein 1-like 1							129.0	109.0	116.0					8																	62212572		2203	4300	6503	SO:0001819	synonymous_variant	157807				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr8:62212572C>G	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.186C>G	8.37:g.62212572C>G						CLVS1_uc003xug.2_Silent_p.T62T|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Silent_p.T62T	p.T62T	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN			2	510	+			62					B2R7M5|C8UZT3|Q8NB32	Silent	SNP	ENST00000519846.1	37	c.186C>G	CCDS6176.1																																																																																				0.473	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519		10	47	0	0	0	0.001855	0	10	47				
ZFHX4	79776	broad.mit.edu	37	8	77618316	77618316	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:77618316G>T	ENST00000521891.2	+	2	2441	c.1993G>T	c.(1993-1995)Gag>Tag	p.E665*	ZFHX4_ENST00000455469.2_Nonsense_Mutation_p.E665*|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Nonsense_Mutation_p.E665*|ZFHX4_ENST00000050961.6_Nonsense_Mutation_p.E665*	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	665					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.E665*(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCATATGAAGGAGAAACACCC	0.498										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(1993-1995)GAG>TAG		zinc finger homeodomain 4							55.0	58.0	57.0					8																	77618316		1961	4173	6134	SO:0001587	stop_gained	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77618316G>T		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1993G>T	8.37:g.77618316G>T	ENSP00000430497:p.Glu665*	HNSCC(33;0.089)				ZFHX4_uc003yat.1_Nonsense_Mutation_p.E665*|ZFHX4_uc003yau.1_Nonsense_Mutation_p.E665*|ZFHX4_uc003yaw.1_Nonsense_Mutation_p.E665*	p.E665*	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		2	2380	+			665			C2H2-type 2.		G3V138|Q18PS0|Q6ZN20	Nonsense_Mutation	SNP	ENST00000521891.2	37	c.1993G>T	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	37	6.410793	0.97546	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	.	.	.	5.24	5.24	0.73138	.	0.000000	0.44902	U	0.000406	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	19.0009	0.92834	0.0:0.0:1.0:0.0	.	.	.	.	X	665	.	ENSP00000050961:E665X	E	+	1	0	ZFHX4	77780871	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.657000	0.98554	2.714000	0.92807	0.655000	0.94253	GAG		0.498	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		10	66	1	0	0.00829132	0.008291	0.00873825	10	66				
ZFHX4	79776	broad.mit.edu	37	8	77690535	77690535	+	Missense_Mutation	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:77690535T>A	ENST00000521891.2	+	4	3633	c.3185T>A	c.(3184-3186)cTg>cAg	p.L1062Q	ZFHX4_ENST00000455469.2_Missense_Mutation_p.L1036Q|ZFHX4_ENST00000517683.1_3'UTR|ZFHX4_ENST00000518282.1_Missense_Mutation_p.L1036Q|ZFHX4_ENST00000050961.6_Missense_Mutation_p.L1036Q	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1036					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.L1062Q(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAGTTGAATCTGGTACAACAT	0.532										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(3106-3108)CTG>CAG		zinc finger homeodomain 4							158.0	162.0	161.0					8																	77690535		2051	4191	6242	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77690535T>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3185T>A	8.37:g.77690535T>A	ENSP00000430497:p.Leu1062Gln	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.L1062Q|ZFHX4_uc003yaw.1_Missense_Mutation_p.L1036Q	p.L1036Q	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		4	3494	+			1036			C2H2-type 7.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.3107T>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	T	14.13	2.443746	0.43429	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	5.22	5.22	0.72569	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);	0.000000	0.34986	U	0.003537	T	0.71626	0.3362	M	0.73319	2.225	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.75260	-0.3380	10	0.87932	D	0	.	15.5609	0.76244	0.0:0.0:0.0:1.0	.	1036;1036;1062	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	Q	1062;1062;1036;1036;1036	ENSP00000430497:L1062Q;ENSP00000399605:L1036Q;ENSP00000050961:L1036Q;ENSP00000430848:L1036Q	ENSP00000050961:L1036Q	L	+	2	0	ZFHX4	77853090	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.825000	0.86693	2.320000	0.78422	0.528000	0.53228	CTG		0.532	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		25	157	0	0	0	0.00632	0	25	157				
ZFHX4	79776	broad.mit.edu	37	8	77765635	77765635	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:77765635C>A	ENST00000521891.2	+	10	6926	c.6478C>A	c.(6478-6480)Cag>Aag	p.Q2160K	ZFHX4_ENST00000455469.2_Missense_Mutation_p.Q2115K|ZFHX4_ENST00000518282.1_Missense_Mutation_p.Q2134K|ZFHX4_ENST00000050961.6_Missense_Mutation_p.Q2115K	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.Q2144K(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGAACAGATCCAGGAAATGGC	0.378										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(6343-6345)CAG>AAG		zinc finger homeodomain 4							59.0	58.0	59.0					8																	77765635		1840	4078	5918	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77765635C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6478C>A	8.37:g.77765635C>A	ENSP00000430497:p.Gln2160Lys	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.Q2160K|ZFHX4_uc003yaw.1_Missense_Mutation_p.Q2115K	p.Q2115K	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	6730	+			2115			Homeobox 1.		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.6343C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533281	0.45073	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93	3.92	3.92	0.45320	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.42682	U	0.000673	D	0.93409	0.7898	N	0.12527	0.23	0.80722	D	1	D;D;D	0.62365	0.991;0.989;0.989	D;D;D	0.74023	0.982;0.969;0.969	D	0.89298	0.3624	10	0.02654	T	1	.	16.4682	0.84092	0.0:1.0:0.0:0.0	.	2115;2115;2160	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	K	2160;2144;2115;2115;2134	ENSP00000430497:Q2160K;ENSP00000399605:Q2115K;ENSP00000050961:Q2115K;ENSP00000430848:Q2134K	ENSP00000050961:Q2115K	Q	+	1	0	ZFHX4	77928190	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.548000	0.82154	2.200000	0.70718	0.455000	0.32223	CAG		0.378	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		9	118	1	0	0.000442599	0.006214	0.000492066	9	118				
RUNX1T1	862	broad.mit.edu	37	8	92998367	92998367	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:92998367C>G	ENST00000523629.1	-	9	1718	c.1264G>C	c.(1264-1266)Gac>Cac	p.D422H	RUNX1T1_ENST00000396218.1_Missense_Mutation_p.D395H|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.D385H|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.D422H|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.D433H|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.D385H|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.D395H|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.D385H	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	422					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D422H(1)|p.D385H(1)|p.D433H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GCAACTGGGTCTGGGTTGACG	0.428																																							uc003yfd.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16						c.(1264-1266)GAC>CAC		acute myelogenous leukemia 1 translocation 1							110.0	118.0	115.0					8																	92998367		2203	4300	6503	SO:0001583	missense	862				generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:92998367C>G	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1264G>C	8.37:g.92998367C>G	ENSP00000428543:p.Asp422His					RUNX1T1_uc003yfc.1_Missense_Mutation_p.D395H|RUNX1T1_uc003yfe.1_Missense_Mutation_p.D385H|RUNX1T1_uc010mao.2_Missense_Mutation_p.D395H|RUNX1T1_uc011lgi.1_Missense_Mutation_p.D433H|RUNX1T1_uc010man.1_5'UTR|RUNX1T1_uc003yfb.1_Missense_Mutation_p.D385H	p.D422H	NM_175634	NP_783552	Q06455	MTG8_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.0141)		8	1348	-			422					B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	c.1264G>C	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278390	0.80692	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.34275	1.38;1.4;1.38;1.41;1.41;1.41;1.37;1.4	5.67	5.67	0.87782	.	0.187713	0.56097	D	0.000023	T	0.42131	0.1189	N	0.19112	0.55	0.58432	D	0.999997	D;B;P	0.56746	0.977;0.003;0.725	P;B;P	0.55161	0.77;0.009;0.601	T	0.39643	-0.9604	10	0.72032	D	0.01	-18.8452	19.773	0.96379	0.0:1.0:0.0:0.0	.	433;422;395	E7EPN4;Q06455;Q06455-2	.;MTG8_HUMAN;.	H	422;395;422;385;385;385;433;395	ENSP00000428543:D422H;ENSP00000379520:D395H;ENSP00000265814:D422H;ENSP00000353504:D385H;ENSP00000390137:D385H;ENSP00000428742:D385H;ENSP00000402257:D433H;ENSP00000430728:D395H	ENSP00000265814:D422H	D	-	1	0	RUNX1T1	93067543	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	4.779000	0.62375	2.677000	0.91161	0.655000	0.94253	GAC		0.428	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635		16	147	0	0	0	0.00499	0	16	147				
MTERF3	51001	broad.mit.edu	37	8	97256256	97256256	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:97256256G>T	ENST00000287025.3	-	7	1048	c.950C>A	c.(949-951)aCc>aAc	p.T317N	MTERFD1_ENST00000522822.1_Missense_Mutation_p.T196N|MTERFD1_ENST00000524341.1_Intron|MTERFD1_ENST00000523821.1_Missense_Mutation_p.T317N	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		317					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)	p.T317N(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					TGGGATTCTGGTGATCATATG	0.328																																							uc003yhs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(949-951)ACC>AAC		MTERF domain containing 1 precursor							207.0	198.0	201.0					8																	97256256		2203	4300	6503	SO:0001583	missense	51001				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion	transcription regulatory region DNA binding	g.chr8:97256256G>T																												ENST00000287025.3:c.950C>A	8.37:g.97256256G>T	ENSP00000287025:p.Thr317Asn					MTERFD1_uc003yhr.1_Missense_Mutation_p.T196N|MTERFD1_uc010mbd.1_Missense_Mutation_p.T317N	p.T317N	NM_015942	NP_057026	Q96E29	MTER1_HUMAN			7	1028	-	Breast(36;5.16e-05)		317					B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	ENST00000287025.3	37	c.950C>A	CCDS6270.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.127618	0.37533	.	.	ENSG00000156469	ENST00000523821;ENST00000522822;ENST00000287025	T;T;T	0.11277	2.79;2.79;2.79	5.94	4.14	0.48551	.	0.415006	0.28694	N	0.014444	T	0.10423	0.0255	L	0.60455	1.87	0.28231	N	0.926109	P;B	0.36249	0.545;0.372	B;B	0.38194	0.253;0.267	T	0.17319	-1.0373	10	0.27785	T	0.31	-17.61	2.6121	0.04894	0.2116:0.1251:0.534:0.1293	.	317;317	E5RIK9;Q96E29	.;MTER1_HUMAN	N	317;196;317	ENSP00000429400:T317N;ENSP00000430138:T196N;ENSP00000287025:T317N	ENSP00000287025:T317N	T	-	2	0	MTERFD1	97325432	0.847000	0.29606	1.000000	0.80357	0.995000	0.86356	0.310000	0.19356	0.830000	0.34757	0.650000	0.86243	ACC		0.328	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379876.1			16	64	1	0	6.72482e-11	0.003163	9.62872e-11	16	64				
ODF1	4956	broad.mit.edu	37	8	103573108	103573108	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:103573108T>C	ENST00000285402.3	+	2	905	c.749T>C	c.(748-750)tTg>tCg	p.L250S	ODF1_ENST00000518835.1_Missense_Mutation_p.L43S	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	250					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.L250S(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			AAGATGATTTTGTAAAGTGCG	0.517																																							uc003ykt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(748-750)TTG>TCG		outer dense fiber of sperm tails 1							84.0	93.0	90.0					8																	103573108		2203	4300	6503	SO:0001583	missense	4956				cell differentiation|multicellular organismal development|spermatogenesis	outer dense fiber	structural molecule activity	g.chr8:103573108T>C	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.749T>C	8.37:g.103573108T>C	ENSP00000285402:p.Leu250Ser						p.L250S	NM_024410	NP_077721	Q14990	ODFP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)		2	857	+	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		250					Q3SX72	Missense_Mutation	SNP	ENST00000285402.3	37	c.749T>C	CCDS6293.1	.	.	.	.	.	.	.	.	.	.	T	13.97	2.395119	0.42512	.	.	ENSG00000155087	ENST00000285402;ENST00000518835	T;T	0.39787	1.15;1.06	5.65	3.14	0.36123	.	0.000000	0.39834	N	0.001243	T	0.24005	0.0581	N	0.22421	0.69	0.20196	N	0.99992	B	0.09022	0.002	B	0.06405	0.002	T	0.10428	-1.0630	10	0.87932	D	0	.	3.4376	0.07452	0.1987:0.1064:0.0:0.6948	.	250	Q14990	ODFP1_HUMAN	S	250;43	ENSP00000285402:L250S;ENSP00000430023:L43S	ENSP00000285402:L250S	L	+	2	0	ODF1	103642284	0.946000	0.32159	0.981000	0.43875	0.950000	0.60333	1.385000	0.34408	2.169000	0.68431	0.528000	0.53228	TTG		0.517	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1			17	228	0	0	0	0.006122	0	17	228				
DPYS	1807	broad.mit.edu	37	8	105436574	105436574	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:105436574C>A	ENST00000351513.2	-	7	1268	c.1136G>T	c.(1135-1137)aGc>aTc	p.S379I	AP003471.2_ENST00000410226.1_RNA	NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	379					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)	p.S379I(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TGCATTTGTGCTGGTAACTGC	0.358																																							uc003yly.3		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1135-1137)AGC>ATC		dihydropyrimidinase							138.0	135.0	136.0					8																	105436574		2203	4300	6503	SO:0001583	missense	1807				protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding	g.chr8:105436574C>A	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.1136G>T	8.37:g.105436574C>A	ENSP00000276651:p.Ser379Ile						p.S379I	NM_001385	NP_001376	Q14117	DPYS_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		7	1265	-			379						Missense_Mutation	SNP	ENST00000351513.2	37	c.1136G>T	CCDS6302.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.845482	0.91197	.	.	ENSG00000147647	ENST00000351513	D	0.91464	-2.85	5.98	5.98	0.97165	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.97025	0.9028	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97276	0.9914	10	0.87932	D	0	-33.8318	20.4434	0.99119	0.0:1.0:0.0:0.0	.	379	Q14117	DPYS_HUMAN	I	379	ENSP00000276651:S379I	ENSP00000276651:S379I	S	-	2	0	DPYS	105505750	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.769000	0.85360	2.838000	0.97847	0.655000	0.94253	AGC		0.358	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385		7	119	1	0	0.00198382	0.001984	0.00214661	7	119				
FER1L6	654463	broad.mit.edu	37	8	124992872	124992872	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:124992872C>A	ENST00000522917.1	+	11	1437	c.1231C>A	c.(1231-1233)Cag>Aag	p.Q411K	FER1L6_ENST00000399018.1_Missense_Mutation_p.Q411K	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	411						integral component of membrane (GO:0016021)		p.Q411K(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AGGACGGGCACAGGAATCTAA	0.468											OREG0018964	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003yqw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(1231-1233)CAG>AAG		fer-1-like 6							114.0	116.0	116.0					8																	124992872		1876	4101	5977	SO:0001583	missense	654463					integral to membrane		g.chr8:124992872C>A	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.1231C>A	8.37:g.124992872C>A	ENSP00000428280:p.Gln411Lys		OREG0018964	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1538		p.Q411K	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		11	1437	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		411			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000522917.1	37	c.1231C>A	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.318462	0.40996	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.80393	-1.37;-1.37	5.53	5.53	0.82687	.	1.911950	0.03772	U	0.259882	T	0.80226	0.4584	L	0.58101	1.795	0.32585	N	0.52798	B	0.27450	0.179	B	0.21708	0.036	T	0.63834	-0.6547	10	0.05833	T	0.94	.	19.466	0.94939	0.0:1.0:0.0:0.0	.	411	Q2WGJ9	FR1L6_HUMAN	K	411	ENSP00000428280:Q411K;ENSP00000381982:Q411K	ENSP00000381982:Q411K	Q	+	1	0	FER1L6	125062053	0.940000	0.31905	0.998000	0.56505	0.841000	0.47740	2.295000	0.43576	2.607000	0.88179	0.655000	0.94253	CAG		0.468	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		44	134	1	0	1.97e-11	0.010771	2.87884e-11	44	134				
LRRC6	23639	broad.mit.edu	37	8	133673705	133673706	+	Splice_Site	DNP	CC	CC	AT			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:133673705_133673706CC>AT	ENST00000519595.1	-	2	276_277	c.178_179GG>AT	c.(178-180)GGa>ATa	p.G60I	LRRC6_ENST00000518642.1_Splice_Site_p.G60I|LRRC6_ENST00000250173.1_Splice_Site_p.G60I|LRRC6_ENST00000520446.1_5'UTR			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	60					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.?(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			CTGAAACTTACCAATTTTCCCA	0.322																																							uc003ytk.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|kidney(1)	2						c.e2+1		leucine rich repeat containing 6																																				SO:0001630	splice_region_variant	23639					cytoplasm		g.chr8:133673705_133673706CC>AT	U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.178_179delinsAT	8.37:g.133673705_133673706delinsAT						LRRC6_uc003ytl.2_Splice_Site	p.E60_splice	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000311)		2	252	-	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)							Q13648|Q4G183	Splice_Site	DNP	ENST00000519595.1	37	c.178_splice																																																																																					0.322	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379578.1	NM_012472	Missense_Mutation	9	37	0	0	0	0.004672	0	9	37				
TG	7038	broad.mit.edu	37	8	133906105	133906105	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:133906105C>T	ENST00000220616.4	+	11	2972	c.2932C>T	c.(2932-2934)Ccc>Tcc	p.P978S	TG_ENST00000377869.1_Missense_Mutation_p.P978S	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	978	Thyroglobulin type-1 8. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.P978S(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GCTCTTCCCGCCCCGGGAGGC	0.602																																							uc003ytw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15						c.(2932-2934)CCC>TCC		thyroglobulin precursor							79.0	75.0	77.0					8																	133906105		2203	4300	6503	SO:0001583	missense	7038				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity	g.chr8:133906105C>T	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.2932C>T	8.37:g.133906105C>T	ENSP00000220616:p.Pro978Ser						p.P978S	NM_003235	NP_003226	P01266	THYG_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)	11	2973	+	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	978			Thyroglobulin type-1 8.		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	c.2932C>T	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	c	0.585	-0.835538	0.02713	.	.	ENSG00000042832	ENST00000377869;ENST00000220616	T;T	0.60040	0.22;0.22	4.9	-3.91	0.04168	Thyroglobulin type-1 (1);	0.839497	0.10454	N	0.672743	T	0.17408	0.0418	N	0.01576	-0.805	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.26677	-1.0096	10	0.02654	T	1	.	1.9972	0.03459	0.1227:0.3019:0.1266:0.4488	.	978	P01266	THYG_HUMAN	S	978	ENSP00000367100:P978S;ENSP00000220616:P978S	ENSP00000220616:P978S	P	+	1	0	TG	133975287	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.334000	0.07883	-0.720000	0.04935	-0.811000	0.03165	CCC		0.602	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		8	184	0	0	0	0.004482	0	8	184				
FAM135B	51059	broad.mit.edu	37	8	139268931	139268931	+	Splice_Site	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:139268931C>A	ENST00000395297.1	-	5	539		c.e5+1			NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B									p.?(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ATGACACTCACTGCTGTTCAC	0.463										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Unknown(2)		lung(2)	ovary(7)|skin(2)	9						c.e5+1		hypothetical protein LOC51059							103.0	99.0	100.0					8																	139268931		1984	4175	6159	SO:0001630	splice_region_variant	51059							g.chr8:139268931C>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.368+1G>T	8.37:g.139268931C>A		HNSCC(54;0.14)				FAM135B_uc003yux.2_Splice_Site_p.Q24_splice|FAM135B_uc003yuz.2_Splice_Site	p.Q123_splice	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		5	539	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)							B5MDB3|O95879|Q2WGJ7|Q3KP46	Splice_Site	SNP	ENST00000395297.1	37	c.368_splice	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937473	0.92458	.	.	ENSG00000147724	ENST00000395297;ENST00000160713	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4074	0.90541	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM135B	139338113	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.610000	0.82949	2.663000	0.90544	0.655000	0.94253	.		0.463	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	Intron	10	58	1	0	4.68919e-08	0.008291	6.08414e-08	10	58				
LY6D	8581	broad.mit.edu	37	8	143867039	143867039	+	Silent	SNP	C	C	T	rs138562115		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr8:143867039C>T	ENST00000301263.4	-	2	192	c.117G>A	c.(115-117)ccG>ccA	p.P39P	RP11-706C16.8_ENST00000510610.2_RNA|LY6D_ENST00000518434.1_5'UTR	NM_003695.2	NP_003686.1	Q14210	LY6D_HUMAN	lymphocyte antigen 6 complex, locus D	39	UPAR/Ly6.				cell adhesion (GO:0007155)|lymphocyte differentiation (GO:0030098)|response to stilbenoid (GO:0035634)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.P39P(1)		large_intestine(1)|lung(3)|prostate(1)	5	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GAGAGCTGGCCGGGCAGACCA	0.647																																							uc003yxf.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(115-117)CCG>CCA		lymphocyte antigen 6 complex, locus D precursor		C		0,4406		0,0,2203	78.0	77.0	78.0		117	-6.3	0.0	8	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LY6D	NM_003695.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		39/129	143867039	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8581				cell adhesion	anchored to membrane|membrane fraction|plasma membrane	protein binding	g.chr8:143867039C>T	U66837	CCDS6390.1	8q24	2004-07-06			ENSG00000167656	ENSG00000167656			13348	protein-coding gene	gene with protein product		606204				7790363, 9551972	Standard	NM_003695		Approved	E48	uc003yxf.1	Q14210	OTTHUMG00000164693	ENST00000301263.4:c.117G>A	8.37:g.143867039C>T							p.P39P	NM_003695	NP_003686	Q14210	LY6D_HUMAN			2	193	-	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		39			UPAR/Ly6.		B2R5F1|D3DWJ0|O43783|Q6GTV9|Q8TBD4|Q92933	Silent	SNP	ENST00000301263.4	37	c.117G>A	CCDS6390.1																																																																																				0.647	LY6D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379774.1	NM_003695		33	97	0	0	0	0.004289	0	33	97				
RIC1	57589	broad.mit.edu	37	9	5768969	5768969	+	Splice_Site	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:5768969G>C	ENST00000414202.2	+	22	3328		c.e22-1		KIAA1432_ENST00000418622.3_Splice_Site|KIAA1432_ENST00000251879.6_Splice_Site|KIAA1432_ENST00000381532.2_Splice_Site|KIAA1432_ENST00000449720.2_Splice_Site	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.?(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TCCACTTACAGATGGAGCAAA	0.423																																							uc003zji.2		NA																	1	Unknown(1)		lung(1)		0						c.e21-1		connexin 43-interacting protein 150 isoform a							70.0	65.0	67.0					9																	5768969		2202	4296	6498	SO:0001630	splice_region_variant	57589					integral to membrane		g.chr9:5768969G>C																												ENST00000414202.2:c.3138-1G>C	9.37:g.5768969G>C						KIAA1432_uc003zjh.2_Splice_Site_p.R967_splice|KIAA1432_uc003zjl.3_Splice_Site_p.R930_splice|KIAA1432_uc003zjj.1_Splice_Site_p.R509_splice|ERMP1_uc011lme.1_Intron	p.R967_splice	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)	21	2994	+		Acute lymphoblastic leukemia(23;0.154)							Splice_Site	SNP	ENST00000414202.2	37	c.2901_splice	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635091	0.67130	.	.	ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000545641;ENST00000449720	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0953	0.97838	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1432	5758969	1.000000	0.71417	0.790000	0.31976	0.741000	0.42261	8.595000	0.90840	2.767000	0.95098	0.655000	0.94253	.		0.423	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		Intron	3	95	0	0	0	0.004672	0	3	95				
SLC24A2	25769	broad.mit.edu	37	9	19597236	19597236	+	Missense_Mutation	SNP	T	T	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:19597236T>C	ENST00000341998.2	-	4	1181	c.1120A>G	c.(1120-1122)Act>Gct	p.T374A	SLC24A2_ENST00000286344.3_Intron	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	374					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.T374A(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CCTTCTTCAGTCATTGTGTCA	0.318																																							uc003zoa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1120-1122)ACT>GCT		solute carrier family 24							227.0	207.0	214.0					9																	19597236		2200	4300	6500	SO:0001583	missense	25769				visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity	g.chr9:19597236T>C	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1120A>G	9.37:g.19597236T>C	ENSP00000344801:p.Thr374Ala					SLC24A2_uc003zob.1_Intron	p.T374A	NM_020344	NP_065077	Q9UI40	NCKX2_HUMAN		GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)	4	1182	-			374			Cytoplasmic (Potential).		B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	c.1120A>G	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	T	13.58	2.278274	0.40294	.	.	ENSG00000155886	ENST00000341998	T	0.74526	-0.85	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.53334	0.1790	N	0.08118	0	0.80722	D	1	B	0.33198	0.401	B	0.24541	0.054	T	0.55866	-0.8073	9	.	.	.	.	16.5932	0.84781	0.0:0.0:0.0:1.0	.	374	Q9UI40	NCKX2_HUMAN	A	374	ENSP00000344801:T374A	.	T	-	1	0	SLC24A2	19587236	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.474000	0.81024	2.320000	0.78422	0.528000	0.53228	ACT		0.318	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344		4	22	0	0	0	0.009096	0	4	22				
TAF1L	138474	broad.mit.edu	37	9	32631299	32631299	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:32631299G>T	ENST00000242310.4	-	1	4368	c.4279C>A	c.(4279-4281)Cca>Aca	p.P1427T	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1427	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.P1427T(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GCATTGACTGGAGTGTGGAAA	0.478																																							uc003zrg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(4279-4281)CCA>ACA		TBP-associated factor RNA polymerase 1-like							318.0	271.0	287.0					9																	32631299		2203	4300	6503	SO:0001583	missense	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32631299G>T	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.4279C>A	9.37:g.32631299G>T	ENSP00000418379:p.Pro1427Thr					uc003zrh.1_5'Flank	p.P1427T	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	4369	-			1427			Bromo 1.		Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	c.4279C>A	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.479689	0.63849	.	.	ENSG00000122728	ENST00000242310	T	0.27256	1.68	0.658	0.658	0.17855	Bromodomain (5);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.59636	0.2208	H	0.97962	4.115	0.54753	D	0.99998	D	0.76494	0.999	D	0.75484	0.986	T	0.64419	-0.6412	10	0.87932	D	0	.	7.0823	0.25237	1.0E-4:0.0:0.9999:0.0	.	1427	Q8IZX4	TAF1L_HUMAN	T	1427	ENSP00000418379:P1427T	ENSP00000418379:P1427T	P	-	1	0	TAF1L	32621299	1.000000	0.71417	0.995000	0.50966	0.674000	0.39518	6.138000	0.71717	0.626000	0.30322	0.195000	0.17529	CCA		0.478	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			89	285	1	0	4.78148e-37	0.01441	8.74549e-37	89	285				
TAF1L	138474	broad.mit.edu	37	9	32633637	32633637	+	Silent	SNP	G	G	C	rs34334113		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:32633637G>C	ENST00000242310.4	-	1	2030	c.1941C>G	c.(1939-1941)ctC>ctG	p.L647L	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	647					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.L647L(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CTGGCTGAGAGAGTGCACCAA	0.502																																							uc003zrg.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(1939-1941)CTC>CTG		TBP-associated factor RNA polymerase 1-like							128.0	122.0	124.0					9																	32633637		2203	4300	6503	SO:0001819	synonymous_variant	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32633637G>C	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.1941C>G	9.37:g.32633637G>C						uc003zrh.1_RNA	p.L647L	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	2031	-			647					Q0VG57	Silent	SNP	ENST00000242310.4	37	c.1941C>G	CCDS35003.1																																																																																				0.502	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			48	155	0	0	0	0.01441	0	48	155				
SPATA31A6	389730	broad.mit.edu	37	9	43624985	43624985	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:43624985C>A	ENST00000332857.6	-	4	3730	c.3702G>T	c.(3700-3702)aaG>aaT	p.K1234N	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	1234					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.K1234N(1)									GGGCTTGAAACTTCTGTTTGT	0.502																																							uc011lrb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3700-3702)AAG>AAT		hypothetical protein LOC389730							9.0	10.0	10.0					9																	43624985		605	1531	2136	SO:0001583	missense	389730					integral to membrane		g.chr9:43624985C>A		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.3702G>T	9.37:g.43624985C>A	ENSP00000329825:p.Lys1234Asn						p.K1234N	NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN			4	3731	-			1234						Missense_Mutation	SNP	ENST00000332857.6	37	c.3702G>T	CCDS47973.1	.	.	.	.	.	.	.	.	.	.	C	6.649	0.488218	0.12641	.	.	ENSG00000185775	ENST00000332857	T	0.03801	3.8	2.44	-1.83	0.07833	.	0.646967	0.12951	N	0.425835	T	0.01940	0.0061	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.13407	0.009	T	0.43653	-0.9378	10	0.37606	T	0.19	-5.063	0.1803	0.00123	0.2413:0.1594:0.2228:0.3764	.	1234	Q5VVP1	F75A6_HUMAN	N	1234	ENSP00000329825:K1234N	ENSP00000329825:K1234N	K	-	3	2	FAM75A6	43564981	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.389000	0.07342	-0.365000	0.08076	-0.559000	0.04183	AAG		0.502	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		38	304	1	0	9.73076e-26	0.006999	1.70815e-25	38	304				
TMEM2	23670	broad.mit.edu	37	9	74305045	74305045	+	Missense_Mutation	SNP	G	G	A	rs377453592		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:74305045G>A	ENST00000377044.4	-	22	4353	c.3814C>T	c.(3814-3816)Cgc>Tgc	p.R1272C	TMEM2_ENST00000396272.3_Missense_Mutation_p.R265C|TMEM2_ENST00000377066.5_Missense_Mutation_p.R1209C	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1272					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R1272C(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TCTTCAATGCGACTGACATCA	0.488																																							uc011lsa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(3814-3816)CGC>TGC		transmembrane protein 2 isoform a		G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	168.0	150.0	156.0		3625,3814	3.1	0.2	9		156	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TMEM2	NM_001135820.1,NM_013390.2	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	1209/1321,1272/1384	74305045	1,13005	2203	4300	6503	SO:0001583	missense	23670					integral to membrane		g.chr9:74305045G>A		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3814C>T	9.37:g.74305045G>A	ENSP00000366243:p.Arg1272Cys					TMEM2_uc011lrz.1_Missense_Mutation_p.R265C|TMEM2_uc010mos.2_Missense_Mutation_p.R1209C|TMEM2_uc011lsb.1_RNA|TMEM2_uc004aik.2_Missense_Mutation_p.R106C	p.R1272C	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)	22	4354	-		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)	1272					A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	c.3814C>T	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.905438	0.33628	0.0	1.16E-4	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000396272	T;T;T	0.73789	-0.78;-0.71;2.47	5.99	3.1	0.35709	.	1.035900	0.07493	N	0.906015	T	0.75302	0.3831	L	0.40543	1.245	0.09310	N	0.999999	P;P	0.52170	0.756;0.951	B;P	0.51229	0.209;0.663	T	0.61569	-0.7036	10	0.56958	D	0.05	.	11.178	0.48612	0.0:0.2286:0.5347:0.2367	.	1272;1209	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	C	1272;1209;265	ENSP00000366243:R1272C;ENSP00000366266:R1209C;ENSP00000379569:R265C	ENSP00000366243:R1272C	R	-	1	0	TMEM2	73494865	0.017000	0.18338	0.247000	0.24249	0.616000	0.37450	1.192000	0.32150	0.394000	0.25230	0.655000	0.94253	CGC		0.488	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390		12	218	0	0	0	0.013537	0	12	218				
SVEP1	79987	broad.mit.edu	37	9	113148345	113148345	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:113148345C>A	ENST00000401783.2	-	43	10406	c.10070G>T	c.(10069-10071)tGc>tTc	p.C3357F	SVEP1_ENST00000374469.1_Missense_Mutation_p.C3334F|SVEP1_ENST00000297826.5_Missense_Mutation_p.C1283F	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3357	Sushi 33. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.C3360F(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						AGGAACAGGGCATGGATTTGC	0.388																																							uc010mtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)	7						c.(10069-10071)TGC>TTC		polydom							88.0	83.0	85.0					9																	113148345		1870	4121	5991	SO:0001583	missense	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113148345C>A	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.10070G>T	9.37:g.113148345C>A	ENSP00000384917:p.Cys3357Phe					SVEP1_uc010mty.2_Missense_Mutation_p.C1283F	p.C3357F	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN			43	10407	-			3357			Sushi 33.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	c.10070G>T	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109312	0.77096	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	D;D;D	0.99784	-6.74;-6.74;-6.74	5.22	5.22	0.72569	Complement control module (3);Sushi/SCR/CCP (3);	0.089147	0.85682	D	0.000000	D	0.99809	0.9917	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97125	0.9814	10	0.87932	D	0	.	19.2177	0.93785	0.0:1.0:0.0:0.0	.	3357	Q4LDE5	SVEP1_HUMAN	F	3357;3334;1283	ENSP00000384917:C3357F;ENSP00000363593:C3334F;ENSP00000297826:C1283F	ENSP00000297826:C1283F	C	-	2	0	SVEP1	112188166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.201000	0.72124	2.609000	0.88269	0.650000	0.86243	TGC		0.388	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				22	84	1	0	1.10923e-09	0.00278	1.51916e-09	22	84				
MUSK	4593	broad.mit.edu	37	9	113510054	113510054	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:113510054A>T	ENST00000374448.4	+	7	1021	c.887A>T	c.(886-888)aAg>aTg	p.K296M	MUSK_ENST00000416899.2_Missense_Mutation_p.K296M|MUSK_ENST00000189978.5_Missense_Mutation_p.K296M	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	296	Ig-like 3.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.K296M(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						AGTACTGCCAAGGCTGCAGCC	0.488																																							uc004bey.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(2)|central_nervous_system(1)	6						c.(886-888)AAG>ATG		skeletal muscle receptor tyrosine kinase							95.0	91.0	92.0					9																	113510054		2050	4193	6243	SO:0001583	missense	4593				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr9:113510054A>T	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.887A>T	9.37:g.113510054A>T	ENSP00000363571:p.Lys296Met					MUSK_uc004bex.2_Missense_Mutation_p.K306M	p.K296M	NM_005592	NP_005583	O15146	MUSK_HUMAN			7	985	+			296			Ig-like 3.|Extracellular (Potential).		Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	ENST00000374448.4	37	c.887A>T	CCDS48005.1	.	.	.	.	.	.	.	.	.	.	A	19.54	3.846528	0.71603	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000416899	T	0.75367	-0.93	5.9	5.9	0.94986	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87374	0.6161	M	0.87097	2.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.88112	0.2826	10	0.45353	T	0.12	.	14.2752	0.66175	1.0:0.0:0.0:0.0	.	296;306	O15146;F5H6T2	MUSK_HUMAN;.	M	296;296;296;306;306;296	ENSP00000363571:K296M	ENSP00000189978:K296M	K	+	2	0	MUSK	112549875	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	5.683000	0.68189	2.252000	0.74401	0.533000	0.62120	AAG		0.488	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				18	46	0	0	0	0.012319	0	18	46				
ZNF618	114991	broad.mit.edu	37	9	116811997	116811997	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:116811997C>T	ENST00000374126.5	+	15	2514	c.2415C>T	c.(2413-2415)gcC>gcT	p.A805A	ZNF618_ENST00000470105.1_3'UTR|ZNF618_ENST00000288466.7_Silent_p.A712A			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	805					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A722A(1)|p.A805A(1)|p.A712A(1)		breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						ACAAGGTGGCCATGATCCTGG	0.617																																							uc004bid.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(2413-2415)GCC>GCT		zinc finger protein 618							44.0	50.0	48.0					9																	116811997		2066	4190	6256	SO:0001819	synonymous_variant	114991				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:116811997C>T	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.2415C>T	9.37:g.116811997C>T						ZNF618_uc004bic.2_Silent_p.A712A|ZNF618_uc011lxi.1_Silent_p.A772A|ZNF618_uc011lxj.1_Silent_p.A773A|ZNF618_uc010mvb.2_Silent_p.A395A	p.A805A	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN			15	2514	+			805					B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Silent	SNP	ENST00000374126.5	37	c.2415C>T																																																																																					0.617	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053749.1	XM_054983		12	47	0	0	0	0.013537	0	12	47				
NOTCH1	4851	broad.mit.edu	37	9	139413994	139413994	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:139413994C>G	ENST00000277541.6	-	5	841	c.766G>C	c.(766-768)Gaa>Caa	p.E256Q	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	256					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E256Q(2)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TCGATATTTTCCTCACAGTTC	0.627			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													uc004chz.2		NA		Dom	yes		9	9q34.3	4851	T|Mis|O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""			L	TRB@		T-ALL		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856						c.(766-768)GAA>CAA		notch1 preproprotein							106.0	129.0	122.0					9																	139413994		2043	4199	6242	SO:0001583	missense	4851				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr9:139413994C>G	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.766G>C	9.37:g.139413994C>G	ENSP00000277541:p.Glu256Gln	HNSCC(8;0.001)					p.E256Q	NM_017617	NP_060087	P46531	NOTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)	5	766	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	256			Extracellular (Potential).		Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	c.766G>C	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	3.048	-0.195924	0.06259	.	.	ENSG00000148400	ENST00000277541	D	0.87412	-2.25	5.12	5.12	0.69794	.	0.461199	0.24059	N	0.041938	T	0.80369	0.4610	L	0.31526	0.94	0.32355	N	0.557943	B	0.06786	0.001	B	0.14578	0.011	T	0.76024	-0.3110	10	0.17369	T	0.5	.	16.0241	0.80528	0.0:1.0:0.0:0.0	.	256	P46531	NOTC1_HUMAN	Q	256	ENSP00000277541:E256Q	ENSP00000277541:E256Q	E	-	1	0	NOTCH1	138533815	0.453000	0.25721	0.116000	0.21606	0.039000	0.13416	1.990000	0.40717	2.381000	0.81170	0.561000	0.74099	GAA		0.627	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		43	222	0	0	0	0.009718	0	43	222				
GRIN1	2902	broad.mit.edu	37	9	140058266	140058266	+	Silent	SNP	C	C	A	rs146086141	byFrequency	TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr9:140058266C>A	ENST00000371561.3	+	18	3596	c.2499C>A	c.(2497-2499)atC>atA	p.I833I	GRIN1_ENST00000371550.4_Silent_p.I833I|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000315048.3_Silent_p.I833I|GRIN1_ENST00000371559.4_Silent_p.I833I|GRIN1_ENST00000371555.4_Silent_p.I854I|GRIN1_ENST00000371546.4_Silent_p.I854I|GRIN1_ENST00000371553.3_Silent_p.I854I|GRIN1_ENST00000350902.5_Silent_p.I833I|GRIN1_ENST00000371560.3_Silent_p.I854I	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	833					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)	p.I833I(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGATTTTCATCGAGATTGCCT	0.622																																					NSCLC(113;717 1653 2089 20474 37618)	NSCLC(113;717 1653 2089 20474 37618)	uc004clk.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(2497-2499)ATC>ATA		NMDA receptor 1 isoform NR1-3 precursor	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)						81.0	77.0	78.0					9																	140058266		2203	4300	6503	SO:0001819	synonymous_variant	2902				ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding	g.chr9:140058266C>A		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.2499C>A	9.37:g.140058266C>A						GRIN1_uc004cli.1_Silent_p.I508I|GRIN1_uc004clj.1_Silent_p.I830I|GRIN1_uc004cll.2_Silent_p.I833I|GRIN1_uc004clm.2_Silent_p.I833I|GRIN1_uc004cln.2_Silent_p.I851I|GRIN1_uc004clo.2_Silent_p.I851I	p.I833I	NM_007327	NP_015566	Q05586	NMDZ1_HUMAN	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	18	2829	+	all_cancers(76;0.0926)		833			Helical; (Potential).		A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Silent	SNP	ENST00000371561.3	37	c.2499C>A	CCDS7031.1																																																																																				0.622	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327		24	86	1	0	1.33986e-20	0.004656	2.28139e-20	24	86				
ASMT	438	broad.mit.edu	37	X	1755382	1755382	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:1755382G>T	ENST00000381229.4	+	7	791	c.755G>T	c.(754-756)aGg>aTg	p.R252M	ASMT_ENST00000381233.3_Missense_Mutation_p.R205M|ASMT_ENST00000381241.3_Missense_Mutation_p.R280M			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	252					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)	p.R280M(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	ATCCTGGCCAGGGTCCTCCAT	0.552																																							uc004cqd.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(838-840)AGG>ATG		acetylserotonin O-methyltransferase							331.0	294.0	307.0					X																	1755382		2203	4296	6499	SO:0001583	missense	438				melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity	g.chrX:1755382G>T	M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.755G>T	X.37:g.1755382G>T	ENSP00000370627:p.Arg252Met					ASMT_uc010ncy.2_Missense_Mutation_p.R280M|ASMT_uc004cqe.2_Missense_Mutation_p.R205M	p.R280M	NM_004043	NP_004034	P46597	HIOM_HUMAN			9	984	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	252					B2RC33|Q16598|Q5JQ72|Q5JQ73	Missense_Mutation	SNP	ENST00000381229.4	37	c.839G>T		.	.	.	.	.	.	.	.	.	.	.	10.57	1.388386	0.25118	.	.	ENSG00000196433	ENST00000381241;ENST00000381229;ENST00000381233;ENST00000432523	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	2.33	1.43	0.22495	.	0.052138	0.64402	U	0.000001	T	0.40297	0.1111	M	0.75150	2.29	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.13926	-1.0491	10	0.66056	D	0.02	.	7.3181	0.26511	0.2564:0.0:0.7436:0.0	.	205;280	P46597-2;P46597-3	.;.	M	280;252;205;31	ENSP00000370639:R280M;ENSP00000370627:R252M;ENSP00000370631:R205M;ENSP00000392053:R31M	ENSP00000370627:R252M	R	+	2	0	ASMT	1715382	1.000000	0.71417	0.045000	0.18777	0.158000	0.22134	5.195000	0.65131	0.078000	0.16900	0.453000	0.30009	AGG		0.552	ASMT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055612.1	NM_004043		69	255	1	0	5.43229e-20	0.01441	9.19436e-20	69	255				
NLGN4X	57502	broad.mit.edu	37	X	5821792	5821792	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:5821792C>T	ENST00000381095.3	-	5	1554	c.927G>A	c.(925-927)ctG>ctA	p.L309L	NLGN4X_ENST00000381093.2_Silent_p.L329L|NLGN4X_ENST00000538097.1_Silent_p.L309L|NLGN4X_ENST00000381092.1_Silent_p.L309L|NLGN4X_ENST00000275857.6_Silent_p.L309L	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	309					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.L309L(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CCGTGGTGTCCAGCATGTTGC	0.592																																							uc010ndh.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(925-927)CTG>CTA		X-linked neuroligin 4 precursor							173.0	115.0	135.0					X																	5821792		2203	4300	6503	SO:0001819	synonymous_variant	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5821792C>T	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.927G>A	X.37:g.5821792C>T						NLGN4X_uc004crp.2_Silent_p.L329L|NLGN4X_uc004crq.2_Silent_p.L309L|NLGN4X_uc010ndi.2_Silent_p.L346L|NLGN4X_uc004crr.2_Silent_p.L309L|NLGN4X_uc010ndj.2_Silent_p.L309L	p.L309L	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN			5	1428	-			309			Extracellular (Potential).		Q6UX10|Q9ULG0	Silent	SNP	ENST00000381095.3	37	c.927G>A	CCDS14126.1																																																																																				0.592	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		24	102	0	0	0	0.005443	0	24	102				
GPR64	10149	broad.mit.edu	37	X	19046303	19046303	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:19046303G>T	ENST00000379869.3	-	10	575	c.412C>A	c.(412-414)Cag>Aag	p.Q138K	GPR64_ENST00000379878.3_Missense_Mutation_p.Q122K|GPR64_ENST00000379873.2_Missense_Mutation_p.Q138K|GPR64_ENST00000360279.4_Missense_Mutation_p.Q116K|GPR64_ENST00000340581.3_Missense_Mutation_p.Q108K|GPR64_ENST00000357544.3_Missense_Mutation_p.Q108K|GPR64_ENST00000356606.4_Missense_Mutation_p.Q124K|GPR64_ENST00000379876.1_Missense_Mutation_p.Q114K|GPR64_ENST00000357991.3_Missense_Mutation_p.Q135K|GPR64_ENST00000354791.3_Missense_Mutation_p.Q122K	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	138					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.Q135K(1)		breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					AAACTTACCTGGGGAACAGTG	0.254																																							uc004cyx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(412-414)CAG>AAG		G protein-coupled receptor 64 isoform 1							42.0	44.0	44.0					X																	19046303		2190	4250	6440	SO:0001583	missense	10149				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity	g.chrX:19046303G>T	X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.412C>A	X.37:g.19046303G>T	ENSP00000369198:p.Gln138Lys					GPR64_uc004cyy.2_Missense_Mutation_p.Q135K|GPR64_uc004cyz.2_Missense_Mutation_p.Q124K|GPR64_uc004czb.2_Missense_Mutation_p.Q138K|GPR64_uc004czc.2_Missense_Mutation_p.Q122K|GPR64_uc004czd.2_Missense_Mutation_p.Q114K|GPR64_uc004cze.2_Missense_Mutation_p.Q108K|GPR64_uc004czf.2_Missense_Mutation_p.Q100K|GPR64_uc004cza.2_Missense_Mutation_p.Q116K|GPR64_uc004cyw.2_Missense_Mutation_p.Q122K|GPR64_uc010nfj.2_Missense_Mutation_p.Q108K	p.Q138K	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN			10	576	-	Hepatocellular(33;0.183)		138			Extracellular (Potential).		B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Missense_Mutation	SNP	ENST00000379869.3	37	c.412C>A	CCDS43923.1	.	.	.	.	.	.	.	.	.	.	G	9.093	1.002318	0.19121	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606;ENST00000340581;ENST00000397917	T;T;T;T;T;T;T;T;T;T	0.34667	1.43;1.54;1.54;1.55;1.55;1.58;1.55;1.58;1.58;1.35	6.16	4.37	0.52481	.	0.544194	0.16704	N	0.203002	T	0.29126	0.0724	L	0.29908	0.895	0.23665	N	0.997162	B;B;B;B;B;B;B;B;B;B;B	0.22541	0.002;0.071;0.071;0.071;0.071;0.071;0.071;0.071;0.071;0.042;0.042	B;B;B;B;B;B;B;B;B;B;B	0.28916	0.002;0.096;0.096;0.096;0.096;0.096;0.096;0.096;0.096;0.044;0.044	T	0.28902	-1.0029	10	0.87932	D	0	.	9.0323	0.36267	0.0:0.1573:0.6753:0.1674	.	108;100;108;114;122;138;116;124;135;138;122	Q14CE0;Q8IZP9-8;Q8IZP9-7;Q8IZP9-5;Q8IZP9-3;Q8IZP9-9;Q8IZP9-6;Q8IZP9-4;Q8IZP9-2;Q8IZP9;Q14CE1	.;.;.;.;.;.;.;.;.;GPR64_HUMAN;.	K	138;122;122;114;108;138;116;135;124;108;61	ENSP00000369202:Q138K;ENSP00000369207:Q122K;ENSP00000346845:Q122K;ENSP00000369205:Q114K;ENSP00000350152:Q108K;ENSP00000369198:Q138K;ENSP00000353421:Q116K;ENSP00000350680:Q135K;ENSP00000349015:Q124K;ENSP00000344972:Q108K	ENSP00000344972:Q108K	Q	-	1	0	GPR64	18956224	0.998000	0.40836	0.860000	0.33809	0.040000	0.13550	2.046000	0.41260	0.692000	0.31613	0.594000	0.82650	CAG		0.254	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2			15	70	1	0	0.000422831	0.004007	0.000472871	15	70				
MAP3K15	389840	broad.mit.edu	37	X	19398322	19398322	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:19398322C>A	ENST00000338883.4	-	19	2504	c.2505G>T	c.(2503-2505)tgG>tgT	p.W835C	MAP3K15_ENST00000469203.2_Missense_Mutation_p.W667C|MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Missense_Mutation_p.W270C	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	835	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.W310C(1)|p.W882C(1)		NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					AGCCCAGGGACCAGATATCGG	0.542																																							uc004czk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)|stomach(1)|skin(1)	7						c.(928-930)TGG>TGT		mitogen-activated protein kinase kinase kinase							62.0	50.0	54.0					X																	19398322		2202	4300	6502	SO:0001583	missense	389840						ATP binding|MAP kinase kinase kinase activity|metal ion binding	g.chrX:19398322C>A	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2505G>T	X.37:g.19398322C>A	ENSP00000345629:p.Trp835Cys					MAP3K15_uc004czj.1_Missense_Mutation_p.W270C	p.W310C	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN			20	2567	-	Hepatocellular(33;0.183)		835			Protein kinase.		A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	37	c.930G>T		.	.	.	.	.	.	.	.	.	.	C	23.8	4.464390	0.84425	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.46819	0.86;0.86;0.86	5.68	5.68	0.88126	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84088	0.5395	H	0.99609	4.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91695	0.5369	10	0.87932	D	0	.	18.7988	0.92007	0.0:1.0:0.0:0.0	.	310;835	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	C	835;270;667	ENSP00000345629:W835C;ENSP00000352093:W270C;ENSP00000428356:W667C	ENSP00000345629:W835C	W	-	3	0	MAP3K15	19308243	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.426000	0.80270	2.385000	0.81259	0.600000	0.82982	TGG		0.542	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671		6	21	1	0	2.17888e-05	0.006214	2.56312e-05	6	21				
SUPT20HL1	100130302	broad.mit.edu	37	X	24381752	24381752	+	IGR	SNP	C	C	A	rs191671746		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:24381752C>A								AC004552.1 (14729 upstream) : PDK3 (101585 downstream)														p.T399K(1)									TGTGTAGACACGTGGAAAGGC	0.502																																							uc011mjx.1		NA																	1	Substitution - Missense(1)		lung(1)	kidney(1)	1						c.(874-876)ACG>AAG		hypothetical protein LOC100130302							164.0	133.0	142.0					X																	24381752		1568	3582	5150	SO:0001628	intergenic_variant	100130302							g.chrX:24381752C>A																													X.37:g.24381752C>A							p.T292K	NM_001136234	NP_001129706					1	875	+									Missense_Mutation	SNP		37	c.875C>A																																																																																				0	0.502									69	206	1	0	3.94839e-29	0.01441	7.08461e-29	69	206				
MAGEB18	286514	broad.mit.edu	37	X	26157899	26157899	+	Missense_Mutation	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:26157899G>C	ENST00000325250.1	+	2	984	c.797G>C	c.(796-798)cGc>cCc	p.R266P		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	266	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)		p.R266P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						GATCCTCCACGCTATGAATTC	0.498																																							uc004dbq.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(796-798)CGC>CCC		melanoma antigen family B, 18							86.0	70.0	76.0					X																	26157899		2202	4300	6502	SO:0001583	missense	286514						protein binding	g.chrX:26157899G>C	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.797G>C	X.37:g.26157899G>C	ENSP00000314543:p.Arg266Pro						p.R266P	NM_173699	NP_775970	Q96M61	MAGBI_HUMAN			2	984	+			266			MAGE.			Missense_Mutation	SNP	ENST00000325250.1	37	c.797G>C	CCDS14216.1	.	.	.	.	.	.	.	.	.	.	G	8.171	0.791673	0.16258	.	.	ENSG00000176774	ENST00000325250	T	0.05081	3.5	4.56	1.67	0.24075	.	0.472937	0.21520	N	0.073236	T	0.20577	0.0495	M	0.89534	3.04	0.09310	N	1	D	0.58970	0.984	D	0.65233	0.933	T	0.10965	-1.0607	10	0.40728	T	0.16	.	2.2373	0.04011	0.1121:0.1974:0.4959:0.1946	.	266	Q96M61	MAGBI_HUMAN	P	266	ENSP00000314543:R266P	ENSP00000314543:R266P	R	+	2	0	MAGEB18	26067820	0.000000	0.05858	0.000000	0.03702	0.103000	0.19146	0.347000	0.20014	0.218000	0.20820	0.600000	0.82982	CGC		0.498	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699		6	34	0	0	0	0.001984	0	6	34				
ARAF	369	broad.mit.edu	37	X	47426121	47426121	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:47426121C>T	ENST00000377045.4	+	7	835	c.641C>T	c.(640-642)tCc>tTc	p.S214F	ARAF_ENST00000290277.6_Intron	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	214					cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.S214F(1)		biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	CGCTCCACGTCCACTCCCAAC	0.662																																							uc011mlq.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|lung(2)|ovary(1)|skin(1)	7						c.(640-642)TCC>TTC		v-raf murine sarcoma 3611 viral oncogene	Adenosine triphosphate(DB00171)						72.0	58.0	63.0					X																	47426121		2203	4300	6503	SO:0001583	missense	369				intracellular signal transduction|negative regulation of apoptosis|positive regulation of peptidyl-serine phosphorylation		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity	g.chrX:47426121C>T	X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.641C>T	X.37:g.47426121C>T	ENSP00000366244:p.Ser214Phe					ARAF_uc011mln.1_Intron|ARAF_uc011mlo.1_Missense_Mutation_p.S80F|ARAF_uc011mlp.1_Missense_Mutation_p.S214F|ARAF_uc004dic.1_5'UTR	p.S214F	NM_001654	NP_001645	P10398	ARAF_HUMAN			7	774	+			214					P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	ENST00000377045.4	37	c.641C>T	CCDS35232.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718323	0.89205	.	.	ENSG00000078061	ENST00000377045	T	0.77098	-1.07	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.87120	0.6098	M	0.78456	2.415	0.80722	D	1	D;D	0.69078	0.991;0.997	P;D	0.64506	0.823;0.926	D	0.88905	0.3355	10	0.87932	D	0	.	15.4172	0.74980	0.0:1.0:0.0:0.0	.	214;80	P10398;B4DV85	ARAF_HUMAN;.	F	214	ENSP00000366244:S214F	ENSP00000366244:S214F	S	+	2	0	ARAF	47311065	1.000000	0.71417	0.941000	0.38009	0.960000	0.62799	7.334000	0.79224	2.233000	0.73108	0.544000	0.68410	TCC		0.662	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1			15	36	0	0	0	0.004007	0	15	36				
WDR13	64743	broad.mit.edu	37	X	48457296	48457296	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:48457296A>T	ENST00000218056.5	+	2	738	c.233A>T	c.(232-234)tAt>tTt	p.Y78F	WDR13_ENST00000492715.1_3'UTR|WDR13_ENST00000376729.5_Missense_Mutation_p.Y78F	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	78						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Y78F(2)		endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						GCTCGTGCCTATAGCAACAGC	0.662																																							uc004dkh.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(232-234)TAT>TTT		WD repeat domain 13 protein							35.0	25.0	29.0					X																	48457296		2203	4300	6503	SO:0001583	missense	64743					cytoplasm|nucleus		g.chrX:48457296A>T	AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.233A>T	X.37:g.48457296A>T	ENSP00000218056:p.Tyr78Phe					WDR13_uc010nif.1_Intron|WDR13_uc004dki.1_5'UTR|WDR13_uc004dkj.1_Missense_Mutation_p.Y78F|WDR13_uc004dkk.1_5'UTR|WDR13_uc004dkl.3_5'UTR|WDR13_uc011mme.1_5'Flank	p.Y78F	NM_017883	NP_060353	Q9H1Z4	WDR13_HUMAN			3	380	+			78					Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	ENST00000218056.5	37	c.233A>T	CCDS14302.1	.	.	.	.	.	.	.	.	.	.	A	9.345	1.064111	0.20067	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.71579	-0.58;-0.58	4.53	4.53	0.55603	.	0.175915	0.50627	D	0.000108	T	0.55970	0.1954	L	0.36672	1.1	0.28458	N	0.916006	B	0.02656	0.0	B	0.01281	0.0	T	0.41070	-0.9529	10	0.10377	T	0.69	-19.0395	10.7907	0.46432	1.0:0.0:0.0:0.0	.	78	Q9H1Z4	WDR13_HUMAN	F	78	ENSP00000365919:Y78F;ENSP00000218056:Y78F	ENSP00000218056:Y78F	Y	+	2	0	WDR13	48342240	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.749000	0.68704	1.670000	0.50864	0.425000	0.28330	TAT		0.662	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2			11	34	0	0	0	0.008291	0	11	34				
CACNA1F	778	broad.mit.edu	37	X	49063289	49063289	+	Silent	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:49063289C>G	ENST00000376265.2	-	45	5353	c.5292G>C	c.(5290-5292)ggG>ggC	p.G1764G	CACNA1F_ENST00000323022.5_Silent_p.G1753G|CACNA1F_ENST00000376251.1_Silent_p.G1699G	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1764					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.G1764G(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	ACGGGGGAGTCCCTGCCTGCT	0.637																																							uc004dnb.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(3)|ovary(1)|kidney(1)|skin(1)	6						c.(5290-5292)GGG>GGC		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						56.0	54.0	55.0					X																	49063289		2203	4300	6503	SO:0001819	synonymous_variant	778				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chrX:49063289C>G	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5292G>C	X.37:g.49063289C>G						CACNA1F_uc010nip.2_Silent_p.G1753G	p.G1764G	NM_005183	NP_005174	O60840	CAC1F_HUMAN			45	5354	-			1764			Cytoplasmic (Potential).		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	ENST00000376265.2	37	c.5292G>C	CCDS35253.1																																																																																				0.637	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183		12	77	0	0	0	0.003163	0	12	77				
STARD8	9754	broad.mit.edu	37	X	67937356	67937356	+	Silent	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:67937356C>A	ENST00000252336.6	+	5	732	c.360C>A	c.(358-360)gcC>gcA	p.A120A	STARD8_ENST00000374597.3_Silent_p.A120A|STARD8_ENST00000374599.3_Silent_p.A200A	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	120					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.A120A(2)|p.A200A(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						AGGACAAAGCCAAGAAGCGCC	0.632																																							uc004dxa.2		NA																	3	Substitution - coding silent(3)		lung(3)	breast(3)|ovary(2)|pancreas(1)	6						c.(358-360)GCC>GCA		StAR-related lipid transfer (START) domain							62.0	55.0	57.0					X																	67937356		2203	4300	6503	SO:0001819	synonymous_variant	9754				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity	g.chrX:67937356C>A	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.360C>A	X.37:g.67937356C>A						STARD8_uc004dxb.2_Silent_p.A200A|STARD8_uc004dxc.3_Silent_p.A120A	p.A120A	NM_014725	NP_055540	Q92502	STAR8_HUMAN			5	732	+			120					A8K6T2|D3DVT9|Q5JST0|Q68DG7	Silent	SNP	ENST00000252336.6	37	c.360C>A	CCDS14390.1																																																																																				0.632	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		12	107	1	0	0.00136819	0.013537	0.0014833	12	107				
STARD8	9754	broad.mit.edu	37	X	67941413	67941413	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:67941413G>T	ENST00000252336.6	+	9	2416	c.2044G>T	c.(2044-2046)Gcc>Tcc	p.A682S	STARD8_ENST00000374597.3_Missense_Mutation_p.A682S|STARD8_ENST00000374599.3_Missense_Mutation_p.A762S	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	682	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.A682S(2)|p.A762S(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						AGCAGCACAAGCCGCCACCTT	0.562																																							uc004dxa.2		NA																	3	Substitution - Missense(3)		lung(3)	breast(3)|ovary(2)|pancreas(1)	6						c.(2044-2046)GCC>TCC		StAR-related lipid transfer (START) domain							77.0	70.0	72.0					X																	67941413		2203	4300	6503	SO:0001583	missense	9754				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity	g.chrX:67941413G>T	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.2044G>T	X.37:g.67941413G>T	ENSP00000252336:p.Ala682Ser					STARD8_uc004dxb.2_Missense_Mutation_p.A762S|STARD8_uc004dxc.3_Missense_Mutation_p.A682S	p.A682S	NM_014725	NP_055540	Q92502	STAR8_HUMAN			9	2416	+			682			Rho-GAP.		A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	ENST00000252336.6	37	c.2044G>T	CCDS14390.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.023210	0.75275	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.18174	2.23;2.23;2.23	4.15	3.28	0.37604	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.26484	0.0647	L	0.39514	1.22	0.58432	D	0.999996	B;P	0.38395	0.104;0.629	B;P	0.55749	0.166;0.783	T	0.01874	-1.1256	10	0.34782	T	0.22	.	10.2751	0.43506	0.0:0.0:0.8014:0.1986	.	762;682	Q92502-2;Q92502	.;STAR8_HUMAN	S	682;762;682	ENSP00000252336:A682S;ENSP00000363727:A762S;ENSP00000363725:A682S	ENSP00000252336:A682S	A	+	1	0	STARD8	67858138	1.000000	0.71417	0.654000	0.29608	0.929000	0.56500	7.231000	0.78106	0.874000	0.35823	0.600000	0.82982	GCC		0.562	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		19	88	1	0	3.51602e-12	0.008871	5.34472e-12	19	88				
TEX11	56159	broad.mit.edu	37	X	69849576	69849576	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:69849576G>T	ENST00000395889.2	-	19	1693	c.1538C>A	c.(1537-1539)gCa>gAa	p.A513E	TEX11_ENST00000374320.2_Missense_Mutation_p.A188E|TEX11_ENST00000374333.2_Missense_Mutation_p.A498E|TEX11_ENST00000344304.3_Missense_Mutation_p.A513E	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	513					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.A498E(1)		breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					AGTAATTATTGCCTGCAAAGC	0.313																																							uc004dyl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|skin(1)	5						c.(1537-1539)GCA>GAA		testis expressed sequence 11 isoform 1							65.0	60.0	62.0					X																	69849576		2203	4300	6503	SO:0001583	missense	56159						protein binding	g.chrX:69849576G>T	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1538C>A	X.37:g.69849576G>T	ENSP00000379226:p.Ala513Glu					TEX11_uc004dyk.2_Missense_Mutation_p.A188E|TEX11_uc004dym.2_Missense_Mutation_p.A498E	p.A513E	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN			19	1700	-	Renal(35;0.156)		513					A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	37	c.1538C>A	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.938641	0.34189	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	3.77	1.94	0.25998	Tetratricopeptide-like helical (1);	0.308756	0.29459	N	0.012085	T	0.81302	0.4794	M	0.74258	2.255	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.72075	0.976;0.946	T	0.69457	-0.5140	9	.	.	.	-1.4467	5.1353	0.14932	0.2956:0.0:0.7044:0.0	.	498;513	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	E	498;513;188;513	ENSP00000363453:A498E;ENSP00000379226:A513E;ENSP00000363440:A188E;ENSP00000340995:A513E	.	A	-	2	0	TEX11	69766301	0.278000	0.24230	0.116000	0.21606	0.082000	0.17680	1.384000	0.34396	0.248000	0.21435	0.526000	0.51066	GCA		0.313	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			5	62	1	0	0.000602214	0.000602	0.00066431	5	62				
RGAG4	340526	broad.mit.edu	37	X	71350872	71350872	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:71350872G>A	ENST00000545866.1	-	1	886	c.519C>T	c.(517-519)ttC>ttT	p.F173F	RGAG4_ENST00000609883.1_Silent_p.F173F|NHSL2_ENST00000373677.1_5'Flank|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	173								p.F246F(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					GGTCGGCTATGAAGGTCTCTA	0.602																																							uc010nlh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(517-519)TTC>TTT		retrotransposon gag domain containing 4							24.0	26.0	25.0					X																	71350872		1896	4093	5989	SO:0001819	synonymous_variant	340526							g.chrX:71350872G>A	AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.519C>T	X.37:g.71350872G>A						NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA|NHSL2_uc004eak.1_5'Flank	p.F173F	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN			1	880	-	Renal(35;0.156)		173					A7E2W7|Q8NCM4|Q9NPX1	Silent	SNP	ENST00000545866.1	37	c.519C>T	CCDS55446.1																																																																																				0.602	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1	NM_001024455		11	40	0	0	0	0.013537	0	11	40				
RLIM	51132	broad.mit.edu	37	X	73812218	73812218	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:73812218C>A	ENST00000332687.6	-	4	1150	c.932G>T	c.(931-933)gGa>gTa	p.G311V	RLIM_ENST00000349225.2_Missense_Mutation_p.G311V	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	311					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G311V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CTGTCCTGATCCTGTAGATTC	0.478																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)	Esophageal Squamous(169;1899 1923 14997 18818 32118)	uc004ebu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(931-933)GGA>GTA		ring finger protein, LIM domain interacting							57.0	48.0	51.0					X																	73812218		2203	4300	6503	SO:0001583	missense	51132				random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding	g.chrX:73812218C>A	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.932G>T	X.37:g.73812218C>A	ENSP00000328059:p.Gly311Val					RLIM_uc004ebw.2_Missense_Mutation_p.G311V	p.G311V	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN			5	1222	-			311					B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	c.932G>T	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.482604	0.26598	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.08546	3.08;3.08	5.79	3.86	0.44501	.	0.174202	0.49916	D	0.000135	T	0.11324	0.0276	L	0.47716	1.5	0.80722	D	1	D	0.55605	0.972	P	0.44597	0.454	T	0.05435	-1.0885	10	0.56958	D	0.05	-7.5746	15.5711	0.76337	0.0:0.7517:0.2483:0.0	.	311	Q9NVW2	RNF12_HUMAN	V	311	ENSP00000328059:G311V;ENSP00000253571:G311V	ENSP00000328059:G311V	G	-	2	0	RLIM	73728943	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	2.992000	0.49417	2.437000	0.82529	0.600000	0.82982	GGA		0.478	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120		5	57	1	0	3.59834e-05	0.001168	4.18085e-05	5	57				
ABCB7	22	broad.mit.edu	37	X	74273349	74273349	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:74273349C>G	ENST00000373394.3	-	16	2122	c.2115G>C	c.(2113-2115)tgG>tgC	p.W705C	ABCB7_ENST00000339447.4_Missense_Mutation_p.W665C|ABCB7_ENST00000253577.3_Missense_Mutation_p.W706C			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	705	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)	p.W706C(1)		breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						TCTGTGTATGCCACATTTCTG	0.423																																							uc004eca.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2113-2115)TGG>TGC		ATP-binding cassette, sub-family B, member 7							86.0	68.0	74.0					X																	74273349		2202	4300	6502	SO:0001583	missense	22				cellular iron ion homeostasis	integral to membrane|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|heme transporter activity	g.chrX:74273349C>G	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.2115G>C	X.37:g.74273349C>G	ENSP00000362492:p.Trp705Cys					ABCB7_uc004ebz.2_Missense_Mutation_p.W706C|ABCB7_uc011mqn.1_Missense_Mutation_p.W679C|ABCB7_uc010nls.2_Missense_Mutation_p.W666C|ABCB7_uc010nlt.2_Missense_Mutation_p.W665C	p.W705C	NM_004299	NP_004290	O75027	ABCB7_HUMAN			16	2140	-			705			ABC transporter.		G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	ENST00000373394.3	37	c.2115G>C		.	.	.	.	.	.	.	.	.	.	C	21.2	4.110326	0.77210	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	5.76	5.76	0.90799	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.77011	0.4068	L	0.39467	1.215	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.78961	-0.1997	10	0.87932	D	0	-34.1596	17.8445	0.88725	0.0:1.0:0.0:0.0	.	679;665;706;705;706	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	C	679;706;665;705;679	ENSP00000253577:W706C;ENSP00000343849:W665C;ENSP00000362492:W705C;ENSP00000436586:W679C	ENSP00000253577:W706C	W	-	3	0	ABCB7	74190074	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.456000	0.80751	2.433000	0.82419	0.600000	0.82982	TGG		0.423	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	NM_004299		6	40	0	0	0	0.001168	0	6	40				
PABPC5	140886	broad.mit.edu	37	X	90690839	90690839	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:90690839C>T	ENST00000312600.3	+	2	477	c.263C>T	c.(262-264)cCa>cTa	p.P88L	PABPC5_ENST00000373105.1_Intron|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	88	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.P88L(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						AATGGAAAACCATTCCGCCTT	0.473																																							uc004efg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|pancreas(1)	3						c.(262-264)CCA>CTA		poly(A) binding protein, cytoplasmic 5							45.0	39.0	41.0					X																	90690839		2203	4300	6503	SO:0001583	missense	140886					cytoplasm	nucleotide binding|RNA binding	g.chrX:90690839C>T	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.263C>T	X.37:g.90690839C>T	ENSP00000308012:p.Pro88Leu					PABPC5_uc004eff.1_Intron	p.P88L	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN			2	703	+			88			RRM 1.		A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	ENST00000312600.3	37	c.263C>T	CCDS14460.1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.271937	0.59649	.	.	ENSG00000174740	ENST00000312600;ENST00000402906	T	0.16324	2.35	4.43	3.56	0.40772	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.30634	0.0771	M	0.69463	2.115	0.80722	D	1	D	0.59767	0.986	P	0.55455	0.776	T	0.05632	-1.0873	10	0.66056	D	0.02	.	10.7908	0.46432	0.1904:0.8096:0.0:0.0	.	88	Q96DU9	PABP5_HUMAN	L	88;56	ENSP00000308012:P88L	ENSP00000308012:P88L	P	+	2	0	PABPC5	90577495	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.331000	0.79192	1.185000	0.42971	0.600000	0.82982	CCA		0.473	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832		17	76	0	0	0	0.004007	0	17	76				
PABPC5	140886	broad.mit.edu	37	X	90690948	90690948	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:90690948C>A	ENST00000312600.3	+	2	586	c.372C>A	c.(370-372)taC>taA	p.Y124*	PABPC5_ENST00000373105.1_Intron|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	124	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.Y124*(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						CCCTGTTTTACTTATTTTCTG	0.443																																							uc004efg.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|lung(1)|pancreas(1)	3						c.(370-372)TAC>TAA		poly(A) binding protein, cytoplasmic 5							91.0	83.0	86.0					X																	90690948		2203	4300	6503	SO:0001587	stop_gained	140886					cytoplasm	nucleotide binding|RNA binding	g.chrX:90690948C>A	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.372C>A	X.37:g.90690948C>A	ENSP00000308012:p.Tyr124*					PABPC5_uc004eff.1_Intron	p.Y124*	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN			2	812	+			124			RRM 2.		A8K240|Q5JQF4|Q6P529|Q9UFE5	Nonsense_Mutation	SNP	ENST00000312600.3	37	c.372C>A	CCDS14460.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872342	0.91587	.	.	ENSG00000174740	ENST00000312600;ENST00000402906	.	.	.	4.43	-0.733	0.11144	.	0.048575	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	8.3241	0.32147	0.0:0.4405:0.0:0.5595	.	.	.	.	X	124;92	.	ENSP00000308012:Y124X	Y	+	3	2	PABPC5	90577604	0.923000	0.31300	0.975000	0.42487	0.997000	0.91878	0.036000	0.13819	-0.238000	0.09724	0.600000	0.82982	TAC		0.443	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832		40	202	1	0	5.20837e-25	0.00874	9.11465e-25	40	202				
PCDH11X	27328	broad.mit.edu	37	X	91642839	91642839	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:91642839G>T	ENST00000373094.1	+	5	4095	c.3250G>T	c.(3250-3252)Ggc>Tgc	p.G1084C	PCDH11X_ENST00000361655.2_Missense_Mutation_p.G1074C|PCDH11X_ENST00000373097.1_Missense_Mutation_p.G1074C|PCDH11X_ENST00000504220.2_Intron|PCDH11X_ENST00000373088.1_Missense_Mutation_p.G1047C|PCDH11X_ENST00000298274.8_Missense_Mutation_p.G1047C|PCDH11X_ENST00000406881.1_Missense_Mutation_p.G1084C	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1084					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G1084C(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CACATCTCATGGCCTGCCCCT	0.552																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)	2						c.(3250-3252)GGC>TGC		protocadherin 11 X-linked isoform c							189.0	145.0	160.0					X																	91642839		2201	4298	6499	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91642839G>T	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3250G>T	X.37:g.91642839G>T	ENSP00000362186:p.Gly1084Cys					PCDH11X_uc004efl.1_Missense_Mutation_p.G1074C|PCDH11X_uc004efo.1_Missense_Mutation_p.G1047C|PCDH11X_uc010nmv.1_Intron|PCDH11X_uc004efm.1_Missense_Mutation_p.G1084C|PCDH11X_uc004efn.1_Missense_Mutation_p.G1074C	p.G1084C	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN			5	4095	+			1084			Cytoplasmic (Potential).		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.3250G>T	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.666737	0.29604	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.56275	0.64;0.6;0.56;0.51;0.47;0.56	3.56	2.59	0.31030	.	0.318056	0.18341	U	0.144183	T	0.41003	0.1140	N	0.08118	0	0.25173	N	0.99026	P;P;P;P;P	0.51791	0.948;0.948;0.948;0.948;0.913	P;P;P;P;P	0.52424	0.698;0.698;0.698;0.698;0.503	T	0.25082	-1.0142	10	0.87932	D	0	.	9.5349	0.39216	0.0:0.5029:0.4971:0.0	.	1047;1074;1084;1074;1084	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	C	1084;1074;1047;1074;1084;1084;1047	ENSP00000362186:G1084C;ENSP00000362189:G1074C;ENSP00000362180:G1047C;ENSP00000355105:G1074C;ENSP00000384758:G1084C;ENSP00000298274:G1047C	ENSP00000298274:G1047C	G	+	1	0	PCDH11X	91529495	1.000000	0.71417	0.973000	0.42090	0.376000	0.30014	3.707000	0.54838	1.376000	0.46267	0.502000	0.49764	GGC		0.552	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		12	78	1	0	4.36969e-10	0.001855	6.07258e-10	12	78				
SYTL4	94121	broad.mit.edu	37	X	99943410	99943410	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:99943410G>T	ENST00000372989.1	-	12	1274	c.943C>A	c.(943-945)Cac>Aac	p.H315N	SYTL4_ENST00000454200.2_Missense_Mutation_p.H317N|SYTL4_ENST00000455616.1_Missense_Mutation_p.H315N|SYTL4_ENST00000263033.5_Missense_Mutation_p.H315N|SYTL4_ENST00000372981.1_Missense_Mutation_p.H315N|SYTL4_ENST00000276141.6_Missense_Mutation_p.H315N	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	315					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.H315N(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTCACTAGGTGGTCAATGtct	0.388																																							uc004egd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(943-945)CAC>AAC		synaptotagmin-like 4	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						157.0	112.0	127.0					X																	99943410		2203	4300	6503	SO:0001583	missense	94121				exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding	g.chrX:99943410G>T		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.943C>A	X.37:g.99943410G>T	ENSP00000362080:p.His315Asn					SYTL4_uc010nnb.2_5'UTR|SYTL4_uc010nnc.2_Missense_Mutation_p.H315N|SYTL4_uc004ege.3_Missense_Mutation_p.H315N|SYTL4_uc004egf.3_Missense_Mutation_p.H315N|SYTL4_uc004egg.3_Missense_Mutation_p.H315N	p.H315N	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN			12	1299	-			315					Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	c.943C>A	CCDS14472.1	.	.	.	.	.	.	.	.	.	.	G	7.261	0.605261	0.14002	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033;ENST00000372981	T;T;T;T;T;T	0.62232	2.14;2.14;2.13;2.14;2.14;0.04	5.8	3.88	0.44766	.	0.320500	0.39146	N	0.001446	T	0.28034	0.0691	N	0.01576	-0.805	0.30016	N	0.814757	B;B	0.10296	0.003;0.0	B;B	0.08055	0.003;0.0	T	0.17258	-1.0375	9	.	.	.	-19.8686	6.3478	0.21359	0.0995:0.0:0.4825:0.418	.	315;315	Q96C24-2;Q96C24	.;SYTL4_HUMAN	N	315;315;317;315;315;315	ENSP00000362080:H315N;ENSP00000390252:H315N;ENSP00000403556:H317N;ENSP00000276141:H315N;ENSP00000263033:H315N;ENSP00000362072:H315N	.	H	-	1	0	SYTL4	99830066	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	3.145000	0.50623	1.212000	0.43366	-0.295000	0.09555	CAC		0.388	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	NM_080737		11	87	1	0	3.07112e-06	0.010729	3.72874e-06	11	87				
GPRASP1	9737	broad.mit.edu	37	X	101910160	101910161	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:101910160_101910161GG>TT	ENST00000361600.5	+	5	2120_2121	c.1319_1320GG>TT	c.(1318-1320)tGG>tTT	p.W440F	GPRASP1_ENST00000415986.1_Missense_Mutation_p.W440F|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000444152.1_Missense_Mutation_p.W440F|GPRASP1_ENST00000537097.1_Missense_Mutation_p.W440F	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	440					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.W440F(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AGTTGGTTCTGGACTGAAGAAG	0.515																																							uc004ejj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(1318-1320)TGG>TTT		G protein-coupled receptor associated sorting																																				SO:0001583	missense	9737					cytoplasm	protein binding	g.chrX:101910160_101910161GG>TT	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	Exception_encountered	X.37:g.101910160_101910161delinsTT	ENSP00000355146:p.Trp440Phe					GPRASP1_uc004eji.3_Missense_Mutation_p.W440F|GPRASP1_uc010nod.2_Missense_Mutation_p.W440F	p.W440F	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN			5	2120_2121	+			440					O43168|Q96LA1	Missense_Mutation	DNP	ENST00000361600.5	37	c.1319_1320GG>TT	CCDS35352.1																																																																																				0.515	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710		20	203	0	0	0	0.004672	0	20	203				
H2BFWT	158983	broad.mit.edu	37	X	103268141	103268141	+	Missense_Mutation	SNP	C	C	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:103268141C>G	ENST00000217926.5	-	1	118	c.92G>C	c.(91-93)gGa>gCa	p.G31A	H2BFM_ENST00000243297.5_5'Flank	NM_001002916.3	NP_001002916.3	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific	31						membrane (GO:0016020)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G31A(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	16						AGAGGAAGGTCCAGCCATGGC	0.612																																							uc004elr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(91-93)GGA>GCA		H2B histone family, member W, testis-specific							63.0	49.0	53.0					X																	103268141		2203	4300	6503	SO:0001583	missense	158983				nucleosome assembly	nuclear membrane|nucleosome	DNA binding	g.chrX:103268141C>G	BC038109	CCDS35362.1	Xq22.2	2011-01-27			ENSG00000123569	ENSG00000123569		"""Histones / Replication-independent"""	27252	protein-coding gene	gene with protein product		300507				12477932	Standard	NM_001002916		Approved		uc004elr.3	Q7Z2G1	OTTHUMG00000022120	ENST00000217926.5:c.92G>C	X.37:g.103268141C>G	ENSP00000354723:p.Gly31Ala						p.G31A	NM_001002916	NP_001002916	Q7Z2G1	H2BWT_HUMAN			1	116	-			31					B1AK72|Q147W3	Missense_Mutation	SNP	ENST00000217926.5	37	c.92G>C	CCDS35362.1	.	.	.	.	.	.	.	.	.	.	.	6.655	0.489343	0.12641	.	.	ENSG00000123569	ENST00000217926	T	0.21191	2.02	2.44	-3.55	0.04639	.	.	.	.	.	T	0.08133	0.0203	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32295	-0.9912	9	0.28530	T	0.3	.	4.6914	0.12783	0.0:0.3701:0.1687:0.4612	.	31	Q7Z2G1	H2BWT_HUMAN	A	31	ENSP00000354723:G31A	ENSP00000354723:G31A	G	-	2	0	H2BFWT	103154797	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.076000	0.03420	-0.984000	0.03507	-1.187000	0.01702	GGA		0.612	H2BFWT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057756.2	NM_001002916		4	29	0	0	0	0.009096	0	4	29				
NRK	203447	broad.mit.edu	37	X	105150543	105150543	+	Missense_Mutation	SNP	A	A	G			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:105150543A>G	ENST00000243300.9	+	11	1285	c.982A>G	c.(982-984)Agg>Ggg	p.R328G	NRK_ENST00000428173.2_Missense_Mutation_p.R328G	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	328					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R328G(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						GTCATTAACAAGGCATCTTAC	0.303										HNSCC(51;0.14)																													uc004emd.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						c.(982-984)AGG>GGG		Nik related kinase							54.0	43.0	46.0					X																	105150543		1817	4071	5888	SO:0001583	missense	203447						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chrX:105150543A>G	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.982A>G	X.37:g.105150543A>G	ENSP00000434830:p.Arg328Gly	HNSCC(51;0.14)				NRK_uc010npc.1_5'UTR	p.R328G	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN			11	1285	+			328					Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37	c.982A>G		.	.	.	.	.	.	.	.	.	.	A	14.66	2.602949	0.46423	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.78126	1.86;-1.15	5.27	3.95	0.45737	Protein kinase-like domain (1);	0.151066	0.31020	N	0.008402	T	0.54111	0.1838	N	0.08118	0	0.80722	D	1	B	0.19817	0.039	B	0.14023	0.01	T	0.55068	-0.8198	10	0.72032	D	0.01	.	4.0132	0.09632	0.7167:0.0:0.2832:0.0	.	328	Q7Z2Y5	NRK_HUMAN	G	328	ENSP00000434830:R328G;ENSP00000438378:R328G	ENSP00000434830:R328G	R	+	1	2	NRK	105037199	1.000000	0.71417	0.899000	0.35326	0.851000	0.48451	6.065000	0.71176	1.852000	0.53769	0.486000	0.48141	AGG		0.303	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465		2	6	0	0	0	0.004672	0	2	6				
RNF128	79589	broad.mit.edu	37	X	106038880	106038880	+	Missense_Mutation	SNP	C	C	G	rs377271840		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:106038880C>G	ENST00000255499.2	+	7	1474	c.1224C>G	c.(1222-1224)aaC>aaG	p.N408K	RNF128_ENST00000324342.3_Missense_Mutation_p.N382K	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	408					negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N382K(1)|p.N408K(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						ATGTTGACAACCCAACCTTTG	0.338																																							uc004eml.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(1222-1224)AAC>AAG		ring finger protein 128 isoform 1							180.0	178.0	179.0					X																	106038880		2203	4300	6503	SO:0001583	missense	79589					endomembrane system|integral to membrane|perinuclear region of cytoplasm	zinc ion binding	g.chrX:106038880C>G	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.1224C>G	X.37:g.106038880C>G	ENSP00000255499:p.Asn408Lys					RNF128_uc004emk.2_Missense_Mutation_p.N382K	p.N408K	NM_194463	NP_919445	Q8TEB7	RN128_HUMAN			7	1474	+			408					A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Missense_Mutation	SNP	ENST00000255499.2	37	c.1224C>G	CCDS14521.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889078	0.52014	.	.	ENSG00000133135	ENST00000324342;ENST00000255499	T;T	0.11821	2.94;2.74	5.71	3.93	0.45458	.	0.000000	0.64402	D	0.000001	T	0.29524	0.0736	L	0.56769	1.78	0.40393	D	0.979568	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.02625	-1.1132	10	0.66056	D	0.02	.	8.2595	0.31777	0.0:0.8119:0.0:0.1881	.	408;382	Q8TEB7;Q8TEB7-2	RN128_HUMAN;.	K	382;408	ENSP00000316127:N382K;ENSP00000255499:N408K	ENSP00000255499:N408K	N	+	3	2	RNF128	105925536	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.520000	0.35899	1.149000	0.42402	0.594000	0.82650	AAC		0.338	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539		18	264	0	0	0	0.010504	0	18	264				
PRPS1	5631	broad.mit.edu	37	X	106882646	106882646	+	Missense_Mutation	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:106882646G>A	ENST00000372435.4	+	2	366	c.244G>A	c.(244-246)Gcc>Acc	p.A82T	PRPS1_ENST00000372418.1_Missense_Mutation_p.A15T|PRPS1_ENST00000372428.4_Missense_Mutation_p.A15T|PRPS1_ENST00000543248.1_Missense_Mutation_p.A82T|PRPS1_ENST00000372419.3_Missense_Mutation_p.A82T	NM_002764.3	NP_002755.1	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1	82				A -> G (in Ref. 3; BAG35584). {ECO:0000305}.	5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|hypoxanthine biosynthetic process (GO:0046101)|nervous system development (GO:0007399)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|pyrimidine nucleotide biosynthetic process (GO:0006221)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|urate biosynthetic process (GO:0034418)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.A82T(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	23						GATTGCTTCAGCCAGCCGGGT	0.443																																							uc004ene.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|large_intestine(1)	4						c.(244-246)GCC>ACC		phosphoribosyl pyrophosphate synthetase 1							170.0	160.0	163.0					X																	106882646		2203	4300	6503	SO:0001583	missense	5631				5-phosphoribose 1-diphosphate biosynthetic process|hypoxanthine biosynthetic process|nervous system development|nucleoside metabolic process|purine nucleotide biosynthetic process|pyrimidine nucleotide biosynthetic process|ribonucleoside monophosphate biosynthetic process|urate biosynthetic process	cytosol	ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity	g.chrX:106882646G>A	X15331	CCDS14529.1, CCDS76007.1	Xq22.3	2014-09-17			ENSG00000147224	ENSG00000147224	2.7.6.1		9462	protein-coding gene	gene with protein product	"""PRS I"", ""ribose-phosphate diphosphokinase 1"""	311850	"""deafness, X-linked 2, perceptive, congenital"""	DFN2		1962753, 20021999	Standard	NM_002764		Approved	CMTX5, DFNX1	uc004ene.4	P60891	OTTHUMG00000022167	ENST00000372435.4:c.244G>A	X.37:g.106882646G>A	ENSP00000361512:p.Ala82Thr					PRPS1_uc010npg.2_Missense_Mutation_p.A82T|PRPS1_uc011msj.1_Intron	p.A82T	NM_002764	NP_002755	P60891	PRPS1_HUMAN			2	449	+			82					B1ALA8|B2R6T7|B4DNL6|D3DUX6|P09329	Missense_Mutation	SNP	ENST00000372435.4	37	c.244G>A	CCDS14529.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501455	0.85176	.	.	ENSG00000147224	ENST00000372435;ENST00000372428;ENST00000372419;ENST00000543248;ENST00000372418	D;D;D;D;D	0.95724	-3.79;-3.79;-3.79;-3.79;-3.79	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.98482	0.9494	H	0.97918	4.105	0.54753	D	0.999985	P;P	0.50272	0.933;0.933	P;P	0.61201	0.885;0.885	D	0.99818	1.1045	10	0.87932	D	0	.	15.9964	0.80250	0.0:0.0:1.0:0.0	.	82;82	Q53FW2;P60891	.;PRPS1_HUMAN	T	82;15;82;82;15	ENSP00000361512:A82T;ENSP00000361505:A15T;ENSP00000361496:A82T;ENSP00000443185:A82T;ENSP00000361495:A15T	ENSP00000361495:A15T	A	+	1	0	PRPS1	106769302	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.132000	0.71676	2.169000	0.68431	0.600000	0.82982	GCC		0.443	PRPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057840.1			39	315	0	0	0	0.009718	0	39	315				
COL4A6	1288	broad.mit.edu	37	X	107422549	107422549	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:107422549C>A	ENST00000372216.4	-	26	2354	c.2254G>T	c.(2254-2256)Gac>Tac	p.D752Y	COL4A6_ENST00000394872.2_Missense_Mutation_p.D752Y|COL4A6_ENST00000538570.1_Missense_Mutation_p.D751Y|COL4A6_ENST00000545689.1_Missense_Mutation_p.D751Y|COL4A6_ENST00000334504.7_Missense_Mutation_p.D751Y	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	752	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.D751Y(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CCAAAGATGTCACCAGTGGCT	0.547									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	Melanoma(87;1895 1945 2589 7165)	uc004enw.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|urinary_tract(1)|large_intestine(1)	8						c.(2254-2256)GAC>TAC		type IV alpha 6 collagen isoform A precursor							95.0	75.0	82.0					X																	107422549		2203	4300	6503	SO:0001583	missense	1288	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107422549C>A	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2254G>T	X.37:g.107422549C>A	ENSP00000361290:p.Asp752Tyr					COL4A6_uc004env.3_Missense_Mutation_p.D751Y|COL4A6_uc011msn.1_Missense_Mutation_p.D751Y|COL4A6_uc010npk.2_Missense_Mutation_p.D751Y	p.D752Y	NM_001847	NP_001838	Q14031	CO4A6_HUMAN			26	2357	-			752			Triple-helical region.		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	c.2254G>T	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.953264	0.53293	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26;-3.26	4.59	4.59	0.56863	.	0.000000	0.43747	D	0.000529	D	0.95056	0.8399	L	0.43152	1.355	0.49582	D	0.999807	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.997;1.0;1.0	D	0.94943	0.8093	10	0.45353	T	0.12	.	17.3695	0.87372	0.0:1.0:0.0:0.0	.	751;751;752;751	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	Y	752;751;752;751;751;751	ENSP00000361290:D752Y;ENSP00000334733:D751Y;ENSP00000378340:D752Y;ENSP00000443707:D751Y;ENSP00000445236:D751Y	ENSP00000334733:D751Y	D	-	1	0	COL4A6	107309205	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.890000	0.56220	2.223000	0.72356	0.523000	0.50628	GAC		0.547	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			13	135	1	0	5.50884e-06	0.013537	6.58968e-06	13	135				
COL4A5	1287	broad.mit.edu	37	X	107842032	107842032	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:107842032C>T	ENST00000361603.2	+	25	2124	c.1880C>T	c.(1879-1881)cCt>cTt	p.P627L	COL4A5_ENST00000328300.6_Missense_Mutation_p.P627L	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	627	Triple-helical region.			FGPP -> LALQ (in Ref. 5; AAA99480). {ECO:0000305}.	axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.P627L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGTTTCGGCCCTCCAGGCCCA	0.517									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(1879-1881)CCT>CTT		type IV collagen alpha 5 isoform 2 precursor							75.0	78.0	77.0					X																	107842032		2203	4300	6503	SO:0001583	missense	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107842032C>T	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.1880C>T	X.37:g.107842032C>T	ENSP00000354505:p.Pro627Leu					COL4A5_uc011mso.1_Missense_Mutation_p.P627L|COL4A5_uc004eob.1_Missense_Mutation_p.P235L	p.P627L	NM_033380	NP_203699	P29400	CO4A5_HUMAN			25	2082	+			627	FGPP -> LALQ (in Ref. 5; AAA99480).		Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	c.1880C>T	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.272136	0.23221	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.96685	-4.09;-4.09	5.93	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.90683	0.7077	N	0.17901	0.54	0.80722	D	1	B;B;B	0.16603	0.018;0.006;0.018	B;B;B	0.16289	0.015;0.011;0.015	D	0.83779	0.0224	10	0.13108	T	0.6	.	11.8845	0.52594	0.0:0.8559:0.0:0.1441	.	627;235;627	E7EVY4;Q49AM6;P29400	.;.;CO4A5_HUMAN	L	627	ENSP00000331902:P627L;ENSP00000354505:P627L	ENSP00000331902:P627L	P	+	2	0	COL4A5	107728688	0.816000	0.29132	1.000000	0.80357	0.979000	0.70002	1.832000	0.39151	0.643000	0.30638	0.600000	0.82982	CCT		0.517	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			12	120	0	0	0	0.00245	0	12	120				
KCNE1L	23630	broad.mit.edu	37	X	108867958	108867958	+	Missense_Mutation	SNP	A	A	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:108867958A>T	ENST00000372101.2	-	1	435	c.292T>A	c.(292-294)Tgc>Agc	p.C98S		NM_012282.2	NP_036414.1	Q9UJ90	KCE1L_HUMAN	KCNE1-like	98					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)	p.C98S(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						TGCTCGGCGCAAGCCTGGGAC	0.721																																							uc004eoh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(292-294)TGC>AGC		potassium voltage-gated channel, Isk-related							13.0	12.0	12.0					X																	108867958		2189	4280	6469	SO:0001583	missense	23630				regulation of heart contraction	voltage-gated potassium channel complex		g.chrX:108867958A>T	AJ012743	CCDS14547.1	Xq22.3	2008-02-05	2004-06-09		ENSG00000176076	ENSG00000176076		"""Potassium channels"""	6241	protein-coding gene	gene with protein product		300328	"""potassium voltage-gated channel, Isk-related family, member 1-like"""			10493825	Standard	NM_012282		Approved		uc004eoh.3	Q9UJ90	OTTHUMG00000022189	ENST00000372101.2:c.292T>A	X.37:g.108867958A>T	ENSP00000361173:p.Cys98Ser						p.C98S	NM_012282	NP_036414	Q9UJ90	KCE1L_HUMAN			1	436	-			98			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000372101.2	37	c.292T>A	CCDS14547.1	.	.	.	.	.	.	.	.	.	.	a	2.876	-0.232813	0.05983	.	.	ENSG00000176076	ENST00000372101	T	0.70516	-0.49	4.97	3.79	0.43588	.	0.309228	0.28236	N	0.016094	T	0.57548	0.2061	L	0.36672	1.1	0.21579	N	0.999639	B	0.02656	0.0	B	0.06405	0.002	T	0.34204	-0.9838	10	0.12103	T	0.63	-10.2853	12.6795	0.56914	0.8727:0.0:0.0:0.1273	.	98	Q9UJ90	KCE1L_HUMAN	S	98	ENSP00000361173:C98S	ENSP00000361173:C98S	C	-	1	0	KCNE1L	108754614	1.000000	0.71417	0.270000	0.24601	0.051000	0.14879	3.939000	0.56591	0.268000	0.21939	-1.654000	0.00755	TGC		0.721	KCNE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057892.1	NM_012282		3	25	0	0	0	0.000602	0	3	25				
HTR2C	3358	broad.mit.edu	37	X	114141546	114141546	+	Silent	SNP	T	T	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:114141546T>A	ENST00000276198.1	+	6	1673	c.945T>A	c.(943-945)atT>atA	p.I315I	HTR2C_ENST00000371951.1_Silent_p.I315I|HTR2C_ENST00000371950.3_3'UTR	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	315					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.I315I(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TCCTTGGGATTGTTTTCTTTG	0.433																																							uc004epu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(943-945)ATT>ATA		5-hydroxytryptamine (serotonin) receptor 2C	Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)						199.0	173.0	182.0					X																	114141546		2203	4300	6503	SO:0001819	synonymous_variant	3358				cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity	g.chrX:114141546T>A		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.945T>A	X.37:g.114141546T>A						HTR2C_uc010nqc.1_Silent_p.I315I|HTR2C_uc004epv.1_3'UTR	p.I315I	NM_000868	NP_000859	P28335	5HT2C_HUMAN			6	1673	+			315			Helical; Name=6; (By similarity).		B1AMW4|Q5VUF8|Q9NP28	Silent	SNP	ENST00000276198.1	37	c.945T>A	CCDS14564.1																																																																																				0.433	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868		10	298	0	0	0	0.006214	0	10	298				
CXorf56	63932	broad.mit.edu	37	X	118673720	118673720	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:118673720C>A	ENST00000371594.4	-	7	717	c.639G>T	c.(637-639)aaG>aaT	p.K213N	CXorf56_ENST00000469448.1_5'UTR|CXorf56_ENST00000320339.4_Missense_Mutation_p.K164N|CXorf56_ENST00000536133.1_Missense_Mutation_p.K199N	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	213								p.K213N(1)		cervix(1)|endometrium(2)|lung(7)	10						TCAAGGTCCCCTTCATTTTCG	0.368																																							uc004erk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(637-639)AAG>AAT		hypothetical protein LOC63932							133.0	113.0	120.0					X																	118673720		2203	4300	6503	SO:0001583	missense	63932						protein binding	g.chrX:118673720C>A	AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.639G>T	X.37:g.118673720C>A	ENSP00000360652:p.Lys213Asn					uc004eri.2_5'Flank|CXorf56_uc004erj.1_Missense_Mutation_p.K164N|CXorf56_uc011mtu.1_Missense_Mutation_p.K199N	p.K213N	NM_022101	NP_071384	Q9H5V9	CX056_HUMAN			7	685	-			213			Potential.		A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Missense_Mutation	SNP	ENST00000371594.4	37	c.639G>T	CCDS14579.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.746283	0.49257	.	.	ENSG00000018610	ENST00000486230;ENST00000320339;ENST00000371594;ENST00000536133;ENST00000476164	T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82	5.04	3.97	0.46021	.	0.101827	0.64402	D	0.000003	T	0.18800	0.0451	L	0.34521	1.04	0.40363	D	0.979264	P;P	0.40660	0.675;0.726	B;B	0.40565	0.265;0.333	T	0.03121	-1.1070	10	0.87932	D	0	-11.5971	6.1501	0.20306	0.0:0.7088:0.0:0.2912	.	199;213	F5GWL7;Q9H5V9	.;CX056_HUMAN	N	213;164;213;199;213	ENSP00000420787:K213N;ENSP00000320345:K164N;ENSP00000360652:K213N;ENSP00000441786:K199N;ENSP00000420635:K213N	ENSP00000320345:K164N	K	-	3	2	CXorf56	118557748	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.431000	0.21444	2.088000	0.63022	0.600000	0.82982	AAG		0.368	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022101		7	57	1	0	0.00307968	0.00308	0.0033009	7	57				
SEPT6	23157	broad.mit.edu	37	X	118771019	118771019	+	Silent	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:118771019C>T	ENST00000343984.5	-	7	1191	c.927G>A	c.(925-927)aaG>aaA	p.K309K	SEPT6_ENST00000489216.1_Silent_p.K309K|SEPT6_ENST00000394610.1_Silent_p.K309K|SEPT6_ENST00000394617.2_Silent_p.K339K|SEPT6_ENST00000360156.7_Silent_p.K309K|SEPT6_ENST00000354416.3_Silent_p.K309K|SEPT6_ENST00000394616.4_Silent_p.K251K|SEPT6_ENST00000354228.4_Silent_p.K309K	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6	309					cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)	p.K309K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						GGTCGGTGTCCTTGAAGCCCA	0.612			T	MLL	AML																																		uc004erv.2		NA		Dom	yes		X	Xq24	23157		septin 6			L					1	Substitution - coding silent(1)		lung(1)	lung(1)|ovary(1)|prostate(1)|kidney(1)	4						c.(925-927)AAG>AAA		septin 6 isoform B							124.0	87.0	100.0					X																	118771019		2203	4300	6503	SO:0001819	synonymous_variant	23157				cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding	g.chrX:118771019C>T	D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.927G>A	X.37:g.118771019C>T						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Silent_p.K309K|SEPT6_uc004ert.2_Silent_p.K309K|SEPT6_uc004eru.2_Silent_p.K309K|SEPT6_uc004erw.2_Silent_p.K251K|SEPT6_uc011mtv.1_Silent_p.K251K|SEPT6_uc011mtw.1_Silent_p.K339K	p.K309K	NM_015129	NP_055944	Q14141	SEPT6_HUMAN			7	1192	-			309					Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	Silent	SNP	ENST00000343984.5	37	c.927G>A	CCDS14584.1																																																																																				0.612	SEPT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058059.1	NM_145802		10	85	0	0	0	0.013537	0	10	85				
SEPT6	23157	broad.mit.edu	37	X	118783987	118783987	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:118783987G>A	ENST00000343984.5	-	5	867	c.603C>T	c.(601-603)atC>atT	p.I201I	SEPT6_ENST00000489216.1_Silent_p.I201I|SEPT6_ENST00000394610.1_Silent_p.I201I|SEPT6_ENST00000394617.2_Silent_p.I231I|SEPT6_ENST00000360156.7_Silent_p.I201I|SEPT6_ENST00000354416.3_Silent_p.I201I|SEPT6_ENST00000394616.4_Silent_p.I143I|SEPT6_ENST00000354228.4_Silent_p.I201I	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6	201	Septin-type G.				cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)	p.I201I(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						GCTCGCTGGTGATTTTGATTT	0.488			T	MLL	AML																																		uc004erv.2		NA		Dom	yes		X	Xq24	23157		septin 6			L					1	Substitution - coding silent(1)		lung(1)	lung(1)|ovary(1)|prostate(1)|kidney(1)	4						c.(601-603)ATC>ATT		septin 6 isoform B							251.0	200.0	217.0					X																	118783987		2203	4300	6503	SO:0001819	synonymous_variant	23157				cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding	g.chrX:118783987G>A	D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.603C>T	X.37:g.118783987G>A						SEPT6_uc010nqk.2_RNA|SEPT6_uc004ers.2_Silent_p.I201I|SEPT6_uc004ert.2_Silent_p.I201I|SEPT6_uc004eru.2_Silent_p.I201I|SEPT6_uc004erw.2_Silent_p.I143I|SEPT6_uc011mtv.1_Silent_p.I143I|SEPT6_uc011mtw.1_Silent_p.I231I	p.I201I	NM_015129	NP_055944	Q14141	SEPT6_HUMAN			5	868	-			201					Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	Silent	SNP	ENST00000343984.5	37	c.603C>T	CCDS14584.1																																																																																				0.488	SEPT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058059.1	NM_145802		50	280	0	0	0	0.01441	0	50	280				
ARHGAP36	158763	broad.mit.edu	37	X	130220349	130220349	+	Missense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:130220349C>T	ENST00000276211.5	+	10	1673	c.1328C>T	c.(1327-1329)tCc>tTc	p.S443F	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.S307F|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.S431F	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	443					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.S443F(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GTGTGGAAGTCCAGCCCGGAA	0.463																																							uc004evz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1327-1329)TCC>TTC		hypothetical protein LOC158763 precursor							108.0	99.0	102.0					X																	130220349		2203	4300	6503	SO:0001583	missense	158763				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chrX:130220349C>T		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1328C>T	X.37:g.130220349C>T	ENSP00000276211:p.Ser443Phe					ARHGAP36_uc004ewa.2_Missense_Mutation_p.S431F|ARHGAP36_uc004ewb.2_Missense_Mutation_p.S412F|ARHGAP36_uc004ewc.2_Missense_Mutation_p.S307F	p.S443F	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN			10	1673	+			443					B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	c.1328C>T	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	C	7.606	0.673825	0.14841	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.11277	2.8;2.8;2.81;2.79	4.69	3.81	0.43845	.	0.161017	0.29956	N	0.010775	T	0.06600	0.0169	N	0.08118	0	0.46241	D	0.998945	P;P;B	0.40794	0.514;0.729;0.38	B;B;B	0.41236	0.351;0.351;0.191	T	0.35992	-0.9766	10	0.87932	D	0	.	9.1654	0.37048	0.217:0.783:0.0:0.0	.	412;431;443	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	F	443;431;412;307	ENSP00000276211:S443F;ENSP00000359960:S431F;ENSP00000408515:S412F;ENSP00000359959:S307F	ENSP00000276211:S443F	S	+	2	0	ARHGAP36	130048030	1.000000	0.71417	0.999000	0.59377	0.097000	0.18754	1.949000	0.40313	1.068000	0.40764	-0.224000	0.12420	TCC		0.463	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967		11	106	0	0	0	0.010729	0	11	106				
IGSF1	3547	broad.mit.edu	37	X	130407900	130407900	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:130407900G>T	ENST00000361420.3	-	20	3960	c.3881C>A	c.(3880-3882)tCa>tAa	p.S1294*	IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Nonsense_Mutation_p.S1285*|IGSF1_ENST00000370903.3_Nonsense_Mutation_p.S1299*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.S1285*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1294					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.S1294*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GTCTGTCTCTGAGCCTCTATG	0.478																																							uc004ewd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|lung(1)|central_nervous_system(1)	5						c.(3880-3882)TCA>TAA		immunoglobulin superfamily, member 1 isoform 1							147.0	138.0	141.0					X																	130407900		2203	4300	6503	SO:0001587	stop_gained	3547				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding	g.chrX:130407900G>T	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3881C>A	X.37:g.130407900G>T	ENSP00000355010:p.Ser1294*					IGSF1_uc004ewe.3_Nonsense_Mutation_p.S1288*|IGSF1_uc004ewf.2_Nonsense_Mutation_p.S1274*	p.S1294*	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN			20	4119	-			1294			Extracellular (Potential).		B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	ENST00000361420.3	37	c.3881C>A	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	G	40	8.102708	0.98654	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	4.1	4.1	0.47936	.	0.000000	0.39615	N	0.001320	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6983	0.45911	0.0:0.0:1.0:0.0	.	.	.	.	X	1285;1294;1285;1299	.	ENSP00000355010:S1294X	S	-	2	0	IGSF1	130235581	1.000000	0.71417	0.993000	0.49108	0.668000	0.39293	3.817000	0.55668	2.287000	0.76781	0.544000	0.68410	TCA		0.478	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			41	388	1	0	1.62957e-23	0.00874	2.84298e-23	41	388				
PLAC1	10761	broad.mit.edu	37	X	133700520	133700520	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:133700520G>T	ENST00000359237.4	-	3	478	c.193C>A	c.(193-195)Cat>Aat	p.H65N	PLAC1_ENST00000476971.1_5'UTR	NM_021796.3	NP_068568.1			placenta-specific 1									p.H65N(1)		large_intestine(4)|lung(1)|pancreas(1)	6	Acute lymphoblastic leukemia(192;0.000127)					GGCTGAACATGGTTTGGGGGG	0.502																																							uc004exo.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(193-195)CAT>AAT		placenta-specific 1 precursor							229.0	194.0	206.0					X																	133700520		2203	4300	6503	SO:0001583	missense	10761				placenta development	extracellular region		g.chrX:133700520G>T	AF234654	CCDS14642.1	Xq26.3	2013-10-14			ENSG00000170965	ENSG00000170965			9044	protein-coding gene	gene with protein product	"""cancer/testis antigen 92"""	300296				10995572	Standard	NM_021796		Approved	CT92, OOSP2L	uc004exo.1	Q9HBJ0	OTTHUMG00000022457	ENST00000359237.4:c.193C>A	X.37:g.133700520G>T	ENSP00000352173:p.His65Asn					PLAC1_uc004exp.1_Missense_Mutation_p.H65N	p.H65N	NM_021796	NP_068568	Q9HBJ0	PLAC1_HUMAN			3	479	-	Acute lymphoblastic leukemia(192;0.000127)		65						Missense_Mutation	SNP	ENST00000359237.4	37	c.193C>A	CCDS14642.1	.	.	.	.	.	.	.	.	.	.	G	9.768	1.171957	0.21704	.	.	ENSG00000170965	ENST00000359237	T	0.81415	-1.49	4.25	0.481	0.16809	.	0.750556	0.11535	N	0.554336	D	0.84147	0.5408	M	0.72479	2.2	0.09310	N	1	D	0.69078	0.997	P	0.58780	0.845	T	0.72235	-0.4352	10	0.62326	D	0.03	-13.4163	6.676	0.23093	0.4198:0.0:0.5802:0.0	.	65	Q9HBJ0	PLAC1_HUMAN	N	65	ENSP00000352173:H65N	ENSP00000352173:H65N	H	-	1	0	PLAC1	133528186	0.560000	0.26570	0.010000	0.14722	0.029000	0.11900	0.311000	0.19380	-0.048000	0.13401	-0.208000	0.12717	CAT		0.502	PLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058375.1	NM_021796		29	205	1	0	7.26314e-15	0.007291	1.15034e-14	29	205				
CT45A5	441521	broad.mit.edu	37	X	134947928	134947928	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:134947928C>A	ENST00000463085.2	-	3	486	c.397G>T	c.(397-399)Gaa>Taa	p.E133*	CT45A4_ENST00000420087.2_Intron|CT45A5_ENST00000491480.1_Nonsense_Mutation_p.E133*|CT45A5_ENST00000370724.3_Nonsense_Mutation_p.E133*			Q6NSH3	CT455_HUMAN	cancer/testis antigen family 45, member A5	133								p.E133*(1)		endometrium(1)|large_intestine(2)|lung(6)	9						CATCGGATTTCCTTCACTACT	0.388																																							uc004eze.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(397-399)GAA>TAA		cancer/testis antigen family 45, member A5							209.0	174.0	186.0					X																	134947928		2188	4266	6454	SO:0001587	stop_gained	441521							g.chrX:134947928C>A	AY743713	CCDS35406.1	Xq26.3	2009-03-12				ENSG00000269586			33270	protein-coding gene	gene with protein product	"""cancer/testis antigen CT45-5"""	300796				15905330	Standard	XM_006724759		Approved	CT45-5, CT45.5	uc022ces.1	Q6NSH3		ENST00000463085.2:c.397G>T	X.37:g.134947928C>A	ENSP00000424778:p.Glu133*					CT45A5_uc011mvu.1_Nonsense_Mutation_p.E133*	p.E133*	NM_001007551	NP_001007552	Q6NSH3	CT455_HUMAN			3	642	-			133					A8K842|B7ZMC5	Nonsense_Mutation	SNP	ENST00000463085.2	37	c.397G>T	CCDS35406.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.863292	0.32884	.	.	ENSG00000242284	ENST00000370724;ENST00000491480	.	.	.	2.4	1.46	0.22682	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-3.4548	5.7026	0.17891	0.3195:0.6805:0.0:0.0	.	.	.	.	X	133	.	ENSP00000359759:E133X	E	-	1	0	CT45A5	134775594	0.998000	0.40836	0.013000	0.15412	0.005000	0.04900	2.054000	0.41335	0.206000	0.20587	0.365000	0.22127	GAA		0.388	CT45A5-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472589.1	NM_001007551		21	177	1	0	5.35356e-11	0.00278	7.72384e-11	21	177				
GPR112	139378	broad.mit.edu	37	X	135432071	135432071	+	Missense_Mutation	SNP	C	C	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:135432071C>A	ENST00000394143.1	+	6	6497	c.6206C>A	c.(6205-6207)aCc>aAc	p.T2069N	GPR112_ENST00000287534.4_Missense_Mutation_p.T2006N|GPR112_ENST00000370652.1_Missense_Mutation_p.T2069N|GPR112_ENST00000394141.1_Missense_Mutation_p.T1864N|GPR112_ENST00000412101.1_Missense_Mutation_p.T1864N	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2069					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T2069N(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACCATACTCACCCGAACCATT	0.443																																							uc004ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(6205-6207)ACC>AAC		G-protein coupled receptor 112							276.0	198.0	225.0					X																	135432071		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135432071C>A	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6206C>A	X.37:g.135432071C>A	ENSP00000377699:p.Thr2069Asn					GPR112_uc010nsb.1_Missense_Mutation_p.T1864N|GPR112_uc010nsc.1_Missense_Mutation_p.T1836N	p.T2069N	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	6497	+	Acute lymphoblastic leukemia(192;0.000127)		2069			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.6206C>A	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	c	9.682	1.149486	0.21288	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.37411	1.3;1.3;1.26;1.2;1.26	3.59	1.71	0.24356	.	.	.	.	.	T	0.20618	0.0496	L	0.29908	0.895	0.09310	N	1	B;B;B	0.32781	0.1;0.025;0.384	B;B;B	0.23716	0.021;0.008;0.048	T	0.20371	-1.0277	9	0.72032	D	0.01	.	3.1693	0.06546	0.266:0.5873:0.0:0.1468	.	2006;1864;2069	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	N	2069;2069;1864;2006;1864	ENSP00000377699:T2069N;ENSP00000359686:T2069N;ENSP00000416526:T1864N;ENSP00000287534:T2006N;ENSP00000377697:T1864N	ENSP00000287534:T2006N	T	+	2	0	GPR112	135259737	0.000000	0.05858	0.001000	0.08648	0.089000	0.18198	0.041000	0.13927	0.664000	0.31047	0.525000	0.51046	ACC		0.443	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			17	186	1	0	7.07596e-05	0.006122	8.1216e-05	17	186				
VGLL1	51442	broad.mit.edu	37	X	135618242	135618242	+	Silent	SNP	G	G	A			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:135618242G>A	ENST00000370634.3	+	2	233	c.63G>A	c.(61-63)acG>acA	p.T21T		NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	21					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.T21T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					CTATAAAGACGGAATGGAATT	0.493																																							uc004ezy.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(61-63)ACG>ACA		vestigial like 1							101.0	96.0	98.0					X																	135618242		2203	4300	6503	SO:0001819	synonymous_variant	51442				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	transcription coactivator activity	g.chrX:135618242G>A	AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.63G>A	X.37:g.135618242G>A							p.T21T	NM_016267	NP_057351	Q99990	VGLL1_HUMAN			2	233	+	Acute lymphoblastic leukemia(192;0.000127)		21					Q5H915	Silent	SNP	ENST00000370634.3	37	c.63G>A	CCDS14658.1																																																																																				0.493	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	NM_016267		6	115	0	0	0	0.00308	0	6	115				
CXorf66	347487	broad.mit.edu	37	X	139038299	139038299	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:139038299G>T	ENST00000370540.1	-	3	865	c.842C>A	c.(841-843)cCt>cAt	p.P281H		NM_001013403.2	NP_001013421.1	Q5JRM2	CX066_HUMAN	chromosome X open reading frame 66	281						integral component of membrane (GO:0016021)		p.P281H(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|skin(1)|stomach(1)	26						ATTGACCAAAGGCCTATAAGT	0.398																																							uc004fbb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(841-843)CCT>CAT		hypothetical protein LOC347487 precursor							135.0	120.0	125.0					X																	139038299		2203	4300	6503	SO:0001583	missense	347487					integral to membrane		g.chrX:139038299G>T		CCDS35411.1	Xq27.1	2014-05-30			ENSG00000203933	ENSG00000203933			33743	protein-coding gene	gene with protein product	"""secreted glycoprotein, X-linked"""					24709545	Standard	NM_001013403		Approved	RP11-35F15.2, SGPX	uc004fbb.3	Q5JRM2	OTTHUMG00000022539	ENST00000370540.1:c.842C>A	X.37:g.139038299G>T	ENSP00000359571:p.Pro281His						p.P281H	NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN			3	864	-			281			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000370540.1	37	c.842C>A	CCDS35411.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654680	0.29425	.	.	ENSG00000203933	ENST00000370540	T	0.46451	0.87	4.21	-0.373	0.12516	.	1.117110	0.06856	N	0.798297	T	0.27697	0.0681	L	0.32530	0.975	0.09310	N	1	P	0.36483	0.555	B	0.35971	0.215	T	0.17471	-1.0368	9	.	.	.	9.1613	3.0347	0.06118	0.4287:0.0:0.3741:0.1972	.	281	Q5JRM2	CX066_HUMAN	H	281	ENSP00000359571:P281H	.	P	-	2	0	CXorf66	138865965	0.003000	0.15002	0.000000	0.03702	0.006000	0.05464	0.712000	0.25779	-0.196000	0.10366	-0.239000	0.12128	CCT		0.398	CXorf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058572.1	NM_001013403		18	219	1	0	3.52763e-06	0.00499	4.27386e-06	18	219				
SLITRK2	84631	broad.mit.edu	37	X	144904139	144904139	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:144904139C>T	ENST00000370490.1	+	1	4451	c.196C>T	c.(196-198)Cag>Tag	p.Q66*	SLITRK2_ENST00000434188.2_Nonsense_Mutation_p.Q66*|SLITRK2_ENST00000413937.2_Nonsense_Mutation_p.Q66*|SLITRK2_ENST00000447897.2_Nonsense_Mutation_p.Q66*|SLITRK2_ENST00000428560.2_Nonsense_Mutation_p.Q66*			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	66					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.Q66*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TCGAATCTATCAGCTTTTTCT	0.433																																							uc004fcd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(196-198)CAG>TAG		SLIT and NTRK-like family, member 2 precursor							90.0	83.0	85.0					X																	144904139		2203	4300	6503	SO:0001587	stop_gained	84631					integral to membrane		g.chrX:144904139C>T	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.196C>T	X.37:g.144904139C>T	ENSP00000359521:p.Gln66*					SLITRK2_uc010nsp.2_Nonsense_Mutation_p.Q66*|SLITRK2_uc010nso.2_Nonsense_Mutation_p.Q66*|SLITRK2_uc011mwq.1_Nonsense_Mutation_p.Q66*|SLITRK2_uc011mwr.1_Nonsense_Mutation_p.Q66*|SLITRK2_uc011mws.1_Nonsense_Mutation_p.Q66*|SLITRK2_uc004fcg.2_Nonsense_Mutation_p.Q66*|SLITRK2_uc011mwt.1_Nonsense_Mutation_p.Q66*	p.Q66*	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN			5	1186	+	Acute lymphoblastic leukemia(192;6.56e-05)		66			Extracellular (Potential).|LRR 1.		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Nonsense_Mutation	SNP	ENST00000370490.1	37	c.196C>T	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	C	59	35.535783	0.99982	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-7.3337	14.8435	0.70243	0.0:1.0:0.0:0.0	.	.	.	.	X	66	.	ENSP00000334374:Q66X	Q	+	1	0	SLITRK2	144711831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.920000	0.70017	2.087000	0.62958	0.600000	0.82982	CAG		0.433	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		26	157	0	0	0	0.004656	0	26	157				
AFF2	2334	broad.mit.edu	37	X	148037249	148037249	+	Silent	SNP	G	G	C			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:148037249G>C	ENST00000370460.2	+	11	2153	c.1674G>C	c.(1672-1674)ctG>ctC	p.L558L	AFF2_ENST00000370457.5_Silent_p.L525L|AFF2_ENST00000342251.3_Silent_p.L525L|AFF2_ENST00000286437.5_Silent_p.L199L	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	558					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.L558L(4)|p.L199L(2)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CTATTTCTCTGCCTCCTCCAA	0.458																																							uc004fcp.2		NA																	6	Substitution - coding silent(6)		lung(6)	ovary(3)|pancreas(2)	5						c.(1672-1674)CTG>CTC		fragile X mental retardation 2							197.0	209.0	205.0					X																	148037249		2203	4300	6503	SO:0001819	synonymous_variant	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148037249G>C	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1674G>C	X.37:g.148037249G>C						AFF2_uc004fcq.2_Silent_p.L548L|AFF2_uc004fcr.2_Silent_p.L519L|AFF2_uc011mxb.1_Silent_p.L523L|AFF2_uc004fcs.2_Silent_p.L525L|AFF2_uc011mxc.1_Silent_p.L199L	p.L558L	NM_002025	NP_002016	P51816	AFF2_HUMAN			11	2153	+	Acute lymphoblastic leukemia(192;6.56e-05)		558					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	c.1674G>C	CCDS14684.1																																																																																				0.458	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		103	520	0	0	0	0.01441	0	103	520				
PDZD4	57595	broad.mit.edu	37	X	153068961	153068961	+	Missense_Mutation	SNP	G	G	T			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chrX:153068961G>T	ENST00000164640.4	-	8	2348	c.2157C>A	c.(2155-2157)aaC>aaA	p.N719K	PDZD4_ENST00000544474.1_Missense_Mutation_p.N610K|PDZD4_ENST00000393758.2_Missense_Mutation_p.N644K|PDZD4_ENST00000475140.1_5'Flank	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	719						cytoplasm (GO:0005737)		p.N719K(1)		breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGCAATGATGTTGAGCTCGG	0.622																																							uc004fiz.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(2155-2157)AAC>AAA		PDZ domain containing 4							161.0	118.0	133.0					X																	153068961		2203	4300	6503	SO:0001583	missense	57595					cell cortex		g.chrX:153068961G>T	AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.2157C>A	X.37:g.153068961G>T	ENSP00000164640:p.Asn719Lys					PDZD4_uc004fiy.1_Missense_Mutation_p.N644K|PDZD4_uc004fix.2_Missense_Mutation_p.N623K|PDZD4_uc004fja.1_Missense_Mutation_p.N725K|PDZD4_uc011mze.1_Missense_Mutation_p.N610K	p.N719K	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN			8	2407	-	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		719					B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Missense_Mutation	SNP	ENST00000164640.4	37	c.2157C>A	CCDS14732.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425868	0.43020	.	.	ENSG00000067840	ENST00000164640;ENST00000393758;ENST00000537633;ENST00000544474	T;T;T	0.75260	-0.92;-0.92;-0.92	5.47	4.61	0.57282	.	0.216709	0.46442	D	0.000298	T	0.66458	0.2791	L	0.60455	1.87	0.46874	D	0.999235	B;B;B;P;B	0.40144	0.094;0.193;0.076;0.704;0.094	B;B;B;B;B	0.29716	0.061;0.065;0.013;0.106;0.061	T	0.69083	-0.5239	10	0.72032	D	0.01	-53.2839	12.1552	0.54072	0.0862:0.0:0.9138:0.0	.	610;725;719;644;623	B7ZKY3;Q17RL8;Q76G19;D3DWW0;B3KVR9	.;.;PDZD4_HUMAN;.;.	K	719;644;623;610	ENSP00000164640:N719K;ENSP00000377355:N644K;ENSP00000442033:N610K	ENSP00000164640:N719K	N	-	3	2	PDZD4	152722155	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	2.658000	0.46733	1.084000	0.41184	0.529000	0.55759	AAC		0.622	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061013.3	NM_032512		7	105	1	0	0.00307968	0.00308	0.0033009	7	105				
C1orf168	199920	broad.mit.edu	37	1	57219534	57219534	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:57219534delG	ENST00000343433.6	-	8	1285	c.1205delC	c.(1204-1206)ccafs	p.P402fs	C1orf168_ENST00000484327.1_Intron	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	402										NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						GTTTGAATATGGTTCCTTTTC	0.363																																							uc001cym.3		NA																	0				ovary(3)|skin(2)	5						c.(1204-1206)CCAfs		hypothetical protein LOC199920							243.0	213.0	223.0					1																	57219534		2202	4300	6502	SO:0001589	frameshift_variant	199920							g.chr1:57219534delG	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.1205delC	1.37:g.57219534delG	ENSP00000345972:p.Pro402fs					C1orf168_uc009vzu.1_Intron|C1orf168_uc001cyl.2_RNA	p.P402fs	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN			8	1611	-			402					Q63HM3|Q6ZUY6	Frame_Shift_Del	DEL	ENST00000343433.6	37	c.1205delC	CCDS30729.1																																																																																				0.363	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303		17	56	NA	NA	NA	NA	NA	17	56	---	---	---	---
FLG2	388698	broad.mit.edu	37	1	152324558	152324559	+	Frame_Shift_Del	DEL	TG	TG	-	rs140875805		TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr1:152324558_152324559delTG	ENST00000388718.5	-	3	5775_5776	c.5703_5704delCA	c.(5701-5706)cacagcfs	p.HS1901fs	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1901					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H1901fs*30(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGCTTGGCTGTGTGTGTGTC	0.515																																							uc001ezw.3		NA																	1	Deletion - Frameshift(1)		large_intestine(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(5701-5706)CACAGCfs		filaggrin family member 2																																				SO:0001589	frameshift_variant	388698						calcium ion binding|structural molecule activity	g.chr1:152324558_152324559delTG	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5703_5704delCA	1.37:g.152324566_152324567delTG	ENSP00000373370:p.His1901fs					uc001ezv.2_Intron	p.H1901fs	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	5776_5777	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1901_1902					Q9H4U1	Frame_Shift_Del	DEL	ENST00000388718.5	37	c.5703_5704delCA	CCDS30861.1																																																																																				0.515	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		11	500	NA	NA	NA	NA	NA	11	500	---	---	---	---
KBTBD3	143879	broad.mit.edu	37	11	105924167	105924167	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr11:105924167delC	ENST00000526793.1	-	3	1408	c.1249delG	c.(1249-1251)gacfs	p.D417fs	KBTBD3_ENST00000534815.1_Frame_Shift_Del_p.D338fs|KBTBD3_ENST00000531837.1_Frame_Shift_Del_p.D417fs	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	413										NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		CTTTTAATGTCCCGGGATCCT	0.388																																							uc001pja.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1249-1251)GACfs		BTB and kelch domain containing 3							46.0	45.0	45.0					11																	105924167		2201	4295	6496	SO:0001589	frameshift_variant	143879							g.chr11:105924167delC	AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.1249delG	11.37:g.105924167delC	ENSP00000436262:p.Asp417fs					KBTBD3_uc001pjb.2_Frame_Shift_Del_p.D417fs|KBTBD3_uc009yxm.2_Frame_Shift_Del_p.D338fs	p.D417fs	NM_198439	NP_940841	Q8NAB2	KBTB3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)	4	1889	-		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)	413			Kelch 3.		Q6N066|Q86X38|Q96NK5	Frame_Shift_Del	DEL	ENST00000526793.1	37	c.1249delG	CCDS8334.1																																																																																				0.388	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388705.2	NM_152433		7	36	NA	NA	NA	NA	NA	7	36	---	---	---	---
MYH6	4624	broad.mit.edu	37	14	23871694	23871694	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:23871694delC	ENST00000356287.3	-	11	1149	c.1120delG	c.(1120-1122)gcgfs	p.A374fs	MYH6_ENST00000405093.3_Frame_Shift_Del_p.A374fs			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	374	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TCTGGCTCCGCCTGCTCCTCC	0.622																																							uc001wjv.2		NA																	0				pancreas(2)|ovary(1)|skin(1)	4						c.(1120-1122)GCGfs		myosin heavy chain 6							89.0	84.0	86.0					14																	23871694		2203	4300	6503	SO:0001589	frameshift_variant	4624				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle	g.chr14:23871694delC	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1120delG	14.37:g.23871694delC	ENSP00000348634:p.Ala374fs					MYH6_uc010akp.1_Frame_Shift_Del_p.A374fs	p.A374fs	NM_002471	NP_002462	P13533	MYH6_HUMAN		GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)	12	1187	-	all_cancers(95;2.54e-05)		374			Myosin head-like.		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Frame_Shift_Del	DEL	ENST00000356287.3	37	c.1120delG	CCDS9600.1																																																																																				0.622	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3			17	158	NA	NA	NA	NA	NA	17	158	---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72925085	72925085	+	Splice_Site	DEL	G	G	-			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr14:72925085delG	ENST00000553530.1	+	5	549	c.342delG	c.(340-342)cag>ca	p.Q114fs	RGS6_ENST00000406236.4_Splice_Site_p.Q114fs|RGS6_ENST00000407322.4_Splice_Site_p.Q114fs|RGS6_ENST00000555571.1_Splice_Site_p.Q114fs|RGS6_ENST00000553690.1_3'UTR|RGS6_ENST00000355512.6_Splice_Site_p.Q114fs|RGS6_ENST00000556437.1_Splice_Site_p.Q114fs|RGS6_ENST00000402788.2_Splice_Site_p.Q114fs|RGS6_ENST00000553525.1_Splice_Site_p.Q114fs|RGS6_ENST00000554782.1_5'Flank|RGS6_ENST00000434263.2_Splice_Site_p.Q45fs|RGS6_ENST00000404301.2_Splice_Site_p.Q114fs|RGS6_ENST00000343854.6_Splice_Site_p.Q114fs	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	114	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		ATCGTTTCCAGGTAAGCCTGC	0.463																																					Ovarian(143;1926 2468 21071 48641)	Ovarian(143;1926 2468 21071 48641)	uc001xna.3		NA																	0				upper_aerodigestive_tract(1)|lung(1)|skin(1)	3						c.(340-342)CAGfs		regulator of G-protein signalling 6							137.0	96.0	110.0					14																	72925085		2203	4300	6503	SO:0001630	splice_region_variant	9628				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity	g.chr14:72925085delG	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.342+1G>-	14.37:g.72925085delG						RGS6_uc010ttn.1_Frame_Shift_Del_p.Q114fs|RGS6_uc001xmx.3_Frame_Shift_Del_p.Q114fs|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Frame_Shift_Del_p.Q114fs|RGS6_uc010ttp.1_Frame_Shift_Del_p.Q45fs|RGS6_uc001xmz.1_5'Flank|RGS6_uc010arg.2_RNA	p.Q114fs	NM_004296	NP_004287	P49758	RGS6_HUMAN		all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)	5	865	+			114			DEP.		C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Frame_Shift_Del	DEL	ENST00000553530.1	37	c.342delG	CCDS9808.1																																																																																				0.463	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		Frame_Shift_Del	10	91	NA	NA	NA	NA	NA	10	91	---	---	---	---
NOP56	10528	broad.mit.edu	37	20	2636619	2636619	+	Frame_Shift_Del	DEL	A	A	-			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:2636619delA	ENST00000329276.5	+	8	1465	c.949delA	c.(949-951)aacfs	p.N317fs	SNORD86_ENST00000391196.1_RNA|IDH3B_ENST00000488299.1_5'Flank|NOP56_ENST00000492135.1_3'UTR|SNORD57_ENST00000448188.1_RNA|SNORD110_ENST00000408189.1_RNA|SNORD56_ENST00000413522.1_RNA|SNORA51_ENST00000606420.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	317	Nop. {ECO:0000255|PROSITE- ProRule:PRU00690}.				cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						CAGCCTCACCAACCTGGCCAA	0.562																																							uc002wgh.2		NA																	0				ovary(1)|pancreas(1)	2						c.(949-951)AACfs		nucleolar protein 5A							81.0	64.0	70.0					20																	2636619		2203	4300	6503	SO:0001589	frameshift_variant	10528				rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding	g.chr20:2636619delA	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.949delA	20.37:g.2636619delA	ENSP00000370589:p.Asn317fs					NOP56_uc010zpy.1_RNA|NOP56_uc002wgi.2_Frame_Shift_Del_p.N151fs|NOP56_uc002wgm.1_Frame_Shift_Del_p.N64fs|SNORD86_uc010gaq.1_5'Flank|SNORD56_uc010gar.2_5'Flank|SNORD57_uc002wgo.1_5'Flank	p.N317fs	NM_006392	NP_006383	O00567	NOP56_HUMAN			8	1002	+			317			Nop.		Q2M3T6|Q9NQ05	Frame_Shift_Del	DEL	ENST00000329276.5	37	c.949delA	CCDS13030.1																																																																																				0.562	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392		11	62	NA	NA	NA	NA	NA	11	62	---	---	---	---
OVOL2	58495	broad.mit.edu	37	20	18022316	18022317	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:18022316_18022317delCA	ENST00000278780.6	-	3	614_615	c.372_373delTG	c.(370-375)tgtggcfs	p.CG124fs	OVOL2_ENST00000483661.1_5'UTR	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2	124					angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						AAGCCCTTGCCACACAGGTCAC	0.614																																							uc002wqi.1		NA																	0				central_nervous_system(1)	1						c.(370-375)TGTGGCfs		zinc finger protein 339																																				SO:0001589	frameshift_variant	58495				negative regulation of keratinocyte differentiation|negative regulation of Notch signaling pathway|negative regulation of transcription by competitive promoter binding|regulation of cell cycle|regulation of keratinocyte proliferation|transcription, DNA-dependent	nucleus	DNA binding|transcription regulatory region DNA binding|zinc ion binding	g.chr20:18022316_18022317delCA	AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.372_373delTG	20.37:g.18022320_18022321delCA	ENSP00000278780:p.Cys124fs						p.C124fs	NM_021220	NP_067043	Q9BRP0	OVOL2_HUMAN			3	615_616	-			124_125			C2H2-type 1.		Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	Frame_Shift_Del	DEL	ENST00000278780.6	37	c.372_373delTG	CCDS13132.1																																																																																				0.614	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078148.5	NM_021220		7	64	NA	NA	NA	NA	NA	7	64	---	---	---	---
ARFGAP1	55738	broad.mit.edu	37	20	61907501	61907501	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr20:61907501delG	ENST00000370283.4	+	3	259	c.119delG	c.(118-120)tggfs	p.W40fs	ARFGAP1_ENST00000519273.2_5'UTR|ARFGAP1_ENST00000353546.3_Frame_Shift_Del_p.W40fs|ARFGAP1_ENST00000519604.1_Intron|ARFGAP1_ENST00000370275.4_Frame_Shift_Del_p.W40fs|ARFGAP1_ENST00000547204.1_Intron	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	40	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					TACGGCATCTGGATCTGCCTG	0.627																																							uc002yem.2		NA																	0				pancreas(1)	1						c.(118-120)TGGfs		ADP-ribosylation factor GTPase activating							136.0	124.0	128.0					20																	61907501		2203	4300	6503	SO:0001589	frameshift_variant	55738				COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding	g.chr20:61907501delG	AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.119delG	20.37:g.61907501delG	ENSP00000359306:p.Trp40fs					ARFGAP1_uc011aas.1_Intron|ARFGAP1_uc011aat.1_5'UTR|ARFGAP1_uc002yel.2_Frame_Shift_Del_p.W40fs|ARFGAP1_uc002yen.2_Frame_Shift_Del_p.W40fs	p.W40fs	NM_018209	NP_060679	Q8N6T3	ARFG1_HUMAN			3	231	+	all_cancers(38;1.59e-09)		40			C4-type.|Arf-GAP.		B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Frame_Shift_Del	DEL	ENST00000370283.4	37	c.119delG	CCDS13515.1																																																																																				0.627	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080134.3	NM_018209		24	290	NA	NA	NA	NA	NA	24	290	---	---	---	---
PCDHGA9	56107	broad.mit.edu	37	5	140783119	140783119	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-2657-01A-01D-1105-08	TCGA-44-2657-10A-01D-1105-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	e3aa9b45-13b9-4b61-a30f-ae3f88466040	da5203dd-6288-46be-82cb-6c5f5d4cf129	g.chr5:140783119delG	ENST00000573521.1	+	1	600	c.600delG	c.(598-600)ctgfs	p.L200fs	PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	200	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGCGCCCTGGACAGGGAGG	0.632																																							uc003lkh.1		NA																	0					0						c.(598-600)CTGfs		protocadherin gamma subfamily A, 9 isoform 1							38.0	42.0	41.0					5																	140783119		2041	4186	6227	SO:0001589	frameshift_variant	56107				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140783119delG	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.600delG	5.37:g.140783119delG	ENSP00000460274:p.Leu200fs					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Frame_Shift_Del_p.L200fs	p.L200fs	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	600	+			200			Extracellular (Potential).|Cadherin 2.		A2RU65|Q9Y5C9	Frame_Shift_Del	DEL	ENST00000573521.1	37	c.600delG	CCDS58981.1																																																																																				0.632	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921		7	50	NA	NA	NA	NA	NA	7	50	---	---	---	---
