#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MTOR	2475	broad.mit.edu	37	1	11308080	11308080	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:11308080C>A	ENST00000361445.4	-	7	988	c.912G>T	c.(910-912)atG>atT	p.M304I		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	304	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.M304I(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TTCCGAAGCCCATGAGATCTT	0.488																																							uc001asd.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						c.(910-912)ATG>ATT		FK506 binding protein 12-rapamycin associated							118.0	120.0	120.0					1																	11308080		2203	4300	6503	SO:0001583	missense	2475				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity	g.chr1:11308080C>A	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.912G>T	1.37:g.11308080C>A	ENSP00000354558:p.Met304Ile						p.M304I	NM_004958	NP_004949	P42345	MTOR_HUMAN			7	1033	-			304					Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	c.912G>T	CCDS127.1	.	.	.	.	.	.	.	.	.	.	C	13.07	2.127743	0.37533	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.06768	3.26	5.33	5.33	0.75918	Armadillo-like helical (1);Armadillo-type fold (1);	0.043893	0.85682	D	0.000000	T	0.10252	0.0251	L	0.46157	1.445	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21314	-1.0249	10	0.14252	T	0.57	-4.9242	19.2942	0.94115	0.0:1.0:0.0:0.0	.	304	P42345	MTOR_HUMAN	I	304	ENSP00000354558:M304I	ENSP00000354558:M304I	M	-	3	0	MTOR	11230667	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.286000	0.78671	2.784000	0.95788	0.644000	0.83932	ATG		0.488	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958		16	122	1	0	1.5739e-10	0.004007	2.58705e-10	16	122				
PRAMEF2	65122	broad.mit.edu	37	1	12918928	12918928	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:12918928G>C	ENST00000240189.2	+	2	151	c.64G>C	c.(64-66)Gcc>Ccc	p.A22P		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	22					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.A22P(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAGAGACCAGGCCTTGTCCAT	0.567																																							uc001aum.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(64-66)GCC>CCC		PRAME family member 2							89.0	100.0	96.0					1																	12918928		2201	4296	6497	SO:0001583	missense	65122							g.chr1:12918928G>C		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.64G>C	1.37:g.12918928G>C	ENSP00000240189:p.Ala22Pro						p.A22P	NM_023014	NP_075390	O60811	PRAM2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	2	151	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	22						Missense_Mutation	SNP	ENST00000240189.2	37	c.64G>C	CCDS149.1	.	.	.	.	.	.	.	.	.	.	g	6.291	0.421815	0.11928	.	.	ENSG00000120952	ENST00000240189	T	0.15017	2.46	0.842	0.842	0.18927	.	0.350802	0.29537	N	0.011869	T	0.17619	0.0423	M	0.77313	2.365	0.09310	N	1	B	0.16802	0.019	B	0.18561	0.022	T	0.15694	-1.0428	10	0.42905	T	0.14	.	5.0452	0.14480	0.0:0.0:1.0:0.0	.	22	O60811	PRAM2_HUMAN	P	22	ENSP00000240189:A22P	ENSP00000240189:A22P	A	+	1	0	PRAMEF2	12841515	0.002000	0.14202	0.010000	0.14722	0.003000	0.03518	0.564000	0.23563	0.759000	0.33084	0.194000	0.17425	GCC		0.567	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014		11	86	0	0	0	0.010729	0	11	86				
PADI2	11240	broad.mit.edu	37	1	17410262	17410262	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:17410262C>A	ENST00000375486.4	-	9	1072	c.1009G>T	c.(1009-1011)Gtc>Ttc	p.V337F	PADI2_ENST00000466151.1_5'Flank|PADI2_ENST00000444885.2_Missense_Mutation_p.V221F|PADI2_ENST00000375481.1_Missense_Mutation_p.V337F	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	337					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)	p.V337F(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TGGAAGCAGACCTTCAGCTCA	0.532																																							uc001baf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6						c.(1009-1011)GTC>TTC		peptidyl arginine deiminase, type II	L-Citrulline(DB00155)						145.0	138.0	141.0					1																	17410262		2203	4300	6503	SO:0001583	missense	11240				peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity	g.chr1:17410262C>A	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1009G>T	1.37:g.17410262C>A	ENSP00000364635:p.Val337Phe					PADI2_uc010ocm.1_Missense_Mutation_p.V221F|PADI2_uc001bag.1_Missense_Mutation_p.V337F	p.V337F	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	9	1091	-		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)	337					Q96DA7|Q9UPN2	Missense_Mutation	SNP	ENST00000375486.4	37	c.1009G>T	CCDS177.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.122492	0.77436	.	.	ENSG00000117115	ENST00000375486;ENST00000444885;ENST00000375481	T;T;T	0.28666	1.6;1.6;1.6	5.77	4.67	0.58626	Protein-arginine deiminase, C-terminal (1);	0.107490	0.64402	D	0.000004	T	0.50633	0.1627	M	0.67397	2.05	0.47621	D	0.99947	D;P	0.76494	0.999;0.954	D;P	0.77004	0.989;0.72	T	0.50906	-0.8772	10	0.87932	D	0	-50.7877	10.7761	0.46350	0.0:0.8401:0.0:0.1599	.	221;337	B4DIU3;Q9Y2J8	.;PADI2_HUMAN	F	337;221;337	ENSP00000364635:V337F;ENSP00000405894:V221F;ENSP00000364630:V337F	ENSP00000364630:V337F	V	-	1	0	PADI2	17282849	0.955000	0.32602	1.000000	0.80357	0.983000	0.72400	1.558000	0.36309	2.724000	0.93272	0.561000	0.74099	GTC		0.532	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006624.1			10	80	1	0	7.03913e-09	0.013537	1.08665e-08	10	80				
UBR4	23352	broad.mit.edu	37	1	19449430	19449430	+	Missense_Mutation	SNP	C	C	A	rs199842567		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:19449430C>A	ENST00000375254.3	-	66	9740	c.9713G>T	c.(9712-9714)cGt>cTt	p.R3238L	UBR4_ENST00000375226.2_Missense_Mutation_p.R3214L|UBR4_ENST00000375267.2_Missense_Mutation_p.R3238L|UBR4_ENST00000375217.2_Missense_Mutation_p.R3231L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	3238					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R3238L(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTTGATCCCACGCACGTGAGA	0.547																																							uc001bbi.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25						c.(9712-9714)CGT>CTT		retinoblastoma-associated factor 600							97.0	95.0	96.0					1																	19449430		2203	4300	6503	SO:0001583	missense	23352				interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:19449430C>A	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.9713G>T	1.37:g.19449430C>A	ENSP00000364403:p.Arg3238Leu					UBR4_uc001bbk.1_Missense_Mutation_p.R885L	p.R3238L	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)	66	9717	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)	3238					A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	c.9713G>T	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	32	5.111572	0.94339	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.24151	1.87;1.87;1.89;1.89	6.02	6.02	0.97574	.	0.103019	0.64402	D	0.000002	T	0.20700	0.0498	L	0.34521	1.04	0.80722	D	1	P	0.35401	0.499	B	0.32342	0.144	T	0.02020	-1.1228	10	0.62326	D	0.03	.	13.3608	0.60654	0.0:0.9278:0.0:0.0722	.	3238	Q5T4S7	UBR4_HUMAN	L	3238;3238;3231;3214;846;1924	ENSP00000364403:R3238L;ENSP00000364416:R3238L;ENSP00000364365:R3231L;ENSP00000364374:R3214L	ENSP00000364365:R3231L	R	-	2	0	UBR4	19322017	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.775000	0.68915	2.865000	0.98341	0.655000	0.94253	CGT		0.547	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765		13	54	1	0	0.00316338	0.003163	0.00354788	13	54				
HSPG2	3339	broad.mit.edu	37	1	22222444	22222444	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:22222444C>A	ENST00000374695.3	-	3	294	c.215G>T	c.(214-216)gGg>gTg	p.G72V		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	72					angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.G72V(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCCCAGGTCCCCACTGCCCAG	0.567																																							uc001bfj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9						c.(214-216)GGG>GTG		heparan sulfate proteoglycan 2 precursor	Becaplermin(DB00102)|Palifermin(DB00039)						52.0	53.0	53.0					1																	22222444		2203	4300	6503	SO:0001583	missense	3339				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	g.chr1:22222444C>A	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.215G>T	1.37:g.22222444C>A	ENSP00000363827:p.Gly72Val					HSPG2_uc009vqd.2_Missense_Mutation_p.G72V|HSPG2_uc009vqe.1_Missense_Mutation_p.G27V	p.G72V	NM_005529	NP_005520	P98160	PGBM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	3	255	-		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	72					Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	c.215G>T	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239114	0.58995	.	.	ENSG00000142798	ENST00000374695;ENST00000412328;ENST00000439717	D;T;T	0.83250	-1.7;-0.23;-0.06	4.72	4.72	0.59763	.	0.000000	0.40144	N	0.001174	D	0.84924	0.5580	L	0.27053	0.805	0.51233	D	0.999914	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.86366	0.1720	10	0.72032	D	0.01	.	13.0666	0.59036	0.0:1.0:0.0:0.0	.	51;72	Q5SZI5;P98160	.;PGBM_HUMAN	V	72;51;38	ENSP00000363827:G72V;ENSP00000405412:G51V;ENSP00000395884:G38V	ENSP00000363827:G72V	G	-	2	0	HSPG2	22095031	0.983000	0.35010	0.649000	0.29536	0.685000	0.39939	3.531000	0.53546	2.452000	0.82932	0.643000	0.83706	GGG		0.567	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		6	34	1	0	0.00198382	0.001984	0.00223731	6	34				
PTAFR	5724	broad.mit.edu	37	1	28477276	28477276	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:28477276G>T	ENST00000373857.3	-	2	891	c.257C>A	c.(256-258)cCc>cAc	p.P86H	PTAFR_ENST00000539896.1_Missense_Mutation_p.P86H|PTAFR_ENST00000305392.3_Missense_Mutation_p.P86H	NM_000952.4|NM_001164722.2|NM_001164723.2	NP_000943.1|NP_001158194.1|NP_001158195.1	P25105	PTAFR_HUMAN	platelet-activating factor receptor	86					chemotaxis (GO:0006935)|cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|inositol trisphosphate biosynthetic process (GO:0032959)|interferon-gamma-mediated signaling pathway (GO:0060333)|phosphatidylinositol-mediated signaling (GO:0048015)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|phospholipid binding (GO:0005543)|platelet activating factor receptor activity (GO:0004992)	p.P86H(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|stomach(1)	15		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGAATTTGGGGAGTATCCA	0.507																																							uc001bpl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(256-258)CCC>CAC		platelet-activating factor receptor							151.0	126.0	135.0					1																	28477276		2203	4300	6503	SO:0001583	missense	5724				chemotaxis|inflammatory response|interferon-gamma-mediated signaling pathway|phosphatidylinositol-mediated signaling	integral to plasma membrane|nucleus	phospholipid binding|platelet activating factor receptor activity	g.chr1:28477276G>T	BC063000	CCDS318.1	1p35-p34.3	2012-08-20			ENSG00000169403	ENSG00000169403		"""GPCR / Class A : Platelet-activating factor receptors"""	9582	protein-coding gene	gene with protein product		173393				1322356	Standard	NM_001164721		Approved		uc001bpl.3	P25105	OTTHUMG00000003953	ENST00000373857.3:c.257C>A	1.37:g.28477276G>T	ENSP00000362965:p.Pro86His					PTAFR_uc001bpm.3_Missense_Mutation_p.P86H|PTAFR_uc009vte.2_Missense_Mutation_p.P86H	p.P86H	NM_000952	NP_000943	P25105	PTAFR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)	2	384	-		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)	86			Extracellular (Potential).		A3KMC8|A8K2H5	Missense_Mutation	SNP	ENST00000373857.3	37	c.257C>A	CCDS318.1	.	.	.	.	.	.	.	.	.	.	G	10.46	1.356035	0.24598	.	.	ENSG00000169403	ENST00000373857;ENST00000539896;ENST00000305392	T;T;T	0.38240	1.15;1.15;1.15	5.71	4.79	0.61399	GPCR, rhodopsin-like superfamily (1);	0.438845	0.24412	N	0.038743	T	0.37517	0.1006	M	0.66939	2.045	0.09310	N	1	B	0.20368	0.044	B	0.22753	0.041	T	0.34800	-0.9814	10	0.54805	T	0.06	.	10.5501	0.45083	0.069:0.0:0.7969:0.1341	.	86	P25105	PTAFR_HUMAN	H	86	ENSP00000362965:P86H;ENSP00000442658:P86H;ENSP00000301974:P86H	ENSP00000301974:P86H	P	-	2	0	PTAFR	28349863	0.693000	0.27728	0.989000	0.46669	0.952000	0.60782	1.766000	0.38491	1.391000	0.46566	0.655000	0.94253	CCC		0.507	PTAFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011258.1	NM_000952		4	43	1	0	1.024e-07	0.000602	1.51731e-07	4	43				
PUM1	9698	broad.mit.edu	37	1	31426788	31426788	+	Silent	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:31426788A>G	ENST00000257075.5	-	15	2457	c.2364T>C	c.(2362-2364)gcT>gcC	p.A788A	PUM1_ENST00000423018.2_Silent_p.A644A|PUM1_ENST00000373742.2_Silent_p.A729A|PUM1_ENST00000426105.2_Silent_p.A788A|PUM1_ENST00000373747.3_Silent_p.A789A|PUM1_ENST00000440538.2_Silent_p.A762A|PUM1_ENST00000424085.2_Silent_p.A546A|PUM1_ENST00000373741.4_Silent_p.A824A	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	788	Ser-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)	p.A788A(1)		breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		CAGCGCCTGGAGCAGCAGAGA	0.507																																							uc001bsi.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2362-2364)GCT>GCC		pumilio 1 isoform 2							89.0	92.0	91.0					1																	31426788		2203	4300	6503	SO:0001819	synonymous_variant	9698				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding	g.chr1:31426788A>G	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.2364T>C	1.37:g.31426788A>G						PUM1_uc001bsf.1_Silent_p.A454A|PUM1_uc001bsg.1_Silent_p.A522A|PUM1_uc001bsh.1_Silent_p.A788A|PUM1_uc001bsj.1_Silent_p.A762A|PUM1_uc010oga.1_Silent_p.A644A|PUM1_uc001bsk.1_Silent_p.A824A|PUM1_uc010ogb.1_Silent_p.A729A	p.A788A	NM_014676	NP_055491	Q14671	PUM1_HUMAN		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)	15	2477	-		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)	788			Ser-rich.		A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Silent	SNP	ENST00000257075.5	37	c.2364T>C	CCDS338.1	.	.	.	.	.	.	.	.	.	.	A	10.44	1.352219	0.24512	.	.	ENSG00000134644	ENST00000525843;ENST00000498419	.	.	.	5.87	-2.88	0.05682	.	.	.	.	.	T	0.36635	0.0974	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33111	-0.9881	4	.	.	.	-6.4637	0.4079	0.00436	0.2876:0.233:0.1406:0.3387	.	.	.	.	P	727;500	.	.	S	-	1	0	PUM1	31199375	0.006000	0.16342	0.982000	0.44146	0.992000	0.81027	-1.091000	0.03369	-0.395000	0.07715	-0.336000	0.08194	TCC		0.507	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1			15	107	0	0	0	0.003163	0	15	107				
ZSCAN20	7579	broad.mit.edu	37	1	33959006	33959006	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:33959006C>T	ENST00000361328.3	+	7	1817	c.1664C>T	c.(1663-1665)cCa>cTa	p.P555L		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	555					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P555L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AGCAGCCACCCACCAGGGACA	0.602																																							uc001bxj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1663-1665)CCA>CTA		zinc finger protein 31							78.0	82.0	80.0					1																	33959006		2067	4216	6283	SO:0001583	missense	7579				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:33959006C>T	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1664C>T	1.37:g.33959006C>T	ENSP00000355053:p.Pro555Leu					ZSCAN20_uc009vui.2_Missense_Mutation_p.P554L	p.P555L	NM_145238	NP_660281	P17040	ZSC20_HUMAN			7	1831	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)	555					A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	c.1664C>T	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757651	0.69648	.	.	ENSG00000121903	ENST00000326544;ENST00000361328;ENST00000401072	.	.	.	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000012	T	0.63792	0.2541	L	0.27053	0.805	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.60409	-0.7269	9	0.32370	T	0.25	-8.0181	14.9921	0.71396	0.0:1.0:0.0:0.0	.	554;555	P17040-3;P17040	.;ZSC20_HUMAN	L	555;489;489	.	ENSP00000324450:P555L	P	+	2	0	ZSCAN20	33731593	0.995000	0.38212	1.000000	0.80357	0.988000	0.76386	4.197000	0.58413	2.692000	0.91855	0.655000	0.94253	CCA		0.602	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238		4	69	0	0	0	0.009096	0	4	69				
SLFNL1	200172	broad.mit.edu	37	1	41486066	41486066	+	Silent	SNP	C	C	G	rs148645268		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:41486066C>G	ENST00000359345.1	-	1	2843	c.267G>C	c.(265-267)ccG>ccC	p.P89P	SLFNL1_ENST00000397197.2_Silent_p.P89P|SLFNL1_ENST00000302946.8_Silent_p.P89P|SLFNL1_ENST00000372613.2_Silent_p.P89P|SLFNL1_ENST00000439569.2_Silent_p.P89P|SLFNL1_ENST00000372611.1_Silent_p.P89P	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	89							ATP binding (GO:0005524)	p.P89P(1)		endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				AGGCCTTCCGCGGCCGCCTCA	0.672																																							uc001cgm.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(265-267)CCG>CCC		schlafen-like 1							50.0	55.0	53.0					1																	41486066		2203	4300	6503	SO:0001819	synonymous_variant	200172						ATP binding	g.chr1:41486066C>G	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.267G>C	1.37:g.41486066C>G						SLFNL1_uc009vwf.1_Silent_p.P89P|SLFNL1_uc001cgn.1_Silent_p.P89P|SLFNL1_uc009vwg.1_Silent_p.P89P	p.P89P	NM_144990	NP_659427	Q499Z3	SLNL1_HUMAN			2	487	-	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)	89					A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Silent	SNP	ENST00000359345.1	37	c.267G>C	CCDS460.1																																																																																				0.672	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015650.1	NM_144990		8	55	0	0	0	0.00308	0	8	55				
INSL5	10022	broad.mit.edu	37	1	67263820	67263820	+	Missense_Mutation	SNP	C	C	A	rs144286383		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:67263820C>A	ENST00000304526.2	-	2	318	c.284G>T	c.(283-285)gGt>gTt	p.G95V		NM_005478.4	NP_005469.2	Q9Y5Q6	INSL5_HUMAN	insulin-like 5	95						extracellular region (GO:0005576)		p.G95V(1)		breast(2)|endometrium(1)|lung(5)	8						CATCTGTCCACCCCAAAGACG	0.478																																							uc001dcw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(283-285)GGT>GTT		insulin-like 5 precursor							123.0	116.0	119.0					1																	67263820		2203	4300	6503	SO:0001583	missense	10022					extracellular region	hormone activity	g.chr1:67263820C>A	AF133816	CCDS634.1	1p31.3	2013-02-26			ENSG00000172410	ENSG00000172410		"""Endogenous ligands"""	6088	protein-coding gene	gene with protein product	"""prepro-INSL5"""	606413				10458910	Standard	NM_005478		Approved		uc001dcw.3	Q9Y5Q6	OTTHUMG00000009164	ENST00000304526.2:c.284G>T	1.37:g.67263820C>A	ENSP00000302724:p.Gly95Val						p.G95V	NM_005478	NP_005469	Q9Y5Q6	INSL5_HUMAN			2	319	-			95					Q3MIY4|Q5VYD8	Missense_Mutation	SNP	ENST00000304526.2	37	c.284G>T	CCDS634.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392774	0.25118	.	.	ENSG00000172410	ENST00000304526	T	0.63744	-0.06	4.31	-1.16	0.09678	Insulin-like (3);	0.389135	0.20339	N	0.094262	T	0.35307	0.0927	L	0.54323	1.7	0.09310	N	1	P	0.44946	0.846	B	0.43445	0.42	T	0.35375	-0.9791	10	0.34782	T	0.22	-19.8999	7.9709	0.30127	0.0:0.322:0.0:0.678	.	95	Q9Y5Q6	INSL5_HUMAN	V	95	ENSP00000302724:G95V	ENSP00000302724:G95V	G	-	2	0	INSL5	67036408	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.484000	0.06528	-0.114000	0.11936	0.555000	0.69702	GGT		0.478	INSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025403.1	NM_005478		11	76	1	0	5.16669e-11	0.010729	8.70404e-11	11	76				
LRRIQ3	127255	broad.mit.edu	37	1	74507107	74507107	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:74507107A>T	ENST00000395089.1	-	6	1507	c.1508T>A	c.(1507-1509)cTg>cAg	p.L503Q	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.L503Q			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	503								p.L503Q(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TTTTAGAAACAGAGCTTTTCT	0.333																																							uc001dfy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1507-1509)CTG>CAG		leucine-rich repeats and IQ motif containing 3							108.0	105.0	106.0					1																	74507107		1797	4068	5865	SO:0001583	missense	127255							g.chr1:74507107A>T	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1508T>A	1.37:g.74507107A>T	ENSP00000378524:p.Leu503Gln					LRRIQ3_uc001dfz.3_Intron	p.L503Q	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN			7	1700	-			503					A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	c.1508T>A	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	A	7.805	0.714408	0.15306	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	T;T	0.07688	3.17;3.17	5.86	-4.68	0.03309	.	0.398124	0.18515	N	0.138924	T	0.01387	0.0045	L	0.29908	0.895	0.09310	N	1	B	0.17852	0.024	B	0.12156	0.007	T	0.45920	-0.9228	10	0.26408	T	0.33	.	6.7036	0.23238	0.2143:0.2797:0.0:0.5061	.	503	A6PVS8	LRIQ3_HUMAN	Q	503	ENSP00000378524:L503Q;ENSP00000346414:L503Q	ENSP00000346414:L503Q	L	-	2	0	LRRIQ3	74279695	0.000000	0.05858	0.002000	0.10522	0.060000	0.15804	0.092000	0.15066	-0.386000	0.07821	0.528000	0.53228	CTG		0.333	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258		20	163	0	0	0	0.008871	0	20	163				
RABGGTB	5876	broad.mit.edu	37	1	76253183	76253183	+	Splice_Site	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:76253183G>T	ENST00000319942.3	+	2	76	c.5G>T	c.(4-6)gGc>gTc	p.G2V	RABGGTB_ENST00000496055.1_3'UTR|SNORD45C_ENST00000383893.1_RNA|SNORD45A_ENST00000384512.1_RNA|SNORD45B_ENST00000364617.1_RNA|RABGGTB_ENST00000535300.1_5'UTR|RABGGTB_ENST00000370826.3_Splice_Site_p.G2V	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit	2					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)	p.G2V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						TTTTGAAAGGGCACTCCACAG	0.378																																							uc001dgy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(4-6)GGC>GTC		RAB geranylgeranyltransferase, beta subunit							127.0	115.0	119.0					1																	76253183		2203	4300	6503	SO:0001630	splice_region_variant	5876				protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity	g.chr1:76253183G>T	U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.4-1G>T	1.37:g.76253183G>T						RABGGTB_uc009wbt.1_RNA|RABGGTB_uc001dha.1_5'UTR|SNORD45A_uc009wbu.1_5'Flank|SNORD45B_uc009wbv.1_5'Flank	p.G2V	NM_004582	NP_004573	P53611	PGTB2_HUMAN			2	76	+			2					Q92697	Missense_Mutation	SNP	ENST00000319942.3	37	c.5G>T	CCDS669.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259383	0.80246	.	.	ENSG00000137955	ENST00000319942;ENST00000370824;ENST00000370826	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.53286	0.1787	M	0.72894	2.215	0.80722	D	1	P	0.47677	0.899	B	0.42995	0.404	T	0.63883	-0.6536	9	0.66056	D	0.02	-8.1589	18.7645	0.91866	0.0:0.0:1.0:0.0	.	2	P53611	PGTB2_HUMAN	V	2	.	ENSP00000317473:G2V	G	+	2	0	RABGGTB	76025771	1.000000	0.71417	0.998000	0.56505	0.923000	0.55619	9.411000	0.97342	2.510000	0.84645	0.655000	0.94253	GGC		0.378	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026972.1	NM_004582	Missense_Mutation	25	69	1	0	6.32553e-13	0.004656	1.16735e-12	25	69				
CLCA1	1179	broad.mit.edu	37	1	86951077	86951077	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:86951077C>A	ENST00000234701.3	+	7	1138	c.787C>A	c.(787-789)Caa>Aaa	p.Q263K	CLCA1_ENST00000394711.1_Missense_Mutation_p.Q263K			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	263					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)	p.Q263K(1)		NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		TCCAAACAAGCAAAATCAAAA	0.373																																							uc001dlt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(787-789)CAA>AAA		chloride channel accessory 1 precursor							113.0	96.0	101.0					1																	86951077		2203	4300	6503	SO:0001583	missense	1179				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity	g.chr1:86951077C>A		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.787C>A	1.37:g.86951077C>A	ENSP00000234701:p.Gln263Lys					CLCA1_uc001dls.1_Missense_Mutation_p.Q202K	p.Q263K	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN		all cancers(265;0.0249)|Epithelial(280;0.0476)	6	916	+		Lung NSC(277;0.239)	263					B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	c.787C>A	CCDS709.1	.	.	.	.	.	.	.	.	.	.	C	19.34	3.809688	0.70797	.	.	ENSG00000016490	ENST00000234701;ENST00000394711	T;T	0.03951	3.75;3.75	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.17109	0.0411	M	0.87038	2.855	0.41165	D	0.986126	D;P	0.57571	0.98;0.944	P;P	0.57324	0.818;0.818	T	0.00817	-1.1554	10	0.87932	D	0	-15.3256	19.936	0.97142	0.0:1.0:0.0:0.0	.	263;26	A8K7I4;B4DUZ6	CLCA1_HUMAN;.	K	263	ENSP00000234701:Q263K;ENSP00000378200:Q263K	ENSP00000234701:Q263K	Q	+	1	0	CLCA1	86723665	1.000000	0.71417	0.951000	0.38953	0.244000	0.25665	5.850000	0.69473	2.814000	0.96858	0.655000	0.94253	CAA		0.373	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285		17	70	1	0	1.56452e-12	0.007413	2.78595e-12	17	70				
PLPPR4	9890	broad.mit.edu	37	1	99771542	99771542	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:99771542C>T	ENST00000370185.3	+	7	1765	c.1268C>T	c.(1267-1269)cCa>cTa	p.P423L	LPPR4_ENST00000457765.1_Missense_Mutation_p.P365L|LPPR4_ENST00000370184.1_Missense_Mutation_p.P265L	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		423					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.P423L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		GCCAATACCCCATCTGTAGAA	0.483																																							uc001dse.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1267-1269)CCA>CTA		plasticity related gene 1							58.0	61.0	60.0					1																	99771542		2203	4300	6503	SO:0001583	missense	9890						phosphatidate phosphatase activity	g.chr1:99771542C>T																												ENST00000370185.3:c.1268C>T	1.37:g.99771542C>T	ENSP00000359204:p.Pro423Leu					LPPR4_uc010oue.1_Missense_Mutation_p.P365L	p.P423L	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)	7	1374	+		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)	423					E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	c.1268C>T	CCDS757.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.912975	0.52439	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.28666	2.17;2.01;1.6	5.71	5.71	0.89125	.	0.535440	0.22058	N	0.065217	T	0.45478	0.1344	L	0.57536	1.79	0.80722	D	1	D;P	0.76494	0.999;0.923	D;P	0.68943	0.961;0.558	T	0.13872	-1.0493	9	.	.	.	-15.062	19.8478	0.96722	0.0:1.0:0.0:0.0	.	365;423	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	L	423;365;423;265	ENSP00000359204:P423L;ENSP00000394913:P365L;ENSP00000359203:P265L	.	P	+	2	0	RP4-788L13.1	99544130	1.000000	0.71417	0.876000	0.34364	0.158000	0.22134	5.528000	0.67129	2.685000	0.91497	0.650000	0.86243	CCA		0.483	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			6	43	0	0	0	0.001984	0	6	43				
KCNA2	3737	broad.mit.edu	37	1	111146095	111146095	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:111146095T>G	ENST00000485317.1	-	3	1983	c.1310A>C	c.(1309-1311)aAg>aCg	p.K437T	KCNA2_ENST00000440270.1_Missense_Mutation_p.K437T|KCNA2_ENST00000369770.3_Intron|KCNA2_ENST00000525120.1_5'Flank|KCNA2_ENST00000316361.4_Missense_Mutation_p.K437T			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	437					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.K437T(1)		endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	GGATGGGATCTTTGGACAGCT	0.463																																					Pancreas(18;568 735 10587 23710 36357)	Pancreas(18;568 735 10587 23710 36357)	uc001dzu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1309-1311)AAG>ACG		potassium voltage-gated channel, shaker-related							218.0	204.0	209.0					1																	111146095		2203	4300	6503	SO:0001583	missense	3737					juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity	g.chr1:111146095T>G	L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.1310A>C	1.37:g.111146095T>G	ENSP00000433109:p.Lys437Thr					KCNA2_uc009wfv.1_Intron|KCNA2_uc009wfw.2_Missense_Mutation_p.K437T	p.K437T	NM_004974	NP_004965	P16389	KCNA2_HUMAN		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	2	1806	-		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)	437					Q86XG6	Missense_Mutation	SNP	ENST00000485317.1	37	c.1310A>C	CCDS827.1	.	.	.	.	.	.	.	.	.	.	T	8.786	0.929394	0.18131	.	.	ENSG00000177301	ENST00000485317;ENST00000440270;ENST00000316361	D;D;D	0.96459	-4.02;-4.02;-4.02	4.92	4.92	0.64577	.	0.134965	0.52532	D	0.000079	D	0.86301	0.5900	N	0.14661	0.345	0.80722	D	1	B	0.32051	0.354	B	0.27887	0.084	D	0.86184	0.1608	10	0.28530	T	0.3	.	14.2431	0.65971	0.0:0.0:0.0:1.0	.	437	P16389	KCNA2_HUMAN	T	437	ENSP00000433109:K437T;ENSP00000415257:K437T;ENSP00000314520:K437T	ENSP00000314520:K437T	K	-	2	0	KCNA2	110947618	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.988000	0.88194	1.841000	0.53522	0.533000	0.62120	AAG		0.463	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128001.2	NM_004974		27	106	0	0	0	0.00632	0	27	106				
HIPK1	204851	broad.mit.edu	37	1	114505013	114505013	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:114505013G>C	ENST00000369558.1	+	9	2288	c.2056G>C	c.(2056-2058)Gca>Cca	p.A686P	HIPK1_ENST00000369554.2_Missense_Mutation_p.A686P|HIPK1_ENST00000340480.4_Missense_Mutation_p.A312P|HIPK1_ENST00000406344.1_Missense_Mutation_p.A292P|HIPK1_ENST00000369555.2_Missense_Mutation_p.A686P|HIPK1_ENST00000369559.4_Missense_Mutation_p.A686P|HIPK1_ENST00000369561.4_Missense_Mutation_p.A652P|HIPK1_ENST00000369553.1_Missense_Mutation_p.A292P|HIPK1_ENST00000426820.2_Missense_Mutation_p.A686P			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	686					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A686P(2)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTACCCCAGGCACCAGCTGC	0.443																																							uc001eem.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(2056-2058)GCA>CCA		homeodomain-interacting protein kinase 1 isoform							92.0	85.0	87.0					1																	114505013		2203	4300	6503	SO:0001583	missense	204851				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr1:114505013G>C	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.2056G>C	1.37:g.114505013G>C	ENSP00000358571:p.Ala686Pro					HIPK1_uc001eel.2_Missense_Mutation_p.A686P|HIPK1_uc001een.2_Missense_Mutation_p.A686P|HIPK1_uc001eeo.2_Missense_Mutation_p.A312P|HIPK1_uc001eep.2_Missense_Mutation_p.A292P|HIPK1_uc001eeq.2_5'Flank	p.A686P	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	9	2217	+	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)	686					A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	c.2056G>C	CCDS867.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458595	0.84317	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344	T;T;T;T;T;T;T;T;T;T	0.56103	0.53;0.54;0.57;0.54;0.54;0.57;0.48;3.58;2.64;2.64	6.02	6.02	0.97574	.	0.000000	0.64402	D	0.000001	T	0.63570	0.2522	M	0.64404	1.975	0.50632	D	0.999888	P;D;D	0.69078	0.851;0.994;0.997	P;P;P	0.62298	0.623;0.855;0.9	T	0.57130	-0.7864	10	0.38643	T	0.18	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	292;686;686	Q86Z02-4;Q86Z02;Q86Z02-2	.;HIPK1_HUMAN;.	P	757;686;686;686;686;686;652;312;292;292	ENSP00000407442:A757P;ENSP00000358572:A686P;ENSP00000409673:A686P;ENSP00000358567:A686P;ENSP00000358568:A686P;ENSP00000358571:A686P;ENSP00000358574:A652P;ENSP00000340956:A312P;ENSP00000358566:A292P;ENSP00000384960:A292P	ENSP00000340956:A312P	A	+	1	0	HIPK1	114306536	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	3.973000	0.56845	2.865000	0.98341	0.655000	0.94253	GCA		0.443	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268		13	48	0	0	0	0.013537	0	13	48				
PIP5K1A	8394	broad.mit.edu	37	1	151219439	151219439	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:151219439C>T	ENST00000368888.4	+	15	2106	c.1684C>T	c.(1684-1686)Cat>Tat	p.H562Y	PIP5K1A_ENST00000441902.2_Missense_Mutation_p.H522Y|PIP5K1A_ENST00000414290.2_Silent_p.P170P|PIP5K1A_ENST00000368890.4_Missense_Mutation_p.H500Y|PIP5K1A_ENST00000409426.1_Missense_Mutation_p.H550Y	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	562					actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)	p.H562Y(1)		breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGAGTTCACCCATGTGAGTAT	0.408																																					Pancreas(80;36 1443 2325 16095 21302)	Pancreas(80;36 1443 2325 16095 21302)	uc001exj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1684-1686)CAT>TAT		phosphatidylinositol-4-phosphate 5-kinase, type							161.0	152.0	155.0					1																	151219439		2203	4300	6503	SO:0001583	missense	8394				phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding	g.chr1:151219439C>T	U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.1684C>T	1.37:g.151219439C>T	ENSP00000357883:p.His562Tyr					PIP5K1A_uc001exi.2_Missense_Mutation_p.H549Y|PIP5K1A_uc010pcu.1_Missense_Mutation_p.H522Y|PIP5K1A_uc001exk.2_Missense_Mutation_p.H500Y|PIP5K1A_uc010pcv.1_Silent_p.P226P	p.H562Y	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)		15	2136	+	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		562					A8K4Q0|B4DIN0|Q99754|Q99756	Missense_Mutation	SNP	ENST00000368888.4	37	c.1684C>T	CCDS44219.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522285	0.44866	.	.	ENSG00000143398	ENST00000349792;ENST00000409426;ENST00000441902;ENST00000368890;ENST00000368888	T;T;T;T;T	0.40225	1.62;1.63;1.3;1.04;1.61	4.98	2.87	0.33458	.	1.245850	0.05615	U	0.578855	T	0.23249	0.0562	L	0.51422	1.61	0.80722	D	1	B;B;B;B	0.29085	0.036;0.232;0.072;0.036	B;B;B;B	0.31751	0.037;0.135;0.064;0.037	T	0.46707	-0.9172	10	0.72032	D	0.01	.	5.3653	0.16111	0.0:0.7231:0.0:0.2769	.	522;500;562;549	Q99755-4;Q99755-2;Q99755;Q99755-3	.;.;PI51A_HUMAN;.	Y	549;550;522;500;562	ENSP00000271663:H549Y;ENSP00000386432:H550Y;ENSP00000415648:H522Y;ENSP00000357885:H500Y;ENSP00000357883:H562Y	ENSP00000271663:H549Y	H	+	1	0	PIP5K1A	149486063	0.004000	0.15560	0.721000	0.30653	0.987000	0.75469	0.714000	0.25808	1.241000	0.43820	0.563000	0.77884	CAT		0.408	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034425.2	NM_003557		17	98	0	0	0	0.007413	0	17	98				
SPRR3	6707	broad.mit.edu	37	1	152975939	152975939	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:152975939A>T	ENST00000295367.4	+	2	485	c.443A>T	c.(442-444)aAg>aTg	p.K148M	SPRR3_ENST00000331860.3_Missense_Mutation_p.K148M|SPRR3_ENST00000542696.1_Missense_Mutation_p.K140M	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	148	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.K148M(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGCTACACAAAGCTACCAGAG	0.517																																							uc001fax.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(442-444)AAG>ATG		small proline-rich protein 3							81.0	74.0	77.0					1																	152975939		2203	4300	6503	SO:0001583	missense	6707				keratinization|peptide cross-linking|wound healing	cytoplasm	protein binding|structural molecule activity	g.chr1:152975939A>T	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.443A>T	1.37:g.152975939A>T	ENSP00000295367:p.Lys148Met					SPRR3_uc001faz.3_Missense_Mutation_p.K148M|SPRR3_uc001fay.2_Missense_Mutation_p.K140M	p.K148M	NM_005416	NP_005407	Q9UBC9	SPRR3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		3	593	+	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		148			14 X 8 AA approximate tandem repeats.|14.		A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Missense_Mutation	SNP	ENST00000295367.4	37	c.443A>T	CCDS1033.1	.	.	.	.	.	.	.	.	.	.	A	14.71	2.615257	0.46631	.	.	ENSG00000163209	ENST00000331860;ENST00000443178;ENST00000295367;ENST00000542696	T;T;T;T	0.13420	2.59;2.59;2.59;2.59	4.27	-4.72	0.03269	.	.	.	.	.	T	0.09818	0.0241	L	0.54323	1.7	0.09310	N	1	D;D	0.89917	1.0;0.978	D;P	0.78314	0.991;0.824	T	0.05852	-1.0860	9	0.48119	T	0.1	.	1.2629	0.02005	0.382:0.2626:0.0862:0.2692	.	140;148	F5GZ12;Q9UBC9	.;SPRR3_HUMAN	M	148;148;148;140	ENSP00000330391:K148M;ENSP00000402016:K148M;ENSP00000295367:K148M;ENSP00000441477:K140M	ENSP00000295367:K148M	K	+	2	0	SPRR3	151242563	0.015000	0.18098	0.000000	0.03702	0.004000	0.04260	-0.010000	0.12743	-1.133000	0.02903	0.455000	0.32223	AAG		0.517	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416		8	21	0	0	0	0.00308	0	8	21				
OR10T2	128360	broad.mit.edu	37	1	158368884	158368884	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:158368884C>A	ENST00000334438.1	-	1	372	c.373G>T	c.(373-375)Gta>Tta	p.V125L		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V125L(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					CAAATTGCTACATAGCGATCA	0.473																																							uc010pih.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(373-375)GTA>TTA		olfactory receptor, family 10, subfamily T,							127.0	125.0	126.0					1																	158368884		2203	4300	6503	SO:0001583	missense	128360				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158368884C>A	AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.373G>T	1.37:g.158368884C>A	ENSP00000334115:p.Val125Leu						p.V125L	NM_001004475	NP_001004475	Q8NGX3	O10T2_HUMAN			1	373	-	all_hematologic(112;0.0378)		125			Cytoplasmic (Potential).		Q6IF98	Missense_Mutation	SNP	ENST00000334438.1	37	c.373G>T	CCDS30895.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.676197	0.29783	.	.	ENSG00000186306	ENST00000334438	T	0.12039	2.72	4.56	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35320	U	0.003294	T	0.10121	0.0248	M	0.66297	2.02	0.22610	N	0.998934	P	0.42409	0.779	B	0.39904	0.313	T	0.03043	-1.1079	10	0.59425	D	0.04	.	16.2659	0.82579	0.0:1.0:0.0:0.0	.	125	Q8NGX3	O10T2_HUMAN	L	125	ENSP00000334115:V125L	ENSP00000334115:V125L	V	-	1	0	OR10T2	156635508	0.231000	0.23751	0.196000	0.23383	0.237000	0.25408	0.764000	0.26532	2.355000	0.79922	0.650000	0.86243	GTA		0.473	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046371.1	NM_001004475		25	93	1	0	5.45024e-15	0.00333	1.04872e-14	25	93				
SPTA1	6708	broad.mit.edu	37	1	158592830	158592830	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:158592830C>A	ENST00000368147.4	-	43	6243	c.6063G>T	c.(6061-6063)ctG>ctT	p.L2021L		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2021					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L2021L(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCGAGGCTTCCAGCAACTGTT	0.468																																							uc001fst.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(6061-6063)CTG>CTT		spectrin, alpha, erythrocytic 1							202.0	203.0	203.0					1																	158592830		1929	4130	6059	SO:0001819	synonymous_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158592830C>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6063G>T	1.37:g.158592830C>A							p.L2021L	NM_003126	NP_003117	P02549	SPTA1_HUMAN			43	6262	-	all_hematologic(112;0.0378)		2021			Spectrin 19.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	c.6063G>T	CCDS41423.1																																																																																				0.468	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		55	261	1	0	1.46156e-29	0.01441	3.07457e-29	55	261				
PBX1	5087	broad.mit.edu	37	1	164789369	164789369	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:164789369T>G	ENST00000420696.2	+	7	1246	c.1058T>G	c.(1057-1059)cTc>cGc	p.L353R	PBX1_ENST00000560641.1_Missense_Mutation_p.L248R|PBX1_ENST00000540246.1_Missense_Mutation_p.L248R|PBX1_ENST00000540236.1_Missense_Mutation_p.L353R|PBX1_ENST00000559240.1_Intron|PBX1_ENST00000401534.1_Intron|PBX1_ENST00000367897.1_Intron	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	353					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.L353R(1)	EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						GTGCAGTCACTCAATGGGGAT	0.488			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																		uc001gct.2		NA		Dom	yes		1	1q23	5087	T	pre-B-cell leukemia transcription factor 1			"""L, M"""	TCF3|EWSR1		pre B-ALL|myoepithelioma	EWSR1/PBX1(3)	1	Substitution - Missense(1)		lung(1)	soft_tissue(3)|lung(1)|skin(1)	5						c.(1057-1059)CTC>CGC		pre-B-cell leukemia homeobox 1							94.0	93.0	94.0					1																	164789369		2203	4300	6503	SO:0001583	missense	5087				negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr1:164789369T>G	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.1058T>G	1.37:g.164789369T>G	ENSP00000405890:p.Leu353Arg					PBX1_uc010pku.1_Missense_Mutation_p.L353R|PBX1_uc010pkv.1_Missense_Mutation_p.L270R|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Missense_Mutation_p.L243R	p.L353R	NM_002585	NP_002576	P40424	PBX1_HUMAN			7	1316	+			353					B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	37	c.1058T>G	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.772724	0.90108	.	.	ENSG00000185630	ENST00000420696;ENST00000540236;ENST00000540246	D;D;D	0.89939	-2.48;-2.51;-2.59	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.92331	0.7567	M	0.79475	2.455	.	.	.	D;D;D;D	0.56287	0.957;0.968;0.975;0.968	P;P;P;P	0.61800	0.822;0.756;0.894;0.756	D	0.92896	0.6335	9	0.54805	T	0.06	-10.0862	15.47	0.75434	0.0:0.0:0.0:1.0	.	248;353;353;353	B7Z774;A8K5V0;F5H4U9;P40424	.;.;.;PBX1_HUMAN	R	353;353;248	ENSP00000405890:L353R;ENSP00000439943:L353R;ENSP00000440869:L248R	ENSP00000405890:L353R	L	+	2	0	PBX1	163055993	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.587000	0.82613	2.134000	0.65973	0.533000	0.62120	CTC		0.488	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585		6	76	0	0	0	0.001168	0	6	76				
SELL	6402	broad.mit.edu	37	1	169670773	169670773	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:169670773G>A	ENST00000236147.4	-	7	1208	c.1048C>T	c.(1048-1050)Cca>Tca	p.P350S	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	337					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)	p.P337S(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					ACTGCCACTGGAATGAAGAGG	0.403																																							uc001ggk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1009-1011)CCA>TCA		selectin L precursor							45.0	43.0	44.0					1																	169670773		1854	4095	5949	SO:0001583	missense	6402				blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	integral to plasma membrane	glycosphingolipid binding|heparin binding|protease binding|sugar binding	g.chr1:169670773G>A	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.1048C>T	1.37:g.169670773G>A	ENSP00000236147:p.Pro350Ser					C1orf112_uc001ggj.2_Intron|SELL_uc010pls.1_Missense_Mutation_p.P290S|SELL_uc001ggl.1_Missense_Mutation_p.P350S	p.P337S	NM_000655	NP_000646	P14151	LYAM1_HUMAN			7	1207	-	all_hematologic(923;0.208)		337			Helical; (Potential).		B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	ENST00000236147.4	37	c.1009C>T	CCDS53427.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719453	0.68844	.	.	ENSG00000188404	ENST00000236147	T	0.13901	2.55	5.79	4.88	0.63580	.	0.121259	0.37136	N	0.002230	T	0.23926	0.0579	M	0.71581	2.175	0.40608	D	0.981648	D;D	0.89917	1.0;1.0	D;D	0.85130	0.973;0.997	T	0.02424	-1.1161	10	0.59425	D	0.04	-13.933	10.7756	0.46348	0.0866:0.0:0.9134:0.0	.	350;337	Q8WW79;P14151	.;LYAM1_HUMAN	S	350	ENSP00000236147:P350S	ENSP00000236147:P350S	P	-	1	0	SELL	167937397	0.994000	0.37717	0.708000	0.30435	0.857000	0.48899	4.489000	0.60309	1.457000	0.47850	0.655000	0.94253	CCA		0.403	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655		4	11	0	0	0	0.009096	0	4	11				
SLC9C2	284525	broad.mit.edu	37	1	173493226	173493226	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:173493226A>G	ENST00000367714.3	-	21	2944	c.2522T>C	c.(2521-2523)cTt>cCt	p.L841P	SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	841					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.L841P(1)									TAATTTTTTAAGAAGTACCTA	0.338																																							uc001giz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2521-2523)CTT>CCT		solute carrier family 9, member 11																																				SO:0001583	missense	284525				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity	g.chr1:173493226A>G	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.2522T>C	1.37:g.173493226A>G	ENSP00000356687:p.Leu841Pro					SLC9A11_uc009wwe.2_Missense_Mutation_p.L399P	p.L841P	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN			21	2945	-			841					Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	c.2522T>C	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	A	17.50	3.405907	0.62288	.	.	ENSG00000162753	ENST00000367714	T	0.04454	3.62	5.62	5.62	0.85841	.	0.138873	0.30920	N	0.008617	T	0.10078	0.0247	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04065	-1.0980	10	0.42905	T	0.14	-22.1466	12.2456	0.54568	1.0:0.0:0.0:0.0	.	841	Q5TAH2	S9A11_HUMAN	P	841	ENSP00000356687:L841P	ENSP00000356687:L841P	L	-	2	0	SLC9A11	171759849	1.000000	0.71417	0.604000	0.28916	0.799000	0.45148	4.381000	0.59587	2.141000	0.66446	0.528000	0.53228	CTT		0.338	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		11	55	0	0	0	0.001855	0	11	55				
KIAA1614	57710	broad.mit.edu	37	1	180886014	180886014	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:180886014C>A	ENST00000367588.4	+	2	830	c.775C>A	c.(775-777)Ctg>Atg	p.L259M		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	259								p.L259M(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						TAGCACATCCCTGACCTCCGA	0.582																																							uc001gok.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(775-777)CTG>ATG		hypothetical protein LOC57710							144.0	158.0	153.0					1																	180886014		2071	4206	6277	SO:0001583	missense	57710							g.chr1:180886014C>A	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.775C>A	1.37:g.180886014C>A	ENSP00000356560:p.Leu259Met						p.L259M	NM_020950	NP_066001	Q5VZ46	K1614_HUMAN			2	842	+			259					Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	c.775C>A	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.608961	0.28623	.	.	ENSG00000135835	ENST00000367588	T	0.05925	3.37	4.57	2.71	0.32032	.	0.607548	0.12570	N	0.457382	T	0.14614	0.0353	L	0.44542	1.39	0.23391	N	0.99778	D	0.89917	1.0	D	0.72075	0.976	T	0.14671	-1.0464	9	0.56958	D	0.05	-1.8665	6.2175	0.20663	0.0:0.6952:0.0:0.3048	.	259	Q5VZ46	K1614_HUMAN	M	259	ENSP00000356560:L259M	ENSP00000356560:L259M	L	+	1	2	KIAA1614	179152637	0.004000	0.15560	0.003000	0.11579	0.410000	0.31052	0.051000	0.14141	0.557000	0.29117	0.563000	0.77884	CTG		0.582	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531		32	156	1	0	3.03874e-20	0.003271	6.10757e-20	32	156				
DHX9	1660	broad.mit.edu	37	1	182827319	182827319	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:182827319C>T	ENST00000367549.3	+	8	864	c.754C>T	c.(754-756)Cat>Tat	p.H252Y		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	252	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.|Interaction with BRCA1.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)	p.H252Y(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						ACAACTGTACCATCTTGGAGT	0.418																																					Colon(69;210 1162 3697 13559 39565)	Colon(69;210 1162 3697 13559 39565)	uc001gpr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(754-756)CAT>TAT		DEAH (Asp-Glu-Ala-His) box polypeptide 9							98.0	93.0	95.0					1																	182827319		1997	4194	6191	SO:0001583	missense	1660				CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding	g.chr1:182827319C>T	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.754C>T	1.37:g.182827319C>T	ENSP00000356520:p.His252Tyr					DHX9_uc001gps.2_Missense_Mutation_p.H38Y	p.H252Y	NM_001357	NP_001348	Q08211	DHX9_HUMAN			8	917	+			252			Interaction with BRCA1.|DRBM 2.		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	c.754C>T	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026685	0.93518	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.10382	2.88	5.25	5.25	0.73442	Double-stranded RNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.41834	0.1176	M	0.88105	2.93	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.47947	-0.9077	10	0.66056	D	0.02	.	18.8047	0.92032	0.0:1.0:0.0:0.0	.	252	Q08211	DHX9_HUMAN	Y	252	ENSP00000356520:H252Y	ENSP00000356520:H252Y	H	+	1	0	DHX9	181093942	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.200000	0.77838	2.610000	0.88304	0.591000	0.81541	CAT		0.418	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588		16	84	0	0	0	0.00499	0	16	84				
ASPM	259266	broad.mit.edu	37	1	197112663	197112663	+	Missense_Mutation	SNP	G	G	A	rs140646088|rs199422135		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:197112663G>A	ENST00000367409.4	-	3	975	c.719C>T	c.(718-720)tCt>tTt	p.S240F	ASPM_ENST00000294732.7_Missense_Mutation_p.S240F	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	240					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.S240F(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TCGACGTACAGAGAGTGGCAA	0.363																																							uc001gtu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(718-720)TCT>TTT		asp (abnormal spindle)-like, microcephaly							140.0	131.0	134.0					1																	197112663		2203	4300	6503	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197112663G>A	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.719C>T	1.37:g.197112663G>A	ENSP00000356379:p.Ser240Phe					ASPM_uc001gtv.2_Missense_Mutation_p.S240F|ASPM_uc001gtw.3_Intron	p.S240F	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN			3	976	-			240					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.719C>T	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	G	6.447	0.450557	0.12223	.	.	ENSG00000066279	ENST00000367409;ENST00000294732	T;T	0.64438	-0.1;1.27	5.25	2.14	0.27477	.	0.366306	0.26435	N	0.024384	T	0.41396	0.1157	L	0.38175	1.15	0.09310	N	1	B;P	0.35363	0.003;0.497	B;B	0.28553	0.003;0.091	T	0.21348	-1.0248	10	0.13470	T	0.59	.	7.4099	0.27011	0.162:0.1354:0.7026:0.0	.	240;240	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	F	240	ENSP00000356379:S240F;ENSP00000294732:S240F	ENSP00000294732:S240F	S	-	2	0	ASPM	195379286	0.004000	0.15560	0.001000	0.08648	0.009000	0.06853	0.449000	0.21744	0.225000	0.20959	-0.377000	0.06932	TCT		0.363	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		27	136	0	0	0	0.00632	0	27	136				
KIF21B	23046	broad.mit.edu	37	1	200960046	200960046	+	Splice_Site	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:200960046G>T	ENST00000422435.2	-	18	3002	c.2686C>A	c.(2686-2688)Cga>Aga	p.R896R	KIF21B_ENST00000360529.5_Splice_Site_p.R896R|KIF21B_ENST00000461742.2_Splice_Site_p.R896R|KIF21B_ENST00000332129.2_Splice_Site_p.R896R	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	896					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R896R(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CCACCTTACCGGGCAGGACGG	0.647																																							uc001gvs.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(3)	6						c.(2686-2688)CGA>AGA		kinesin family member 21B							61.0	62.0	62.0					1																	200960046		2203	4300	6503	SO:0001630	splice_region_variant	23046				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:200960046G>T	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.2687+1C>A	1.37:g.200960046G>T						KIF21B_uc001gvr.1_Silent_p.R896R|KIF21B_uc009wzl.1_Silent_p.R896R|KIF21B_uc010ppn.1_Silent_p.R896R	p.R896R	NM_017596	NP_060066	O75037	KI21B_HUMAN			18	3003	-			896					B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	37	c.2686C>A	CCDS58056.1																																																																																				0.647	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	Silent	12	44	1	0	2.80697e-09	0.010729	4.40012e-09	12	44				
PRELP	5549	broad.mit.edu	37	1	203453067	203453067	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:203453067A>G	ENST00000343110.2	+	2	882	c.755A>G	c.(754-756)aAc>aGc	p.N252S		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	252					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.N252S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			CTGGACAGTAACAAGATTGAG	0.532																																							uc001gzs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(754-756)AAC>AGC		proline arginine-rich end leucine-rich repeat							141.0	139.0	140.0					1																	203453067		2203	4300	6503	SO:0001583	missense	5549				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent	g.chr1:203453067A>G	BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.755A>G	1.37:g.203453067A>G	ENSP00000343924:p.Asn252Ser					PRELP_uc001gzt.2_Missense_Mutation_p.N252S	p.N252S	NM_002725	NP_002716	P51888	PRELP_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		2	955	+			252			LRR 7.		Q6FG38	Missense_Mutation	SNP	ENST00000343110.2	37	c.755A>G	CCDS1438.1	.	.	.	.	.	.	.	.	.	.	A	18.67	3.673203	0.67928	.	.	ENSG00000188783	ENST00000343110	T	0.72615	-0.67	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.85622	0.5739	M	0.88105	2.93	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.88380	0.3001	10	0.87932	D	0	-17.1399	13.134	0.59399	1.0:0.0:0.0:0.0	.	252	P51888	PRELP_HUMAN	S	252	ENSP00000343924:N252S	ENSP00000343924:N252S	N	+	2	0	PRELP	201719690	1.000000	0.71417	0.996000	0.52242	0.789000	0.44602	9.339000	0.96797	1.797000	0.52628	0.379000	0.24179	AAC		0.532	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	NM_002725		18	106	0	0	0	0.008871	0	18	106				
FAM71A	149647	broad.mit.edu	37	1	212798394	212798394	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:212798394G>A	ENST00000294829.3	+	1	606	c.175G>A	c.(175-177)Gtg>Atg	p.V59M	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	59						nucleus (GO:0005634)		p.V59M(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		AAGGGGAGAAGTGATTGATGT	0.522																																							uc001hjk.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|central_nervous_system(1)	5						c.(175-177)GTG>ATG		hypothetical protein LOC149647							191.0	166.0	174.0					1																	212798394		2203	4300	6503	SO:0001583	missense	149647							g.chr1:212798394G>A		CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.175G>A	1.37:g.212798394G>A	ENSP00000294829:p.Val59Met					uc010pth.1_Intron	p.V59M	NM_153606	NP_705834	Q8IYT1	FA71A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)	1	579	+			59					Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	37	c.175G>A	CCDS1507.1	.	.	.	.	.	.	.	.	.	.	G	16.01	3.001947	0.54254	.	.	ENSG00000162771	ENST00000294829	T	0.04706	3.57	4.41	2.45	0.29901	.	0.244339	0.28171	N	0.016331	T	0.20210	0.0486	M	0.87456	2.885	0.09310	N	1	D	0.71674	0.998	D	0.64042	0.921	T	0.03193	-1.1062	10	0.72032	D	0.01	-25.6287	10.8953	0.47019	0.0:0.3682:0.6318:0.0	.	59	Q8IYT1	FA71A_HUMAN	M	59	ENSP00000294829:V59M	ENSP00000294829:V59M	V	+	1	0	FAM71A	210865017	0.719000	0.27986	0.003000	0.11579	0.996000	0.88848	1.490000	0.35573	0.569000	0.29329	0.460000	0.39030	GTG		0.522	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606		14	69	0	0	0	0.00499	0	14	69				
KCNK2	3776	broad.mit.edu	37	1	215408346	215408346	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:215408346G>T	ENST00000444842.2	+	7	1289	c.1139G>T	c.(1138-1140)tGt>tTt	p.C380F	KCNK2_ENST00000391895.2_Missense_Mutation_p.C376F|KCNK2_ENST00000391894.2_Missense_Mutation_p.C365F	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	380	Essential for chloroform and halothane sensitivity. {ECO:0000250}.|Required for basal channel activity. {ECO:0000250}.				G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.C380F(1)|p.C365F(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	CTGACTCCTTGTAGGAGGACC	0.532																																							uc001hkq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1138-1140)TGT>TTT		potassium channel, subfamily K, member 2 isoform	Dofetilide(DB00204)						79.0	78.0	78.0					1																	215408346		2203	4300	6503	SO:0001583	missense	3776						outward rectifier potassium channel activity	g.chr1:215408346G>T	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.1139G>T	1.37:g.215408346G>T	ENSP00000394033:p.Cys380Phe					KCNK2_uc001hko.2_Missense_Mutation_p.C376F|KCNK2_uc009xdm.2_RNA|KCNK2_uc001hkp.2_RNA|KCNK2_uc001hkr.3_Missense_Mutation_p.C365F	p.C380F	NM_001017425	NP_001017425	O95069	KCNK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	7	1308	+			380			Cytoplasmic (Potential).|Essential for chloroform and halothane sensitivity (By similarity).|Required for basal channel activity (By similarity).		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	c.1139G>T	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371757	0.61624	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.20332	2.09;2.1;2.08	5.72	5.72	0.89469	.	0.147686	0.64402	D	0.000007	T	0.23249	0.0562	N	0.19112	0.55	0.53688	D	0.999975	P;P;P	0.50943	0.94;0.9;0.94	P;P;P	0.52066	0.689;0.492;0.689	T	0.01977	-1.1236	10	0.10111	T	0.7	.	19.88	0.96892	0.0:0.0:1.0:0.0	.	365;380;376	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	F	376;365;380	ENSP00000375765:C376F;ENSP00000375764:C365F;ENSP00000394033:C380F	ENSP00000375764:C365F	C	+	2	0	KCNK2	213474969	1.000000	0.71417	0.611000	0.29010	0.978000	0.69477	5.277000	0.65586	2.708000	0.92522	0.561000	0.74099	TGT		0.532	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217		7	42	1	0	8.12818e-05	0.001984	9.76344e-05	7	42				
USH2A	7399	broad.mit.edu	37	1	216424377	216424377	+	Missense_Mutation	SNP	C	C	T	rs367693972		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:216424377C>T	ENST00000307340.3	-	12	2421	c.2035G>A	c.(2035-2037)Gga>Aga	p.G679R	USH2A_ENST00000366942.3_Missense_Mutation_p.G679R|USH2A_ENST00000366943.2_Missense_Mutation_p.G679R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	679	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.G679R(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTGTAGAATCCATTCTGGCAC	0.438										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(2035-2037)GGA>AGA		usherin isoform B		C	ARG/GLY,ARG/GLY	0,4406		0,0,2203	146.0	123.0	131.0		2035,2035	5.3	1.0	1		131	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	USH2A	NM_007123.5,NM_206933.2	125,125	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	679/1547,679/5203	216424377	2,13004	2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216424377C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2035G>A	1.37:g.216424377C>T	ENSP00000305941:p.Gly679Arg	HNSCC(13;0.011)				USH2A_uc001hkv.2_Missense_Mutation_p.G679R	p.G679R	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	12	2422	-			679			Extracellular (Potential).|Laminin EGF-like 3.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.2035G>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.036837	0.75617	0.0	2.33E-4	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.66638	-0.22;-0.22;-0.22	5.26	5.26	0.73747	EGF-like, laminin (4);	0.000000	0.42821	D	0.000651	D	0.86155	0.5865	M	0.91038	3.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89286	0.3615	10	0.87932	D	0	.	18.8587	0.92264	0.0:1.0:0.0:0.0	.	679;679	O75445-2;O75445	.;USH2A_HUMAN	R	679	ENSP00000305941:G679R;ENSP00000355910:G679R;ENSP00000355909:G679R	ENSP00000305941:G679R	G	-	1	0	USH2A	214491000	1.000000	0.71417	0.964000	0.40570	0.999000	0.98932	7.191000	0.77763	2.463000	0.83235	0.655000	0.94253	GGA		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		11	51	0	0	0	0.008291	0	11	51				
TGFB2	7042	broad.mit.edu	37	1	218607527	218607527	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:218607527A>T	ENST00000366930.4	+	3	1081	c.614A>T	c.(613-615)gAt>gTt	p.D205V	TGFB2_ENST00000479322.1_3'UTR|TGFB2_ENST00000366929.4_Missense_Mutation_p.D233V	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	205					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)	p.D205V(1)|p.D233V(1)		breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		GATGTAACTGATGCTGTTCAT	0.423																																							uc001hlm.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(613-615)GAT>GTT		transforming growth factor, beta 2 isoform 2							159.0	140.0	146.0					1																	218607527		2203	4300	6503	SO:0001583	missense	7042				activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding	g.chr1:218607527A>T	M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.614A>T	1.37:g.218607527A>T	ENSP00000355897:p.Asp205Val					TGFB2_uc001hln.2_Missense_Mutation_p.D233V|TGFB2_uc010pue.1_RNA|TGFB2_uc001hlo.2_RNA	p.D205V	NM_003238	NP_003229	P61812	TGFB2_HUMAN		all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)	3	1267	+			205					B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Missense_Mutation	SNP	ENST00000366930.4	37	c.614A>T	CCDS1521.1	.	.	.	.	.	.	.	.	.	.	A	18.32	3.598176	0.66332	.	.	ENSG00000092969	ENST00000366930;ENST00000366929	T;T	0.66099	-0.19;-0.19	5.91	5.91	0.95273	Transforming growth factor-beta, N-terminal (1);	0.090954	0.85682	D	0.000000	T	0.60560	0.2278	L	0.42245	1.32	0.80722	D	1	B;B	0.29805	0.257;0.091	B;B	0.35182	0.197;0.102	T	0.61992	-0.6948	10	0.72032	D	0.01	.	16.3512	0.83208	1.0:0.0:0.0:0.0	.	233;205	P61812-2;P61812	.;TGFB2_HUMAN	V	205;233	ENSP00000355897:D205V;ENSP00000355896:D233V	ENSP00000355896:D233V	D	+	2	0	TGFB2	216674150	1.000000	0.71417	0.555000	0.28281	0.974000	0.67602	8.904000	0.92590	2.266000	0.75297	0.533000	0.62120	GAT		0.423	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238		27	125	0	0	0	0.003954	0	27	125				
RAB4A	5867	broad.mit.edu	37	1	229438646	229438646	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:229438646G>T	ENST00000366690.4	+	7	787	c.579G>T	c.(577-579)caG>caT	p.Q193H	SPHAR_ENST00000366688.3_5'Flank|RAB4A_ENST00000473894.1_3'UTR	NM_004578.2	NP_004569.2	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	193					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein transporter activity (GO:0008565)	p.Q193H(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				CAGGTATTCAGTACGGAGATG	0.502																																					Esophageal Squamous(11;250 603 9619 16563)	Esophageal Squamous(11;250 603 9619 16563)	uc001hth.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(577-579)CAG>CAT		RAB4A, member RAS oncogene family							92.0	93.0	92.0					1																	229438646		2203	4300	6503	SO:0001583	missense	5867						GDP binding|GTP binding|GTPase activity	g.chr1:229438646G>T	BC004309	CCDS31050.1, CCDS73046.1	1q42-q43	2014-04-03		2002-02-28	ENSG00000168118	ENSG00000168118		"""RAB, member RAS oncogene"""	9781	protein-coding gene	gene with protein product		179511		RAB4			Standard	NM_004578		Approved	HRES-1/RAB4	uc001hth.4	P20338	OTTHUMG00000037627	ENST00000366690.4:c.579G>T	1.37:g.229438646G>T	ENSP00000355651:p.Gln193His					RAB4A_uc001hti.2_RNA|RAB4A_uc001htj.2_RNA|SPHAR_uc001htk.3_5'Flank	p.Q193H	NM_004578	NP_004569	P20338	RAB4A_HUMAN			7	787	+	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)	188					Q5T7P7|Q9BQ44	Missense_Mutation	SNP	ENST00000366690.4	37	c.579G>T	CCDS31050.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292197	0.59976	.	.	ENSG00000168118	ENST00000366690	T	0.64085	-0.08	5.74	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.47544	0.1451	N	0.19112	0.55	0.58432	D	0.999996	B	0.18863	0.031	B	0.21151	0.033	T	0.46748	-0.9169	10	0.59425	D	0.04	.	12.473	0.55797	0.0768:0.0:0.9232:0.0	.	188	P20338	RAB4A_HUMAN	H	193	ENSP00000355651:Q193H	ENSP00000355651:Q193H	Q	+	3	2	RAB4A	227505269	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.158000	0.42329	2.709000	0.92574	0.655000	0.94253	CAG		0.502	RAB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091727.3	NM_004578		15	77	1	0	1.52009e-12	0.003163	2.74292e-12	15	77				
LYST	1130	broad.mit.edu	37	1	235918893	235918893	+	Nonsense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:235918893T>A	ENST00000389794.3	-	25	7288	c.7114A>T	c.(7114-7116)Aag>Tag	p.K2372*	LYST_ENST00000389793.2_Nonsense_Mutation_p.K2372*			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2372					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.K2372*(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CCACGATTCTTCAGAAATTTA	0.308																																							uc001hxj.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|breast(4)|central_nervous_system(2)	12						c.(7114-7116)AAG>TAG		lysosomal trafficking regulator							146.0	150.0	149.0					1																	235918893		2203	4300	6503	SO:0001587	stop_gained	1130	Chediak-Higashsyndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235918893T>A	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.7114A>T	1.37:g.235918893T>A	ENSP00000374444:p.Lys2372*					LYST_uc009xga.1_5'Flank	p.K2372*	NM_000081	NP_000072	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		25	7289	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	2372					O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Nonsense_Mutation	SNP	ENST00000389794.3	37	c.7114A>T	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	T	49	15.521190	0.99836	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	.	.	.	5.31	4.15	0.48705	.	0.188889	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3955	0.49838	0.1356:0.0:0.0:0.8644	.	.	.	.	X	2372	.	ENSP00000374443:K2372X	K	-	1	0	LYST	233985516	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	0.817000	0.34445	0.477000	0.44152	AAG		0.308	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			57	251	0	0	0	0.01441	0	57	251				
OR2L3	391192	broad.mit.edu	37	1	248224588	248224588	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:248224588C>A	ENST00000359959.3	+	1	605	c.605C>A	c.(604-606)aCc>aAc	p.T202N	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T202N(1)		cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TTTTTGAGCACCACCATCTTT	0.488																																							uc001idx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(604-606)ACC>AAC		olfactory receptor, family 2, subfamily L,							193.0	212.0	205.0					1																	248224588		2194	4300	6494	SO:0001583	missense	391192				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248224588C>A	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.605C>A	1.37:g.248224588C>A	ENSP00000353044:p.Thr202Asn					OR2L13_uc001ids.2_Intron	p.T202N	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	605	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		202			Helical; Name=5; (Potential).		B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	c.605C>A	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.757269	0.31137	.	.	ENSG00000198128	ENST00000359959	T	0.38077	1.16	2.05	-3.41	0.04839	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34002	U	0.004342	T	0.37945	0.1022	L	0.41492	1.28	0.09310	N	1	P	0.50369	0.934	P	0.62491	0.903	T	0.31613	-0.9937	10	0.87932	D	0	.	5.6291	0.17499	0.0:0.4926:0.2985:0.2089	.	202	Q8NG85	OR2L3_HUMAN	N	202	ENSP00000353044:T202N	ENSP00000353044:T202N	T	+	2	0	OR2L3	246291211	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.564000	0.05936	-0.699000	0.05077	-0.361000	0.07541	ACC		0.488	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687		14	108	1	0	1.5842e-08	0.001855	2.40893e-08	14	108				
OR2M7	391196	broad.mit.edu	37	1	248487473	248487473	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr1:248487473G>T	ENST00000317965.2	-	1	426	c.398C>A	c.(397-399)aCc>aAc	p.T133N		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T133N(1)		breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATGAGATTGGTGTATCTTAG	0.433																																							uc010pzk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(397-399)ACC>AAC		olfactory receptor, family 2, subfamily M,							223.0	227.0	226.0					1																	248487473		2203	4298	6501	SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248487473G>T	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.398C>A	1.37:g.248487473G>T	ENSP00000324557:p.Thr133Asn						p.T133N	NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	398	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		133			Cytoplasmic (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	c.398C>A	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	G	6.364	0.435226	0.12045	.	.	ENSG00000177186	ENST00000317965	T	0.19532	2.14	1.54	0.551	0.17225	GPCR, rhodopsin-like superfamily (1);	0.658638	0.11629	U	0.545032	T	0.16769	0.0403	L	0.55213	1.73	0.09310	N	1	B	0.33549	0.417	B	0.32677	0.15	T	0.29701	-1.0003	10	0.87932	D	0	.	2.5056	0.04644	0.4463:0.2734:0.2804:0.0	.	133	Q8NG81	OR2M7_HUMAN	N	133	ENSP00000324557:T133N	ENSP00000324557:T133N	T	-	2	0	OR2M7	246554096	0.000000	0.05858	0.014000	0.15608	0.111000	0.19643	-0.282000	0.08445	0.845000	0.35118	0.184000	0.17185	ACC		0.433	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		36	178	1	0	3.76114e-14	0.004289	7.10242e-14	36	178				
TUBB8	347688	broad.mit.edu	37	10	93408	93408	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:93408G>T	ENST00000309812.4	-	4	986	c.924C>A	c.(922-924)ggC>ggA	p.G308G	TUBB8_ENST00000447903.2_Silent_p.G236G|TUBB8_ENST00000413237.3_5'Flank	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	308					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G308G(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TTAGGTAGCGGCCGTGACGGG	0.552																																					Pancreas(192;2041 3010 9013 18103)	Pancreas(192;2041 3010 9013 18103)	uc001ifi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(922-924)GGC>GGA		tubulin, beta 8 isoform 1							55.0	69.0	64.0					10																	93408		1889	3741	5630	SO:0001819	synonymous_variant	347688				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr10:93408G>T	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.924C>A	10.37:g.93408G>T						TUBB8_uc009xhe.2_Silent_p.G271G|TUBB8_uc010pzs.1_Silent_p.G236G	p.G308G	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)	4	924	-		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)	308					Q5SQX9|Q8WZ78	Silent	SNP	ENST00000309812.4	37	c.924C>A	CCDS7051.1																																																																																				0.552	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987		31	94	1	0	6.68952e-21	0.013114	1.35122e-20	31	94				
ALOX5	240	broad.mit.edu	37	10	45877968	45877968	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:45877968G>C	ENST00000374391.2	+	2	241	c.188G>C	c.(187-189)gGc>gCc	p.G63A	ALOX5_ENST00000542434.1_Missense_Mutation_p.G63A	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	63	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)	p.G63A(1)		breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	GAGGAACTGGGCGAGATCCAG	0.552																																							uc001jce.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(187-189)GGC>GCC		arachidonate 5-lipoxygenase	Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)						151.0	115.0	127.0					10																	45877968		2203	4300	6503	SO:0001583	missense	240				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding	g.chr10:45877968G>C	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.188G>C	10.37:g.45877968G>C	ENSP00000363512:p.Gly63Ala					ALOX5_uc009xmt.2_Missense_Mutation_p.G63A|ALOX5_uc010qfg.1_Missense_Mutation_p.G63A	p.G63A	NM_000698	NP_000689	P09917	LOX5_HUMAN			2	287	+		Lung SC(717;0.0257)	63			PLAT.		B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	c.188G>C	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.745973	0.89663	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	T;T	0.75938	-0.98;-0.98	4.9	4.9	0.64082	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.103749	0.64402	D	0.000004	D	0.86826	0.6026	M	0.83774	2.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.88685	0.3205	10	0.87932	D	0	-21.3664	15.6141	0.76750	0.0:0.0:1.0:0.0	.	63;63;63	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	A	63	ENSP00000437634:G63A;ENSP00000363512:G63A	ENSP00000363512:G63A	G	+	2	0	ALOX5	45197974	1.000000	0.71417	0.967000	0.41034	0.901000	0.52897	9.657000	0.98554	2.558000	0.86282	0.650000	0.86243	GGC		0.552	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1			7	27	0	0	0	0.00308	0	7	27				
NRG3	10718	broad.mit.edu	37	10	84745264	84745264	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:84745264C>A	ENST00000404547.1	+	10	2066	c.2066C>A	c.(2065-2067)aCa>aAa	p.T689K	NRG3_ENST00000372142.2_Missense_Mutation_p.T468K|NRG3_ENST00000556918.1_Missense_Mutation_p.T495K|NRG3_ENST00000545131.1_Missense_Mutation_p.T315K|NRG3_ENST00000372141.2_Missense_Mutation_p.T665K|NRG3_ENST00000537893.1_Missense_Mutation_p.T315K|NRG3_ENST00000404576.2_Missense_Mutation_p.T469K			P56975	NRG3_HUMAN	neuregulin 3	689					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.T468K(1)|p.T665K(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		AGCGAAAACACAGCCTTTCTC	0.488																																							uc001kco.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|breast(1)	6						c.(1993-1995)ACA>AAA		neuregulin 3 isoform 1							80.0	74.0	76.0					10																	84745264		2203	4300	6503	SO:0001583	missense	10718				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity	g.chr10:84745264C>A	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.2066C>A	10.37:g.84745264C>A	ENSP00000384796:p.Thr689Lys					NRG3_uc010qlz.1_Missense_Mutation_p.T664K|NRG3_uc001kcp.2_Missense_Mutation_p.T468K|NRG3_uc001kcq.2_Missense_Mutation_p.T315K|NRG3_uc001kcr.2_Missense_Mutation_p.T339K	p.T665K	NM_001010848	NP_001010848	P56975	NRG3_HUMAN		GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)	9	2021	+			689			Cytoplasmic (Potential).		A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	37	c.1994C>A	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.546374	0.65198	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.60797	0.81;0.68;0.73;0.16;0.73;0.33;0.33	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000001	T	0.72011	0.3408	L	0.50333	1.59	0.53005	D	0.999966	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.73864	-0.3848	10	0.87932	D	0	-18.8055	16.9886	0.86347	0.0:1.0:0.0:0.0	.	664;689;468;665	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	K	665;689;664;468;469;495;315;315	ENSP00000361214:T665K;ENSP00000384796:T689K;ENSP00000361215:T468K;ENSP00000385804:T469K;ENSP00000451376:T495K;ENSP00000441201:T315K;ENSP00000440377:T315K	ENSP00000361214:T665K	T	+	2	0	NRG3	84735244	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.274000	0.65569	2.615000	0.88500	0.655000	0.94253	ACA		0.488	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086		8	47	1	0	0.000157383	0.00308	0.000186835	8	47				
BMPR1A	657	broad.mit.edu	37	10	88681386	88681386	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:88681386A>G	ENST00000372037.3	+	11	1813	c.1276A>G	c.(1276-1278)Atc>Gtc	p.I426V		NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	426	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.I426V(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						CCAGCCCTACATCATGGCTGA	0.488			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												Ovarian(190;603 2086 22044 30335 47971)	Ovarian(190;603 2086 22044 30335 47971)	uc001kdy.2		NA	yes	Rec		Juvenile polyposis	10	10q22.3	657	Mis|N|F	"""bone morphogenetic protein receptor, type IA"""			E		gastrointestinal polyps			2	Substitution - Missense(2)		lung(2)	lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						c.(1276-1278)ATC>GTC		bone morphogenetic protein receptor, type IA							159.0	151.0	154.0					10																	88681386		2203	4298	6501	SO:0001583	missense	657	Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity	g.chr10:88681386A>G	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.1276A>G	10.37:g.88681386A>G	ENSP00000361107:p.Ile426Val					BMPR1A_uc001kdz.2_5'Flank	p.I426V	NM_004329	NP_004320	P36894	BMR1A_HUMAN			11	1824	+			426			Cytoplasmic (Potential).|Protein kinase.		A8K6U9|Q8NEN8	Missense_Mutation	SNP	ENST00000372037.3	37	c.1276A>G	CCDS7378.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.955289	0.73902	.	.	ENSG00000107779	ENST00000224764;ENST00000372037	T	0.64618	-0.11	5.63	4.51	0.55191	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.086238	0.85682	N	0.000000	T	0.60996	0.2312	N	0.17901	0.54	0.53005	D	0.999967	P	0.44139	0.827	P	0.55455	0.776	T	0.64601	-0.6369	10	0.72032	D	0.01	.	11.6185	0.51104	0.9307:0.0:0.0693:0.0	.	426	P36894	BMR1A_HUMAN	V	426	ENSP00000361107:I426V	ENSP00000224764:I426V	I	+	1	0	BMPR1A	88671366	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.215000	0.72206	1.092000	0.41356	0.533000	0.62120	ATC		0.488	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049170.3	NM_004329		19	120	0	0	0	0.010504	0	19	120				
FAS	355	broad.mit.edu	37	10	90768652	90768652	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:90768652A>T	ENST00000355279.2	+	4	341	c.341A>T	c.(340-342)gAa>gTa	p.E114V	FAS_ENST00000357339.2_Missense_Mutation_p.E114V|FAS_ENST00000355740.2_Missense_Mutation_p.E114V|FAS_ENST00000313771.5_3'UTR|FAS_ENST00000352159.4_Missense_Mutation_p.E114V			P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E114V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	CTAGGCTTAGAAGTGGAAATA	0.408																																							uc001kfr.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|breast(1)	2						c.(340-342)GAA>GTA		tumor necrosis factor receptor superfamily,							205.0	229.0	220.0					10																	90768652		2203	4300	6503	SO:0001583	missense	355	Autoimmune_Lymphoproliferative_syndrome_type_I			activation of caspase activity|activation of pro-apoptotic gene products|anti-apoptosis|cellular response to mechanical stimulus|positive regulation of necrotic cell death	cytosol|extracellular region|integral to membrane|soluble fraction	identical protein binding|kinase binding	g.chr10:90768652A>T	M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355279.2:c.341A>T	10.37:g.90768652A>T	ENSP00000347426:p.Glu114Val					FAS_uc010qna.1_RNA|FAS_uc001kfs.2_Missense_Mutation_p.E114V|FAS_uc001kft.2_Missense_Mutation_p.E114V|FAS_uc010qnb.1_Intron|FAS_uc010qnc.1_Intron|FAS_uc001kfw.2_Intron|FAS_uc010qnd.1_Intron|FAS_uc010qne.1_Intron|FAS_uc009xtp.2_RNA	p.E114V	NM_000043	NP_000034	P25445	TNR6_HUMAN		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	4	687	+		Colorectal(252;0.0161)	114			Extracellular (Potential).|TNFR-Cys 2.		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000355279.2	37	c.341A>T	CCDS7395.1	.	.	.	.	.	.	.	.	.	.	A	16.84	3.232720	0.58777	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000352159;ENST00000357339;ENST00000355279;ENST00000371875	D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73	4.2	4.2	0.49525	TNFR/CD27/30/40/95 cysteine-rich region (3);	0.336333	0.30547	N	0.009394	D	0.92103	0.7497	L	0.46157	1.445	0.44402	D	0.997314	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.994;0.986;0.998	D	0.90454	0.4441	10	0.36615	T	0.2	-51.5331	9.9623	0.41704	1.0:0.0:0.0:0.0	.	114;114;114	P25445-6;Q5T9P3;P25445	.;.;TNR6_HUMAN	V	141;114;114;114;114;114	ENSP00000347979:E114V;ENSP00000345601:E114V;ENSP00000349896:E114V;ENSP00000347426:E114V	ENSP00000345601:E114V	E	+	2	0	FAS	90758632	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	4.440000	0.59975	2.138000	0.66242	0.528000	0.53228	GAA		0.408	FAS-011	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000049280.2			57	340	0	0	0	0.01441	0	57	340				
ENTPD1	953	broad.mit.edu	37	10	97583120	97583120	+	Splice_Site	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:97583120A>T	ENST00000371205.4	+	2	426	c.143A>T	c.(142-144)aAg>aTg	p.K48M	ENTPD1_ENST00000539125.1_De_novo_Start_InFrame|ENTPD1_ENST00000490659.1_3'UTR|ENTPD1_ENST00000371203.5_5'UTR|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000371207.3_Splice_Site_p.K60M|ENTPD1_ENST00000543964.1_Intron|ENTPD1_ENST00000453258.2_Splice_Site_p.K55M			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	48					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)	p.K48M(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		GAAAACGTTAAGGTAAGTCAA	0.458																																							uc001klh.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(142-144)AAG>ATG		ectonucleoside triphosphate diphosphohydrolase 1							131.0	121.0	124.0					10																	97583120		2203	4300	6503	SO:0001630	splice_region_variant	953				cell adhesion	integral to plasma membrane	ATP binding	g.chr10:97583120A>T	S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.144+1A>T	10.37:g.97583120A>T						ENTPD1_uc001kle.1_Missense_Mutation_p.K55M|ENTPD1_uc001kli.3_Missense_Mutation_p.K55M|uc001klg.1_Intron|ENTPD1_uc010qoj.1_Missense_Mutation_p.K60M|ENTPD1_uc010qok.1_Intron|ENTPD1_uc010qol.1_Intron|ENTPD1_uc010qom.1_Missense_Mutation_p.K48M|ENTPD1_uc010qon.1_Translation_Start_Site|ENTPD1_uc009xva.2_Translation_Start_Site|ENTPD1_uc009xuz.2_RNA	p.K48M	NM_001776	NP_001767	P49961	ENTP1_HUMAN		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)	2	467	+		Colorectal(252;0.0821)	48			Extracellular (Potential).		A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Missense_Mutation	SNP	ENST00000371205.4	37	c.143A>T	CCDS7444.1	.	.	.	.	.	.	.	.	.	.	A	17.58	3.425481	0.62733	.	.	ENSG00000138185	ENST00000453258;ENST00000371206;ENST00000371207;ENST00000371205	T;T;T	0.14516	2.5;2.5;2.5	5.26	5.26	0.73747	.	0.147419	0.64402	D	0.000012	T	0.33702	0.0872	M	0.70903	2.155	0.80722	D	1	D;D;B;D;B	0.71674	0.995;0.994;0.051;0.998;0.103	D;P;B;D;B	0.68621	0.936;0.894;0.132;0.959;0.174	T	0.05007	-1.0912	10	0.56958	D	0.05	-23.2205	11.5721	0.50839	1.0:0.0:0.0:0.0	.	60;60;55;48;55	B4DWB9;G3XAF6;P49961-2;P49961;P49961-3	.;.;.;ENTP1_HUMAN;.	M	55;55;60;48	ENSP00000390955:K55M;ENSP00000360250:K60M;ENSP00000360248:K48M	ENSP00000360248:K48M	K	+	2	0	ENTPD1	97573110	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	4.812000	0.62613	1.991000	0.58162	0.460000	0.39030	AAG		0.458	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049566.1	NM_001776	Missense_Mutation	11	56	0	0	0	0.010729	0	11	56				
SLIT1	6585	broad.mit.edu	37	10	98778813	98778813	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:98778813G>T	ENST00000266058.4	-	27	3043	c.2798C>A	c.(2797-2799)cCg>cAg	p.P933Q	SLIT1_ENST00000371070.4_Missense_Mutation_p.P933Q|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	933	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.P933Q(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GTTCTGGCACGGACTGGACAA	0.652																																							uc001kmw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(2797-2799)CCG>CAG		slit homolog 1 precursor							50.0	44.0	46.0					10																	98778813		2203	4300	6503	SO:0001583	missense	6585				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding	g.chr10:98778813G>T	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.2798C>A	10.37:g.98778813G>T	ENSP00000266058:p.Pro933Gln						p.P933Q	NM_003061	NP_003052	O75093	SLIT1_HUMAN		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)	27	3050	-		Colorectal(252;0.162)	933			EGF-like 1.		Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	c.2798C>A	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501643	0.85176	.	.	ENSG00000187122	ENST00000266058;ENST00000371070	D;D	0.95035	-3.59;-3.59	5.32	5.32	0.75619	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.98080	0.9367	H	0.95712	3.71	0.80722	D	1	D	0.67145	0.996	D	0.66351	0.943	D	0.99282	1.0896	10	0.87932	D	0	.	18.5941	0.91224	0.0:0.0:1.0:0.0	.	933	O75093	SLIT1_HUMAN	Q	933	ENSP00000266058:P933Q;ENSP00000360109:P933Q	ENSP00000266058:P933Q	P	-	2	0	SLIT1	98768803	1.000000	0.71417	0.963000	0.40424	0.733000	0.41908	7.978000	0.88095	2.498000	0.84270	0.462000	0.41574	CCG		0.652	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061		5	21	1	0	1.23904e-05	0.000602	1.59193e-05	5	21				
SLIT1	6585	broad.mit.edu	37	10	98799743	98799743	+	Splice_Site	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:98799743A>T	ENST00000266058.4	-	21	2543		c.e21+1		SLIT1_ENST00000371070.4_Splice_Site|ARHGAP19-SLIT1_ENST00000453547.2_Splice_Site	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)						axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.?(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		TGAGCTACTCACAGTTCTGTG	0.642																																							uc001kmw.2		NA																	1	Unknown(1)		lung(1)	ovary(4)	4						c.e21+1		slit homolog 1 precursor							68.0	59.0	62.0					10																	98799743		2203	4300	6503	SO:0001630	splice_region_variant	6585				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding	g.chr10:98799743A>T	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.2297+1T>A	10.37:g.98799743A>T						SLIT1_uc009xvh.1_Splice_Site_p.L776_splice	p.L766_splice	NM_003061	NP_003052	O75093	SLIT1_HUMAN		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)	21	2549	-		Colorectal(252;0.162)						Q5T0V1|Q8WWZ2|Q9UIL7	Splice_Site	SNP	ENST00000266058.4	37	c.2297_splice	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.753429	0.89753	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7017	0.69160	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLIT1	98789733	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.761000	0.91691	2.060000	0.61445	0.533000	0.62120	.		0.642	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	Intron	8	43	0	0	0	0.006214	0	8	43				
RRP12	23223	broad.mit.edu	37	10	99144970	99144970	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:99144970C>A	ENST00000370992.4	-	10	1272	c.1161G>T	c.(1159-1161)ctG>ctT	p.L387L	RRP12_ENST00000536831.1_Silent_p.L105L|RRP12_ENST00000315563.6_Silent_p.L287L|RRP12_ENST00000414986.1_Silent_p.L326L	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	387						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.L387L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		GCCAGGCTAGCAGGGGTTGTA	0.537																																							uc001knf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1159-1161)CTG>CTT		ribosomal RNA processing 12 homolog isoform 1							264.0	208.0	227.0					10																	99144970		2203	4300	6503	SO:0001819	synonymous_variant	23223					integral to membrane|nuclear membrane|nucleolus	protein binding	g.chr10:99144970C>A		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.1161G>T	10.37:g.99144970C>A						RRP12_uc009xvm.2_Silent_p.L105L|RRP12_uc010qou.1_Silent_p.L326L|RRP12_uc009xvn.2_Silent_p.L287L	p.L387L	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)	10	1300	-		Colorectal(252;0.162)	387					B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Silent	SNP	ENST00000370992.4	37	c.1161G>T	CCDS7457.1																																																																																				0.537	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	NM_015179		18	97	1	0	3.62473e-10	0.012319	5.91021e-10	18	97				
COL17A1	1308	broad.mit.edu	37	10	105794442	105794442	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:105794442G>T	ENST00000353479.5	-	51	3993	c.3703C>A	c.(3703-3705)Ctg>Atg	p.L1235M	COL17A1_ENST00000369733.3_Missense_Mutation_p.L1153M	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1235	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.L1235M(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TAGGTTGCCAGGGCTCCTGAG	0.652																																							uc001kxr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(3703-3705)CTG>ATG		alpha 1 type XVII collagen							26.0	26.0	26.0					10																	105794442		2203	4300	6503	SO:0001583	missense	1308				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding	g.chr10:105794442G>T	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.3703C>A	10.37:g.105794442G>T	ENSP00000340937:p.Leu1235Met					COL17A1_uc001kxq.2_5'Flank	p.L1235M	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	51	3872	-		Colorectal(252;0.103)|Breast(234;0.122)	1235			Extracellular (Potential).|Triple-helical region.		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	c.3703C>A	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.983925	0.35036	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.92397	-3.03;-2.95	5.07	2.84	0.33178	.	0.000000	0.35615	N	0.003097	D	0.93510	0.7929	L	0.59436	1.845	0.58432	D	0.999998	D	0.71674	0.998	D	0.80764	0.994	D	0.91861	0.5499	10	0.46703	T	0.11	-7.6366	7.9978	0.30277	0.2216:0.0:0.7784:0.0	.	1235	Q9UMD9	COHA1_HUMAN	M	1235;1153	ENSP00000340937:L1235M;ENSP00000358748:L1153M	ENSP00000340937:L1235M	L	-	1	2	COL17A1	105784432	1.000000	0.71417	0.965000	0.40720	0.328000	0.28507	1.200000	0.32247	1.137000	0.42214	-0.258000	0.10820	CTG		0.652	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		6	16	1	0	5.9392e-07	0.001168	8.4018e-07	6	16				
CFAP43	80217	broad.mit.edu	37	10	105952008	105952008	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:105952008A>G	ENST00000278064.2	-	12	1613	c.1288T>C	c.(1288-1290)Ttt>Ctt	p.F430L	WDR96_ENST00000357060.3_Missense_Mutation_p.F499L|WDR96_ENST00000428666.1_Missense_Mutation_p.F500L														p.F499L(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TTGATAATAAAGACTTTTCCT	0.318																																							uc001kxw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1495-1497)TTT>CTT		hypothetical protein LOC80217							134.0	132.0	133.0					10																	105952008		2203	4300	6503	SO:0001583	missense	80217							g.chr10:105952008A>G																												ENST00000278064.2:c.1288T>C	10.37:g.105952008A>G	ENSP00000278064:p.Phe430Leu					C10orf79_uc001kxx.3_Missense_Mutation_p.F500L	p.F499L	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)	12	1611	-		Colorectal(252;0.178)	499			WD 8.			Missense_Mutation	SNP	ENST00000278064.2	37	c.1495T>C		.	.	.	.	.	.	.	.	.	.	A	19.33	3.806423	0.70682	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064	T;T;T	0.27720	1.65;1.65;1.65	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.45867	D	0.000334	T	0.56217	0.1970	M	0.76002	2.32	0.42188	D	0.991715	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.60383	-0.7274	10	0.66056	D	0.02	.	14.3004	0.66346	1.0:0.0:0.0:0.0	.	500;499	B4DHB6;Q8NDM7	.;WDR96_HUMAN	L	499;500;430	ENSP00000349568:F499L;ENSP00000400289:F500L;ENSP00000278064:F430L	ENSP00000278064:F430L	F	-	1	0	WDR96	105941998	1.000000	0.71417	0.987000	0.45799	0.285000	0.27093	5.187000	0.65087	2.254000	0.74563	0.533000	0.62120	TTT		0.318	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1			10	84	0	0	0	0.004007	0	10	84				
SORCS1	114815	broad.mit.edu	37	10	108448049	108448049	+	Missense_Mutation	SNP	G	G	T	rs531485951		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:108448049G>T	ENST00000263054.6	-	10	1468	c.1461C>A	c.(1459-1461)aaC>aaA	p.N487K	SORCS1_ENST00000369698.1_Missense_Mutation_p.N22K|SORCS1_ENST00000344440.6_Missense_Mutation_p.N487K	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	487				N -> Y (in Ref. 1; AAL56667). {ECO:0000305}.	neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.N487K(2)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TCTTCACTTGGTTGTCAATCT	0.463																																							uc001kym.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(1459-1461)AAC>AAA		SORCS receptor 1 isoform a							102.0	91.0	95.0					10																	108448049		2203	4300	6503	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108448049G>T	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1461C>A	10.37:g.108448049G>T	ENSP00000263054:p.Asn487Lys					SORCS1_uc001kyl.2_Missense_Mutation_p.N487K|SORCS1_uc009xxs.2_Missense_Mutation_p.N487K|SORCS1_uc001kyn.1_Missense_Mutation_p.N487K|SORCS1_uc001kyo.2_Missense_Mutation_p.N487K	p.N487K	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	10	1469	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	487	N -> Y (in Ref. 1; AAL56667).		Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.1461C>A	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801627	0.50315	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.22134	1.97;1.97;1.97	6.17	5.28	0.74379	VPS10 (1);	0.099297	0.64402	D	0.000002	T	0.14700	0.0355	N	0.11064	0.09	0.45172	D	0.998188	P;P;P;P;P	0.43024	0.695;0.798;0.798;0.695;0.798	B;P;P;B;P	0.46299	0.313;0.511;0.511;0.313;0.511	T	0.14868	-1.0457	9	.	.	.	-26.5461	10.6228	0.45489	0.0657:0.0:0.8028:0.1315	.	487;487;487;487;487	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	K	22;487;487	ENSP00000358712:N22K;ENSP00000263054:N487K;ENSP00000345964:N487K	.	N	-	3	2	SORCS1	108438039	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.402000	0.59722	1.640000	0.50565	-0.126000	0.14955	AAC		0.463	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		10	88	1	0	9.70103e-10	0.008291	1.55677e-09	10	88				
NRAP	4892	broad.mit.edu	37	10	115383307	115383307	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:115383307T>C	ENST00000359988.3	-	23	2682	c.2438A>G	c.(2437-2439)aAg>aGg	p.K813R	NRAP_ENST00000369360.3_Missense_Mutation_p.K786R|NRAP_ENST00000360478.3_Missense_Mutation_p.K778R|NRAP_ENST00000369358.4_Missense_Mutation_p.K821R	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.K813R(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CAGGtccctcttggctttggc	0.512																																							uc001laj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10						c.(2437-2439)AAG>AGG		nebulin-related anchoring protein isoform S							121.0	109.0	113.0					10																	115383307		2203	4300	6503	SO:0001583	missense	4892					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding	g.chr10:115383307T>C		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.2438A>G	10.37:g.115383307T>C	ENSP00000353078:p.Lys813Arg					NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Missense_Mutation_p.K778R|NRAP_uc001lal.3_Missense_Mutation_p.K813R	p.K813R	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN		Epithelial(162;0.00392)|all cancers(201;0.00569)	23	2602	-		Colorectal(252;0.0233)|Breast(234;0.188)	813			Nebulin 20.			Missense_Mutation	SNP	ENST00000359988.3	37	c.2438A>G	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	T	15.09	2.729907	0.48833	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.87	5.87	0.94306	.	0.192710	0.53938	N	0.000043	T	0.43765	0.1262	L	0.60455	1.87	0.31921	N	0.613475	B;B;B	0.15473	0.013;0.006;0.013	B;B;B	0.23018	0.043;0.025;0.043	T	0.50742	-0.8792	10	0.42905	T	0.14	.	15.9211	0.79575	0.0:0.0:0.0:1.0	.	813;778;813	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	R	821;786;813;778	ENSP00000358365:K821R;ENSP00000358367:K786R;ENSP00000353078:K813R;ENSP00000353666:K778R	ENSP00000353078:K813R	K	-	2	0	NRAP	115373297	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.990000	0.56965	2.243000	0.73865	0.533000	0.62120	AAG		0.512	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175		12	73	0	0	0	0.013537	0	12	73				
TRUB1	142940	broad.mit.edu	37	10	116698036	116698036	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:116698036G>T	ENST00000298746.3	+	1	85	c.24G>T	c.(22-24)gtG>gtT	p.V8V		NM_139169.4	NP_631908.1	Q8WWH5	TRUB1_HUMAN	TruB pseudouridine (psi) synthase family member 1	8					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.V8V(1)		breast(2)|kidney(2)|large_intestine(1)|lung(5)|urinary_tract(2)	12		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)		Epithelial(162;0.00879)|all cancers(201;0.0243)		AGGCGGCGGTGGTGTCTTCGC	0.587																																							uc001lcd.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(22-24)GTG>GTT		TruB pseudouridine (psi) synthase homolog 1							53.0	52.0	53.0					10																	116698036		2203	4300	6503	SO:0001819	synonymous_variant	142940				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding	g.chr10:116698036G>T	AF448144	CCDS7591.1	10q25.3	2013-09-02	2013-09-02		ENSG00000165832	ENSG00000165832			16060	protein-coding gene	gene with protein product		610726	"""TruB pseudouridine (psi) synthase homolog 1 (E. coli)"""			12736709	Standard	NM_139169		Approved	PUS4	uc001lcd.3	Q8WWH5	OTTHUMG00000019094	ENST00000298746.3:c.24G>T	10.37:g.116698036G>T						TRUB1_uc010qsl.1_Intron	p.V8V	NM_139169	NP_631908	Q8WWH5	TRUB1_HUMAN		Epithelial(162;0.00879)|all cancers(201;0.0243)	1	85	+		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)	8					B2R716|Q53ES2	Silent	SNP	ENST00000298746.3	37	c.24G>T	CCDS7591.1																																																																																				0.587	TRUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050504.1	NM_139169		3	27	1	0	6.4e-05	0.004672	7.87568e-05	3	27				
DHX32	55760	broad.mit.edu	37	10	127530320	127530320	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:127530320A>C	ENST00000284690.3	-	7	2025	c.1535T>G	c.(1534-1536)aTg>aGg	p.M512R	BCCIP_ENST00000368759.5_Intron|BCCIP_ENST00000299130.3_3'UTR|DHX32_ENST00000284688.6_Missense_Mutation_p.M431R|DHX32_ENST00000368721.1_Missense_Mutation_p.M136R|BCCIP_ENST00000429863.2_3'UTR|AL360176.1_ENST00000401153.1_RNA	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	512						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.M512R(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ACCTGTTACCATGGCTGCGAT	0.378																																							uc001ljf.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)|lung(1)	4						c.(1534-1536)ATG>AGG		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							71.0	67.0	69.0					10																	127530320		2203	4300	6503	SO:0001583	missense	55760					mitochondrion|nucleus	ATP binding|helicase activity	g.chr10:127530320A>C		CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1535T>G	10.37:g.127530320A>C	ENSP00000284690:p.Met512Arg					BCCIP_uc001ljd.3_Intron|DHX32_uc001lje.1_Missense_Mutation_p.M136R|DHX32_uc001ljg.1_Missense_Mutation_p.M512R|BCCIP_uc001ljc.3_3'UTR|BCCIP_uc010quj.1_3'UTR	p.M512R	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN			7	2026	-		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)	512					A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	ENST00000284690.3	37	c.1535T>G	CCDS7652.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.296456	0.60086	.	.	ENSG00000089876	ENST00000368721;ENST00000284690;ENST00000284688	T;T;T	0.32753	1.44;1.44;1.44	4.61	4.61	0.57282	Helicase-associated domain (2);	0.044252	0.85682	D	0.000000	T	0.68522	0.3010	H	0.98682	4.3	0.80722	D	1	D	0.64830	0.994	D	0.63192	0.912	T	0.81944	-0.0701	10	0.87932	D	0	-40.5717	13.8728	0.63629	1.0:0.0:0.0:0.0	.	512	Q7L7V1	DHX32_HUMAN	R	136;512;431	ENSP00000357710:M136R;ENSP00000284690:M512R;ENSP00000284688:M431R	ENSP00000284688:M431R	M	-	2	0	DHX32	127520310	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	9.001000	0.93568	1.944000	0.56390	0.533000	0.62120	ATG		0.378	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050945.2	NM_018180		11	69	0	0	0	0.010729	0	11	69				
TCERG1L	256536	broad.mit.edu	37	10	132891506	132891506	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:132891506C>A	ENST00000368642.4	-	12	1765	c.1680G>T	c.(1678-1680)caG>caT	p.Q560H	RP11-462G8.3_ENST00000436942.1_RNA	NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	560	FF 2.							p.Q519H(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		AAAAATGCTCCTGGTCCTTTC	0.398																																							uc001lkp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(2)	4						c.(1678-1680)CAG>CAT		transcription elongation regulator 1-like							106.0	107.0	107.0					10																	132891506		2203	4300	6503	SO:0001583	missense	256536							g.chr10:132891506C>A	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1680G>T	10.37:g.132891506C>A	ENSP00000357631:p.Gln560His						p.Q560H	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)	12	1766	-		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)	560			FF 2.		Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	37	c.1680G>T	CCDS7662.2	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403619	0.62288	.	.	ENSG00000176769	ENST00000368642	T	0.29655	1.56	4.82	1.91	0.25777	FF domain (4);	0.000000	0.49305	D	0.000160	T	0.42017	0.1184	L	0.44542	1.39	0.54753	D	0.999989	D	0.71674	0.998	D	0.71414	0.973	T	0.33752	-0.9856	10	0.87932	D	0	-10.5593	9.7017	0.40192	0.0:0.7102:0.0:0.2898	.	560	Q5VWI1	TCRGL_HUMAN	H	560	ENSP00000357631:Q560H	ENSP00000357631:Q560H	Q	-	3	2	TCERG1L	132781496	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.823000	0.27366	1.024000	0.39682	0.563000	0.77884	CAG		0.398	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937		20	86	1	0	1.87028e-06	0.012319	2.53111e-06	20	86				
CFAP46	54777	broad.mit.edu	37	10	134664738	134664738	+	Silent	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr10:134664738C>T	ENST00000368586.5	-	40	5746	c.5646G>A	c.(5644-5646)ctG>ctA	p.L1882L	TTC40_ENST00000263170.5_Silent_p.L43L	NM_001200049.2	NP_001186978.2												p.L43L(1)|p.L1882L(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGAGCATGTCCAGAGCCATTT	0.612																																							uc010qux.1		NA																	2	Substitution - coding silent(2)		lung(2)		NA						c.(4822-4824)CTG>CTA		Homo sapiens cDNA, FLJ17989.							74.0	67.0	69.0					10																	134664738		2202	4300	6502	SO:0001819	synonymous_variant	0							g.chr10:134664738C>T																												ENST00000368586.5:c.5646G>A	10.37:g.134664738C>T							p.L1608L	NM_017609	NP_060079					32	4824	-									Silent	SNP	ENST00000368586.5	37	c.4824G>A	CCDS58101.1																																																																																				0.612	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3			7	28	0	0	0	0.001984	0	7	28				
B4GALNT4	338707	broad.mit.edu	37	11	379988	379988	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:379988G>T	ENST00000329962.6	+	16	2611	c.2611G>T	c.(2611-2613)Gag>Tag	p.E871*		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	871					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.E871*(1)		endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TATGGACGTGGAGCGGGCCCT	0.682																																							uc001lpb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	pancreas(1)	1						c.(2611-2613)GAG>TAG		beta							36.0	45.0	42.0					11																	379988		2201	4297	6498	SO:0001587	stop_gained	338707					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity	g.chr11:379988G>T	AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.2611G>T	11.37:g.379988G>T	ENSP00000328277:p.Glu871*						p.E871*	NM_178537	NP_848632	Q76KP1	B4GN4_HUMAN		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)	16	2620	+		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	871			Lumenal (Potential).		Q96LV2	Nonsense_Mutation	SNP	ENST00000329962.6	37	c.2611G>T	CCDS7694.1	.	.	.	.	.	.	.	.	.	.	g	37	6.602884	0.97697	.	.	ENSG00000182272	ENST00000329962	.	.	.	3.71	3.71	0.42584	.	0.128657	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-33.0364	16.0369	0.80638	0.0:0.0:1.0:0.0	.	.	.	.	X	871	.	ENSP00000328277:E871X	E	+	1	0	B4GALNT4	369988	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.007000	0.70731	2.063000	0.61619	0.549000	0.68633	GAG		0.682	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239289.2	NM_178537		6	40	1	0	1.06961e-07	0.00308	1.57342e-07	6	40				
MUC2	4583	broad.mit.edu	37	11	1084795	1084795	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:1084795G>A	ENST00000441003.2	+	20	2617	c.2590G>A	c.(2590-2592)Ggg>Agg	p.G864R	MUC2_ENST00000359061.5_Missense_Mutation_p.G864R	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	864	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.G864R(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CTCCATTTACGGGAGTGGCCA	0.597																																							uc001lsx.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)|breast(1)	2						c.(2590-2592)GGG>AGG		mucin 2 precursor	Pranlukast(DB01411)						70.0	71.0	71.0					11																	1084795		2156	4248	6404	SO:0001583	missense	4583					inner mucus layer|outer mucus layer	protein binding	g.chr11:1084795G>A	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.2590G>A	11.37:g.1084795G>A	ENSP00000415183:p.Gly864Arg						p.G864R	NM_002457	NP_002448	Q02817	MUC2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	20	2617	+		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)	864			VWFD 3.		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37	c.2590G>A		.	.	.	.	.	.	.	.	.	.	G	13.35	2.210034	0.39003	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.67523	-0.27;-0.27	4.21	4.21	0.49690	.	0.089004	0.42682	D	0.000670	D	0.88529	0.6461	H	0.97852	4.09	0.52501	D	0.999958	D	0.89917	1.0	D	0.97110	1.0	D	0.93235	0.6621	10	0.87932	D	0	.	16.7651	0.85522	0.0:0.0:1.0:0.0	.	864	E7EUV1	.	R	864	ENSP00000415183:G864R;ENSP00000351956:G864R	ENSP00000351956:G864R	G	+	1	0	MUC2	1074795	1.000000	0.71417	0.043000	0.18650	0.136000	0.21042	7.618000	0.83043	2.190000	0.69967	0.561000	0.74099	GGG		0.597	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457		3	7	0	0	0	0.004672	0	3	7				
OR52E2	119678	broad.mit.edu	37	11	5080580	5080580	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:5080580C>A	ENST00000321522.2	-	1	277	c.278G>T	c.(277-279)gGg>gTg	p.G93V		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G93V(1)		endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		AAAGATGATCCCTCTGAGGTT	0.483																																							uc010qyw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(277-279)GGG>GTG		olfactory receptor, family 52, subfamily E,							82.0	77.0	79.0					11																	5080580		2201	4298	6499	SO:0001583	missense	119678				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5080580C>A	AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.278G>T	11.37:g.5080580C>A	ENSP00000322088:p.Gly93Val						p.G93V	NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)	1	278	-		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)	93			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000321522.2	37	c.278G>T	CCDS31371.1	.	.	.	.	.	.	.	.	.	.	C	1.480	-0.557585	0.03967	.	.	ENSG00000176787	ENST00000321522	T	0.00619	6.18	3.77	1.35	0.21983	GPCR, rhodopsin-like superfamily (1);	0.243327	0.28476	N	0.015215	T	0.00356	0.0011	N	0.02379	-0.575	0.25018	N	0.991355	B	0.02656	0.0	B	0.01281	0.0	T	0.48269	-0.9050	10	0.66056	D	0.02	.	4.8466	0.13516	0.1638:0.0974:0.0:0.7388	.	93	Q8NGJ4	O52E2_HUMAN	V	93	ENSP00000322088:G93V	ENSP00000322088:G93V	G	-	2	0	OR52E2	5037156	0.032000	0.19561	0.312000	0.25196	0.003000	0.03518	1.251000	0.32862	0.269000	0.21961	-0.301000	0.09380	GGG		0.483	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142815.1	NM_001005164		6	12	1	0	3.59834e-05	0.001168	4.49515e-05	6	12				
OR51M1	390059	broad.mit.edu	37	11	5410856	5410856	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:5410856C>A	ENST00000328611.3	+	1	250	c.228C>A	c.(226-228)tcC>tcA	p.S76S	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	76					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S76S(1)		NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCTACTATCCTTGCTGGCCC	0.468																																							uc010qzc.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(226-228)TCC>TCA		olfactory receptor, family 51, subfamily M,							152.0	142.0	145.0					11																	5410856		2037	4190	6227	SO:0001819	synonymous_variant	390059					integral to membrane	olfactory receptor activity	g.chr11:5410856C>A	BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.228C>A	11.37:g.5410856C>A						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	p.S76S	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	228	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	76					Q6IF80	Silent	SNP	ENST00000328611.3	37	c.228C>A	CCDS53596.1																																																																																				0.468	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142981.1	NM_001004756		22	90	1	0	7.45023e-12	0.010504	1.29265e-11	22	90				
OR51I2	390064	broad.mit.edu	37	11	5475122	5475122	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:5475122T>A	ENST00000341449.2	+	1	485	c.404T>A	c.(403-405)gTg>gAg	p.V135E	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	135					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V135E(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TATGCAACTGTGCTCACCACT	0.473																																							uc010qzf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(403-405)GTG>GAG		olfactory receptor, family 51, subfamily I,							161.0	149.0	153.0					11																	5475122		2201	4297	6498	SO:0001583	missense	390064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5475122T>A	BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.404T>A	11.37:g.5475122T>A	ENSP00000341987:p.Val135Glu					HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	p.V135E	NM_001004754	NP_001004754	Q9H344	O51I2_HUMAN		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	404	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	135			Cytoplasmic (Potential).		Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	37	c.404T>A	CCDS31383.1	.	.	.	.	.	.	.	.	.	.	T	18.18	3.566940	0.65651	.	.	ENSG00000187918	ENST00000341449	T	0.21191	2.02	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.335281	0.25783	N	0.028322	T	0.40886	0.1135	M	0.93854	3.465	0.27872	N	0.940002	P	0.45396	0.857	B	0.42827	0.399	T	0.57768	-0.7754	10	0.87932	D	0	.	14.7227	0.69320	0.0:0.0:0.0:1.0	.	135	Q9H344	O51I2_HUMAN	E	135	ENSP00000341987:V135E	ENSP00000341987:V135E	V	+	2	0	OR51I2	5431698	0.965000	0.33210	0.991000	0.47740	0.972000	0.66771	7.420000	0.80191	2.343000	0.79666	0.533000	0.62120	GTG		0.473	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754		21	103	0	0	0	0.014323	0	21	103				
UBQLN3	50613	broad.mit.edu	37	11	5530683	5530683	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:5530683A>T	ENST00000311659.4	-	2	253	c.106T>A	c.(106-108)Tca>Aca	p.S36T	HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	36	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.							p.S36T(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTGTAACTGAGAAATCCTCC	0.522																																					Ovarian(72;684 1260 12332 41642 52180)	Ovarian(72;684 1260 12332 41642 52180)	uc001may.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(106-108)TCA>ACA		ubiquilin 3							159.0	150.0	153.0					11																	5530683		2201	4297	6498	SO:0001583	missense	50613							g.chr11:5530683A>T	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.106T>A	11.37:g.5530683A>T	ENSP00000347997:p.Ser36Thr					HBG2_uc001mak.1_Intron	p.S36T	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	2	192	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	36			Ubiquitin-like.		Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	c.106T>A	CCDS7758.1	.	.	.	.	.	.	.	.	.	.	A	12.97	2.096081	0.36952	.	.	ENSG00000175520	ENST00000311659;ENST00000445998	T;T	0.73047	-0.71;-0.71	5.49	4.32	0.51571	Ubiquitin supergroup (1);Ubiquitin (2);	0.192566	0.25771	N	0.028417	T	0.51805	0.1696	N	0.16656	0.425	0.33410	D	0.578477	B	0.02656	0.0	B	0.13407	0.009	T	0.58115	-0.7693	10	0.38643	T	0.18	-14.5047	8.8194	0.35016	0.7563:0.2437:0.0:0.0	.	36	Q9H347	UBQL3_HUMAN	T	36	ENSP00000347997:S36T;ENSP00000412561:S36T	ENSP00000347997:S36T	S	-	1	0	UBQLN3	5487259	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	3.767000	0.55288	2.219000	0.72066	0.402000	0.26972	TCA		0.522	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481		17	80	0	0	0	0.010504	0	17	80				
OR52B6	340980	broad.mit.edu	37	11	5603032	5603032	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:5603032C>T	ENST00000345043.2	+	1	926	c.926C>T	c.(925-927)cCc>cTc	p.P309L	HBG2_ENST00000380259.2_Intron|AC015691.13_ENST00000394793.2_RNA	NM_001005162.2	NP_001005162.2	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B, member 6	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P309L(1)		endometrium(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGCTCAATCCCGTTATTTAT	0.438																																							uc010qzi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(925-927)CCC>CTC		olfactory receptor, family 52, subfamily B,							205.0	189.0	194.0					11																	5603032		1933	4131	6064	SO:0001583	missense	340980				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5603032C>T	AB065858	CCDS41611.1	11p15.4	2012-08-09			ENSG00000187747	ENSG00000187747		"""GPCR / Class A : Olfactory receptors"""	15211	protein-coding gene	gene with protein product							Standard	NM_001005162		Approved		uc010qzi.2	Q8NGF0	OTTHUMG00000066906	ENST00000345043.2:c.926C>T	11.37:g.5603032C>T	ENSP00000341581:p.Pro309Leu					HBG2_uc001mak.1_Intron	p.P309L	NM_001005162	NP_001005162	Q8NGF0	O52B6_HUMAN		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	926	+		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)	309			Helical; Name=7; (Potential).		Q6IFI7	Missense_Mutation	SNP	ENST00000345043.2	37	c.926C>T	CCDS41611.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429206	0.43122	.	.	ENSG00000187747	ENST00000345043	T	0.63417	-0.04	4.8	3.87	0.44632	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39274	U	0.001411	T	0.77942	0.4206	M	0.84846	2.72	0.50171	D	0.999851	D	0.55800	0.973	P	0.61397	0.888	T	0.81818	-0.0758	10	0.87932	D	0	.	12.7024	0.57041	0.0:0.8327:0.1673:0.0	.	309	Q8NGF0	O52B6_HUMAN	L	309	ENSP00000341581:P309L	ENSP00000341581:P309L	P	+	2	0	OR52B6	5559608	1.000000	0.71417	0.237000	0.24090	0.209000	0.24338	6.597000	0.74118	1.231000	0.43661	-0.282000	0.10007	CCC		0.438	OR52B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143397.1	NM_001005162		25	127	0	0	0	0.003954	0	25	127				
OR52N4	390072	broad.mit.edu	37	11	5776693	5776693	+	Silent	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:5776693T>C	ENST00000317254.3	+	1	771	c.723T>C	c.(721-723)aaT>aaC	p.N241N	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N241N(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		AGGCCTTTAATACCTGCACTG	0.493																																							uc001mbu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(721-723)AAT>AAC		olfactory receptor, family 52, subfamily N,							198.0	191.0	193.0					11																	5776693		2098	4259	6357	SO:0001819	synonymous_variant	390072				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5776693T>C	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.723T>C	11.37:g.5776693T>C						TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.N241N	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)	1	771	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	241			Helical; Name=6; (Potential).		B2RNP8|Q6IF77	Silent	SNP	ENST00000317254.3	37	c.723T>C	CCDS44528.1																																																																																				0.493	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175		15	138	0	0	0	0.00245	0	15	138				
PTPN5	84867	broad.mit.edu	37	11	18765712	18765712	+	Missense_Mutation	SNP	G	G	T	rs367543233		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:18765712G>T	ENST00000358540.2	-	4	562	c.132C>A	c.(130-132)gaC>gaA	p.D44E	PTPN5_ENST00000496201.2_5'UTR|PTPN5_ENST00000396168.1_Missense_Mutation_p.D20E|PTPN5_ENST00000396170.1_Missense_Mutation_p.D44E|PTPN5_ENST00000477854.1_5'Flank|PTPN5_ENST00000396167.2_Missense_Mutation_p.D44E|PTPN5_ENST00000396171.4_Missense_Mutation_p.D44E	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	44					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)	p.D44E(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						CTTCAGCCTCGTCCAGTGCCT	0.672																																							uc001mpd.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(130-132)GAC>GAA		protein-tyrosine-phosphatase non-receptor 5							86.0	86.0	86.0					11																	18765712		2199	4293	6492	SO:0001583	missense	84867					integral to membrane	phosphotyrosine binding|protein tyrosine phosphatase activity	g.chr11:18765712G>T	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.132C>A	11.37:g.18765712G>T	ENSP00000351342:p.Asp44Glu					PTPN5_uc001mpb.2_Missense_Mutation_p.D44E|PTPN5_uc001mpc.2_Missense_Mutation_p.D44E|PTPN5_uc001mpe.2_Missense_Mutation_p.D44E|PTPN5_uc010rdj.1_Missense_Mutation_p.D20E|PTPN5_uc001mpf.2_Missense_Mutation_p.D20E|PTPN5_uc010rdk.1_Intron	p.D44E	NM_006906	NP_008837	P54829	PTN5_HUMAN			4	563	-			44					B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	37	c.132C>A	CCDS7845.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.989421	0.35131	.	.	ENSG00000110786	ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T	0.11930	3.52;2.73;3.52;2.73;3.57	4.76	1.82	0.25136	.	0.000000	0.64402	D	0.000018	T	0.13329	0.0323	N	0.24115	0.695	0.19300	N	0.99997	D;D	0.60575	0.988;0.988	P;P	0.53313	0.723;0.723	T	0.06285	-1.0835	10	0.72032	D	0.01	.	6.9789	0.24692	0.3844:0.0:0.6156:0.0	.	44;44	P54829;B3KXG7	PTN5_HUMAN;.	E	44;44;44;44;20	ENSP00000351342:D44E;ENSP00000379473:D44E;ENSP00000379474:D44E;ENSP00000379470:D44E;ENSP00000379471:D20E	ENSP00000351342:D44E	D	-	3	2	PTPN5	18722288	0.925000	0.31364	0.932000	0.37286	0.019000	0.09904	1.261000	0.32980	0.558000	0.29135	-0.339000	0.08088	GAC		0.672	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970		24	124	1	0	1.85244e-09	0.00333	2.93786e-09	24	124				
ANO3	63982	broad.mit.edu	37	11	26669345	26669345	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:26669345C>A	ENST00000256737.3	+	24	3370	c.2518C>A	c.(2518-2520)Cgt>Agt	p.R840S	ANO3_ENST00000531568.1_Missense_Mutation_p.R694S|ANO3_ENST00000537978.1_Missense_Mutation_p.R824S|ANO3_ENST00000525139.1_Missense_Mutation_p.R824S	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	840					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)	p.R840S(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TTACATCCCACGTTTTGTTTA	0.348																																							uc001mqt.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(2518-2520)CGT>AGT		transmembrane protein 16C							129.0	119.0	122.0					11																	26669345		2203	4299	6502	SO:0001583	missense	63982					chloride channel complex	chloride channel activity	g.chr11:26669345C>A	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.2518C>A	11.37:g.26669345C>A	ENSP00000256737:p.Arg840Ser					ANO3_uc010rdr.1_Missense_Mutation_p.R824S|ANO3_uc010rds.1_Missense_Mutation_p.R679S|ANO3_uc010rdt.1_Missense_Mutation_p.R694S	p.R840S	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN			24	2663	+			840			Extracellular (Potential).		B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	37	c.2518C>A	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	C	31	5.087717	0.94100	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000538001;ENST00000531568	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-0.91	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.91529	0.7325	M	0.94101	3.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93363	0.6728	10	0.87932	D	0	.	18.9891	0.92784	0.0:1.0:0.0:0.0	.	742;840	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	S	824;824;840;742;694	ENSP00000440737:R824S;ENSP00000432576:R824S;ENSP00000256737:R840S;ENSP00000432394:R694S	ENSP00000256737:R840S	R	+	1	0	ANO3	26625921	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.593000	0.87608	0.650000	0.86243	CGT		0.348	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418		13	61	1	0	0.00010058	0.013537	0.000119752	13	61				
PAMR1	25891	broad.mit.edu	37	11	35515796	35515796	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:35515796C>A	ENST00000378880.2	-	2	543	c.98G>T	c.(97-99)tGc>tTc	p.C33F	PAMR1_ENST00000378878.3_Missense_Mutation_p.C33F|PAMR1_ENST00000532848.1_5'UTR|PAMR1_ENST00000278360.3_Missense_Mutation_p.C33F|PAMR1_ENST00000534803.1_5'UTR	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	33						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.C33F(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TGCTCCAGGGCAGGCTTCATT	0.483																																							uc001mwg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(97-99)TGC>TTC		regeneration associated muscle protease isoform							122.0	112.0	115.0					11																	35515796		2202	4298	6500	SO:0001583	missense	25891				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr11:35515796C>A		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.98G>T	11.37:g.35515796C>A	ENSP00000368158:p.Cys33Phe					PAMR1_uc001mwf.2_Missense_Mutation_p.C33F|PAMR1_uc010rew.1_Missense_Mutation_p.C33F|PAMR1_uc010rex.1_5'UTR	p.C33F	NM_001001991	NP_001001991	Q6UXH9	PAMR1_HUMAN			2	141	-			33					A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	ENST00000378880.2	37	c.98G>T	CCDS31460.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186976	0.78789	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000529303	D;D;D;D	0.94613	-2.51;-2.54;-3.28;-3.47	4.94	4.94	0.65067	.	0.105607	0.64402	D	0.000003	D	0.95043	0.8395	N	0.24115	0.695	0.45718	D	0.998622	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.91635	0.997;0.991;0.999	D	0.96317	0.9233	10	0.87932	D	0	.	18.1528	0.89679	0.0:1.0:0.0:0.0	.	33;33;33	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	F	33	ENSP00000278360:C33F;ENSP00000368158:C33F;ENSP00000368156:C33F;ENSP00000433024:C33F	ENSP00000278360:C33F	C	-	2	0	PAMR1	35472372	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	7.689000	0.84165	2.294000	0.77228	0.462000	0.41574	TGC		0.483	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430		14	60	1	0	6.94344e-10	0.006122	1.12312e-09	14	60				
DGKZ	8525	broad.mit.edu	37	11	46398736	46398736	+	Silent	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:46398736C>T	ENST00000454345.1	+	26	3005	c.2880C>T	c.(2878-2880)ccC>ccT	p.P960P	MIR4688_ENST00000577966.1_RNA|DGKZ_ENST00000395574.3_Silent_p.P738P|DGKZ_ENST00000543978.1_Silent_p.P124P|DGKZ_ENST00000318201.8_Silent_p.P749P|DGKZ_ENST00000528615.1_Silent_p.P550P|DGKZ_ENST00000343674.6_Silent_p.P788P|DGKZ_ENST00000421244.2_Silent_p.P772P|DGKZ_ENST00000456247.2_Silent_p.P771P|DGKZ_ENST00000527911.1_Silent_p.P772P|DGKZ_ENST00000532868.2_Silent_p.P776P	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	960					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)	p.P960P(1)|p.P788P(1)|p.P772P(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CCCCTCTCCCCACCTCACCCT	0.627																																							uc001ncn.1		NA																	3	Substitution - coding silent(3)		lung(3)	pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(2878-2880)CCC>CCT		diacylglycerol kinase zeta isoform 4							42.0	40.0	41.0					11																	46398736		2201	4298	6499	SO:0001819	synonymous_variant	8525				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding	g.chr11:46398736C>T	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.2880C>T	11.37:g.46398736C>T						DGKZ_uc001nch.1_Silent_p.P788P|DGKZ_uc010rgq.1_Silent_p.P715P|DGKZ_uc001ncj.1_Silent_p.P738P|DGKZ_uc010rgr.1_Silent_p.P737P|DGKZ_uc001nck.1_Silent_p.P550P|DGKZ_uc001ncl.2_Silent_p.P772P|DGKZ_uc001ncm.2_Silent_p.P771P|DGKZ_uc009yky.1_Silent_p.P772P|DGKZ_uc010rgs.1_Silent_p.P749P	p.P960P	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN		GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)	26	3005	+			960					B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Silent	SNP	ENST00000454345.1	37	c.2880C>T	CCDS41640.1																																																																																				0.627	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540		6	18	0	0	0	0.001984	0	6	18				
OR5L2	26338	broad.mit.edu	37	11	55595244	55595244	+	Missense_Mutation	SNP	C	C	A	rs142870159		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:55595244C>A	ENST00000378397.1	+	1	550	c.550C>A	c.(550-552)Ctc>Atc	p.L184I		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L184I(1)		breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TCTACCCCCTCTCCTAAGTCT	0.463										HNSCC(27;0.073)																													uc001nhy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(550-552)CTC>ATC		olfactory receptor, family 5, subfamily L,		C	ILE/LEU	0,4400		0,0,2200	240.0	218.0	225.0		550	3.3	0.9	11	dbSNP_134	225	1,8591		0,1,4295	no	missense	OR5L2	NM_001004739.1	5	0,1,6495	AA,AC,CC		0.0116,0.0,0.0077	benign	184/312	55595244	1,12991	2200	4296	6496	SO:0001583	missense	26338				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55595244C>A	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.550C>A	11.37:g.55595244C>A	ENSP00000367650:p.Leu184Ile	HNSCC(27;0.073)					p.L184I	NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN			1	550	+		all_epithelial(135;0.208)	184			Extracellular (Potential).		Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	37	c.550C>A	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	5.033	0.191818	0.09547	0.0	1.16E-4	ENSG00000205030	ENST00000378397	T	0.00069	8.77	5.24	3.3	0.37823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000246	T	0.00178	0.0005	L	0.60957	1.885	0.18873	N	0.999986	B	0.28082	0.2	B	0.30943	0.122	T	0.19844	-1.0293	10	0.48119	T	0.1	-24.5494	9.8262	0.40914	0.2792:0.5857:0.1352:0.0	.	184	Q8NGL0	OR5L2_HUMAN	I	184	ENSP00000367650:L184I	ENSP00000367650:L184I	L	+	1	0	OR5L2	55351820	0.000000	0.05858	0.865000	0.33974	0.017000	0.09413	-0.859000	0.04277	0.665000	0.31066	-0.209000	0.12711	CTC		0.463	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739		29	200	1	0	2.70662e-09	0.009535	4.25926e-09	29	200				
OR10AG1	282770	broad.mit.edu	37	11	55735507	55735507	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:55735507G>T	ENST00000312345.2	-	1	483	c.433C>A	c.(433-435)Cct>Act	p.P145T		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P145T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					ATTACTACAGGAATTGTGATG	0.418																																							uc010rit.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(433-435)CCT>ACT		olfactory receptor, family 10, subfamily AG,							78.0	76.0	77.0					11																	55735507		2201	4296	6497	SO:0001583	missense	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735507G>T	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.433C>A	11.37:g.55735507G>T	ENSP00000311477:p.Pro145Thr						p.P145T	NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN			1	433	-	Esophageal squamous(21;0.0137)		145			Helical; Name=4; (Potential).		B2RNH4|Q6IEU3	Missense_Mutation	SNP	ENST00000312345.2	37	c.433C>A	CCDS31514.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.527195	0.27299	.	.	ENSG00000174970	ENST00000312345	T	0.36520	1.25	5.47	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.114420	0.40064	N	0.001186	T	0.26593	0.0650	N	0.20610	0.595	0.09310	N	1	P	0.41041	0.736	P	0.46339	0.513	T	0.09335	-1.0679	10	0.27785	T	0.31	.	7.126	0.25471	0.09:0.1744:0.7356:0.0	.	145	Q8NH19	O10AG_HUMAN	T	145	ENSP00000311477:P145T	ENSP00000311477:P145T	P	-	1	0	OR10AG1	55492083	0.000000	0.05858	0.023000	0.16930	0.313000	0.28021	-0.426000	0.07008	2.625000	0.88918	0.477000	0.44152	CCT		0.418	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		9	54	1	0	1.12685e-05	0.004482	1.47107e-05	9	54				
OR8H2	390151	broad.mit.edu	37	11	55873077	55873077	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:55873077C>A	ENST00000313503.1	+	1	559	c.559C>A	c.(559-561)Ctg>Atg	p.L187M		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L187M(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					AATTTTAGCTCTGTCCTGCAC	0.403										HNSCC(53;0.14)																													uc010riy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(559-561)CTG>ATG		olfactory receptor, family 8, subfamily H,							251.0	231.0	238.0					11																	55873077		2201	4296	6497	SO:0001583	missense	390151				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55873077C>A	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.559C>A	11.37:g.55873077C>A	ENSP00000323982:p.Leu187Met	HNSCC(53;0.14)					p.L187M	NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN			1	559	+	Esophageal squamous(21;0.00693)		187			Extracellular (Potential).		Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	37	c.559C>A	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	c	17.55	3.418472	0.62622	.	.	ENSG00000181767	ENST00000313503	T	0.00402	7.56	3.58	2.65	0.31530	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41001	D	0.000963	T	0.01124	0.0037	M	0.88512	2.96	0.32728	N	0.509344	D	0.64830	0.994	P	0.62382	0.901	T	0.16512	-1.0400	10	0.87932	D	0	.	11.0215	0.47720	0.0:0.9043:0.0:0.0957	.	187	Q8N162	OR8H2_HUMAN	M	187	ENSP00000323982:L187M	ENSP00000323982:L187M	L	+	1	2	OR8H2	55629653	0.007000	0.16637	0.246000	0.24233	0.099000	0.18886	0.262000	0.18460	1.952000	0.56665	0.440000	0.28878	CTG		0.403	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200		36	187	1	0	2.87052e-16	0.005524	5.60303e-16	36	187				
SERPING1	710	broad.mit.edu	37	11	57381888	57381888	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:57381888T>A	ENST00000278407.4	+	8	1564	c.1337T>A	c.(1336-1338)gTg>gAg	p.V446E	SERPING1_ENST00000378323.4_Missense_Mutation_p.V451E|SERPING1_ENST00000378324.2_Missense_Mutation_p.V394E|SERPING1_ENST00000340687.6_Missense_Mutation_p.V409E|SERPING1_ENST00000403558.1_Missense_Mutation_p.V489E	NM_000062.2	NP_000053.2	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G (C1 inhibitor), member 1	446					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V446E(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(1)	27						CACCAGACAGTGCTGGAACTG	0.557																																							uc001nkp.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1336-1338)GTG>GAG		serpin peptidase inhibitor, clade G, member 1							65.0	63.0	64.0					11																	57381888		2201	4296	6497	SO:0001583	missense	710	Hereditary_Angioedema			blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity	g.chr11:57381888T>A	X54486	CCDS7962.1	11q12.1	2014-09-17	2008-07-31		ENSG00000149131	ENSG00000149131		"""Serine (or cysteine) peptidase inhibitors"""	1228	protein-coding gene	gene with protein product	"""plasma protease C1 inhibitor"", ""angioedema, hereditary"""	606860	"""serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)"""	C1NH		2026152, 24172014	Standard	NM_000062		Approved	C1IN, C1-INH, HAE1, HAE2	uc001nkp.1	P05155	OTTHUMG00000150304	ENST00000278407.4:c.1337T>A	11.37:g.57381888T>A	ENSP00000278407:p.Val446Glu					SERPING1_uc001nkq.1_Missense_Mutation_p.V409E|SERPING1_uc010rju.1_Missense_Mutation_p.V394E|SERPING1_uc010rjv.1_Missense_Mutation_p.V451E|SERPING1_uc001nkr.1_Missense_Mutation_p.V446E|SERPING1_uc009ymi.1_Missense_Mutation_p.V455E|SERPING1_uc009ymj.1_3'UTR|SERPING1_uc001nks.1_Missense_Mutation_p.V137E	p.V446E	NM_000062	NP_000053	P05155	IC1_HUMAN			8	1528	+			446					A6NMU0|A8KAI9|B2R6L5|B4E1F0|B4E1H2|Q16304|Q547W3|Q59EI5|Q7Z455|Q96FE0|Q9UC49|Q9UCF9	Missense_Mutation	SNP	ENST00000278407.4	37	c.1337T>A	CCDS7962.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.074904	0.55646	.	.	ENSG00000149131	ENST00000278407;ENST00000340687;ENST00000378323;ENST00000378324;ENST00000403558	D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91	4.95	1.34	0.21922	Serpin domain (3);	0.906677	0.09438	N	0.802231	D	0.89469	0.6724	M	0.67397	2.05	0.27630	N	0.948076	D;D;D	0.64830	0.994;0.99;0.99	D;D;D	0.64877	0.93;0.93;0.93	T	0.78006	-0.2373	10	0.72032	D	0.01	.	7.8437	0.29414	0.0:0.2387:0.0:0.7613	.	451;446;446	B4E1F0;E9KL26;P05155	.;.;IC1_HUMAN	E	446;409;451;394;489	ENSP00000278407:V446E;ENSP00000341861:V409E;ENSP00000367574:V451E;ENSP00000367575:V394E;ENSP00000384420:V489E	ENSP00000278407:V446E	V	+	2	0	SERPING1	57138464	0.340000	0.24792	0.050000	0.19076	0.828000	0.46876	0.507000	0.22675	0.037000	0.15575	0.459000	0.35465	GTG		0.557	SERPING1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317465.1	NM_000062		9	49	0	0	0	0.004482	0	9	49				
MS4A4A	51338	broad.mit.edu	37	11	60073661	60073661	+	Missense_Mutation	SNP	G	G	T	rs540491858		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:60073661G>T	ENST00000337908.4	+	6	725	c.635G>T	c.(634-636)tGt>tTt	p.C212F	MS4A4A_ENST00000355131.3_Missense_Mutation_p.C193F|MS4A4A_ENST00000532114.1_Missense_Mutation_p.C159F|MS4A4A_ENST00000395016.3_Missense_Mutation_p.C193F	NM_148975.2	NP_683876.1	Q96JQ5	M4A4A_HUMAN	membrane-spanning 4-domains, subfamily A, member 4A	212						integral component of membrane (GO:0016021)		p.C193F(1)|p.C212F(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(12)|prostate(1)|skin(4)	23						GTGCTCTGTTGTACCCCTGGT	0.453																																							uc001noz.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(634-636)TGT>TTT		membrane-spanning 4-domains, subfamily A, member							291.0	248.0	262.0					11																	60073661		2203	4300	6503	SO:0001583	missense	51338					integral to membrane	receptor activity	g.chr11:60073661G>T	AB013102	CCDS7982.1, CCDS58135.1	11q12	2012-02-28	2012-02-28		ENSG00000110079	ENSG00000110079			13371	protein-coding gene	gene with protein product		606547	"""membrane-spanning 4-domains, subfamily A, member 4"""	MS4A4		11245982, 11401424	Standard	NM_148975		Approved	CD20L1, MS4A7	uc001noz.3	Q96JQ5	OTTHUMG00000154949	ENST00000337908.4:c.635G>T	11.37:g.60073661G>T	ENSP00000338648:p.Cys212Phe					MS4A4A_uc001npa.2_Missense_Mutation_p.C193F|MS4A4A_uc001npb.2_Missense_Mutation_p.C193F|MS4A4A_uc001npc.2_Missense_Mutation_p.C140F	p.C212F	NM_148975	NP_683876	Q96JQ5	M4A4A_HUMAN			6	645	+			212			Cytoplasmic (Potential).		Q8TEZ6|Q96PG7|Q9BY18|Q9H3V3|Q9P1S3	Missense_Mutation	SNP	ENST00000337908.4	37	c.635G>T	CCDS7982.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.295184	0.23564	.	.	ENSG00000110079	ENST00000532114;ENST00000337908;ENST00000355131;ENST00000395016	T;T;T;T	0.24151	1.87;2.83;2.85;2.85	3.6	-0.989	0.10242	.	0.271689	0.34932	N	0.003567	T	0.37839	0.1018	L	0.61218	1.895	0.09310	N	0.999999	D;D	0.89917	0.999;1.0	D;D	0.74023	0.982;0.96	T	0.15407	-1.0438	10	0.62326	D	0.03	-0.1629	5.0884	0.14694	0.1073:0.0:0.3859:0.5068	.	159;212	Q96JQ5-2;Q96JQ5	.;M4A4A_HUMAN	F	159;212;193;193	ENSP00000434506:C159F;ENSP00000338648:C212F;ENSP00000347252:C193F;ENSP00000378462:C193F	ENSP00000338648:C212F	C	+	2	0	MS4A4A	59830237	0.985000	0.35326	0.000000	0.03702	0.003000	0.03518	2.520000	0.45554	-0.293000	0.08986	-0.396000	0.06452	TGT		0.453	MS4A4A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337774.2			12	83	1	0	7.93312e-07	0.00245	1.09927e-06	12	83				
PACS1	55690	broad.mit.edu	37	11	65988115	65988115	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:65988115T>C	ENST00000320580.4	+	9	1085	c.1052T>C	c.(1051-1053)cTg>cCg	p.L351P		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	351					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.L351P(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						GGCTTTGGGCTGGAGCATGTG	0.527																																							uc001oha.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)	6						c.(1051-1053)CTG>CCG		phosphofurin acidic cluster sorting protein 1							85.0	80.0	81.0					11																	65988115		2201	4295	6496	SO:0001583	missense	55690				interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding	g.chr11:65988115T>C	AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.1052T>C	11.37:g.65988115T>C	ENSP00000316454:p.Leu351Pro						p.L351P	NM_018026	NP_060496	Q6VY07	PACS1_HUMAN			9	1186	+			351					Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	ENST00000320580.4	37	c.1052T>C	CCDS8129.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.446407	0.43429	.	.	ENSG00000175115	ENST00000320580	T	0.16743	2.32	5.2	5.2	0.72013	.	0.090486	0.49305	D	0.000153	T	0.30603	0.0770	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.01956	-1.1240	10	0.30078	T	0.28	-15.7297	14.0328	0.64627	0.0:0.0:0.0:1.0	.	351	Q6VY07	PACS1_HUMAN	P	351	ENSP00000316454:L351P	ENSP00000316454:L351P	L	+	2	0	PACS1	65744691	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.945000	0.70226	1.968000	0.57251	0.397000	0.26171	CTG		0.527	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026		6	44	0	0	0	0.001984	0	6	44				
ALDH3B2	222	broad.mit.edu	37	11	67432013	67432013	+	Missense_Mutation	SNP	C	C	G	rs374568776		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:67432013C>G	ENST00000349015.3	-	8	1165	c.727G>C	c.(727-729)Gtg>Ctg	p.V243L	ALDH3B2_ENST00000531881.1_5'Flank|ALDH3B2_ENST00000530069.1_Missense_Mutation_p.V243L	NM_000695.3	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3 family, member B2	243					alcohol metabolic process (GO:0006066)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)		3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)	p.V243L(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	18						GTCTCCTGCACGTCCACCAGC	0.662																																							uc001omr.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|kidney(1)	2						c.(727-729)GTG>CTG		aldehyde dehydrogenase 3B2	NADH(DB00157)						104.0	82.0	90.0					11																	67432013		2200	4294	6494	SO:0001583	missense	222				alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase	g.chr11:67432013C>G	U37519	CCDS31622.1	11q13.2	2014-09-04			ENSG00000132746	ENSG00000132746	1.2.1.5	"""Aldehyde dehydrogenases"""	411	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 8"", ""acetaldehyde dehydrogenase 8"""	601917		ALDH8		8890755, 9161417	Standard	NM_000695		Approved		uc001oms.3	P48448	OTTHUMG00000167284	ENST00000349015.3:c.727G>C	11.37:g.67432013C>G	ENSP00000255084:p.Val243Leu					ALDH3B2_uc001oms.2_Missense_Mutation_p.V243L|ALDH3B2_uc009ysa.1_Missense_Mutation_p.V243L	p.V243L	NM_000695	NP_000686	P48448	AL3B2_HUMAN			8	1166	-			243					Q53Y98|Q8NAL5|Q96IB2	Missense_Mutation	SNP	ENST00000349015.3	37	c.727G>C	CCDS31622.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.36|19.36	3.812156|3.812156	0.70797|0.70797	.|.	.|.	ENSG00000132746|ENSG00000132746	ENST00000531248|ENST00000530069;ENST00000349015	.|T;T	.|0.80393	.|-1.37;-1.37	4.18|4.18	2.17|2.17	0.27698|0.27698	.|Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	.|0.072936	.|0.53938	.|U	.|0.000050	D|D	0.89860|0.89860	0.6837|0.6837	M|M	0.90870|0.90870	3.155|3.155	0.53688|0.53688	D|D	0.999976|0.999976	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.88816|0.88816	0.3295|0.3295	5|10	.|0.66056	.|D	.|0.02	.|.	9.0287|9.0287	0.36245|0.36245	0.0:0.7668:0.1484:0.0847|0.0:0.7668:0.1484:0.0847	.|.	.|128;243	.|B4DSX1;P48448	.|.;AL3B2_HUMAN	P|L	13|243	.|ENSP00000431595:V243L;ENSP00000255084:V243L	.|ENSP00000255084:V243L	R|V	-|-	2|1	0|0	ALDH3B2|ALDH3B2	67188589|67188589	0.998000|0.998000	0.40836|0.40836	0.996000|0.996000	0.52242|0.52242	0.851000|0.851000	0.48451|0.48451	3.784000|3.784000	0.55416|0.55416	0.461000|0.461000	0.27071|0.27071	0.462000|0.462000	0.41574|0.41574	CGT|GTG		0.662	ALDH3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394004.1	NM_000695		8	31	0	0	0	0.00308	0	8	31				
SLCO2B1	11309	broad.mit.edu	37	11	74876920	74876920	+	Missense_Mutation	SNP	T	T	A	rs371587955		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:74876920T>A	ENST00000289575.5	+	4	769	c.374T>A	c.(373-375)gTg>gAg	p.V125E	SLCO2B1_ENST00000341411.4_Missense_Mutation_p.V9E|SLCO2B1_ENST00000526660.1_Intron|SLCO2B1_ENST00000525650.1_Intron|SLCO2B1_ENST00000454962.2_Missense_Mutation_p.V9E|SLCO2B1_ENST00000531756.1_Intron|SLCO2B1_ENST00000532236.1_Missense_Mutation_p.V9E|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.V103E	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	125					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.V125E(1)		breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	GCTATCCTTGTGGCCCTGGCG	0.592																																							uc001owb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(373-375)GTG>GAG		solute carrier organic anion transporter family,	Ergoloid mesylate(DB01049)						140.0	141.0	141.0					11																	74876920		2200	4293	6493	SO:0001583	missense	11309				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity	g.chr11:74876920T>A	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.374T>A	11.37:g.74876920T>A	ENSP00000289575:p.Val125Glu					SLCO2B1_uc010rrq.1_Intron|SLCO2B1_uc010rrr.1_Intron|SLCO2B1_uc010rrs.1_Missense_Mutation_p.V9E|SLCO2B1_uc001owc.2_Missense_Mutation_p.V9E|SLCO2B1_uc001owd.2_Missense_Mutation_p.V103E	p.V125E	NM_007256	NP_009187	O94956	SO2B1_HUMAN			4	761	+			125			Helical; Name=3; (Potential).		A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	37	c.374T>A	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.911218	0.72983	.	.	ENSG00000137491	ENST00000289575;ENST00000341411;ENST00000532236;ENST00000454962;ENST00000527180;ENST00000534186;ENST00000428359;ENST00000526839	T;T;T;T;T;T;T;T	0.81078	0.95;-1.45;0.95;-1.45;0.95;0.95;0.95;0.95	4.24	4.24	0.50183	Major facilitator superfamily domain, general substrate transporter (1);	0.074702	0.53938	D	0.000045	D	0.88265	0.6390	M	0.79475	2.455	0.19575	N	0.999967	D;D	0.89917	0.997;1.0	P;D	0.79784	0.899;0.993	T	0.80621	-0.1301	10	0.87932	D	0	.	11.3312	0.49477	0.0:0.0:0.0:1.0	.	9;125	O94956-2;O94956	.;SO2B1_HUMAN	E	125;9;9;9;103;103;103;1	ENSP00000289575:V125E;ENSP00000341286:V9E;ENSP00000434112:V9E;ENSP00000389653:V9E;ENSP00000436513:V103E;ENSP00000433872:V103E;ENSP00000388912:V103E;ENSP00000434742:V1E	ENSP00000289575:V125E	V	+	2	0	SLCO2B1	74554568	0.996000	0.38824	0.998000	0.56505	0.851000	0.48451	2.711000	0.47177	1.770000	0.52166	0.460000	0.39030	GTG		0.592	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256		25	113	0	0	0	0.003954	0	25	113				
RAB38	23682	broad.mit.edu	37	11	87847169	87847169	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:87847169C>A	ENST00000243662.6	-	3	705	c.623G>T	c.(622-624)tGt>tTt	p.C208F	RP11-164N3.3_ENST00000528458.1_RNA	NM_022337.2	NP_071732.1	P57729	RAB38_HUMAN	RAB38, member RAS oncogene family	208		Not methylated.			endosome to melanosome transport (GO:0035646)|GTP catabolic process (GO:0006184)|melanosome organization (GO:0032438)|phagosome acidification (GO:0090383)|platelet dense granule organization (GO:0060155)|protein localization to membrane (GO:0072657)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|early endosome (GO:0005769)|melanosome (GO:0042470)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	AP-1 adaptor complex binding (GO:0035650)|AP-3 adaptor complex binding (GO:0035651)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)	p.C208F(1)		large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GGATTTGGCACAGCCAGAGCA	0.473																																							uc001pcj.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|large_intestine(1)	2						c.(622-624)TGT>TTT		RAB38							126.0	119.0	121.0					11																	87847169		2201	4299	6500	SO:0001583	missense	23682				protein transport|small GTPase mediated signal transduction	melanosome|plasma membrane	GTP binding|GTPase activity	g.chr11:87847169C>A	AF235022	CCDS8281.1	11q14	2008-05-14			ENSG00000123892	ENSG00000123892		"""RAB, member RAS oncogene"""	9776	protein-coding gene	gene with protein product		606281				10910072	Standard	NM_022337		Approved	NY-MEL-1	uc001pcj.2	P57729	OTTHUMG00000167288	ENST00000243662.6:c.623G>T	11.37:g.87847169C>A	ENSP00000243662:p.Cys208Phe						p.C208F	NM_022337	NP_071732	P57729	RAB38_HUMAN			3	670	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)	208				Not methylated.	Q53XK7	Missense_Mutation	SNP	ENST00000243662.6	37	c.623G>T	CCDS8281.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846420	0.51164	.	.	ENSG00000123892	ENST00000243662	T	0.73258	-0.73	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.70237	0.3201	N	0.24115	0.695	0.80722	D	1	D	0.69078	0.997	P	0.56700	0.804	T	0.68194	-0.5473	9	.	.	.	.	17.1709	0.86830	0.0:1.0:0.0:0.0	.	208	P57729	RAB38_HUMAN	F	208	ENSP00000243662:C208F	.	C	-	2	0	RAB38	87486817	1.000000	0.71417	1.000000	0.80357	0.207000	0.24258	5.968000	0.70413	2.724000	0.93272	0.650000	0.86243	TGT		0.473	RAB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394015.2			19	93	1	0	6.49762e-13	0.006122	1.18297e-12	19	93				
GRM5	2915	broad.mit.edu	37	11	88300971	88300971	+	Missense_Mutation	SNP	A	A	T	rs201208612		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:88300971A>T	ENST00000305447.4	-	7	2029	c.1880T>A	c.(1879-1881)cTg>cAg	p.L627Q	GRM5_ENST00000305432.5_Missense_Mutation_p.L627Q|GRM5_ENST00000393297.1_Missense_Mutation_p.L627Q|GRM5_ENST00000455756.2_Missense_Mutation_p.L627Q|GRM5_ENST00000418177.2_Missense_Mutation_p.L627Q	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	627					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.L627Q(2)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	TAAGTAGCCCAGGCAGATGCC	0.473																																							uc001pcq.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(1879-1881)CTG>CAG		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						101.0	90.0	94.0					11																	88300971		2201	4299	6500	SO:0001583	missense	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88300971A>T	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1880T>A	11.37:g.88300971A>T	ENSP00000306138:p.Leu627Gln					GRM5_uc009yvm.2_Missense_Mutation_p.L627Q	p.L627Q	NM_001143831	NP_001137303	P41594	GRM5_HUMAN			7	2080	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	627			Helical; Name=2; (Potential).		Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	c.1880T>A	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.108272	0.77096	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72	5.71	5.71	0.89125	GPCR, family 3, C-terminal (2);	0.148976	0.48286	D	0.000196	D	0.94909	0.8354	M	0.75085	2.285	0.51767	D	0.999937	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.99	D	0.94728	0.7907	9	.	.	.	.	15.9905	0.80202	1.0:0.0:0.0:0.0	.	627;627	P41594-2;P41594	.;GRM5_HUMAN	Q	627	ENSP00000402912:L627Q;ENSP00000405690:L627Q;ENSP00000305905:L627Q;ENSP00000306138:L627Q;ENSP00000376975:L627Q	.	L	-	2	0	GRM5	87940619	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.187000	0.69744	0.533000	0.62120	CTG		0.473	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		6	26	0	0	0	0.00308	0	6	26				
NXPE4	54827	broad.mit.edu	37	11	114453728	114453728	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:114453728T>A	ENST00000375478.3	-	3	292	c.112A>T	c.(112-114)Aac>Tac	p.N38Y	NXPE4_ENST00000424261.2_5'UTR	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	38						extracellular vesicular exosome (GO:0070062)		p.N38Y(1)									ATGGATAAGTTTAGAGCAGAC	0.388																																							uc001ppc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(112-114)AAC>TAC		hypothetical protein LOC54827 isoform 1							159.0	146.0	150.0					11																	114453728		1941	4131	6072	SO:0001583	missense	54827					extracellular region		g.chr11:114453728T>A	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.112A>T	11.37:g.114453728T>A	ENSP00000364627:p.Asn38Tyr					FAM55D_uc001ppd.2_5'UTR	p.N38Y	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)	3	293	-		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)	38					Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	c.112A>T	CCDS41718.1	.	.	.	.	.	.	.	.	.	.	T	9.643	1.139571	0.21205	.	.	ENSG00000137634	ENST00000375478	T	0.11930	2.73	4.51	2.2	0.27929	.	1.556440	0.03662	N	0.242770	T	0.14313	0.0346	L	0.51422	1.61	0.09310	N	1	B	0.33583	0.418	B	0.30179	0.112	T	0.29088	-1.0023	10	0.62326	D	0.03	.	5.0546	0.14525	0.0:0.2618:0.0:0.7382	.	38	Q6UWF7	FA55D_HUMAN	Y	38	ENSP00000364627:N38Y	ENSP00000364627:N38Y	N	-	1	0	FAM55D	113958938	0.004000	0.15560	0.001000	0.08648	0.004000	0.04260	0.921000	0.28718	0.855000	0.35359	0.477000	0.44152	AAC		0.388	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678		7	163	0	0	0	0.001984	0	7	163				
PHLDB1	23187	broad.mit.edu	37	11	118498623	118498623	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:118498623A>T	ENST00000361417.2	+	7	1495	c.1084A>T	c.(1084-1086)Agc>Tgc	p.S362C	PHLDB1_ENST00000356063.5_Missense_Mutation_p.S362C	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	362								p.S362C(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GGTGGCCATCAGCCTGAGTGA	0.627																																							uc001ptr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1084-1086)AGC>TGC		pleckstrin homology-like domain, family B,							46.0	44.0	45.0					11																	118498623		2200	4295	6495	SO:0001583	missense	23187							g.chr11:118498623A>T		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.1084A>T	11.37:g.118498623A>T	ENSP00000354498:p.Ser362Cys					PHLDB1_uc010ryh.1_Missense_Mutation_p.S361C|PHLDB1_uc001pts.2_Missense_Mutation_p.S362C|PHLDB1_uc001ptt.2_Missense_Mutation_p.S362C|PHLDB1_uc001ptu.1_Intron|PHLDB1_uc001ptv.1_Missense_Mutation_p.S162C|PHLDB1_uc001ptw.1_5'Flank	p.S362C	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)	7	1437	+	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)	362					B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	c.1084A>T	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.843653	0.51164	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000543207;ENST00000356063	T;T	0.42513	1.0;0.97	5.13	3.99	0.46301	.	0.091863	0.48767	D	0.000180	T	0.41166	0.1147	N	0.19112	0.55	0.80722	D	1	P;D;P;D	0.71674	0.599;0.998;0.924;0.983	B;P;P;P	0.61592	0.22;0.891;0.634;0.635	T	0.33599	-0.9862	10	0.59425	D	0.04	-11.9765	6.8658	0.24093	0.7685:0.1505:0.081:0.0	.	361;362;362;362	B4DIX4;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	C	362;121;361;362	ENSP00000354498:S362C;ENSP00000348359:S362C	ENSP00000348359:S362C	S	+	1	0	PHLDB1	118003833	0.973000	0.33851	0.981000	0.43875	0.987000	0.75469	2.752000	0.47516	0.952000	0.37798	0.460000	0.39030	AGC		0.627	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157		13	33	0	0	0	0.013537	0	13	33				
SC5D	6309	broad.mit.edu	37	11	121177914	121177914	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:121177914A>T	ENST00000392789.2	+	5	830	c.593A>T	c.(592-594)tAc>tTc	p.Y198F	SC5D_ENST00000264027.4_Missense_Mutation_p.Y198F|SC5D_ENST00000528991.1_3'UTR|SC5D_ENST00000534230.1_Missense_Mutation_p.Y198F	NM_001024956.2	NP_001020127.1	O75845	SC5D_HUMAN	sterol-C5-desaturase	198					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via lathosterol (GO:0033490)|fatty acid biosynthetic process (GO:0006633)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	C-5 sterol desaturase activity (GO:0000248)|iron ion binding (GO:0005506)|lathosterol oxidase activity (GO:0050046)										TTAAGTCTGTACATCTTGGTT	0.378																																							uc001pxu.2		NA																	0				ovary(1)	1						c.(592-594)TAC>TTC		sterol-C5-desaturase							218.0	209.0	212.0					11																	121177914		2203	4299	6502	SO:0001583	missense	6309				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	C-5 sterol desaturase activity|iron ion binding|lathosterol oxidase activity	g.chr11:121177914A>T		CCDS8435.1	11q23.3	2013-03-04	2013-03-04	2013-03-04	ENSG00000109929	ENSG00000109929	1.14.21.6	"""Fatty acid hydroxylase domain containing"""	10547	protein-coding gene	gene with protein product	"""lathosterol oxidase"""	602286	"""sterol-C5-desaturase (fungal ERG3, delta-5-desaturase)-like"", ""sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, fungal)-like"", ""sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like"""	SC5DL		8976377	Standard	NM_006918		Approved		uc001pxu.3	O75845	OTTHUMG00000166068	ENST00000392789.2:c.593A>T	11.37:g.121177914A>T	ENSP00000376539:p.Tyr198Phe					SC5DL_uc001pxt.2_3'UTR|SC5DL_uc001pxv.2_Missense_Mutation_p.Y198F	p.Y198F	NM_006918	NP_008849	O75845	SC5D_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;0.0334)	BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.144)	5	741	+		Breast(109;0.00328)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	198			Helical; (Potential).		O00119|Q6GTM5|Q9UK15	Missense_Mutation	SNP	ENST00000392789.2	37	c.593A>T	CCDS8435.1	.	.	.	.	.	.	.	.	.	.	A	1.949	-0.441627	0.04604	.	.	ENSG00000109929	ENST00000264027;ENST00000534230;ENST00000392789	D;D;D	0.83506	-1.73;-1.73;-1.73	6.02	4.88	0.63580	Fatty acid hydroxylase (1);	0.000000	0.85682	D	0.000000	T	0.57154	0.2034	N	0.02142	-0.665	0.49130	D	0.999753	B	0.09022	0.002	B	0.09377	0.004	T	0.56408	-0.7984	10	0.02654	T	1	-18.5485	11.768	0.51941	0.8679:0.0:0.0:0.1321	.	198	O75845	SC5D_HUMAN	F	198	ENSP00000264027:Y198F;ENSP00000432550:Y198F;ENSP00000376539:Y198F	ENSP00000264027:Y198F	Y	+	2	0	SC5DL	120683124	1.000000	0.71417	0.065000	0.19835	0.420000	0.31355	9.300000	0.96151	1.079000	0.41038	-0.336000	0.08194	TAC		0.378	SC5D-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387702.1	NM_001024956		6	166	0	0	0	0.001984	0	6	166				
SCN3B	55800	broad.mit.edu	37	11	123513202	123513202	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr11:123513202G>T	ENST00000392770.2	-	3	1199	c.397C>A	c.(397-399)Ccc>Acc	p.P133T	SCN3B_ENST00000530277.1_Missense_Mutation_p.P133T|SCN3B_ENST00000299333.3_Missense_Mutation_p.P133T	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	133	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.P133T(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	TTCACAAAGGGCCGATGCGCC	0.597																																							uc001pza.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						c.(397-399)CCC>ACC		voltage-gated sodium channel beta-3 subunit							89.0	82.0	84.0					11																	123513202		2202	4299	6501	SO:0001583	missense	55800				axon guidance	integral to membrane|plasma membrane	voltage-gated sodium channel activity	g.chr11:123513202G>T	AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.397C>A	11.37:g.123513202G>T	ENSP00000376523:p.Pro133Thr					SCN3B_uc001pzb.1_Missense_Mutation_p.P133T	p.P133T	NM_001040151	NP_001035241	Q9NY72	SCN3B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	4	804	-		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	133			Ig-like C2-type.|Extracellular (Potential).		A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	ENST00000392770.2	37	c.397C>A	CCDS8442.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362151	0.82353	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277;ENST00000527836	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.193726	0.56097	D	0.000026	T	0.65913	0.2737	L	0.36672	1.1	0.58432	D	0.999999	D	0.59767	0.986	P	0.53450	0.726	T	0.57877	-0.7735	10	0.22109	T	0.4	-22.82	20.5666	0.99351	0.0:0.0:1.0:0.0	.	133	Q9NY72	SCN3B_HUMAN	T	133	ENSP00000376523:P133T;ENSP00000299333:P133T;ENSP00000432785:P133T;ENSP00000435554:P133T	ENSP00000299333:P133T	P	-	1	0	SCN3B	123018412	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.405000	0.73272	2.854000	0.98071	0.655000	0.94253	CCC		0.597	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387412.1	NM_018400		16	33	1	0	6.72482e-11	0.003163	1.11897e-10	16	33				
PDE3A	5139	broad.mit.edu	37	12	20522824	20522824	+	Silent	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:20522824A>T	ENST00000359062.3	+	1	646	c.606A>T	c.(604-606)acA>acT	p.T202T	RP11-284H19.1_ENST00000535755.1_RNA	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	202					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.T202T(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CCGCCGCGACATGGCTGGTGC	0.652																																							uc001reh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)	4						c.(604-606)ACA>ACT		phosphodiesterase 3A	Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)						21.0	24.0	23.0					12																	20522824		2171	4252	6423	SO:0001819	synonymous_variant	5139				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:20522824A>T		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.606A>T	12.37:g.20522824A>T							p.T202T	NM_000921	NP_000912	Q14432	PDE3A_HUMAN			1	628	+	Esophageal squamous(101;0.125)	Breast(259;0.134)	202			Helical; (Potential).		O60865|Q13348|Q17RD1	Silent	SNP	ENST00000359062.3	37	c.606A>T	CCDS31754.1																																																																																				0.652	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2			4	23	0	0	0	0.000602	0	4	23				
GOLT1B	51026	broad.mit.edu	37	12	21661496	21661496	+	Splice_Site	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:21661496G>T	ENST00000229314.5	+	3	405		c.e3+1		GOLT1B_ENST00000542038.1_Splice_Site|GOLT1B_ENST00000540141.1_Splice_Site|GOLT1B_ENST00000535593.1_Intron	NM_016072.4	NP_057156.1	Q9Y3E0	GOT1B_HUMAN	golgi transport 1B						positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|signal transduction (GO:0007165)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	signal transducer activity (GO:0004871)	p.?(1)		large_intestine(2)|lung(3)	5						TCTTGTTCAGGTAAGGCATAT	0.353																																							uc001rez.2		NA																	1	Unknown(1)		lung(1)		0						c.e3+1		golgi transport 1 homolog B							82.0	83.0	83.0					12																	21661496		2203	4296	6499	SO:0001630	splice_region_variant	51026				positive regulation of I-kappaB kinase/NF-kappaB cascade|protein transport|vesicle-mediated transport	endoplasmic reticulum|Golgi membrane|integral to membrane	signal transducer activity	g.chr12:21661496G>T	AB097020	CCDS8689.1	12p13.1	2010-06-24	2010-06-24		ENSG00000111711	ENSG00000111711			20175	protein-coding gene	gene with protein product		615078	"""golgi transport 1 homolog B (S. cerevisiae)"""			12414650, 10810093	Standard	NM_016072		Approved	CGI-141, YMR292W, GOT1	uc001rez.2	Q9Y3E0	OTTHUMG00000169133	ENST00000229314.5:c.296+1G>T	12.37:g.21661496G>T						GOLT1B_uc009zis.2_Splice_Site|GOLT1B_uc009zit.2_Splice_Site|GOLT1B_uc009ziu.2_Intron	p.R99_splice	NM_016072	NP_057156	Q9Y3E0	GOT1B_HUMAN			3	455	+								B2R4R4|Q54A40|Q6I9W6|Q9P1R9	Splice_Site	SNP	ENST00000229314.5	37	c.296_splice	CCDS8689.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098557	0.76870	.	.	ENSG00000111711	ENST00000542038;ENST00000540141;ENST00000229314	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9939	0.92804	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GOLT1B	21552763	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	9.796000	0.99103	2.472000	0.83506	0.557000	0.71058	.		0.353	GOLT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402384.2	NM_016072	Intron	12	86	1	0	6.40141e-05	0.010729	7.87568e-05	12	86				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GTT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12V|KRAS_uc001rgr.2_RNA	p.G12V	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		7	19	1	0	0.00198382	0.001984	0.00223731	7	19				
CNTN1	1272	broad.mit.edu	37	12	41327516	41327516	+	Missense_Mutation	SNP	G	G	C	rs374200408		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:41327516G>C	ENST00000551295.2	+	9	938	c.821G>C	c.(820-822)cGa>cCa	p.R274P	CNTN1_ENST00000347616.1_Missense_Mutation_p.R274P|CNTN1_ENST00000348761.2_Missense_Mutation_p.R263P|CNTN1_ENST00000547702.1_Missense_Mutation_p.R274P|CNTN1_ENST00000360099.3_Missense_Mutation_p.R274P|CNTN1_ENST00000547849.1_Missense_Mutation_p.R274P	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	274	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.R274P(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CCGGATATCCGATGGCGGAAG	0.373																																							uc001rmm.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(3)|large_intestine(1)|skin(1)	9						c.(820-822)CGA>CCA		contactin 1 isoform 1 precursor							89.0	90.0	90.0					12																	41327516		2201	4299	6500	SO:0001583	missense	1272				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane		g.chr12:41327516G>C	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.821G>C	12.37:g.41327516G>C	ENSP00000447006:p.Arg274Pro					CNTN1_uc009zjy.1_Missense_Mutation_p.R274P|CNTN1_uc001rmn.1_Missense_Mutation_p.R263P|CNTN1_uc001rmo.2_Missense_Mutation_p.R274P	p.R274P	NM_001843	NP_001834	Q12860	CNTN1_HUMAN			9	934	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	274			Ig-like C2-type 3.		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	c.821G>C	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297719	0.60086	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.27	4.37	0.52481	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.347874	0.23629	N	0.046156	T	0.80502	0.4635	M	0.87328	2.875	0.39582	D	0.969445	D;D;D	0.69078	0.993;0.997;0.997	P;D;D	0.68039	0.819;0.925;0.955	T	0.80799	-0.1221	10	0.33141	T	0.24	.	9.7281	0.40344	0.0746:0.1407:0.7847:0.0	.	274;263;274	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	P	274;274;274;274;274;263	ENSP00000448004:R274P;ENSP00000447006:R274P;ENSP00000448653:R274P;ENSP00000325660:R274P;ENSP00000353213:R274P;ENSP00000261160:R263P	ENSP00000325660:R274P	R	+	2	0	CNTN1	39613783	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	4.658000	0.61497	1.360000	0.45960	0.650000	0.86243	CGA		0.373	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843		26	109	0	0	0	0.00632	0	26	109				
ACVR1B	91	broad.mit.edu	37	12	52377917	52377917	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:52377917G>A	ENST00000257963.4	+	5	1023	c.946G>A	c.(946-948)Gca>Aca	p.A316T	ACVR1B_ENST00000563121.1_3'UTR|ACVR1B_ENST00000541224.1_Missense_Mutation_p.A357T|ACVR1B_ENST00000426655.2_Missense_Mutation_p.A316T|ACVR1B_ENST00000542485.1_Missense_Mutation_p.A264T|ACVR1B_ENST00000415850.2_Missense_Mutation_p.A316T	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	316	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.A357T(1)|p.A316T(1)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TAGTGGGCTGGCACACCTGCA	0.542																																							uc001rzn.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(4)|breast(2)|ovary(1)|lung(1)|kidney(1)	9						c.(946-948)GCA>ACA		activin A receptor, type IB isoform a precursor	Adenosine triphosphate(DB00171)						98.0	76.0	84.0					12																	52377917		2203	4300	6503	SO:0001583	missense	91				G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|peptidyl-threonine phosphorylation|positive regulation of activin receptor signaling pathway|positive regulation of erythrocyte differentiation|protein autophosphorylation|transmembrane receptor protein serine/threonine kinase signaling pathway	cell surface	activin receptor activity, type I|ATP binding|metal ion binding|SMAD binding|transforming growth factor beta receptor activity|ubiquitin protein ligase binding	g.chr12:52377917G>A		CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.946G>A	12.37:g.52377917G>A	ENSP00000257963:p.Ala316Thr					ACVR1B_uc001rzl.2_Missense_Mutation_p.A316T|ACVR1B_uc001rzm.2_Missense_Mutation_p.A316T|ACVR1B_uc010snn.1_Missense_Mutation_p.A357T	p.A316T	NM_004302	NP_004293	P36896	ACV1B_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.104)	5	988	+			316			Protein kinase.|Cytoplasmic (Potential).		B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	c.946G>A	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	36	5.901281	0.97087	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81024	0.4737	M	0.64080	1.96	0.80722	D	1	D;D;D;P	0.89917	0.958;1.0;0.958;0.908	P;D;P;P	0.85130	0.835;0.997;0.803;0.788	T	0.82396	-0.0478	10	0.87932	D	0	.	19.2879	0.94085	0.0:0.0:1.0:0.0	.	357;316;316;316	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	T	316;357;316;316;264	ENSP00000257963:A316T;ENSP00000442656:A357T;ENSP00000390477:A316T;ENSP00000397550:A316T;ENSP00000442885:A264T	ENSP00000257963:A316T	A	+	1	0	ACVR1B	50664184	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.827000	0.99397	2.644000	0.89710	0.655000	0.94253	GCA		0.542	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328		4	25	0	0	0	0.000602	0	4	25				
KRT77	374454	broad.mit.edu	37	12	53096691	53096691	+	Silent	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:53096691G>A	ENST00000341809.3	-	1	556	c.528C>T	c.(526-528)gcC>gcT	p.A176A	KRT77_ENST00000537195.1_5'UTR	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	176	Coil 1A.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.A176A(1)		NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						caatgaaggaggcaaacttgt	0.522																																							uc001saw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(526-528)GCC>GCT		keratin 77							134.0	127.0	129.0					12																	53096691		2203	4300	6503	SO:0001819	synonymous_variant	374454					keratin filament	structural molecule activity	g.chr12:53096691G>A	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.528C>T	12.37:g.53096691G>A						KRT77_uc009zmi.2_5'UTR	p.A176A	NM_175078	NP_778253	Q7Z794	K2C1B_HUMAN			1	557	-			176			Coil 1A.|Rod.		Q7RTS8	Silent	SNP	ENST00000341809.3	37	c.528C>T	CCDS8837.1																																																																																				0.522	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078		10	106	0	0	0	0.008291	0	10	106				
INHBE	83729	broad.mit.edu	37	12	57850274	57850274	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:57850274G>T	ENST00000266646.2	+	2	912	c.696G>T	c.(694-696)cgG>cgT	p.R232R	INHBE_ENST00000551553.1_3'UTR	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	232					growth (GO:0040007)	extracellular region (GO:0005576)		p.R232R(1)		breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						GAGCAGGCCGGGCCAGGAGGA	0.607											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(191;1808 2166 15720 36624 50371)	GBM(191;1808 2166 15720 36624 50371)	uc001snw.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|central_nervous_system(1)	3						c.(694-696)CGG>CGT		activin beta E precursor							72.0	84.0	80.0					12																	57850274		2203	4300	6503	SO:0001819	synonymous_variant	83729				growth	extracellular region	growth factor activity|hormone activity	g.chr12:57850274G>T		CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.696G>T	12.37:g.57850274G>T			OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1026		p.R232R	NM_031479	NP_113667	P58166	INHBE_HUMAN			2	920	+			232						Silent	SNP	ENST00000266646.2	37	c.696G>T	CCDS8939.1																																																																																				0.607	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406773.1	NM_031479		14	75	1	0	1.52009e-12	0.003163	2.74292e-12	14	75				
HMGA2	8091	broad.mit.edu	37	12	66221815	66221815	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:66221815G>T	ENST00000403681.2	+	2	1286	c.146G>T	c.(145-147)aGg>aTg	p.R49M	HMGA2_ENST00000354636.3_Missense_Mutation_p.R49M|HMGA2_ENST00000393577.3_Missense_Mutation_p.R49M|HMGA2_ENST00000541363.1_Missense_Mutation_p.R49M|RPSAP52_ENST00000489520.2_RNA|HMGA2_ENST00000393578.3_Missense_Mutation_p.R49M|HMGA2_ENST00000425208.2_Missense_Mutation_p.R49M|HMGA2_ENST00000536545.1_Missense_Mutation_p.R49M	NM_003483.4	NP_003474.1	P52926	HMGA2_HUMAN	high mobility group AT-hook 2	49	Interaction with E4F1.				adrenal gland development (GO:0030325)|base-excision repair (GO:0006284)|cell proliferation in forebrain (GO:0021846)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|chromatin organization (GO:0006325)|chromosome breakage (GO:0031052)|chromosome condensation (GO:0030261)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA damage response, detection of DNA damage (GO:0042769)|endodermal cell differentiation (GO:0035987)|epithelial to mesenchymal transition (GO:0001837)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|heterochromatin assembly (GO:0031507)|histone H2A-S139 phosphorylation (GO:0035978)|male gonad development (GO:0008584)|mesenchymal cell differentiation (GO:0048762)|mesodermal cell differentiation (GO:0048333)|mesodermal-endodermal cell signaling (GO:0003131)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of DNA binding (GO:0043392)|negative regulation of double-strand break repair via nonhomologous end joining (GO:2001033)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|oncogene-induced cell senescence (GO:0090402)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cellular response to X-ray (GO:2000685)|positive regulation of cellular senescence (GO:2000774)|positive regulation of gene expression (GO:0010628)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle process (GO:0010564)|regulation of cellular response to drug (GO:2001038)|regulation of growth hormone secretion (GO:0060123)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|senescence-associated heterochromatin focus assembly (GO:0035986)|signal transduction (GO:0007165)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|senescence-associated heterochromatin focus (GO:0035985)|SMAD protein complex (GO:0071141)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|AT DNA binding (GO:0003680)|C2H2 zinc finger domain binding (GO:0070742)|cAMP response element binding (GO:0035497)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|DNA-dependent protein kinase activity (GO:0004677)|MH1 domain binding (GO:0035501)|MH2 domain binding (GO:0035500)|nucleosomal DNA binding (GO:0031492)|regulatory region DNA binding (GO:0000975)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.R49M(2)	HMGA2/RAD51B(11)|HMGA2/CCNB1IP1(2)|HMGA2/WIF1_ENST00000286574(14)|HMGA2/ALDH2_ENST00000261733(2)|HMGA2/EBF1(2)|HMGA2/LHFP(2)|HMGA2/NFIB_ENST00000397581(8)|HMGA2/LPP(161)|HMGA2/FHIT_ENST00000476844(4)|HMGA2/COX6C(2)	lung(2)	2	all_cancers(1;5.78e-46)		GBM - Glioblastoma multiforme(1;0.00179)|LUSC - Lung squamous cell carcinoma(43;0.156)	GBM - Glioblastoma multiforme(28;0.0386)		AAGAGACCCAGGGGAAGACCC	0.448			T	""" LHFP, RAD51L1, LPP, COX6C, CMKOR1, NFIB, ALDH2, CCNB1IP1, EBF1, WIF1, FHIT"""	"""lipoma, leiomyoma, pleiomorphic salivary gland adenoma"""																																		uc001ssx.2		NA		Dom	yes		12	12q15	8091	T	high mobility group AT-hook 2 (HMGIC)			M	LHFP|RAD51L1|LPP|HEI10|COX6C|CMKOR1|NFIB|ALDH2|CCNB1IP1|EBF1|WIF1|FHIT		lipoma|leiomyoma|pleiomorphic salivary gland adenoma	HMGA2/LPP(161)|HMGA2/WIF1_ENST00000286574(14)|HMGA2/RAD51B(11)|HMGA2/NFIB_ENST00000397581(8)|HMGA2/FHIT_ENST00000476844(4)|HMGA2/CCNB1IP1(2)|HMGA2/ALDH2_ENST00000261733(2)|HMGA2/EBF1(2)|HMGA2/LHFP(2)|HMGA2/COX6C(2)	2	Substitution - Missense(2)		lung(2)	soft_tissue(159)|bone(27)|salivary_gland(22)	208						c.(145-147)AGG>ATG		high mobility group AT-hook 2 isoform a							88.0	95.0	92.0					12																	66221815		2203	4300	6503	SO:0001583	missense	8091				cell division|chromatin organization|mitosis|multicellular organismal development|regulation of growth|transcription, DNA-dependent	chromatin	AT DNA binding	g.chr12:66221815G>T	U28754	CCDS31854.1, CCDS44936.1, CCDS73491.1, CCDS73492.1	12q15	2011-07-01	2002-07-25	2002-07-26	ENSG00000149948	ENSG00000149948		"""High-mobility group / Canonical"""	5009	protein-coding gene	gene with protein product		600698	"""high-mobility group (nonhistone chromosomal) protein isoform I-C"""	HMGIC		8824803, 9003504	Standard	XM_006719620		Approved	BABL, LIPO	uc001ssx.3	P52926	OTTHUMG00000168936	ENST00000403681.2:c.146G>T	12.37:g.66221815G>T	ENSP00000384026:p.Arg49Met					RPSAP52_uc001sso.2_5'Flank|HMGA2_uc001ssw.1_Missense_Mutation_p.R49M|HMGA2_uc001ssp.1_RNA|HMGA2_uc010ssv.1_RNA|HMGA2_uc001sss.1_RNA|HMGA2_uc001sst.1_Missense_Mutation_p.R49M|HMGA2_uc001ssu.1_Missense_Mutation_p.R49M|HMGA2_uc001ssv.2_Missense_Mutation_p.R49M	p.R49M	NM_003483	NP_003474	P52926	HMGA2_HUMAN	GBM - Glioblastoma multiforme(1;0.00179)|LUSC - Lung squamous cell carcinoma(43;0.156)	GBM - Glioblastoma multiforme(28;0.0386)	2	957	+	all_cancers(1;5.78e-46)		49			A.T hook 2.|Interaction with E4F1.		E7EP85|E7EWA2|Q1M182|Q1M185|Q1M186|Q1M187|Q1M188	Missense_Mutation	SNP	ENST00000403681.2	37	c.146G>T	CCDS44936.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.463548	0.84425	.	.	ENSG00000149948	ENST00000403681;ENST00000354636;ENST00000393578;ENST00000536545;ENST00000425208;ENST00000541363;ENST00000393577	T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.17	5.17	0.71159	AT hook, DNA-binding motif (2);	0.000000	0.85682	D	0.000000	T	0.67373	0.2886	M	0.64404	1.975	0.51482	D	0.999924	D;D;D;D;D	0.76494	0.996;0.999;0.999;0.998;0.999	D;D;D;D;D	0.85130	0.99;0.995;0.997;0.992;0.997	T	0.65841	-0.6070	9	.	.	.	-10.715	19.058	0.93074	0.0:0.0:1.0:0.0	.	49;49;49;49;49	P52926;F5H2U8;Q1M182;F5H6H0;Q1M186	HMGA2_HUMAN;.;.;.;.	M	49	ENSP00000384026:R49M;ENSP00000346658:R49M;ENSP00000377206:R49M;ENSP00000437621:R49M;ENSP00000407306:R49M;ENSP00000439317:R49M;ENSP00000377205:R49M	.	R	+	2	0	HMGA2	64508082	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.772000	0.85439	2.578000	0.87016	0.650000	0.86243	AGG		0.448	HMGA2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401654.1	NM_003483		7	35	1	0	0.00621372	0.006214	0.00681829	7	35				
GLIPR1	11010	broad.mit.edu	37	12	75875626	75875626	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:75875626G>C	ENST00000266659.3	+	2	388	c.187G>C	c.(187-189)Gca>Cca	p.A63P	RP11-585P4.5_ENST00000547326.1_RNA	NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	63	SCP.				cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A63P(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						TTGGGACCCAGCACTAGCCCA	0.453																																							uc001sxs.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(187-189)GCA>CCA		GLI pathogenesis-related 1 precursor							120.0	119.0	119.0					12																	75875626		2203	4300	6503	SO:0001583	missense	11010				cellular lipid metabolic process	extracellular region|integral to membrane		g.chr12:75875626G>C	U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.187G>C	12.37:g.75875626G>C	ENSP00000266659:p.Ala63Pro					GLIPR1_uc009zsb.1_Missense_Mutation_p.A63P	p.A63P	NM_006851	NP_006842	P48060	GLIP1_HUMAN			2	335	+			63					A7YET6|F8VUC2|Q15409|Q969K2	Missense_Mutation	SNP	ENST00000266659.3	37	c.187G>C	CCDS9011.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400412	0.62177	.	.	ENSG00000139278	ENST00000266659;ENST00000456650	T;T	0.08546	3.08;3.08	5.92	0.62	0.17637	CAP domain (3);	1.687940	0.03397	N	0.202724	T	0.23727	0.0574	M	0.79614	2.46	0.09310	N	1	D;D	0.67145	0.996;0.988	P;P	0.56127	0.792;0.772	T	0.14587	-1.0467	10	0.45353	T	0.12	.	8.0301	0.30459	0.1374:0.3658:0.4967:0.0	.	63;63	F6VVE8;P48060	.;GLIP1_HUMAN	P	63	ENSP00000266659:A63P;ENSP00000391144:A63P	ENSP00000266659:A63P	A	+	1	0	GLIPR1	74161893	0.001000	0.12720	0.014000	0.15608	0.785000	0.44390	0.883000	0.28200	0.065000	0.16485	-0.176000	0.13171	GCA		0.453	GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405722.1	NM_006851		28	171	0	0	0	0.010818	0	28	171				
LRRIQ1	84125	broad.mit.edu	37	12	85518290	85518290	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:85518290G>T	ENST00000393217.2	+	17	4061	c.4000G>T	c.(4000-4002)Gaa>Taa	p.E1334*		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1334								p.E1334*(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TGAGCCTAGTGAAAAAATGTA	0.328																																							uc001tac.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(4000-4002)GAA>TAA		leucine-rich repeats and IQ motif containing 1							79.0	93.0	89.0					12																	85518290		2201	4291	6492	SO:0001587	stop_gained	84125							g.chr12:85518290G>T	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4000G>T	12.37:g.85518290G>T	ENSP00000376910:p.Glu1334*					LRRIQ1_uc001tab.1_Nonsense_Mutation_p.E1334*	p.E1334*	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN		GBM - Glioblastoma multiforme(134;0.212)	17	4111	+			1334					Q567P4|Q9BS17|Q9HA36	Nonsense_Mutation	SNP	ENST00000393217.2	37	c.4000G>T	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	38	6.781347	0.97833	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	.	.	.	5.33	1.45	0.22620	.	0.279785	0.27424	N	0.019425	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	1.4698	0.02414	0.3161:0.1335:0.4131:0.1373	.	.	.	.	X	1334;1309;1334	.	ENSP00000256007:E1334X	E	+	1	0	LRRIQ1	84042421	0.004000	0.15560	0.004000	0.12327	0.132000	0.20833	0.692000	0.25482	0.055000	0.16094	-0.229000	0.12294	GAA		0.328	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		30	196	1	0	4.22769e-11	0.00632	7.15185e-11	30	196				
USP44	84101	broad.mit.edu	37	12	95927532	95927532	+	Silent	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:95927532T>C	ENST00000258499.3	-	2	789	c.501A>G	c.(499-501)gaA>gaG	p.E167E	USP44_ENST00000537435.2_Silent_p.E167E|USP44_ENST00000393091.2_Silent_p.E167E|USP44_ENST00000552440.1_Silent_p.E167E	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	167					mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.E167E(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						TGGGTGATTGTTCAAACCATG	0.383																																							uc001teg.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|breast(1)|central_nervous_system(1)	3						c.(499-501)GAA>GAG		ubiquitin thiolesterase 44							104.0	104.0	104.0					12																	95927532		2203	4300	6503	SO:0001819	synonymous_variant	84101				anaphase|cell division|mitosis|negative regulation of mitotic anaphase-promoting complex activity|protein deubiquitination|regulation of spindle checkpoint|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr12:95927532T>C	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.501A>G	12.37:g.95927532T>C						USP44_uc001teh.2_Silent_p.E167E|USP44_uc009zte.2_Silent_p.E164E	p.E167E	NM_001042403	NP_001035862	Q9H0E7	UBP44_HUMAN			2	645	-			167					B2RDW3	Silent	SNP	ENST00000258499.3	37	c.501A>G	CCDS9053.1																																																																																				0.383	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147		21	81	0	0	0	0.010504	0	21	81				
CDK17	5128	broad.mit.edu	37	12	96707200	96707200	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:96707200C>A	ENST00000261211.3	-	4	919	c.316G>T	c.(316-318)Gat>Tat	p.D106Y	CDK17_ENST00000542666.1_Missense_Mutation_p.D53Y|CDK17_ENST00000543119.2_Missense_Mutation_p.D106Y	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	106					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.D106Y(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						CTCTCACCATCTGATCCCATT	0.333																																							uc001tep.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7						c.(316-318)GAT>TAT		PCTAIRE protein kinase 2							81.0	75.0	77.0					12																	96707200		2203	4300	6503	SO:0001583	missense	5128						ATP binding|cyclin-dependent protein kinase activity	g.chr12:96707200C>A		CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.316G>T	12.37:g.96707200C>A	ENSP00000261211:p.Asp106Tyr					CDK17_uc009ztk.2_Missense_Mutation_p.D106Y|CDK17_uc010svb.1_Missense_Mutation_p.D53Y	p.D106Y	NM_002595	NP_002586	Q00537	CDK17_HUMAN			4	805	-			106					A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	ENST00000261211.3	37	c.316G>T	CCDS9061.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645514	0.87859	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666;ENST00000551816;ENST00000552496;ENST00000548734	T;T;T;T;T;T	0.73047	-0.57;-0.57;-0.71;0.08;-0.01;-0.28	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.84813	0.5555	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70935	0.971;0.971	D	0.85904	0.1436	10	0.66056	D	0.02	-19.9891	19.5071	0.95124	0.0:1.0:0.0:0.0	.	106;106	A8K1U6;Q00537	.;CDK17_HUMAN	Y	106;106;53;106;106;126	ENSP00000261211:D106Y;ENSP00000444459:D106Y;ENSP00000442926:D53Y;ENSP00000450058:D106Y;ENSP00000447282:D106Y;ENSP00000447441:D126Y	ENSP00000261211:D106Y	D	-	1	0	CDK17	95231331	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.486000	0.81215	2.617000	0.88574	0.557000	0.71058	GAT		0.333	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408751.1	NM_002595		4	44	1	0	0.00024832	0.009096	0.000291381	4	44				
NEDD1	121441	broad.mit.edu	37	12	97313900	97313900	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:97313900C>A	ENST00000266742.4	+	6	825	c.486C>A	c.(484-486)aaC>aaA	p.N162K	NEDD1_ENST00000429527.2_Missense_Mutation_p.N162K|NEDD1_ENST00000557644.1_Missense_Mutation_p.N169K|NEDD1_ENST00000457368.2_Missense_Mutation_p.N73K|NEDD1_ENST00000555114.1_3'UTR|NEDD1_ENST00000411739.2_Missense_Mutation_p.N73K	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	162					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)		p.N162K(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						ATGGTAGTAACCAGGTACAGT	0.323																																							uc001teu.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(484-486)AAC>AAA		neural precursor cell expressed, developmentally							110.0	108.0	109.0					12																	97313900		2202	4299	6501	SO:0001583	missense	121441				cell division|G2/M transition of mitotic cell cycle|mitosis	cytosol		g.chr12:97313900C>A		CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.486C>A	12.37:g.97313900C>A	ENSP00000266742:p.Asn162Lys					NEDD1_uc001tev.3_Missense_Mutation_p.N162K|NEDD1_uc010svc.1_Missense_Mutation_p.N73K|NEDD1_uc001tew.2_Missense_Mutation_p.N169K|NEDD1_uc001tex.2_Missense_Mutation_p.N73K	p.N162K	NM_152905	NP_690869	Q8NHV4	NEDD1_HUMAN			6	825	+			162			WD 5.		B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	ENST00000266742.4	37	c.486C>A	CCDS9063.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.642061	0.29157	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000557478;ENST00000411739;ENST00000553609;ENST00000557644;ENST00000457368	T;T;T;T;T;T;T	0.74209	0.82;0.82;1.06;1.66;-0.82;0.82;1.66	5.54	1.56	0.23342	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.294782	0.45867	N	0.000335	T	0.53883	0.1824	L	0.39245	1.2	0.38950	D	0.958337	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.33599	-0.9862	10	0.07482	T	0.82	.	2.7244	0.05210	0.1125:0.4685:0.1159:0.3031	.	169;162	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	K	162;162;162;73;73;169;73	ENSP00000266742:N162K;ENSP00000404978:N162K;ENSP00000451869:N162K;ENSP00000411307:N73K;ENSP00000451830:N73K;ENSP00000451211:N169K;ENSP00000407964:N73K	ENSP00000266742:N162K	N	+	3	2	NEDD1	95838031	0.937000	0.31787	0.997000	0.53966	0.750000	0.42670	0.041000	0.13927	0.282000	0.22254	-0.459000	0.05422	AAC		0.323	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1			13	98	1	0	7.93312e-07	0.00245	1.09927e-06	13	98				
C12orf42	374470	broad.mit.edu	37	12	103699904	103699904	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:103699904T>A	ENST00000378113.2	-	5	704	c.479A>T	c.(478-480)cAg>cTg	p.Q160L	C12orf42_ENST00000548883.1_Missense_Mutation_p.Q160L|C12orf42_ENST00000548789.1_5'UTR|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Missense_Mutation_p.Q93L	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	160								p.Q160L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						GTTCCAAGCCTGCTTGGGTGC	0.493																																							uc001tjt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(478-480)CAG>CTG		hypothetical protein LOC374470							71.0	73.0	72.0					12																	103699904		1898	4120	6018	SO:0001583	missense	374470							g.chr12:103699904T>A	AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.479A>T	12.37:g.103699904T>A	ENSP00000367353:p.Gln160Leu					C12orf42_uc001tjs.2_Intron|C12orf42_uc009zuf.1_Missense_Mutation_p.Q160L|C12orf42_uc001tju.2_Missense_Mutation_p.Q65L	p.Q160L	NM_198521	NP_940923	Q96LP6	CL042_HUMAN			5	567	-			160					Q49A64|Q4G0S2	Missense_Mutation	SNP	ENST00000378113.2	37	c.479A>T	CCDS44963.1	.	.	.	.	.	.	.	.	.	.	T	11.07	1.531323	0.27387	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113;ENST00000552578	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	3.98	-2.53	0.06326	.	1.793630	0.03941	N	0.286923	T	0.31734	0.0806	L	0.27053	0.805	0.09310	N	1	B	0.18013	0.025	B	0.12837	0.008	T	0.27606	-1.0069	10	0.87932	D	0	0.1836	2.8065	0.05429	0.3346:0.2979:0.0:0.3675	.	160	Q96LP6	CL042_HUMAN	L	160;93;160;160	ENSP00000447908:Q160L;ENSP00000449362:Q93L;ENSP00000367353:Q160L;ENSP00000447795:Q160L	ENSP00000367353:Q160L	Q	-	2	0	C12orf42	102224034	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.044000	0.12023	-0.472000	0.06881	-0.546000	0.04227	CAG		0.493	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406754.1	NM_198521		10	49	0	0	0	0.006214	0	10	49				
PWP1	11137	broad.mit.edu	37	12	108086637	108086637	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:108086637G>T	ENST00000412830.3	+	4	534	c.366G>T	c.(364-366)ggG>ggT	p.G122G	PWP1_ENST00000541166.1_Silent_p.G60G	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	122					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.G122G(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						CGGTCTACGGGAGTAATGATC	0.338																																							uc001tmo.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(364-366)GGG>GGT		periodic tryptophan protein 1							128.0	124.0	125.0					12																	108086637		2203	4300	6503	SO:0001819	synonymous_variant	11137				transcription, DNA-dependent	nucleus		g.chr12:108086637G>T	BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.366G>T	12.37:g.108086637G>T						PWP1_uc001tmn.1_RNA|PWP1_uc009zuu.1_Silent_p.G122G	p.G122G	NM_007062	NP_008993	Q13610	PWP1_HUMAN			4	453	+			122					A8K3R6|Q7Z3X9	Silent	SNP	ENST00000412830.3	37	c.366G>T	CCDS9114.1																																																																																				0.338	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406539.1	NM_007062		7	71	1	0	1.12685e-05	0.004482	1.47107e-05	7	71				
RASAL1	8437	broad.mit.edu	37	12	113557022	113557022	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:113557022C>A	ENST00000261729.5	-	8	868	c.553G>T	c.(553-555)Gag>Tag	p.E185*	RASAL1_ENST00000446861.3_Nonsense_Mutation_p.E185*|RASAL1_ENST00000546530.1_Nonsense_Mutation_p.E185*|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000548055.1_Nonsense_Mutation_p.E185*			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	185	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.E185*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						TCCCGCAGCTCCAGCACTTCA	0.617																																							uc001tum.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(2)	4						c.(553-555)GAG>TAG		RAS protein activator like 1							66.0	58.0	61.0					12																	113557022		2203	4300	6503	SO:0001587	stop_gained	8437				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity	g.chr12:113557022C>A	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.553G>T	12.37:g.113557022C>A	ENSP00000261729:p.Glu185*					RASAL1_uc010syp.1_Nonsense_Mutation_p.E185*|RASAL1_uc001tul.2_Nonsense_Mutation_p.E185*|RASAL1_uc001tun.1_Nonsense_Mutation_p.E185*|RASAL1_uc010syq.1_Nonsense_Mutation_p.E185*|RASAL1_uc001tuo.3_Nonsense_Mutation_p.E185*|RASAL1_uc010syr.1_Nonsense_Mutation_p.E185*	p.E185*	NM_004658	NP_004649	O95294	RASL1_HUMAN			8	846	-			185			C2 2.		B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Nonsense_Mutation	SNP	ENST00000261729.5	37	c.553G>T	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	C	40	8.105643	0.98657	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	.	.	.	5.46	4.57	0.56435	.	0.056424	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	13.4827	0.61345	0.0:0.9225:0.0:0.0775	.	.	.	.	X	185	.	ENSP00000261729:E185X	E	-	1	0	RASAL1	112041405	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.691000	0.68249	1.316000	0.45131	0.491000	0.48974	GAG		0.617	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		13	36	1	0	9.31168e-06	0.001855	1.23145e-05	13	36				
PLBD2	196463	broad.mit.edu	37	12	113812724	113812724	+	Silent	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:113812724C>T	ENST00000280800.3	+	5	802	c.771C>T	c.(769-771)ctC>ctT	p.L257L	PLBD2_ENST00000547163.1_3'UTR|PLBD2_ENST00000545182.2_Silent_p.L257L	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	257					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)	p.L257L(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						AGAGTGACCTCCTGGTTGCCC	0.577																																							uc001tve.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(769-771)CTC>CTT		phospholipase B domain containing 2 isoform 1							111.0	93.0	99.0					12																	113812724		2203	4300	6503	SO:0001819	synonymous_variant	196463				lipid catabolic process	lysosomal lumen	hydrolase activity	g.chr12:113812724C>T	BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.771C>T	12.37:g.113812724C>T						PLBD2_uc001tvf.2_Silent_p.L257L	p.L257L	NM_173542	NP_775813	Q8NHP8	PLBL2_HUMAN			5	806	+			257					F5H5E2	Silent	SNP	ENST00000280800.3	37	c.771C>T	CCDS9168.1																																																																																				0.577	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404835.1	NM_173542		12	53	0	0	0	0.001855	0	12	53				
SNRNP35	11066	broad.mit.edu	37	12	123950105	123950105	+	Silent	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:123950105C>G	ENST00000526639.2	+	2	597	c.18C>G	c.(16-18)ccC>ccG	p.P6P	SNRNP35_ENST00000412157.2_Silent_p.P11P|SNRNP35_ENST00000350887.5_Silent_p.P6P|SNRNP35_ENST00000527158.2_Intron	NM_022717.3	NP_073208.1	Q16560	U1SBP_HUMAN	small nuclear ribonucleoprotein 35kDa (U11/U12)	6					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.P6P(1)		NS(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						ATTGGATGCCCATCGCCAAGG	0.517																																							uc001ufb.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(16-18)CCC>CCG		small nuclear ribonucleoprotein 35kDa (U11/U12)							64.0	56.0	59.0					12																	123950105		2203	4300	6503	SO:0001819	synonymous_variant	11066				mRNA processing	U12-type spliceosomal complex	nucleotide binding|RNA binding	g.chr12:123950105C>G	BC054034	CCDS9249.1, CCDS45005.1	12q24.31	2013-02-12				ENSG00000184209		"""RNA binding motif (RRM) containing"""	30852	protein-coding gene	gene with protein product	"""U1 snRNP binding protein homolog"""					10520751, 8889548	Standard	XM_005253545		Approved	U1SNRNPBP	uc001ufb.1	Q16560		ENST00000526639.2:c.18C>G	12.37:g.123950105C>G						SNRNP35_uc010tar.1_Silent_p.P11P|SNRNP35_uc009zxz.2_Silent_p.P11P|SNRNP35_uc001ufc.1_Intron	p.P6P	NM_022717	NP_073208	Q16560	U1SBP_HUMAN			2	134	+			6					A8K262|Q5XKN9	Silent	SNP	ENST00000526639.2	37	c.18C>G	CCDS9249.1																																																																																				0.517	SNRNP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395197.2	NM_007020		9	37	0	0	0	0.008291	0	9	37				
RIMBP2	23504	broad.mit.edu	37	12	130926762	130926762	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:130926762A>T	ENST00000261655.4	-	8	1247	c.1084T>A	c.(1084-1086)Tgc>Agc	p.C362S	RIMBP2_ENST00000536002.1_Missense_Mutation_p.C270S|RIMBP2_ENST00000535703.1_Missense_Mutation_p.C270S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	362	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.C362S(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CGGTAGGTGCAGGCTGCCATG	0.622																																							uc001uil.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11						c.(1084-1086)TGC>AGC		RIM-binding protein 2							178.0	169.0	172.0					12																	130926762		2203	4300	6503	SO:0001583	missense	23504					cell junction|synapse		g.chr12:130926762A>T	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1084T>A	12.37:g.130926762A>T	ENSP00000261655:p.Cys362Ser					RIMBP2_uc001uim.2_Missense_Mutation_p.C270S|RIMBP2_uc001uin.1_Missense_Mutation_p.C21S	p.C362S	NM_015347	NP_056162	O15034	RIMB2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)	8	1248	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	362			Fibronectin type-III 1.		Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	c.1084T>A	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	a	2.996	-0.207167	0.06180	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.50813	0.73;0.73;0.73	4.09	1.64	0.23874	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.228496	0.45606	D	0.000343	T	0.51635	0.1686	L	0.50919	1.6	0.30176	N	0.800833	B;B;D	0.63880	0.068;0.046;0.993	B;B;D	0.72338	0.014;0.029;0.977	T	0.50947	-0.8767	10	0.09338	T	0.73	-13.0645	6.8609	0.24066	0.7062:0.0:0.2938:0.0	.	270;270;362	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	S	362;270;270;270	ENSP00000261655:C362S;ENSP00000440347:C270S;ENSP00000439159:C270S	ENSP00000261655:C362S	C	-	1	0	RIMBP2	129492715	0.982000	0.34865	0.991000	0.47740	0.763000	0.43281	1.334000	0.33827	0.022000	0.15160	-0.493000	0.04662	TGC		0.622	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347		5	45	0	0	0	0.000602	0	5	45				
PARP4	143	broad.mit.edu	37	13	25060347	25060347	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr13:25060347C>A	ENST00000381989.3	-	11	1416	c.1311G>T	c.(1309-1311)ttG>ttT	p.L437F		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	437	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.L437F(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		GAGAACCATGCAACAAGGGCC	0.403																																							uc001upl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1309-1311)TTG>TTT		poly (ADP-ribose) polymerase family, member 4							110.0	98.0	102.0					13																	25060347		2203	4300	6503	SO:0001583	missense	143				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity	g.chr13:25060347C>A	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1311G>T	13.37:g.25060347C>A	ENSP00000371419:p.Leu437Phe					PARP4_uc010tdc.1_Missense_Mutation_p.L437F	p.L437F	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)	11	1417	-		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)	437			PARP catalytic.		O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	c.1311G>T	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	C	1.186	-0.636606	0.03557	.	.	ENSG00000102699	ENST00000381989	T	0.07908	3.15	4.56	-2.13	0.07144	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.368716	0.22695	N	0.056772	T	0.02688	0.0081	N	0.03281	-0.365	0.19775	N	0.99995	B	0.34161	0.439	B	0.39876	0.312	T	0.34725	-0.9817	10	0.20046	T	0.44	-5.7409	0.1541	0.00096	0.2649:0.2052:0.2602:0.2697	.	437	Q9UKK3	PARP4_HUMAN	F	437	ENSP00000371419:L437F	ENSP00000371419:L437F	L	-	3	2	PARP4	23958347	0.730000	0.28100	0.217000	0.23759	0.272000	0.26649	-0.371000	0.07513	-0.357000	0.08175	0.557000	0.71058	TTG		0.403	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437		13	64	1	0	7.03913e-09	0.013537	1.08665e-08	13	64				
CDK8	1024	broad.mit.edu	37	13	26974649	26974649	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr13:26974649G>T	ENST00000381527.3	+	10	1496	c.993G>T	c.(991-993)caG>caT	p.Q331H	CDK8_ENST00000536792.1_3'UTR|CDK8_ENST00000480323.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	331	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.Q331H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		AGGCTATGCAGGACCCCTATT	0.428																																							uc001uqr.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|large_intestine(1)|ovary(1)|skin(1)	5						c.(991-993)CAG>CAT		cyclin-dependent kinase 8							195.0	181.0	186.0					13																	26974649		2203	4300	6503	SO:0001583	missense	1024				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr13:26974649G>T	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.993G>T	13.37:g.26974649G>T	ENSP00000370938:p.Gln331His					CDK8_uc001uqs.1_Missense_Mutation_p.Q331H|CDK8_uc001uqt.1_Missense_Mutation_p.Q158H	p.Q331H	NM_001260	NP_001251	P49336	CDK8_HUMAN		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)	10	1019	+	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)	331			Protein kinase.		Q5VUF3|Q6ISB5	Missense_Mutation	SNP	ENST00000381527.3	37	c.993G>T	CCDS9317.1	.	.	.	.	.	.	.	.	.	.	G	34	5.371848	0.95923	.	.	ENSG00000132964	ENST00000381527	T	0.66638	-0.22	5.8	5.8	0.92144	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79155	0.4398	M	0.62266	1.93	0.80722	D	1	D;D	0.58970	0.98;0.984	P;P	0.59761	0.785;0.863	T	0.79754	-0.1670	10	0.72032	D	0.01	-10.3223	20.0479	0.97616	0.0:0.0:1.0:0.0	.	331;331	P49336-2;P49336	.;CDK8_HUMAN	H	331	ENSP00000370938:Q331H	ENSP00000370938:Q331H	Q	+	3	2	CDK8	25872649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.576000	0.82467	2.750000	0.94351	0.650000	0.86243	CAG		0.428	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044250.1			20	123	1	0	7.45023e-12	0.010504	1.29265e-11	20	123				
POSTN	10631	broad.mit.edu	37	13	38143960	38143960	+	Splice_Site	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr13:38143960T>C	ENST00000379747.4	-	20	2387		c.e20-2		POSTN_ENST00000379749.4_Splice_Site|POSTN_ENST00000541481.1_Splice_Site|POSTN_ENST00000497145.1_Splice_Site|POSTN_ENST00000541179.1_Splice_Site|POSTN_ENST00000379742.4_Splice_Site|POSTN_ENST00000379743.4_Splice_Site	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor						cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.?(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TTTCAGGACCTATGAGAAGGA	0.378																																							uc001uwo.3		NA																	1	Unknown(1)		lung(1)	ovary(2)	2						c.e20-1		periostin, osteoblast specific factor isoform 1							81.0	84.0	83.0					13																	38143960		2203	4300	6503	SO:0001630	splice_region_variant	10631				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding	g.chr13:38143960T>C	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.2270-2A>G	13.37:g.38143960T>C						POSTN_uc010tet.1_Splice_Site_p.G258_splice|POSTN_uc001uwp.3_Splice_Site_p.G700_splice|POSTN_uc001uwr.2_Splice_Site_p.G730_splice|POSTN_uc001uwq.2_Splice_Site_p.G700_splice|POSTN_uc010teu.1_Splice_Site_p.G730_splice|POSTN_uc010tev.1_Splice_Site_p.S670_splice|POSTN_uc010tew.1_Splice_Site_p.S670_splice	p.G757_splice	NM_006475	NP_006466	Q15063	POSTN_HUMAN		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)	20	2388	-		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)						B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Splice_Site	SNP	ENST00000379747.4	37	c.2270_splice	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	T	15.40	2.822731	0.50739	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.632	0.76917	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	POSTN	37041960	1.000000	0.71417	0.955000	0.39395	0.720000	0.41350	5.139000	0.64801	2.146000	0.66826	0.528000	0.53228	.		0.378	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	Intron	21	76	0	0	0	0.00278	0	21	76				
CCDC122	160857	broad.mit.edu	37	13	44411448	44411449	+	Missense_Mutation	DNP	CG	CG	TT	rs536074833		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr13:44411448_44411449CG>TT	ENST00000444614.3	-	7	1047_1048	c.789_790CG>AA	c.(787-792)gcCGaa>gcAAaa	p.E264K		NM_144974.3	NP_659411.2	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	264								p.E264K(1)		endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)		TTTCTTAATTCGGCTGCAGTTT	0.381																																							uc010acf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(787-792)GCCGAA>GCAAAA		coiled-coil domain containing 122																																				SO:0001583	missense	160857							g.chr13:44411448_44411449CG>TT	AK056408	CCDS9390.2	13q14.11	2008-10-30			ENSG00000151773	ENSG00000151773			26478	protein-coding gene	gene with protein product		613408					Standard	NM_144974		Approved	FLJ31846	uc010acf.3	Q5T0U0	OTTHUMG00000017413	ENST00000444614.3:c.789_790delinsTT	13.37:g.44411448_44411449delinsTT	ENSP00000407763:p.Glu264Lys						p.E264K	NM_144974	NP_659411	Q5T0U0	CC122_HUMAN		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)	7	1048_1049	-		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)	264			Potential.		B2RP70|B7ZMI9|Q96MV0	Missense_Mutation	DNP	ENST00000444614.3	37	c.789_790CG>AA	CCDS9390.2																																																																																				0.381	CCDC122-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276172.4	NM_144974		6	69	0	0	0	0.004672	0	6	69				
LACC1	144811	broad.mit.edu	37	13	44457980	44457980	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr13:44457980A>G	ENST00000441843.1	+	4	1300	c.815A>G	c.(814-816)cAg>cGg	p.Q272R	LACC1_ENST00000325686.6_Missense_Mutation_p.Q272R	NM_001128303.1	NP_001121775.1	Q8IV20	LACC1_HUMAN	laccase (multicopper oxidoreductase) domain containing 1	272								p.Q272R(1)									ACCACAAATCAGAGAGGAGTC	0.408																																							uc010acg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(814-816)CAG>CGG		hypothetical protein LOC144811							114.0	108.0	110.0					13																	44457980		2203	4300	6503	SO:0001583	missense	144811							g.chr13:44457980A>G	AK096044	CCDS9391.1	13q14.11	2012-05-11	2011-08-09	2011-08-09	ENSG00000179630	ENSG00000179630			26789	protein-coding gene	gene with protein product		613409	"""chromosome 13 open reading frame 31"""	C13orf31		16740638, 22504414	Standard	NM_153218		Approved	FLJ38725	uc010acg.3	Q8IV20	OTTHUMG00000016826	ENST00000441843.1:c.815A>G	13.37:g.44457980A>G	ENSP00000391747:p.Gln272Arg					C13orf31_uc001uzf.3_Missense_Mutation_p.Q272R	p.Q272R	NM_001128303	NP_001121775	Q8IV20	CM031_HUMAN		GBM - Glioblastoma multiforme(144;0.000573)|BRCA - Breast invasive adenocarcinoma(63;0.121)	4	1300	+		Lung NSC(96;0.000163)|all_hematologic(4;0.0127)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Breast(139;0.0364)|Lung SC(185;0.0367)|Acute lymphoblastic leukemia(4;0.138)	272					A2A3Z6|Q8N8X5	Missense_Mutation	SNP	ENST00000441843.1	37	c.815A>G	CCDS9391.1	.	.	.	.	.	.	.	.	.	.	A	12.08	1.830576	0.32329	.	.	ENSG00000179630	ENST00000441843;ENST00000325686	T;T	0.42513	0.97;0.97	5.59	5.59	0.84812	.	0.366441	0.32147	N	0.006507	T	0.34745	0.0908	L	0.33624	1.015	0.45621	D	0.998553	B	0.17038	0.02	B	0.20955	0.032	T	0.08554	-1.0716	10	0.33141	T	0.24	-21.4856	14.9416	0.70997	1.0:0.0:0.0:0.0	.	272	Q8IV20	LACC1_HUMAN	R	272	ENSP00000391747:Q272R;ENSP00000317619:Q272R	ENSP00000317619:Q272R	Q	+	2	0	LACC1	43355980	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.277000	0.72608	2.117000	0.64856	0.533000	0.62120	CAG		0.408	LACC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044726.3	NM_153218		19	82	0	0	0	0.012319	0	19	82				
CYSLTR2	57105	broad.mit.edu	37	13	49281193	49281193	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr13:49281193G>T	ENST00000282018.3	+	1	243	c.240G>T	c.(238-240)ctG>ctT	p.L80L		NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	80					immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell death (GO:0010942)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteinyl leukotriene receptor activity (GO:0001631)|leukotriene receptor activity (GO:0004974)	p.L80L(1)		endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	TGCTAAATCTGGCCATTTCAG	0.428																																							uc010acx.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)	2						c.(238-240)CTG>CTT		cysteinyl leukotriene receptor 2	Nedocromil(DB00716)						90.0	88.0	89.0					13																	49281193		2203	4300	6503	SO:0001819	synonymous_variant	57105				immune response	integral to membrane|plasma membrane		g.chr13:49281193G>T	AB038269	CCDS9412.1	13q14.2	2012-08-10			ENSG00000152207	ENSG00000152207		"""GPCR / Class A : Leukotriene receptors"""	18274	protein-coding gene	gene with protein product		605666				10913337, 1085123	Standard	NM_020377		Approved	CysLT(2), CYSLT2R	uc001vck.2	Q9NS75	OTTHUMG00000016906	ENST00000282018.3:c.240G>T	13.37:g.49281193G>T						CYSLTR2_uc010acy.1_Silent_p.L80L|CYSLTR2_uc010acz.1_Silent_p.L80L|CYSLTR2_uc010ada.1_Silent_p.L80L|CYSLTR2_uc010adb.1_Silent_p.L80L|CYSLTR2_uc010adc.1_Silent_p.L80L|CYSLTR2_uc010add.1_Silent_p.L80L|CYSLTR2_uc010acw.1_Silent_p.L80L|CYSLTR2_uc001vck.2_Silent_p.L80L	p.L80L	NM_020377	NP_065110	Q9NS75	CLTR2_HUMAN		GBM - Glioblastoma multiforme(99;1.19e-09)	6	923	+		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)	80			Helical; Name=2; (Potential).		Q9HCQ2	Silent	SNP	ENST00000282018.3	37	c.240G>T	CCDS9412.1																																																																																				0.428	CYSLTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044894.1			15	64	1	0	7.93312e-07	0.00245	1.09927e-06	15	64				
KLHL1	57626	broad.mit.edu	37	13	70281875	70281875	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr13:70281875C>A	ENST00000377844.4	-	10	2828	c.2069G>T	c.(2068-2070)aGa>aTa	p.R690I	KLHL1_ENST00000545028.1_Missense_Mutation_p.R497I	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	690					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.R690I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		AACAGCATCTCTGGGCATACT	0.413																																							uc001vip.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2068-2070)AGA>ATA		kelch-like 1 protein							130.0	109.0	116.0					13																	70281875		2203	4299	6502	SO:0001583	missense	57626				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr13:70281875C>A	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.2069G>T	13.37:g.70281875C>A	ENSP00000367075:p.Arg690Ile					KLHL1_uc010thm.1_Missense_Mutation_p.R629I	p.R690I	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)	10	2863	-		Breast(118;0.000162)	690			Kelch 5.		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	c.2069G>T	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	33	5.252491	0.95336	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	D;D	0.85171	-1.95;-1.95	5.43	5.43	0.79202	Galactose oxidase, beta-propeller (1);	0.000000	0.64402	D	0.000003	D	0.95620	0.8576	H	0.97440	4.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96855	0.9628	10	0.87932	D	0	.	19.6195	0.95650	0.0:1.0:0.0:0.0	.	690;690	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	I	690;497	ENSP00000367075:R690I;ENSP00000439602:R497I	ENSP00000367075:R690I	R	-	2	0	KLHL1	69179876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.556000	0.82233	2.710000	0.92621	0.650000	0.86243	AGA		0.413	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		20	64	1	0	1.33834e-09	0.007413	2.13084e-09	20	64				
TMCO3	55002	broad.mit.edu	37	13	114193696	114193696	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr13:114193696A>T	ENST00000434316.2	+	10	1923	c.1564A>T	c.(1564-1566)Atg>Ttg	p.M522L	TMCO3_ENST00000375391.1_Intron	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	522						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.M522L(1)		NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			GGACGTCTCCATGGAGCTGGG	0.642																																							uc001vtu.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1564-1566)ATG>TTG		transmembrane and coiled-coil domains 3							115.0	92.0	100.0					13																	114193696		2203	4300	6503	SO:0001583	missense	55002					integral to membrane	solute:hydrogen antiporter activity	g.chr13:114193696A>T	BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.1564A>T	13.37:g.114193696A>T	ENSP00000389399:p.Met522Leu						p.M522L	NM_017905	NP_060375	Q6UWJ1	TMCO3_HUMAN	all cancers(43;0.0317)		10	1925	+	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	522					Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Missense_Mutation	SNP	ENST00000434316.2	37	c.1564A>T	CCDS9537.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.288800	0.80914	.	.	ENSG00000150403	ENST00000434316	T	0.14893	2.47	4.53	4.53	0.55603	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.19087	0.0458	L	0.39326	1.205	0.80722	D	1	P	0.41498	0.752	B	0.43754	0.43	T	0.01966	-1.1238	10	0.38643	T	0.18	-28.489	14.2118	0.65769	1.0:0.0:0.0:0.0	.	522	Q6UWJ1	TMCO3_HUMAN	L	522	ENSP00000389399:M522L	ENSP00000389399:M522L	M	+	1	0	TMCO3	113241697	1.000000	0.71417	0.999000	0.59377	0.735000	0.41995	8.476000	0.90421	1.815000	0.52974	0.374000	0.22700	ATG		0.642	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045931.3	NM_017905		10	45	0	0	0	0.013537	0	10	45				
CHAMP1	283489	broad.mit.edu	37	13	115091623	115091623	+	Missense_Mutation	SNP	G	G	T	rs376247811		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr13:115091623G>T	ENST00000361283.1	+	3	2615	c.2306G>T	c.(2305-2307)cGt>cTt	p.R769L		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	769	Mediates localization to the chromosome and the spindle and negatively regulates chromosome alignment.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.R769L(1)									AAATGTCCACGTTGTAATTTT	0.363																																							uc010ahb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2305-2307)CGT>CTT		zinc finger protein 828		G	LEU/ARG,LEU/ARG,LEU/ARG	0,4406		0,0,2203	53.0	56.0	55.0		2306,2306,2306	5.0	1.0	13		55	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ZNF828	NM_001164144.1,NM_001164145.1,NM_032436.2	102,102,102	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	769/813,769/813,769/813	115091623	1,13005	2203	4300	6503	SO:0001583	missense	283489				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|protein localization to kinetochore|protein localization to microtubule|sister chromatid biorientation	condensed chromosome kinetochore|cytoplasm|nucleus|spindle	nucleic acid binding|protein binding|zinc ion binding	g.chr13:115091623G>T	AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.2306G>T	13.37:g.115091623G>T	ENSP00000354730:p.Arg769Leu					ZNF828_uc001vuv.2_Missense_Mutation_p.R769L|ZNF828_uc010tko.1_Missense_Mutation_p.R769L	p.R769L	NM_001164144	NP_001157616	Q96JM3	ZN828_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.104)	OV - Ovarian serous cystadenocarcinoma(48;0.193)|Epithelial(10;0.197)	3	2635	+	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_epithelial(44;0.122)|all_lung(25;0.123)	769			Mediates localization to the chromosome and the spindle and negatively regulates chromosome alignment.		B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	ENST00000361283.1	37	c.2306G>T	CCDS9545.1	.	.	.	.	.	.	.	.	.	.	g	16.71	3.199561	0.58126	0.0	1.16E-4	ENSG00000198824	ENST00000361283	T	0.38887	1.11	5.81	4.96	0.65561	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000010	T	0.37652	0.1011	N	0.19112	0.55	0.39180	D	0.962769	P	0.51933	0.949	P	0.52309	0.695	T	0.09796	-1.0658	9	.	.	.	-7.5168	12.5339	0.56131	0.1313:0.0:0.8687:0.0	.	769	Q96JM3	ZN828_HUMAN	L	769	ENSP00000354730:R769L	.	R	+	2	0	ZNF828	114109725	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.691000	0.47010	2.746000	0.94184	0.655000	0.94253	CGT		0.363	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045977.2	NM_032436		15	58	1	0	1.5739e-10	0.004007	2.58705e-10	15	58				
OR4K15	81127	broad.mit.edu	37	14	20443947	20443947	+	Silent	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr14:20443947G>C	ENST00000305051.5	+	1	345	c.270G>C	c.(268-270)ctG>ctC	p.L90L		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L90L(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTGCAAACCTGTCATTTATAG	0.453																																							uc010tkx.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(268-270)CTG>CTC		olfactory receptor, family 4, subfamily K,							95.0	107.0	103.0					14																	20443947		2203	4298	6501	SO:0001819	synonymous_variant	81127				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20443947G>C		CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.270G>C	14.37:g.20443947G>C							p.L90L	NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	270	+	all_cancers(95;0.00108)		90			Helical; Name=2; (Potential).		B9EIL3|Q6IEZ4	Silent	SNP	ENST00000305051.5	37	c.270G>C	CCDS32026.1																																																																																				0.453	OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409883.1			19	114	0	0	0	0.00278	0	19	114				
IPO4	79711	broad.mit.edu	37	14	24648811	24648811	+	IGR	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr14:24648811G>A	ENST00000354464.6	-	0	3646				REC8_ENST00000559939.1_3'UTR|REC8_ENST00000311457.3_Missense_Mutation_p.E443K|REC8_ENST00000559919.1_Missense_Mutation_p.E443K	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4						DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)		p.E443K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		GGCCTGGCCTGAGGTGGAGGC	0.622																																						NSCLC(139;1764 2537 12868 49041)	uc001wmr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1330-1332)GAG>AAG		REC8 homolog							66.0	76.0	73.0					14																	24648811		2135	4227	6362	SO:0001628	intergenic_variant	9985				mitotic metaphase/anaphase transition|mitotic prometaphase|reciprocal meiotic recombination|sister chromatid cohesion	nucleoplasm		g.chr14:24648811G>A	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801		14.37:g.24648811G>A						REC8_uc001wms.2_Missense_Mutation_p.E444K	p.E444K	NM_005132	NP_005123	O95072	REC8_HUMAN		GBM - Glioblastoma multiforme(265;0.00839)	19	1757	+			444			Glu-rich.		B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	ENST00000354464.6	37	c.1330G>A	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282865	0.59867	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	T	0.29142	1.58	5.53	5.53	0.82687	.	0.639694	0.15054	N	0.283106	T	0.42359	0.1199	L	0.32530	0.975	0.32585	N	0.527922	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.991	T	0.11616	-1.0580	10	0.07325	T	0.83	-5.2462	16.4307	0.83841	0.0:0.0:1.0:0.0	.	427;444	O95072-2;O95072	.;REC8_HUMAN	K	443;426	ENSP00000308699:E443K	ENSP00000308699:E443K	E	+	1	0	REC8	23718651	0.994000	0.37717	0.768000	0.31515	0.014000	0.08584	3.529000	0.53532	2.627000	0.88993	0.456000	0.33151	GAG		0.622	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658		9	46	0	0	0	0.008291	0	9	46				
LRFN5	145581	broad.mit.edu	37	14	42356224	42356224	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr14:42356224C>A	ENST00000298119.4	+	3	1585	c.396C>A	c.(394-396)aaC>aaA	p.N132K	LRFN5_ENST00000554171.1_Missense_Mutation_p.N132K|LRFN5_ENST00000554120.1_Missense_Mutation_p.N132K	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	132						integral component of membrane (GO:0016021)		p.N132K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TACTGAACAACAATCAGCTGA	0.373										HNSCC(30;0.082)																													uc001wvm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(394-396)AAC>AAA		leucine rich repeat and fibronectin type III							92.0	87.0	88.0					14																	42356224		2203	4300	6503	SO:0001583	missense	145581					integral to membrane		g.chr14:42356224C>A	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.396C>A	14.37:g.42356224C>A	ENSP00000298119:p.Asn132Lys	HNSCC(30;0.082)				LRFN5_uc010ana.2_Missense_Mutation_p.N132K	p.N132K	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	3	1594	+			132			Extracellular (Potential).|LRR 4.		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	c.396C>A	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990476	0.54041	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.55052	0.54;0.54;0.54	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000007	T	0.69450	0.3112	L	0.60012	1.86	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.995;0.996	T	0.67925	-0.5544	10	0.44086	T	0.13	.	17.0193	0.86429	0.0:1.0:0.0:0.0	.	132;132	G3V364;Q96NI6	.;LRFN5_HUMAN	K	132	ENSP00000298119:N132K;ENSP00000451897:N132K;ENSP00000451067:N132K	ENSP00000298119:N132K	N	+	3	2	LRFN5	41425974	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.094000	0.57721	2.595000	0.87683	0.650000	0.86243	AAC		0.373	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		6	64	1	0	8.12818e-05	0.001984	9.76344e-05	6	64				
MDGA2	161357	broad.mit.edu	37	14	47530708	47530708	+	Silent	SNP	C	C	T	rs373885586		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr14:47530708C>T	ENST00000399232.2	-	7	1426	c.1062G>A	c.(1060-1062)gaG>gaA	p.E354E	MDGA2_ENST00000439988.3_Silent_p.E423E|MDGA2_ENST00000426342.1_Silent_p.E125E|MDGA2_ENST00000357362.3_Silent_p.E125E	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	354	Ig-like 4.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.E125E(2)|p.E423E(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						ATATTTTCACCTCACGGCCAA	0.388													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17655	0.0		0.0	False		,,,				2504	0.0						uc001wwj.3		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(4)|large_intestine(1)|pancreas(1)	6						c.(1060-1062)GAG>GAA		MAM domain containing 1 isoform 1		C	,	1,3753		0,1,1876	84.0	77.0	79.0		1269,375	4.2	1.0	14		79	0,8192		0,0,4096	no	coding-synonymous,coding-synonymous	MDGA2	NM_001113498.2,NM_182830.3	,	0,1,5972	TT,TC,CC		0.0,0.0266,0.0084	,	423/1026,125/728	47530708	1,11945	1877	4096	5973	SO:0001819	synonymous_variant	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47530708C>T	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1062G>A	14.37:g.47530708C>T						MDGA2_uc001wwi.3_Silent_p.E125E|MDGA2_uc010ani.2_5'UTR	p.E354E	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN			7	1258	-			354			Ig-like 4.		F6W3S7|J3KPX6	Silent	SNP	ENST00000399232.2	37	c.1062G>A		.	.	.	.	.	.	.	.	.	.	C	7.933	0.741022	0.15642	2.66E-4	0.0	ENSG00000139915	ENST00000554762	.	.	.	5.96	4.16	0.48862	.	.	.	.	.	T	0.62913	0.2467	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59721	-0.7401	4	.	.	.	.	11.782	0.52020	0.0:0.8574:0.0:0.1426	.	.	.	.	S	129	.	.	G	-	1	0	MDGA2	46600458	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.685000	0.46959	0.868000	0.35678	-0.126000	0.14955	GGT		0.388	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		9	57	0	0	0	0.004482	0	9	57				
KIAA0586	9786	broad.mit.edu	37	14	58941420	58941420	+	Silent	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr14:58941420A>G	ENST00000556134.1	+	20	2959	c.2685A>G	c.(2683-2685)ccA>ccG	p.P895P	KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000423743.3_Silent_p.P866P|KIAA0586_ENST00000261244.5_Silent_p.P834P|KIAA0586_ENST00000354386.6_Silent_p.P963P	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	895					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.P963P(1)|p.P834P(1)		endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ATGGTCCTCCATTTCCGCCAG	0.363																																							uc001xdv.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2500-2502)CCA>CCG		talpid3 protein							68.0	66.0	66.0					14																	58941420		1820	4078	5898	SO:0001819	synonymous_variant	9786							g.chr14:58941420A>G	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2685A>G	14.37:g.58941420A>G						KIAA0586_uc010trr.1_Silent_p.P951P|KIAA0586_uc001xdt.3_Silent_p.P866P|KIAA0586_uc001xdu.3_Silent_p.P895P|KIAA0586_uc010trs.1_Silent_p.P825P|KIAA0586_uc010trt.1_Silent_p.P770P|KIAA0586_uc010tru.1_Silent_p.P770P	p.P834P	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN			18	2775	+			834					B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Silent	SNP	ENST00000556134.1	37	c.2502A>G	CCDS58321.1																																																																																				0.363	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749		9	40	0	0	0	0.008291	0	9	40				
PCNX	22990	broad.mit.edu	37	14	71576295	71576295	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr14:71576295G>T	ENST00000304743.2	+	35	7317	c.6871G>T	c.(6871-6873)Ggc>Tgc	p.G2291C	PCNX_ENST00000439984.3_Missense_Mutation_p.G2180C|PCNX_ENST00000556272.1_3'UTR|PCNX_ENST00000238570.5_Missense_Mutation_p.G2219C	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	2291						integral component of membrane (GO:0016021)		p.G2291C(1)		NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TCCGCAGGAGGGCATGGAAGG	0.483																																							uc001xmo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(6871-6873)GGC>TGC		pecanex-like 1							67.0	78.0	74.0					14																	71576295		2203	4300	6503	SO:0001583	missense	22990					integral to membrane		g.chr14:71576295G>T	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.6871G>T	14.37:g.71576295G>T	ENSP00000304192:p.Gly2291Cys					PCNX_uc010are.1_Missense_Mutation_p.G2180C|PCNX_uc010arf.1_Missense_Mutation_p.G1079C|PCNX_uc001xmp.2_Missense_Mutation_p.G375C	p.G2291C	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)	35	7317	+			2291					B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	c.6871G>T	CCDS9806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.260977|4.260977	0.80246|0.80246	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984;ENST00000555780|ENST00000554691	T;T;T|.	0.48522|.	1.04;1.2;0.81|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.81973|0.81973	0.4936|0.4936	M|M	0.79123|0.79123	2.44|2.44	0.54753|0.54753	D|D	0.999981|0.999981	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|T	0.79962|0.79962	-0.1582|-0.1582	10|5	0.87932|.	D|.	0|.	.|.	20.8598|20.8598	0.99761|0.99761	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2219;2180;2291|.	Q96RV3-3;B2RTR6;Q96RV3|.	.;.;PCX1_HUMAN|.	C|S	2291;2219;2180;52|1277	ENSP00000304192:G2291C;ENSP00000238570:G2219C;ENSP00000396617:G2180C|.	ENSP00000238570:G2219C|.	G|R	+|+	1|3	0|2	PCNX|PCNX	70646048|70646048	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.260000|9.260000	0.95568|0.95568	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GGC|AGG		0.483	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982		5	26	1	0	2.7689e-08	0.001984	4.1636e-08	5	26				
OR4N4	283694	broad.mit.edu	37	15	22383396	22383396	+	Nonsense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr15:22383396T>A	ENST00000328795.4	+	1	1015	c.924T>A	c.(922-924)tgT>tgA	p.C308*	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C308*(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ATGTAGTCTGTCAAGTGGATT	0.373																																							uc001yuc.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(1)	5						c.(922-924)TGT>TGA		olfactory receptor, family 4, subfamily N,							43.0	41.0	42.0					15																	22383396		2167	4240	6407	SO:0001587	stop_gained	283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22383396T>A	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.924T>A	15.37:g.22383396T>A	ENSP00000332500:p.Cys308*					LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Nonsense_Mutation_p.C308*	p.C308*	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	7	1905	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	308			Cytoplasmic (Potential).		Q6IEY3|Q6IF56	Nonsense_Mutation	SNP	ENST00000328795.4	37	c.924T>A	CCDS32173.1	.	.	.	.	.	.	.	.	.	.	.	14.18	2.458385	0.43634	.	.	ENSG00000183706	ENST00000328795	.	.	.	3.18	-4.94	0.03057	.	.	.	.	.	.	.	.	.	.	.	0.26533	N	0.97421	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-1.978	0.8127	0.01096	0.1682:0.1932:0.1689:0.4698	.	.	.	.	X	308	.	ENSP00000332500:C308X	C	+	3	2	OR4N4	19884760	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	-2.375000	0.01071	-0.835000	0.04234	0.328000	0.21473	TGT		0.373	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			12	62	0	0	0	0.010729	0	12	62				
OR4N3P	390539	broad.mit.edu	37	15	22413842	22413842	+	IGR	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr15:22413842C>A								RP11-69H14.6 (30034 upstream) : RP11-2F9.4 (20047 downstream)																							TCACCATCTGCCTGCCTCTGC	0.507																																							uc001yuf.2		NA																	0					0						c.(139-141)TGC>TGA		RecName: Full=Olfactory receptor 4N2; AltName: Full=Olfactory receptor OR14-8; AltName: Full=Olfactory receptor OR14-13;																																				SO:0001628	intergenic_variant	390539							g.chr15:22413842C>A																													15.37:g.22413842C>A							p.C47*	NM_001080841	NP_001074310					1	141	+									Nonsense_Mutation	SNP		37	c.141C>A																																																																																				0	0.507									8	195	1	0	0.00448238	0.004482	0.00499958	8	195				
NPAP1	23742	broad.mit.edu	37	15	24923779	24923779	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr15:24923779C>G	ENST00000329468.2	+	1	3239	c.2765C>G	c.(2764-2766)cCa>cGa	p.P922R		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	922					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P922R(1)									CCAGCAACCCCAGCACCAGTT	0.468																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(2764-2766)CCA>CGA		hypothetical protein LOC23742							98.0	103.0	101.0					15																	24923779		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24923779C>G	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2765C>G	15.37:g.24923779C>G	ENSP00000333735:p.Pro922Arg						p.P922R	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	3239	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	922						Missense_Mutation	SNP	ENST00000329468.2	37	c.2765C>G	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	13.61	2.288626	0.40494	.	.	ENSG00000185823	ENST00000329468	T	0.12147	2.71	2.32	-0.879	0.10613	.	0.819406	0.10057	N	0.721418	T	0.08980	0.0222	L	0.38175	1.15	0.09310	N	1	P	0.39094	0.659	B	0.40134	0.32	T	0.29941	-0.9995	10	0.15499	T	0.54	.	2.8286	0.05492	0.0:0.4316:0.2476:0.3208	.	922	Q9NZP6	CO002_HUMAN	R	922	ENSP00000333735:P922R	ENSP00000333735:P922R	P	+	2	0	C15orf2	22474872	0.000000	0.05858	0.001000	0.08648	0.644000	0.38419	-1.395000	0.02516	-0.206000	0.10203	0.313000	0.20887	CCA		0.468	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		8	104	0	0	0	0.00308	0	8	104				
LPCAT4	254531	broad.mit.edu	37	15	34652348	34652348	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr15:34652348G>T	ENST00000314891.6	-	12	1383	c.1206C>A	c.(1204-1206)ggC>ggA	p.G402G		NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	402					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)	p.G402G(1)		NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						CCAGGCTCCTGCCCCCATCCA	0.602																																							uc001zig.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1204-1206)GGC>GGA		lysophosphatidylcholine acyltransferase 4							110.0	107.0	108.0					15																	34652348		2201	4298	6499	SO:0001819	synonymous_variant	254531				phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding	g.chr15:34652348G>T	AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.1206C>A	15.37:g.34652348G>T							p.G402G	NM_153613	NP_705841	Q643R3	LPCT4_HUMAN			12	1300	-			402					A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Silent	SNP	ENST00000314891.6	37	c.1206C>A	CCDS32191.1																																																																																				0.602	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418028.2	NM_153613		4	81	1	0	0.000602214	0.000602	0.000696578	4	81				
PAK6	56924	broad.mit.edu	37	15	40568142	40568142	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr15:40568142G>T	ENST00000542403.2	+	9	2004	c.1893G>T	c.(1891-1893)ctG>ctT	p.L631L	PAK6_ENST00000260404.4_Silent_p.L631L|PAK6_ENST00000560346.1_Silent_p.L631L|PAK6_ENST00000453867.1_Silent_p.L631L|PAK6_ENST00000441369.1_Silent_p.L631L|PAK6_ENST00000455577.2_Silent_p.L586L|RP11-133K1.2_ENST00000558658.1_3'UTR	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	631	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		CCCCAGTGCTGCGAGACTTCC	0.577																																							uc010bbl.2		NA																	0				lung(5)|large_intestine(1)|ovary(1)|skin(1)	8						c.(1891-1893)CTG>CTT		p21-activated kinase 6							92.0	91.0	91.0					15																	40568142		2203	4300	6503	SO:0001819	synonymous_variant	56924						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr15:40568142G>T	AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.1893G>T	15.37:g.40568142G>T						PAK6_uc010bbm.2_Silent_p.L631L|PAK6_uc001zky.3_Silent_p.L586L|PAK6_uc010bbn.2_Silent_p.L631L|PAK6_uc001zlb.2_Silent_p.L631L	p.L631L	NM_001128628	NP_001122100	Q9NQU5	PAK6_HUMAN		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)	11	2333	+		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)	631			Protein kinase.		A8K2G2|B3KYB0|G5E9R2	Silent	SNP	ENST00000542403.2	37	c.1893G>T	CCDS10054.1																																																																																				0.577	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1			6	70	1	0	3.59834e-05	0.001168	4.49515e-05	6	70				
MAPKBP1	23005	broad.mit.edu	37	15	42107526	42107526	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr15:42107526G>T	ENST00000456763.2	+	12	1454	c.1258G>T	c.(1258-1260)Gac>Tac	p.D420Y	MAPKBP1_ENST00000221214.6_Missense_Mutation_p.D297Y|MAPKBP1_ENST00000260357.7_Intron|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.D414Y|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.D414Y	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	420								p.D414Y(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CTGCTCCTCAGACAACACCAT	0.597																																							uc001zok.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10						c.(1258-1260)GAC>TAC		mitogen-activated protein kinase binding protein							87.0	81.0	83.0					15																	42107526		2203	4300	6503	SO:0001583	missense	23005							g.chr15:42107526G>T	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1258G>T	15.37:g.42107526G>T	ENSP00000393099:p.Asp420Tyr					MAPKBP1_uc001zoj.3_Missense_Mutation_p.D414Y|MAPKBP1_uc010bcj.2_5'UTR|MAPKBP1_uc010bci.2_Missense_Mutation_p.D414Y|MAPKBP1_uc010udb.1_Intron|MAPKBP1_uc010bck.2_5'UTR|MAPKBP1_uc010bcl.2_5'UTR	p.D420Y	NM_001128608	NP_001122080	O60336	MABP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)	12	1544	+		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)	420			WD 6.		A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	c.1258G>T	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	g	26.7	4.761589	0.89932	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000456763;ENST00000514566	D;T;D;D	0.89415	-2.51;0.92;-2.51;-2.51	5.72	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.95023	0.8389	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95411	0.8498	10	0.66056	D	0.02	-22.2532	16.807	0.85708	0.0:0.1282:0.8718:0.0	.	414;420;414	O60336-2;O60336;O60336-6	.;MABP1_HUMAN;.	Y	414;297;420;414	ENSP00000397570:D414Y;ENSP00000221214:D297Y;ENSP00000393099:D420Y;ENSP00000426154:D414Y	ENSP00000221214:D297Y	D	+	1	0	MAPKBP1	39894818	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.686000	0.98664	2.694000	0.91930	0.556000	0.70494	GAC		0.597	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994		9	34	1	0	1.76689e-08	0.006214	2.66676e-08	9	34				
TLN2	83660	broad.mit.edu	37	15	63132786	63132786	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr15:63132786G>A	ENST00000561311.1	+	58	7836	c.7606G>A	c.(7606-7608)Gag>Aag	p.E2536K	RP11-1069G10.1_ENST00000560963.1_RNA|TLN2_ENST00000306829.6_Missense_Mutation_p.E2536K|RP11-1069G10.1_ENST00000557994.1_RNA|RP11-1069G10.1_ENST00000558404.1_RNA			Q9Y4G6	TLN2_HUMAN	talin 2	2536					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.E2536K(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TTTACCCACCGAGCTGAGGGA	0.562																																							uc002alb.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						c.(7606-7608)GAG>AAG		talin 2							50.0	54.0	53.0					15																	63132786		2203	4300	6503	SO:0001583	missense	83660				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	g.chr15:63132786G>A	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.7606G>A	15.37:g.63132786G>A	ENSP00000453508:p.Glu2536Lys					TLN2_uc002alc.3_Missense_Mutation_p.E929K|TLN2_uc010uic.1_Missense_Mutation_p.E152K	p.E2536K	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN			56	7606	+			2536					A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	c.7606G>A	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026436	0.75390	.	.	ENSG00000171914	ENST00000306829	T	0.70045	-0.45	5.58	5.58	0.84498	I/LWEQ (1);	0.051329	0.85682	D	0.000000	T	0.56949	0.2020	L	0.38531	1.155	0.51767	D	0.999938	P;P	0.43788	0.817;0.802	B;B	0.35859	0.206;0.212	T	0.57441	-0.7811	10	0.30854	T	0.27	-32.6437	19.5697	0.95407	0.0:0.0:1.0:0.0	.	152;2536	B4DGF3;Q9Y4G6	.;TLN2_HUMAN	K	2536	ENSP00000303476:E2536K	ENSP00000303476:E2536K	E	+	1	0	TLN2	60919839	1.000000	0.71417	0.952000	0.39060	0.093000	0.18481	9.813000	0.99286	2.634000	0.89283	0.650000	0.86243	GAG		0.562	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2			4	19	0	0	0	0.009096	0	4	19				
CILP	8483	broad.mit.edu	37	15	65489472	65489472	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr15:65489472G>A	ENST00000261883.4	-	9	3318	c.3152C>T	c.(3151-3153)cCa>cTa	p.P1051L		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	1051					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.P1051L(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GACTGCAAGTGGCAAGTGGTT	0.592																																							uc002aon.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(2)|skin(1)	7						c.(3151-3153)CCA>CTA		cartilage intermediate layer protein							169.0	100.0	124.0					15																	65489472		2202	4299	6501	SO:0001583	missense	8483				negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix		g.chr15:65489472G>A	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.3152C>T	15.37:g.65489472G>A	ENSP00000261883:p.Pro1051Leu						p.P1051L	NM_003613	NP_003604	O75339	CILP1_HUMAN			9	3333	-			1051					B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	c.3152C>T	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.819874	0.71028	.	.	ENSG00000138615	ENST00000261883	T	0.49139	0.79	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.71230	0.3315	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.74487	-0.3649	10	0.87932	D	0	-22.8775	18.4803	0.90809	0.0:0.0:1.0:0.0	.	1051	O75339	CILP1_HUMAN	L	1051	ENSP00000261883:P1051L	ENSP00000261883:P1051L	P	-	2	0	CILP	63276525	1.000000	0.71417	0.975000	0.42487	0.894000	0.52154	9.864000	0.99589	2.601000	0.87937	0.655000	0.94253	CCA		0.592	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613		7	54	0	0	0	0.001984	0	7	54				
XYLT1	64131	broad.mit.edu	37	16	17235204	17235204	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:17235204C>A	ENST00000261381.6	-	7	1477	c.1393G>T	c.(1393-1395)Gat>Tat	p.D465Y	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	465					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.D465Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AAGAGCCGATCCAGGCCCTGC	0.587																																							uc002dfa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1393-1395)GAT>TAT		xylosyltransferase I							52.0	51.0	52.0					16																	17235204		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17235204C>A	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1393G>T	16.37:g.17235204C>A	ENSP00000261381:p.Asp465Tyr						p.D465Y	NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN			7	1478	-			465			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.1393G>T	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159393	0.94686	.	.	ENSG00000103489	ENST00000261381	T	0.12672	2.66	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.35189	0.0923	L	0.49513	1.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00832	-1.1548	10	0.72032	D	0.01	-50.7516	19.2967	0.94126	0.0:1.0:0.0:0.0	.	465	Q86Y38	XYLT1_HUMAN	Y	465	ENSP00000261381:D465Y	ENSP00000261381:D465Y	D	-	1	0	XYLT1	17142705	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.814000	0.86154	2.797000	0.96272	0.555000	0.69702	GAT		0.587	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		12	46	1	0	0.00185496	0.001855	0.00210956	12	46				
XYLT1	64131	broad.mit.edu	37	16	17294435	17294435	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:17294435A>C	ENST00000261381.6	-	4	1074	c.990T>G	c.(988-990)ttT>ttG	p.F330L		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	330					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)	p.F330L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCACCAGGACAAAGGCGATTC	0.552																																							uc002dfa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(988-990)TTT>TTG		xylosyltransferase I							248.0	208.0	222.0					16																	17294435		2197	4300	6497	SO:0001583	missense	64131				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity	g.chr16:17294435A>C	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.990T>G	16.37:g.17294435A>C	ENSP00000261381:p.Phe330Leu						p.F330L	NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN			4	1075	-			330			Lumenal (Potential).		Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	c.990T>G	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.464239	0.84425	.	.	ENSG00000103489	ENST00000261381	T	0.27720	1.65	5.33	0.12	0.14691	.	0.046664	0.85682	D	0.000000	T	0.50718	0.1632	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.50389	-0.8834	10	0.87932	D	0	-23.0077	8.0555	0.30602	0.7356:0.0:0.2644:0.0	.	330	Q86Y38	XYLT1_HUMAN	L	330	ENSP00000261381:F330L	ENSP00000261381:F330L	F	-	3	2	XYLT1	17201936	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	0.655000	0.24933	0.128000	0.18479	-0.408000	0.06270	TTT		0.552	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166		22	132	0	0	0	0.014323	0	22	132				
THUMPD1	55623	broad.mit.edu	37	16	20748556	20748556	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:20748556C>A	ENST00000381337.2	-	4	1052	c.708G>T	c.(706-708)caG>caT	p.Q236H	THUMPD1_ENST00000396083.2_Missense_Mutation_p.Q236H|THUMPD1_ENST00000431224.2_Missense_Mutation_p.Q322H	NM_017736.3	NP_060206.2	Q9NXG2	THUM1_HUMAN	THUMP domain containing 1	236	THUMP. {ECO:0000255|PROSITE- ProRule:PRU00529}.						poly(A) RNA binding (GO:0044822)	p.Q236H(1)		NS(2)|large_intestine(2)|lung(6)|pancreas(1)|urinary_tract(1)	12						CCACTGTGTACTGTGGATTGG	0.388																																							uc002dho.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(706-708)CAG>CAT		THUMP domain containing 1							88.0	81.0	83.0					16																	20748556		2201	4300	6501	SO:0001583	missense	55623							g.chr16:20748556C>A	BC000448	CCDS10588.1	16p13.11	2010-06-17			ENSG00000066654	ENSG00000066654			23807	protein-coding gene	gene with protein product							Standard	XM_005255422		Approved	FLJ20274	uc002dho.3	Q9NXG2	OTTHUMG00000131558	ENST00000381337.2:c.708G>T	16.37:g.20748556C>A	ENSP00000370741:p.Gln236His					THUMPD1_uc010vaz.1_Missense_Mutation_p.Q89H|THUMPD1_uc002dhp.2_Missense_Mutation_p.Q236H	p.Q236H	NM_017736	NP_060206	Q9NXG2	THUM1_HUMAN			4	846	-			236			THUMP.		Q9BWC3	Missense_Mutation	SNP	ENST00000381337.2	37	c.708G>T	CCDS10588.1	.	.	.	.	.	.	.	.	.	.	C	19.65	3.867943	0.72065	.	.	ENSG00000066654	ENST00000381337;ENST00000431224;ENST00000396083	T;T;T	0.46819	0.9;0.86;0.9	5.82	0.48	0.16804	THUMP (3);	0.113730	0.64402	D	0.000018	T	0.50309	0.1608	L	0.45581	1.43	0.37356	D	0.911011	P	0.48911	0.917	P	0.54759	0.76	T	0.55309	-0.8161	10	0.56958	D	0.05	.	10.5714	0.45202	0.0:0.531:0.0:0.469	.	236	Q9NXG2	THUM1_HUMAN	H	236;322;236	ENSP00000370741:Q236H;ENSP00000392282:Q322H;ENSP00000379392:Q236H	ENSP00000370741:Q236H	Q	-	3	2	THUMPD1	20656057	0.997000	0.39634	0.998000	0.56505	0.985000	0.73830	0.505000	0.22642	0.104000	0.17725	-0.333000	0.08304	CAG		0.388	THUMPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254420.1	NM_017736		13	81	1	0	4.3838e-07	0.001855	6.31143e-07	13	81				
SPNS1	83985	broad.mit.edu	37	16	28990742	28990742	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:28990742G>T	ENST00000311008.11	+	5	990	c.613G>T	c.(613-615)Gca>Tca	p.A205S	RP11-264B17.4_ENST00000567209.1_RNA|SPNS1_ENST00000323081.8_Missense_Mutation_p.A132S|SPNS1_ENST00000561868.1_3'UTR|RP11-264B17.3_ENST00000569969.1_RNA|SPNS1_ENST00000565975.1_Missense_Mutation_p.A250S|SPNS1_ENST00000334536.8_Missense_Mutation_p.A205S|SPNS1_ENST00000352260.7_Missense_Mutation_p.A183S	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)	205					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)		p.A205S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						GGGCTACATTGCAGGCTCCAA	0.617																																							uc010vdi.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(613-615)GCA>TCA		spinster homolog 1 isoform 1							89.0	83.0	85.0					16																	28990742		2197	4300	6497	SO:0001583	missense	83985				lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding	g.chr16:28990742G>T	BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.613G>T	16.37:g.28990742G>T	ENSP00000309945:p.Ala205Ser					uc010vct.1_Intron|SPNS1_uc002dry.2_Missense_Mutation_p.A205S|SPNS1_uc002drx.2_Missense_Mutation_p.A132S|SPNS1_uc002dsa.2_Missense_Mutation_p.A205S|SPNS1_uc002drz.2_Missense_Mutation_p.A205S|SPNS1_uc010byp.2_Missense_Mutation_p.A183S|SPNS1_uc010byq.1_Missense_Mutation_p.A132S	p.A205S	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN			6	753	+			205			Helical; (Potential).		B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Missense_Mutation	SNP	ENST00000311008.11	37	c.613G>T	CCDS10646.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917520	0.52546	.	.	ENSG00000169682	ENST00000311008;ENST00000334536;ENST00000352260;ENST00000323081	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	4.49	4.49	0.54785	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.139306	0.47455	D	0.000221	T	0.38983	0.1061	N	0.12569	0.235	0.42449	D	0.992743	B;B;B;P;B	0.44521	0.041;0.01;0.03;0.837;0.041	B;B;B;B;B	0.38755	0.022;0.022;0.038;0.281;0.036	T	0.44651	-0.9314	10	0.44086	T	0.13	.	14.7147	0.69259	0.0:0.0:1.0:0.0	.	132;183;205;205;205	Q9H2V7-4;Q9H2V7-3;Q9H2V7;Q9H2V7-2;Q9H2V7-5	.;.;SPNS1_HUMAN;.;.	S	205;205;183;132	ENSP00000309945:A205S;ENSP00000335494:A205S;ENSP00000306050:A183S;ENSP00000318228:A132S	ENSP00000309945:A205S	A	+	1	0	SPNS1	28898243	0.845000	0.29573	1.000000	0.80357	0.981000	0.71138	1.807000	0.38902	2.339000	0.79563	0.561000	0.74099	GCA		0.617	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254690.2	NM_032038		16	72	1	0	1.33834e-09	0.007413	2.13084e-09	16	72				
CORO1A	11151	broad.mit.edu	37	16	30198005	30198005	+	Silent	SNP	C	C	T	rs184262856		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:30198005C>T	ENST00000219150.5	+	3	590	c.285C>T	c.(283-285)aaC>aaT	p.N95N	RP11-455F5.5_ENST00000567153.1_RNA|CORO1A_ENST00000570045.1_Silent_p.N95N|RP11-455F5.5_ENST00000566144.1_RNA|CORO1A_ENST00000565497.1_Silent_p.N95N|RP11-455F5.5_ENST00000568506.1_RNA	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	95					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.N95N(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						ACAATGACAACGTCATTGCCA	0.602													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18165	0.0		0.0	False		,,,				2504	0.0						uc002dww.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(283-285)AAC>AAT		coronin, actin binding protein, 1A							58.0	43.0	48.0					16																	30198005		2197	4300	6497	SO:0001819	synonymous_variant	11151				cell-substrate adhesion|innate immune response|leukocyte chemotaxis|negative regulation of actin nucleation|phagolysosome assembly|positive chemotaxis|regulation of cell shape|uropod organization	actin filament|cortical actin cytoskeleton|lamellipodium|phagocytic cup|phagocytic vesicle membrane	actin filament binding|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein homodimerization activity	g.chr16:30198005C>T	X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.285C>T	16.37:g.30198005C>T						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|CORO1A_uc010vej.1_Silent_p.N95N|CORO1A_uc010bzq.2_Silent_p.N95N|CORO1A_uc010bzr.2_Silent_p.N95N|CORO1A_uc002dwx.2_Translation_Start_Site|CORO1A_uc002dwy.1_Translation_Start_Site|LOC606724_uc002dwz.1_5'Flank	p.N95N	NM_007074	NP_009005	P31146	COR1A_HUMAN			3	407	+			95			WD 2.		B2RBL1|Q2YD73	Silent	SNP	ENST00000219150.5	37	c.285C>T	CCDS10673.1																																																																																				0.602	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255195.2	NM_007074		5	16	0	0	0	0.000602	0	5	16				
RNF40	9810	broad.mit.edu	37	16	30776605	30776605	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:30776605G>C	ENST00000324685.6	+	7	1310	c.875G>C	c.(874-876)cGa>cCa	p.R292P	RNF40_ENST00000357890.5_Missense_Mutation_p.R292P|RNF40_ENST00000402121.3_Intron|RNF40_ENST00000563683.1_Missense_Mutation_p.R292P|C16orf93_ENST00000543610.1_5'Flank	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	292					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R292P(1)|p.R292Q(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			CTGCGGAAGCGAGAGCAAAAG	0.597																																							uc002dzq.2		NA																	2	Substitution - Missense(2)		cervix(1)|lung(1)	central_nervous_system(1)	1						c.(874-876)CGA>CCA		ring finger protein 40							104.0	101.0	102.0					16																	30776605		2197	4300	6497	SO:0001583	missense	9810				histone H2B ubiquitination|histone monoubiquitination|ubiquitin-dependent protein catabolic process	nucleus|synaptosome|ubiquitin ligase complex	protein homodimerization activity|ubiquitin protein ligase binding|zinc ion binding	g.chr16:30776605G>C	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.875G>C	16.37:g.30776605G>C	ENSP00000325677:p.Arg292Pro					RNF40_uc010caa.2_Missense_Mutation_p.R292P|RNF40_uc010cab.2_Missense_Mutation_p.R292P|RNF40_uc010vfa.1_Intron|RNF40_uc002dzr.2_Missense_Mutation_p.R292P|RNF40_uc010vfb.1_Intron|RNF40_uc010vfc.1_5'Flank	p.R292P	NM_014771	NP_055586	O75150	BRE1B_HUMAN	Colorectal(24;0.198)		7	998	+			292			Potential.		Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	ENST00000324685.6	37	c.875G>C	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651866	0.88056	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000452273	T;T	0.48522	1.48;0.81	5.66	5.66	0.87406	.	0.057067	0.64402	D	0.000002	T	0.68302	0.2986	M	0.80183	2.485	0.80722	D	1	D;D;D	0.76494	0.993;0.999;0.999	P;D;D	0.72338	0.835;0.977;0.97	T	0.72033	-0.4412	10	0.87932	D	0	-9.844	11.9312	0.52847	0.0807:0.0:0.9193:0.0	.	292;292;292	O75150-4;A8K6K1;O75150	.;.;BRE1B_HUMAN	P	292;292;141	ENSP00000325677:R292P;ENSP00000350563:R292P	ENSP00000325677:R292P	R	+	2	0	RNF40	30684106	1.000000	0.71417	0.988000	0.46212	0.978000	0.69477	7.679000	0.84048	2.667000	0.90743	0.563000	0.77884	CGA		0.597	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255524.2	NM_014771		9	36	0	0	0	0.008291	0	9	36				
ITGAD	3681	broad.mit.edu	37	16	31422734	31422734	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:31422734C>A	ENST00000389202.2	+	14	1652	c.1603C>A	c.(1603-1605)Ctg>Atg	p.L535M		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	535					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.L535M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TGAGGACAAGCTGATAGACGT	0.637																																							uc002ebv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1603-1605)CTG>ATG		integrin, alpha D precursor							126.0	125.0	126.0					16																	31422734		2197	4300	6497	SO:0001583	missense	3681				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr16:31422734C>A	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1603C>A	16.37:g.31422734C>A	ENSP00000373854:p.Leu535Met					ITGAD_uc010cap.1_Missense_Mutation_p.L536M	p.L535M	NM_005353	NP_005344	Q13349	ITAD_HUMAN			14	1652	+			535			FG-GAP 6.|Extracellular (Potential).|Potential.		Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	c.1603C>A	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	C	7.031	0.560529	0.13498	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.26810	1.71	4.34	0.88	0.19161	.	.	.	.	.	T	0.32285	0.0824	M	0.81614	2.55	0.09310	N	1	P;P	0.35507	0.506;0.506	B;B	0.40982	0.345;0.345	T	0.33163	-0.9879	9	0.72032	D	0.01	.	5.2169	0.15348	0.356:0.5364:0.0:0.1075	.	551;535	Q59H14;Q13349	.;ITAD_HUMAN	M	551;535	ENSP00000373854:L535M	ENSP00000373854:L535M	L	+	1	2	ITGAD	31330235	0.002000	0.14202	0.641000	0.29422	0.141000	0.21300	-0.461000	0.06712	0.750000	0.32877	0.407000	0.27541	CTG		0.637	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353		23	181	1	0	2.21704e-12	0.00278	3.93064e-12	23	181				
MMP2	4313	broad.mit.edu	37	16	55519270	55519270	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:55519270C>A	ENST00000219070.4	+	4	1098	c.589C>A	c.(589-591)Cca>Aca	p.P197T	MMP2_ENST00000437642.2_Missense_Mutation_p.P147T|MMP2_ENST00000543485.1_Missense_Mutation_p.P121T|MMP2_ENST00000570308.1_Missense_Mutation_p.P121T	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	197	Collagenase-like 1.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.P197T(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	TGCCTTCGCCCCAGGCACTGG	0.577																																							uc002ehz.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11						c.(589-591)CCA>ACA		matrix metalloproteinase 2 isoform a	Marimastat(DB00786)|Sulindac(DB00605)						138.0	117.0	124.0					16																	55519270		2198	4300	6498	SO:0001583	missense	4313				angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding	g.chr16:55519270C>A		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.589C>A	16.37:g.55519270C>A	ENSP00000219070:p.Pro197Thr					MMP2_uc010vhd.1_Missense_Mutation_p.P121T|MMP2_uc010ccc.2_Missense_Mutation_p.P147T	p.P197T	NM_004530	NP_004521	P08253	MMP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	4	900	+		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)	197			Collagenase-like 1.		B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	ENST00000219070.4	37	c.589C>A	CCDS10752.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.567032	0.65651	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	D;D;D	0.83591	-1.74;-1.74;-1.74	4.77	4.77	0.60923	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91932	0.7445	M	0.84773	2.715	0.80722	D	1	D;D	0.89917	1.0;0.988	D;P	0.77557	0.99;0.892	D	0.93468	0.6816	10	0.87932	D	0	.	17.7946	0.88566	0.0:1.0:0.0:0.0	.	147;197	E9PE45;P08253	.;MMP2_HUMAN	T	197;121;147	ENSP00000219070:P197T;ENSP00000444143:P121T;ENSP00000394237:P147T	ENSP00000219070:P197T	P	+	1	0	MMP2	54076771	1.000000	0.71417	0.968000	0.41197	0.108000	0.19459	7.811000	0.86092	2.194000	0.70268	0.544000	0.68410	CCA		0.577	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3			14	90	1	0	0.000422831	0.004007	0.000493303	14	90				
WWP2	11060	broad.mit.edu	37	16	69964119	69964119	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:69964119G>T	ENST00000359154.2	+	13	1504	c.1403G>T	c.(1402-1404)cGc>cTc	p.R468L	WWP2_ENST00000356003.2_Missense_Mutation_p.R468L|WWP2_ENST00000542271.1_Missense_Mutation_p.R352L|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000448661.1_Missense_Mutation_p.R468L|MIR140_ENST00000385282.1_RNA|WWP2_ENST00000568684.1_Missense_Mutation_p.R29L	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	468	WW 4. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)	p.R468L(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CACAATACCCGCACCACCACC	0.582											OREG0023910	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002exu.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(1)|breast(1)|skin(1)	6						c.(1402-1404)CGC>CTC		WW domain containing E3 ubiquitin protein ligase							72.0	69.0	70.0					16																	69964119		2198	4300	6498	SO:0001583	missense	11060				entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity	g.chr16:69964119G>T	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.1403G>T	16.37:g.69964119G>T	ENSP00000352069:p.Arg468Leu		OREG0023910	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1118	WWP2_uc002exv.1_Missense_Mutation_p.R468L|WWP2_uc010vlm.1_Missense_Mutation_p.R352L|WWP2_uc010vln.1_Missense_Mutation_p.R86L|WWP2_uc002exw.1_Missense_Mutation_p.R29L|uc002exx.1_5'Flank|MIR140_hsa-mir-140|MI0000456_5'Flank	p.R468L	NM_007014	NP_008945	O00308	WWP2_HUMAN			14	1492	+			468			WW 4.		A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	ENST00000359154.2	37	c.1403G>T	CCDS10885.1	.	.	.	.	.	.	.	.	.	.	G	36	5.657112	0.96724	.	.	ENSG00000198373	ENST00000359154;ENST00000545099;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85	5.52	5.52	0.82312	WW/Rsp5/WWP (6);	0.000000	0.85682	D	0.000000	D	0.94863	0.8340	H	0.94658	3.565	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.95864	0.8885	9	.	.	.	.	19.4505	0.94865	0.0:0.0:1.0:0.0	.	468	O00308	WWP2_HUMAN	L	468;29;468;468;355;352	ENSP00000352069:R468L;ENSP00000396871:R468L;ENSP00000348283:R468L;ENSP00000445616:R352L	.	R	+	2	0	WWP2	68521620	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.597000	0.87782	0.655000	0.94253	CGC		0.582	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	NM_007014		11	49	1	0	0.00136819	0.013537	0.00156036	11	49				
CNTNAP4	85445	broad.mit.edu	37	16	76350316	76350316	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:76350316G>T	ENST00000476707.1	+	1	240	c.101G>T	c.(100-102)tGt>tTt	p.C34F	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.C30F|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.C6F|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.C30F			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	31	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.C6F(2)|p.C30F(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						GCAGATGACTGTGATGATCCT	0.468																																							uc002feu.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|pancreas(1)	2						c.(91-93)TGT>TTT		cell recognition protein CASPR4 isoform 1							124.0	88.0	100.0					16																	76350316		2198	4300	6498	SO:0001583	missense	85445				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr16:76350316G>T	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.101G>T	16.37:g.76350316G>T	ENSP00000417628:p.Cys34Phe					CNTNAP4_uc002fev.1_5'UTR|CNTNAP4_uc010chb.1_Missense_Mutation_p.C6F|CNTNAP4_uc002fex.1_Missense_Mutation_p.C34F|CNTNAP4_uc002few.2_Missense_Mutation_p.C6F	p.C31F	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN			4	477	+			31			Extracellular (Potential).|F5/8 type C.		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37	c.92G>T		.	.	.	.	.	.	.	.	.	.	G	20.8	4.056107	0.76074	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.93763	-2.94;-3.03;-3.28;-3.0	4.6	4.6	0.57074	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.000000	0.41823	D	0.000804	D	0.96510	0.8861	.	.	.	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.96887	0.9650	9	0.87932	D	0	.	15.3308	0.74208	0.0:0.0:1.0:0.0	.	6;34;6;31	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	F	30;30;6;34	ENSP00000306893:C30F;ENSP00000439733:C30F;ENSP00000418741:C6F;ENSP00000417628:C34F	ENSP00000306893:C30F	C	+	2	0	CNTNAP4	74907817	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.723000	0.91458	2.546000	0.85860	0.655000	0.94253	TGT		0.468	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		8	28	1	0	7.48243e-07	0.006214	1.04754e-06	8	28				
ADAMTS18	170692	broad.mit.edu	37	16	77355074	77355074	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:77355074C>A	ENST00000282849.5	-	15	2607	c.2189G>T	c.(2188-2190)gGc>gTc	p.G730V		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	730	Cys-rich.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G730V(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TGCTTTAGAGCCTAGTTCATG	0.388																																							uc002ffc.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						c.(2188-2190)GGC>GTC		ADAM metallopeptidase with thrombospondin type 1							99.0	98.0	98.0					16																	77355074		2198	4300	6498	SO:0001583	missense	170692				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr16:77355074C>A	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2189G>T	16.37:g.77355074C>A	ENSP00000282849:p.Gly730Val					ADAMTS18_uc010chc.1_Missense_Mutation_p.G318V|ADAMTS18_uc002ffe.1_Missense_Mutation_p.G426V	p.G730V	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN			15	2608	-			730			Cys-rich.		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	c.2189G>T	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.698163	0.88830	.	.	ENSG00000140873	ENST00000282849	T	0.71222	-0.55	5.71	5.71	0.89125	.	0.114545	0.64402	D	0.000014	D	0.89476	0.6726	H	0.96489	3.83	0.80722	D	1	D;D	0.69078	0.99;0.997	D;D	0.70487	0.935;0.969	D	0.92323	0.5867	10	0.87932	D	0	.	18.8324	0.92145	0.0:1.0:0.0:0.0	.	730;730	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	V	730	ENSP00000282849:G730V	ENSP00000282849:G730V	G	-	2	0	ADAMTS18	75912575	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.409000	0.80053	2.696000	0.92011	0.655000	0.94253	GGC		0.388	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1			14	104	1	0	6.31663e-08	0.003163	9.39396e-08	14	104				
ZNF778	197320	broad.mit.edu	37	16	89293777	89293777	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr16:89293777G>T	ENST00000433976.2	+	6	1329	c.997G>T	c.(997-999)Gga>Tga	p.G333*	ZNF778_ENST00000306502.6_Nonsense_Mutation_p.G291*|RP11-46C24.6_ENST00000563182.1_RNA	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	Q96MU6	ZN778_HUMAN	zinc finger protein 778	333					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G333*(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|skin(2)	24				BRCA - Breast invasive adenocarcinoma(80;0.0269)		AACAGACCCTGGACAGAAGCC	0.468																																							uc002fmv.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(997-999)GGA>TGA		zinc finger protein 778							65.0	71.0	69.0					16																	89293777		2118	4252	6370	SO:0001587	stop_gained	197320				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr16:89293777G>T	AK056437	CCDS45550.1, CCDS73928.1	16q24.3	2014-09-17			ENSG00000170100	ENSG00000170100		"""Zinc fingers, C2H2-type"", ""-"""	26479	protein-coding gene	gene with protein product							Standard	NM_182531		Approved	FLJ31875	uc021tms.1	Q96MU6		ENST00000433976.2:c.997G>T	16.37:g.89293777G>T	ENSP00000405289:p.Gly333*					ZNF778_uc010vpf.1_Intron|ZNF778_uc002fmw.1_Nonsense_Mutation_p.G291*|ZNF778_uc010vpg.1_Nonsense_Mutation_p.G96*	p.G333*	NM_182531	NP_872337	Q96MU6	ZN778_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0269)	6	1336	+			333					Q08AG0	Nonsense_Mutation	SNP	ENST00000433976.2	37	c.997G>T	CCDS45550.1	.	.	.	.	.	.	.	.	.	.	G	31	5.105005	0.94245	.	.	ENSG00000170100	ENST00000433976;ENST00000306502	.	.	.	1.13	1.13	0.20643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	3.4646	0.07545	0.2695:0.0:0.7305:0.0	.	.	.	.	X	333;291	.	ENSP00000305203:G291X	G	+	1	0	ZNF778	87821278	0.985000	0.35326	0.016000	0.15963	0.012000	0.07955	3.720000	0.54933	0.927000	0.37143	0.558000	0.71614	GGA		0.468	ZNF778-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430383.1	NM_182531		15	91	1	0	6.72482e-11	0.003163	1.11897e-10	15	91				
ANKFY1	51479	broad.mit.edu	37	17	4075872	4075872	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:4075872G>A	ENST00000341657.4	-	22	3153	c.3118C>T	c.(3118-3120)Ccg>Tcg	p.P1040S	CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000570535.1_Missense_Mutation_p.P1082S|ANKFY1_ENST00000574367.1_Missense_Mutation_p.P1041S	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	1040					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)	p.P1041S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						TCTGCATCCGGCTTGTCCAGA	0.562																																							uc002fxq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(3118-3120)CCG>TCG		ankyrin repeat and FYVE domain containing 1							80.0	87.0	85.0					17																	4075872		1996	4174	6170	SO:0001583	missense	51479					endosome membrane	metal ion binding|protein binding	g.chr17:4075872G>A	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.3118C>T	17.37:g.4075872G>A	ENSP00000343362:p.Pro1040Ser					ANKFY1_uc002fxn.2_Missense_Mutation_p.P1082S|ANKFY1_uc002fxo.2_Missense_Mutation_p.P1041S|ANKFY1_uc002fxp.2_Missense_Mutation_p.P1039S|ANKFY1_uc010ckp.2_Missense_Mutation_p.P982S	p.P1040S	NM_016376	NP_057460	Q9P2R3	ANFY1_HUMAN			22	3156	-			1040					A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	37	c.3118C>T		.	.	.	.	.	.	.	.	.	.	G	11.50	1.657037	0.29425	.	.	ENSG00000185722	ENST00000341657;ENST00000535427	.	.	.	5.41	4.38	0.52667	Ankyrin repeat-containing domain (3);	0.172359	0.52532	D	0.000075	T	0.59783	0.2219	M	0.65975	2.015	0.80722	D	1	P;B;B;B	0.35575	0.51;0.03;0.05;0.161	B;B;B;B	0.36666	0.23;0.014;0.033;0.053	T	0.56968	-0.7891	9	0.15499	T	0.54	-14.6547	15.888	0.79269	0.0:0.135:0.865:0.0	.	982;1040;1041;1082	F5H754;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;ANFY1_HUMAN;.;.	S	1041;982	.	ENSP00000343362:P1041S	P	-	1	0	ANKFY1	4022621	1.000000	0.71417	0.621000	0.29145	0.006000	0.05464	5.677000	0.68142	2.711000	0.92665	0.563000	0.77884	CCG		0.562	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376		3	53	0	0	0	0.000602	0	3	53				
ALOX12	239	broad.mit.edu	37	17	6913416	6913416	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:6913416T>A	ENST00000251535.6	+	13	1836	c.1783T>A	c.(1783-1785)Tgg>Agg	p.W595R	AC027763.2_ENST00000575727.1_Intron|AC027763.2_ENST00000399540.2_Intron|AC027763.2_ENST00000574377.1_Start_Codon_SNP_p.M1L|RNASEK_ENST00000402093.1_5'Flank|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000573939.1_Intron|RNASEK_ENST00000548577.1_5'Flank|RP11-589P10.7_ENST00000572547.1_RNA	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	595	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)	p.S594fs*1(1)|p.W595R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						GGCCATCTCATGGCATCTGAG	0.582																																							uc002gdx.3		NA																	2	Substitution - Missense(1)|Deletion - Frameshift(1)		ovary(1)|lung(1)	central_nervous_system(1)	1						c.(1783-1785)TGG>AGG		arachidonate 12-lipoxygenase							57.0	50.0	52.0					17																	6913416		2203	4300	6503	SO:0001583	missense	239				anti-apoptosis|cellular component movement|fatty acid oxidation|leukotriene biosynthetic process|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of cell proliferation|superoxide anion generation	cytosol|sarcolemma	arachidonate 12-lipoxygenase activity|hepoxilin-epoxide hydrolase activity|iron ion binding|lipoxygenase activity|protein binding	g.chr17:6913416T>A	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1783T>A	17.37:g.6913416T>A	ENSP00000251535:p.Trp595Arg					uc002gdy.1_Intron|ALOX12_uc002gdz.3_Missense_Mutation_p.W65R|RNASEK_uc002gea.2_5'Flank|C17orf49_uc002geb.3_5'Flank|C17orf49_uc002gec.2_5'Flank	p.W595R	NM_000697	NP_000688	P18054	LOX12_HUMAN			13	1836	+			595			Lipoxygenase.		O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	ENST00000251535.6	37	c.1783T>A	CCDS11084.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.074727	0.55646	.	.	ENSG00000108839	ENST00000251535;ENST00000406228	T	0.76578	-1.03	4.96	4.96	0.65561	Lipoxygenase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.79387	0.4437	M	0.81497	2.545	0.53688	D	0.999972	B	0.26902	0.163	B	0.33295	0.161	T	0.79531	-0.1765	10	0.59425	D	0.04	-0.4523	10.9542	0.47347	0.0:0.0:0.0:1.0	.	595	P18054	LOX12_HUMAN	R	595;65	ENSP00000251535:W595R	ENSP00000251535:W595R	W	+	1	0	ALOX12	6854140	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.757000	0.62213	2.092000	0.63282	0.377000	0.23210	TGG		0.582	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219922.2			8	20	0	0	0	0.00308	0	8	20				
MYH3	4621	broad.mit.edu	37	17	10543658	10543658	+	Silent	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:10543658C>G	ENST00000583535.1	-	21	2505	c.2418G>C	c.(2416-2418)gtG>gtC	p.V806V	MYH3_ENST00000226209.7_Silent_p.V806V	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	806	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.V806V(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						ACCTCCTCTGCACCATCTTCT	0.522																																							uc002gmq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(2416-2418)GTG>GTC		myosin, heavy chain 3, skeletal muscle,							106.0	105.0	105.0					17																	10543658		2203	4300	6503	SO:0001819	synonymous_variant	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10543658C>G		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.2418G>C	17.37:g.10543658C>G							p.V806V	NM_002470	NP_002461	P11055	MYH3_HUMAN			20	2495	-			806			IQ.		Q15492	Silent	SNP	ENST00000583535.1	37	c.2418G>C	CCDS11157.1																																																																																				0.522	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		6	65	0	0	0	0.001984	0	6	65				
DNAH9	1770	broad.mit.edu	37	17	11592948	11592949	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:11592948_11592949CC>AA	ENST00000262442.4	+	20	3877_3878	c.3809_3810CC>AA	c.(3808-3810)tCC>tAA	p.S1270*	DNAH9_ENST00000454412.2_Nonsense_Mutation_p.S1270*	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1270	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.S1270*(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGATGGAATCCACTATGGCCT	0.49																																							uc002gne.2		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(3808-3810)TCC>TAA		dynein, axonemal, heavy chain 9 isoform 2																																				SO:0001587	stop_gained	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11592948_11592949CC>AA	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	Exception_encountered	17.37:g.11592948_11592949delinsAA	ENSP00000262442:p.Ser1270*					DNAH9_uc010coo.2_Nonsense_Mutation_p.S564*	p.S1270*	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	20	3877_3878	+		Breast(5;0.0122)|all_epithelial(5;0.131)	1270			Stem (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Nonsense_Mutation	DNP	ENST00000262442.4	37	c.3809_3810CC>AA	CCDS11160.1																																																																																				0.490	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		13	72	0	0	0	0.004672	0	13	72				
TOP3A	7156	broad.mit.edu	37	17	18196026	18196026	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:18196026C>A	ENST00000321105.5	-	11	1428	c.1214G>T	c.(1213-1215)cGc>cTc	p.R405L	TOP3A_ENST00000540524.1_Intron|TOP3A_ENST00000542570.1_Missense_Mutation_p.R310L	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	405					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)	p.R405L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						GTTCCCATTGCGTGGGGTGGG	0.562																																							uc002gsx.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(1213-1215)CGC>CTC		topoisomerase (DNA) III alpha							137.0	122.0	127.0					17																	18196026		2203	4300	6503	SO:0001583	missense	7156				DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding	g.chr17:18196026C>A	U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.1214G>T	17.37:g.18196026C>A	ENSP00000321636:p.Arg405Leu					TOP3A_uc010cpz.1_5'Flank|TOP3A_uc010vxr.1_Intron|TOP3A_uc002gsw.1_Intron|TOP3A_uc010vxs.1_Missense_Mutation_p.R303L	p.R405L	NM_004618	NP_004609	Q13472	TOP3A_HUMAN			11	1443	-			405					A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	ENST00000321105.5	37	c.1214G>T	CCDS11194.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.740755	0.49045	.	.	ENSG00000177302	ENST00000321105;ENST00000542570	T;T	0.21543	2.0;2.84	5.22	4.24	0.50183	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central region, subdomain 3 (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);	0.053029	0.85682	D	0.000000	T	0.52885	0.1762	M	0.88377	2.95	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.72075	0.976;0.964	T	0.65080	-0.6255	10	0.87932	D	0	-22.341	15.9717	0.80025	0.0:0.8652:0.1348:0.0	.	310;405	B4DK80;Q13472	.;TOP3A_HUMAN	L	405;310	ENSP00000321636:R405L;ENSP00000442336:R310L	ENSP00000321636:R405L	R	-	2	0	TOP3A	18136751	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.705000	0.84606	1.168000	0.42723	0.563000	0.77884	CGC		0.562	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2			11	52	1	0	0.000673444	0.008291	0.000774556	11	52				
SLC47A2	146802	broad.mit.edu	37	17	19611069	19611069	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:19611069C>G	ENST00000325411.5	-	8	875	c.825G>C	c.(823-825)gaG>gaC	p.E275D	SLC47A2_ENST00000350657.5_Missense_Mutation_p.E239D|SLC47A2_ENST00000463318.1_5'UTR	NM_152908.3	NP_690872.2	Q86VL8	S47A2_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 2	275					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antiporter activity (GO:0015297)|drug transmembrane transporter activity (GO:0015238)	p.E275D(1)|p.E239D(1)		endometrium(2)|kidney(3)|large_intestine(2)|lung(1)|ovary(1)	9	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)				Aciclovir(DB00787)	CTGCCCACGTCTCCAGGTGCA	0.632																																							uc002gwe.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(823-825)GAG>GAC		solute carrier family 47, member 2 isoform 1							77.0	68.0	71.0					17																	19611069		2203	4297	6500	SO:0001583	missense	146802					integral to membrane|plasma membrane	drug:hydrogen antiporter activity	g.chr17:19611069C>G	AB250364	CCDS11211.1, CCDS58530.1	17p11.2	2013-07-17	2013-07-17		ENSG00000180638	ENSG00000180638		"""Solute carriers"""	26439	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 2"""	609833				16996621, 16807400	Standard	NM_152908		Approved	FLJ31196, MATE2, MATE2-K	uc002gwf.4	Q86VL8	OTTHUMG00000059464	ENST00000325411.5:c.825G>C	17.37:g.19611069C>G	ENSP00000326671:p.Glu275Asp					SLC47A2_uc002gwg.3_Missense_Mutation_p.E239D|SLC47A2_uc002gwf.3_Missense_Mutation_p.E239D|SLC47A2_uc002gwh.3_RNA|SLC47A2_uc002gwi.2_RNA|SLC47A2_uc010cqs.1_RNA|SLC47A2_uc010cqt.1_RNA	p.E275D	NM_152908	NP_690872	Q86VL8	S47A2_HUMAN			8	1000	-	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)		275			Cytoplasmic (Potential).		A0JBX9|A0P8Z7|Q63HJ9|Q8IV44|Q96NA1	Missense_Mutation	SNP	ENST00000325411.5	37	c.825G>C	CCDS11211.1	.	.	.	.	.	.	.	.	.	.	C	10.29	1.310074	0.23821	.	.	ENSG00000180638	ENST00000350657;ENST00000325411;ENST00000456947;ENST00000433844	T;T;T	0.46063	1.48;1.5;0.88	5.24	0.196	0.15159	.	0.299186	0.36268	N	0.002696	T	0.19644	0.0472	N	0.12527	0.23	0.25343	N	0.988938	B;B;B	0.10296	0.003;0.003;0.001	B;B;B	0.14578	0.011;0.011;0.005	T	0.15780	-1.0425	10	0.23891	T	0.37	-18.1695	7.0229	0.24924	0.0:0.4076:0.4124:0.18	.	239;239;275	Q86VL8-3;Q86VL8-4;Q86VL8	.;.;S47A2_HUMAN	D	239;275;190;239	ENSP00000338084:E239D;ENSP00000326671:E275D;ENSP00000391848:E239D	ENSP00000326671:E275D	E	-	3	2	SLC47A2	19551661	0.001000	0.12720	0.342000	0.25602	0.684000	0.39900	-1.162000	0.03141	0.190000	0.20209	0.563000	0.77884	GAG		0.632	SLC47A2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132242.2	NM_152908		2	4	0	0	0	0.004672	0	2	4				
GAS2L2	246176	broad.mit.edu	37	17	34072004	34072004	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:34072004C>A	ENST00000254466.6	-	6	2539	c.2512G>T	c.(2512-2514)Gag>Tag	p.E838*	GAS2L2_ENST00000587565.1_Nonsense_Mutation_p.E822*	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	838					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)	p.E838*(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		tcctcctcctcctcACCTACT	0.627																																							uc002hjv.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2512-2514)GAG>TAG		growth arrest-specific 2 like 2							62.0	59.0	60.0					17																	34072004		2203	4300	6503	SO:0001587	stop_gained	246176				cell cycle arrest	cytoplasm|cytoskeleton		g.chr17:34072004C>A	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.2512G>T	17.37:g.34072004C>A	ENSP00000254466:p.Glu838*						p.E838*	NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	6	2540	-		Ovarian(249;0.17)	838					Q8NHY4	Nonsense_Mutation	SNP	ENST00000254466.6	37	c.2512G>T	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088457	0.76756	.	.	ENSG00000132139	ENST00000254466;ENST00000359507	.	.	.	4.09	-5.44	0.02624	.	1.237530	0.05724	N	0.598235	.	.	.	.	.	.	0.49389	D	0.999786	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-0.1947	5.599	0.17343	0.0:0.3058:0.248:0.4462	.	.	.	.	X	838;252	.	ENSP00000254466:E838X	E	-	1	0	GAS2L2	31096117	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-1.620000	0.02046	-1.020000	0.03354	-0.367000	0.07326	GAG		0.627	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285		9	32	1	0	1.58986e-06	0.008291	2.15881e-06	9	32				
KRTAP4-11	653240	broad.mit.edu	37	17	39274206	39274206	+	Missense_Mutation	SNP	C	C	T	rs79388709		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:39274206C>T	ENST00000391413.2	-	1	400	c.362G>A	c.(361-363)aGa>aAa	p.R121K		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	121	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.R121K(5)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcactggggtctgcagcagct	0.652																																							uc002hvz.2		NA																	5	Substitution - Missense(5)		lung(2)|prostate(1)|kidney(1)|skin(1)		0						c.(361-363)AGA>AAA		keratin associated protein 4-11							5.0	9.0	8.0					17																	39274206		644	1533	2177	SO:0001583	missense	653240					keratin filament		g.chr17:39274206C>T	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.362G>A	17.37:g.39274206C>T	ENSP00000375232:p.Arg121Lys						p.R121K	NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	401	-		Breast(137;0.000496)	121			20.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	c.362G>A	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	4.782	0.145483	0.09134	.	.	ENSG00000212721	ENST00000391413	T	0.01455	4.87	3.34	-4.84	0.03151	.	.	.	.	.	T	0.01905	0.0060	M	0.73962	2.25	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.50276	-0.8847	9	0.11794	T	0.64	.	2.2508	0.04042	0.1417:0.1925:0.1396:0.5262	.	121	Q9BYQ6	KR411_HUMAN	K	121	ENSP00000375232:R121K	ENSP00000375232:R121K	R	-	2	0	KRTAP4-11	36527732	0.000000	0.05858	0.009000	0.14445	0.065000	0.16274	-1.602000	0.02079	-0.525000	0.06391	-1.218000	0.01608	AGA		0.652	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1			3	26	0	0	0	0.004672	0	3	26				
AARSD1	80755	broad.mit.edu	37	17	41103887	41103887	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:41103887C>A	ENST00000427569.2	-	11	1068	c.1033G>T	c.(1033-1035)Ggc>Tgc	p.G345C	PTGES3L-AARSD1_ENST00000360221.4_Missense_Mutation_p.G458C|PTGES3L-AARSD1_ENST00000409103.1_Missense_Mutation_p.G428C|PTGES3L-AARSD1_ENST00000409399.1_Missense_Mutation_p.G519C|PTGES3L-AARSD1_ENST00000421990.2_Missense_Mutation_p.G519C	NM_001261434.1	NP_001248363.1	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1	345					alanyl-tRNA aminoacylation (GO:0006419)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	alanine-tRNA ligase activity (GO:0004813)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|Ser-tRNA(Ala) hydrolase activity (GO:0002196)	p.G458C(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|skin(1)	17		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		TTCTCATCGCCCACAGTTAAG	0.522																																							uc002icc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1033-1035)GGC>TGC		alanyl-tRNA synthetase domain containing 1							75.0	65.0	68.0					17																	41103887		2203	4300	6503	SO:0001583	missense	80755				alanyl-tRNA aminoacylation	cytoplasm	alanine-tRNA ligase activity|ATP binding|metal ion binding|nucleic acid binding	g.chr17:41103887C>A	BC004172	CCDS11447.1, CCDS45691.1, CCDS58552.1	17q21.31	2012-10-05			ENSG00000266967	ENSG00000266967			28417	protein-coding gene	gene with protein product		613212					Standard	NM_001261434		Approved	MGC2744		Q9BTE6	OTTHUMG00000153515	ENST00000427569.2:c.1033G>T	17.37:g.41103887C>A	ENSP00000400870:p.Gly345Cys					AARSD1_uc002icd.2_Missense_Mutation_p.G458C|AARSD1_uc002ice.2_Missense_Mutation_p.G428C|AARSD1_uc002icf.2_Missense_Mutation_p.G519C|AARSD1_uc010whg.1_Missense_Mutation_p.G519C	p.G345C	NM_025267	NP_079543	Q9BTE6	AASD1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.161)	11	1036	-		Breast(137;0.00499)	345					B4DI73	Missense_Mutation	SNP	ENST00000427569.2	37	c.1033G>T	CCDS58552.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707339	0.89018	.	.	ENSG00000108825	ENST00000360221;ENST00000409399;ENST00000421990;ENST00000427569;ENST00000409103	T;T	0.52057	0.68;0.68	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.75072	0.3800	M	0.88842	2.985	0.50171	D	0.999859	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.998	T	0.80686	-0.1272	9	0.87932	D	0	-23.9648	18.8133	0.92068	0.0:1.0:0.0:0.0	.	519;428;476;345	B4DI73;C9J5N1;B3KSP9;Q9BTE6	.;.;.;AASD1_HUMAN	C	458;519;519;345;428	ENSP00000386621:G519C;ENSP00000409924:G519C	ENSP00000353355:G458C	G	-	1	0	AARSD1	38357413	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	6.690000	0.74567	2.437000	0.82529	0.655000	0.94253	GGC		0.522	AARSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467729.1	NM_001261434		7	28	1	0	0.00307968	0.00308	0.00346357	7	28				
LRRC46	90506	broad.mit.edu	37	17	45913760	45913760	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:45913760C>A	ENST00000269025.4	+	7	877	c.514C>A	c.(514-516)Cgc>Agc	p.R172S		NM_033413.3	NP_219481.1	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	172	LRRCT.							p.R172S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	9						TGTGGTGGAGCGCTGGATTTC	0.602																																							uc002ima.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(514-516)CGC>AGC		leucine rich repeat containing 46							97.0	87.0	91.0					17																	45913760		2203	4300	6503	SO:0001583	missense	90506							g.chr17:45913760C>A		CCDS11518.1	17q21.32	2005-08-09				ENSG00000141294			25047	protein-coding gene	gene with protein product						12477932	Standard	NM_033413		Approved	MGC16309	uc002ima.3	Q96FV0		ENST00000269025.4:c.514C>A	17.37:g.45913760C>A	ENSP00000269025:p.Arg172Ser					LRRC46_uc002imb.2_Missense_Mutation_p.R125S	p.R172S	NM_033413	NP_219481	Q96FV0	LRC46_HUMAN			7	770	+			172			LRRCT.		A8K9Q0	Missense_Mutation	SNP	ENST00000269025.4	37	c.514C>A	CCDS11518.1	.	.	.	.	.	.	.	.	.	.	c	16.35	3.097899	0.56075	.	.	ENSG00000141294	ENST00000269025	T	0.74526	-0.85	5.01	3.82	0.43975	.	0.000000	0.53938	D	0.000060	T	0.65995	0.2745	L	0.54323	1.7	0.25530	N	0.987283	B;B	0.28636	0.218;0.218	B;B	0.26202	0.067;0.067	T	0.54207	-0.8328	10	0.22109	T	0.4	-18.3956	11.6358	0.51202	0.0:0.8958:0.0:0.1042	.	172;172	A8K9Q0;Q96FV0	.;LRC46_HUMAN	S	172	ENSP00000269025:R172S	ENSP00000269025:R172S	R	+	1	0	LRRC46	43268759	0.950000	0.32346	1.000000	0.80357	0.283000	0.27025	0.282000	0.18829	2.337000	0.79520	0.645000	0.84053	CGC		0.602	LRRC46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441377.1	NM_033413		9	29	1	0	0.00621372	0.006214	0.00681829	9	29				
PPM1E	22843	broad.mit.edu	37	17	57050271	57050271	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:57050271G>C	ENST00000308249.2	+	6	1324	c.1195G>C	c.(1195-1197)Gtt>Ctt	p.V399L		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	174					protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)	p.V399L(1)		biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			AAGTCTGTCGGTTTCCAGAGC	0.433																																							uc002iwx.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|lung(1)|skin(1)	5						c.(1195-1197)GTT>CTT		protein phosphatase 1E							200.0	189.0	193.0					17																	57050271		2203	4300	6503	SO:0001583	missense	22843				protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity	g.chr17:57050271G>C	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.1195G>C	17.37:g.57050271G>C	ENSP00000312411:p.Val399Leu					PPM1E_uc010ddd.2_Missense_Mutation_p.V162L	p.V399L	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	BRCA - Breast invasive adenocarcinoma(1;5.76e-11)		6	1322	+	Medulloblastoma(34;0.127)|all_neural(34;0.237)		408			PP2C-like.		Q8N8J9|Q96DB8	Missense_Mutation	SNP	ENST00000308249.2	37	c.1195G>C	CCDS11613.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905410	0.92107	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.20881	2.04	5.8	5.8	0.92144	.	0.054211	0.64402	D	0.000001	T	0.37100	0.0991	L	0.41027	1.25	0.80722	D	1	P;P	0.50710	0.924;0.938	P;P	0.59424	0.746;0.857	T	0.00778	-1.1570	10	0.40728	T	0.16	-1.5899	20.062	0.97678	0.0:0.0:1.0:0.0	.	408;399	Q8WY54-3;Q8WY54-2	.;.	L	399;250	ENSP00000312411:V399L	ENSP00000312411:V399L	V	+	1	0	PPM1E	54405053	1.000000	0.71417	0.912000	0.35992	0.817000	0.46193	9.869000	0.99810	2.730000	0.93505	0.563000	0.77884	GTT		0.433	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906		14	64	0	0	0	0.003163	0	14	64				
CA4	762	broad.mit.edu	37	17	58234889	58234889	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:58234889A>T	ENST00000300900.4	+	4	469	c.370A>T	c.(370-372)Aag>Tag	p.K124*		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	124					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.K124*(1)		kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	CTTGCCATATAAGGGCTCGGA	0.607																																							uc002iym.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(370-372)AAG>TAG		carbonic anhydrase IV precursor	Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)						146.0	134.0	138.0					17																	58234889		2203	4300	6503	SO:0001587	stop_gained	762				bicarbonate transport|one-carbon metabolic process	anchored to external side of plasma membrane|apical plasma membrane|brush border membrane|ER-Golgi intermediate compartment|membrane fraction|perinuclear region of cytoplasm|rough endoplasmic reticulum|secretory granule membrane|trans-Golgi network|transport vesicle membrane	carbonate dehydratase activity|protein binding|zinc ion binding	g.chr17:58234889A>T	L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.370A>T	17.37:g.58234889A>T	ENSP00000300900:p.Lys124*					CA4_uc010wou.1_Intron	p.K124*	NM_000717	NP_000708	P22748	CAH4_HUMAN	Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		4	464	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		124					B4DQA4|Q6FHI7	Nonsense_Mutation	SNP	ENST00000300900.4	37	c.370A>T	CCDS11624.1	.	.	.	.	.	.	.	.	.	.	A	11.82	1.753947	0.31046	.	.	ENSG00000167434	ENST00000300900	.	.	.	4.61	-9.15	0.00698	.	2.180580	0.01802	N	0.032920	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	.	4.9744	0.14133	0.2505:0.1157:0.51:0.1238	.	.	.	.	X	124	.	ENSP00000300900:K124X	K	+	1	0	CA4	55589671	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.939000	0.01545	-2.080000	0.00870	-0.624000	0.04008	AAG		0.607	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449189.1	NM_000717		23	127	0	0	0	0.00278	0	23	127				
MRC2	9902	broad.mit.edu	37	17	60754845	60754845	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:60754845A>T	ENST00000303375.5	+	12	2452	c.2050A>T	c.(2050-2052)Aag>Tag	p.K684*		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	684	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.K684*(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						GTATTGCTATAAGGTAGGGCA	0.642																																							uc002jad.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2050-2052)AAG>TAG		mannose receptor, C type 2							13.0	15.0	14.0					17																	60754845		2155	4227	6382	SO:0001587	stop_gained	9902				endocytosis	integral to membrane	receptor activity|sugar binding	g.chr17:60754845A>T	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2050A>T	17.37:g.60754845A>T	ENSP00000307513:p.Lys684*					MRC2_uc010ddq.1_RNA	p.K684*	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN			12	2452	+			684			Extracellular (Potential).|C-type lectin 4.		A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Nonsense_Mutation	SNP	ENST00000303375.5	37	c.2050A>T	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	A	44	10.741361	0.99460	.	.	ENSG00000011028	ENST00000303375	.	.	.	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-36.6567	14.3474	0.66675	1.0:0.0:0.0:0.0	.	.	.	.	X	684	.	ENSP00000307513:K684X	K	+	1	0	MRC2	58108577	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.668000	0.91158	1.963000	0.57068	0.454000	0.30748	AAG		0.642	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1			3	21	0	0	0	0.009096	0	3	21				
GH2	2689	broad.mit.edu	37	17	61958500	61958500	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:61958500G>T	ENST00000423893.2	-	3	241	c.180C>A	c.(178-180)gcC>gcA	p.A60A	GH2_ENST00000449787.2_Intron|GH2_ENST00000456543.2_Silent_p.A60A|GH2_ENST00000332800.7_Silent_p.A60A			P01242	SOM2_HUMAN	growth hormone 2	60					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.A60A(2)		breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						TCAGGATATAGGCTTCTTCCT	0.517																																							uc002jco.1		NA																	2	Substitution - coding silent(2)		lung(2)	upper_aerodigestive_tract(2)|pancreas(1)	3						c.(178-180)GCC>GCA		growth hormone 2 isoform 1							173.0	183.0	179.0					17																	61958500		2203	4300	6503	SO:0001819	synonymous_variant	2689					extracellular region	hormone activity	g.chr17:61958500G>T	J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.180C>A	17.37:g.61958500G>T						GH2_uc002jcj.2_Silent_p.A60A|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_Silent_p.A60A|GH2_uc002jcm.1_Silent_p.A60A|GH2_uc002jcn.1_Intron	p.A60A	NM_002059	NP_002050	P01242	SOM2_HUMAN			3	242	-			60					B1A4H5|B1A4H7|O14643|O14644|P09587	Silent	SNP	ENST00000423893.2	37	c.180C>A	CCDS11647.1																																																																																				0.517	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059		48	234	1	0	1.32667e-27	0.01441	2.7481e-27	48	234				
QRICH2	84074	broad.mit.edu	37	17	74288678	74288678	+	Silent	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:74288678C>T	ENST00000262765.5	-	4	1811	c.1632G>A	c.(1630-1632)ttG>ttA	p.L544L		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	544	Gln-rich.							p.L544L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						CAGATTGTACCAAACCATGCT	0.527																																							uc002jrd.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(1630-1632)TTG>TTA		glutamine rich 2							208.0	165.0	179.0					17																	74288678		2203	4300	6503	SO:0001819	synonymous_variant	84074						protein binding	g.chr17:74288678C>T	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1632G>A	17.37:g.74288678C>T						QRICH2_uc010wsz.1_Silent_p.L470L|QRICH2_uc010dgw.1_Intron	p.L544L	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN			4	1812	-			544			Gln-rich.		A2RRE1|Q96LM3	Silent	SNP	ENST00000262765.5	37	c.1632G>A	CCDS32741.1																																																																																				0.527	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134		9	50	0	0	0	0.004482	0	9	50				
SPHK1	8877	broad.mit.edu	37	17	74383634	74383634	+	Silent	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:74383634C>G	ENST00000545180.1	+	8	1931	c.1122C>G	c.(1120-1122)ccC>ccG	p.P374P	SPHK1_ENST00000323374.4_Silent_p.P460P|SPHK1_ENST00000392496.3_Silent_p.P374P|SPHK1_ENST00000590959.1_Silent_p.P388P|SPHK1_ENST00000592299.1_Silent_p.P374P			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	374					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)	p.P460P(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	GCTGGAAGCCCCAGCAGATGC	0.632																																					GBM(90;966 1307 27369 33775 44498)	GBM(90;966 1307 27369 33775 44498)	uc002jrf.1		NA																	1	Substitution - coding silent(1)		lung(1)	kidney(1)	1						c.(1120-1122)CCC>CCG		sphingosine kinase 1 isoform 3							31.0	34.0	33.0					17																	74383634		2203	4300	6503	SO:0001819	synonymous_variant	8877				'de novo' posttranslational protein folding|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|calcium-mediated signaling|positive regulation of angiogenesis|positive regulation of cell growth|positive regulation of cell migration|positive regulation of fibroblast proliferation|positive regulation of mitotic cell cycle|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|positive regulation of smooth muscle contraction|regulation of tumor necrosis factor-mediated signaling pathway|sphingoid catabolic process|sphingosine metabolic process	cytosol|membrane fraction|nucleus|plasma membrane|soluble fraction	ATP binding|calmodulin binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|DNA binding|magnesium ion binding|protein phosphatase 2A binding|sphinganine kinase activity	g.chr17:74383634C>G	BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.1122C>G	17.37:g.74383634C>G						SPHK1_uc002jrg.1_Silent_p.P323P|SPHK1_uc002jrh.2_Silent_p.P388P|SPHK1_uc002jrj.2_Silent_p.P460P|SPHK1_uc002jri.2_Silent_p.P374P|SPHK1_uc002jrk.3_Silent_p.P374P|uc010wtd.1_RNA	p.P374P	NM_001142602	NP_001136074	Q9NYA1	SPHK1_HUMAN			8	1931	+			374					Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Silent	SNP	ENST00000545180.1	37	c.1122C>G	CCDS45785.1																																																																																				0.632	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972		5	56	0	0	0	0.001168	0	5	56				
ANKRD12	23253	broad.mit.edu	37	18	9257679	9257679	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr18:9257679G>T	ENST00000262126.4	+	9	4654	c.4414G>T	c.(4414-4416)Gaa>Taa	p.E1472*	ANKRD12_ENST00000383440.2_Nonsense_Mutation_p.E1449*|ANKRD12_ENST00000400020.3_Nonsense_Mutation_p.E1449*|RP11-888D10.4_ENST00000609701.1_RNA	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1472						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E1472*(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						GCGCCAGACTGAACTGCCAGG	0.428																																							uc002knv.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(4414-4416)GAA>TAA		ankyrin repeat domain 12 isoform 1							50.0	53.0	52.0					18																	9257679		2201	4300	6501	SO:0001587	stop_gained	23253					nucleus		g.chr18:9257679G>T	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.4414G>T	18.37:g.9257679G>T	ENSP00000262126:p.Glu1472*					ANKRD12_uc002knw.2_Nonsense_Mutation_p.E1449*|ANKRD12_uc002knx.2_Nonsense_Mutation_p.E1449*|ANKRD12_uc010dkx.1_Nonsense_Mutation_p.E1179*	p.E1472*	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN			9	4671	+			1472					O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Nonsense_Mutation	SNP	ENST00000262126.4	37	c.4414G>T	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	G	41	8.657713	0.98903	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	.	.	.	5.69	5.69	0.88448	.	0.328662	0.31685	N	0.007222	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.5704	18.0068	0.89212	0.0:0.0:1.0:0.0	.	.	.	.	X	1449;1472	.	ENSP00000262126:E1472X	E	+	1	0	ANKRD12	9247679	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	6.394000	0.73223	2.676000	0.91093	0.655000	0.94253	GAA		0.428	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208		12	45	1	0	1.08611e-07	0.010729	1.59191e-07	12	45				
C18orf25	147339	broad.mit.edu	37	18	43796479	43796479	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr18:43796479G>T	ENST00000282059.6	+	2	1007	c.633G>T	c.(631-633)ctG>ctT	p.L211L	C18orf25_ENST00000321319.6_Silent_p.L211L	NM_145055.3	NP_659492	Q96B23	CR025_HUMAN	chromosome 18 open reading frame 25	211								p.L211L(1)		central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	11						ATAGTGACCTGACTTGTGACT	0.478																																							uc002lbw.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)	2						c.(631-633)CTG>CTT		ARKadia-like 1 isoform a							57.0	58.0	58.0					18																	43796479		2035	4182	6217	SO:0001819	synonymous_variant	147339							g.chr18:43796479G>T	AL713661	CCDS42430.1, CCDS42431.1	18q21.1	2014-01-03			ENSG00000152242	ENSG00000152242			28172	protein-coding gene	gene with protein product	"""ARKadia-like 1"""					15722956	Standard	NM_001008239		Approved	MGC12909, ARKL1, RNF111L1	uc002lbw.3	Q96B23		ENST00000282059.6:c.633G>T	18.37:g.43796479G>T						C18orf25_uc002lbx.2_Silent_p.L211L	p.L211L	NM_145055	NP_659492	Q96B23	CR025_HUMAN			2	1012	+			211					A8K123|A8KAB6|Q5XG78|Q6N058|Q86TB5|Q8TCQ5	Silent	SNP	ENST00000282059.6	37	c.633G>T	CCDS42430.1																																																																																				0.478	C18orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445242.1	NM_145055		6	38	1	0	3.59834e-05	0.001168	4.49515e-05	6	38				
MYO5B	4645	broad.mit.edu	37	18	47390574	47390574	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr18:47390574C>G	ENST00000285039.7	-	28	4079	c.3780G>C	c.(3778-3780)gaG>gaC	p.E1260D	MYO5B_ENST00000324581.6_Missense_Mutation_p.E401D|MYO5B_ENST00000587895.1_5'UTR	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1260					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.E1260D(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GGATGAGCACCTCCTCCTTGC	0.667																																							uc002leb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|central_nervous_system(1)	5						c.(3778-3780)GAG>GAC		myosin VB							50.0	54.0	53.0					18																	47390574		2032	4184	6216	SO:0001583	missense	4645				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr18:47390574C>G	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3780G>C	18.37:g.47390574C>G	ENSP00000285039:p.Glu1260Asp					MYO5B_uc002lea.2_Missense_Mutation_p.E401D	p.E1260D	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN		READ - Rectum adenocarcinoma(32;0.103)	28	4068	-			1260			Potential.		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	c.3780G>C	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.441170	0.83993	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.31510	1.49;1.49	5.44	3.66	0.41972	.	0.000000	0.85682	D	0.000000	T	0.53562	0.1804	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.99	T	0.51180	-0.8738	10	0.36615	T	0.2	.	8.9235	0.35625	0.0:0.7709:0.0:0.2291	.	1260;401	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	D	1260;401	ENSP00000285039:E1260D;ENSP00000315531:E401D	ENSP00000285039:E1260D	E	-	3	2	MYO5B	45644572	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.999000	0.29757	0.680000	0.31366	0.561000	0.74099	GAG		0.667	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			15	47	0	0	0	0.003163	0	15	47				
CDH20	28316	broad.mit.edu	37	18	59217255	59217255	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr18:59217255C>A	ENST00000262717.4	+	11	2091	c.1693C>A	c.(1693-1695)Cag>Aag	p.Q565K	CDH20_ENST00000538374.1_Missense_Mutation_p.Q565K|CDH20_ENST00000536675.2_Missense_Mutation_p.Q565K			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	565	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q565K(1)		breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TTTCCGGCAGCAGGAGCAGAG	0.522																																							uc010dps.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)|pancreas(1)	5						c.(1693-1695)CAG>AAG		cadherin 20, type 2 preproprotein							47.0	47.0	47.0					18																	59217255		2203	4300	6503	SO:0001583	missense	28316				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:59217255C>A	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1693C>A	18.37:g.59217255C>A	ENSP00000262717:p.Gln565Lys					CDH20_uc002lif.2_Missense_Mutation_p.Q559K	p.Q565K	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN			10	1705	+		Colorectal(73;0.186)	565			Cadherin 5.|Extracellular (Potential).		Q495S3	Missense_Mutation	SNP	ENST00000262717.4	37	c.1693C>A	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.755169	0.49362	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.50001	0.76;0.76;0.76	5.93	5.93	0.95920	Cadherin (4);Cadherin-like (1);	0.334830	0.34025	N	0.004322	T	0.39306	0.1073	L	0.35487	1.065	0.37576	D	0.919607	B	0.19445	0.036	B	0.32928	0.155	T	0.35500	-0.9786	10	0.28530	T	0.3	.	9.9538	0.41655	0.1389:0.7919:0.0:0.0692	.	565	Q9HBT6	CAD20_HUMAN	K	565	ENSP00000444767:Q565K;ENSP00000442226:Q565K;ENSP00000262717:Q565K	ENSP00000262717:Q565K	Q	+	1	0	CDH20	57368235	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.034000	0.41145	2.826000	0.97356	0.655000	0.94253	CAG		0.522	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891		4	31	1	0	0.00909568	0.009096	0.00987392	4	31				
NETO1	81832	broad.mit.edu	37	18	70451042	70451042	+	Nonsense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr18:70451042T>A	ENST00000327305.6	-	7	1396	c.739A>T	c.(739-741)Aaa>Taa	p.K247*	NETO1_ENST00000583169.1_Nonsense_Mutation_p.K247*|NETO1_ENST00000299430.2_Nonsense_Mutation_p.K246*	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	247	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.K247*(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		AACTTAGCTTTCAAATCCTCC	0.468																																							uc002lkw.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(2)	4						c.(739-741)AAA>TAA		neuropilin- and tolloid-like protein 1 isoform 3							186.0	160.0	168.0					18																	70451042		2203	4300	6503	SO:0001587	stop_gained	81832				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity	g.chr18:70451042T>A	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.739A>T	18.37:g.70451042T>A	ENSP00000313088:p.Lys247*					NETO1_uc002lkx.1_Nonsense_Mutation_p.K246*|NETO1_uc002lky.1_Nonsense_Mutation_p.K247*	p.K247*	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN		READ - Rectum adenocarcinoma(1;0.0487)	7	1023	-		Esophageal squamous(42;0.129)	247			CUB 2.|Extracellular (Potential).		Q86W85|Q8ND78|Q8TDF4	Nonsense_Mutation	SNP	ENST00000327305.6	37	c.739A>T	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	T	41	9.130241	0.99075	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	.	.	.	5.27	5.27	0.74061	.	0.086828	0.48286	D	0.000200	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.8736	15.5016	0.75703	0.0:0.0:0.0:1.0	.	.	.	.	X	247;246	.	ENSP00000299430:K246X	K	-	1	0	NETO1	68602022	1.000000	0.71417	0.833000	0.33012	0.948000	0.59901	5.021000	0.64072	2.102000	0.63906	0.528000	0.53228	AAA		0.468	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		33	105	0	0	0	0.009535	0	33	105				
ATP9B	374868	broad.mit.edu	37	18	77133995	77133995	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr18:77133995G>T	ENST00000426216.2	+	28	3185	c.3168G>T	c.(3166-3168)ctG>ctT	p.L1056L	ATP9B_ENST00000307671.7_Silent_p.L1056L|ATP9B_ENST00000543761.1_Silent_p.L377L	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	1056					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.L1056L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CCGAGCTGCTGATGGTGGCGC	0.597																																							uc002lmx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(3166-3168)CTG>CTT		ATPase, class II, type 9B							139.0	109.0	119.0					18																	77133995		2203	4300	6503	SO:0001819	synonymous_variant	374868				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr18:77133995G>T	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.3168G>T	18.37:g.77133995G>T						ATP9B_uc002lmw.1_Silent_p.L1056L|ATP9B_uc002lna.2_Silent_p.L82L|ATP9B_uc002lnb.1_3'UTR|ATP9B_uc010drb.2_RNA	p.L1056L	NM_198531	NP_940933	O43861	ATP9B_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)	28	3182	+		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)	1056			Helical; (Potential).		O60872|Q08AD8|Q08AD9	Silent	SNP	ENST00000426216.2	37	c.3168G>T	CCDS12014.1																																																																																				0.597	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531		3	42	1	0	0.00909568	0.009096	0.00987392	3	42				
NFIC	4782	broad.mit.edu	37	19	3452574	3452574	+	Silent	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:3452574C>T	ENST00000443272.2	+	8	1230	c.1179C>T	c.(1177-1179)gcC>gcT	p.A393A	NFIC_ENST00000341919.3_Silent_p.A393A|NFIC_ENST00000590282.1_Silent_p.A393A|NFIC_ENST00000395111.3_Silent_p.A384A|NFIC_ENST00000586919.1_Silent_p.A360A|NFIC_ENST00000589123.1_Silent_p.A384A|NFIC_ENST00000346156.5_Silent_p.A360A	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	393					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A384A(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		CCCACACGGCCATCCGCTACC	0.657																																							uc010xhi.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1177-1179)GCC>GCT		nuclear factor I/C isoform 2							185.0	158.0	167.0					19																	3452574		2203	4300	6503	SO:0001819	synonymous_variant	4782				DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:3452574C>T	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.1179C>T	19.37:g.3452574C>T						NFIC_uc002lxo.2_Silent_p.A384A|NFIC_uc010xhh.1_Silent_p.A384A|NFIC_uc002lxp.2_Silent_p.A393A|NFIC_uc010xhj.1_Silent_p.A393A	p.A393A	NM_205843	NP_995315	P08651	NFIC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)	8	1241	+		Hepatocellular(1079;0.137)	393					A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Silent	SNP	ENST00000443272.2	37	c.1179C>T	CCDS59330.1																																																																																				0.657	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1	NM_005597		27	118	0	0	0	0.008361	0	27	118				
DAPK3	1613	broad.mit.edu	37	19	3964952	3964952	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:3964952C>A	ENST00000545797.2	-	3	343	c.100G>T	c.(100-102)Ggc>Tgc	p.G34C	DAPK3_ENST00000301264.3_Missense_Mutation_p.G34C			O43293	DAPK3_HUMAN	death-associated protein kinase 3	34	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|chromatin modification (GO:0016568)|cytokinesis (GO:0000910)|intracellular signal transduction (GO:0035556)|negative regulation of translation (GO:0017148)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of cell motility (GO:2000145)|regulation of focal adhesion assembly (GO:0051893)|regulation of mitosis (GO:0007088)|regulation of mitotic cell cycle (GO:0007346)|regulation of smooth muscle contraction (GO:0006940)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|leucine zipper domain binding (GO:0043522)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)	p.G34C(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(2)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGCCCGTGCCCTTCTGCCGG	0.662																																							uc002lzc.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|lung(2)|ovary(1)|large_intestine(1)	7						c.(100-102)GGC>TGC		death-associated protein kinase 3							57.0	56.0	56.0					19																	3964952		2203	4300	6503	SO:0001583	missense	1613				apoptosis|chromatin modification|induction of apoptosis|intracellular protein kinase cascade	cytoplasm|PML body	ATP binding|leucine zipper domain binding|protein serine/threonine kinase activity	g.chr19:3964952C>A	AB007144	CCDS12116.1	19p13.3	2008-02-05				ENSG00000167657			2676	protein-coding gene	gene with protein product		603289				9488481	Standard	XM_005259508		Approved	ZIP, ZIPK	uc002lzc.1	O43293		ENST00000545797.2:c.100G>T	19.37:g.3964952C>A	ENSP00000442973:p.Gly34Cys					DAPK3_uc002lzd.1_Missense_Mutation_p.G34C	p.G34C	NM_001348	NP_001339	O43293	DAPK3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)	2	193	-		Hepatocellular(1079;0.137)	34			Protein kinase.		A0AVN4|B3KQE2|Q05JY4	Missense_Mutation	SNP	ENST00000545797.2	37	c.100G>T	CCDS12116.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106651	0.77096	.	.	ENSG00000167657	ENST00000301264;ENST00000545797	T;T	0.67171	-0.25;-0.25	5.7	3.45	0.39498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.183408	0.44483	D	0.000460	T	0.63931	0.2553	L	0.49640	1.575	0.43095	D	0.994779	B	0.25609	0.13	B	0.42495	0.389	T	0.66110	-0.6005	10	0.87932	D	0	.	2.4516	0.04519	0.2364:0.4794:0.0:0.2841	.	34	O43293	DAPK3_HUMAN	C	34	ENSP00000301264:G34C;ENSP00000442973:G34C	ENSP00000301264:G34C	G	-	1	0	DAPK3	3915952	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	1.995000	0.40767	1.412000	0.46977	0.561000	0.74099	GGC		0.662	DAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457817.2	NM_001348		5	45	1	0	8.12818e-05	0.001984	9.76344e-05	5	45				
INSR	3643	broad.mit.edu	37	19	7174600	7174600	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:7174600C>T	ENST00000302850.5	-	4	1259	c.1117G>A	c.(1117-1119)Gga>Aga	p.G373R	INSR_ENST00000341500.5_Missense_Mutation_p.G373R	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	373					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TCACTGCCTCCTCGAATGTTG	0.602																																							uc002mgd.1		NA																	0				ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12						c.(1117-1119)GGA>AGA		insulin receptor isoform Long precursor	Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						129.0	100.0	110.0					19																	7174600		2203	4300	6503	SO:0001583	missense	3643				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding	g.chr19:7174600C>T	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.1117G>A	19.37:g.7174600C>T	ENSP00000303830:p.Gly373Arg					INSR_uc002mge.1_Missense_Mutation_p.G373R|INSR_uc002mgf.2_Missense_Mutation_p.G373R	p.G373R	NM_000208	NP_000199	P06213	INSR_HUMAN			4	1226	-			373					Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	c.1117G>A	CCDS12176.1	.	.	.	.	.	.	.	.	.	.	C	8.977	0.974341	0.18736	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	D;D	0.82711	-1.64;-1.64	4.66	4.66	0.58398	EGF receptor, L domain (1);	0.000000	0.46442	D	0.000284	D	0.84678	0.5525	M	0.64630	1.985	0.80722	D	1	B;B;B	0.23377	0.084;0.047;0.025	P;B;B	0.44359	0.447;0.13;0.109	T	0.75679	-0.3234	10	0.02654	T	1	.	15.4721	0.75446	0.0:1.0:0.0:0.0	.	364;373;373	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	R	373	ENSP00000303830:G373R;ENSP00000342838:G373R	ENSP00000303830:G373R	G	-	1	0	INSR	7125600	0.999000	0.42202	0.986000	0.45419	0.845000	0.48019	4.531000	0.60602	2.323000	0.78572	0.456000	0.33151	GGA		0.602	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1			7	42	0	0	0	0.001984	0	7	42				
MUC16	94025	broad.mit.edu	37	19	9061893	9061893	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:9061893G>T	ENST00000397910.4	-	3	25756	c.25553C>A	c.(25552-25554)aCc>aAc	p.T8518N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8520	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T8518N(2)|p.T4151N(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGACCAAAAGGTTGTTGTTGA	0.502																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(25552-25554)ACC>AAC		mucin 16							123.0	114.0	117.0					19																	9061893		1942	4148	6090	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9061893G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.25553C>A	19.37:g.9061893G>T	ENSP00000381008:p.Thr8518Asn						p.T8518N	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	25757	-			8520			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.25553C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.162	0.215523	0.09810	.	.	ENSG00000181143	ENST00000397910	T	0.22336	1.96	3.05	0.677	0.17964	.	.	.	.	.	T	0.12178	0.0296	N	0.14661	0.345	.	.	.	P	0.52316	0.952	B	0.44315	0.446	T	0.17715	-1.0360	8	0.87932	D	0	.	4.6113	0.12404	0.1324:0.2244:0.6432:0.0	.	8518	B5ME49	.	N	8518	ENSP00000381008:T8518N	ENSP00000381008:T8518N	T	-	2	0	MUC16	8922893	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.595000	0.05727	0.269000	0.21961	0.450000	0.29827	ACC		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		21	86	1	0	1.37657e-19	0.012319	2.73963e-19	21	86				
MUC16	94025	broad.mit.edu	37	19	9090511	9090511	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:9090511G>T	ENST00000397910.4	-	1	1507	c.1304C>A	c.(1303-1305)aCa>aAa	p.T435K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	435	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T435K(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGTCATAGATGTATTCAAAGT	0.483																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(1303-1305)ACA>AAA		mucin 16							163.0	153.0	156.0					19																	9090511		1971	4162	6133	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9090511G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1304C>A	19.37:g.9090511G>T	ENSP00000381008:p.Thr435Lys						p.T435K	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			1	1508	-			435			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.1304C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.735	-0.263573	0.05754	.	.	ENSG00000181143	ENST00000397910	T	0.02472	4.28	1.38	0.297	0.15762	.	.	.	.	.	T	0.01523	0.0049	N	0.08118	0	.	.	.	B	0.27625	0.183	B	0.19666	0.026	T	0.42949	-0.9421	8	0.87932	D	0	.	3.658	0.08228	0.2604:0.0:0.7396:0.0	.	435	B5ME49	.	K	435	ENSP00000381008:T435K	ENSP00000381008:T435K	T	-	2	0	MUC16	8951511	0.000000	0.05858	0.010000	0.14722	0.069000	0.16628	-0.139000	0.10358	0.145000	0.18977	0.313000	0.20887	ACA		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		20	73	1	0	1.56452e-12	0.007413	2.78595e-12	20	73				
MAST1	22983	broad.mit.edu	37	19	12951814	12951814	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:12951814C>G	ENST00000251472.4	+	3	221	c.182C>G	c.(181-183)cCc>cGc	p.P61R	MAST1_ENST00000591495.1_Missense_Mutation_p.P57R	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1									p.P61R(2)		NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						GGCAGCAGTCCCCTGGACAGC	0.602																																							uc002mvm.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						c.(181-183)CCC>CGC		microtubule associated serine/threonine kinase							106.0	114.0	112.0					19																	12951814		2203	4300	6503	SO:0001583	missense	22983				cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:12951814C>G	AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.182C>G	19.37:g.12951814C>G	ENSP00000251472:p.Pro61Arg					MAST1_uc002mvk.2_Missense_Mutation_p.P57R|MAST1_uc002mvl.2_Missense_Mutation_p.P61R	p.P61R	NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN			3	310	+			61						Missense_Mutation	SNP	ENST00000251472.4	37	c.182C>G	CCDS32921.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363344	0.82353	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.52983	0.64	5.97	3.84	0.44239	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.292665	0.31909	N	0.006876	T	0.71953	0.3401	M	0.91196	3.185	0.47153	D	0.999332	D;P;P	0.89917	1.0;0.566;0.474	D;P;B	0.91635	0.999;0.624;0.315	T	0.75377	-0.3339	10	0.72032	D	0.01	-19.9154	9.8434	0.41013	0.0:0.7827:0.1411:0.0762	.	61;61;61	Q9Y2H9;B4DMN4;F5H2S9	MAST1_HUMAN;.;.	R	61	ENSP00000251472:P61R	ENSP00000251472:P61R	P	+	2	0	MAST1	12812814	1.000000	0.71417	0.841000	0.33234	0.993000	0.82548	5.634000	0.67833	0.854000	0.35336	0.655000	0.94253	CCC		0.602	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975		7	74	0	0	0	0.001984	0	7	74				
ZNF208	7757	broad.mit.edu	37	19	22156079	22156079	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:22156079C>A	ENST00000397126.4	-	4	1905	c.1757G>T	c.(1756-1758)tGt>tTt	p.C586F	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	586					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.C486F(2)|p.C586F(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGCTTTGCCACATTCTTCACA	0.348																																							uc002nqp.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(5)|skin(2)	7						c.(1456-1458)TGT>TTT		zinc finger protein 208							35.0	37.0	37.0					19																	22156079		2044	4216	6260	SO:0001583	missense	7757							g.chr19:22156079C>A	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1757G>T	19.37:g.22156079C>A	ENSP00000380315:p.Cys586Phe					ZNF208_uc002nqo.1_Intron	p.C486F	NM_007153	NP_009084					5	1606	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Missense_Mutation	SNP	ENST00000397126.4	37	c.1457G>T	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	8.857	0.945945	0.18356	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	D	0.85861	-2.04	2.8	2.8	0.32819	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.91516	0.7321	.	.	.	0.36110	D	0.844722	D	0.89917	1.0	D	0.91635	0.999	D	0.93791	0.7092	8	0.72032	D	0.01	.	12.3083	0.54914	0.0:1.0:0.0:0.0	.	486	O43345	ZN208_HUMAN	F	586;486	ENSP00000380315:C586F	ENSP00000380315:C586F	C	-	2	0	ZNF208	21947919	0.320000	0.24616	0.027000	0.17364	0.097000	0.18754	1.428000	0.34892	1.115000	0.41800	0.306000	0.20318	TGT		0.348	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		6	20	1	0	5.9392e-07	0.001168	8.4018e-07	6	20				
SIPA1L3	23094	broad.mit.edu	37	19	38621383	38621383	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:38621383C>A	ENST00000222345.6	+	10	3623	c.3114C>A	c.(3112-3114)atC>atA	p.I1038I		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1038	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)	p.I1038I(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TGGTCATCATCCCGCCTTTTG	0.627																																							uc002ohk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(3112-3114)ATC>ATA		signal-induced proliferation-associated 1 like							65.0	58.0	60.0					19																	38621383		2203	4300	6503	SO:0001819	synonymous_variant	23094				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr19:38621383C>A	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3114C>A	19.37:g.38621383C>A							p.I1038I	NM_015073	NP_055888	O60292	SI1L3_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)		10	3623	+			1038			PDZ.		Q2TV87	Silent	SNP	ENST00000222345.6	37	c.3114C>A	CCDS33007.1																																																																																				0.627	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278		10	38	1	0	1.58986e-06	0.008291	2.15881e-06	10	38				
KCNK6	9424	broad.mit.edu	37	19	38817960	38817960	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:38817960G>T	ENST00000263372.3	+	3	966	c.859G>T	c.(859-861)Gtg>Ttg	p.V287L		NM_004823.1	NP_004814.1	Q9Y257	KCNK6_HUMAN	potassium channel, subfamily K, member 6	287					negative regulation of systemic arterial blood pressure (GO:0003085)|potassium ion transport (GO:0006813)|regulation of resting membrane potential (GO:0060075)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)	p.V287L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)	17	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)	GGACGATCGGGTGGACATCCT	0.667																																							uc002oic.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(859-861)GTG>TTG		potassium channel, subfamily K, member 6	Ibutilide(DB00308)|Quinidine(DB00908)						63.0	60.0	61.0					19																	38817960		2203	4300	6503	SO:0001583	missense	9424					voltage-gated potassium channel complex	inward rectifier potassium channel activity	g.chr19:38817960G>T	AF117708	CCDS12513.1	19q13.1	2012-03-07				ENSG00000099337		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6281	protein-coding gene	gene with protein product		603939				10075682, 10393428, 16382106	Standard	NM_004823		Approved	K2p6.1, TWIK-2	uc002oic.3	Q9Y257		ENST00000263372.3:c.859G>T	19.37:g.38817960G>T	ENSP00000263372:p.Val287Leu					KCNK6_uc002oid.2_Missense_Mutation_p.V153L	p.V287L	NM_004823	NP_004814	Q9Y257	KCNK6_HUMAN	Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		3	969	+	all_cancers(60;5.83e-07)		287			Cytoplasmic (Potential).		Q9HB47	Missense_Mutation	SNP	ENST00000263372.3	37	c.859G>T	CCDS12513.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857449	0.51376	.	.	ENSG00000099337	ENST00000263372	T	0.22336	1.96	5.36	2.88	0.33553	.	0.974553	0.08441	N	0.945399	T	0.24275	0.0588	M	0.68317	2.08	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.23976	-1.0173	10	0.26408	T	0.33	.	10.4212	0.44352	0.191:0.0:0.809:0.0	.	287	Q9Y257	KCNK6_HUMAN	L	287	ENSP00000263372:V287L	ENSP00000263372:V287L	V	+	1	0	KCNK6	43509800	0.987000	0.35691	0.155000	0.22561	0.700000	0.40528	2.948000	0.49066	1.275000	0.44379	0.561000	0.74099	GTG		0.667	KCNK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460524.1	NM_004823		9	45	1	0	0.000673444	0.008291	0.000774556	9	45				
PAK4	10298	broad.mit.edu	37	19	39660361	39660361	+	Silent	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:39660361C>T	ENST00000593690.1	+	4	595	c.168C>T	c.(166-168)ccC>ccT	p.P56P	PAK4_ENST00000358301.3_Silent_p.P56P|PAK4_ENST00000435673.2_Silent_p.P56P|PAK4_ENST00000599470.1_Silent_p.P56P|PAK4_ENST00000360442.3_Silent_p.P56P|PAK4_ENST00000599386.1_Silent_p.P56P|PAK4_ENST00000321944.4_Silent_p.P56P	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	56	Linker.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P56P(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			TCGTCGACCCCGCCTGCATCA	0.711																																							uc002okj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|ovary(1)	4						c.(166-168)CCC>CCT		p21-activated kinase 4 isoform 1																																				SO:0001819	synonymous_variant	10298				cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr19:39660361C>T	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.168C>T	19.37:g.39660361C>T						PAK4_uc002okl.1_Silent_p.P56P|PAK4_uc002okn.1_Silent_p.P56P|PAK4_uc002okm.1_Silent_p.P56P|PAK4_uc002oko.1_Silent_p.P56P|PAK4_uc002okp.1_Silent_p.P56P	p.P56P	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)		4	629	+	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		56			Linker.		B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Silent	SNP	ENST00000593690.1	37	c.168C>T	CCDS12528.1																																																																																				0.711	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463823.1			9	23	0	0	0	0.008291	0	9	23				
IFNL1	282618	broad.mit.edu	37	19	39788642	39788642	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:39788642C>A	ENST00000333625.2	+	3	385	c.288C>A	c.(286-288)gcC>gcA	p.A96A		NM_172140.1	NP_742152.1	Q8IU54	IFNL1_HUMAN	interferon, lambda 1	96					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of cell proliferation (GO:0008285)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of memory T cell differentiation (GO:0043381)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of immune response (GO:0050778)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-28 receptor complex (GO:0032002)	interleukin-28 receptor binding (GO:0032003)|receptor binding (GO:0005102)	p.A96A(1)									CTGAGCTGGCCCTGACGCTGA	0.642																																							uc002okv.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(286-288)GCC>GCA		interleukin 29 precursor							50.0	52.0	51.0					19																	39788642		2203	4300	6503	SO:0001819	synonymous_variant	282618				defense response to virus|negative regulation of cell proliferation|negative regulation of interleukin-13 production|negative regulation of interleukin-5 production|negative regulation of memory T cell differentiation|negative regulation of transcription, DNA-dependent|negative regulation of type 2 immune response|positive regulation of immune response|positive regulation of interferon-gamma production|positive regulation of MHC class I biosynthetic process|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of STAT protein	extracellular space|interleukin-28 receptor complex	cytokine activity|interleukin-28 receptor binding	g.chr19:39788642C>A	AY129150	CCDS12531.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000182393	ENSG00000182393		"""Interferons"""	18363	protein-coding gene	gene with protein product		607403	"""interleukin 29"", ""interleukin 29 (interferon, lambda 1)"""	IL29			Standard	NM_172140		Approved	IL-29	uc002okv.3	Q8IU54		ENST00000333625.2:c.288C>A	19.37:g.39788642C>A							p.A96A	NM_172140	NP_742152	Q8IU54	IL29_HUMAN	Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)		3	385	+	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		96					A0AV25|Q17R34	Silent	SNP	ENST00000333625.2	37	c.288C>A	CCDS12531.1																																																																																				0.642	IFNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463834.1	NM_172140		5	48	1	0	8.12818e-05	0.001984	9.76344e-05	5	48				
SPTBN4	57731	broad.mit.edu	37	19	41063082	41063082	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:41063082G>A	ENST00000352632.3	+	26	5529	c.5443G>A	c.(5443-5445)Gcc>Acc	p.A1815T	SPTBN4_ENST00000392025.1_Missense_Mutation_p.A558T|SPTBN4_ENST00000595535.1_Missense_Mutation_p.A1815T|SPTBN4_ENST00000392023.1_Missense_Mutation_p.A491T|SPTBN4_ENST00000598249.1_Missense_Mutation_p.A1815T|SPTBN4_ENST00000338932.3_Missense_Mutation_p.A1815T			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1815					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.A491T(1)|p.A1815T(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACTGAACGAGGCCTGGGCTGA	0.632																																							uc002ony.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(5443-5445)GCC>ACC		spectrin, beta, non-erythrocytic 4 isoform							32.0	33.0	33.0					19																	41063082		2202	4300	6502	SO:0001583	missense	57731				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton	g.chr19:41063082G>A	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5443G>A	19.37:g.41063082G>A	ENSP00000263373:p.Ala1815Thr					SPTBN4_uc002onx.2_Missense_Mutation_p.A1815T|SPTBN4_uc002onz.2_Missense_Mutation_p.A1815T|SPTBN4_uc010egx.2_Missense_Mutation_p.A558T|SPTBN4_uc002ooa.2_Missense_Mutation_p.A491T	p.A1815T	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)		26	5529	+			1815			Spectrin 15.		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	c.5443G>A	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226415	0.79576	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	3.49	3.49	0.39957	.	0.086713	0.44902	D	0.000403	T	0.64472	0.2601	M	0.68728	2.09	0.41501	D	0.988285	D;D;D;D	0.89917	0.995;0.998;1.0;1.0	P;D;D;D	0.78314	0.886;0.911;0.991;0.984	T	0.66594	-0.5884	10	0.41790	T	0.15	.	14.2851	0.66240	0.0:0.0:1.0:0.0	.	558;491;1815;1815	C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;SPTN4_HUMAN;.	T	1815;1815;1815;558;491	ENSP00000263373:A1815T;ENSP00000340345:A1815T;ENSP00000375879:A558T;ENSP00000375877:A491T	ENSP00000340345:A1815T	A	+	1	0	SPTBN4	45754922	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.547000	0.45786	1.946000	0.56461	0.455000	0.32223	GCC		0.632	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			6	25	0	0	0	0.00308	0	6	25				
RASIP1	54922	broad.mit.edu	37	19	49243435	49243435	+	Silent	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:49243435C>T	ENST00000222145.4	-	2	309	c.105G>A	c.(103-105)ctG>ctA	p.L35L	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	35					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)		p.L35L(2)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		AGCGCCGCCCCAGCTTCGCCA	0.647																																							uc002pki.2		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(103-105)CTG>CTA		Ras-interacting protein 1							32.0	37.0	36.0					19																	49243435		2200	4293	6493	SO:0001819	synonymous_variant	54922				signal transduction	Golgi stack|perinuclear region of cytoplasm		g.chr19:49243435C>T	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.105G>A	19.37:g.49243435C>T							p.L35L	NM_017805	NP_060275	Q5U651	RAIN_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)	2	302	-		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	35					Q6U676	Silent	SNP	ENST00000222145.4	37	c.105G>A	CCDS12731.1																																																																																				0.647	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805		6	52	0	0	0	0.00308	0	6	52				
SYT3	84258	broad.mit.edu	37	19	51135639	51135639	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:51135639C>A	ENST00000338916.4	-	2	1211	c.578G>T	c.(577-579)gGa>gTa	p.G193V	SYT3_ENST00000600079.1_Missense_Mutation_p.G193V|SYT3_ENST00000544769.1_Missense_Mutation_p.G193V|SYT3_ENST00000593901.1_Missense_Mutation_p.G193V	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	193					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.G193V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		AGAGCCTGCTCCCCCCTCAGA	0.637																																							uc002pst.2		NA																	1	Substitution - Missense(1)	p.G193R(1)	lung(1)	ovary(2)|breast(1)	3						c.(577-579)GGA>GTA		synaptotagmin III							40.0	42.0	42.0					19																	51135639		2203	4300	6503	SO:0001583	missense	84258					cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr19:51135639C>A	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.578G>T	19.37:g.51135639C>A	ENSP00000340914:p.Gly193Val					SYT3_uc002psv.2_Missense_Mutation_p.G193V|SYT3_uc010ycd.1_Missense_Mutation_p.G193V	p.G193V	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)	2	1212	-		all_neural(266;0.131)	193			Cytoplasmic (Potential).		Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	c.578G>T	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	C	9.132	1.011572	0.19277	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.59083	0.29;0.29	5.24	4.17	0.49024	.	0.377447	0.20698	U	0.087331	T	0.33789	0.0875	N	0.08118	0	0.20307	N	0.999913	B	0.26002	0.139	B	0.19666	0.026	T	0.22556	-1.0213	10	0.59425	D	0.04	.	7.5339	0.27700	0.0:0.7408:0.1696:0.0896	.	193	Q9BQG1	SYT3_HUMAN	V	193	ENSP00000340914:G193V;ENSP00000438883:G193V	ENSP00000340914:G193V	G	-	2	0	SYT3	55827451	0.028000	0.19301	0.012000	0.15200	0.598000	0.36846	1.333000	0.33816	1.277000	0.44412	0.655000	0.94253	GGA		0.637	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298		8	38	1	0	1.06961e-07	0.00308	1.57342e-07	8	38				
SIGLEC8	27181	broad.mit.edu	37	19	51960764	51960764	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:51960764C>A	ENST00000321424.3	-	2	750	c.684G>T	c.(682-684)ttG>ttT	p.L228F	SIGLEC8_ENST00000340550.5_Intron|SIGLEC8_ENST00000597352.1_5'UTR|SIGLEC8_ENST00000430817.1_Intron	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	228	Ig-like C2-type 1.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.L228F(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CTGTCCCAGGCAAGGTCACCT	0.647																																							uc002pwt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5						c.(682-684)TTG>TTT		sialic acid binding Ig-like lectin 8 precursor							56.0	51.0	53.0					19																	51960764		2203	4300	6503	SO:0001583	missense	27181				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity	g.chr19:51960764C>A	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.684G>T	19.37:g.51960764C>A	ENSP00000321077:p.Leu228Phe					SIGLEC8_uc010yda.1_Intron|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Intron	p.L228F	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)	2	751	-		all_neural(266;0.0199)	228			Ig-like C2-type 1.|Extracellular (Potential).		Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	c.684G>T	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	0.721	-0.783496	0.02907	.	.	ENSG00000105366	ENST00000321424	T	0.11277	2.79	2.74	0.214	0.15249	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.903833	0.09020	N	0.860308	T	0.03011	0.0089	N	0.01202	-0.96	0.09310	N	0.999998	B	0.09022	0.002	B	0.13407	0.009	T	0.42616	-0.9441	10	0.02654	T	1	.	8.9094	0.35543	0.0:0.5921:0.4079:0.0	.	228	Q9NYZ4	SIGL8_HUMAN	F	228	ENSP00000321077:L228F	ENSP00000321077:L228F	L	-	3	2	SIGLEC8	56652576	0.001000	0.12720	0.010000	0.14722	0.656000	0.38851	-0.432000	0.06956	0.009000	0.14813	0.398000	0.26397	TTG		0.647	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442		5	15	1	0	5.9392e-07	0.001168	8.4018e-07	5	15				
SIGLEC14	100049587	broad.mit.edu	37	19	52149086	52149086	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:52149086G>A	ENST00000360844.6	-	3	690	c.649C>T	c.(649-651)Cgc>Tgc	p.R217C	SIGLEC5_ENST00000222107.4_Intron|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000534261.2_5'Flank|SIGLEC5_ENST00000429354.3_Intron	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	217	Ig-like C2-type 1.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.R217C(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		GCTCCTTGGCGTTTCACCTGA	0.642																																							uc002pxf.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(649-651)CGC>TGC		sialic acid binding Ig-like lectin 14 precursor							83.0	78.0	80.0					19																	52149086		2071	4200	6271	SO:0001583	missense	100049587				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding	g.chr19:52149086G>A	AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.649C>T	19.37:g.52149086G>A	ENSP00000354090:p.Arg217Cys						p.R217C	NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)	3	769	-		all_neural(266;0.0299)	217			Ig-like C2-type 1.|Extracellular (Potential).		Q6UXG0	Missense_Mutation	SNP	ENST00000360844.6	37	c.649C>T	CCDS42604.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.636410	0.67130	.	.	ENSG00000254415	ENST00000360844	D	0.86030	-2.06	3.1	-2.51	0.06365	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.859160	0.03111	N	0.162492	T	0.72358	0.3450	N	0.03608	-0.345	0.09310	N	1	D	0.76494	0.999	P	0.51324	0.666	T	0.63466	-0.6631	10	0.72032	D	0.01	.	0.6088	0.00757	0.2484:0.1895:0.3691:0.1931	.	217	Q08ET2	SIG14_HUMAN	C	217	ENSP00000354090:R217C	ENSP00000354090:R217C	R	-	1	0	SIGLEC14	56840898	0.000000	0.05858	0.000000	0.03702	0.768000	0.43524	-0.391000	0.07323	-0.501000	0.06605	0.514000	0.50259	CGC		0.642	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466899.2	NM_001098612		10	46	0	0	0	0.008291	0	10	46				
ZNF534	147658	broad.mit.edu	37	19	52941035	52941035	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:52941035C>T	ENST00000332323.6	+	4	422	c.361C>T	c.(361-363)Caa>Taa	p.Q121*	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000433050.1_Nonsense_Mutation_p.Q108*	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q121*(2)		central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						ACTTAAAAATCAACATGGATT	0.353																																							uc002pzk.2		NA																	2	Substitution - Nonsense(2)		lung(1)|breast(1)		0						c.(361-363)CAA>TAA		zinc finger protein 534 isoform 2							65.0	55.0	58.0					19																	52941035		1568	3582	5150	SO:0001587	stop_gained	147658				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52941035C>T	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.361C>T	19.37:g.52941035C>T	ENSP00000327538:p.Gln121*					ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Nonsense_Mutation_p.Q108*	p.Q121*	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN			4	422	+			121					Q76KX9	Nonsense_Mutation	SNP	ENST00000332323.6	37	c.361C>T	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	C	12.09	1.833819	0.32421	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	.	.	.	1.69	-1.5	0.08691	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	4.4503	0.11617	0.2528:0.5531:0.1941:0.0	.	.	.	.	X	121;108;120	.	ENSP00000327538:Q121X	Q	+	1	0	ZNF534	57632847	0.000000	0.05858	0.004000	0.12327	0.184000	0.23303	-0.088000	0.11198	-0.093000	0.12396	0.205000	0.17691	CAA		0.353	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512		4	34	0	0	0	0.000602	0	4	34				
ZNF347	84671	broad.mit.edu	37	19	53643937	53643937	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:53643937C>A	ENST00000334197.7	-	5	2212	c.2144G>T	c.(2143-2145)gGg>gTg	p.G715V	ZNF347_ENST00000452676.2_Missense_Mutation_p.G716V|ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Missense_Mutation_p.G716V	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	715					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G715V(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		AAAGGCTTTCCCACACTGATT	0.428																																					Melanoma(64;205 1597 17324 45721)	Melanoma(64;205 1597 17324 45721)	uc002qbb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2143-2145)GGG>GTG		zinc finger protein 347							158.0	148.0	151.0					19																	53643937		2203	4300	6503	SO:0001583	missense	84671				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53643937C>A	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2144G>T	19.37:g.53643937C>A	ENSP00000334146:p.Gly715Val					ZNF347_uc010eql.1_Missense_Mutation_p.G716V|ZNF347_uc002qbc.1_Missense_Mutation_p.G716V	p.G715V	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN		GBM - Glioblastoma multiforme(134;0.0179)	5	2213	-			715			C2H2-type 17.		B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	c.2144G>T	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.096104	0.36952	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.58358	0.34;0.34	2.69	0.431	0.16523	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.73705	0.3621	M	0.93678	3.445	0.40297	D	0.978568	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.989	T	0.71892	-0.4455	9	0.87932	D	0	.	5.9172	0.19061	0.0:0.6183:0.0:0.3817	.	716;715	G5E9N4;Q96SE7	.;ZN347_HUMAN	V	715;716	ENSP00000334146:G715V;ENSP00000405218:G716V	ENSP00000334146:G715V	G	-	2	0	ZNF347	58335749	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.414000	0.21164	0.050000	0.15949	0.561000	0.74099	GGG		0.428	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584		20	141	1	0	7.41877e-09	0.012319	1.14092e-08	20	141				
LILRA4	23547	broad.mit.edu	37	19	54849250	54849250	+	Nonsense_Mutation	SNP	G	G	T	rs149766788	byFrequency	TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:54849250G>T	ENST00000291759.4	-	4	668	c.612C>A	c.(610-612)taC>taA	p.Y204*	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	204	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.Y204*(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		CCGACCACACGTATGGGGTGT	0.552													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16760	0.0		0.0	False		,,,				2504	0.0						uc002qfj.2		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(610-612)TAC>TAA		leukocyte immunoglobulin-like receptor subfamily		G	stop/TYR	3,4403		0,3,2200	84.0	72.0	76.0		612	-5.1	0.0	19	dbSNP_134	76	0,8600		0,0,4300	no	stop-gained	LILRA4	NM_012276.3		0,3,6500	TT,TG,GG		0.0,0.0681,0.0231		204/500	54849250	3,13003	2203	4300	6503	SO:0001587	stop_gained	23547					integral to membrane	receptor activity	g.chr19:54849250G>T	AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.612C>A	19.37:g.54849250G>T	ENSP00000291759:p.Tyr204*					LILRA4_uc002qfi.2_Nonsense_Mutation_p.Y138*	p.Y204*	NM_012276	NP_036408	P59901	LIRA4_HUMAN		GBM - Glioblastoma multiforme(193;0.0565)	4	669	-	Ovarian(34;0.19)		204			Extracellular (Potential).|Ig-like C2-type 2.		Q32MC4	Nonsense_Mutation	SNP	ENST00000291759.4	37	c.612C>A	CCDS12890.1	.	.	.	.	.	.	.	.	.	.	.	11.65	1.703047	0.30232	6.81E-4	0.0	ENSG00000239961	ENST00000291759	.	.	.	2.54	-5.07	0.02938	.	1.804890	0.02862	N	0.130386	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.8527	0.03172	0.412:0.1803:0.2949:0.1128	.	.	.	.	X	204	.	ENSP00000291759:Y204X	Y	-	3	2	LILRA4	59541062	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.688000	0.01925	-1.565000	0.01676	-1.087000	0.02190	TAC		0.552	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276		8	44	1	0	0.00621372	0.006214	0.00681829	8	44				
LILRA2	11027	broad.mit.edu	37	19	55086241	55086241	+	Silent	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:55086241G>C	ENST00000251377.3	+	5	529	c.396G>C	c.(394-396)gtG>gtC	p.V132V	LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000251376.3_Silent_p.V132V|LILRA2_ENST00000391737.1_Silent_p.V120V|LILRA2_ENST00000495786.1_3'UTR|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000391738.3_Silent_p.V132V			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	132	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.V132V(2)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CCAGCCCTGTGGTGACCTTAG	0.562																																							uc002qgg.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(394-396)GTG>GTC		leukocyte immunoglobulin-like receptor,							143.0	133.0	136.0					19																	55086241		2203	4300	6503	SO:0001819	synonymous_variant	11027				defense response	integral to membrane	antigen binding|receptor activity	g.chr19:55086241G>C	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.396G>C	19.37:g.55086241G>C						LILRA2_uc010ern.2_Silent_p.V132V|LILRA2_uc002qgf.2_Silent_p.V132V|LILRA2_uc010yfe.1_Silent_p.V132V|LILRA2_uc010yff.1_Silent_p.V120V|LILRA2_uc010ero.2_Silent_p.V120V|LILRA2_uc010yfg.1_Silent_p.V132V	p.V132V	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN		GBM - Glioblastoma multiforme(193;0.0963)	4	485	+			132			Extracellular (Potential).|Ig-like C2-type 2.		O75020	Silent	SNP	ENST00000251377.3	37	c.396G>C	CCDS46179.1																																																																																				0.562	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2			22	79	0	0	0	0.004656	0	22	79				
LILRA1	11024	broad.mit.edu	37	19	55107774	55107774	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:55107774C>A	ENST00000251372.3	+	7	1261	c.1079C>A	c.(1078-1080)gCg>gAg	p.A360E	LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRA1_ENST00000453777.1_Intron|LILRB1_ENST00000396321.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	360	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.A360V(1)|p.A360E(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CTGACCAAGGCGGGAGCAGCT	0.587																																							uc002qgh.1		NA																	2	Substitution - Missense(2)		lung(1)|prostate(1)	skin(2)|ovary(1)	3						c.(1078-1080)GCG>GAG		leukocyte immunoglobulin-like receptor,							112.0	110.0	111.0					19																	55107774		2203	4300	6503	SO:0001583	missense	11024				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity	g.chr19:55107774C>A	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1079C>A	19.37:g.55107774C>A	ENSP00000251372:p.Ala360Glu					LILRA2_uc010yfg.1_Missense_Mutation_p.A358E|LILRA1_uc010yfh.1_Missense_Mutation_p.A360E	p.A360E	NM_006863	NP_006854	O75019	LIRA1_HUMAN		GBM - Glioblastoma multiforme(193;0.0348)	7	1261	+			360			Ig-like C2-type 4.|Extracellular (Potential).		O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	37	c.1079C>A	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.410844	0.00193	.	.	ENSG00000104974	ENST00000251372	T	0.00642	6.02	1.62	-0.729	0.11158	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.783991	0.11076	N	0.602416	T	0.00178	0.0005	N	0.00109	-2.105	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.40459	-0.9562	10	0.02654	T	1	.	3.6261	0.08113	0.3243:0.4909:0.1848:0.0	.	360	O75019	LIRA1_HUMAN	E	360	ENSP00000251372:A360E	ENSP00000251372:A360E	A	+	2	0	LILRA1	59799586	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.891000	0.04135	-0.769000	0.04620	-3.403000	0.00039	GCG		0.587	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863		14	60	1	0	2.31682e-05	0.003163	2.93947e-05	14	60				
LILRB4	11006	broad.mit.edu	37	19	55175419	55175419	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:55175419C>A	ENST00000391736.1	+	5	593	c.278C>A	c.(277-279)gCa>gAa	p.A93E	LILRB4_ENST00000391733.3_Missense_Mutation_p.A93E|LILRB4_ENST00000430952.2_Missense_Mutation_p.A93E|LILRB4_ENST00000391734.3_Missense_Mutation_p.A93E|LILRB4_ENST00000270452.2_Missense_Mutation_p.A93E	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	93	Ig-like C2-type 1.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.A93E(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		GAGGACTATGCAGGGAGATAC	0.577																																							uc002qgp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(277-279)GCA>GAA		leukocyte immunoglobulin-like receptor,							286.0	249.0	261.0					19																	55175419		2203	4300	6503	SO:0001583	missense	11006					integral to membrane|plasma membrane	antigen binding|receptor activity	g.chr19:55175419C>A	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.278C>A	19.37:g.55175419C>A	ENSP00000375616:p.Ala93Glu					LILRB4_uc002qgo.1_Missense_Mutation_p.A134E|LILRB4_uc002qgq.2_Missense_Mutation_p.A93E|LILRB4_uc010ers.1_Missense_Mutation_p.A6E|LILRB4_uc002qgr.2_Missense_Mutation_p.A134E|LILRB4_uc010ert.2_Missense_Mutation_p.A134E|LILRB4_uc010eru.2_Missense_Mutation_p.A122E	p.A93E	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN		GBM - Glioblastoma multiforme(193;0.035)	3	640	+			93			Ig-like C2-type 1.|Extracellular (Potential).		A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	c.278C>A	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106325	0.37145	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5;2.5	2.43	1.36	0.22044	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.39600	0.1084	M	0.91038	3.17	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.998	D;D;D;D;D	0.91635	0.999;0.999;0.986;0.999;0.984	T	0.12192	-1.0557	9	0.87932	D	0	.	5.212	0.15322	0.0:0.8196:0.0:0.1804	.	93;93;93;93;93	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	E	93	ENSP00000375616:A93E;ENSP00000270452:A93E;ENSP00000408995:A93E;ENSP00000375614:A93E;ENSP00000375613:A93E;ENSP00000401962:A93E	ENSP00000270452:A93E	A	+	2	0	LILRB4	59867231	0.103000	0.21917	0.023000	0.16930	0.004000	0.04260	0.707000	0.25704	0.358000	0.24211	-0.481000	0.04817	GCA		0.577	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3			24	173	1	0	5.62743e-28	0.007291	1.17166e-27	24	173				
BRSK1	84446	broad.mit.edu	37	19	55805585	55805585	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:55805585C>A	ENST00000309383.1	+	6	856	c.579C>A	c.(577-579)tcC>tcA	p.S193S	BRSK1_ENST00000590333.1_Silent_p.S209S|BRSK1_ENST00000585418.1_Silent_p.S193S	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	193	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.S193S(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		CCCTCAGGTCCCCCCATTATG	0.622																																							uc002qkg.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6						c.(577-579)TCC>TCA		BR serine/threonine kinase 1							84.0	87.0	86.0					19																	55805585		2203	4300	6503	SO:0001819	synonymous_variant	84446				establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity	g.chr19:55805585C>A	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.579C>A	19.37:g.55805585C>A						BRSK1_uc002qkf.2_Silent_p.S209S	p.S193S	NM_032430	NP_115806	Q8TDC3	BRSK1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)	6	856	+		Renal(1328;0.245)	193			Protein kinase.		F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	37	c.579C>A	CCDS12921.1																																																																																				0.622	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430		16	81	1	0	6.94344e-10	0.006122	1.12312e-09	16	81				
ZSCAN5B	342933	broad.mit.edu	37	19	56701647	56701647	+	Missense_Mutation	SNP	C	C	T	rs201048831		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:56701647C>T	ENST00000586855.2	-	5	1350	c.1037G>A	c.(1036-1038)gGc>gAc	p.G346D	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.G346D			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	346					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G346D(2)		breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GGCTTCTTGGCCATCTGGGTG	0.547																																							uc010ygh.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1036-1038)GGC>GAC		zinc finger and SCAN domain containing 5B							80.0	85.0	83.0					19																	56701647		2202	4299	6501	SO:0001583	missense	342933				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:56701647C>T		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.1037G>A	19.37:g.56701647C>T	ENSP00000466072:p.Gly346Asp						p.G346D	NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN			4	1037	-			346						Missense_Mutation	SNP	ENST00000586855.2	37	c.1037G>A	CCDS46203.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091013	0.36855	.	.	ENSG00000197213	ENST00000358992	T	0.15372	2.43	2.29	-0.233	0.13078	.	.	.	.	.	T	0.37376	0.1001	M	0.81942	2.565	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.10847	-1.0612	9	0.62326	D	0.03	.	5.8589	0.18734	0.2174:0.5701:0.2124:0.0	.	346	A6NJL1	ZSA5B_HUMAN	D	346	ENSP00000351883:G346D	ENSP00000351883:G346D	G	-	2	0	ZSCAN5B	61393459	0.000000	0.05858	0.003000	0.11579	0.043000	0.13939	-0.111000	0.10807	0.032000	0.15435	0.306000	0.20318	GGC		0.547	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456		17	94	0	0	0	0.007413	0	17	94				
ZNF805	390980	broad.mit.edu	37	19	57765064	57765064	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:57765064G>T	ENST00000414468.2	+	4	877	c.877G>T	c.(877-879)Gga>Tga	p.G293*	ZNF805_ENST00000354309.4_Nonsense_Mutation_p.G160*|ZNF805_ENST00000535550.1_Nonsense_Mutation_p.G160*	NM_001023563.3	NP_001018857.2	Q5CZA5	ZN805_HUMAN	zinc finger protein 805	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G293*(1)		breast(1)|endometrium(3)|kidney(3)|lung(1)|stomach(1)	9						CAGTGAATGTGGAAAGGCCTT	0.493																																							uc010ygt.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(877-879)GGA>TGA		zinc finger protein 805 isoform 1							44.0	44.0	44.0					19																	57765064		692	1591	2283	SO:0001587	stop_gained	390980				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57765064G>T	AF024708	CCDS46207.1, CCDS46208.1	19q13.43	2013-01-08			ENSG00000204524	ENSG00000204524		"""Zinc fingers, C2H2-type"", ""-"""	23272	protein-coding gene	gene with protein product							Standard	NM_001023563		Approved		uc010ygt.2	Q5CZA5		ENST00000414468.2:c.877G>T	19.37:g.57765064G>T	ENSP00000412999:p.Gly293*					ZNF805_uc010ygu.1_Nonsense_Mutation_p.G160*	p.G293*	NM_001023563	NP_001018857	Q5CZA5	ZN805_HUMAN			4	1084	+			293			C2H2-type 4.		B4DNM5	Nonsense_Mutation	SNP	ENST00000414468.2	37	c.877G>T	CCDS46207.1	.	.	.	.	.	.	.	.	.	.	G	36	5.846049	0.97016	.	.	ENSG00000204524	ENST00000535550;ENST00000414468;ENST00000354309	.	.	.	4.34	4.34	0.51931	.	0.360316	0.20372	N	0.093635	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	16.1238	0.81380	0.0:0.0:1.0:0.0	.	.	.	.	X	160;293;160	.	ENSP00000365414:G160X	G	+	1	0	ZNF805	62456876	1.000000	0.71417	0.993000	0.49108	0.498000	0.33706	6.943000	0.75934	2.409000	0.81822	0.655000	0.94253	GGA		0.493	ZNF805-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465722.1	NM_001023563		5	27	1	0	8.12818e-05	0.001984	9.76344e-05	5	27				
ZNF548	147694	broad.mit.edu	37	19	57910758	57910758	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:57910758G>T	ENST00000366197.5	+	3	1353	c.1103G>T	c.(1102-1104)aGt>aTt	p.S368I	AC003002.6_ENST00000596400.1_Intron|AC004076.7_ENST00000597410.1_Intron|ZNF548_ENST00000336128.7_Missense_Mutation_p.S380I|AC003002.6_ENST00000600421.1_Intron	NM_152909.3	NP_690873.2	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	368					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S380I(1)		breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TATGAGTGCAGTGTATGTGGG	0.393																																							uc002qom.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1102-1104)AGT>ATT		zinc finger protein 548							59.0	59.0	59.0					19																	57910758		2201	4299	6500	SO:0001583	missense	147694				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57910758G>T	AK057494	CCDS46209.1, CCDS54324.1	19q13.43	2013-01-08				ENSG00000188785		"""Zinc fingers, C2H2-type"", ""-"""	26561	protein-coding gene	gene with protein product						12477932	Standard	NM_152909		Approved	FLJ32932	uc002qon.3	Q8NEK5		ENST00000366197.5:c.1103G>T	19.37:g.57910758G>T	ENSP00000379482:p.Ser368Ile					ZNF547_uc002qpm.3_Intron|ZNF548_uc002qon.2_Missense_Mutation_p.S371I	p.S368I	NM_152909	NP_690873	Q8NEK5	ZN548_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	3	1353	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	368			C2H2-type 7.		Q96M05	Missense_Mutation	SNP	ENST00000366197.5	37	c.1103G>T	CCDS46209.1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229273	0.39399	.	.	ENSG00000188785	ENST00000336128;ENST00000366197	T;T	0.19105	2.17;2.17	2.76	1.01	0.19927	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18676	0.0448	L	0.54908	1.71	0.09310	N	0.999999	P;P	0.38978	0.6;0.652	B;B	0.40825	0.23;0.341	T	0.16512	-1.0400	9	0.39692	T	0.17	.	2.6465	0.04985	0.3635:0.2556:0.3809:0.0	.	380;368	Q8NEK5-2;Q8NEK5	.;ZN548_HUMAN	I	380;368	ENSP00000337555:S380I;ENSP00000379482:S368I	ENSP00000337555:S380I	S	+	2	0	ZNF548	62602570	0.000000	0.05858	0.004000	0.12327	0.952000	0.60782	-4.041000	0.00307	0.505000	0.28104	0.563000	0.77884	AGT		0.393	ZNF548-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465937.1	NM_152909		8	44	1	0	5.18039e-06	0.00308	6.89587e-06	8	44				
ZIK1	284307	broad.mit.edu	37	19	58101972	58101972	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:58101972A>G	ENST00000597850.1	+	4	1008	c.793A>G	c.(793-795)Agg>Ggg	p.R265G	ZIK1_ENST00000307468.4_3'UTR|ZIK1_ENST00000536878.2_Missense_Mutation_p.R252G|ZIK1_ENST00000599456.1_Missense_Mutation_p.R210G	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R265G(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TACTGGAGAAAGGCCTTGGGA	0.468																																							uc002qpg.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(793-795)AGG>GGG		zinc finger protein interacting with K protein							58.0	59.0	59.0					19																	58101972		2203	4300	6503	SO:0001583	missense	284307				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58101972A>G	AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.793A>G	19.37:g.58101972A>G	ENSP00000472867:p.Arg265Gly					ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.R210G|ZIK1_uc002qpi.2_Missense_Mutation_p.R252G|ZIK1_uc002qpj.2_Missense_Mutation_p.R162G	p.R265G	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	4	890	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)	265					O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	37	c.793A>G	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.559564	0.65538	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.19938	2.11	3.36	2.32	0.28847	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29524	0.0736	L	0.42632	1.34	0.32551	N	0.532317	P;P	0.50819	0.728;0.939	B;P	0.56278	0.297;0.795	T	0.37033	-0.9723	9	0.87932	D	0	.	8.9154	0.35579	0.8108:0.1892:0.0:0.0	.	252;265	F5H435;Q3SY52	.;ZIK1_HUMAN	G	252;246;265	ENSP00000438487:R252G	ENSP00000303820:R265G	R	+	1	2	ZIK1	62793784	0.901000	0.30685	0.397000	0.26308	0.936000	0.57629	3.634000	0.54302	0.468000	0.27243	0.528000	0.53228	AGG		0.468	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879		5	37	0	0	0	0.000602	0	5	37				
ZNF551	90233	broad.mit.edu	37	19	58196642	58196642	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr19:58196642G>T	ENST00000282296.5	+	2	279	c.94G>T	c.(94-96)Gag>Tag	p.E32*	ZNF551_ENST00000599402.1_Intron|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000596085.1_Nonsense_Mutation_p.E16*|ZNF551_ENST00000356715.4_Nonsense_Mutation_p.E16*			Q7Z340	ZN551_HUMAN	zinc finger protein 551	32	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E16*(1)		endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TATGACCTTTGAGGATGTGGC	0.493																																							uc002qpw.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(46-48)GAG>TAG		zinc finger protein 551							232.0	195.0	208.0					19																	58196642		2203	4300	6503	SO:0001587	stop_gained	90233				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58196642G>T	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.94G>T	19.37:g.58196642G>T	ENSP00000282296:p.Glu32*					ZNF551_uc002qpv.3_Intron|ZNF776_uc002qpx.2_Intron	p.E16*	NM_138347	NP_612356	Q7Z340	ZN551_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	2	269	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	32			KRAB.		B4DU22|P17034|Q8N246|Q9BRY1	Nonsense_Mutation	SNP	ENST00000282296.5	37	c.46G>T	CCDS12959.2	.	.	.	.	.	.	.	.	.	.	G	36	5.828942	0.96996	.	.	ENSG00000204519	ENST00000356715;ENST00000282296;ENST00000359821	.	.	.	2.06	2.06	0.26882	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	10.1498	0.42786	0.0:0.0:1.0:0.0	.	.	.	.	X	32;16;4	.	ENSP00000282296:E16X	E	+	1	0	ZNF551	62888454	0.000000	0.05858	0.046000	0.18839	0.660000	0.38997	0.153000	0.16323	1.457000	0.47850	0.462000	0.41574	GAG		0.493	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347		19	101	1	0	1.67942e-08	0.006122	2.54419e-08	19	101				
LPIN1	23175	broad.mit.edu	37	2	11922600	11922600	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:11922600G>T	ENST00000256720.2	+	7	1216	c.1123G>T	c.(1123-1125)Gca>Tca	p.A375S	LPIN1_ENST00000396097.1_Missense_Mutation_p.A105S|LPIN1_ENST00000396099.1_Missense_Mutation_p.A417S|LPIN1_ENST00000396098.1_Missense_Mutation_p.A417S|LPIN1_ENST00000425416.2_Missense_Mutation_p.A381S|LPIN1_ENST00000449576.2_Missense_Mutation_p.A460S	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	375					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.A375S(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		AGTCCAGACAGCAAACAAGAC	0.522																																							uc010yjn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|skin(1)	4						c.(1123-1125)GCA>TCA		lipin 1							69.0	73.0	71.0					2																	11922600		2203	4300	6503	SO:0001583	missense	23175				fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity	g.chr2:11922600G>T	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.1123G>T	2.37:g.11922600G>T	ENSP00000256720:p.Ala375Ser					LPIN1_uc010yjm.1_Missense_Mutation_p.A460S|LPIN1_uc002rbt.2_Missense_Mutation_p.A375S|LPIN1_uc002rbs.2_Missense_Mutation_p.A411S	p.A375S	NM_145693	NP_663731	Q14693	LPIN1_HUMAN		Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)	8	1397	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		375					A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	37	c.1123G>T	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	G	6.854	0.526775	0.13066	.	.	ENSG00000134324	ENST00000449576;ENST00000396098;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097	T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	5.28	2.14	0.27477	.	0.592891	0.18602	N	0.136433	T	0.43277	0.1240	N	0.19112	0.55	0.09310	N	1	B;B;B	0.12013	0.005;0.0;0.005	B;B;B	0.12156	0.006;0.001;0.007	T	0.18681	-1.0329	10	0.11794	T	0.64	-8.3562	6.0469	0.19766	0.2124:0.0:0.622:0.1656	.	460;375;417	F5GY24;Q14693;A8MU38	.;LPIN1_HUMAN;.	S	460;417;417;381;375;105	ENSP00000397908:A460S;ENSP00000379405:A417S;ENSP00000379406:A417S;ENSP00000401522:A381S;ENSP00000256720:A375S;ENSP00000379404:A105S	ENSP00000256720:A375S	A	+	1	0	LPIN1	11840051	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	0.808000	0.27154	0.545000	0.28902	0.655000	0.94253	GCA		0.522	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693		9	45	1	0	2.17888e-05	0.006214	2.77312e-05	9	45				
NBAS	51594	broad.mit.edu	37	2	15358906	15358906	+	Silent	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:15358906G>A	ENST00000281513.5	-	48	6448	c.6423C>T	c.(6421-6423)ccC>ccT	p.P2141P	NBAS_ENST00000441750.1_Silent_p.P2021P	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	2141					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.P2141P(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CCTGTCTCTGGGGCCAGGAGG	0.493																																							uc002rcc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|liver(1)|skin(1)	4						c.(6421-6423)CCC>CCT		neuroblastoma-amplified protein							72.0	78.0	76.0					2																	15358906		2203	4300	6503	SO:0001819	synonymous_variant	51594							g.chr2:15358906G>A	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.6423C>T	2.37:g.15358906G>A						NBAS_uc002rcb.1_Intron|NBAS_uc010exl.1_Silent_p.P1213P|NBAS_uc002rcd.1_Intron	p.P2141P	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN			48	6449	-			2141					O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	37	c.6423C>T	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	G	3.855	-0.030990	0.07543	.	.	ENSG00000151779	ENST00000442506	T	0.20738	2.05	5.63	1.77	0.24775	.	0.101195	0.64402	D	0.000002	T	0.25457	0.0619	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.03278	-1.1053	7	0.62326	D	0.03	.	3.7671	0.08627	0.3897:0.0:0.4417:0.1686	.	.	.	.	L	1189	ENSP00000398411:P1189L	ENSP00000398411:P1189L	P	-	2	0	NBAS	15276357	1.000000	0.71417	1.000000	0.80357	0.395000	0.30598	0.596000	0.24044	0.713000	0.32060	0.591000	0.81541	CCC		0.493	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		15	83	0	0	0	0.00499	0	15	83				
VIT	5212	broad.mit.edu	37	2	37032694	37032694	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:37032694G>T	ENST00000389975.3	+	13	1533	c.1231G>T	c.(1231-1233)Gag>Tag	p.E411*	VIT_ENST00000379242.3_Nonsense_Mutation_p.E426*|VIT_ENST00000379241.3_Nonsense_Mutation_p.E389*|VIT_ENST00000401530.1_Nonsense_Mutation_p.E390*|VIT_ENST00000497382.1_Nonsense_Mutation_p.E80*|VIT_ENST00000404084.1_Nonsense_Mutation_p.E363*	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	411	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)	p.E426*(1)		autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				GGACAAAGTGGAGGAGGCTTC	0.498																																							uc002rpl.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1276-1278)GAG>TAG		vitrin							112.0	100.0	104.0					2																	37032694		2203	4300	6503	SO:0001587	stop_gained	5212					proteinaceous extracellular matrix		g.chr2:37032694G>T	AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.1231G>T	2.37:g.37032694G>T	ENSP00000374625:p.Glu411*					VIT_uc002rpm.2_Nonsense_Mutation_p.E404*|VIT_uc010ezv.2_Nonsense_Mutation_p.E382*|VIT_uc010ezw.2_Nonsense_Mutation_p.E383*	p.E426*	NM_053276	NP_444506	Q6UXI7	VITRN_HUMAN			14	1497	+		all_hematologic(82;0.248)	411			VWFA 1.		A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Nonsense_Mutation	SNP	ENST00000389975.3	37	c.1276G>T	CCDS54347.1	.	.	.	.	.	.	.	.	.	.	G	39	7.605268	0.98384	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000497382;ENST00000404084;ENST00000379241;ENST00000401530	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-33.0988	19.3832	0.94545	0.0:0.0:1.0:0.0	.	.	.	.	X	426;411;80;363;389;390	.	ENSP00000368543:E389X	E	+	1	0	VIT	36886198	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.827000	0.99397	2.569000	0.86673	0.650000	0.86243	GAG		0.498	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				12	73	1	0	3.07112e-06	0.010729	4.10156e-06	12	73				
CRIPT	9419	broad.mit.edu	37	2	46851311	46851311	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:46851311C>A	ENST00000238892.3	+	5	383	c.251C>A	c.(250-252)gCg>gAg	p.A84E	CRIPT_ENST00000486447.1_3'UTR	NM_014171.4	NP_054890.1	Q9P021	CRIPT_HUMAN	cysteine-rich PDZ-binding protein	84					cytoplasmic microtubule organization (GO:0031122)|establishment of protein localization (GO:0045184)|protein localization to microtubule (GO:0035372)|regulation of postsynaptic density protein 95 clustering (GO:1902897)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	microtubule binding (GO:0008017)|PDZ domain binding (GO:0030165)|protein complex binding (GO:0032403)	p.A84E(1)		kidney(1)|large_intestine(1)|lung(2)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			GGCATCTGTGCGATGTGTGGA	0.328																																							uc002rve.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(250-252)GCG>GAG		postsynaptic protein CRIPT							90.0	93.0	92.0					2																	46851311		2203	4299	6502	SO:0001583	missense	9419					cell junction|cytoplasm|dendritic spine		g.chr2:46851311C>A	AA165108	CCDS1829.1	2p21	2008-02-05			ENSG00000119878	ENSG00000119878			14312	protein-coding gene	gene with protein product		604594				16091592, 11744724, 10570482, 9581762	Standard	NM_014171		Approved	HSPC139	uc002rve.3	Q9P021	OTTHUMG00000128815	ENST00000238892.3:c.251C>A	2.37:g.46851311C>A	ENSP00000238892:p.Ala84Glu						p.A84E	NM_014171	NP_054890	Q9P021	CRIPT_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.114)		5	348	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	84						Missense_Mutation	SNP	ENST00000238892.3	37	c.251C>A	CCDS1829.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071829	0.55646	.	.	ENSG00000119878	ENST00000238892	T	0.76448	-1.02	5.9	5.01	0.66863	.	0.197120	0.51477	N	0.000082	D	0.89743	0.6803	M	0.89214	3.015	0.54753	D	0.999982	D	0.67145	0.996	D	0.83275	0.996	D	0.91698	0.5371	10	0.72032	D	0.01	-13.4384	15.8029	0.78471	0.0:0.8632:0.1368:0.0	.	84	Q9P021	CRIPT_HUMAN	E	84	ENSP00000238892:A84E	ENSP00000238892:A84E	A	+	2	0	CRIPT	46704815	1.000000	0.71417	0.586000	0.28679	0.094000	0.18550	6.844000	0.75390	1.468000	0.48064	0.655000	0.94253	GCG		0.328	CRIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250748.1	NM_014171		21	93	1	0	1.55795e-14	0.012319	2.96961e-14	21	93				
MSH6	2956	broad.mit.edu	37	2	48026966	48026966	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:48026966G>T	ENST00000234420.5	+	4	1996	c.1844G>T	c.(1843-1845)tGt>tTt	p.C615F	MSH6_ENST00000538136.1_Missense_Mutation_p.C313F|FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Missense_Mutation_p.C485F	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	615					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCATTGTCCTGTTCTCTTCAG	0.393			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc002rwd.3		NA	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	Mis|N|F|S	mutS homolog 6 (E. coli)			E		colorectal|endometrial|ovarian	colorectal		2	Whole gene deletion(2)		haematopoietic_and_lymphoid_tissue(2)	large_intestine(53)|central_nervous_system(28)|endometrium(28)|stomach(22)|haematopoietic_and_lymphoid_tissue(9)|lung(7)|skin(6)|urinary_tract(5)|breast(5)|ovary(3)|thyroid(1)|upper_aerodigestive_tract(1)	168						c.(1843-1845)TGT>TTT	MMR	mutS homolog 6							62.0	66.0	65.0					2																	48026966		2202	4300	6502	SO:0001583	missense	2956	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding	g.chr2:48026966G>T	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.1844G>T	2.37:g.48026966G>T	ENSP00000234420:p.Cys615Phe					MSH6_uc002rwc.2_Missense_Mutation_p.C615F|MSH6_uc010fbj.2_Missense_Mutation_p.C313F|MSH6_uc010yoi.1_Missense_Mutation_p.C485F|MSH6_uc010yoj.1_Missense_Mutation_p.C313F	p.C615F	NM_000179	NP_000170	P52701	MSH6_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		4	1996	+		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	615					B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	c.1844G>T	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	C	2.185	-0.386764	0.04966	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.87491	-2.26;-2.26;-2.26	5.11	5.11	0.69529	DNA mismatch repair protein MutS, connector (1);	0.240299	0.44097	D	0.000493	T	0.78432	0.4282	N	0.12182	0.205	0.80722	D	1	B;B;B	0.11235	0.004;0.0;0.0	B;B;B	0.09377	0.004;0.003;0.0	T	0.72633	-0.4234	10	0.72032	D	0.01	-9.6095	15.7805	0.78257	0.0:0.8633:0.1367:0.0	.	485;615;615	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	F	615;613;485;313	ENSP00000234420:C615F;ENSP00000446475:C485F;ENSP00000438580:C313F	ENSP00000234420:C615F	C	+	2	0	MSH6	47880470	1.000000	0.71417	0.923000	0.36655	0.448000	0.32197	4.925000	0.63425	1.167000	0.42706	-0.195000	0.12781	TGT		0.393	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179		6	124	1	0	0.00116845	0.001168	0.00133631	6	124				
NAGK	55577	broad.mit.edu	37	2	71303832	71303832	+	Splice_Site	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:71303832G>T	ENST00000244204.6	+	8	827		c.e8+1		NAGK_ENST00000443872.2_Splice_Site|NAGK_ENST00000455662.2_Splice_Site|NAGK_ENST00000443938.2_Splice_Site|NAGK_ENST00000418807.3_Splice_Site			Q9UJ70	NAGK_HUMAN	N-acetylglucosamine kinase						carbohydrate phosphorylation (GO:0046835)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|N-acetylglucosamine kinase activity (GO:0045127)	p.?(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|urinary_tract(1)	18					N-Acetyl-D-glucosamine(DB00141)	GATTGACCCGGTGAGTTGAGG	0.567																																							uc002shp.3		NA																	1	Unknown(1)		lung(1)		0						c.e8+1		N-Acetylglucosamine kinase	N-Acetyl-D-glucosamine(DB00141)						63.0	57.0	59.0					2																	71303832		2203	4300	6503	SO:0001630	splice_region_variant	55577				N-acetylglucosamine metabolic process|N-acetylmannosamine metabolic process		ATP binding|N-acetylglucosamine kinase activity|protein binding	g.chr2:71303832G>T	AJ242910	CCDS33220.1, CCDS33220.2	2p24.3-p24.1	2008-02-05			ENSG00000124357	ENSG00000124357	2.7.1.59		17174	protein-coding gene	gene with protein product		606828				10824116	Standard	NM_017567		Approved	GNK	uc002shp.4	Q9UJ70	OTTHUMG00000153239	ENST00000244204.6:c.765+1G>T	2.37:g.71303832G>T						NAGK_uc010fea.2_Splice_Site|NAGK_uc002shq.3_Splice_Site_p.P106_splice|NAGK_uc002shr.2_Splice_Site_p.P204_splice	p.P255_splice	NM_017567	NP_060037	Q9UJ70	NAGK_HUMAN			8	1171	+								B4DLZ5|Q53HD5|Q6IA84|Q9BS29|Q9BVP0|Q9NV37	Splice_Site	SNP	ENST00000244204.6	37	c.765_splice		.	.	.	.	.	.	.	.	.	.	G	20.3	3.961466	0.74016	.	.	ENSG00000124357	ENST00000244204;ENST00000455662;ENST00000418807;ENST00000443938	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1488	0.81594	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NAGK	71157340	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.230000	0.58632	2.481000	0.83766	0.650000	0.86243	.		0.567	NAGK-032	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471889.1		Intron	3	16	1	0	6.4e-05	0.004672	7.87568e-05	3	16				
DYSF	8291	broad.mit.edu	37	2	71753445	71753445	+	Silent	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:71753445G>C	ENST00000258104.3	+	12	1426	c.1149G>C	c.(1147-1149)ctG>ctC	p.L383L	DYSF_ENST00000409366.1_Silent_p.L384L|DYSF_ENST00000410020.3_Silent_p.L415L|DYSF_ENST00000409744.1_Silent_p.L384L|DYSF_ENST00000409762.1_Silent_p.L414L|DYSF_ENST00000410041.1_Silent_p.L415L|DYSF_ENST00000413539.2_Silent_p.L414L|DYSF_ENST00000394120.2_Silent_p.L384L|DYSF_ENST00000409651.1_Silent_p.L415L|DYSF_ENST00000429174.2_Silent_p.L383L|DYSF_ENST00000409582.3_Silent_p.L414L	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	383	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.L383L(1)|p.L415L(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						ACTTCTGCCTGAAGGTCTTCC	0.657																																							uc002sie.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|breast(2)|pancreas(1)|skin(1)	7						c.(1147-1149)CTG>CTC		dysferlin isoform 8							105.0	116.0	112.0					2																	71753445		2203	4300	6503	SO:0001819	synonymous_variant	8291					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding	g.chr2:71753445G>C	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1149G>C	2.37:g.71753445G>C						DYSF_uc010feg.2_Silent_p.L414L|DYSF_uc010feh.2_Silent_p.L383L|DYSF_uc002sig.3_Silent_p.L383L|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.L383L|DYSF_uc010fef.2_Silent_p.L414L|DYSF_uc010fei.2_Silent_p.L414L|DYSF_uc010fek.2_Silent_p.L415L|DYSF_uc010fej.2_Silent_p.L384L|DYSF_uc010fel.2_Silent_p.L384L|DYSF_uc010feo.2_Silent_p.L415L|DYSF_uc010fem.2_Silent_p.L384L|DYSF_uc010fen.2_Silent_p.L415L|DYSF_uc002sif.2_Silent_p.L384L	p.L383L	NM_003494	NP_003485	O75923	DYSF_HUMAN			12	1525	+			383			Cytoplasmic (Potential).|C2 3.		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	c.1149G>C	CCDS1918.1																																																																																				0.657	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		28	151	0	0	0	0.008361	0	28	151				
IL1RL1	9173	broad.mit.edu	37	2	102964500	102964500	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:102964500G>A	ENST00000233954.1	+	9	1337	c.1066G>A	c.(1066-1068)Gag>Aag	p.E356K		NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	356					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)	p.E356K(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						GTTCTGGATTGAGGCCACTCT	0.363																																							uc002tbu.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1066-1068)GAG>AAG		interleukin 1 receptor-like 1 isoform 1							137.0	130.0	132.0					2																	102964500		2203	4300	6503	SO:0001583	missense	9173				innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity	g.chr2:102964500G>A	D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.1066G>A	2.37:g.102964500G>A	ENSP00000233954:p.Glu356Lys					IL18R1_uc002tbw.3_Intron	p.E356K	NM_016232	NP_057316	Q01638	ILRL1_HUMAN			9	1337	+			356			Cytoplasmic (Potential).		A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Missense_Mutation	SNP	ENST00000233954.1	37	c.1066G>A	CCDS2057.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.112297	0.56398	.	.	ENSG00000115602	ENST00000233954	T	0.61980	0.06	5.63	5.63	0.86233	.	0.495933	0.21168	N	0.079035	T	0.61590	0.2359	M	0.73962	2.25	0.80722	D	1	P	0.43094	0.799	B	0.35931	0.214	T	0.64901	-0.6298	10	0.36615	T	0.2	.	16.7739	0.85546	0.0:0.0:1.0:0.0	.	356	Q01638	ILRL1_HUMAN	K	356	ENSP00000233954:E356K	ENSP00000233954:E356K	E	+	1	0	IL1RL1	102330932	1.000000	0.71417	0.998000	0.56505	0.347000	0.29111	3.670000	0.54569	2.811000	0.96726	0.557000	0.71058	GAG		0.363	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253296.1	NM_016232		5	67	0	0	0	0.001168	0	5	67				
SLC5A7	60482	broad.mit.edu	37	2	108618444	108618444	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:108618444G>T	ENST00000264047.2	+	6	965	c.689G>T	c.(688-690)gGa>gTa	p.G230V	SLC5A7_ENST00000540517.1_Missense_Mutation_p.G125V|SLC5A7_ENST00000409059.1_Missense_Mutation_p.G230V	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	230					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)	p.G230V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	CCGTGGCTGGGAACTGTTGAC	0.453																																							uc002tdv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(688-690)GGA>GTA		solute carrier family 5 (choline transporter),	Choline(DB00122)						230.0	223.0	225.0					2																	108618444		2203	4300	6503	SO:0001583	missense	60482				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity	g.chr2:108618444G>T	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.689G>T	2.37:g.108618444G>T	ENSP00000264047:p.Gly230Val					SLC5A7_uc010ywm.1_5'UTR|SLC5A7_uc010fjj.2_Missense_Mutation_p.G230V|SLC5A7_uc010ywn.1_Missense_Mutation_p.G117V	p.G230V	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN			6	965	+			230			Cytoplasmic (Potential).		Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	c.689G>T	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.596631	0.86953	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.86297	-2.1;-2.1;-2.1	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.95233	0.8454	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94602	0.7797	10	0.33141	T	0.24	-0.6928	19.092	0.93231	0.0:0.0:1.0:0.0	.	230	Q9GZV3	SC5A7_HUMAN	V	230;125;230	ENSP00000387346:G230V;ENSP00000445351:G125V;ENSP00000264047:G230V	ENSP00000264047:G230V	G	+	2	0	SLC5A7	107984876	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	9.859000	0.99545	2.511000	0.84671	0.551000	0.68910	GGA		0.453	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1			11	51	1	0	6.42651e-13	0.010729	1.18062e-12	11	51				
IL36G	56300	broad.mit.edu	37	2	113742478	113742478	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:113742478G>A	ENST00000259205.4	+	5	431	c.362G>A	c.(361-363)cGt>cAt	p.R121H	IL36G_ENST00000376489.2_Missense_Mutation_p.R86H	NM_019618.2	NP_062564.1	Q9NZH8	IL36G_HUMAN	interleukin 36, gamma	121					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular space (GO:0005615)		p.R121H(2)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						CTTTTCTACCGTGCCAAGACT	0.512																																						Esophageal Squamous(44;715 981 6239 42838 46707)	uc002tio.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)		0						c.(361-363)CGT>CAT		interleukin 1 family, member 9							145.0	130.0	135.0					2																	113742478		2203	4300	6503	SO:0001583	missense	56300				cell-cell signaling	extracellular space	cytokine activity|interleukin-1 receptor antagonist activity	g.chr2:113742478G>A	AF200492	CCDS2108.1, CCDS62992.1	2q12-q21	2011-07-14	2011-06-06	2011-06-06	ENSG00000136688	ENSG00000136688		"""Interleukins and interleukin receptors"""	15741	protein-coding gene	gene with protein product	"""interleukin-1 homolog 1"", ""interleukin 1-related protein 2"", ""interleukin-1 epsilon"""	605542	"""interleukin 1 family, member 9"""	IL1F9		10860666, 10744718, 11991722, 11991723	Standard	NM_019618		Approved	IL-1H1, IL-1RP2, IL-1F9, IL1H1, IL1E	uc002tio.1	Q9NZH8	OTTHUMG00000131336	ENST00000259205.4:c.362G>A	2.37:g.113742478G>A	ENSP00000259205:p.Arg121His					IL1F9_uc010fkr.1_Missense_Mutation_p.R86H	p.R121H	NM_019618	NP_062564	Q9NZH8	IL36G_HUMAN			5	431	+			121					Q56B91|Q6UVX7|Q7RTZ9	Missense_Mutation	SNP	ENST00000259205.4	37	c.362G>A	CCDS2108.1	.	.	.	.	.	.	.	.	.	.	G	1.244	-0.620440	0.03636	.	.	ENSG00000136688	ENST00000376489;ENST00000259205	T;T	0.21734	1.99;1.99	4.7	-0.563	0.11778	.	0.447148	0.21593	N	0.072074	T	0.06690	0.0171	N	0.04373	-0.215	0.09310	N	0.999999	B;B	0.13145	0.004;0.007	B;B	0.13407	0.0;0.009	T	0.30621	-0.9972	10	0.20046	T	0.44	-10.2763	3.2889	0.06942	0.4651:0.0:0.3516:0.1832	.	86;121	Q9NZH8-2;Q9NZH8	.;IL36G_HUMAN	H	86;121	ENSP00000365672:R86H;ENSP00000259205:R121H	ENSP00000259205:R121H	R	+	2	0	IL36G	113458949	0.000000	0.05858	0.065000	0.19835	0.035000	0.12851	-0.972000	0.03802	-0.166000	0.10890	0.561000	0.74099	CGT		0.512	IL36G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330713.2	NM_019618		12	60	0	0	0	0.003163	0	12	60				
IL1F10	84639	broad.mit.edu	37	2	113832335	113832335	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:113832335C>G	ENST00000393197.2	+	3	575	c.154C>G	c.(154-156)Cgc>Ggc	p.R52G	IL1F10_ENST00000337569.3_Missense_Mutation_p.R52G|IL1F10_ENST00000341010.2_Missense_Mutation_p.R52G	NM_032556.5	NP_115945.4	Q8WWZ1	IL1FA_HUMAN	interleukin 1 family, member 10 (theta)	52						extracellular space (GO:0005615)		p.R52G(1)		endometrium(1)|lung(6)|ovary(1)	8						AGGCTTGGCCCGCACCAAGGT	0.582																																							uc002tiu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(154-156)CGC>GGC		interleukin 1 family, member 10							91.0	92.0	92.0					2																	113832335		2203	4300	6503	SO:0001583	missense	84639					extracellular space	cytokine activity|interleukin-1 receptor antagonist activity	g.chr2:113832335C>G	AY026753	CCDS2112.1	2q13	2011-07-14			ENSG00000136697	ENSG00000136697		"""Interleukins and interleukin receptors"""	15552	protein-coding gene	gene with protein product	"""FIL1- theta"", ""interleukin-1 receptor antagonist FKSG75"""	615296				11747621, 11991723, 11991722	Standard	NM_173161		Approved	FKSG75, IL-1HY2, IL-1F10, IL1-theta, MGC11983, MGC119832, MGC119833	uc002tiu.3	Q8WWZ1	OTTHUMG00000131339	ENST00000393197.2:c.154C>G	2.37:g.113832335C>G	ENSP00000376893:p.Arg52Gly					IL1F10_uc002tiv.2_Missense_Mutation_p.R52G|IL1F10_uc002tiw.2_Missense_Mutation_p.R44G	p.R52G	NM_173161	NP_775184	Q8WWZ1	IL1FA_HUMAN			4	229	+			52					Q53SR9|Q56AT8|Q7RTZ5|Q969H5|Q9BYX1	Missense_Mutation	SNP	ENST00000393197.2	37	c.154C>G	CCDS2112.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.471080	0.63625	.	.	ENSG00000136697	ENST00000341010;ENST00000337569;ENST00000393197	T;T;T	0.17054	2.3;2.3;2.3	5.1	5.1	0.69264	.	0.282328	0.39083	N	0.001480	T	0.25082	0.0609	L	0.46741	1.465	0.36198	D	0.850517	D;D	0.56287	0.975;0.959	P;P	0.53313	0.723;0.471	T	0.08146	-1.0736	10	0.22109	T	0.4	-7.7042	14.3565	0.66740	0.0:1.0:0.0:0.0	.	52;52	Q8WWZ1-2;Q8WWZ1	.;IL1FA_HUMAN	G	52	ENSP00000341794:R52G;ENSP00000338418:R52G;ENSP00000376893:R52G	ENSP00000338418:R52G	R	+	1	0	IL1F10	113548806	0.612000	0.27000	0.944000	0.38274	0.849000	0.48306	2.339000	0.43965	2.539000	0.85634	0.655000	0.94253	CGC		0.582	IL1F10-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330725.1	NM_173161		8	99	0	0	0	0.012319	0	8	99				
POTEF	728378	broad.mit.edu	37	2	130872806	130872806	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:130872806T>C	ENST00000409914.2	-	4	1016	c.617A>G	c.(616-618)aAg>aGg	p.K206R	POTEF_ENST00000360967.5_Missense_Mutation_p.K206R|POTEF_ENST00000361163.4_Missense_Mutation_p.K206R|POTEF_ENST00000357462.5_Missense_Mutation_p.K206R	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	206					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.K206R(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						AGCTGTCCTCTTTTTGTTGTC	0.403																																							uc010fmh.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)	5						c.(616-618)AAG>AGG		prostate, ovary, testis expressed protein on							12.0	14.0	13.0					2																	130872806		1993	3901	5894	SO:0001583	missense	728378					cell cortex	ATP binding	g.chr2:130872806T>C	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.617A>G	2.37:g.130872806T>C	ENSP00000386786:p.Lys206Arg						p.K206R	NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN			4	1017	-			206			ANK 2.		A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	c.617A>G	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	11.00	1.511266	0.27036	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;D	0.81996	-0.11;-0.11;-0.11;-1.56	0.972	0.972	0.19704	Ankyrin repeat-containing domain (4);	2.020190	0.03002	N	0.148256	T	0.72574	0.3477	N	0.25094	0.71	0.21967	N	0.999441	B	0.17852	0.024	B	0.08055	0.003	T	0.61407	-0.7069	10	0.87932	D	0	.	4.5057	0.11887	0.0:0.0:0.0:1.0	.	206	A5A3E0	POTEF_HUMAN	R	206	ENSP00000350052:K206R;ENSP00000386786:K206R;ENSP00000354232:K206R;ENSP00000355012:K206R	ENSP00000350052:K206R	K	-	2	0	POTEF	130589276	0.845000	0.29573	0.005000	0.12908	0.125000	0.20455	0.253000	0.18296	0.774000	0.33427	0.000000	0.15137	AAG		0.403	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		10	80	0	0	0	0.003163	0	10	80				
POTEF	728378	broad.mit.edu	37	2	130877748	130877748	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:130877748T>A	ENST00000409914.2	-	3	740	c.341A>T	c.(340-342)aAg>aTg	p.K114M	POTEF_ENST00000360967.5_Missense_Mutation_p.K114M|POTEF_ENST00000361163.4_Missense_Mutation_p.K114M|POTEF_ENST00000357462.5_Missense_Mutation_p.K114M	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	114					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.K114M(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CACCTTGCTCTTGCTGCTCCC	0.597																																							uc010fmh.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(2)	5						c.(340-342)AAG>ATG		prostate, ovary, testis expressed protein on							43.0	67.0	59.0					2																	130877748		2186	4289	6475	SO:0001583	missense	728378					cell cortex	ATP binding	g.chr2:130877748T>A	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.341A>T	2.37:g.130877748T>A	ENSP00000386786:p.Lys114Met						p.K114M	NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN			3	741	-			114					A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	c.341A>T	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	9.431	1.085471	0.20390	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.78003	-1.14;-1.14;1.69;1.58	0.409	-0.818	0.10833	.	.	.	.	.	T	0.70945	0.3282	L	0.38175	1.15	0.09310	N	1	D	0.54964	0.969	P	0.50490	0.642	T	0.61569	-0.7036	8	0.87932	D	0	.	.	.	.	.	114	A5A3E0	POTEF_HUMAN	M	114	ENSP00000350052:K114M;ENSP00000386786:K114M;ENSP00000354232:K114M;ENSP00000355012:K114M	ENSP00000350052:K114M	K	-	2	0	POTEF	130594218	0.005000	0.15991	0.001000	0.08648	0.013000	0.08279	-0.151000	0.10175	-0.470000	0.06901	0.145000	0.16022	AAG		0.597	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771		12	88	0	0	0	0.003163	0	12	88				
AMER3	205147	broad.mit.edu	37	2	131519959	131519959	+	Missense_Mutation	SNP	C	C	A	rs376263403		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:131519959C>A	ENST00000423981.1	+	2	424	c.314C>A	c.(313-315)aCg>aAg	p.T105K	AMER3_ENST00000321420.4_Missense_Mutation_p.T105K	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	105					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.T105K(1)									GGCAGGGCCACGGCTGCCACA	0.662																																							uc002trw.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(313-315)ACG>AAG		hypothetical protein LOC205147							9.0	13.0	12.0					2																	131519959		2132	4186	6318	SO:0001583	missense	205147							g.chr2:131519959C>A	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.314C>A	2.37:g.131519959C>A	ENSP00000392700:p.Thr105Lys					FAM123C_uc010fmv.2_Missense_Mutation_p.T105K|FAM123C_uc010fms.1_Missense_Mutation_p.T105K|FAM123C_uc010fmt.1_Missense_Mutation_p.T105K|FAM123C_uc010fmu.1_Missense_Mutation_p.T105K	p.T105K	NM_152698	NP_689911	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	504	+	Colorectal(110;0.1)		105					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.314C>A	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.806954	0.00074	.	.	ENSG00000178171	ENST00000321420;ENST00000431758;ENST00000458606;ENST00000423981	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	3.9	0.659	0.17861	.	1.211760	0.06148	N	0.673580	T	0.07413	0.0187	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.20384	0.029	T	0.39035	-0.9633	10	0.08599	T	0.76	.	3.7863	0.08702	0.0:0.4134:0.2492:0.3374	.	105	Q8N944	F123C_HUMAN	K	105	ENSP00000314914:T105K;ENSP00000410421:T105K;ENSP00000389242:T105K;ENSP00000392700:T105K	ENSP00000314914:T105K	T	+	2	0	FAM123C	131236429	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.824000	0.04438	0.087000	0.17167	-0.219000	0.12488	ACG		0.662	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		5	13	1	0	0.00116845	0.001168	0.00133631	5	13				
NCKAP5	344148	broad.mit.edu	37	2	133543133	133543134	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:133543133_133543134GG>TT	ENST00000409261.1	-	14	1623_1624	c.1250_1251CC>AA	c.(1249-1251)cCC>cAA	p.P417Q	NCKAP5_ENST00000317721.6_Missense_Mutation_p.P417Q|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	417								p.P417Q(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TCACTGATGGGGGTTCAAGTAA	0.411																																							uc002ttp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1249-1251)CCC>CAA		Nck-associated protein 5 isoform 1																																				SO:0001583	missense	344148						protein binding	g.chr2:133543133_133543134GG>TT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1250_1251delinsTT	2.37:g.133543133_133543134delinsTT	ENSP00000387128:p.Pro417Gln					NCKAP5_uc002ttq.2_Intron	p.P417Q	NM_207363	NP_997246	O14513	NCKP5_HUMAN			14	1624_1625	-			417					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	DNP	ENST00000409261.1	37	c.1250_1251CC>AA	CCDS46418.1																																																																																				0.411	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		14	85	0	0	0	0.004672	0	14	85				
LRP1B	53353	broad.mit.edu	37	2	141533673	141533673	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:141533673G>T	ENST00000389484.3	-	33	6465	c.5494C>A	c.(5494-5496)Cag>Aag	p.Q1832K		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1832					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.Q1832K(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTACCTTGCTGTGCTTCTTTA	0.388										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(5494-5496)CAG>AAG		low density lipoprotein-related protein 1B							134.0	127.0	129.0					2																	141533673		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141533673G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5494C>A	2.37:g.141533673G>T	ENSP00000374135:p.Gln1832Lys	TSP Lung(27;0.18)					p.Q1832K	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	33	6466	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1832			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.5494C>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020573	0.75275	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91996	-2.95	5.39	5.39	0.77823	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000001	D	0.96046	0.8712	M	0.89601	3.045	0.58432	D	0.999998	D	0.63880	0.993	D	0.67548	0.952	D	0.94000	0.7274	10	0.05959	T	0.93	.	19.5084	0.95130	0.0:0.0:1.0:0.0	.	1832	Q9NZR2	LRP1B_HUMAN	K	1832;1770	ENSP00000374135:Q1832K	ENSP00000374135:Q1832K	Q	-	1	0	LRP1B	141250143	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.649000	0.98487	2.702000	0.92279	0.591000	0.81541	CAG		0.388	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		11	98	1	0	4.68919e-08	0.008291	6.9993e-08	11	98				
NEB	4703	broad.mit.edu	37	2	152551035	152551035	+	Splice_Site	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:152551035C>G	ENST00000172853.10	-	19	1930		c.e19+1		NEB_ENST00000409198.1_Splice_Site|NEB_ENST00000604864.1_Splice_Site|NEB_ENST00000427231.2_Splice_Site|NEB_ENST00000397345.3_Splice_Site|NEB_ENST00000603639.1_Splice_Site			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.?(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCCACACTCACATCGCTGGTG	0.507																																							uc010fnx.2		NA																	2	Unknown(2)		lung(2)	ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.e19+1		nebulin isoform 3							96.0	93.0	94.0					2																	152551035		1956	4138	6094	SO:0001630	splice_region_variant	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152551035C>G	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.1782+1G>C	2.37:g.152551035C>G						NEB_uc010fny.1_Splice_Site_p.D148_splice	p.D594_splice	NM_004543	NP_004534	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	19	1973	-								F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Splice_Site	SNP	ENST00000172853.10	37	c.1782_splice		.	.	.	.	.	.	.	.	.	.	.	24.4	4.532553	0.85812	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000536533	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1936	0.86887	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NEB	152259281	1.000000	0.71417	0.986000	0.45419	0.893000	0.52053	7.138000	0.77305	2.797000	0.96272	0.655000	0.94253	.		0.507	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	Intron	3	33	0	0	0	0.004672	0	3	33				
PRPF40A	55660	broad.mit.edu	37	2	153535966	153535966	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:153535966G>T	ENST00000410080.1	-	7	1018	c.477C>A	c.(475-477)ccC>ccA	p.P159P		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	186	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P159P(1)|p.P55P(1)|p.P186P(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						ATTCCTTCCAGGGGCATTTAG	0.328																																							uc002tyi.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(556-558)CCC>CCA		formin binding protein 3							33.0	29.0	30.0					2																	153535966		1784	4049	5833	SO:0001819	synonymous_variant	55660				mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding	g.chr2:153535966G>T	AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.477C>A	2.37:g.153535966G>T						PRPF40A_uc002tyh.3_Silent_p.P159P|PRPF40A_uc010zcd.1_Silent_p.P106P|PRPF40A_uc002tyj.2_Silent_p.P55P|PRPF40A_uc002tyl.1_Silent_p.P186P	p.P186P	NM_017892	NP_060362	O75400	PR40A_HUMAN			7	571	-			186			WW 2.		O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Silent	SNP	ENST00000410080.1	37	c.558C>A	CCDS46430.1																																																																																				0.328	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333559.2	XM_371575		5	21	1	0	1.23904e-05	0.000602	1.59193e-05	5	21				
TBR1	10716	broad.mit.edu	37	2	162274296	162274296	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:162274296G>T	ENST00000389554.3	+	2	1119	c.802G>T	c.(802-804)Gga>Tga	p.G268*	TBR1_ENST00000410035.1_5'Flank	NM_006593.2	NP_006584.1	Q16650	TBR1_HUMAN	T-box, brain, 1	268					axon guidance (GO:0007411)|brain development (GO:0007420)|hindbrain development (GO:0030902)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of neuron projection development (GO:0010975)|specification of organ identity (GO:0010092)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G268*(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(3)	30						GAGGTTTCAAGGAGGCAAATG	0.413																																							uc002ubw.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(802-804)GGA>TGA		T-box, brain, 1							85.0	84.0	84.0					2																	162274296		2203	4300	6503	SO:0001587	stop_gained	10716					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:162274296G>T	U49250	CCDS33310.1	2q24.2	2011-06-13			ENSG00000136535	ENSG00000136535		"""T-boxes"""	11590	protein-coding gene	gene with protein product		604616				7619531	Standard	NM_006593		Approved		uc002ubw.1	Q16650	OTTHUMG00000153888	ENST00000389554.3:c.802G>T	2.37:g.162274296G>T	ENSP00000374205:p.Gly268*					TBR1_uc010foy.2_5'Flank	p.G268*	NM_006593	NP_006584	Q16650	TBR1_HUMAN			2	1104	+			268			T-box.		B0AZS4|B2R6G5|Q14DC5|Q53TH0|Q56A81	Nonsense_Mutation	SNP	ENST00000389554.3	37	c.802G>T	CCDS33310.1	.	.	.	.	.	.	.	.	.	.	G	42	9.210313	0.99101	.	.	ENSG00000136535	ENST00000389554;ENST00000411412	.	.	.	5.34	5.34	0.76211	.	0.056288	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	17.9893	0.89164	0.0:0.0:1.0:0.0	.	.	.	.	X	268;3	.	ENSP00000374205:G268X	G	+	1	0	TBR1	161982542	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.809000	0.99208	2.646000	0.89796	0.655000	0.94253	GGA		0.413	TBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332845.1	NM_006593		12	79	1	0	3.07112e-06	0.010729	4.10156e-06	12	79				
CHRNA1	1134	broad.mit.edu	37	2	175618297	175618297	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:175618297C>T	ENST00000261007.5	-	7	853	c.787G>A	c.(787-789)Gtc>Atc	p.V263I	CHRNA1_ENST00000409219.1_Missense_Mutation_p.V238I|CHRNA1_ENST00000348749.5_Missense_Mutation_p.V238I|CHRNA1_ENST00000409542.1_Missense_Mutation_p.V156I|CHRNA1_ENST00000409323.1_Missense_Mutation_p.V238I|AC018890.6_ENST00000442996.1_RNA	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	263					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)	p.V263I(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	GGGATGATGACGTTGACGATG	0.577																																							uc002ujd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(787-789)GTC>ATC		nicotinic cholinergic receptor alpha 1 isoform a							239.0	213.0	222.0					2																	175618297		2203	4300	6503	SO:0001583	missense	1134				muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr2:175618297C>T	Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.787G>A	2.37:g.175618297C>T	ENSP00000261007:p.Val263Ile					uc002uiw.2_Intron|CHRNA1_uc002uje.2_Missense_Mutation_p.V238I|CHRNA1_uc002ujf.3_Missense_Mutation_p.V238I	p.V263I	NM_001039523	NP_001034612	P02708	ACHA_HUMAN			7	865	-			263			Helical.		B4DRV6|D3DPE8	Missense_Mutation	SNP	ENST00000261007.5	37	c.787G>A	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527113	0.64860	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219;ENST00000409323	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	5.17	5.17	0.71159	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	T	0.79364	0.4433	N	0.04768	-0.165	0.80722	D	1	B;B;P	0.39696	0.293;0.149;0.683	B;B;P	0.46208	0.065;0.075;0.507	T	0.82967	-0.0194	10	0.56958	D	0.05	.	19.0425	0.93006	0.0:1.0:0.0:0.0	.	238;238;263	G5E9G9;Q53SH4;P02708	.;.;ACHA_HUMAN	I	238;263;156;238;238	ENSP00000261008:V238I;ENSP00000261007:V263I;ENSP00000387026:V156I;ENSP00000386611:V238I;ENSP00000386684:V238I	ENSP00000261007:V263I	V	-	1	0	CHRNA1	175326543	1.000000	0.71417	0.958000	0.39756	0.966000	0.64601	4.685000	0.61693	2.566000	0.86566	0.650000	0.86243	GTC		0.577	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1			16	83	0	0	0	0.006122	0	16	83				
PDE11A	50940	broad.mit.edu	37	2	178528660	178528660	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:178528660G>T	ENST00000286063.6	-	19	2897	c.2580C>A	c.(2578-2580)aaC>aaA	p.N860K	PDE11A_ENST00000409504.1_Missense_Mutation_p.N502K|PDE11A_ENST00000450799.2_Missense_Mutation_p.N51K|PDE11A_ENST00000449286.2_Missense_Mutation_p.N502K|PDE11A_ENST00000358450.4_Missense_Mutation_p.N610K|PDE11A_ENST00000389683.3_Missense_Mutation_p.N416K	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	860	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.N610K(1)|p.N860K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CATCCTTCCGGTTCCGATCAA	0.453									Primary Pigmented Nodular Adrenocortical Disease, Familial																														uc002ulq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|large_intestine(1)	4						c.(2578-2580)AAC>AAA		phosphodiesterase 11A isoform 4							98.0	87.0	91.0					2																	178528660		2203	4300	6503	SO:0001583	missense	50940	Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr2:178528660G>T	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.2580C>A	2.37:g.178528660G>T	ENSP00000286063:p.Asn860Lys					PDE11A_uc010zfd.1_Missense_Mutation_p.N51K|PDE11A_uc002ulp.2_Missense_Mutation_p.N416K|PDE11A_uc002ulr.2_Missense_Mutation_p.N610K|PDE11A_uc002uls.1_Missense_Mutation_p.N502K|PDE11A_uc002ult.1_Missense_Mutation_p.N610K|PDE11A_uc002ulu.1_Missense_Mutation_p.N502K	p.N860K	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		19	2898	-			860			Catalytic (By similarity).		Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	37	c.2580C>A	CCDS33334.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.12|13.12	2.141219|2.141219	0.37825|0.37825	.|.	.|.	ENSG00000128655|ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000450799;ENST00000409504;ENST00000389683;ENST00000449286|ENST00000436700	T;T;T;T;T;T|.	0.76448|.	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02|.	6.07|6.07	3.35|3.35	0.38373|0.38373	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.54615|0.54615	0.1869|0.1869	L|L	0.43923|0.43923	1.385|1.385	0.50813|0.50813	D|D	0.999896|0.999896	P;D|.	0.54601|.	0.949;0.967|.	P;P|.	0.52481|.	0.492;0.7|.	T|T	0.44421|0.44421	-0.9329|-0.9329	10|5	0.42905|.	T|.	0.14|.	.|.	9.6123|9.6123	0.39670|0.39670	0.2633:0.0:0.7367:0.0|0.2633:0.0:0.7367:0.0	.|.	610;860|.	Q9HCR9-2;Q9HCR9|.	.;PDE11_HUMAN|.	K|T	860;610;51;502;416;502|63	ENSP00000286063:N860K;ENSP00000351232:N610K;ENSP00000387964:N51K;ENSP00000386539:N502K;ENSP00000374333:N416K;ENSP00000390599:N502K|.	ENSP00000286063:N860K|.	N|P	-|-	3|1	2|0	PDE11A|PDE11A	178236906|178236906	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	3.861000|3.861000	0.56002|0.56002	0.468000|0.468000	0.27243|0.27243	-0.749000|-0.749000	0.03505|0.03505	AAC|CCG		0.453	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2			13	48	1	0	1.49906e-05	0.00245	1.91993e-05	13	48				
CERKL	375298	broad.mit.edu	37	2	182412572	182412572	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:182412572C>A	ENST00000339098.5	-	10	1213	c.1214G>T	c.(1213-1215)aGg>aTg	p.R405M	CERKL_ENST00000409440.3_Missense_Mutation_p.R361M|CERKL_ENST00000410087.3_Missense_Mutation_p.R379M|CERKL_ENST00000374969.2_Missense_Mutation_p.R266M|CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000374970.2_Missense_Mutation_p.R310M			Q49MI3	CERKL_HUMAN	ceramide kinase-like	405					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.R405M(1)|p.R379M(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TCCCTGTGCCCTCCTAAAAGA	0.393																																							uc002unx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|kidney(1)|skin(1)	4						c.(1213-1215)AGG>ATG		ceramide kinase-like isoform b							115.0	123.0	120.0					2																	182412572		2203	4300	6503	SO:0001583	missense	375298				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity	g.chr2:182412572C>A	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.1214G>T	2.37:g.182412572C>A	ENSP00000341159:p.Arg405Met					CERKL_uc002uny.2_Missense_Mutation_p.R379M|CERKL_uc010zfm.1_Missense_Mutation_p.R361M|CERKL_uc002unz.2_Missense_Mutation_p.R127M|CERKL_uc002uoa.2_Missense_Mutation_p.R310M|CERKL_uc002uob.2_Missense_Mutation_p.R127M|CERKL_uc002uoc.2_Missense_Mutation_p.R266M|CERKL_uc010frk.2_Intron|CERKL_uc002uod.1_Missense_Mutation_p.R174M|CERKL_uc002unw.2_Translation_Start_Site	p.R405M	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.088)		10	1315	-			405					B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	ENST00000339098.5	37	c.1214G>T	CCDS42789.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474403	0.43942	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	T;T;T;T;T	0.33654	2.16;2.4;1.4;2.39;1.43	5.34	-5.37	0.02681	.	2.344890	0.01225	N	0.008200	T	0.32010	0.0815	L	0.47716	1.5	0.09310	N	1	B;B;B;B;B	0.23316	0.028;0.083;0.017;0.027;0.016	B;B;B;B;B	0.23574	0.009;0.047;0.015;0.012;0.009	T	0.35624	-0.9781	10	0.46703	T	0.11	.	9.4943	0.38978	0.1051:0.2265:0.0:0.6685	.	361;266;310;379;405	B4DEY1;Q49MI3-4;Q49MI3-3;Q49MI3-2;Q49MI3	.;.;.;.;CERKL_HUMAN	M	379;361;266;405;310	ENSP00000386725:R379M;ENSP00000387080:R361M;ENSP00000364108:R266M;ENSP00000341159:R405M;ENSP00000364109:R310M	ENSP00000341159:R405M	R	-	2	0	CERKL	182120817	0.000000	0.05858	0.003000	0.11579	0.622000	0.37654	-0.156000	0.10100	-0.973000	0.03555	-0.140000	0.14226	AGG		0.393	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1			29	187	1	0	7.26314e-15	0.007291	1.39096e-14	29	187				
FAM171B	165215	broad.mit.edu	37	2	187615876	187615876	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:187615876A>T	ENST00000304698.5	+	5	943	c.740A>T	c.(739-741)gAa>gTa	p.E247V		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	247						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.E247V(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GAAAACATTGAATTGACTCCT	0.318																																							uc002ups.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(3)|central_nervous_system(1)	10						c.(739-741)GAA>GTA		KIAA1946							95.0	109.0	104.0					2																	187615876		2203	4300	6503	SO:0001583	missense	165215					integral to membrane	DNA binding	g.chr2:187615876A>T	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.740A>T	2.37:g.187615876A>T	ENSP00000304108:p.Glu247Val					FAM171B_uc002upr.1_Missense_Mutation_p.E247V	p.E247V	NM_177454	NP_803237	Q6P995	F171B_HUMAN			5	852	+			247			Extracellular (Potential).		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	c.740A>T	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	A	16.82	3.228600	0.58777	.	.	ENSG00000144369	ENST00000304698;ENST00000272804	T	0.39056	1.1	5.53	5.53	0.82687	.	0.292310	0.38436	N	0.001695	T	0.43964	0.1271	M	0.62723	1.935	0.47547	D	0.999451	B;B	0.24043	0.096;0.096	B;B	0.24701	0.055;0.055	T	0.42865	-0.9426	10	0.87932	D	0	-25.1357	14.2249	0.65853	1.0:0.0:0.0:0.0	.	247;248	Q6P995;A8K122	F171B_HUMAN;.	V	247	ENSP00000304108:E247V	ENSP00000272804:E247V	E	+	2	0	FAM171B	187324121	1.000000	0.71417	0.629000	0.29254	0.996000	0.88848	7.355000	0.79434	2.110000	0.64415	0.496000	0.49642	GAA		0.318	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		18	126	0	0	0	0.014323	0	18	126				
ZSWIM2	151112	broad.mit.edu	37	2	187712478	187712479	+	Missense_Mutation	DNP	CG	CG	TT			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:187712478_187712479CG>TT	ENST00000295131.2	-	2	248_249	c.209_210CG>AA	c.(208-210)cCG>cAA	p.P70Q		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	70					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P70Q(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			CCCCTCCTTTCGGAAATGTGGA	0.351																																							uc002upu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(208-210)CCG>CAA		zinc finger, SWIM domain containing 2																																				SO:0001583	missense	151112				apoptosis		zinc ion binding	g.chr2:187712478_187712479CG>TT	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.209_210delinsTT	2.37:g.187712478_187712479delinsTT	ENSP00000295131:p.Pro70Gln						p.P70Q	NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)		2	249_250	-			70			SWIM-type.		B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	DNP	ENST00000295131.2	37	c.209_210CG>AA	CCDS33348.1																																																																																				0.351	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521		11	93	0	0	0	0.004672	0	11	93				
COL5A2	1290	broad.mit.edu	37	2	189943287	189943287	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:189943287C>A	ENST00000374866.3	-	16	1288	c.1014G>T	c.(1012-1014)agG>agT	p.R338S		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	338					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.R338S(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CTGGCATTCCCCTCGGACCCT	0.428																																							uc002uqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1012-1014)AGG>AGT		alpha 2 type V collagen preproprotein							150.0	157.0	155.0					2																	189943287		2203	4300	6503	SO:0001583	missense	1290				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent	g.chr2:189943287C>A	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1014G>T	2.37:g.189943287C>A	ENSP00000364000:p.Arg338Ser					COL5A2_uc010frx.2_Intron	p.R338S	NM_000393	NP_000384	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)		16	1289	-			338					P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	c.1014G>T	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.625411	0.66901	.	.	ENSG00000204262	ENST00000374866	D	0.85629	-2.01	5.38	-2.94	0.05581	.	0.000000	0.56097	D	0.000021	D	0.85026	0.5603	L	0.41824	1.3	0.53005	D	0.999964	P	0.48764	0.915	P	0.62560	0.904	T	0.81169	-0.1055	9	.	.	.	.	13.1283	0.59368	0.0:0.332:0.0:0.668	.	338	P05997	CO5A2_HUMAN	S	338	ENSP00000364000:R338S	.	R	-	3	2	COL5A2	189651532	0.658000	0.27402	0.910000	0.35882	0.952000	0.60782	-0.569000	0.05902	-0.335000	0.08451	0.557000	0.71058	AGG		0.428	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393		26	148	1	0	3.65163e-15	0.00632	7.05981e-15	26	148				
BMPR2	659	broad.mit.edu	37	2	203407114	203407114	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:203407114G>T	ENST00000374580.4	+	10	1896	c.1357G>T	c.(1357-1359)Gtg>Ttg	p.V453L	BMPR2_ENST00000374574.2_Missense_Mutation_p.V453L	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	453	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.V453L(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						GCAGGTTCTCGTGTCTAGGGA	0.423																																							uc002uzf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						c.(1357-1359)GTG>TTG		bone morphogenetic protein receptor type II							53.0	53.0	53.0					2																	203407114		2203	4300	6503	SO:0001583	missense	659				anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity	g.chr2:203407114G>T	Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1357G>T	2.37:g.203407114G>T	ENSP00000363708:p.Val453Leu					BMPR2_uc010ftr.2_Missense_Mutation_p.V453L	p.V453L	NM_001204	NP_001195	Q13873	BMPR2_HUMAN			10	2505	+			453			Protein kinase.|Cytoplasmic (Potential).		Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	ENST00000374580.4	37	c.1357G>T	CCDS33361.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.050670	0.75960	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	T;T	0.65364	-0.15;-0.15	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.053648	0.64402	N	0.000001	T	0.65228	0.2671	M	0.69248	2.105	0.80722	D	1	B;B	0.20368	0.022;0.044	B;B	0.23018	0.009;0.043	T	0.64618	-0.6365	10	0.87932	D	0	.	19.1723	0.93583	0.0:0.0:1.0:0.0	.	453;453	Q13161;Q13873	.;BMPR2_HUMAN	L	453	ENSP00000363708:V453L;ENSP00000363702:V453L	ENSP00000363702:V453L	V	+	1	0	BMPR2	203115359	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.520000	0.84964	0.563000	0.77884	GTG		0.423	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204		11	62	1	0	9.70103e-10	0.008291	1.55677e-09	11	62				
VIL1	7429	broad.mit.edu	37	2	219294032	219294032	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:219294032C>T	ENST00000248444.5	+	7	680	c.592C>T	c.(592-594)Cga>Tga	p.R198*	VIL1_ENST00000440053.1_Nonsense_Mutation_p.R198*|VIL1_ENST00000392114.2_Intron	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	198	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)	p.R198*(2)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAAGGAGATCCGAGACCAGGA	0.622																																							uc002via.2		NA																	2	Substitution - Nonsense(2)		NS(1)|lung(1)	ovary(1)	1						c.(592-594)CGA>TGA		villin 1							71.0	70.0	70.0					2																	219294032		2203	4300	6503	SO:0001587	stop_gained	7429				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity	g.chr2:219294032C>T	X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.592C>T	2.37:g.219294032C>T	ENSP00000248444:p.Arg198*					VIL1_uc010zke.1_Intron|VIL1_uc002vib.2_Nonsense_Mutation_p.R198*|VIL1_uc002vic.1_Nonsense_Mutation_p.R198*	p.R198*	NM_007127	NP_009058	P09327	VILI_HUMAN		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	7	657	+		Renal(207;0.0474)	198			Core.		B2R9A7|Q53S11|Q96AC8	Nonsense_Mutation	SNP	ENST00000248444.5	37	c.592C>T	CCDS2417.1	.	.	.	.	.	.	.	.	.	.	C	37	6.057402	0.97241	.	.	ENSG00000127831	ENST00000248444;ENST00000440053	.	.	.	4.8	4.8	0.61643	.	0.092028	0.42964	D	0.000633	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0072	18.0447	0.89328	0.0:1.0:0.0:0.0	.	.	.	.	X	198	.	ENSP00000248444:R198X	R	+	1	2	VIL1	219002276	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.690000	0.61731	2.516000	0.84829	0.561000	0.74099	CGA		0.622	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256778.3	NM_007127		6	70	0	0	0	0.004482	0	6	70				
CCDC108	255101	broad.mit.edu	37	2	219890775	219890775	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:219890775T>A	ENST00000341552.5	-	14	2401	c.2318A>T	c.(2317-2319)cAc>cTc	p.H773L	CCDC108_ENST00000441968.1_Missense_Mutation_p.H773L|CCDC108_ENST00000453220.1_Missense_Mutation_p.H773L	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	773						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.H773L(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGGGGGATGTGGTGCTCAAA	0.592																																							uc002vjl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4						c.(2317-2319)CAC>CTC		coiled-coil domain containing 108 isoform 1							87.0	78.0	81.0					2																	219890775		2203	4300	6503	SO:0001583	missense	255101					integral to membrane	structural molecule activity	g.chr2:219890775T>A	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2318A>T	2.37:g.219890775T>A	ENSP00000340776:p.His773Leu						p.H773L	NM_194302	NP_919278	Q6ZU64	CC108_HUMAN		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	14	2402	-		Renal(207;0.0915)	773					A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	c.2318A>T	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	T	3.865	-0.029033	0.07589	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.04406	3.63;3.63;3.63	4.87	2.49	0.30216	.	0.280301	0.25677	N	0.029026	T	0.04318	0.0119	L	0.57536	1.79	0.58432	D	0.999996	B	0.19200	0.034	B	0.14023	0.01	T	0.31558	-0.9939	10	0.11485	T	0.65	-22.6053	3.0465	0.06155	0.3275:0.2076:0.0:0.465	.	773	Q6ZU64	CC108_HUMAN	L	773	ENSP00000340776:H773L;ENSP00000413377:H773L;ENSP00000409117:H773L	ENSP00000340776:H773L	H	-	2	0	CCDC108	219599019	0.940000	0.31905	0.992000	0.48379	0.156000	0.22039	1.604000	0.36804	0.898000	0.36418	0.459000	0.35465	CAC		0.592	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302		6	45	0	0	0	0.00308	0	6	45				
DOCK10	55619	broad.mit.edu	37	2	225710297	225710297	+	Silent	SNP	G	G	A	rs368832236		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:225710297G>A	ENST00000258390.7	-	20	2365	c.2298C>T	c.(2296-2298)caC>caT	p.H766H	DOCK10_ENST00000409592.3_Silent_p.H760H	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	766	DHR-1.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H766H(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CACAGGTGACGTGATAAAAAG	0.408																																							uc010fwz.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2296-2298)CAC>CAT		dedicator of cytokinesis 10		G		1,3747		0,1,1873	144.0	134.0	137.0		2298	-3.5	1.0	2		137	0,8212		0,0,4106	no	coding-synonymous	DOCK10	NM_014689.2		0,1,5979	AA,AG,GG		0.0,0.0267,0.0084		766/2187	225710297	1,11959	1874	4106	5980	SO:0001819	synonymous_variant	55619						GTP binding	g.chr2:225710297G>A	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.2298C>T	2.37:g.225710297G>A						DOCK10_uc002vob.2_Silent_p.H760H	p.H766H	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)	20	2537	-		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)	766			DHR-1.		B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	ENST00000258390.7	37	c.2298C>T	CCDS46528.1																																																																																				0.408	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			19	81	0	0	0	0.007413	0	19	81				
GPR55	9290	broad.mit.edu	37	2	231774831	231774831	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:231774831G>T	ENST00000392040.1	-	2	1039	c.847C>A	c.(847-849)Ctg>Atg	p.L283M	AC012507.4_ENST00000454890.1_RNA|GPR55_ENST00000392039.2_Missense_Mutation_p.L283M	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	283					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)	p.L283M(1)		endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		AAAACATCCAGGCAGCAGTTG	0.507																																							uc002vrg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(847-849)CTG>ATG		G protein-coupled receptor 55							99.0	99.0	99.0					2																	231774831		2203	4300	6503	SO:0001583	missense	9290				activation of phospholipase C activity|bone resorption|negative regulation of osteoclast differentiation|positive regulation of ERK1 and ERK2 cascade|positive regulation of Rho protein signal transduction	integral to plasma membrane	cannabinoid receptor activity	g.chr2:231774831G>T	AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.847C>A	2.37:g.231774831G>T	ENSP00000375894:p.Leu283Met					GPR55_uc002vrf.2_RNA|GPR55_uc010fxs.1_Missense_Mutation_p.L283M	p.L283M	NM_005683	NP_005674	Q9Y2T6	GPR55_HUMAN		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)	2	1040	-		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)	283			Helical; Name=7; (Potential).		Q8N580	Missense_Mutation	SNP	ENST00000392040.1	37	c.847C>A	CCDS2480.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338429	0.60963	.	.	ENSG00000135898	ENST00000392040;ENST00000392039	T;T	0.49432	0.78;0.78	5.43	2.48	0.30137	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.68824	0.3043	M	0.88310	2.945	0.33279	D	0.56197	D	0.89917	1.0	D	0.91635	0.999	T	0.76055	-0.3099	10	0.51188	T	0.08	-21.8484	9.0565	0.36408	0.2651:0.0:0.7349:0.0	.	283	Q9Y2T6	GPR55_HUMAN	M	283	ENSP00000375894:L283M;ENSP00000375893:L283M	ENSP00000375893:L283M	L	-	1	2	GPR55	231483075	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	3.584000	0.53936	0.579000	0.29504	-0.367000	0.07326	CTG		0.507	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332618.1	NM_005683		15	81	1	0	3.45872e-05	0.004007	4.37458e-05	15	81				
COL6A3	1293	broad.mit.edu	37	2	238274635	238274635	+	Missense_Mutation	SNP	G	G	T	rs531282669		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr2:238274635G>T	ENST00000295550.4	-	12	5996	c.5544C>A	c.(5542-5544)gaC>gaA	p.D1848E	COL6A3_ENST00000347401.3_Missense_Mutation_p.D1647E|COL6A3_ENST00000346358.4_Missense_Mutation_p.D1648E|COL6A3_ENST00000472056.1_Missense_Mutation_p.D1241E|COL6A3_ENST00000353578.4_Missense_Mutation_p.D1642E|COL6A3_ENST00000409809.1_Missense_Mutation_p.D1642E	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1848	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D1848E(2)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AAACATTCTGGTCTCTAGAAC	0.527																																							uc002vwl.2		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)	ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18						c.(5542-5544)GAC>GAA		alpha 3 type VI collagen isoform 1 precursor							67.0	68.0	67.0					2																	238274635		2203	4300	6503	SO:0001583	missense	1293				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	g.chr2:238274635G>T	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5544C>A	2.37:g.238274635G>T	ENSP00000295550:p.Asp1848Glu					COL6A3_uc002vwo.2_Missense_Mutation_p.D1642E|COL6A3_uc010znj.1_Missense_Mutation_p.D1241E	p.D1848E	NM_004369	NP_004360	P12111	CO6A3_HUMAN		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	12	5829	-		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)	1848			VWFA 10.|Nonhelical region.		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	c.5544C>A	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	6.724	0.502392	0.12822	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19	5.44	-2.75	0.05914	von Willebrand factor, type A (2);	0.129271	0.35235	N	0.003356	T	0.33118	0.0852	L	0.44542	1.39	0.26828	N	0.968649	D;D;B	0.67145	0.996;0.991;0.41	P;P;B	0.56434	0.779;0.798;0.138	T	0.30592	-0.9973	10	0.25106	T	0.35	.	5.4481	0.16548	0.2822:0.1103:0.4994:0.1082	.	1241;1642;1848	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	E	1848;1647;1642;1241;1642;1648	ENSP00000295550:D1848E;ENSP00000315609:D1647E;ENSP00000315873:D1642E;ENSP00000418285:D1241E;ENSP00000386844:D1642E;ENSP00000295546:D1648E	ENSP00000295550:D1848E	D	-	3	2	COL6A3	237939374	0.089000	0.21612	0.507000	0.27676	0.169000	0.22640	-0.317000	0.08060	-0.101000	0.12219	-0.768000	0.03414	GAC		0.527	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		17	101	1	0	1.56452e-12	0.007413	2.78595e-12	17	101				
PTPRA	5786	broad.mit.edu	37	20	3018722	3018722	+	Silent	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr20:3018722C>T	ENST00000216877.6	+	23	2725	c.2325C>T	c.(2323-2325)tgC>tgT	p.C775C	PTPRA_ENST00000425918.2_Silent_p.C795C|PTPRA_ENST00000356147.3_Silent_p.C775C|PTPRA_ENST00000399903.2_Silent_p.C784C|PTPRA_ENST00000380393.3_Silent_p.C784C|PTPRA_ENST00000358719.4_Silent_p.C640C|PTPRA_ENST00000318266.5_Silent_p.C775C	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	784	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.C784C(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						ATGAGTTCTGCTACAAGGTGG	0.428																																							uc010zqd.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(2383-2385)TGC>TGT		protein tyrosine phosphatase, receptor type, A							167.0	140.0	149.0					20																	3018722		2203	4300	6503	SO:0001819	synonymous_variant	5786				axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr20:3018722C>T		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.2325C>T	20.37:g.3018722C>T						PTPRA_uc002whj.2_Silent_p.C784C|PTPRA_uc002whk.2_Silent_p.C775C|PTPRA_uc002whl.2_Silent_p.C775C|PTPRA_uc002whm.2_Silent_p.C551C|PTPRA_uc002whn.2_Silent_p.C775C|PTPRA_uc002who.2_Silent_p.C447C	p.C795C	NM_002836	NP_002827	P18433	PTPRA_HUMAN			23	2702	+			784			Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.		A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Silent	SNP	ENST00000216877.6	37	c.2385C>T	CCDS13039.1																																																																																				0.428	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3			15	71	0	0	0	0.00499	0	15	71				
GDAP1L1	78997	broad.mit.edu	37	20	42893134	42893134	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr20:42893134G>T	ENST00000342560.5	+	5	783	c.695G>T	c.(694-696)gGg>gTg	p.G232V	GDAP1L1_ENST00000537864.1_Missense_Mutation_p.G40V	NM_001256737.1|NM_024034.4	NP_001243666.1|NP_076939.3	Q96MZ0	GD1L1_HUMAN	ganglioside induced differentiation associated protein 1-like 1	232	GST C-terminal.							p.G232V(1)		endometrium(1)|large_intestine(5)|lung(10)|pancreas(1)|prostate(1)	18		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			AAGATCCTCGGGGAACTGGCC	0.607											OREG0006458	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=GDAP1L1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																											uc002xlq.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(694-696)GGG>GTG		ganglioside-induced differentiation-associated							70.0	67.0	68.0					20																	42893134		2203	4300	6503	SO:0001583	missense	78997							g.chr20:42893134G>T		CCDS13328.1, CCDS74725.1, CCDS74726.1, CCDS74727.1	20q12	2012-02-09	2012-02-09		ENSG00000124194	ENSG00000124194			4213	protein-coding gene	gene with protein product							Standard	NM_024034		Approved		uc010zwl.3	Q96MZ0	OTTHUMG00000032530	ENST00000342560.5:c.695G>T	20.37:g.42893134G>T	ENSP00000341782:p.Gly232Val		OREG0006458	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=GDAP1L1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	912	GDAP1L1_uc002xlp.1_Missense_Mutation_p.G232V|GDAP1L1_uc010zwl.1_Missense_Mutation_p.G251V|GDAP1L1_uc010zwm.1_Missense_Mutation_p.G174V|GDAP1L1_uc010zwn.1_Missense_Mutation_p.G40V	p.G232V	NM_024034	NP_076939	Q96MZ0	GD1L1_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		5	762	+		Myeloproliferative disorder(115;0.0122)	232			GST C-terminal.		B7Z621|Q5TE60|Q68CW7|Q9BQJ7|Q9BQV4|Q9BWJ4|Q9H3Y2|Q9H4G5	Missense_Mutation	SNP	ENST00000342560.5	37	c.695G>T	CCDS13328.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329488	0.60743	.	.	ENSG00000124194	ENST00000342560;ENST00000372947;ENST00000372946;ENST00000545149;ENST00000262604;ENST00000438466;ENST00000537864;ENST00000447658	D;D;D;D	0.98914	-5.23;-5.23;-5.23;-5.23	5.31	5.31	0.75309	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.114892	0.64402	D	0.000012	D	0.97870	0.9300	L	0.58510	1.815	0.80722	D	1	P;P;B;P	0.45126	0.605;0.805;0.443;0.851	P;P;B;B	0.48368	0.544;0.575;0.299;0.137	D	0.97490	1.0053	10	0.41790	T	0.15	.	13.8867	0.63712	0.0:0.0:0.8475:0.1524	.	174;251;232;178	B7Z1I3;B7Z621;Q96MZ0;Q5JY50	.;.;GD1L1_HUMAN;.	V	232;229;174;200;18;174;40;14	ENSP00000341782:G232V;ENSP00000392881:G174V;ENSP00000440498:G40V;ENSP00000391714:G14V	ENSP00000262604:G18V	G	+	2	0	GDAP1L1	42326548	1.000000	0.71417	0.997000	0.53966	0.907000	0.53573	6.205000	0.72148	2.489000	0.83994	0.491000	0.48974	GGG		0.607	GDAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079356.1	NM_024034		5	31	1	0	5.9392e-07	0.001168	8.4018e-07	5	31				
KCNB1	3745	broad.mit.edu	37	20	47989564	47989564	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr20:47989564G>T	ENST00000371741.4	-	2	2699	c.2533C>A	c.(2533-2535)Cca>Aca	p.P845T		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	845					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)	p.P845T(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	CCTCCCCCTGGCAACACACGG	0.532																																							uc002xur.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)|skin(1)	2						c.(2533-2535)CCA>ACA		potassium voltage-gated channel, Shab-related							77.0	65.0	69.0					20																	47989564		2203	4300	6503	SO:0001583	missense	3745				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	g.chr20:47989564G>T	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.2533C>A	20.37:g.47989564G>T	ENSP00000360806:p.Pro845Thr					KCNB1_uc002xus.1_Missense_Mutation_p.P845T	p.P845T	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		2	2697	-			845			Cytoplasmic (Potential).		Q14193	Missense_Mutation	SNP	ENST00000371741.4	37	c.2533C>A	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017453	0.35606	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	D	0.99143	-5.48	5.56	5.56	0.83823	.	0.725706	0.12760	N	0.441430	D	0.98469	0.9490	M	0.62723	1.935	0.45676	D	0.998599	P	0.51057	0.941	P	0.46110	0.504	D	0.98974	1.0802	10	0.54805	T	0.06	.	19.1308	0.93406	0.0:0.0:1.0:0.0	.	845	Q14721	KCNB1_HUMAN	T	845;800	ENSP00000360806:P845T	ENSP00000360806:P845T	P	-	1	0	KCNB1	47422971	1.000000	0.71417	0.986000	0.45419	0.407000	0.30961	5.715000	0.68430	2.598000	0.87819	0.655000	0.94253	CCA		0.532	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975		4	37	1	0	0.00024832	0.009096	0.000291381	4	37				
ABHD16B	140701	broad.mit.edu	37	20	62493424	62493424	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr20:62493424C>G	ENST00000369916.3	+	1	859	c.531C>G	c.(529-531)tgC>tgG	p.C177W	C20ORF135_ENST00000601296.1_5'Flank	NM_080622.3	NP_542189.1	Q9H3Z7	ABHGB_HUMAN	abhydrolase domain containing 16B	177							hydrolase activity (GO:0016787)	p.C177W(1)		endometrium(2)|kidney(1)|lung(3)	6						TCATCTGCTGCGAAGGCAACG	0.672																																							uc002ygx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(529-531)TGC>TGG		hypothetical protein LOC140701							28.0	28.0	28.0					20																	62493424		2201	4300	6501	SO:0001583	missense	140701						hydrolase activity	g.chr20:62493424C>G		CCDS13539.1	20q13.33	2013-01-17	2010-12-09	2010-12-09	ENSG00000183260	ENSG00000183260		"""Abhydrolase domain containing"""	16128	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 135"""	C20orf135			Standard	NM_080622		Approved	dJ591C20.1	uc002ygx.1	Q9H3Z7	OTTHUMG00000033010	ENST00000369916.3:c.531C>G	20.37:g.62493424C>G	ENSP00000358932:p.Cys177Trp						p.C177W	NM_080622	NP_542189	Q9H3Z7	ABHGB_HUMAN			1	859	+	all_cancers(38;1.77e-12)|all_epithelial(29;3.12e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)		177						Missense_Mutation	SNP	ENST00000369916.3	37	c.531C>G	CCDS13539.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241848	0.39598	.	.	ENSG00000183260	ENST00000369916	T	0.43688	0.94	4.59	1.86	0.25419	.	0.000000	0.85682	U	0.000000	T	0.60650	0.2285	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58685	-0.7593	10	0.87932	D	0	-0.934	7.4437	0.27198	0.0:0.7138:0.0:0.2862	.	177	Q9H3Z7	ABHGB_HUMAN	W	177	ENSP00000358932:C177W	ENSP00000358932:C177W	C	+	3	2	ABHD16B	61963868	1.000000	0.71417	0.999000	0.59377	0.610000	0.37248	0.608000	0.24223	0.103000	0.17682	0.491000	0.48974	TGC		0.672	ABHD16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080254.1			3	11	0	0	0	0.009096	0	3	11				
MYT1	4661	broad.mit.edu	37	20	62839561	62839561	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr20:62839561C>T	ENST00000328439.1	+	7	1376	c.1012C>T	c.(1012-1014)Cct>Tct	p.P338S	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Missense_Mutation_p.P338S	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P338S(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					CAGTCCCAAGCCTGAGTACTC	0.582																																					GBM(59;481 1041 20555 21139 33705)	GBM(59;481 1041 20555 21139 33705)	uc002yii.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1012-1014)CCT>TCT		myelin transcription factor 1							111.0	115.0	114.0					20																	62839561		2203	4300	6503	SO:0001583	missense	4661				cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:62839561C>T	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1012C>T	20.37:g.62839561C>T	ENSP00000327465:p.Pro338Ser					MYT1_uc002yih.2_Intron|MYT1_uc002yij.2_5'UTR	p.P338S	NM_004535	NP_004526	Q01538	MYT1_HUMAN			7	1376	+	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)		338					B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	c.1012C>T	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	c	8.532	0.871204	0.17322	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.68903	-0.36;-0.36	4.6	3.66	0.41972	.	0.270557	0.29616	N	0.011660	T	0.58424	0.2121	M	0.64997	1.995	0.80722	D	1	P	0.44946	0.846	B	0.36134	0.218	T	0.57046	-0.7878	10	0.24483	T	0.36	-11.4768	12.8329	0.57756	0.0:0.9198:0.0:0.0802	.	338	Q01538	MYT1_HUMAN	S	338	ENSP00000327465:P338S;ENSP00000442412:P338S	ENSP00000327465:P338S	P	+	1	0	MYT1	62310005	.	.	0.171000	0.22900	0.067000	0.16453	.	.	0.945000	0.37605	-0.260000	0.10688	CCT		0.582	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535		19	84	0	0	0	0.010504	0	19	84				
KRTAP8-1	337879	broad.mit.edu	37	21	32185358	32185358	+	Missense_Mutation	SNP	C	C	A	rs199737998	byFrequency	TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr21:32185358C>A	ENST00000329621.4	-	1	212	c.181G>T	c.(181-183)Gct>Tct	p.A61S		NM_175857.3	NP_787053.1	Q8IUC2	KRA81_HUMAN	keratin associated protein 8-1	61						intermediate filament (GO:0005882)		p.A61S(1)		central_nervous_system(1)|large_intestine(1)|lung(4)	6						CAGTAGAGAGCAAATGGCGAG	0.562																																							uc002you.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(181-183)GCT>TCT		keratin associated protein 8-1							85.0	81.0	83.0					21																	32185358		2203	4300	6503	SO:0001583	missense	337879					intermediate filament		g.chr21:32185358C>A	AJ457064	CCDS13607.1	21q22.1	2006-03-13			ENSG00000183640	ENSG00000183640		"""Keratin associated proteins"""	18935	protein-coding gene	gene with protein product						12359730	Standard	NM_175857		Approved	KAP8.1	uc002you.3	Q8IUC2	OTTHUMG00000057771	ENST00000329621.4:c.181G>T	21.37:g.32185358C>A	ENSP00000332805:p.Ala61Ser						p.A61S	NM_175857	NP_787053	Q8IUC2	KRA81_HUMAN			1	213	-			61					Q3LI57	Missense_Mutation	SNP	ENST00000329621.4	37	c.181G>T	CCDS13607.1	.	.	.	.	.	.	.	.	.	.	C	5.768	0.326010	0.10900	.	.	ENSG00000183640	ENST00000329621	.	.	.	5.56	0.0609	0.14338	.	0.823335	0.10610	N	0.654542	T	0.28067	0.0692	.	.	.	0.09310	N	1	B	0.20164	0.042	B	0.28385	0.089	T	0.30707	-0.9969	8	0.33141	T	0.24	-0.1965	4.2324	0.10610	0.1483:0.4747:0.0:0.3771	.	61	Q8IUC2	KRA81_HUMAN	S	61	.	ENSP00000332805:A61S	A	-	1	0	KRTAP8-1	31107229	0.000000	0.05858	0.000000	0.03702	0.404000	0.30871	-0.119000	0.10676	-0.200000	0.10300	-0.140000	0.14226	GCT		0.562	KRTAP8-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128223.1			17	52	1	0	7.07596e-05	0.006122	8.67927e-05	17	52				
GRAP2	9402	broad.mit.edu	37	22	40366981	40366981	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr22:40366981G>T	ENST00000344138.4	+	8	1149	c.886G>T	c.(886-888)Gag>Tag	p.E296*	GRAP2_ENST00000399090.2_Nonsense_Mutation_p.E183*|GRAP2_ENST00000407075.3_Nonsense_Mutation_p.E296*|GRAP2_ENST00000544756.1_Nonsense_Mutation_p.E224*|GRAP2_ENST00000540310.1_Nonsense_Mutation_p.E230*|GRAP2_ENST00000543252.1_Intron	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	296	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)	p.E296*(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						CCACAGCGGGGAGGTGGTGGA	0.642																																							uc003ayh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(886-888)GAG>TAG		GRB2-related adaptor protein 2							74.0	67.0	70.0					22																	40366981		2203	4300	6503	SO:0001587	stop_gained	9402				cell-cell signaling|Ras protein signal transduction|T cell costimulation|T cell receptor signaling pathway	cytosol	SH3/SH2 adaptor activity	g.chr22:40366981G>T	AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.886G>T	22.37:g.40366981G>T	ENSP00000339186:p.Glu296*					GRAP2_uc003ayi.2_RNA|GRAP2_uc011aom.1_Nonsense_Mutation_p.E270*|GRAP2_uc011aon.1_Nonsense_Mutation_p.E230*|GRAP2_uc010gya.1_Nonsense_Mutation_p.E296*|GRAP2_uc011aoo.1_Nonsense_Mutation_p.E224*|GRAP2_uc011aop.1_Nonsense_Mutation_p.E256*|GRAP2_uc011aoq.1_Nonsense_Mutation_p.E183*|GRAP2_uc003ayj.1_Nonsense_Mutation_p.E296*	p.E296*	NM_004810	NP_004801	O75791	GRAP2_HUMAN			8	1149	+			296			SH3 2.		B7Z8I3|O43726|Q9NRB7	Nonsense_Mutation	SNP	ENST00000344138.4	37	c.886G>T	CCDS13999.1	.	.	.	.	.	.	.	.	.	.	G	39	7.319552	0.98210	.	.	ENSG00000100351	ENST00000344138;ENST00000544006;ENST00000540310;ENST00000544756;ENST00000399090;ENST00000407075	.	.	.	5.45	5.45	0.79879	.	0.293866	0.41194	D	0.000935	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-37.1724	19.2918	0.94103	0.0:0.0:1.0:0.0	.	.	.	.	X	296;270;230;224;183;296	.	ENSP00000339186:E296X	E	+	1	0	GRAP2	38696927	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.960000	0.87893	2.544000	0.85801	0.557000	0.71058	GAG		0.642	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321295.1	NM_004810		10	35	1	0	4.68919e-08	0.008291	6.9993e-08	10	35				
LRRC3B	116135	broad.mit.edu	37	3	26751340	26751340	+	Silent	SNP	T	T	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr3:26751340T>G	ENST00000396641.2	+	2	769	c.177T>G	c.(175-177)ccT>ccG	p.P59P	AC114877.3_ENST00000446601.1_lincRNA|LRRC3B_ENST00000456208.2_Silent_p.P59P|LRRC3B_ENST00000417744.1_Silent_p.P59P	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	59	LRRNT.					integral component of membrane (GO:0016021)		p.P59P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						AGGAAATACCTAGAGATCTTC	0.423																																							uc003cdp.2		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(175-177)CCT>CCG		leucine rich repeat containing 3B precursor							116.0	112.0	113.0					3																	26751340		2203	4300	6503	SO:0001819	synonymous_variant	116135					integral to membrane		g.chr3:26751340T>G	AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.177T>G	3.37:g.26751340T>G						LRRC3B_uc003cdq.2_Silent_p.P59P	p.P59P	NM_052953	NP_443185	Q96PB8	LRC3B_HUMAN			2	766	+			59			LRRNT.		Q5M8T0	Silent	SNP	ENST00000396641.2	37	c.177T>G	CCDS2644.1																																																																																				0.423	LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252997.2	NM_052953		9	42	0	0	0	0.004482	0	9	42				
TGM4	7047	broad.mit.edu	37	3	44948497	44948497	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr3:44948497A>G	ENST00000296125.4	+	10	1200	c.1132A>G	c.(1132-1134)Att>Gtt	p.I378V		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	378					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.I378V(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	TGACATCTTTATTGTCTATGA	0.527																																							uc003coc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1132-1134)ATT>GTT		transglutaminase 4 (prostate)	L-Glutamine(DB00130)						116.0	105.0	108.0					3																	44948497		2203	4300	6503	SO:0001583	missense	7047				peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr3:44948497A>G	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.1132A>G	3.37:g.44948497A>G	ENSP00000296125:p.Ile378Val						p.I378V	NM_003241	NP_003232	P49221	TGM4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	10	1205	+			378					Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	37	c.1132A>G	CCDS2723.1	.	.	.	.	.	.	.	.	.	.	A	11.81	1.749988	0.30955	.	.	ENSG00000163810	ENST00000296125	T	0.22539	1.95	2.03	-1.29	0.09288	.	0.803616	0.09809	U	0.753008	T	0.08670	0.0215	N	0.10972	0.075	0.09310	N	1	B	0.15141	0.012	B	0.15484	0.013	T	0.33111	-0.9881	10	0.56958	D	0.05	.	0.4959	0.00572	0.4173:0.1475:0.1398:0.2954	.	378	P49221	TGM4_HUMAN	V	378	ENSP00000296125:I378V	ENSP00000296125:I378V	I	+	1	0	TGM4	44923501	0.003000	0.15002	0.001000	0.08648	0.733000	0.41908	-0.339000	0.07832	0.023000	0.15187	0.377000	0.23210	ATT		0.527	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241		6	64	0	0	0	0.001168	0	6	64				
OR5K3	403277	broad.mit.edu	37	3	98109906	98109906	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr3:98109906C>A	ENST00000383695.1	+	1	397	c.397C>A	c.(397-399)Cac>Aac	p.H133N	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H133N(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						ACTGCAGTACCACACCATGAT	0.468																																							uc011bgw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(397-399)CAC>AAC		olfactory receptor, family 5, subfamily K,							168.0	155.0	159.0					3																	98109906		2203	4300	6503	SO:0001583	missense	403277				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr3:98109906C>A		CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.397C>A	3.37:g.98109906C>A	ENSP00000373194:p.His133Asn						p.H133N	NM_001005516	NP_001005516	A6NET4	OR5K3_HUMAN			1	397	+			133			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000383695.1	37	c.397C>A	CCDS33803.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.729084	0.30684	.	.	ENSG00000206536	ENST00000383695	T	0.24350	1.86	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.146315	0.31747	N	0.007126	T	0.14485	0.0350	N	0.13235	0.315	0.23555	N	0.997427	B	0.09022	0.002	B	0.08055	0.003	T	0.16247	-1.0409	10	0.19590	T	0.45	-34.7503	11.557	0.50755	0.1787:0.8213:0.0:0.0	.	133	A6NET4	OR5K3_HUMAN	N	133	ENSP00000373194:H133N	ENSP00000373194:H133N	H	+	1	0	OR5K3	99592596	0.000000	0.05858	1.000000	0.80357	0.919000	0.55068	-1.196000	0.03041	2.527000	0.85204	0.603000	0.83216	CAC		0.468	OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359110.1			51	84	1	0	1.91693e-13	0.01441	3.57006e-13	51	84				
CPNE4	131034	broad.mit.edu	37	3	131404802	131404802	+	Splice_Site	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr3:131404802C>A	ENST00000512055.1	-	10	2634	c.508G>T	c.(508-510)Gat>Tat	p.D170Y	CPNE4_ENST00000502818.1_Splice_Site_p.D188Y|CPNE4_ENST00000429747.1_Splice_Site_p.D170Y|CPNE4_ENST00000511604.1_Splice_Site_p.D170Y|CPNE4_ENST00000512332.1_Splice_Site_p.D188Y			Q96A23	CPNE4_HUMAN	copine IV	170	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)		p.D170Y(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						CTGAAGAAATCCTAAAATAGA	0.373																																							uc003eok.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(508-510)GAT>TAT		copine IV							59.0	55.0	56.0					3																	131404802		2203	4300	6503	SO:0001630	splice_region_variant	131034							g.chr3:131404802C>A	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.508-1G>T	3.37:g.131404802C>A						CPNE4_uc011blq.1_Missense_Mutation_p.D188Y|CPNE4_uc003eol.2_Missense_Mutation_p.D188Y|CPNE4_uc003eom.2_Missense_Mutation_p.D170Y	p.D170Y	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN			6	943	-			170			C2 2.		D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	37	c.508G>T	CCDS3072.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.246193	0.80024	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46	5.81	5.81	0.92471	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.047569	0.85682	D	0.000000	D	0.82486	0.5047	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.81914	0.971;0.995	D	0.87369	0.2349	10	0.87932	D	0	-16.4249	19.7406	0.96230	0.0:1.0:0.0:0.0	.	188;170	Q96A23-2;Q96A23	.;CPNE4_HUMAN	Y	170;170;188;170;188	ENSP00000421705:D170Y;ENSP00000411904:D170Y;ENSP00000424853:D188Y;ENSP00000423811:D170Y;ENSP00000421646:D188Y	ENSP00000411904:D170Y	D	-	1	0	CPNE4	132887492	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	6.688000	0.74557	2.767000	0.95098	0.638000	0.83543	GAT		0.373	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808	Missense_Mutation	14	29	1	0	9.31168e-06	0.001855	1.23145e-05	14	29				
AADACL2	344752	broad.mit.edu	37	3	151474791	151474791	+	Silent	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr3:151474791T>C	ENST00000356517.3	+	5	724	c.615T>C	c.(613-615)gaT>gaC	p.D205D	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_207365.3	NP_997248.2	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2	205						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.D183D(1)|p.D205D(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(13)|skin(2)	24			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TGCAGAATGATGCTGAAATAA	0.313																																							uc003ezc.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(613-615)GAT>GAC		arylacetamide deacetylase-like 2 precursor							60.0	61.0	61.0					3																	151474791		2203	4297	6500	SO:0001819	synonymous_variant	344752					extracellular region|integral to membrane	carboxylesterase activity	g.chr3:151474791T>C	BC065724	CCDS3161.2	3q25.1	2010-12-14			ENSG00000197953	ENSG00000197953			24427	protein-coding gene	gene with protein product							Standard	NM_207365		Approved	MGC72001	uc003ezc.3	Q6P093	OTTHUMG00000155914	ENST00000356517.3:c.615T>C	3.37:g.151474791T>C						AADACL2_uc010hvn.2_5'UTR	p.D205D	NM_207365	NP_997248	Q6P093	ADCL2_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		5	735	+			205					Q5HYJ4	Silent	SNP	ENST00000356517.3	37	c.615T>C	CCDS3161.2																																																																																				0.313	AADACL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342288.3	NM_207365		28	40	0	0	0	0.009535	0	28	40				
ABCC5	10057	broad.mit.edu	37	3	183689508	183689508	+	Missense_Mutation	SNP	C	C	A	rs550542220		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr3:183689508C>A	ENST00000334444.6	-	11	1844	c.1604G>T	c.(1603-1605)cGc>cTc	p.R535L	ABCC5_ENST00000265586.6_Missense_Mutation_p.R535L	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	535					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.R535L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	ATGCTCAGTGCGCTGCAGCTG	0.582																																							uc003fmg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(1603-1605)CGC>CTC		ATP-binding cassette, sub-family C, member 5							80.0	84.0	83.0					3																	183689508		2083	4221	6304	SO:0001583	missense	10057					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity	g.chr3:183689508C>A	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.1604G>T	3.37:g.183689508C>A	ENSP00000333926:p.Arg535Leu					ABCC5_uc011bqt.1_Missense_Mutation_p.R63L|ABCC5_uc010hxl.2_Missense_Mutation_p.R535L	p.R535L	NM_005688	NP_005679	O15440	MRP5_HUMAN	Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		11	1769	-	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		535					B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	37	c.1604G>T	CCDS43176.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.312883	0.23908	.	.	ENSG00000114770	ENST00000334444;ENST00000382495;ENST00000265586	D;D	0.91740	-2.69;-2.9	5.56	-2.5	0.06384	ABC transporter, transmembrane domain, type 1 (1);	0.864225	0.10581	N	0.657898	T	0.80031	0.4549	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.12837	0.008;0.0	T	0.65948	-0.6044	10	0.33141	T	0.24	0.2068	7.938	0.29941	0.0:0.3277:0.1129:0.5593	.	535;535	Q86UX3;O15440	.;MRP5_HUMAN	L	535;471;535	ENSP00000333926:R535L;ENSP00000265586:R535L	ENSP00000265586:R535L	R	-	2	0	ABCC5	185172202	0.009000	0.17119	0.209000	0.23619	0.924000	0.55760	-0.044000	0.12023	-0.307000	0.08804	0.655000	0.94253	CGC		0.582	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688		16	38	1	0	2.4624e-09	0.008871	3.89001e-09	16	38				
UBXN7	26043	broad.mit.edu	37	3	196089416	196089416	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr3:196089416C>A	ENST00000296328.4	-	9	1051	c.977G>T	c.(976-978)aGt>aTt	p.S326I	UBXN7_ENST00000428095.1_Missense_Mutation_p.S164I|UBXN7_ENST00000535858.1_Missense_Mutation_p.S178I	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	326						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.S326I(1)		NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						GAACTCCTCACTGCCAGAAAA	0.428																																							uc003fwm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(976-978)AGT>ATT		UBX domain containing 7							102.0	96.0	98.0					3																	196089416		1849	4109	5958	SO:0001583	missense	26043						protein binding	g.chr3:196089416C>A	AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.977G>T	3.37:g.196089416C>A	ENSP00000296328:p.Ser326Ile					UBXN7_uc003fwn.3_Missense_Mutation_p.S178I|UBXN7_uc010iae.2_Missense_Mutation_p.S164I	p.S326I	NM_015562	NP_056377	O94888	UBXN7_HUMAN			9	1052	-			326					D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	ENST00000296328.4	37	c.977G>T	CCDS43191.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819426	0.90873	.	.	ENSG00000163960	ENST00000296328;ENST00000428095;ENST00000535858	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.63885	0.2549	L	0.27053	0.805	0.80722	D	1	D	0.62365	0.991	P	0.60949	0.881	T	0.60419	-0.7267	9	0.34782	T	0.22	-12.539	20.0368	0.97565	0.0:1.0:0.0:0.0	.	326	O94888	UBXN7_HUMAN	I	326;164;178	.	ENSP00000296328:S326I	S	-	2	0	UBXN7	197573813	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.372000	0.79612	2.735000	0.93741	0.563000	0.77884	AGT		0.428	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353		47	104	1	0	2.52991e-16	0.01441	4.96204e-16	47	104				
GBA3	57733	broad.mit.edu	37	4	22749245	22749245	+	RNA	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr4:22749245T>C	ENST00000503442.1	+	0	377				GBA3_ENST00000508166.1_RNA|GBA3_ENST00000511446.2_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)	p.W205R(1)		breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TGCCAGATCCTGGCACAGCTA	0.453																																							uc003gqp.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(613-615)TGG>CGG		cytosolic beta-glucosidase isoform a							152.0	149.0	150.0					4																	22749245		1879	4099	5978			57733				glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity	g.chr4:22749245T>C	AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22749245T>C						GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Missense_Mutation_p.W206R	p.W205R	NM_020973	NP_066024	Q9H227	GBA3_HUMAN			3	704	+			205					Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Missense_Mutation	SNP	ENST00000503442.1	37	c.613T>C																																																																																					0.453	GBA3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000360620.2			26	115	0	0	0	0.005443	0	26	115				
ATP8A1	10396	broad.mit.edu	37	4	42554575	42554575	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr4:42554575G>C	ENST00000381668.5	-	17	1697	c.1466C>G	c.(1465-1467)aCa>aGa	p.T489R	ATP8A1_ENST00000264449.10_Missense_Mutation_p.T474R	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	489					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T489R(1)|p.T474R(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TGGCACTGCTGTGTGACAGAC	0.363																																							uc003gwr.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|central_nervous_system(1)	3						c.(1465-1467)ACA>AGA		ATPase, aminophospholipid transporter (APLT),	Phosphatidylserine(DB00144)						133.0	124.0	127.0					4																	42554575		2203	4300	6503	SO:0001583	missense	10396				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr4:42554575G>C	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1466C>G	4.37:g.42554575G>C	ENSP00000371084:p.Thr489Arg					ATP8A1_uc003gws.2_Missense_Mutation_p.T474R|ATP8A1_uc011byz.1_Missense_Mutation_p.T474R	p.T489R	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN			17	1698	-			489			Cytoplasmic (Potential).		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	37	c.1466C>G	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989403	0.93106	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	D;D	0.86627	-2.15;-2.15	5.75	5.75	0.90469	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.96488	0.8854	H	0.98027	4.13	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.91635	0.992;0.997;0.999	D	0.97546	1.0089	10	0.87932	D	0	.	19.94	0.97155	0.0:0.0:1.0:0.0	.	474;474;489	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	R	489;474	ENSP00000371084:T489R;ENSP00000264449:T474R	ENSP00000264449:T474R	T	-	2	0	ATP8A1	42249332	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.762000	0.91711	2.721000	0.93114	0.650000	0.86243	ACA		0.363	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095		11	68	0	0	0	0.001855	0	11	68				
EPHA5	2044	broad.mit.edu	37	4	66201737	66201737	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr4:66201737C>A	ENST00000273854.3	-	16	3365	c.2765G>T	c.(2764-2766)aGg>aTg	p.R922M	EPHA5_ENST00000511294.1_Missense_Mutation_p.R923M|EPHA5_ENST00000432638.2_Missense_Mutation_p.R759M|EPHA5_ENST00000354839.4_Missense_Mutation_p.R900M	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	922	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.R922M(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AAACTTGGGCCTGCTATTTCG	0.483										TSP Lung(17;0.13)																													uc003hcy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(2764-2766)AGG>ATG		ephrin receptor EphA5 isoform a precursor							173.0	151.0	158.0					4																	66201737		2203	4299	6502	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66201737C>A	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2765G>T	4.37:g.66201737C>A	ENSP00000273854:p.Arg922Met	TSP Lung(17;0.13)				EPHA5_uc003hcx.2_Missense_Mutation_p.R854M|EPHA5_uc003hcz.2_Missense_Mutation_p.R900M|EPHA5_uc011cah.1_Missense_Mutation_p.R923M|EPHA5_uc011cai.1_Missense_Mutation_p.R901M|EPHA5_uc003hda.2_Missense_Mutation_p.R923M	p.R922M	NM_004439	NP_004430	P54756	EPHA5_HUMAN			16	2958	-			922			Cytoplasmic (Potential).|Protein kinase.		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.2765G>T	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612514	0.87258	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	5.93	5.1	0.69264	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	D	0.96858	0.8974	H	0.99830	4.82	0.54753	D	0.99998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98539	1.0631	10	0.87932	D	0	.	15.0977	0.72247	0.0:0.9326:0.0:0.0674	.	901;923;900;922	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	M	922;759;900;923	ENSP00000273854:R922M;ENSP00000389208:R759M;ENSP00000346899:R900M;ENSP00000427638:R923M	ENSP00000273854:R922M	R	-	2	0	EPHA5	65884332	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	1.537000	0.49254	-0.136000	0.14681	AGG		0.483	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		9	46	1	0	7.48243e-07	0.006214	1.04754e-06	9	46				
UGT2B7	7364	broad.mit.edu	37	4	69962328	69962328	+	Silent	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr4:69962328A>T	ENST00000508661.1	+	1	117	c.90A>T	c.(88-90)gcA>gcT	p.A30A	UGT2B7_ENST00000509763.1_Intron|UGT2B7_ENST00000305231.7_Silent_p.A30A			P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	30					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)	p.A30A(1)		autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TGGTGTGGGCAGCAGAATACA	0.428																																							uc003heg.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(88-90)GCA>GCT		UDP glucuronosyltransferase 2B7 precursor							143.0	146.0	145.0					4																	69962328		2203	4300	6503	SO:0001819	synonymous_variant	7364				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69962328A>T	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000508661.1:c.90A>T	4.37:g.69962328A>T						UGT2B7_uc010ihq.2_Silent_p.A30A	p.A30A	NM_001074	NP_001065	P16662	UD2B7_HUMAN			1	136	+			30					B2R810|Q6GTW0	Silent	SNP	ENST00000508661.1	37	c.90A>T																																																																																					0.428	UGT2B7-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000362103.1	NM_001074		16	99	0	0	0	0.006122	0	16	99				
EEF1A1P9	441032	broad.mit.edu	37	4	106406416	106406416	+	IGR	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr4:106406416T>C								PPA2 (11178 upstream) : AC004066.3 (54930 downstream)																							CACAGTAGCATTTGTGCCAGT	0.468																																							uc003hxt.1		NA																	0					0						c.(424-426)TTT>CTT		SubName: Full=Eukaryotic translation elongation factor 1 alpha; Flags: Fragment;																																				SO:0001628	intergenic_variant	441032							g.chr4:106406416T>C																													4.37:g.106406416T>C							p.F142L	NR_003586						1	554	+									Missense_Mutation	SNP		37	c.424T>C																																																																																				0	0.468									3	36	0	0	0	0.000602	0	3	36				
ELF2	1998	broad.mit.edu	37	4	139980359	139980359	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr4:139980359C>A	ENST00000394235.2	-	10	2026	c.1524G>T	c.(1522-1524)caG>caT	p.Q508H	ELF2_ENST00000379549.2_Missense_Mutation_p.Q431H|ELF2_ENST00000379550.1_Missense_Mutation_p.Q520H|ELF2_ENST00000265495.4_Missense_Mutation_p.Q508H|ELF2_ENST00000510408.1_Missense_Mutation_p.Q448H|ELF2_ENST00000358635.3_Missense_Mutation_p.Q460H|ELF2_ENST00000515489.1_Intron	NM_001276458.1	NP_001263387.1			E74-like factor 2 (ets domain transcription factor)									p.Q508H(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	19	all_hematologic(180;0.162)					GAGGAGGAGTCTGGCCAGATG	0.478																																							uc003ihp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1522-1524)CAG>CAT		E74-like factor 2 (ets domain transcription							124.0	125.0	124.0					4																	139980359		2203	4300	6503	SO:0001583	missense	1998				negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity	g.chr4:139980359C>A	AF256222	CCDS3744.1, CCDS3745.1, CCDS64062.1, CCDS64063.1	4q28	2008-02-05			ENSG00000109381	ENSG00000109381			3317	protein-coding gene	gene with protein product						8756667	Standard	NM_201999		Approved	EU32, NERF, NERF-2, NERF-1A, NERF-1B	uc003ihm.2	Q15723	OTTHUMG00000133383	ENST00000394235.2:c.1524G>T	4.37:g.139980359C>A	ENSP00000377782:p.Gln508His					ELF2_uc003ihm.1_Missense_Mutation_p.Q460H|ELF2_uc003ihn.1_Missense_Mutation_p.Q448H|ELF2_uc003iho.1_Missense_Mutation_p.Q431H|ELF2_uc011chc.1_Missense_Mutation_p.Q323H	p.Q508H	NM_201999	NP_973728	Q15723	ELF2_HUMAN			9	1730	-	all_hematologic(180;0.162)		520						Missense_Mutation	SNP	ENST00000394235.2	37	c.1524G>T	CCDS3744.1	.	.	.	.	.	.	.	.	.	.	C	0.036	-1.306611	0.01353	.	.	ENSG00000109381	ENST00000358635;ENST00000394235;ENST00000379550;ENST00000265495;ENST00000379549;ENST00000540754;ENST00000510408	T;T;T;T;T;T	0.11604	2.79;2.95;2.97;2.95;2.98;2.76	5.76	3.96	0.45880	.	0.309619	0.36854	N	0.002364	T	0.06371	0.0164	N	0.12746	0.255	0.44227	D	0.997061	B;B;B;B;B	0.10296	0.0;0.003;0.0;0.0;0.001	B;B;B;B;B	0.10450	0.0;0.005;0.0;0.001;0.004	T	0.32107	-0.9919	9	.	.	.	.	12.9473	0.58379	0.1038:0.6315:0.2647:0.0	.	323;508;431;448;460	B7Z8R4;Q15723-1;E9PCX3;B7Z720;Q15723-3	.;.;.;.;.	H	460;508;520;508;431;323;448	ENSP00000351458:Q460H;ENSP00000377782:Q508H;ENSP00000368868:Q520H;ENSP00000265495:Q508H;ENSP00000368867:Q431H;ENSP00000426997:Q448H	.	Q	-	3	2	ELF2	140199809	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.971000	0.29396	1.418000	0.47098	0.644000	0.83932	CAG		0.478	ELF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257233.2	NM_006874		24	104	1	0	2.89027e-11	0.014323	4.90983e-11	24	104				
RXFP1	59350	broad.mit.edu	37	4	159568062	159568062	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr4:159568062G>A	ENST00000307765.5	+	16	1716	c.1465G>A	c.(1465-1467)Gga>Aga	p.G489R	RXFP1_ENST00000343542.5_Missense_Mutation_p.G441R|RXFP1_ENST00000470033.1_Missense_Mutation_p.G456R|RXFP1_ENST00000448688.2_Missense_Mutation_p.G384R|RXFP1_ENST00000460056.2_Missense_Mutation_p.G408R	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	489					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)	p.G489R(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		TCAGCTTGTAGGATCTTTGGC	0.388																																							uc003ipz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1465-1467)GGA>AGA		relaxin/insulin-like family peptide receptor 1							138.0	128.0	131.0					4																	159568062		1915	4142	6057	SO:0001583	missense	59350					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding	g.chr4:159568062G>A	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.1465G>A	4.37:g.159568062G>A	ENSP00000303248:p.Gly489Arg					RXFP1_uc011cja.1_Missense_Mutation_p.G384R|RXFP1_uc010iqo.2_Missense_Mutation_p.G441R|RXFP1_uc011cjb.1_Missense_Mutation_p.G387R|RXFP1_uc010iqk.2_Missense_Mutation_p.G357R|RXFP1_uc011cjc.1_Missense_Mutation_p.G408R|RXFP1_uc011cjd.1_Missense_Mutation_p.G408R|RXFP1_uc010iql.2_Missense_Mutation_p.G333R|RXFP1_uc011cje.1_Missense_Mutation_p.G516R|RXFP1_uc010iqm.2_Missense_Mutation_p.G456R|RXFP1_uc011cjf.1_Missense_Mutation_p.G358R|RXFP1_uc010iqn.2_Missense_Mutation_p.G434R	p.G489R	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN		COAD - Colon adenocarcinoma(41;0.0219)	16	1547	+	all_hematologic(180;0.24)	Renal(120;0.0854)	489			Helical; Name=3; (Potential).		B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	37	c.1465G>A	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766783	0.90020	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.73202	0.3557	M	0.90814	3.15	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.998;1.0;1.0;0.997;0.996;0.996;0.998;1.0	T	0.78316	-0.2251	10	0.87932	D	0	.	19.9294	0.97114	0.0:0.0:1.0:0.0	.	500;516;384;441;456;408;359;489	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q9HBX9	.;.;.;.;.;.;.;RXFP1_HUMAN	R	408;489;384;441;456;359	ENSP00000423306:G408R;ENSP00000303248:G489R;ENSP00000414885:G384R;ENSP00000345889:G441R;ENSP00000420712:G456R	ENSP00000303248:G489R	G	+	1	0	RXFP1	159787512	1.000000	0.71417	0.624000	0.29186	0.684000	0.39900	9.777000	0.99008	2.701000	0.92244	0.650000	0.86243	GGA		0.388	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634		11	92	0	0	0	0.010729	0	11	92				
FRG1	2483	broad.mit.edu	37	4	190883020	190883020	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr4:190883020A>G	ENST00000226798.4	+	8	895	c.673A>G	c.(673-675)Aaa>Gaa	p.K225E		NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	225					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K225E(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TAAAATAAGTAAAGAAGACAG	0.308																																							uc003izs.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(673-675)AAA>GAA		FSHD region gene 1							73.0	90.0	84.0					4																	190883020		2149	4213	6362	SO:0001583	missense	2483				rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus		g.chr4:190883020A>G	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.673A>G	4.37:g.190883020A>G	ENSP00000226798:p.Lys225Glu						p.K225E	NM_004477	NP_004468	Q14331	FRG1_HUMAN		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)	8	864	+		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)	225					A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	c.673A>G	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	12.13	1.844280	0.32606	.	.	ENSG00000109536	ENST00000226798;ENST00000524583	T	0.30981	1.51	3.89	2.57	0.30868	.	0.213089	0.49305	D	0.000154	T	0.15478	0.0373	N	0.17764	0.52	0.35920	D	0.831779	B	0.22080	0.064	B	0.23275	0.045	T	0.13045	-1.0524	10	0.10111	T	0.7	-0.665	7.7244	0.28750	0.6245:0.3755:0.0:0.0	.	225	Q14331	FRG1_HUMAN	E	225;97	ENSP00000226798:K225E	ENSP00000226798:K225E	K	+	1	0	FRG1	191120014	1.000000	0.71417	0.994000	0.49952	0.923000	0.55619	3.474000	0.53129	1.541000	0.49316	0.392000	0.25879	AAA		0.308	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477		22	203	0	0	0	0.003954	0	22	203				
TRIP13	9319	broad.mit.edu	37	5	908506	908506	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:908506G>T	ENST00000166345.3	+	9	1152	c.796G>T	c.(796-798)Gcg>Tcg	p.A266S		NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	266					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)	p.A266S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			TGCCTGCAGGGCGGGCACCGA	0.562																																							uc003jbr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(796-798)GCG>TCG		thyroid hormone receptor interactor 13							62.0	66.0	64.0					5																	908506		2203	4300	6503	SO:0001583	missense	9319				double-strand break repair|reciprocal meiotic recombination|synaptonemal complex assembly|transcription from RNA polymerase II promoter		ATP binding|identical protein binding|nucleoside-triphosphatase activity|transcription cofactor activity	g.chr5:908506G>T	L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.796G>T	5.37:g.908506G>T	ENSP00000166345:p.Ala266Ser					TRIP13_uc010ite.1_Missense_Mutation_p.A266S	p.A266S	NM_004237	NP_004228	Q15645	PCH2_HUMAN	Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)		9	906	+			266					C9K0T3|D3DTC0|O15324	Missense_Mutation	SNP	ENST00000166345.3	37	c.796G>T	CCDS3858.1	.	.	.	.	.	.	.	.	.	.	.	4.221	0.039889	0.08148	.	.	ENSG00000071539	ENST00000166345	D	0.91996	-2.95	6.08	6.08	0.98989	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.81945	0.4930	N	0.02708	-0.52	0.80722	D	1	B	0.32829	0.386	B	0.35931	0.214	T	0.80311	-0.1436	10	0.02654	T	1	-15.1393	20.2585	0.98435	0.0:0.0:1.0:0.0	.	266	Q15645	PCH2_HUMAN	S	266	ENSP00000166345:A266S	ENSP00000166345:A266S	A	+	1	0	TRIP13	961506	1.000000	0.71417	0.997000	0.53966	0.041000	0.13682	5.961000	0.70356	2.894000	0.99253	0.655000	0.94253	GCG		0.562	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206721.2	NM_004237		8	44	1	0	1.12685e-05	0.004482	1.47107e-05	8	44				
CTNND2	1501	broad.mit.edu	37	5	11364898	11364898	+	Missense_Mutation	SNP	C	C	T	rs148824970	byFrequency	TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:11364898C>T	ENST00000304623.8	-	8	1471	c.1282G>A	c.(1282-1284)Gtc>Atc	p.V428I	CTNND2_ENST00000503622.1_Missense_Mutation_p.V91I|CTNND2_ENST00000511377.1_Missense_Mutation_p.V337I|CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.V428I|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	428					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V428I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TTCTGATAGACGCGGTCTTCA	0.617																																							uc003jfa.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(1282-1284)GTC>ATC		catenin (cadherin-associated protein), delta 2		C	ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	50.0	54.0	53.0		1282	4.6	1.0	5	dbSNP_134	53	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CTNND2	NM_001332.2	29	0,4,6499	TT,TC,CC		0.0116,0.0681,0.0308	probably-damaging	428/1226	11364898	4,13002	2203	4300	6503	SO:0001583	missense	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11364898C>T	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1282G>A	5.37:g.11364898C>T	ENSP00000307134:p.Val428Ile					CTNND2_uc010itt.2_Missense_Mutation_p.V337I|CTNND2_uc011cmy.1_Missense_Mutation_p.V91I|CTNND2_uc011cmz.1_5'UTR|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_5'UTR	p.V428I	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN			8	1427	-			428			ARM 1.		B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	c.1282G>A	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977602	0.92982	6.81E-4	1.16E-4	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000503622;ENST00000502551	T;T;T;T	0.78707	-1.08;-1.15;-1.09;-1.2	5.47	4.6	0.57074	.	0.086833	0.45361	N	0.000371	D	0.84129	0.5404	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72982	0.959;0.979	D	0.85369	0.1112	10	0.66056	D	0.02	-16.9562	13.9713	0.64242	0.0:0.9272:0.0:0.0728	.	91;428	B4DRK2;Q9UQB3	.;CTND2_HUMAN	I	428;428;337;91;168	ENSP00000307134:V428I;ENSP00000352661:V428I;ENSP00000426510:V337I;ENSP00000426887:V91I	ENSP00000307134:V428I	V	-	1	0	CTNND2	11417898	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	5.748000	0.68697	1.313000	0.45069	0.655000	0.94253	GTC		0.617	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		4	38	0	0	0	0.009096	0	4	38				
DNAH5	1767	broad.mit.edu	37	5	13786382	13786382	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:13786382C>A	ENST00000265104.4	-	52	8830	c.8726G>T	c.(8725-8727)cGt>cTt	p.R2909L		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2909					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2909H(1)|p.R2909L(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CATATTCAGACGCTCTTTTAG	0.433									Kartagener syndrome																														uc003jfd.2		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(8725-8727)CGT>CTT		dynein, axonemal, heavy chain 5							92.0	89.0	90.0					5																	13786382		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13786382C>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8726G>T	5.37:g.13786382C>A	ENSP00000265104:p.Arg2909Leu						p.R2909L	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN			52	8768	-	Lung NSC(4;0.00476)		2909					Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.8726G>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760895	0.69763	.	.	ENSG00000039139	ENST00000265104	T	0.22134	1.97	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	M	0.79011	2.435	0.80722	D	1	P	0.46064	0.872	B	0.42214	0.38	T	0.13656	-1.0501	10	0.22109	T	0.4	.	19.2104	0.93751	0.0:1.0:0.0:0.0	.	2909	Q8TE73	DYH5_HUMAN	L	2909	ENSP00000265104:R2909L	ENSP00000265104:R2909L	R	-	2	0	DNAH5	13839382	1.000000	0.71417	1.000000	0.80357	0.478000	0.33099	5.894000	0.69806	2.590000	0.87494	0.655000	0.94253	CGT		0.433	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		12	49	1	0	3.07112e-06	0.010729	4.10156e-06	12	49				
CDH10	1008	broad.mit.edu	37	5	24509704	24509704	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:24509704C>A	ENST00000264463.4	-	7	1734	c.1227G>T	c.(1225-1227)agG>agT	p.R409S		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	409	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R409R(1)|p.R409S(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		AATCTGGGTCCCTTGCCATTA	0.453										HNSCC(23;0.051)																													uc003jgr.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		upper_aerodigestive_tract(1)|lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(1225-1227)AGG>AGT		cadherin 10, type 2 preproprotein							95.0	95.0	95.0					5																	24509704		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24509704C>A	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1227G>T	5.37:g.24509704C>A	ENSP00000264463:p.Arg409Ser	HNSCC(23;0.051)				CDH10_uc011cnu.1_RNA	p.R409S	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	7	1559	-			409			Cadherin 4.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1227G>T	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.315161	0.40996	.	.	ENSG00000040731	ENST00000264463	T	0.01665	4.7	5.26	-1.27	0.09347	Cadherin (4);Cadherin-like (1);	0.100486	0.64402	D	0.000007	T	0.01661	0.0053	L	0.33792	1.035	0.39584	D	0.969475	B	0.21606	0.058	B	0.26770	0.073	T	0.54248	-0.8322	10	0.27785	T	0.31	.	10.3553	0.43960	0.0:0.2368:0.0:0.7632	.	409	Q9Y6N8	CAD10_HUMAN	S	409	ENSP00000264463:R409S	ENSP00000264463:R409S	R	-	3	2	CDH10	24545461	0.000000	0.05858	0.977000	0.42913	0.997000	0.91878	-0.737000	0.04877	-0.185000	0.10550	0.650000	0.86243	AGG		0.453	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		15	63	1	0	6.49762e-13	0.006122	1.18297e-12	15	63				
CDH6	1004	broad.mit.edu	37	5	31294067	31294067	+	Splice_Site	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:31294067A>T	ENST00000265071.2	+	3	493		c.e3-1		CDH6_ENST00000514738.1_Splice_Site	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(1)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTTCTACACTAGTTACATTCA	0.328																																							uc003jhe.1		NA																	1	Unknown(1)		lung(1)	ovary(4)|skin(2)|large_intestine(1)	7						c.e3-2		cadherin 6, type 2 preproprotein							45.0	47.0	47.0					5																	31294067		2202	4299	6501	SO:0001630	splice_region_variant	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31294067A>T	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.229-1A>T	5.37:g.31294067A>T						CDH6_uc003jhd.1_Splice_Site_p.L77_splice	p.L77_splice	NM_004932	NP_004923	P55285	CADH6_HUMAN			3	555	+								A8K5H5|Q9BWS0	Splice_Site	SNP	ENST00000265071.2	37	c.229_splice	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.988153	0.74589	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5764	0.84681	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH6	31329824	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.883000	0.92426	2.371000	0.80710	0.533000	0.62120	.		0.328	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	Intron	6	71	0	0	0	0.001984	0	6	71				
SPEF2	79925	broad.mit.edu	37	5	35753776	35753776	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:35753776G>T	ENST00000356031.3	+	24	3535	c.3381G>T	c.(3379-3381)gcG>gcT	p.A1127A	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Silent_p.A1122A	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1127					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.A1127A(2)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGGAAGAGGCGGAGCAGGAGC	0.493																																							uc003jjo.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(3379-3381)GCG>GCT		KPL2 protein isoform 1							133.0	137.0	136.0					5																	35753776		1921	4143	6064	SO:0001819	synonymous_variant	79925				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity	g.chr5:35753776G>T	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3381G>T	5.37:g.35753776G>T						SPEF2_uc003jjp.1_Silent_p.A613A	p.A1127A	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		24	3492	+	all_lung(31;7.56e-05)		1127					Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	ENST00000356031.3	37	c.3381G>T	CCDS43309.1																																																																																				0.493	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		22	114	1	0	1.22574e-08	0.014323	1.87086e-08	22	114				
SNX18	112574	broad.mit.edu	37	5	53815085	53815085	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:53815085A>T	ENST00000326277.3	+	1	1493	c.1303A>T	c.(1303-1305)Acc>Tcc	p.T435S	SNX18_ENST00000343017.6_Missense_Mutation_p.T435S|SNX18_ENST00000381410.4_Missense_Mutation_p.T435S	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	435	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.T435S(2)		endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				CAAGTGCTTCACCAAGAAGAT	0.607																																							uc003jpj.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1303-1305)ACC>TCC		sorting nexin 18 isoform b							54.0	58.0	57.0					5																	53815085		2203	4300	6503	SO:0001583	missense	112574				cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding	g.chr5:53815085A>T	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.1303A>T	5.37:g.53815085A>T	ENSP00000317332:p.Thr435Ser					SNX18_uc011cqg.1_Missense_Mutation_p.T435S|SNX18_uc003jpi.3_Missense_Mutation_p.T435S	p.T435S	NM_052870	NP_443102	Q96RF0	SNX18_HUMAN			1	1493	+		Lung NSC(810;3.46e-05)|Breast(144;0.102)	435			BAR.		B4E2B3|H7BXX3|Q05BB3|Q0VG02	Missense_Mutation	SNP	ENST00000326277.3	37	c.1303A>T	CCDS3962.1	.	.	.	.	.	.	.	.	.	.	A	12.21	1.868677	0.32977	.	.	ENSG00000178996	ENST00000343017;ENST00000381410;ENST00000326277	T;T;T	0.15372	2.62;2.43;2.8	5.13	5.13	0.70059	Sorting nexin protein, WASP-binding domain (1);	0.124181	0.53938	D	0.000055	T	0.15305	0.0369	L	0.37850	1.14	0.41652	D	0.989132	P;B	0.42296	0.775;0.041	B;B	0.39660	0.306;0.237	T	0.06679	-1.0813	10	0.23302	T	0.38	-29.8716	15.1072	0.72329	1.0:0.0:0.0:0.0	.	435;435	Q96RF0;Q96RF0-2	SNX18_HUMAN;.	S	435	ENSP00000342276:T435S;ENSP00000370817:T435S;ENSP00000317332:T435S	ENSP00000317332:T435S	T	+	1	0	SNX18	53850842	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.759000	0.62227	2.153000	0.67306	0.459000	0.35465	ACC		0.607	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2			4	35	0	0	0	0.009096	0	4	35				
IL31RA	133396	broad.mit.edu	37	5	55168177	55168177	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:55168177C>A	ENST00000447346.2	+	4	417	c.352C>A	c.(352-354)Cca>Aca	p.P118T	IL31RA_ENST00000396834.1_Missense_Mutation_p.P99T|IL31RA_ENST00000396836.2_Missense_Mutation_p.P118T|IL31RA_ENST00000297015.3_5'UTR|IL31RA_ENST00000354961.4_Missense_Mutation_p.P99T|IL31RA_ENST00000490985.1_5'UTR|IL31RA_ENST00000359040.5_Missense_Mutation_p.P118T	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	86	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)	p.P118T(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				TTTTTTCCTTCCAAGAATAAC	0.348																																							uc003jql.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(352-354)CCA>ACA		gp130-like monocyte receptor							87.0	90.0	89.0					5																	55168177		2203	4300	6503	SO:0001583	missense	133396				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity	g.chr5:55168177C>A	AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.352C>A	5.37:g.55168177C>A	ENSP00000415900:p.Pro118Thr					IL31RA_uc003jqk.2_Missense_Mutation_p.P118T|IL31RA_uc011cqj.1_5'UTR|IL31RA_uc003jqm.2_Missense_Mutation_p.P86T|IL31RA_uc003jqn.2_Missense_Mutation_p.P118T|IL31RA_uc010iwa.1_Missense_Mutation_p.P86T|IL31RA_uc003jqo.2_5'UTR	p.P118T	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN			4	417	+		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)	86			Extracellular (Potential).|Fibronectin type-III 1.		A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	ENST00000447346.2	37	c.352C>A	CCDS3970.2	.	.	.	.	.	.	.	.	.	.	C	6.796	0.515961	0.12944	.	.	ENSG00000164509	ENST00000396836;ENST00000396834;ENST00000447346;ENST00000359040;ENST00000354961	T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28	4.23	0.74	0.18330	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (3);Immunoglobulin-like fold (1);	79.416300	0.00166	U	0.000000	T	0.43831	0.1265	L	0.52126	1.63	0.09310	N	0.999999	B;B;B;B;P	0.38335	0.267;0.225;0.225;0.225;0.627	B;B;B;B;B	0.29077	0.081;0.048;0.048;0.048;0.098	T	0.23691	-1.0181	10	0.06494	T	0.89	-4.7159	6.1603	0.20360	0.0:0.5698:0.0:0.4302	.	86;118;99;118;118	Q8NI17;Q8NI17-5;Q8NI17-3;Q8NI17-2;Q8NI17-8	IL31R_HUMAN;.;.;.;.	T	118;99;118;118;99	ENSP00000380048:P118T;ENSP00000380046:P99T;ENSP00000415900:P118T;ENSP00000351935:P118T;ENSP00000347047:P99T	ENSP00000347047:P99T	P	+	1	0	IL31RA	55203934	0.000000	0.05858	0.001000	0.08648	0.111000	0.19643	-0.074000	0.11450	0.015000	0.14971	0.563000	0.77884	CCA		0.348	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1	NM_139017		18	63	1	0	9.16793e-09	0.00499	1.4046e-08	18	63				
FTMT	94033	broad.mit.edu	37	5	121187725	121187725	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:121187725C>T	ENST00000321339.1	+	1	76	c.67C>T	c.(67-69)Cgc>Tgc	p.R23C		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	23					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)	p.R23C(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GCGCCCGGTGCGCTGCTGCTT	0.731																																							uc003kss.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(67-69)CGC>TGC		ferritin mitochondrial precursor							16.0	18.0	17.0					5																	121187725		2198	4292	6490	SO:0001583	missense	94033				cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity	g.chr5:121187725C>T	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.67C>T	5.37:g.121187725C>T	ENSP00000313691:p.Arg23Cys						p.R23C	NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)	1	76	+		all_cancers(142;0.0124)|Prostate(80;0.0322)	23						Missense_Mutation	SNP	ENST00000321339.1	37	c.67C>T	CCDS4128.1	.	.	.	.	.	.	.	.	.	.	C	8.592	0.884920	0.17540	.	.	ENSG00000181867	ENST00000321339	T	0.63580	-0.05	2.95	0.0714	0.14382	.	.	.	.	.	T	0.41994	0.1183	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.27606	-1.0069	9	0.46703	T	0.11	.	2.3777	0.04346	0.2393:0.4726:0.0:0.288	.	23	Q8N4E7	FTMT_HUMAN	C	23	ENSP00000313691:R23C	ENSP00000313691:R23C	R	+	1	0	FTMT	121215624	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.252000	0.08806	-0.015000	0.14150	-0.760000	0.03462	CGC		0.731	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478		5	10	0	0	0	0.001168	0	5	10				
SLC23A1	9963	broad.mit.edu	37	5	138713677	138713677	+	Silent	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:138713677G>T	ENST00000348729.3	-	12	1486	c.1440C>A	c.(1438-1440)ggC>ggA	p.G480G	SLC23A1_ENST00000353963.3_Silent_p.G484G|SLC23A1_ENST00000503919.1_5'Flank	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	480					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)	p.G484G(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	TATTGATGGCGCCAGGGTTGG	0.547																																							uc003leh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1438-1440)GGC>GGA		solute carrier family 23 (nucleobase	Vitamin C(DB00126)						50.0	45.0	47.0					5																	138713677		2203	4300	6503	SO:0001819	synonymous_variant	9963				brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity	g.chr5:138713677G>T	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1440C>A	5.37:g.138713677G>T						SLC23A1_uc003leg.2_Silent_p.G484G	p.G480G	NM_005847	NP_005838	Q9UHI7	S23A1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		12	1537	-			480					O95191|Q8WWB6|Q9UGH4|Q9UI39	Silent	SNP	ENST00000348729.3	37	c.1440C>A	CCDS4212.1																																																																																				0.547	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685		3	13	1	0	6.4e-05	0.004672	7.87568e-05	3	13				
UBE2D2	7322	broad.mit.edu	37	5	138994325	138994325	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:138994325A>G	ENST00000398733.3	+	4	790	c.164A>G	c.(163-165)cAt>cGt	p.H55R	UBE2D2_ENST00000511725.1_Missense_Mutation_p.H26R|UBE2D2_ENST00000505548.1_Missense_Mutation_p.H26R|UBE2D2_ENST00000253815.2_Missense_Mutation_p.H26R	NM_003339.2	NP_003330.1	P62837	UB2D2_HUMAN	ubiquitin-conjugating enzyme E2D 2	55					cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.H55R(1)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTGACAATTCATTTCCCAACA	0.313																																							uc003ler.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(163-165)CAT>CGT		ubiquitin-conjugating enzyme E2D 2 isoform 1							100.0	95.0	97.0					5																	138994325		1949	4190	6139	SO:0001583	missense	7322				protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|protein binding|ubiquitin-protein ligase activity	g.chr5:138994325A>G	L40146	CCDS43369.1, CCDS47275.1	5q31.2	2013-10-18	2011-05-19		ENSG00000131508	ENSG00000131508		"""Ubiquitin-conjugating enzymes E2"""	12475	protein-coding gene	gene with protein product		602962	"""ubiquitin-conjugating enzyme E2D 2 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181838		Approved	UbcH5B, UBC4	uc003ler.3	P62837	OTTHUMG00000163282	ENST00000398733.3:c.164A>G	5.37:g.138994325A>G	ENSP00000381717:p.His55Arg					UBE2D2_uc003leq.2_Missense_Mutation_p.H26R	p.H55R	NM_003339	NP_003330	P62837	UB2D2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		4	790	+			55					D3DQC9|P51669|Q3MN78|Q96RP6	Missense_Mutation	SNP	ENST00000398733.3	37	c.164A>G	CCDS43369.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.997386	0.54147	.	.	ENSG00000131508	ENST00000511725;ENST00000398733;ENST00000253815;ENST00000505007;ENST00000398734;ENST00000505548	T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27	5.9	4.73	0.59995	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.087728	0.85682	D	0.000000	T	0.24198	0.0586	N	0.13168	0.305	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.03641	-1.1017	10	0.87932	D	0	.	12.4377	0.55608	0.8741:0.0:0.0:0.1259	.	55	P62837	UB2D2_HUMAN	R	26;55;26;26;55;26	ENSP00000429613:H26R;ENSP00000381717:H55R;ENSP00000253815:H26R;ENSP00000426523:H26R;ENSP00000381718:H55R;ENSP00000424941:H26R	ENSP00000253815:H26R	H	+	2	0	UBE2D2	138974509	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.339000	0.96797	1.029000	0.39812	-0.490000	0.04691	CAT		0.313	UBE2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372454.3	NM_181838		16	56	0	0	0	0.007413	0	16	56				
PCDHGA6	56109	broad.mit.edu	37	5	140753949	140753949	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:140753949C>A	ENST00000517434.1	+	1	299	c.299C>A	c.(298-300)cCg>cAg	p.P100Q	PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	100	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P100Q(1)|p.P100L(1)		breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCAGAGCCCGCGGTGTCTG	0.512																																							uc003ljy.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(298-300)CCG>CAG		protocadherin gamma subfamily A, 6 isoform 1							49.0	56.0	54.0					5																	140753949		2165	4287	6452	SO:0001583	missense	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140753949C>A	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.299C>A	5.37:g.140753949C>A	ENSP00000429601:p.Pro100Gln					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.P100Q	p.P100Q	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	299	+			100			Cadherin 1.|Extracellular (Potential).		A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	c.299C>A	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	8.924	0.961764	0.18583	.	.	ENSG00000253731	ENST00000517434	T	0.26810	1.71	5.23	0.385	0.16249	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.735356	0.10219	U	0.701092	T	0.27489	0.0675	M	0.71036	2.16	0.09310	N	1	B;B	0.34214	0.271;0.442	B;B	0.37780	0.068;0.258	T	0.25882	-1.0119	10	0.35671	T	0.21	.	5.3148	0.15850	0.4511:0.3538:0.0:0.1951	.	100;100	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	Q	100	ENSP00000429601:P100Q	ENSP00000429601:P100Q	P	+	2	0	PCDHGA6	140734133	0.000000	0.05858	0.000000	0.03702	0.687000	0.40016	-1.249000	0.02888	-0.048000	0.13401	0.655000	0.94253	CCG		0.512	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		13	57	1	0	0.00010058	0.013537	0.000119752	13	57				
SIMC1	375484	broad.mit.edu	37	5	175716732	175716732	+	Missense_Mutation	SNP	A	A	G	rs550182179	byFrequency	TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:175716732A>G	ENST00000443967.1	+	4	555	c.148A>G	c.(148-150)Aga>Gga	p.R50G	SIMC1_ENST00000341199.6_Intron|SIMC1_ENST00000429602.2_Missense_Mutation_p.R69G|SIMC1_ENST00000430704.2_Intron|SIMC1_ENST00000503595.1_3'UTR			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	50							SUMO polymer binding (GO:0032184)	p.R50G(1)									TGACCTGACAAGAGCTGAGGG	0.448													a|||	3	0.000599042	0.0	0.0043	5008	,	,		22375	0.0		0.0	False		,,,				2504	0.0						uc003mds.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(148-150)AGA>GGA		RecName: Full=Uncharacterized protein C5orf25;							75.0	69.0	71.0					5																	175716732		2203	4300	6503	SO:0001583	missense	375484							g.chr5:175716732A>G	BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.148A>G	5.37:g.175716732A>G	ENSP00000406571:p.Arg50Gly					C5orf25_uc003mdt.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Missense_Mutation_p.R69G|uc003mdu.1_5'UTR	p.R50G			Q8NDZ2	CE025_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)	4	555	+	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	50					J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Missense_Mutation	SNP	ENST00000443967.1	37	c.148A>G		.	.	.	.	.	.	.	.	.	.	A	0.174	-1.069119	0.01918	.	.	ENSG00000170085	ENST00000443967;ENST00000429602	T;T	0.34072	2.15;1.38	3.92	-1.73	0.08081	.	1.182270	0.06197	N	0.682537	T	0.17408	0.0418	.	.	.	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.28554	-1.0040	9	0.08837	T	0.75	-0.0082	8.8791	0.35363	0.5755:0.0:0.4245:0.0	.	69;50	B4DRM7;Q8NDZ2	.;CE025_HUMAN	G	50;69	ENSP00000406571:R50G;ENSP00000410552:R69G	ENSP00000410552:R69G	R	+	1	2	C5orf25	175649338	0.357000	0.24938	0.818000	0.32626	0.088000	0.18126	0.166000	0.16583	-0.449000	0.07117	-1.475000	0.01000	AGA		0.448	SIMC1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000253155.2	NM_198567		5	14	0	0	0	0.000602	0	5	14				
DBN1	1627	broad.mit.edu	37	5	176887645	176887645	+	Splice_Site	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:176887645C>T	ENST00000309007.5	-	9	1050	c.831G>A	c.(829-831)gaG>gaA	p.E277E	DBN1_ENST00000512501.1_Splice_Site_p.E9E|DBN1_ENST00000292385.5_Splice_Site_p.E279E|DBN1_ENST00000393563.4_Splice_Site_p.E9E|DBN1_ENST00000393565.1_Splice_Site_p.E277E	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	277					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.E277E(1)|p.E279E(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGCTCTCACCTCCACCTCCG	0.607																																							uc003mgy.2		NA																	2	Substitution - coding silent(2)		lung(2)	breast(3)|ovary(1)|lung(1)|skin(1)	6						c.(829-831)GAG>GAA		drebrin 1 isoform a							160.0	128.0	139.0					5																	176887645		2203	4300	6503	SO:0001630	splice_region_variant	1627				actin filament organization|regulation of dendrite development|regulation of neuronal synaptic plasticity	actomyosin|cytoplasm|dendrite	actin binding|profilin binding	g.chr5:176887645C>T		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.831+1G>A	5.37:g.176887645C>T						DBN1_uc011dga.1_Silent_p.E9E|DBN1_uc003mgx.2_Silent_p.E279E|DBN1_uc010jkn.1_Silent_p.E227E|DBN1_uc003mgz.1_Silent_p.E214E	p.E277E	NM_004395	NP_004386	Q16643	DREB_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		9	1003	-	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	277					A8MV58|B2RBG0|Q9UFZ5	Silent	SNP	ENST00000309007.5	37	c.831G>A	CCDS4420.1																																																																																				0.607	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881	Silent	5	39	0	0	0	0.001168	0	5	39				
DUSP22	56940	broad.mit.edu	37	6	348145	348145	+	Silent	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:348145C>T	ENST00000344450.5	+	6	749	c.306C>T	c.(304-306)taC>taT	p.Y102Y	DUSP22_ENST00000419235.2_Silent_p.Y102Y|DUSP22_ENST00000603453.1_5'UTR|DUSP22_ENST00000605315.1_5'UTR|DUSP22_ENST00000604971.1_5'UTR|DUSP22_ENST00000605035.1_5'UTR|DUSP22_ENST00000605863.1_5'UTR	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	102	Tyrosine-protein phosphatase.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.Y102Y(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		TGATCGCATACATCATGACCG	0.612																																							uc003msx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(304-306)TAC>TAT		dual specificity phosphatase 22							193.0	177.0	182.0					6																	348145		2203	4300	6503	SO:0001819	synonymous_variant	56940				apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr6:348145C>T	AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.306C>T	6.37:g.348145C>T						DUSP22_uc011dhn.1_Silent_p.Y102Y|DUSP22_uc003msy.1_Silent_p.Y59Y	p.Y102Y	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)	6	745	+	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)	102			Tyrosine-protein phosphatase.		B4DK56|Q59GW2|Q5VWR2|Q96AR1	Silent	SNP	ENST00000344450.5	37	c.306C>T	CCDS4468.1	.	.	.	.	.	.	.	.	.	.	C	6.784	0.513605	0.12944	.	.	ENSG00000112679	ENST00000419235	.	.	.	5.82	2.1	0.27182	.	.	.	.	.	T	0.43389	0.1245	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32214	-0.9915	4	.	.	.	.	8.7463	0.34589	0.0:0.5769:0.0:0.4231	.	.	.	.	Y	40	.	.	H	+	1	0	DUSP22	293145	1.000000	0.71417	0.991000	0.47740	0.571000	0.35966	1.382000	0.34374	0.389000	0.25086	-0.140000	0.14226	CAT		0.612	DUSP22-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000039621.1	NM_020185		12	134	0	0	0	0.001855	0	12	134				
BMP6	654	broad.mit.edu	37	6	7727541	7727541	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:7727541A>T	ENST00000283147.6	+	1	512	c.353A>T	c.(352-354)cAg>cTg	p.Q118L		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	118					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)	p.Q118L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					cagcagcagcagcTGCCTCGC	0.731																																							uc003mxu.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)	3						c.(352-354)CAG>CTG		bone morphogenetic protein 6 preproprotein																																				SO:0001583	missense	654				BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity	g.chr6:7727541A>T	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.353A>T	6.37:g.7727541A>T	ENSP00000283147:p.Gln118Leu						p.Q118L	NM_001718	NP_001709	P22004	BMP6_HUMAN			1	531	+	Ovarian(93;0.0721)		118					Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	c.353A>T	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	A	5.648	0.304211	0.10678	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.72725	-0.68	3.64	-7.28	0.01456	Transforming growth factor-beta, N-terminal (1);	0.609742	0.13235	N	0.403351	T	0.27134	0.0665	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10382	-1.0632	10	0.41790	T	0.15	.	2.9855	0.05966	0.1788:0.4954:0.0931:0.2327	.	118	P22004	BMP6_HUMAN	L	40;118;81	ENSP00000283147:Q118L	ENSP00000283147:Q118L	Q	+	2	0	BMP6	7672540	0.177000	0.23109	0.002000	0.10522	0.071000	0.16799	-0.158000	0.10070	-1.400000	0.02061	-1.802000	0.00618	CAG		0.731	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718		3	14	0	0	0	0.004672	0	3	14				
DAXX	1616	broad.mit.edu	37	6	33287401	33287401	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:33287401G>A	ENST00000374542.5	-	6	1900	c.1696C>T	c.(1696-1698)Ctc>Ttc	p.L566F	DAXX_ENST00000266000.6_Missense_Mutation_p.L566F|ZBTB22_ENST00000431845.2_5'Flank|DAXX_ENST00000477162.1_5'UTR|ZBTB22_ENST00000418724.1_5'Flank|DAXX_ENST00000414083.2_Missense_Mutation_p.L491F	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	566	Asp/Glu-rich (acidic).|Interaction with MAP3K5.|Necessary for interaction with USP7.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.L566F(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						AGCTCAAAGAGCTGAGACACA	0.542			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																		uc003oec.2		NA		Rec	yes		6	6p21.3	1616	Mis|F|N	death-domain associated protein			E			Pancreatic neuroendocrine tumors		1	Substitution - Missense(1)		lung(1)	pancreas(18)|ovary(2)|skin(2)|prostate(1)	23						c.(1696-1698)CTC>TTC		death-domain associated protein isoform a							91.0	91.0	91.0					6																	33287401		2203	4300	6503	SO:0001583	missense	1616				activation of JUN kinase activity|androgen receptor signaling pathway|apoptosis|induction of apoptosis via death domain receptors|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|regulation of protein ubiquitination|transcription, DNA-dependent	chromosome, centromeric region|cytosol|nucleolus|PML body	androgen receptor binding|heat shock protein binding|p53 binding|protein homodimerization activity|protein N-terminus binding|receptor signaling protein activity|transcription factor binding|ubiquitin protein ligase binding	g.chr6:33287401G>A	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1696C>T	6.37:g.33287401G>A	ENSP00000363668:p.Leu566Phe					ZBTB22_uc003oeb.2_5'Flank|ZBTB22_uc010juu.2_5'Flank|DAXX_uc011drd.1_Missense_Mutation_p.L491F|DAXX_uc011dre.1_Missense_Mutation_p.L578F|DAXX_uc003oed.2_Missense_Mutation_p.L566F	p.L566F	NM_001350	NP_001341	Q9UER7	DAXX_HUMAN			6	1900	-			566			Asp/Glu-rich (acidic).|Interaction with MAP3K5.|Necessary for interaction with USP7.		B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	ENST00000374542.5	37	c.1696C>T	CCDS4776.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199326	0.58126	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	.	.	.	4.69	2.86	0.33363	.	0.431558	0.19615	N	0.110041	T	0.38134	0.1029	M	0.63428	1.95	0.32206	N	0.577217	P;P	0.48998	0.918;0.918	P;P	0.54889	0.763;0.763	T	0.20140	-1.0284	9	0.32370	T	0.25	-6.2315	7.4075	0.27000	0.0:0.2125:0.6053:0.1822	.	578;566	B4E1C1;Q9UER7	.;DAXX_HUMAN	F	566;566;491	.	ENSP00000266000:L566F	L	-	1	0	DAXX	33395379	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	0.657000	0.24963	0.548000	0.28955	0.549000	0.68633	CTC		0.542	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1			31	65	0	0	0	0.008361	0	31	65				
PNPLA1	285848	broad.mit.edu	37	6	36274107	36274107	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:36274107G>T	ENST00000394571.2	+	7	1423	c.1423G>T	c.(1423-1425)Gtg>Ttg	p.V475L	PNPLA1_ENST00000388715.3_Missense_Mutation_p.V380L|PNPLA1_ENST00000312917.5_Missense_Mutation_p.V389L	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	475					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)	p.V475L(1)|p.V380L(1)		breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						AAAAAGCGCCGTGCCTCTGGT	0.478																																							uc010jwf.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4						c.(1423-1425)GTG>TTG		patatin-like phospholipase domain containing 1							168.0	158.0	161.0					6																	36274107		2203	4300	6503	SO:0001583	missense	285848				lipid catabolic process		hydrolase activity	g.chr6:36274107G>T		CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.1423G>T	6.37:g.36274107G>T	ENSP00000378072:p.Val475Leu					PNPLA1_uc003olw.1_Missense_Mutation_p.V380L|PNPLA1_uc010jwe.1_Missense_Mutation_p.V389L	p.V475L	NM_001145717	NP_001139189	Q8N8W4	PLPL1_HUMAN			7	1423	+			475					A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	ENST00000394571.2	37	c.1423G>T	CCDS54997.1	.	.	.	.	.	.	.	.	.	.	G	9.368	1.069743	0.20147	.	.	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.32272	1.68;1.68;1.46;1.46	4.25	-3.67	0.04476	.	3.375160	0.01297	N	0.010192	T	0.06005	0.0156	N	0.17082	0.46	0.09310	N	1	B;B	0.21381	0.055;0.002	B;B	0.20384	0.029;0.005	T	0.24440	-1.0160	10	0.45353	T	0.12	12.6928	5.025	0.14379	0.4474:0.2825:0.2701:0.0	.	475;389	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	L	380;389;476;475	ENSP00000373367:V380L;ENSP00000321116:V389L;ENSP00000391868:V476L;ENSP00000378072:V475L	ENSP00000321116:V389L	V	+	1	0	PNPLA1	36382085	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.581000	0.02119	-1.010000	0.03396	-0.304000	0.09214	GTG		0.478	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676		28	120	1	0	1.39649e-27	0.012213	2.87804e-27	28	120				
XPO5	57510	broad.mit.edu	37	6	43538667	43538667	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:43538667T>A	ENST00000265351.7	-	4	575	c.365A>T	c.(364-366)gAa>gTa	p.E122V		NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	122					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)	p.E122V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			CTTGATCATTTCCACTACAAT	0.398																																							uc003ovp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|breast(1)|kidney(1)	4						c.(364-366)GAA>GTA		exportin 5							144.0	141.0	142.0					6																	43538667		1909	4135	6044	SO:0001583	missense	57510				gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding	g.chr6:43538667T>A	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.365A>T	6.37:g.43538667T>A	ENSP00000265351:p.Glu122Val						p.E122V	NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)		4	576	-	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		122					Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	ENST00000265351.7	37	c.365A>T	CCDS47430.1	.	.	.	.	.	.	.	.	.	.	T	35	5.430020	0.96131	.	.	ENSG00000124571	ENST00000265351	T	0.48522	0.81	5.78	5.78	0.91487	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66645	0.2810	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72388	-0.4309	10	0.72032	D	0.01	-20.0846	16.3979	0.83621	0.0:0.0:0.0:1.0	.	122	Q9HAV4	XPO5_HUMAN	V	122	ENSP00000265351:E122V	ENSP00000265351:E122V	E	-	2	0	XPO5	43646645	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.764000	0.85297	2.333000	0.79357	0.533000	0.62120	GAA		0.398	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750		43	97	0	0	0	0.009718	0	43	97				
RHAG	6005	broad.mit.edu	37	6	49586929	49586929	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:49586929G>T	ENST00000371175.4	-	2	330	c.304C>A	c.(304-306)Caa>Aaa	p.Q102K	RHAG_ENST00000229810.7_Missense_Mutation_p.Q102K	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	102					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.Q102K(1)		NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					CCCTGGCTTTGCAGGATTCCC	0.443																																					Ovarian(176;476 2003 7720 43408 44749)	Ovarian(176;476 2003 7720 43408 44749)	uc003ozk.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|skin(1)	2						c.(304-306)CAA>AAA		Rh-associated glycoprotein							128.0	121.0	123.0					6																	49586929		2203	4300	6503	SO:0001583	missense	6005				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding	g.chr6:49586929G>T		CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.304C>A	6.37:g.49586929G>T	ENSP00000360217:p.Gln102Lys					RHAG_uc010jzl.2_Missense_Mutation_p.Q102K|RHAG_uc010jzm.2_Missense_Mutation_p.Q102K	p.Q102K	NM_000324	NP_000315	Q02094	RHAG_HUMAN			2	366	-	Lung NSC(77;0.0255)		102			Extracellular (Potential).		B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Missense_Mutation	SNP	ENST00000371175.4	37	c.304C>A	CCDS4927.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.941359	0.53079	.	.	ENSG00000112077	ENST00000371175;ENST00000229810;ENST00000418071;ENST00000539403	T;T	0.22743	1.94;1.94	5.83	4.04	0.47022	Ammonium transporter AmtB-like (3);	0.746815	0.13821	N	0.360386	T	0.05090	0.0136	N	0.13168	0.305	0.24858	N	0.992363	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.16722	0.016;0.007;0.005	T	0.37407	-0.9707	10	0.72032	D	0.01	-1.258	10.3442	0.43897	0.0698:0.0:0.7953:0.1349	.	102;102;102	O43515;Q9UHG9;Q02094	.;.;RHAG_HUMAN	K	102	ENSP00000360217:Q102K;ENSP00000229810:Q102K	ENSP00000229810:Q102K	Q	-	1	0	RHAG	49694888	1.000000	0.71417	0.003000	0.11579	0.009000	0.06853	5.096000	0.64535	0.789000	0.33779	0.591000	0.81541	CAA		0.443	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043806.1			14	47	1	0	4.7546e-09	0.004007	7.4245e-09	14	47				
KHDC3L	154288	broad.mit.edu	37	6	74073549	74073549	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:74073549G>T	ENST00000370367.3	+	3	673	c.620G>T	c.(619-621)cGc>cTc	p.R207L		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	207							RNA binding (GO:0003723)	p.R207L(1)									CAGCGGTTTCGCGAGGATGCC	0.622																																							uc003pgt.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(619-621)CGC>CTC		hypothetical protein LOC154288							33.0	34.0	33.0					6																	74073549		2201	4298	6499	SO:0001583	missense	154288							g.chr6:74073549G>T	AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	ENST00000370367.3:c.620G>T	6.37:g.74073549G>T	ENSP00000359392:p.Arg207Leu						p.R207L	NM_001017361	NP_001017361	Q587J8	ECAT1_HUMAN			3	673	+			207					B2RNW7	Missense_Mutation	SNP	ENST00000370367.3	37	c.620G>T	CCDS34484.1	.	.	.	.	.	.	.	.	.	.	G	6.213	0.407446	0.11754	.	.	ENSG00000203908	ENST00000370367	T	0.44881	0.91	2.24	-1.01	0.10169	.	1.253690	0.05990	N	0.645817	T	0.09113	0.0225	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.27157	-1.0082	10	0.48119	T	0.1	.	1.1423	0.01768	0.2006:0.3186:0.3279:0.1529	.	207	Q587J8	ECAT1_HUMAN	L	207	ENSP00000359392:R207L	ENSP00000359392:R207L	R	+	2	0	C6orf221	74130270	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.787000	0.04618	-0.326000	0.08564	-0.657000	0.03884	CGC		0.622	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041202.3	NM_001017361		8	29	1	0	3.09899e-07	0.004482	4.47754e-07	8	29				
ZNF292	23036	broad.mit.edu	37	6	87967002	87967002	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:87967002G>T	ENST00000369577.3	+	8	3698	c.3655G>T	c.(3655-3657)Gat>Tat	p.D1219Y	ZNF292_ENST00000339907.4_Missense_Mutation_p.D1214Y	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1219						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.D1074Y(1)|p.D1219Y(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AACTTCTCAGGATAAAAATGA	0.398																																							uc003plm.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(3655-3657)GAT>TAT		zinc finger protein 292							55.0	53.0	54.0					6																	87967002		1874	4119	5993	SO:0001583	missense	23036				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:87967002G>T	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.3655G>T	6.37:g.87967002G>T	ENSP00000358590:p.Asp1219Tyr						p.D1219Y	NM_015021	NP_055836	O60281	ZN292_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0199)	8	3696	+		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)	1219					Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	c.3655G>T	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.715193	0.30413	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.07216	3.21;3.22	5.65	4.76	0.60689	.	0.355864	0.32802	N	0.005640	T	0.02888	0.0086	L	0.34521	1.04	0.38743	D	0.953931	P	0.45283	0.855	B	0.41571	0.36	T	0.43032	-0.9416	10	0.59425	D	0.04	.	5.5744	0.17215	0.1189:0.0:0.6885:0.1926	.	1219	O60281	ZN292_HUMAN	Y	1219;1214	ENSP00000358590:D1219Y;ENSP00000342847:D1214Y	ENSP00000342847:D1214Y	D	+	1	0	ZNF292	88023721	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.311000	0.51919	1.348000	0.45733	0.585000	0.79938	GAT		0.398	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021		11	15	1	0	1.58986e-06	0.008291	2.15881e-06	11	15				
BCLAF1	9774	broad.mit.edu	37	6	136597526	136597526	+	Silent	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:136597526T>C	ENST00000531224.1	-	5	1389	c.1137A>G	c.(1135-1137)gaA>gaG	p.E379E	BCLAF1_ENST00000527759.1_Silent_p.E377E|BCLAF1_ENST00000392348.2_Silent_p.E377E|BCLAF1_ENST00000530767.1_Intron|BCLAF1_ENST00000353331.4_Silent_p.E377E|BCLAF1_ENST00000527536.1_Silent_p.E379E	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	379					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.E379E(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AATCTAGAGCTTCCTGATCTT	0.428																																					Colon(142;1534 1789 5427 7063 28491)	Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1135-1137)GAA>GAG		BCL2-associated transcription factor 1 isoform							234.0	253.0	246.0					6																	136597526		2203	4299	6502	SO:0001819	synonymous_variant	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136597526T>C	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1137A>G	6.37:g.136597526T>C						BCLAF1_uc003qgw.1_Intron|BCLAF1_uc003qgy.1_Silent_p.E377E|BCLAF1_uc011edc.1_Intron|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Silent_p.E377E	p.E379E	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	5	1390	-	Colorectal(23;0.24)		379					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Silent	SNP	ENST00000531224.1	37	c.1137A>G	CCDS5177.1																																																																																				0.428	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		37	472	0	0	0	0.00623	0	37	472				
ABCB5	340273	broad.mit.edu	37	7	20739552	20739552	+	Splice_Site	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:20739552G>T	ENST00000404938.2	+	18	2911	c.2259G>T	c.(2257-2259)caG>caT	p.Q753H	ABCB5_ENST00000258738.6_Splice_Site_p.Q308H	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	753	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.Q308H(1)|p.Q753H(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ATTTCATGCAGGTAAGCTTTT	0.289																																							uc003suw.3		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						c.(922-924)CAG>CAT		ATP-binding cassette, sub-family B, member 5							140.0	132.0	135.0					7																	20739552		2202	4299	6501	SO:0001630	splice_region_variant	340273				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity	g.chr7:20739552G>T	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2259+1G>T	7.37:g.20739552G>T						ABCB5_uc010kuh.2_Missense_Mutation_p.Q753H	p.Q308H	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN			9	1470	+			308			Helical; (Potential).|ABC transmembrane type-1.		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	c.924G>T	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707263	0.68615	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.89875	-2.58;-2.58	5.64	5.64	0.86602	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.46145	D	0.000301	D	0.95159	0.8431	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.989;0.992	D	0.95606	0.8667	10	0.87932	D	0	.	17.202	0.86908	0.0:0.0:1.0:0.0	.	753;308	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	H	753;308	ENSP00000384881:Q753H;ENSP00000258738:Q308H	ENSP00000258738:Q308H	Q	+	3	2	ABCB5	20706077	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	6.263000	0.72521	2.651000	0.90000	0.585000	0.79938	CAG		0.289	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	Missense_Mutation	6	32	1	0	0.00198382	0.001984	0.00223731	6	32				
HOXA1	3198	broad.mit.edu	37	7	27135409	27135409	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:27135409C>A	ENST00000343060.4	-	1	184	c.123G>T	c.(121-123)gcG>gcT	p.A41A	HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOXA1_ENST00000355633.5_Silent_p.A41A|HOTAIRM1_ENST00000425358.2_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	41					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A41A(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGGCGCTGACCGCGCACGACT	0.642											OREG0003750	type=REGULATORY REGION|Gene=BC031342|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc003sye.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(121-123)GCG>GCT		homeobox A1 isoform a							58.0	64.0	62.0					7																	27135409		2203	4300	6503	SO:0001819	synonymous_variant	3198					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:27135409C>A		CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.123G>T	7.37:g.27135409C>A			OREG0003750	type=REGULATORY REGION|Gene=BC031342|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	792	HOXA1_uc003syd.2_Silent_p.A41A|uc003syg.2_5'Flank	p.A41A	NM_005522	NP_005513	P49639	HXA1_HUMAN			1	217	-			41					A4D184|B2R8U7|O43363	Silent	SNP	ENST00000343060.4	37	c.123G>T	CCDS5401.1																																																																																				0.642	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1			8	39	1	0	7.48243e-07	0.006214	1.04754e-06	8	39				
PSPH	5723	broad.mit.edu	37	7	56087349	56087349	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:56087349C>A	ENST00000395471.3	-	5	1024	c.219G>T	c.(217-219)agG>agT	p.R73S	PSPH_ENST00000275605.3_Missense_Mutation_p.R73S|PSPH_ENST00000459834.1_Intron			P78330	SERB_HUMAN	phosphoserine phosphatase	73					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)	p.R73S(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GCACCTGCTCCCTGGAGGGCT	0.607																																							uc003trg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(217-219)AGG>AGT		phosphoserine phosphatase							57.0	44.0	48.0					7																	56087349		2203	4300	6503	SO:0001583	missense	5723				L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity	g.chr7:56087349C>A	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.219G>T	7.37:g.56087349C>A	ENSP00000378854:p.Arg73Ser					PSPH_uc003trh.2_Missense_Mutation_p.R73S|PSPH_uc003tri.2_Missense_Mutation_p.R73S|PSPH_uc003trj.2_Missense_Mutation_p.R102S	p.R73S	NM_004577	NP_004568	P78330	SERB_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		4	582	-	Breast(14;0.214)		73					B2RCR5|Q7Z3S5	Missense_Mutation	SNP	ENST00000395471.3	37	c.219G>T	CCDS5522.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710637	0.30322	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	T;T;T	0.66638	-0.22;-0.22;-0.22	5.13	1.8	0.24995	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);Phosphoserine phosphatase, domain 2 (1);	0.198350	0.47852	D	0.000208	T	0.42017	0.1184	L	0.28776	0.89	0.54753	D	0.999989	P;B	0.38167	0.621;0.296	B;B	0.34489	0.079;0.184	T	0.27400	-1.0075	10	0.08381	T	0.77	-15.2868	4.6407	0.12546	0.1582:0.4911:0.0:0.3507	.	73;73	Q53EY1;P78330	.;SERB_HUMAN	S	73	ENSP00000275605:R73S;ENSP00000378854:R73S;ENSP00000398653:R73S	ENSP00000275605:R73S	R	-	3	2	PSPH	56054843	0.997000	0.39634	1.000000	0.80357	0.938000	0.57974	0.511000	0.22739	0.546000	0.28920	0.591000	0.81541	AGG		0.607	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343304.1	NM_004577		5	32	1	0	1.23904e-05	0.000602	1.59193e-05	5	32				
PSPH	5723	broad.mit.edu	37	7	56087351	56087351	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:56087351T>A	ENST00000395471.3	-	5	1022	c.217A>T	c.(217-219)Agg>Tgg	p.R73W	PSPH_ENST00000275605.3_Missense_Mutation_p.R73W|PSPH_ENST00000459834.1_Intron			P78330	SERB_HUMAN	phosphoserine phosphatase	73					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)	p.R73W(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACCTGCTCCCTGGAGGGCTGG	0.607																																							uc003trg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(217-219)AGG>TGG		phosphoserine phosphatase							56.0	43.0	47.0					7																	56087351		2203	4300	6503	SO:0001583	missense	5723				L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity	g.chr7:56087351T>A	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.217A>T	7.37:g.56087351T>A	ENSP00000378854:p.Arg73Trp					PSPH_uc003trh.2_Missense_Mutation_p.R73W|PSPH_uc003tri.2_Missense_Mutation_p.R73W|PSPH_uc003trj.2_Missense_Mutation_p.R102W	p.R73W	NM_004577	NP_004568	P78330	SERB_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		4	580	-	Breast(14;0.214)		73					B2RCR5|Q7Z3S5	Missense_Mutation	SNP	ENST00000395471.3	37	c.217A>T	CCDS5522.1	.	.	.	.	.	.	.	.	.	.	T	19.03	3.747429	0.69533	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	T;T;T	0.66460	-0.21;-0.21;-0.21	5.13	5.13	0.70059	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);Phosphoserine phosphatase, domain 2 (1);	0.198350	0.47852	D	0.000208	T	0.77798	0.4184	M	0.79011	2.435	0.58432	D	0.999997	D;D	0.69078	0.997;0.988	P;P	0.61592	0.835;0.891	T	0.79804	-0.1649	10	0.56958	D	0.05	-15.2868	9.9156	0.41432	0.1621:0.0:0.0:0.8379	.	73;73	Q53EY1;P78330	.;SERB_HUMAN	W	73	ENSP00000275605:R73W;ENSP00000378854:R73W;ENSP00000398653:R73W	ENSP00000275605:R73W	R	-	1	2	PSPH	56054845	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.926000	0.40084	1.940000	0.56252	0.482000	0.46254	AGG		0.607	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343304.1	NM_004577		5	31	0	0	0	0.000602	0	5	31				
ZNF479	90827	broad.mit.edu	37	7	57188426	57188426	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:57188426T>A	ENST00000331162.4	-	5	966	c.696A>T	c.(694-696)aaA>aaT	p.K232N		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	232					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K232N(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TATGAATTATTTTATGTGTAG	0.383																																							uc010kzo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(694-696)AAA>AAT		zinc finger protein 479							13.0	14.0	14.0					7																	57188426		1924	4138	6062	SO:0001583	missense	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57188426T>A	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.696A>T	7.37:g.57188426T>A	ENSP00000333776:p.Lys232Asn						p.K232N	NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	967	-			232			C2H2-type 2.			Missense_Mutation	SNP	ENST00000331162.4	37	c.696A>T	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	t	11.39	1.625191	0.28889	.	.	ENSG00000185177	ENST00000331162	T	0.51817	0.69	1.16	-1.86	0.07760	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53834	0.1821	L	0.47190	1.495	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.45056	-0.9287	9	0.62326	D	0.03	.	4.9038	0.13788	0.0:0.3268:0.0:0.6732	.	232	Q96JC4	ZN479_HUMAN	N	232	ENSP00000333776:K232N	ENSP00000333776:K232N	K	-	3	2	ZNF479	57192368	0.000000	0.05858	0.005000	0.12908	0.009000	0.06853	-0.577000	0.05847	-0.362000	0.08113	-0.548000	0.04221	AAA		0.383	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		4	24	0	0	0	0.001168	0	4	24				
PCLO	27445	broad.mit.edu	37	7	82583854	82583854	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:82583854C>G	ENST00000333891.9	-	5	6752	c.6415G>C	c.(6415-6417)Gaa>Caa	p.E2139Q	PCLO_ENST00000423517.2_Missense_Mutation_p.E2139Q	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E2139Q(2)|p.E2070Q(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCAATTTCTTCTGTTGAAAAA	0.393																																							uc003uhx.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(7)	7						c.(6415-6417)GAA>CAA		piccolo isoform 1							78.0	77.0	77.0					7																	82583854		1845	4099	5944	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82583854C>G	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6415G>C	7.37:g.82583854C>G	ENSP00000334319:p.Glu2139Gln					PCLO_uc003uhv.2_Missense_Mutation_p.E2139Q	p.E2139Q	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			5	6704	-			2070						Missense_Mutation	SNP	ENST00000333891.9	37	c.6415G>C	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.103617	0.37145	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.25250	1.81;1.82	5.77	5.77	0.91146	.	.	.	.	.	T	0.43366	0.1244	L	0.54323	1.7	0.80722	D	1	D;D	0.59767	0.986;0.986	P;P	0.55260	0.772;0.772	T	0.24261	-1.0165	9	0.87932	D	0	.	19.9785	0.97317	0.0:1.0:0.0:0.0	.	2139;2139	Q9Y6V0-5;Q9Y6V0-6	.;.	Q	2070;2139;2139	ENSP00000334319:E2139Q;ENSP00000388393:E2139Q	ENSP00000334319:E2139Q	E	-	1	0	PCLO	82421790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.534000	0.82004	2.724000	0.93272	0.650000	0.86243	GAA		0.393	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		11	44	0	0	0	0.010729	0	11	44				
SEMA3A	10371	broad.mit.edu	37	7	83636733	83636733	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:83636733C>T	ENST00000265362.4	-	10	1390	c.1076G>A	c.(1075-1077)aGg>aAg	p.R359K	SEMA3A_ENST00000436949.1_Missense_Mutation_p.R359K	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	359	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.R359K(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						GGGTCCATCCCTGTGGGCATA	0.438																																							uc003uhz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|kidney(1)	4						c.(1075-1077)AGG>AAG		semaphorin 3A precursor							147.0	124.0	132.0					7																	83636733		2203	4300	6503	SO:0001583	missense	10371				axon guidance	extracellular region|membrane	receptor activity	g.chr7:83636733C>T	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1076G>A	7.37:g.83636733C>T	ENSP00000265362:p.Arg359Lys						p.R359K	NM_006080	NP_006071	Q14563	SEM3A_HUMAN			10	1391	-			359			Sema.			Missense_Mutation	SNP	ENST00000265362.4	37	c.1076G>A	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	C	8.731	0.916550	0.17907	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.09255	3.0;3.0	4.4	4.4	0.53042	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.07279	0.0184	N	0.17278	0.47	0.53005	D	0.999967	B	0.17852	0.024	B	0.23574	0.047	T	0.08680	-1.0710	10	0.02654	T	1	.	17.3506	0.87322	0.0:1.0:0.0:0.0	.	359	Q14563	SEM3A_HUMAN	K	359	ENSP00000265362:R359K;ENSP00000415260:R359K	ENSP00000265362:R359K	R	-	2	0	SEMA3A	83474669	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.767000	0.62286	2.154000	0.67381	0.561000	0.74099	AGG		0.438	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080		36	73	0	0	0	0.004878	0	36	73				
C7orf62	219557	broad.mit.edu	37	7	88424136	88424136	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:88424136G>T	ENST00000297203.2	-	2	306	c.121C>A	c.(121-123)Cac>Aac	p.H41N	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	41								p.H41N(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						TTCTTTAGGTGTAGTCGTTGT	0.408																																							uc003ujv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(121-123)CAC>AAC		hypothetical protein LOC219557							134.0	143.0	140.0					7																	88424136		2203	4300	6503	SO:0001583	missense	219557							g.chr7:88424136G>T	BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.121C>A	7.37:g.88424136G>T	ENSP00000297203:p.His41Asn					ZNF804B_uc011khi.1_Intron	p.H41N	NM_152706	NP_689919	Q8TBZ9	CG062_HUMAN	STAD - Stomach adenocarcinoma(171;0.229)		2	303	-	Esophageal squamous(14;0.00802)|all_hematologic(106;0.109)|Lung NSC(181;0.168)|all_lung(186;0.169)		41						Missense_Mutation	SNP	ENST00000297203.2	37	c.121C>A	CCDS34678.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.907350	0.33628	.	.	ENSG00000164645	ENST00000297203	T	0.13307	2.6	6.01	6.01	0.97437	.	0.237751	0.36034	N	0.002839	T	0.08891	0.0220	N	0.08118	0	0.28382	N	0.919471	B	0.26547	0.152	B	0.24155	0.051	T	0.19451	-1.0305	10	0.42905	T	0.14	0.0483	16.0892	0.81080	0.0:0.0:1.0:0.0	.	41	Q8TBZ9	CG062_HUMAN	N	41	ENSP00000297203:H41N	ENSP00000297203:H41N	H	-	1	0	C7orf62	88262072	0.997000	0.39634	0.850000	0.33497	0.386000	0.30323	2.979000	0.49313	2.862000	0.98298	0.644000	0.83932	CAC		0.408	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332714.1	NM_152706		34	133	1	0	1.836e-18	0.003755	3.63618e-18	34	133				
AKAP9	10142	broad.mit.edu	37	7	91712731	91712731	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:91712731G>T	ENST00000359028.2	+	34	8669	c.8444G>T	c.(8443-8445)gGa>gTa	p.G2815V	AKAP9_ENST00000358100.2_Missense_Mutation_p.G2815V|AKAP9_ENST00000356239.3_Missense_Mutation_p.G2803V			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2815					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.G2803V(1)|p.G2815V(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AAAAATGCAGGAATACAAATT	0.358			T	BRAF	papillary thyroid																																		uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		2	Substitution - Missense(2)		lung(2)	breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(8407-8409)GGA>GTA		A-kinase anchor protein 9 isoform 2							57.0	58.0	58.0					7																	91712731		2203	4300	6503	SO:0001583	missense	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91712731G>T	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.8444G>T	7.37:g.91712731G>T	ENSP00000351922:p.Gly2815Val					AKAP9_uc003ulf.2_Missense_Mutation_p.G2795V|AKAP9_uc003uli.2_Missense_Mutation_p.G2426V|AKAP9_uc003ulj.2_Missense_Mutation_p.G573V|AKAP9_uc003ulk.2_Missense_Mutation_p.G78V	p.G2803V	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		33	8633	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		2815					A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37	c.8408G>T		.	.	.	.	.	.	.	.	.	.	G	7.125	0.578754	0.13686	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	4.47	2.65	0.31530	.	0.232621	0.22216	N	0.063038	T	0.64907	0.2641	M	0.69823	2.125	0.52501	D	0.99995	D;D;P;P;P	0.76494	0.999;0.959;0.614;0.733;0.733	D;P;B;P;P	0.67231	0.95;0.811;0.435;0.638;0.638	T	0.62421	-0.6858	10	0.52906	T	0.07	.	7.2545	0.26168	0.1692:0.1416:0.6893:0.0	.	2807;2807;2815;2803;2795	F5H3X5;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	V	2803;2815;2815;2807;649	ENSP00000348573:G2803V;ENSP00000351922:G2815V;ENSP00000350813:G2815V;ENSP00000378042:G649V	ENSP00000348573:G2803V	G	+	2	0	AKAP9	91550667	1.000000	0.71417	0.213000	0.23690	0.212000	0.24457	1.514000	0.35834	0.514000	0.28300	-0.191000	0.12829	GGA		0.358	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		15	56	1	0	4.93089e-13	0.00245	9.14129e-13	15	56				
SAMD9	54809	broad.mit.edu	37	7	92733294	92733294	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:92733294A>T	ENST00000379958.2	-	3	2386	c.2117T>A	c.(2116-2118)gTc>gAc	p.V706D		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	706						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.V706D(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			ATCCCTTTTGACAAAAGGTGA	0.358																																							uc003umf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(2116-2118)GTC>GAC		sterile alpha motif domain containing 9							151.0	151.0	151.0					7																	92733294		2203	4300	6503	SO:0001583	missense	54809					cytoplasm		g.chr7:92733294A>T	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2117T>A	7.37:g.92733294A>T	ENSP00000369292:p.Val706Asp					SAMD9_uc003umg.2_Missense_Mutation_p.V706D	p.V706D	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		3	2373	-	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		706					A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	c.2117T>A	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	A	17.35	3.367081	0.61513	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.29655	1.56;2.36	4.66	4.66	0.58398	.	0.173004	0.36303	N	0.002667	T	0.46619	0.1402	M	0.72894	2.215	0.51482	D	0.999923	D	0.61697	0.99	P	0.54664	0.758	T	0.52320	-0.8591	10	0.87932	D	0	.	13.0367	0.58877	1.0:0.0:0.0:0.0	.	706	Q5K651	SAMD9_HUMAN	D	706	ENSP00000369292:V706D;ENSP00000414529:V706D	ENSP00000369292:V706D	V	-	2	0	SAMD9	92571230	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.696000	0.91302	1.959000	0.56917	0.496000	0.49642	GTC		0.358	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654		56	145	0	0	0	0.01441	0	56	145				
COL1A2	1278	broad.mit.edu	37	7	94057003	94057003	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:94057003G>T	ENST00000297268.6	+	49	3803	c.3332G>T	c.(3331-3333)gGt>gTt	p.G1111V		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1111					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.G1111V(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TATGACTTTGGTTACGATGGA	0.537										HNSCC(75;0.22)																													uc003ung.1		NA																COL1A2/PLAG1(3)	1	Substitution - Missense(1)		lung(1)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	GRCh37	HM060012	COL1A2	M		c.(3331-3333)GGT>GTT		alpha 2 type I collagen precursor	Collagenase(DB00048)						96.0	98.0	97.0					7																	94057003		2203	4300	6503	SO:0001583	missense	1278				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	g.chr7:94057003G>T	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3332G>T	7.37:g.94057003G>T	ENSP00000297268:p.Gly1111Val	HNSCC(75;0.22)				COL1A2_uc011kib.1_Intron	p.G1111V	NM_000089	NP_000080	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		49	3803	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		1111					P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	c.3332G>T	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298017	0.40694	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.89681	-2.55	5.71	4.83	0.62350	.	0.000000	0.85682	D	0.000000	D	0.87641	0.6228	N	0.11560	0.145	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	D	0.87239	0.2265	10	0.29301	T	0.29	.	14.8942	0.70630	0.0687:0.0:0.9313:0.0	.	1111	P08123	CO1A2_HUMAN	V	1111;1112	ENSP00000297268:G1111V	ENSP00000297268:G1111V	G	+	2	0	COL1A2	93894939	1.000000	0.71417	0.881000	0.34555	0.233000	0.25261	9.869000	0.99810	1.568000	0.49683	0.561000	0.74099	GGT		0.537	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089		29	75	1	0	2.24059e-21	0.00632	4.54841e-21	29	75				
TAC1	6863	broad.mit.edu	37	7	97362026	97362026	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:97362026G>T	ENST00000319273.5	+	2	399	c.102G>T	c.(100-102)tgG>tgT	p.W34C	TAC1_ENST00000350485.4_Missense_Mutation_p.W34C|TAC1_ENST00000346867.4_Missense_Mutation_p.W34C	NM_003182.2	NP_003173.1	P20366	TKN1_HUMAN	tachykinin, precursor 1	34					associative learning (GO:0008306)|cell-cell signaling (GO:0007267)|detection of abiotic stimulus (GO:0009582)|inflammatory response (GO:0006954)|insemination (GO:0007320)|long-term memory (GO:0007616)|negative regulation of heart rate (GO:0010459)|neuropeptide signaling pathway (GO:0007218)|positive regulation of action potential (GO:0045760)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of blood pressure (GO:0008217)|response to hormone (GO:0009725)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)|tachykinin receptor signaling pathway (GO:0007217)	axon (GO:0030424)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.W34C(1)		large_intestine(4)|lung(6)|urinary_tract(1)	11	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)					GGTCCGACTGGTACGACAGCG	0.547																																							uc003uop.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(100-102)TGG>TGT		tachykinin 1 isoform beta precursor	Bacitracin(DB00626)						117.0	106.0	110.0					7																	97362026		2203	4300	6503	SO:0001583	missense	6863				detection of abiotic stimulus|elevation of cytosolic calcium ion concentration|insemination|neuropeptide signaling pathway|synaptic transmission|tachykinin receptor signaling pathway	extracellular space		g.chr7:97362026G>T	M68907	CCDS5649.1, CCDS5650.1, CCDS5651.1	7q21-q22	2013-02-26	2008-01-17		ENSG00000006128	ENSG00000006128		"""Endogenous ligands"""	11517	protein-coding gene	gene with protein product	"""substance K"", ""substance P"", ""neurokinin 1"", ""neurokinin 2"", ""neuromedin L"", ""neurokinin alpha"", ""neuropeptide K"", ""neuropeptide gamma"", ""preprotachykinin"""	162320	"""tachykinin, precursor 1 (substance K, substance P, neurokinin 1, neurokinin 2, neuromedin L, neurokinin alpha, neuropeptide K, neuropeptide gamma)"""	TAC2, NKNA		1708336	Standard	NM_003182		Approved	NPK	uc003uop.4	P20366	OTTHUMG00000154069	ENST00000319273.5:c.102G>T	7.37:g.97362026G>T	ENSP00000321106:p.Trp34Cys					TAC1_uc003uoq.3_Missense_Mutation_p.W34C|TAC1_uc003uor.3_Missense_Mutation_p.W34C|TAC1_uc003uos.3_Missense_Mutation_p.W34C	p.W34C	NM_003182	NP_003173	P20366	TKN1_HUMAN			2	348	+	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)		34					O60600|O60601|Q00072|Q53GH4|Q549V0|Q549V1|Q549V2|Q6FHM1	Missense_Mutation	SNP	ENST00000319273.5	37	c.102G>T	CCDS5649.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655510	0.67586	.	.	ENSG00000006128	ENST00000319273;ENST00000350485;ENST00000346867	.	.	.	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.68375	0.2994	L	0.44542	1.39	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.87578	0.993;0.998;0.995;0.997	T	0.70223	-0.4931	9	0.87932	D	0	-4.2353	13.7982	0.63184	0.0:0.0:1.0:0.0	.	34;34;34;34	P20366-4;P20366-3;P20366-2;P20366	.;.;.;TKN1_HUMAN	C	34	.	ENSP00000321106:W34C	W	+	3	0	TAC1	97199962	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.323000	0.65858	2.724000	0.93272	0.561000	0.74099	TGG		0.547	TAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333696.1	NM_003182		22	60	1	0	1.50039e-11	0.012319	2.58118e-11	22	60				
COL26A1	136227	broad.mit.edu	37	7	101090977	101090977	+	RNA	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:101090977G>A	ENST00000397927.3	+	0	507				COL26A1_ENST00000313669.7_RNA|COL26A1_ENST00000528707.1_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.L98L(1)									ACAGGACTCTGATCAGACCCA	0.592																																							uc010lhy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(286-288)CTG>CTA		EMI domain containing 2							46.0	46.0	46.0					7																	101090977		2065	4211	6276			136227					collagen		g.chr7:101090977G>A	AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101090977G>A						EMID2_uc003uyo.1_Silent_p.L98L	p.L96L	NM_133457	NP_597714	Q96A83	EMID2_HUMAN			3	480	+	Lung NSC(181;0.215)		98			EMI.		Q32M90	Silent	SNP	ENST00000397927.3	37	c.288G>A																																																																																					0.592	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000315898.2	NM_133457		3	7	0	0	0	0.004672	0	3	7				
FBXL13	222235	broad.mit.edu	37	7	102667916	102667916	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:102667916T>C	ENST00000313221.4	-	5	733	c.307A>G	c.(307-309)Aaa>Gaa	p.K103E	FBXL13_ENST00000455112.2_Missense_Mutation_p.K103E|FBXL13_ENST00000456695.1_Missense_Mutation_p.K103E|FBXL13_ENST00000471074.1_5'UTR|FBXL13_ENST00000393772.2_Missense_Mutation_p.K103E|RP11-645N11.3_ENST00000447336.1_RNA|FBXL13_ENST00000379308.3_Missense_Mutation_p.K103E|FBXL13_ENST00000436908.1_Missense_Mutation_p.K103E|FBXL13_ENST00000379306.3_Missense_Mutation_p.K103E|FBXL13_ENST00000379305.3_Missense_Mutation_p.K103E	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	103								p.K103E(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						TCTTTCTTTTTACTCTTATGT	0.333																																							uc003vaq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(307-309)AAA>GAA		F-box and leucine-rich repeat protein 13 isoform							132.0	119.0	123.0					7																	102667916		2203	4299	6502	SO:0001583	missense	222235							g.chr7:102667916T>C	BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.307A>G	7.37:g.102667916T>C	ENSP00000321927:p.Lys103Glu					FBXL13_uc010liq.1_5'Flank|FBXL13_uc010lir.1_Missense_Mutation_p.K103E|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Missense_Mutation_p.K103E|FBXL13_uc003vav.2_RNA	p.K103E	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN			5	734	-			103					C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Missense_Mutation	SNP	ENST00000313221.4	37	c.307A>G	CCDS5726.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.242960	0.58995	.	.	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000379306;ENST00000349747;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000456695;ENST00000455112;ENST00000440067	T;T;T;T;T;T;T;T;T	0.51817	3.26;3.25;3.0;3.26;3.26;3.26;3.0;3.25;0.69	4.05	2.84	0.33178	.	0.087808	0.46758	D	0.000265	T	0.62307	0.2417	M	0.69823	2.125	0.09310	N	1	P;D;D	0.89917	0.89;1.0;0.997	P;D;D	0.85130	0.602;0.997;0.916	T	0.51411	-0.8709	10	0.72032	D	0.01	.	7.3775	0.26837	0.0:0.0:0.2233:0.7767	.	103;103;103	Q8NEE6-3;Q8NEE6-2;Q8NEE6	.;.;FXL13_HUMAN	E	103;103;103;30;103;103;103;103;103;193	ENSP00000377367:K103E;ENSP00000368610:K103E;ENSP00000368608:K103E;ENSP00000368607:K103E;ENSP00000388608:K103E;ENSP00000321927:K103E;ENSP00000409716:K103E;ENSP00000391550:K103E;ENSP00000390126:K193E	ENSP00000321927:K103E	K	-	1	0	FBXL13	102455152	0.004000	0.15560	0.043000	0.18650	0.319000	0.28217	0.408000	0.21065	0.850000	0.35239	0.533000	0.62120	AAA		0.333	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348001.1	NM_145032		13	74	0	0	0	0.003163	0	13	74				
SLC26A3	1811	broad.mit.edu	37	7	107427872	107427872	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:107427872G>T	ENST00000340010.5	-	7	1002	c.818C>A	c.(817-819)tCc>tAc	p.S273Y	SLC26A3_ENST00000422236.2_Missense_Mutation_p.S238Y	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	273					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)	p.S273Y(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						TTTAACAATGGATACAACCAA	0.348																																							uc003ver.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(817-819)TCC>TAC		solute carrier family 26, member 3							142.0	140.0	141.0					7																	107427872		2203	4300	6503	SO:0001583	missense	1811				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity	g.chr7:107427872G>T	L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.818C>A	7.37:g.107427872G>T	ENSP00000345873:p.Ser273Tyr					SLC26A3_uc003ves.2_Missense_Mutation_p.S238Y	p.S273Y	NM_000111	NP_000102	P40879	S26A3_HUMAN			7	1029	-			273			Helical; (Potential).			Missense_Mutation	SNP	ENST00000340010.5	37	c.818C>A	CCDS5748.1	.	.	.	.	.	.	.	.	.	.	G	2.901	-0.227454	0.06022	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.92858	-3.12;-3.12	5.4	-4.84	0.03151	Sulphate transporter (1);	0.394448	0.33127	N	0.005245	T	0.78033	0.4220	N	0.04203	-0.255	0.09310	N	1	B;B	0.15141	0.012;0.003	B;B	0.15870	0.006;0.014	T	0.63580	-0.6605	10	0.32370	T	0.25	.	13.1101	0.59268	0.5614:0.0:0.4386:0.0	.	238;273	G5E9U3;P40879	.;S26A3_HUMAN	Y	238;273	ENSP00000415817:S238Y;ENSP00000345873:S273Y	ENSP00000345873:S273Y	S	-	2	0	SLC26A3	107215108	0.465000	0.25815	0.000000	0.03702	0.000000	0.00434	1.622000	0.36997	-0.693000	0.05121	-1.105000	0.02106	TCC		0.348	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111		30	158	1	0	5.45727e-16	0.008361	1.06012e-15	30	158				
NRCAM	4897	broad.mit.edu	37	7	107871486	107871486	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:107871486C>T	ENST00000425651.2	-	5	538	c.539G>A	c.(538-540)tGg>tAg	p.W180*	NRCAM_ENST00000379028.3_Nonsense_Mutation_p.W180*|NRCAM_ENST00000413765.2_Nonsense_Mutation_p.W180*|NRCAM_ENST00000379022.4_Nonsense_Mutation_p.W180*|NRCAM_ENST00000379024.4_Nonsense_Mutation_p.W180*|NRCAM_ENST00000351718.4_Nonsense_Mutation_p.W174*	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	180	Ig-like 2.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)	p.W174*(1)|p.W180*(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						ATTATCCATCCAAAATATTAT	0.323																																							uc003vfb.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|breast(2)	5						c.(538-540)TGG>TAG		neuronal cell adhesion molecule isoform A							52.0	54.0	53.0					7																	107871486		2203	4300	6503	SO:0001587	stop_gained	4897				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding	g.chr7:107871486C>T		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.539G>A	7.37:g.107871486C>T	ENSP00000401244:p.Trp180*					NRCAM_uc003vfc.2_Nonsense_Mutation_p.W174*|NRCAM_uc011kmk.1_Nonsense_Mutation_p.W175*|NRCAM_uc003vfd.2_Nonsense_Mutation_p.W175*|NRCAM_uc003vfe.2_Nonsense_Mutation_p.W175*	p.W180*	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN			8	1010	-			180			Ig-like 2.|Extracellular (Potential).		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Nonsense_Mutation	SNP	ENST00000425651.2	37	c.539G>A	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	C	42	9.261046	0.99117	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979;ENST00000417701	.	.	.	4.8	4.8	0.61643	.	0.055231	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4227	0.90597	0.0:1.0:0.0:0.0	.	.	.	.	X	180;180;180;180;174;180;180;180;174;174	.	ENSP00000325269:W174X	W	-	2	0	NRCAM	107658722	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.609000	0.82925	2.639000	0.89480	0.650000	0.86243	TGG		0.323	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132		4	56	0	0	0	0.009096	0	4	56				
PPP1R3A	5506	broad.mit.edu	37	7	113518073	113518073	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:113518073C>A	ENST00000284601.3	-	4	3142	c.3074G>T	c.(3073-3075)aGg>aTg	p.R1025M		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1025					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.R1025M(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATTTTCATGCCTTGCTTCTTC	0.398																																							uc010ljy.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						c.(3073-3075)AGG>ATG		protein phosphatase 1, regulatory (inhibitor)							187.0	181.0	183.0					7																	113518073		2203	4299	6502	SO:0001583	missense	5506				glycogen metabolic process	integral to membrane		g.chr7:113518073C>A	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3074G>T	7.37:g.113518073C>A	ENSP00000284601:p.Arg1025Met						p.R1025M	NM_002711	NP_002702	Q16821	PPR3A_HUMAN			4	3105	-			1025					A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	c.3074G>T	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	8.169	0.791336	0.16258	.	.	ENSG00000154415	ENST00000284601	T	0.16457	2.34	5.71	1.26	0.21427	.	0.620801	0.16293	N	0.220829	T	0.26448	0.0646	M	0.65975	2.015	0.09310	N	1	D	0.62365	0.991	P	0.54270	0.747	T	0.07139	-1.0788	10	0.59425	D	0.04	-0.3076	6.2515	0.20848	0.0:0.6231:0.1288:0.2481	.	1025	Q16821	PPR3A_HUMAN	M	1025	ENSP00000284601:R1025M	ENSP00000284601:R1025M	R	-	2	0	PPP1R3A	113305309	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	0.152000	0.16302	0.213000	0.20722	-0.142000	0.14014	AGG		0.398	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		34	222	1	0	1.61788e-16	0.012213	3.18864e-16	34	222				
WASL	8976	broad.mit.edu	37	7	123349179	123349179	+	Silent	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:123349179T>C	ENST00000223023.4	-	2	548	c.216A>G	c.(214-216)ccA>ccG	p.P72P		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	72	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)	p.P72P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AAGATCTCTGTGGATTGTCCT	0.343																																							uc003vkz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(214-216)CCA>CCG		Wiskott-Aldrich syndrome gene-like protein							70.0	68.0	69.0					7																	123349179		2203	4300	6503	SO:0001819	synonymous_variant	8976				actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity	g.chr7:123349179T>C	D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.216A>G	7.37:g.123349179T>C							p.P72P	NM_003941	NP_003932	O00401	WASL_HUMAN			2	544	-			72			WH1.		A1JUI9|Q7Z746	Silent	SNP	ENST00000223023.4	37	c.216A>G	CCDS34743.1																																																																																				0.343	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348522.1	NM_003941		22	46	0	0	0	0.012319	0	22	46				
POT1	25913	broad.mit.edu	37	7	124503540	124503540	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:124503540C>A	ENST00000357628.3	-	8	1008	c.410G>T	c.(409-411)cGt>cTt	p.R137L	POT1_ENST00000393329.1_Missense_Mutation_p.R6L	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	137			R -> H (in CMM10; increased telomere intensity signals and telomere fragility). {ECO:0000269|PubMed:24686846}.		DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)	p.R137L(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						TGCCCAAACACGTAAGGCTTC	0.438																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	uc003vlm.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(409-411)CGT>CTT		protection of telomeres 1 isoform 1							164.0	147.0	153.0					7																	124503540		2203	4300	6503	SO:0001583	missense	25913				DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity	g.chr7:124503540C>A	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.410G>T	7.37:g.124503540C>A	ENSP00000350249:p.Arg137Leu					POT1_uc011koe.1_RNA|POT1_uc003vlk.2_RNA|POT1_uc003vll.2_RNA|POT1_uc003vlo.2_Missense_Mutation_p.R6L|POT1_uc003vln.2_RNA	p.R137L	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN			8	1011	-			137					O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	ENST00000357628.3	37	c.410G>T	CCDS5793.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737655	0.89573	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391	T;T	0.63417	-0.04;0.04	5.44	5.44	0.79542	Nucleic acid-binding, OB-fold-like (1);Telomere end binding protein (2);Nucleic acid-binding, OB-fold (1);	0.055770	0.64402	D	0.000001	T	0.81475	0.4830	M	0.83483	2.645	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.83571	0.0112	10	0.62326	D	0.03	0.1077	18.2686	0.90060	0.0:1.0:0.0:0.0	.	137	Q9NUX5	POTE1_HUMAN	L	137;6;137;137;137;136	ENSP00000350249:R137L;ENSP00000377002:R6L	ENSP00000265391:R136L	R	-	2	0	POT1	124290776	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.047000	0.71038	2.543000	0.85770	0.650000	0.86243	CGT		0.438	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1			51	114	1	0	9.57592e-29	0.01441	2.00403e-28	51	114				
POT1	25913	broad.mit.edu	37	7	124510993	124510993	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:124510993C>A	ENST00000357628.3	-	7	825	c.227G>T	c.(226-228)gGa>gTa	p.G76V	POT1_ENST00000393329.1_Intron	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	76					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)	p.G76V(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						AACAATATCTCCATTTTTATA	0.333																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	uc003vlm.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(226-228)GGA>GTA		protection of telomeres 1 isoform 1							67.0	72.0	70.0					7																	124510993		2202	4297	6499	SO:0001583	missense	25913				DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity	g.chr7:124510993C>A	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.227G>T	7.37:g.124510993C>A	ENSP00000350249:p.Gly76Val					POT1_uc011koe.1_RNA|POT1_uc003vlk.2_RNA|POT1_uc003vll.2_RNA|POT1_uc003vlo.2_Intron|POT1_uc003vln.2_RNA	p.G76V	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN			7	828	-			76					O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	ENST00000357628.3	37	c.227G>T	CCDS5793.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.427316	0.83667	.	.	ENSG00000128513	ENST00000357628;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391;ENST00000446993	T	0.58652	0.32	5.87	5.87	0.94306	Nucleic acid-binding, OB-fold-like (1);Telomere end binding protein (2);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.80008	0.4545	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82190	-0.0580	10	0.87932	D	0	-10.3692	18.8026	0.92023	0.0:1.0:0.0:0.0	.	76	Q9NUX5	POTE1_HUMAN	V	76;76;76;76;75;76	ENSP00000350249:G76V	ENSP00000265391:G75V	G	-	2	0	POT1	124298229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.135000	0.71696	2.770000	0.95276	0.650000	0.86243	GGA		0.333	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1			14	89	1	0	2.61681e-11	0.00245	4.46398e-11	14	89				
CPA2	1358	broad.mit.edu	37	7	129919383	129919383	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:129919383G>T	ENST00000222481.4	+	9	923	c.868G>T	c.(868-870)Gtg>Ttg	p.V290L		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	290					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.V288L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					GAAATCCATAGTGGACTTCAT	0.493																																							uc003vpq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(868-870)GTG>TTG		carboxypeptidase A2 (pancreatic) precursor							118.0	109.0	112.0					7																	129919383		2203	4300	6503	SO:0001583	missense	1358				proteolysis|vacuolar protein catabolic process	extracellular region|vacuole	metallocarboxypeptidase activity|zinc ion binding	g.chr7:129919383G>T	U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.868G>T	7.37:g.129919383G>T	ENSP00000222481:p.Val290Leu						p.V290L	NM_001869	NP_001860	P48052	CBPA2_HUMAN			9	887	+	Melanoma(18;0.0435)		290					A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Missense_Mutation	SNP	ENST00000222481.4	37	c.868G>T	CCDS5817.2	.	.	.	.	.	.	.	.	.	.	G	35	5.517771	0.96416	.	.	ENSG00000158516	ENST00000222481	T	0.09538	2.97	6.17	6.17	0.99709	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.40067	0.1102	M	0.89715	3.055	0.80722	D	1	P	0.49559	0.925	P	0.58210	0.835	T	0.31194	-0.9952	10	0.72032	D	0.01	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	290	P48052	CBPA2_HUMAN	L	290	ENSP00000222481:V290L	ENSP00000222481:V290L	V	+	1	0	CPA2	129706619	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.533000	0.81994	2.941000	0.99782	0.655000	0.94253	GTG		0.493	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347124.2	NM_001869		23	63	1	0	3.5997e-14	0.014323	6.82934e-14	23	63				
NUP205	23165	broad.mit.edu	37	7	135311040	135311040	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:135311040G>C	ENST00000285968.6	+	33	4750	c.4724G>C	c.(4723-4725)aGa>aCa	p.R1575T		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1575					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.R1575T(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						GAGCTGCTAAGATCAGGGGTG	0.443																																							uc003vsw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(4723-4725)AGA>ACA		nucleoporin 205kDa							124.0	114.0	118.0					7																	135311040		2203	4300	6503	SO:0001583	missense	23165				carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr7:135311040G>C	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.4724G>C	7.37:g.135311040G>C	ENSP00000285968:p.Arg1575Thr					NUP205_uc003vsx.2_RNA	p.R1575T	NM_015135	NP_055950	Q92621	NU205_HUMAN			33	4755	+			1575					A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	c.4724G>C	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177445	0.57692	.	.	ENSG00000155561	ENST00000285968	T	0.29655	1.56	5.6	4.53	0.55603	.	0.043638	0.85682	D	0.000000	T	0.30008	0.0751	L	0.43152	1.355	0.80722	D	1	B	0.21381	0.055	B	0.30179	0.112	T	0.05419	-1.0886	10	0.30854	T	0.27	-3.5549	15.3725	0.74577	0.0782:0.0:0.9218:0.0	.	1575	Q92621	NU205_HUMAN	T	1575	ENSP00000285968:R1575T	ENSP00000285968:R1575T	R	+	2	0	NUP205	134961580	1.000000	0.71417	0.992000	0.48379	0.969000	0.65631	7.405000	0.80007	2.638000	0.89438	0.591000	0.81541	AGA		0.443	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1			27	79	0	0	0	0.005443	0	27	79				
EPHB6	2051	broad.mit.edu	37	7	142562114	142562114	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:142562114G>C	ENST00000392957.2	+	7	1343	c.556G>C	c.(556-558)Gct>Cct	p.A186P	EPHB6_ENST00000442129.1_Missense_Mutation_p.A186P|EPHB6_ENST00000411471.2_Intron	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	186	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.A171P(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					ACCCCACGGGGCTGGGCAGCG	0.637																																							uc011kst.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(556-558)GCT>CCT		ephrin receptor EphB6 precursor							118.0	137.0	131.0					7																	142562114		2201	4288	6489	SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142562114G>C	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.556G>C	7.37:g.142562114G>C	ENSP00000376684:p.Ala186Pro					EPHB6_uc011ksu.1_Missense_Mutation_p.A186P|EPHB6_uc003wbs.2_5'UTR|EPHB6_uc003wbt.2_Intron|EPHB6_uc003wbu.2_5'UTR|EPHB6_uc003wbv.2_5'Flank	p.A186P	NM_004445	NP_004436	O15197	EPHB6_HUMAN			7	1343	+	Melanoma(164;0.059)		186			Extracellular (Potential).		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	c.556G>C	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	8.440	0.850572	0.17034	.	.	ENSG00000106123	ENST00000392957;ENST00000442129	T;T	0.03745	3.82;3.82	4.61	-1.79	0.07932	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	1.179790	0.06583	N	0.750694	T	0.02083	0.0065	N	0.08118	0	0.09310	N	0.999999	B	0.27316	0.175	B	0.34991	0.193	T	0.48352	-0.9043	10	0.27785	T	0.31	.	0.182	0.00124	0.2983:0.1567:0.2721:0.2729	.	186	O15197	EPHB6_HUMAN	P	186	ENSP00000376684:A186P;ENSP00000410789:A186P	ENSP00000376684:A186P	A	+	1	0	EPHB6	142272236	.	.	0.003000	0.11579	0.285000	0.27093	.	.	-0.087000	0.12528	-0.140000	0.14226	GCT		0.637	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			38	297	0	0	0	0.013114	0	38	297				
OR2F1	26211	broad.mit.edu	37	7	143657537	143657537	+	Silent	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:143657537G>C	ENST00000392899.1	+	1	511	c.474G>C	c.(472-474)gtG>gtC	p.V158V	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	158					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V158V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					GCTCTCCTGTGCAGACTGCTA	0.527																																							uc003wds.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(472-474)GTG>GTC		olfactory receptor, family 2, subfamily F,							140.0	117.0	125.0					7																	143657537		2203	4300	6503	SO:0001819	synonymous_variant	26211				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143657537G>C	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.474G>C	7.37:g.143657537G>C							p.V158V	NM_012369	NP_036501	Q13607	OR2F1_HUMAN			1	518	+	Melanoma(164;0.0903)		158			Helical; Name=4; (Potential).		A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Silent	SNP	ENST00000392899.1	37	c.474G>C	CCDS5887.1																																																																																				0.527	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1			19	46	0	0	0	0.008871	0	19	46				
OR2A14	135941	broad.mit.edu	37	7	143827061	143827061	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:143827061C>A	ENST00000408899.2	+	1	911	c.856C>A	c.(856-858)Ccc>Acc	p.P286T		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P286T(1)		large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					AATGCTGAACCCCCTGATATA	0.542																																							uc011kua.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(856-858)CCC>ACC		olfactory receptor, family 2, subfamily A,							146.0	150.0	149.0					7																	143827061		1908	4125	6033	SO:0001583	missense	135941				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143827061C>A		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.856C>A	7.37:g.143827061C>A	ENSP00000386137:p.Pro286Thr						p.P286T	NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN			1	856	+	Melanoma(164;0.0783)		286			Helical; Name=7; (Potential).		Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	37	c.856C>A	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.580500	0.46006	.	.	ENSG00000221938	ENST00000408899	T	0.63913	-0.07	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32273	U	0.006329	D	0.86859	0.6034	H	0.98866	4.355	0.49915	D	0.999839	D	0.71674	0.998	D	0.77004	0.989	D	0.91889	0.5522	10	0.87932	D	0	-26.0903	14.3811	0.66911	0.0:1.0:0.0:0.0	.	286	Q96R47	O2A14_HUMAN	T	286	ENSP00000386137:P286T	ENSP00000386137:P286T	P	+	1	0	OR2A14	143457994	1.000000	0.71417	0.996000	0.52242	0.049000	0.14656	5.589000	0.67523	2.303000	0.77524	0.561000	0.74099	CCC		0.542	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1			41	171	1	0	1.15183e-24	0.009718	2.34997e-24	41	171				
C7orf33	202865	broad.mit.edu	37	7	148312477	148312477	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:148312477G>A	ENST00000307003.2	+	3	879	c.518G>A	c.(517-519)aGa>aAa	p.R173K		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	173								p.R173K(1)		central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			AGGATTTCCAGAACTGACAGC	0.383																																							uc003wew.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(517-519)AGA>AAA		hypothetical protein LOC202865							126.0	125.0	125.0					7																	148312477		2203	4300	6503	SO:0001583	missense	202865							g.chr7:148312477G>A	BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.518G>A	7.37:g.148312477G>A	ENSP00000304071:p.Arg173Lys						p.R173K	NM_145304	NP_660347	Q8WU49	CG033_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00291)		3	879	+	Melanoma(164;0.15)		173						Missense_Mutation	SNP	ENST00000307003.2	37	c.518G>A	CCDS5890.1	.	.	.	.	.	.	.	.	.	.	G	6.710	0.499613	0.12762	.	.	ENSG00000170279	ENST00000307003	.	.	.	1.79	1.79	0.24919	.	.	.	.	.	T	0.21550	0.0519	N	0.19112	0.55	0.09310	N	1	D	0.53462	0.96	P	0.45406	0.479	T	0.09465	-1.0673	8	0.87932	D	0	.	7.0793	0.25221	0.0:0.0:1.0:0.0	.	173	Q8WU49	CG033_HUMAN	K	173	.	ENSP00000304071:R173K	R	+	2	0	C7orf33	147943410	0.032000	0.19561	0.014000	0.15608	0.038000	0.13279	1.438000	0.35002	1.301000	0.44836	0.655000	0.94253	AGA		0.383	C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327684.1	NM_145304		16	116	0	0	0	0.00499	0	16	116				
ZBED6CL	113763	broad.mit.edu	37	7	150027589	150027589	+	Silent	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:150027589A>G	ENST00000343855.4	+	1	652	c.96A>G	c.(94-96)acA>acG	p.T32T	LRRC61_ENST00000359623.4_Intron|LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000323078.7_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	32								p.T32T(1)									AGGTTCACACACACTTTCAGG	0.642																																							uc003wgy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(94-96)ACA>ACG		hypothetical protein LOC113763							97.0	105.0	102.0					7																	150027589		2203	4300	6503	SO:0001819	synonymous_variant	113763							g.chr7:150027589A>G	BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.96A>G	7.37:g.150027589A>G						LRRC61_uc003wgv.2_Intron|LRRC61_uc003wgx.2_Intron|LRRC61_uc003wgw.2_Intron	p.T32T	NM_138434	NP_612443	Q96FA7	CG029_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.011)		1	652	+			32						Silent	SNP	ENST00000343855.4	37	c.96A>G	CCDS5900.1																																																																																				0.642	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350702.1	NM_138434		36	162	0	0	0	0.00623	0	36	162				
UBE3C	9690	broad.mit.edu	37	7	157000138	157000138	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr7:157000138T>A	ENST00000348165.5	+	12	1825	c.1465T>A	c.(1465-1467)Tct>Act	p.S489T		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	489					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S489T(1)		central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TTCTCCTATGTCTTTTGAAGA	0.348																																							uc010lqs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|large_intestine(1)	5						c.(1465-1467)TCT>ACT		ubiquitin protein ligase E3C							183.0	178.0	180.0					7																	157000138		2203	4300	6503	SO:0001583	missense	9690				protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity	g.chr7:157000138T>A	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.1465T>A	7.37:g.157000138T>A	ENSP00000309198:p.Ser489Thr					UBE3C_uc003wng.2_Missense_Mutation_p.S489T	p.S489T	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)	12	1777	+		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	489					A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	37	c.1465T>A	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	T	15.74	2.922440	0.52653	.	.	ENSG00000009335	ENST00000348165	T	0.46451	0.87	5.26	5.26	0.73747	.	0.052943	0.85682	D	0.000000	T	0.38348	0.1037	L	0.43152	1.355	0.80722	D	1	B;B	0.21147	0.043;0.052	B;B	0.24155	0.051;0.037	T	0.15407	-1.0438	10	0.37606	T	0.19	.	15.1561	0.72743	0.0:0.0:0.0:1.0	.	489;489	Q15386;Q15386-2	UBE3C_HUMAN;.	T	489	ENSP00000309198:S489T	ENSP00000309198:S489T	S	+	1	0	UBE3C	156692899	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.549000	0.53681	1.982000	0.57802	0.533000	0.62120	TCT		0.348	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671		24	194	0	0	0	0.003954	0	24	194				
MYOM2	9172	broad.mit.edu	37	8	2020568	2020568	+	Missense_Mutation	SNP	C	C	T	rs368565089		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:2020568C>T	ENST00000262113.4	+	9	1078	c.937C>T	c.(937-939)Cgc>Tgc	p.R313C	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	313	Ig-like C2-type 2.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.R313C(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GGTGCAGCCGCGCGCCGAGTG	0.592																																							uc003wpx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(937-939)CGC>TGC		myomesin 2							47.0	42.0	44.0					8																	2020568		2203	4300	6503	SO:0001583	missense	9172				muscle contraction	myosin filament	structural constituent of muscle	g.chr8:2020568C>T		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.937C>T	8.37:g.2020568C>T	ENSP00000262113:p.Arg313Cys					MYOM2_uc011kwi.1_Intron	p.R313C	NM_003970	NP_003961	P54296	MYOM2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)	9	1075	+		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)	313			Ig-like C2-type 2.		Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	c.937C>T	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401405	0.42613	.	.	ENSG00000036448	ENST00000262113	T	0.68025	-0.3	5.13	4.22	0.49857	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.269957	0.31415	N	0.007689	T	0.72203	0.3431	L	0.47716	1.5	0.51482	D	0.999923	D	0.67145	0.996	P	0.56788	0.806	T	0.74572	-0.3621	10	0.59425	D	0.04	.	14.9525	0.71086	0.1535:0.8465:0.0:0.0	.	313	P54296	MYOM2_HUMAN	C	313	ENSP00000262113:R313C	ENSP00000262113:R313C	R	+	1	0	MYOM2	2007975	0.021000	0.18746	0.023000	0.16930	0.010000	0.07245	0.684000	0.25364	1.064000	0.40671	0.655000	0.94253	CGC		0.592	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970		5	17	0	0	0	0.001984	0	5	17				
MYOM2	9172	broad.mit.edu	37	8	2057201	2057201	+	Nonsense_Mutation	SNP	C	C	A	rs201134786		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:2057201C>A	ENST00000262113.4	+	25	3200	c.3059C>A	c.(3058-3060)tCg>tAg	p.S1020*	MYOM2_ENST00000523438.1_Nonsense_Mutation_p.S445*	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1020					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.S1020*(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CCTCTGAAATCGGAATTAGCT	0.413																																							uc003wpx.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(3058-3060)TCG>TAG		myomesin 2							71.0	69.0	70.0					8																	2057201		2203	4300	6503	SO:0001587	stop_gained	9172				muscle contraction	myosin filament	structural constituent of muscle	g.chr8:2057201C>A		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3059C>A	8.37:g.2057201C>A	ENSP00000262113:p.Ser1020*					MYOM2_uc011kwi.1_Nonsense_Mutation_p.S445*	p.S1020*	NM_003970	NP_003961	P54296	MYOM2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)	25	3197	+		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)	1020					Q7Z3Y2	Nonsense_Mutation	SNP	ENST00000262113.4	37	c.3059C>A	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	c	42	9.300186	0.99130	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	.	.	.	5.77	5.77	0.91146	.	0.403344	0.26092	N	0.026387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.0285	0.97531	0.0:1.0:0.0:0.0	.	.	.	.	X	1020;445	.	ENSP00000262113:S1020X	S	+	2	0	MYOM2	2044608	1.000000	0.71417	0.981000	0.43875	0.965000	0.64279	2.639000	0.46570	2.727000	0.93392	0.645000	0.84053	TCG		0.413	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970		9	34	1	0	0.000442599	0.006214	0.000514886	9	34				
RP1L1	94137	broad.mit.edu	37	8	10468155	10468155	+	Silent	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:10468155G>C	ENST00000382483.3	-	4	3676	c.3453C>G	c.(3451-3453)ctC>ctG	p.L1151L		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1151					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.L1151L(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCGAGATGCTGAGCAGCTCCT	0.567																																							uc003wtc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(3)|central_nervous_system(1)	8						c.(3451-3453)CTC>CTG		retinitis pigmentosa 1-like 1							52.0	60.0	57.0					8																	10468155		2083	4207	6290	SO:0001819	synonymous_variant	94137				intracellular signal transduction			g.chr8:10468155G>C	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.3453C>G	8.37:g.10468155G>C							p.L1151L	NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	3682	-			1151					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	c.3453C>G	CCDS43708.1																																																																																				0.567	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			4	43	0	0	0	0.009096	0	4	43				
CSGALNACT1	55790	broad.mit.edu	37	8	19362786	19362786	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:19362786G>C	ENST00000454498.2	-	4	1573	c.560C>G	c.(559-561)gCc>gGc	p.A187G	CSGALNACT1_ENST00000522854.1_Missense_Mutation_p.A187G|CSGALNACT1_ENST00000311540.4_Missense_Mutation_p.A187G|CSGALNACT1_ENST00000544602.1_Missense_Mutation_p.A187G|CSGALNACT1_ENST00000332246.6_Missense_Mutation_p.A187G	NM_001130518.1	NP_001123990.1	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 1	187					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|endochondral ossification (GO:0001958)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|heparin biosynthetic process (GO:0030210)|nervous system development (GO:0007399)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|UDP-glucuronate metabolic process (GO:0046398)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|intracellular (GO:0005622)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|glucuronosyltransferase activity (GO:0015020)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)|peptidoglycan glycosyltransferase activity (GO:0008955)	p.A187G(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				Colorectal(111;0.182)		GGTCTCCAAGGCTGATTCAAT	0.542																																							uc011kyn.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(559-561)GCC>GGC		chondroitin sulfate							131.0	114.0	120.0					8																	19362786		2203	4300	6503	SO:0001583	missense	55790				anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity	g.chr8:19362786G>C	AK002126	CCDS6010.1	8p21.3	2013-02-19				ENSG00000147408		"""Beta 4-glycosyltransferases"""	24290	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase"""					17145758, 12446672	Standard	NM_018371		Approved	CSGalNAcT-1, FLJ11264, ChGn	uc011kyo.2	Q8TDX6		ENST00000454498.2:c.560C>G	8.37:g.19362786G>C	ENSP00000411816:p.Ala187Gly					CSGALNACT1_uc011kyo.1_Missense_Mutation_p.A187G|CSGALNACT1_uc003wzg.2_RNA|CSGALNACT1_uc011kyp.1_Missense_Mutation_p.A186G|CSGALNACT1_uc003wzh.2_RNA	p.A187G	NM_001130518	NP_001123990	Q8TDX6	CGAT1_HUMAN		Colorectal(111;0.182)	4	1624	-			187			Lumenal (Potential).		B2RBE4|Q6P9G6|Q8IUF9|Q9NSQ7|Q9NUM9	Missense_Mutation	SNP	ENST00000454498.2	37	c.560C>G	CCDS6010.1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.421701	0.43020	.	.	ENSG00000147408	ENST00000454498;ENST00000332246;ENST00000311540;ENST00000522854;ENST00000544602	T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.22781	0.0550	L	0.27975	0.815	0.80722	D	1	B	0.23249	0.082	B	0.35727	0.209	T	0.05115	-1.0905	10	0.33141	T	0.24	-32.3316	18.8612	0.92273	0.0:0.0:1.0:0.0	.	187	Q8TDX6	CGAT1_HUMAN	G	187	ENSP00000411816:A187G;ENSP00000330805:A187G;ENSP00000310891:A187G;ENSP00000429809:A187G;ENSP00000442155:A187G	ENSP00000310891:A187G	A	-	2	0	CSGALNACT1	19407066	1.000000	0.71417	0.220000	0.23810	0.678000	0.39670	7.418000	0.80167	2.873000	0.98535	0.563000	0.77884	GCC		0.542	CSGALNACT1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375204.1	NM_018371		6	49	0	0	0	0.001984	0	6	49				
SCARA5	286133	broad.mit.edu	37	8	27737266	27737266	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:27737266T>C	ENST00000354914.3	-	8	1656	c.1171A>G	c.(1171-1173)Atg>Gtg	p.M391V	SCARA5_ENST00000380385.2_Missense_Mutation_p.M166V	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	391					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)	p.M391V(1)		central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		CGGATCATCATCGGGGCCTCC	0.657																																							uc003xgj.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(1171-1173)ATG>GTG		scavenger receptor class A, member 5							52.0	51.0	51.0					8																	27737266		2203	4300	6503	SO:0001583	missense	286133				cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity	g.chr8:27737266T>C	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1171A>G	8.37:g.27737266T>C	ENSP00000346990:p.Met391Val					SCARA5_uc010luz.2_Missense_Mutation_p.M166V	p.M391V	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)	8	1611	-		Ovarian(32;0.0218)	391			Extracellular (Potential).		Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	37	c.1171A>G	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	T	9.588	1.125369	0.20959	.	.	ENSG00000168079	ENST00000354914;ENST00000380385	T;T	0.26373	1.74;1.74	4.96	-8.57	0.00900	Speract/scavenger receptor-related (1);	0.869088	0.09941	N	0.735994	T	0.05181	0.0138	N	0.01096	-1.015	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29427	-1.0012	10	0.27785	T	0.31	.	3.2158	0.06699	0.0985:0.1843:0.3909:0.3263	.	166;391	Q6ZMJ2-4;Q6ZMJ2	.;SCAR5_HUMAN	V	391;166	ENSP00000346990:M391V;ENSP00000369746:M166V	ENSP00000346990:M391V	M	-	1	0	SCARA5	27793185	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.734000	0.04893	-1.426000	0.01994	-0.899000	0.02877	ATG		0.657	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833		5	14	0	0	0	0.001168	0	5	14				
KCNU1	157855	broad.mit.edu	37	8	36663793	36663793	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:36663793G>T	ENST00000399881.3	+	5	512	c.475G>T	c.(475-477)Gca>Tca	p.A159S		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	159					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.A159S(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		ATAGTTTATGGCAGCTGATGA	0.338																																							uc010lvw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(475-477)GCA>TCA		potassium channel, subfamily U, member 1							77.0	75.0	75.0					8																	36663793		1850	4106	5956	SO:0001583	missense	157855					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr8:36663793G>T	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.475G>T	8.37:g.36663793G>T	ENSP00000382770:p.Ala159Ser					KCNU1_uc003xjw.2_RNA	p.A159S	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)	5	562	+			159			Helical; Name=Segment S2; (Potential).			Missense_Mutation	SNP	ENST00000399881.3	37	c.475G>T	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577944	0.86645	.	.	ENSG00000215262	ENST00000523973;ENST00000399881	T;T	0.49720	0.77;0.77	5.57	5.57	0.84162	Ion transport (1);	0.095383	0.38663	U	0.001608	T	0.55893	0.1949	N	0.20610	0.595	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.61342	-0.7082	10	0.87932	D	0	-5.7492	18.3115	0.90201	0.0:0.0:1.0:0.0	.	159	A8MYU2	KCNU1_HUMAN	S	159	ENSP00000429951:A159S;ENSP00000382770:A159S	ENSP00000382770:A159S	A	+	1	0	KCNU1	36782951	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	8.804000	0.91921	2.616000	0.88540	0.557000	0.71058	GCA		0.338	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836		5	20	1	0	0.000602214	0.000602	0.000696578	5	20				
PXDNL	137902	broad.mit.edu	37	8	52325734	52325734	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:52325734G>C	ENST00000356297.4	-	15	1980	c.1880C>G	c.(1879-1881)tCc>tGc	p.S627C	PXDNL_ENST00000543296.1_Missense_Mutation_p.S627C	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	627					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.S627C(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCTTCGTGTGGAGTTAATTGC	0.348																																							uc003xqu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1879-1881)TCC>TGC		peroxidasin homolog-like precursor							136.0	135.0	135.0					8																	52325734		1869	4121	5990	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52325734G>C		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1880C>G	8.37:g.52325734G>C	ENSP00000348645:p.Ser627Cys						p.S627C	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN			15	1981	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	627					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.1880C>G	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241125	0.58995	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.66638	-0.21;-0.22	4.94	3.12	0.35913	.	.	.	.	.	T	0.77294	0.4109	M	0.70595	2.14	0.29788	N	0.833457	D	0.76494	0.999	D	0.71184	0.972	T	0.70868	-0.4755	9	0.72032	D	0.01	.	7.6404	0.28290	0.0881:0.0:0.7484:0.1635	.	627	A1KZ92	PXDNL_HUMAN	C	627	ENSP00000348645:S627C;ENSP00000444865:S627C	ENSP00000348645:S627C	S	-	2	0	PXDNL	52488287	1.000000	0.71417	0.946000	0.38457	0.887000	0.51463	2.188000	0.42612	0.477000	0.27464	0.655000	0.94253	TCC		0.348	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		13	42	0	0	0	0.003163	0	13	42				
CSMD3	114788	broad.mit.edu	37	8	113299383	113299383	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:113299383C>A	ENST00000297405.5	-	58	9485	c.9241G>T	c.(9241-9243)Gct>Tct	p.A3081S	CSMD3_ENST00000352409.3_Missense_Mutation_p.A3011S|CSMD3_ENST00000343508.3_Missense_Mutation_p.A3041S|CSMD3_ENST00000455883.2_Missense_Mutation_p.A2912S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3081	Sushi 22. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A3041S(1)|p.A3081S(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTATCACAAGCATAACGTACA	0.468										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(9241-9243)GCT>TCT		CUB and Sushi multiple domains 3 isoform 1							188.0	158.0	168.0					8																	113299383		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113299383C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9241G>T	8.37:g.113299383C>A	ENSP00000297405:p.Ala3081Ser	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.A2283S|CSMD3_uc003ynt.2_Missense_Mutation_p.A3041S|CSMD3_uc011lhx.1_Missense_Mutation_p.A2912S	p.A3081S	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			58	9400	-			3081			Extracellular (Potential).|Sushi 22.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.9241G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	4.877	0.163091	0.09287	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04	5.36	2.44	0.29823	Complement control module (2);Sushi/SCR/CCP (3);	0.345917	0.26109	N	0.026293	T	0.13200	0.0320	N	0.00068	-2.29	0.24878	N	0.992246	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.001;0.003;0.001	T	0.44421	-0.9329	10	0.02654	T	1	.	2.5894	0.04838	0.3569:0.3462:0.0:0.2969	.	2912;3081;3041	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	3041;3081;2351;2912;3011	ENSP00000345799:A3041S;ENSP00000297405:A3081S;ENSP00000341558:A2351S;ENSP00000412263:A2912S;ENSP00000343124:A3011S	ENSP00000297405:A3081S	A	-	1	0	CSMD3	113368559	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.152000	0.31663	1.398000	0.46701	0.650000	0.86243	GCT		0.468	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		24	86	1	0	4.26978e-12	0.00333	7.50446e-12	24	86				
COL22A1	169044	broad.mit.edu	37	8	139609156	139609156	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:139609156G>T	ENST00000303045.6	-	62	4869	c.4423C>A	c.(4423-4425)Cag>Aag	p.Q1475K	COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_Missense_Mutation_p.Q1455K	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1475	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.Q1475K(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTTTCAAGCTGCTTCCCCAGC	0.507										HNSCC(7;0.00092)																													uc003yvd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|pancreas(1)|skin(1)	13						c.(4423-4425)CAG>AAG		collagen, type XXII, alpha 1							182.0	182.0	182.0					8																	139609156		2203	4300	6503	SO:0001583	missense	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139609156G>T	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4423C>A	8.37:g.139609156G>T	ENSP00000303153:p.Gln1475Lys	HNSCC(7;0.00092)				COL22A1_uc011ljo.1_Missense_Mutation_p.Q755K	p.Q1475K	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		62	4870	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1475			Pro-rich.|Gly-rich.		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	c.4423C>A	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645403	0.67358	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.89123	-2.47;-2.39	5.06	5.06	0.68205	.	0.000000	0.44688	U	0.000425	D	0.91918	0.7441	M	0.68317	2.08	0.54753	D	0.999984	D;D	0.62365	0.991;0.969	P;D	0.64877	0.84;0.93	D	0.88842	0.3313	10	0.05833	T	0.94	.	17.4049	0.87470	0.0:0.0:1.0:0.0	.	1455;1475	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	K	1475;1455;1168	ENSP00000303153:Q1475K;ENSP00000387655:Q1455K	ENSP00000303153:Q1475K	Q	-	1	0	COL22A1	139678338	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	8.323000	0.90002	2.349000	0.79799	0.563000	0.77884	CAG		0.507	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		68	183	1	0	5.41795e-27	0.01441	1.11095e-26	68	183				
GSDMD	79792	broad.mit.edu	37	8	144641996	144641996	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr8:144641996G>C	ENST00000526406.1	+	6	1150	c.267G>C	c.(265-267)caG>caC	p.Q89H	GSDMD_ENST00000533063.1_Missense_Mutation_p.Q137H|GSDMD_ENST00000262580.4_Missense_Mutation_p.Q89H	NM_001166237.1	NP_001159709.1	P57764	GSDMD_HUMAN	gasdermin D	89					cellular response to extracellular stimulus (GO:0031668)			p.Q89H(1)		breast(1)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	12						TGGATGGGCAGATACAGGGCA	0.642																																							uc010mfe.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(265-267)CAG>CAC		gasdermin D							43.0	42.0	43.0					8																	144641996		2199	4297	6496	SO:0001583	missense	79792							g.chr8:144641996G>C	AK096216	CCDS34956.1	8q24.3	2008-07-31	2008-07-31	2008-07-31		ENSG00000104518			25697	protein-coding gene	gene with protein product			"""gasdermin domain containing 1"""	GSDMDC1		15289881, 17350798	Standard	NM_024736		Approved	FLJ12150, DF5L	uc003yyg.3	P57764		ENST00000526406.1:c.267G>C	8.37:g.144641996G>C	ENSP00000433209:p.Gln89His					uc003yye.2_5'Flank|GSDMD_uc003yyf.2_Missense_Mutation_p.Q137H|GSDMD_uc003yyi.2_Missense_Mutation_p.Q89H|GSDMD_uc003yyg.2_Missense_Mutation_p.Q89H|GSDMD_uc003yyh.2_Intron	p.Q89H	NM_024736	NP_079012	P57764	GSDMD_HUMAN			6	970	+			89					D3DWJ9|Q96Q98	Missense_Mutation	SNP	ENST00000526406.1	37	c.267G>C	CCDS34956.1	.	.	.	.	.	.	.	.	.	.	G	10.58	1.389053	0.25118	.	.	ENSG00000104518	ENST00000526406;ENST00000533348;ENST00000533063;ENST00000262580;ENST00000525721;ENST00000534018;ENST00000533888	T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92	4.7	3.81	0.43845	.	1.588920	0.03557	N	0.226495	T	0.40398	0.1115	L	0.41824	1.3	0.09310	N	1	D;B;B	0.65815	0.995;0.013;0.01	D;B;B	0.63597	0.916;0.017;0.01	T	0.31752	-0.9932	10	0.14252	T	0.57	-6.1967	10.4468	0.44499	0.0:0.2075:0.7925:0.0	.	119;89;137	Q6ZRV8;P57764;G3V1A6	.;GSDMD_HUMAN;.	H	89;89;137;89;89;105;89	ENSP00000433209:Q89H;ENSP00000434386:Q89H;ENSP00000433958:Q137H;ENSP00000262580:Q89H;ENSP00000434452:Q89H;ENSP00000436684:Q105H;ENSP00000437065:Q89H	ENSP00000262580:Q89H	Q	+	3	2	GSDMD	144713139	0.355000	0.24921	0.014000	0.15608	0.009000	0.06853	1.617000	0.36943	1.172000	0.42781	0.543000	0.68304	CAG		0.642	GSDMD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382046.3	NM_024736		4	23	0	0	0	0.001168	0	4	23				
PDCD1LG2	80380	broad.mit.edu	37	9	5534764	5534764	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:5534764C>A	ENST00000397747.3	+	3	323	c.75C>A	c.(73-75)gtC>gtA	p.V25V	PDCD1LG2_ENST00000397745.2_Silent_p.V25V	NM_025239.3	NP_079515.2	Q9BQ51	PD1L2_HUMAN	programmed cell death 1 ligand 2	25	Ig-like V-type.				immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V25V(1)		large_intestine(2)|lung(4)|prostate(2)	8	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000767)|Lung(218;0.112)		CAGTGACAGTCCCTAAGGAAC	0.408																																							uc003zjg.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(73-75)GTC>GTA		programmed cell death 1 ligand 2 precursor							86.0	77.0	80.0					9																	5534764		2203	4300	6503	SO:0001819	synonymous_variant	80380				immune response|T cell costimulation	endomembrane system|extracellular region|integral to membrane|plasma membrane	receptor activity	g.chr9:5534764C>A	AF344424	CCDS6465.1	9p24.2	2014-01-30			ENSG00000197646	ENSG00000197646		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	18731	protein-coding gene	gene with protein product	"""B7 dendritic cell molecule"""	605723				11224527	Standard	NM_025239		Approved	PD-L2, Btdc, PDL2, bA574F11.2, CD273, B7-DC	uc003zjg.4	Q9BQ51	OTTHUMG00000019504	ENST00000397747.3:c.75C>A	9.37:g.5534764C>A						C9orf46_uc003zjd.2_Intron|PDCD1LG2_uc011lmc.1_Silent_p.V25V|PDCD1LG2_uc011lmd.1_Silent_p.V25V|PDCD1LG2_uc010mhp.1_Silent_p.V25V|PDCD1LG2_uc010mho.1_Silent_p.V25V	p.V25V	NM_025239	NP_079515	Q9BQ51	PD1L2_HUMAN		GBM - Glioblastoma multiforme(50;0.000767)|Lung(218;0.112)	3	348	+	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)	25			Ig-like V-type.|Extracellular (Potential).		Q14CN8|Q5T7Z6|Q6JXL8|Q6JXL9	Silent	SNP	ENST00000397747.3	37	c.75C>A	CCDS6465.1																																																																																				0.408	PDCD1LG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051634.1	NM_025239		8	58	1	0	3.09899e-07	0.004482	4.47754e-07	8	58				
PTPRD	5789	broad.mit.edu	37	9	8465644	8465644	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:8465644C>G	ENST00000381196.4	-	29	4079	c.3536G>C	c.(3535-3537)aGc>aCc	p.S1179T	PTPRD_ENST00000360074.4_Missense_Mutation_p.S1166T|PTPRD_ENST00000540109.1_Missense_Mutation_p.S1179T|PTPRD_ENST00000355233.5_Missense_Mutation_p.S768T|PTPRD_ENST00000358503.5_Missense_Mutation_p.S1157T|PTPRD_ENST00000486161.1_Missense_Mutation_p.S768T|PTPRD_ENST00000537002.1_Missense_Mutation_p.S765T|PTPRD_ENST00000397611.3_Missense_Mutation_p.S765T|PTPRD_ENST00000397606.3_Missense_Mutation_p.S758T|PTPRD_ENST00000397617.3_Missense_Mutation_p.S758T|PTPRD_ENST00000356435.5_Missense_Mutation_p.S1179T	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1179					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.S1179T(2)|p.S768T(1)|p.S650T(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ATAACGGATGCTTCTGCGCTT	0.398										TSP Lung(15;0.13)																													uc003zkk.2		NA																	4	Substitution - Missense(4)		lung(4)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(3535-3537)AGC>ACC		protein tyrosine phosphatase, receptor type, D							110.0	105.0	107.0					9																	8465644		2203	4299	6502	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8465644C>G	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3536G>C	9.37:g.8465644C>G	ENSP00000370593:p.Ser1179Thr	TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Missense_Mutation_p.S768T|PTPRD_uc003zkq.2_Missense_Mutation_p.S768T|PTPRD_uc003zkr.2_Missense_Mutation_p.S763T|PTPRD_uc003zks.2_Missense_Mutation_p.S758T|PTPRD_uc003zkl.2_Missense_Mutation_p.S1170T|PTPRD_uc003zkm.2_Missense_Mutation_p.S1166T|PTPRD_uc003zkn.2_Missense_Mutation_p.S768T|PTPRD_uc003zko.2_Missense_Mutation_p.S765T	p.S1179T	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	31	4247	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1179			Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.3536G>C	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.486574	0.44249	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.55234	0.55;0.55;0.59;0.64;0.75;0.86;0.63;0.53;0.55;0.75;0.86	5.5	5.5	0.81552	.	0.245380	0.48767	D	0.000178	T	0.53061	0.1773	L	0.41824	1.3	0.42835	D	0.994039	B;B;B;B;P;B;B;B;B	0.41643	0.304;0.072;0.039;0.006;0.758;0.002;0.005;0.339;0.005	B;B;B;B;P;B;B;B;B	0.45037	0.096;0.031;0.018;0.002;0.467;0.004;0.015;0.08;0.005	T	0.45687	-0.9244	9	.	.	.	.	19.7567	0.96296	0.0:1.0:0.0:0.0	.	758;763;768;768;765;765;1166;1179;1179	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	T	1179;1179;1166;1157;768;758;765;765;650;1179;768;758	ENSP00000370593:S1179T;ENSP00000348812:S1179T;ENSP00000353187:S1166T;ENSP00000351293:S1157T;ENSP00000347373:S768T;ENSP00000380741:S758T;ENSP00000380735:S765T;ENSP00000440515:S765T;ENSP00000438164:S1179T;ENSP00000417093:S768T;ENSP00000380731:S758T	.	S	-	2	0	PTPRD	8455644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.339000	0.43965	2.746000	0.94184	0.650000	0.86243	AGC		0.398	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			9	79	0	0	0	0.013537	0	9	79				
LURAP1L	286343	broad.mit.edu	37	9	12821419	12821419	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:12821419G>T	ENST00000319264.3	+	2	1042	c.347G>T	c.(346-348)cGc>cTc	p.R116L		NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	119								p.R116L(1)									AGGCTCATGCGCCAGTTGCTT	0.483																																							uc003zkw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(346-348)CGC>CTC		hypothetical protein LOC286343							109.0	113.0	112.0					9																	12821419		2203	4300	6503	SO:0001583	missense	286343							g.chr9:12821419G>T	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.347G>T	9.37:g.12821419G>T	ENSP00000321026:p.Arg116Leu						p.R116L	NM_203403	NP_981948	Q8IV03	CI150_HUMAN		GBM - Glioblastoma multiforme(1;1.64e-13)	2	1050	+			119					Q5VZX7|Q8N923|Q8NCG2	Missense_Mutation	SNP	ENST00000319264.3	37	c.347G>T	CCDS6473.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919611	0.73098	.	.	ENSG00000153714	ENST00000319264	T	0.46451	0.87	5.31	5.31	0.75309	.	0.529661	0.17093	N	0.187297	T	0.59046	0.2165	L	0.43152	1.355	0.47862	D	0.999539	D	0.71674	0.998	D	0.68353	0.957	T	0.60459	-0.7259	10	0.72032	D	0.01	.	18.9767	0.92740	0.0:0.0:1.0:0.0	.	119	Q8IV03	CI150_HUMAN	L	116	ENSP00000321026:R116L	ENSP00000321026:R116L	R	+	2	0	C9orf150	12811419	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.719000	0.68462	2.477000	0.83638	0.563000	0.77884	CGC		0.483	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403		28	145	1	0	4.87955e-14	0.005443	9.17175e-14	28	145				
FRMPD1	22844	broad.mit.edu	37	9	37746166	37746166	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:37746166C>A	ENST00000539465.1	+	16	4730	c.4137C>A	c.(4135-4137)ccC>ccA	p.P1379P	FRMPD1_ENST00000377765.3_Silent_p.P1379P|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1379						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.P1379P(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		TGGTTCTGCCCTGGAGGCCTG	0.652																																							uc004aag.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(4135-4137)CCC>CCA		FERM and PDZ domain containing 1							51.0	60.0	57.0					9																	37746166		2203	4300	6503	SO:0001819	synonymous_variant	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37746166C>A	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.4137C>A	9.37:g.37746166C>A						FRMPD1_uc004aah.1_Silent_p.P1379P	p.P1379P	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	16	4181	+			1379					B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	37	c.4137C>A	CCDS6612.1																																																																																				0.652	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		16	70	1	0	1.3612e-06	0.003163	1.86706e-06	16	70				
PCSK5	5125	broad.mit.edu	37	9	78601129	78601129	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:78601129A>G	ENST00000545128.1	+	3	917	c.379A>G	c.(379-381)Aat>Gat	p.N127D	PCSK5_ENST00000376752.4_Missense_Mutation_p.N127D|PCSK5_ENST00000376767.3_Missense_Mutation_p.N127D	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	127					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.N127D(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TACCTATTTCAATGATCCCAA	0.473																																							uc004ajz.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|skin(1)	3						c.(379-381)AAT>GAT		proprotein convertase subtilisin/kexin type 5							174.0	153.0	160.0					9																	78601129		2203	4300	6503	SO:0001583	missense	5125				anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity	g.chr9:78601129A>G		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.379A>G	9.37:g.78601129A>G	ENSP00000446280:p.Asn127Asp					PCSK5_uc004ajy.2_Missense_Mutation_p.N127D|PCSK5_uc004aka.2_RNA	p.N127D	NM_006200	NP_006191	Q92824	PCSK5_HUMAN			3	917	+			127			Catalytic.		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	c.379A>G	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	A	18.48	3.633611	0.67015	.	.	ENSG00000099139	ENST00000545128;ENST00000376767;ENST00000396108;ENST00000376752	T;T;T	0.41400	1.0;1.0;1.0	5.83	5.83	0.93111	.	.	.	.	.	T	0.59487	0.2197	M	0.76433	2.335	0.49483	D	0.999793	P;P	0.48998	0.918;0.768	P;B	0.54346	0.749;0.347	T	0.62964	-0.6742	9	0.59425	D	0.04	.	16.1968	0.82036	1.0:0.0:0.0:0.0	.	127;127	Q92824-2;B1AMG5	.;.	D	127	ENSP00000446280:N127D;ENSP00000365958:N127D;ENSP00000365943:N127D	ENSP00000365943:N127D	N	+	1	0	PCSK5	77790949	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.058000	0.76676	2.225000	0.72522	0.533000	0.62120	AAT		0.473	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				14	67	0	0	0	0.006122	0	14	67				
PRUNE2	158471	broad.mit.edu	37	9	79321909	79321909	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:79321909G>T	ENST00000376718.3	-	8	5404	c.5281C>A	c.(5281-5283)Caa>Aaa	p.Q1761K	PRUNE2_ENST00000428286.1_Missense_Mutation_p.Q1402K	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1761					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.Q1761K(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GGGCTGCTTTGTTGATTGTCA	0.448																																							uc010mpk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(5281-5283)CAA>AAA		prune homolog 2							193.0	150.0	163.0					9																	79321909		1568	3582	5150	SO:0001583	missense	158471				apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity	g.chr9:79321909G>T	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.5281C>A	9.37:g.79321909G>T	ENSP00000365908:p.Gln1761Lys					PRUNE2_uc004akj.3_5'Flank|PRUNE2_uc010mpl.1_5'Flank	p.Q1761K	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN			8	5405	-			1761					B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	c.5281C>A	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.173|7.173	0.588054|0.588054	0.13812|0.13812	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.48201|.	0.82;0.82|.	4.95|4.95	4.03|4.03	0.46877|0.46877	.|.	0.252084|.	0.28521|.	N|.	0.015051|.	T|T	0.60287|0.60287	0.2257|0.2257	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	P|.	0.34864|.	0.473|.	B|.	0.24848|.	0.056|.	T|T	0.58306|0.58306	-0.7659|-0.7659	10|5	0.28530|.	T|.	0.3|.	-4.133|-4.133	8.3038|8.3038	0.32029|0.32029	0.0:0.1596:0.6502:0.1901|0.0:0.1596:0.6502:0.1901	.|.	1761|.	Q8WUY3|.	PRUN2_HUMAN|.	K|K	1761;1402;1760|1082	ENSP00000365908:Q1761K;ENSP00000397425:Q1402K|.	ENSP00000365908:Q1761K|.	Q|T	-|-	1|2	0|0	PRUNE2|PRUNE2	78511729|78511729	0.977000|0.977000	0.34250|0.34250	0.818000|0.818000	0.32626|0.32626	0.021000|0.021000	0.10359|0.10359	1.858000|1.858000	0.39408|0.39408	1.421000|1.421000	0.47157|0.47157	0.655000|0.655000	0.94253|0.94253	CAA|ACA		0.448	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		5	46	1	0	8.12818e-05	0.001984	9.76344e-05	5	46				
VPS13A	23230	broad.mit.edu	37	9	79933209	79933209	+	Missense_Mutation	SNP	A	A	C	rs554283579		TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:79933209A>C	ENST00000360280.3	+	41	5275	c.5015A>C	c.(5014-5016)aAg>aCg	p.K1672T	VPS13A_ENST00000357409.5_Missense_Mutation_p.K1672T|VPS13A_ENST00000423463.2_3'UTR|VPS13A_ENST00000376634.4_Missense_Mutation_p.K1672T|VPS13A_ENST00000376636.3_Missense_Mutation_p.K1633T	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1672					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.K1672T(3)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TATACAACTAAGGAAACCATC	0.308													A|||	1	0.000199681	0.0	0.0	5008	,	,		15256	0.0		0.0	False		,,,				2504	0.001						uc004akr.2		NA																	3	Substitution - Missense(3)		lung(3)	pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						c.(5014-5016)AAG>ACG		vacuolar protein sorting 13A isoform A							79.0	83.0	82.0					9																	79933209		2203	4300	6503	SO:0001583	missense	23230				Golgi to endosome transport|protein transport	intracellular	protein binding	g.chr9:79933209A>C	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.5015A>C	9.37:g.79933209A>C	ENSP00000353422:p.Lys1672Thr					VPS13A_uc004akp.3_Missense_Mutation_p.K1672T|VPS13A_uc004akq.3_Missense_Mutation_p.K1672T|VPS13A_uc004aks.2_Missense_Mutation_p.K1633T|VPS13A_uc004akt.2_Missense_Mutation_p.K12T|VPS13A_uc010mpo.1_Missense_Mutation_p.K268T	p.K1672T	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN			41	5275	+			1672					Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	c.5015A>C	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	A	9.823	1.186217	0.21870	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.51574	0.87;0.7;0.78;0.87	5.3	4.11	0.48088	.	0.400459	0.24412	N	0.038750	T	0.31606	0.0802	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.17465	0.013;0.013;0.022;0.022	B;B;B;B	0.18871	0.02;0.01;0.023;0.023	T	0.09228	-1.0684	10	0.19590	T	0.45	.	11.5174	0.50529	0.7606:0.2394:0.0:0.0	.	1633;1672;1672;1672	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	T	1672;1633;1672;1672	ENSP00000365821:K1672T;ENSP00000365823:K1633T;ENSP00000353422:K1672T;ENSP00000349985:K1672T	ENSP00000349985:K1672T	K	+	2	0	VPS13A	79123029	1.000000	0.71417	1.000000	0.80357	0.127000	0.20565	3.788000	0.55446	2.135000	0.66039	0.377000	0.23210	AAG		0.308	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186		16	87	0	0	0	0.006122	0	16	87				
ERP44	23071	broad.mit.edu	37	9	102778708	102778708	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:102778708C>A	ENST00000262455.6	-	8	857	c.658G>T	c.(658-660)Gat>Tat	p.D220Y		NM_015051.1	NP_055866.1	Q9BS26	ERP44_HUMAN	endoplasmic reticulum protein 44	220					cell redox homeostasis (GO:0045454)|glycoprotein metabolic process (GO:0009100)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	protein disulfide isomerase activity (GO:0003756)	p.D220Y(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)	19						TACACCATATCCGGAGCAGAA	0.299																																							uc004bam.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(658-660)GAT>TAT		thioredoxin domain containing 4 (endoplasmic							59.0	58.0	58.0					9																	102778708		2203	4300	6503	SO:0001583	missense	23071				cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity	g.chr9:102778708C>A	AB011145	CCDS35082.1	9q22.33	2011-10-19	2009-02-23	2009-02-23	ENSG00000023318	ENSG00000023318		"""Protein disulfide isomerases"""	18311	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 10"""	609170	"""thioredoxin domain containing 4 (endoplasmic reticulum)"""	TXNDC4		11847130	Standard	NM_015051		Approved	KIAA0573, PDIA10	uc004bam.3	Q9BS26	OTTHUMG00000020363	ENST00000262455.6:c.658G>T	9.37:g.102778708C>A	ENSP00000262455:p.Asp220Tyr					ERP44_uc010msy.2_RNA|ERP44_uc010msz.2_Missense_Mutation_p.D220Y	p.D220Y	NM_015051	NP_055866	Q9BS26	ERP44_HUMAN			8	866	-			220					O60319|Q4VXC1|Q5VWZ7|Q6UW14|Q8WX67	Missense_Mutation	SNP	ENST00000262455.6	37	c.658G>T	CCDS35082.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433065	0.62844	.	.	ENSG00000023318	ENST00000262455	T	0.29917	1.55	6.17	6.17	0.99709	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.43678	0.1258	M	0.76574	2.34	0.80722	D	1	P	0.42692	0.787	B	0.43360	0.417	T	0.15235	-1.0444	10	0.30854	T	0.27	-5.7146	20.8794	0.99867	0.0:1.0:0.0:0.0	.	220	Q9BS26	ERP44_HUMAN	Y	220	ENSP00000262455:D220Y	ENSP00000262455:D220Y	D	-	1	0	ERP44	101818529	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.381000	0.79718	2.941000	0.99782	0.655000	0.94253	GAT		0.299	ERP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053402.1	XM_088476		10	51	1	0	0.00829132	0.008291	0.00907352	10	51				
AKNA	80709	broad.mit.edu	37	9	117124771	117124771	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:117124771C>G	ENST00000307564.4	-	8	1992	c.1831G>C	c.(1831-1833)Gag>Cag	p.E611Q	AKNA_ENST00000312033.3_Missense_Mutation_p.E611Q|AKNA_ENST00000374075.5_Missense_Mutation_p.E530Q|AKNA_ENST00000374088.3_Missense_Mutation_p.E611Q|AKNA_ENST00000223791.3_Missense_Mutation_p.E71Q	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	611					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E611Q(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TTCAGGTACTCCTCCTCTAGG	0.652																																							uc004biq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(2)	6						c.(1831-1833)GAG>CAG		AT-hook transcription factor							30.0	33.0	32.0					9																	117124771		2203	4300	6503	SO:0001583	missense	80709				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr9:117124771C>G	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.1831G>C	9.37:g.117124771C>G	ENSP00000303769:p.Glu611Gln					AKNA_uc004bin.3_5'Flank|AKNA_uc004bio.3_Missense_Mutation_p.E71Q|AKNA_uc004bip.3_Missense_Mutation_p.E530Q|AKNA_uc004bir.3_Missense_Mutation_p.E611Q|AKNA_uc004bis.3_Missense_Mutation_p.E611Q|AKNA_uc010mve.2_Missense_Mutation_p.E492Q|AKNA_uc004biu.1_Missense_Mutation_p.E352Q|AKNA_uc004biv.1_Missense_Mutation_p.E611Q	p.E611Q	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN			7	1966	-			611					Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	c.1831G>C	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	c	15.88	2.964503	0.53507	.	.	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000223791;ENST00000374075;ENST00000312033	T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27	4.94	3.08	0.35506	.	0.579519	0.15756	N	0.246185	T	0.50922	0.1644	L	0.46157	1.445	0.80722	D	1	B;B	0.20261	0.043;0.035	B;B	0.24394	0.053;0.031	T	0.46428	-0.9192	10	0.48119	T	0.1	-5.9555	11.6238	0.51134	0.0:0.6257:0.3743:0.0	.	611;530	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	Q	611;452;611;71;530;611	ENSP00000303769:E611Q;ENSP00000363201:E611Q;ENSP00000223791:E71Q;ENSP00000363188:E530Q;ENSP00000309222:E611Q	ENSP00000223791:E71Q	E	-	1	0	AKNA	116164592	0.269000	0.24143	0.987000	0.45799	0.773000	0.43773	2.479000	0.45197	0.665000	0.31066	-0.323000	0.08544	GAG		0.652	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767		3	7	0	0	0	0.004672	0	3	7				
BRINP1	1620	broad.mit.edu	37	9	122075577	122075577	+	Silent	SNP	T	T	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:122075577T>A	ENST00000265922.3	-	2	518	c.57A>T	c.(55-57)tcA>tcT	p.S19S	BRINP1_ENST00000373964.2_Silent_p.S19S	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	19					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.S19S(1)									AGGGCTGCACTGAGATACGGC	0.512																																							uc004bkc.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						c.(55-57)TCA>TCT		deleted in bladder cancer 1 precursor							113.0	107.0	109.0					9																	122075577		2203	4300	6503	SO:0001819	synonymous_variant	1620				cell cycle arrest|cell death	cytoplasm	protein binding	g.chr9:122075577T>A	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.57A>T	9.37:g.122075577T>A						DBC1_uc004bkd.2_Silent_p.S19S	p.S19S	NM_014618	NP_055433	O60477	DBC1_HUMAN			2	513	-			19					Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	ENST00000265922.3	37	c.57A>T	CCDS6822.1																																																																																				0.512	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618		23	68	0	0	0	0.00333	0	23	68				
OR1J1	347168	broad.mit.edu	37	9	125239270	125239270	+	Silent	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:125239270A>G	ENST00000259357.2	-	1	965	c.936T>C	c.(934-936)gcT>gcC	p.A312A	RP11-542K23.9_ENST00000412262.2_RNA	NM_001004451.1	NP_001004451.1	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J, member 1	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	16						tacaggcatgagccactgcgc	0.502																																							uc011lyu.1		NA																	0				skin(2)	2						c.(934-936)GCT>GCC		olfactory receptor, family 1, subfamily J,							49.0	45.0	46.0					9																	125239270		2203	4300	6503	SO:0001819	synonymous_variant	347168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125239270A>G	AL353767	CCDS35120.1	9q33.2	2013-09-20			ENSG00000136834	ENSG00000136834		"""GPCR / Class A : Olfactory receptors"""	8208	protein-coding gene	gene with protein product							Standard	NM_001004451		Approved	hg32	uc011lyu.2	Q8NGS3	OTTHUMG00000020603	ENST00000259357.2:c.936T>C	9.37:g.125239270A>G						OR1J2_uc004bmj.1_Intron	p.A312A	NM_001004451	NP_001004451	Q8NGS3	OR1J1_HUMAN			1	936	-			312			Cytoplasmic (Potential).		A3KFL8|Q6IF10|Q96R88	Silent	SNP	ENST00000259357.2	37	c.936T>C	CCDS35120.1																																																																																				0.502	OR1J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053931.1			3	74	0	0	0	0.004672	0	3	74				
LRSAM1	90678	broad.mit.edu	37	9	130251778	130251778	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:130251778A>G	ENST00000323301.4	+	18	2007	c.1403A>G	c.(1402-1404)cAt>cGt	p.H468R	LRSAM1_ENST00000300417.6_Missense_Mutation_p.H468R|LRSAM1_ENST00000483302.1_3'UTR|LRSAM1_ENST00000373322.1_Missense_Mutation_p.H468R|LRSAM1_ENST00000373324.4_Missense_Mutation_p.H468R	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	468					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H468R(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						GACCTGATGCATCGGCAGATC	0.647																																							uc004brb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1402-1404)CAT>CGT		leucine rich repeat and sterile alpha motif							56.0	44.0	48.0					9																	130251778		2203	4300	6503	SO:0001583	missense	90678				negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:130251778A>G	AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.1403A>G	9.37:g.130251778A>G	ENSP00000322937:p.His468Arg					LRSAM1_uc010mxk.1_Missense_Mutation_p.H468R|LRSAM1_uc004brc.1_Missense_Mutation_p.H468R|LRSAM1_uc004brd.1_Missense_Mutation_p.H468R|LRSAM1_uc004bre.1_Missense_Mutation_p.H48R	p.H468R	NM_001005373	NP_001005373	Q6UWE0	LRSM1_HUMAN			19	1748	+			468					Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	ENST00000323301.4	37	c.1403A>G	CCDS6873.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582397	0.46006	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.79940	1.39;-1.32;1.39;1.39	5.62	4.47	0.54385	.	0.048546	0.85682	D	0.000000	T	0.81819	0.4903	M	0.72118	2.19	0.53688	D	0.999971	P;B	0.46621	0.881;0.31	P;B	0.47118	0.538;0.113	T	0.81974	-0.0687	10	0.66056	D	0.02	-10.6125	10.2633	0.43441	0.8517:0.0:0.0:0.1483	.	468;468	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	R	468	ENSP00000300417:H468R;ENSP00000362421:H468R;ENSP00000322937:H468R;ENSP00000362419:H468R	ENSP00000300417:H468R	H	+	2	0	LRSAM1	129291599	1.000000	0.71417	0.965000	0.40720	0.906000	0.53458	5.752000	0.68728	0.952000	0.37798	0.454000	0.30748	CAT		0.647	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054164.1	NM_138361		3	8	0	0	0	0.004672	0	3	8				
C9orf171	389799	broad.mit.edu	37	9	135447819	135447819	+	Silent	SNP	G	G	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:135447819G>A	ENST00000343036.2	+	7	933	c.885G>A	c.(883-885)caG>caA	p.Q295Q	C9orf171_ENST00000393216.2_Silent_p.Q259Q	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	295								p.Q295Q(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						CCGATCGCCAGAGAGCATTAA	0.627																																							uc004cbn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(1)	5						c.(883-885)CAG>CAA		hypothetical protein LOC389799							71.0	65.0	67.0					9																	135447819		2203	4300	6503	SO:0001819	synonymous_variant	389799							g.chr9:135447819G>A	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.885G>A	9.37:g.135447819G>A						C9orf171_uc004cbo.2_Silent_p.Q259Q	p.Q295Q	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN			7	933	+			295					Q147X1	Silent	SNP	ENST00000343036.2	37	c.885G>A	CCDS6949.1																																																																																				0.627	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417		11	34	0	0	0	0.00245	0	11	34				
FCN2	2220	broad.mit.edu	37	9	137777622	137777622	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:137777622G>T	ENST00000291744.6	+	6	448	c.438G>T	c.(436-438)caG>caT	p.Q146H	FCN2_ENST00000350339.2_Missense_Mutation_p.Q108H	NM_004108.2	NP_004099.2	Q15485	FCN2_HUMAN	ficolin (collagen/fibrinogen domain containing lectin) 2	146	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|opsonization (GO:0008228)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|carbohydrate binding (GO:0030246)	p.Q146H(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	20		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		AGGTTTTCCAGCGGAGGGTGG	0.652																																							uc004cfg.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(436-438)CAG>CAT		ficolin 2 isoform a precursor							54.0	55.0	55.0					9																	137777622		2203	4300	6503	SO:0001583	missense	2220				complement activation, lectin pathway|opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|calcium-dependent protein binding|receptor binding|sugar binding	g.chr9:137777622G>T	D49353	CCDS6983.1	9q34	2013-09-12	2013-09-12		ENSG00000160339	ENSG00000160339		"""Fibrinogen C domain containing"""	3624	protein-coding gene	gene with protein product	"""hucolin"", ""collagen/fibrinogen domain-containing protein 2"", ""ficolin B"", ""serum lectin p35"", ""L-ficolin"""	601624	"""ficolin (collagen/fibrinogen domain-containing lectin) 2 (hucolin)"""			8884275	Standard	XM_006717015		Approved	P35, FCNL, EBP-37, ficolin-2	uc004cfg.1	Q15485	OTTHUMG00000020892	ENST00000291744.6:c.438G>T	9.37:g.137777622G>T	ENSP00000291744:p.Gln146His					FCN2_uc004cfh.1_Missense_Mutation_p.Q108H	p.Q146H	NM_004108	NP_004099	Q15485	FCN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)	6	448	+		Myeloproliferative disorder(178;0.0333)	146			Fibrinogen C-terminal.		A6NFG7|A8K478|Q6IS69|Q7M4P4|Q9UC57	Missense_Mutation	SNP	ENST00000291744.6	37	c.438G>T	CCDS6983.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.879739	0.33162	.	.	ENSG00000160339	ENST00000350339;ENST00000291744	T;T	0.30182	1.54;1.54	3.96	3.04	0.35103	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.40222	N	0.001152	T	0.62097	0.2400	H	0.95745	3.715	0.53688	D	0.999978	D;D	0.69078	0.98;0.997	P;D	0.68765	0.852;0.96	T	0.71354	-0.4618	10	0.87932	D	0	.	9.6541	0.39914	0.1107:0.0:0.8893:0.0	.	108;146	Q15485-2;Q15485	.;FCN2_HUMAN	H	108;146	ENSP00000291741:Q108H;ENSP00000291744:Q146H	ENSP00000291744:Q146H	Q	+	3	2	FCN2	136917443	1.000000	0.71417	0.797000	0.32132	0.079000	0.17450	4.383000	0.59600	1.720000	0.51447	0.563000	0.77884	CAG		0.652	FCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054960.1	NM_004108		6	42	1	0	8.12818e-05	0.001984	9.76344e-05	6	42				
OLFM1	10439	broad.mit.edu	37	9	138011774	138011775	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:138011774_138011775GG>TT	ENST00000371793.3	+	6	1459_1460	c.1208_1209GG>TT	c.(1207-1209)gGG>gTT	p.G403V	OLFM1_ENST00000371796.3_Missense_Mutation_p.G376V|OLFM1_ENST00000252854.4_Missense_Mutation_p.G385V	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	403	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)	p.G385V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		CGCAGCGCCGGGGAGGCCTTCA	0.599																																							uc010nar.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1207-1209)GGG>GTT		olfactomedin related ER localized protein																																				SO:0001583	missense	10439				nervous system development	endoplasmic reticulum lumen	protein binding	g.chr9:138011774_138011775GG>TT	AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	Exception_encountered	9.37:g.138011774_138011775delinsTT	ENSP00000360858:p.Gly403Val					OLFM1_uc004cfl.3_Missense_Mutation_p.G385V|OLFM1_uc004cfn.3_Missense_Mutation_p.G154V	p.G403V	NM_014279	NP_055094	Q99784	NOE1_HUMAN		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)	6	1524_1525	+		Myeloproliferative disorder(178;0.0333)	403			Olfactomedin-like.		Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	DNP	ENST00000371793.3	37	c.1208_1209GG>TT																																																																																					0.599	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279		4	34	0	0	0	0.004672	0	4	34				
PNPLA7	375775	broad.mit.edu	37	9	140389498	140389498	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr9:140389498C>T	ENST00000277531.4	-	18	2225	c.2039G>A	c.(2038-2040)cGc>cAc	p.R680H	PNPLA7_ENST00000406427.1_Missense_Mutation_p.R705H|PNPLA7_ENST00000371457.1_Missense_Mutation_p.R286H	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	680					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)	p.R680H(2)		breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		TGGGTACCTGCGCTTGATGGA	0.657																																							uc004cnf.2		NA																	2	Substitution - Missense(2)		prostate(1)|lung(1)	skin(1)	1						c.(2038-2040)CGC>CAC		patatin-like phospholipase domain containing 7							99.0	88.0	92.0					9																	140389498		2203	4300	6503	SO:0001583	missense	375775				lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity	g.chr9:140389498C>T	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.2039G>A	9.37:g.140389498C>T	ENSP00000277531:p.Arg680His					C9orf167_uc011mew.1_Intron|PNPLA7_uc011mfa.1_Intron|PNPLA7_uc010ncj.1_Missense_Mutation_p.R705H	p.R680H	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)	18	2376	-	all_cancers(76;0.126)		680			cNMP 3.		B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	c.2039G>A	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.033339	0.54896	.	.	ENSG00000130653	ENST00000371457;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.55	4.55	0.56014	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	T	0.54398	0.1856	L	0.55213	1.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.949;0.977	T	0.52866	-0.8518	10	0.44086	T	0.13	-19.7507	8.9162	0.35583	0.0:0.8961:0.0:0.1039	.	705;680	Q6ZV29-5;Q6ZV29	.;PLPL7_HUMAN	H	286;680;705;680;671	ENSP00000360512:R286H;ENSP00000277531:R680H;ENSP00000384610:R705H;ENSP00000400582:R671H	ENSP00000277531:R680H	R	-	2	0	PNPLA7	139509319	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	5.699000	0.68310	2.240000	0.73641	0.643000	0.83706	CGC		0.657	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286		11	41	0	0	0	0.008291	0	11	41				
FRMPD4	9758	broad.mit.edu	37	X	12708435	12708435	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:12708435C>A	ENST00000380682.1	+	8	1309	c.803C>A	c.(802-804)aCt>aAt	p.T268N		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	268	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.T258N(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GAACAGGAGACTCTAACTCAG	0.502																																							uc004cuz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						c.(802-804)ACT>AAT		FERM and PDZ domain containing 4							139.0	112.0	122.0					X																	12708435		2203	4300	6503	SO:0001583	missense	9758				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chrX:12708435C>A	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.803C>A	X.37:g.12708435C>A	ENSP00000370057:p.Thr268Asn					FRMPD4_uc011mij.1_Missense_Mutation_p.T260N	p.T268N	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN			8	1309	+			268			FERM.		A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	c.803C>A	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793104	0.50102	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.74842	-0.88	5.28	5.28	0.74379	Band 4.1 domain (1);FERM domain (1);	0.060559	0.64402	D	0.000004	T	0.71829	0.3386	L	0.39898	1.24	0.40430	D	0.979938	P;B	0.37663	0.604;0.036	B;B	0.42771	0.397;0.031	T	0.69258	-0.5192	10	0.23891	T	0.37	.	18.3043	0.90175	0.0:1.0:0.0:0.0	.	260;268	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	N	268;259;257	ENSP00000370057:T268N	ENSP00000304583:T257N	T	+	2	0	FRMPD4	12618356	1.000000	0.71417	0.975000	0.42487	0.998000	0.95712	4.532000	0.60608	2.349000	0.79799	0.600000	0.82982	ACT		0.502	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		18	82	1	0	9.7654e-05	0.007413	0.000116954	18	82				
RAI2	10742	broad.mit.edu	37	X	17818841	17818842	+	Missense_Mutation	DNP	CA	CA	AT			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:17818841_17818842CA>AT	ENST00000545871.1	-	3	1749_1750	c.1289_1290TG>AT	c.(1288-1290)aTG>aAT	p.M430N	RAI2_ENST00000415486.3_Missense_Mutation_p.M380N|RAI2_ENST00000331511.1_Missense_Mutation_p.M430N|RAI2_ENST00000451717.1_Missense_Mutation_p.M430N|RAI2_ENST00000360011.1_Missense_Mutation_p.M430N	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	430					embryo development (GO:0009790)			p.M430N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					ACTCGCCCACCATCTCAATGTT	0.545																																							uc004cyf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1288-1290)ATG>AAT		retinoic acid induced 2																																				SO:0001583	missense	10742				embryo development			g.chrX:17818841_17818842CA>AT	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.1289_1290delinsAT	X.37:g.17818841_17818842delinsAT	ENSP00000444210:p.Met430Asn					RAI2_uc004cyg.2_Missense_Mutation_p.M430N|RAI2_uc010nfa.2_Missense_Mutation_p.M430N|RAI2_uc004cyh.3_Missense_Mutation_p.M430N|RAI2_uc011miy.1_Missense_Mutation_p.M380N	p.M430N	NM_021785	NP_068557	Q9Y5P3	RAI2_HUMAN			3	1859_1860	-	Hepatocellular(33;0.183)		430					B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	DNP	ENST00000545871.1	37	c.1289_1290TG>AT	CCDS14183.1																																																																																				0.545	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1	NM_021785		6	145	0	0	0	0.004672	0	6	145				
HEPH	9843	broad.mit.edu	37	X	65474945	65474945	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:65474945G>T	ENST00000343002.2	+	15	3296	c.2632G>T	c.(2632-2634)Gtt>Ttt	p.V878F	HEPH_ENST00000441993.2_Missense_Mutation_p.V881F|HEPH_ENST00000519389.1_Missense_Mutation_p.V932F|HEPH_ENST00000419594.1_Missense_Mutation_p.V689F|HEPH_ENST00000336279.5_Missense_Mutation_p.V611F|HEPH_ENST00000374727.3_Missense_Mutation_p.V881F			Q9BQS7	HEPH_HUMAN	hephaestin	878	Plastocyanin-like 5.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)	p.V878F(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CTCTGCTTGTGTTTCCTGGAT	0.483																																							uc011moz.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)|ovary(4)	9						c.(2641-2643)GTT>TTT		hephaestin isoform a							134.0	113.0	120.0					X																	65474945		2203	4300	6503	SO:0001583	missense	9843				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity	g.chrX:65474945G>T	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.2632G>T	X.37:g.65474945G>T	ENSP00000343939:p.Val878Phe					HEPH_uc004dwn.2_Missense_Mutation_p.V881F|HEPH_uc004dwo.2_Missense_Mutation_p.V611F|HEPH_uc010nkr.2_Missense_Mutation_p.V689F|HEPH_uc011mpa.1_Missense_Mutation_p.V881F|HEPH_uc010nks.2_Missense_Mutation_p.V170F	p.V881F	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN			16	2701	+			878			Extracellular (Potential).|Plastocyanin-like 5.		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37	c.2641G>T		.	.	.	.	.	.	.	.	.	.	G	15.10	2.732762	0.48939	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002	D;D;D;D;D;D	0.99098	-5.42;-5.42;-5.42;-5.42;-5.42;-5.42	4.54	3.59	0.41128	Cupredoxin (2);	0.125108	0.53938	D	0.000054	D	0.98216	0.9410	L	0.56199	1.76	0.32419	N	0.549609	P;P;D;D	0.71674	0.911;0.915;0.998;0.957	P;P;P;P	0.58331	0.536;0.821;0.837;0.641	D	0.97636	1.0145	10	0.66056	D	0.02	.	5.616	0.17432	0.1206:0.0:0.6791:0.2003	.	932;278;689;878	E9PHN8;B4DFV3;E7ES21;Q9BQS7	.;.;.;HEPH_HUMAN	F	932;881;611;881;689;878	ENSP00000430620:V932F;ENSP00000363859:V881F;ENSP00000337418:V611F;ENSP00000411687:V881F;ENSP00000413211:V689F;ENSP00000343939:V878F	ENSP00000337418:V611F	V	+	1	0	HEPH	65391670	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.055000	0.49916	2.083000	0.62718	0.600000	0.82982	GTT		0.483	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737		6	42	1	0	2.0095e-06	0.001984	2.71049e-06	6	42				
KIAA2022	340533	broad.mit.edu	37	X	73961404	73961404	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:73961404C>A	ENST00000055682.6	-	3	3599	c.2988G>T	c.(2986-2988)atG>atT	p.M996I		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	996					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.M996I(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						AGAGTGGGGCCATTGAATCAA	0.438																																							uc004eby.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(2986-2988)ATG>ATT		hypothetical protein LOC340533							72.0	62.0	65.0					X																	73961404		2203	4300	6503	SO:0001583	missense	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73961404C>A		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2988G>T	X.37:g.73961404C>A	ENSP00000055682:p.Met996Ile						p.M996I	NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN			3	3605	-			996					A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	c.2988G>T	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	C	9.964	1.223722	0.22457	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.28895	1.59;1.59	5.58	3.81	0.43845	.	0.258920	0.44688	N	0.000430	T	0.17874	0.0429	N	0.22421	0.69	0.30872	N	0.732315	B	0.02656	0.0	B	0.01281	0.0	T	0.13282	-1.0515	10	0.28530	T	0.3	-0.7462	6.5634	0.22499	0.1465:0.7029:0.0:0.1506	.	996	Q5QGS0	K2022_HUMAN	I	996	ENSP00000362567:M996I;ENSP00000055682:M996I	ENSP00000055682:M996I	M	-	3	0	KIAA2022	73878129	1.000000	0.71417	0.978000	0.43139	0.992000	0.81027	1.812000	0.38952	0.535000	0.28714	0.600000	0.82982	ATG		0.438	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		14	48	1	0	2.61681e-11	0.00245	4.46398e-11	14	48				
KIAA2022	340533	broad.mit.edu	37	X	73963752	73963752	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:73963752C>T	ENST00000055682.6	-	3	1251	c.640G>A	c.(640-642)Gca>Aca	p.A214T		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	214					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.A214T(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CTGTCTCCTGCCCTTGACTTA	0.448																																							uc004eby.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(640-642)GCA>ACA		hypothetical protein LOC340533							104.0	94.0	97.0					X																	73963752		2203	4300	6503	SO:0001583	missense	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73963752C>T		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.640G>A	X.37:g.73963752C>T	ENSP00000055682:p.Ala214Thr						p.A214T	NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN			3	1257	-			214					A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	c.640G>A	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	C	13.38	2.219799	0.39201	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.32272	1.46;1.46	5.97	5.97	0.96955	.	0.309885	0.34959	N	0.003552	T	0.33990	0.0882	L	0.40543	1.245	0.44409	D	0.997326	P	0.37370	0.592	B	0.40199	0.322	T	0.05419	-1.0886	10	0.54805	T	0.06	-1.5902	19.3296	0.94280	0.0:1.0:0.0:0.0	.	214	Q5QGS0	K2022_HUMAN	T	214	ENSP00000362567:A214T;ENSP00000055682:A214T	ENSP00000055682:A214T	A	-	1	0	KIAA2022	73880477	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	3.716000	0.54904	2.517000	0.84864	0.600000	0.82982	GCA		0.448	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		26	108	0	0	0	0.004656	0	26	108				
IL1RAPL2	26280	broad.mit.edu	37	X	104440260	104440260	+	Silent	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:104440260C>A	ENST00000372582.1	+	3	942	c.186C>A	c.(184-186)acC>acA	p.T62T	IL1RAPL2_ENST00000344799.4_Silent_p.T62T	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	62	Ig-like C2-type 1.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.T62T(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ATATTCGTACCAACTATAGCA	0.473																																							uc004elz.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)|ovary(1)	3						c.(184-186)ACC>ACA		interleukin 1 receptor accessory protein-like 2							139.0	111.0	121.0					X																	104440260		2203	4300	6503	SO:0001819	synonymous_variant	26280				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity	g.chrX:104440260C>A	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.186C>A	X.37:g.104440260C>A							p.T62T	NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN			3	942	+			62			Ig-like C2-type 1.|Extracellular (Potential).		Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	37	c.186C>A	CCDS14517.1																																																																																				0.473	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416		15	53	1	0	1.15088e-07	0.004007	1.68078e-07	15	53				
RGAG1	57529	broad.mit.edu	37	X	109697657	109697657	+	Missense_Mutation	SNP	G	G	T	rs34064910	byFrequency	TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:109697657G>T	ENST00000465301.2	+	3	4058	c.3812G>T	c.(3811-3813)cGg>cTg	p.R1271L	RGAG1_ENST00000540313.1_Missense_Mutation_p.R1271L	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1271								p.R1271L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GCCATTCTACGGACCAGGTTT	0.522																																							uc004eor.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(3811-3813)CGG>CTG		retrotransposon gag domain containing 1							124.0	121.0	122.0					X																	109697657		2203	4300	6503	SO:0001583	missense	57529							g.chrX:109697657G>T	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3812G>T	X.37:g.109697657G>T	ENSP00000419786:p.Arg1271Leu					RGAG1_uc011msr.1_Missense_Mutation_p.R1271L	p.R1271L	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN			3	4058	+			1271					Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	c.3812G>T	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978069	0.53720	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.50813	0.73;0.73	4.26	1.54	0.23209	.	0.206645	0.24578	N	0.037327	T	0.43456	0.1248	N	0.24115	0.695	0.29557	N	0.850939	D	0.63046	0.992	P	0.61592	0.891	T	0.33599	-0.9862	9	.	.	.	-1.443	5.6367	0.17540	0.361:0.0:0.639:0.0	.	1271	Q8NET4	RGAG1_HUMAN	L	1271;1271;832	ENSP00000419786:R1271L;ENSP00000441452:R1271L	.	R	+	2	0	RGAG1	109584313	0.992000	0.36948	0.994000	0.49952	0.991000	0.79684	0.084000	0.14891	0.190000	0.20209	0.600000	0.82982	CGG		0.522	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		31	137	1	0	8.88839e-20	0.010818	1.77768e-19	31	137				
IGSF1	3547	broad.mit.edu	37	X	130409975	130409975	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:130409975C>A	ENST00000361420.3	-	15	2935	c.2856G>T	c.(2854-2856)agG>agT	p.R952S	IGSF1_ENST00000467244.1_5'UTR|IGSF1_ENST00000370903.3_Missense_Mutation_p.R957S|IGSF1_ENST00000370910.1_Missense_Mutation_p.R943S|IGSF1_ENST00000370904.1_Missense_Mutation_p.R943S			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	952	Ig-like C2-type 9.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.R952S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GATATGACCCCCTGTTTGACA	0.512																																							uc004ewd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|central_nervous_system(1)	5						c.(2854-2856)AGG>AGT		immunoglobulin superfamily, member 1 isoform 1							91.0	70.0	77.0					X																	130409975		2203	4300	6503	SO:0001583	missense	3547				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding	g.chrX:130409975C>A	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.2856G>T	X.37:g.130409975C>A	ENSP00000355010:p.Arg952Ser					IGSF1_uc004ewe.3_Missense_Mutation_p.R946S|IGSF1_uc004ewf.2_Missense_Mutation_p.R932S	p.R952S	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN			15	3094	-			952			Extracellular (Potential).|Ig-like C2-type 9.		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	c.2856G>T	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	C	9.753	1.167961	0.21621	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.00695	5.83;5.83;5.83;5.83	5.2	1.3	0.21679	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.01454	0.0047	N	0.20483	0.58	0.24566	N	0.99395	P;D;D	0.89917	0.724;1.0;0.994	B;D;D	0.91635	0.334;0.999;0.985	T	0.57106	-0.7868	9	0.31617	T	0.26	.	6.6793	0.23111	0.0:0.5582:0.0:0.4418	.	943;396;952	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	S	943;952;943;957	ENSP00000359947:R943S;ENSP00000355010:R952S;ENSP00000359941:R943S;ENSP00000359940:R957S	ENSP00000355010:R952S	R	-	3	2	IGSF1	130237656	0.834000	0.29399	0.991000	0.47740	0.238000	0.25445	-0.048000	0.11944	0.133000	0.18654	-0.208000	0.12717	AGG		0.512	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			11	53	1	0	3.86212e-05	0.008291	4.80988e-05	11	53				
MAGEC3	139081	broad.mit.edu	37	X	140926218	140926218	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:140926218G>T	ENST00000298296.1	+	1	117	c.117G>T	c.(115-117)caG>caT	p.Q39H		NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	39								p.Q39H(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					TCCCACCTCAGCCCCAGGTGT	0.537																																							uc011mwp.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(115-117)CAG>CAT		melanoma antigen family C, 3 isoform 1							123.0	99.0	107.0					X																	140926218		2203	4300	6503	SO:0001583	missense	139081							g.chrX:140926218G>T	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.117G>T	X.37:g.140926218G>T	ENSP00000298296:p.Gln39His						p.Q39H	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN			1	117	+	Acute lymphoblastic leukemia(192;6.56e-05)		39					Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	c.117G>T	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	G	5.156	0.214453	0.09810	.	.	ENSG00000165509	ENST00000298296	T	0.10288	2.89	0.427	0.427	0.16489	.	.	.	.	.	T	0.09905	0.0243	N	0.08118	0	0.09310	N	1	P	0.51240	0.943	P	0.55667	0.781	T	0.29852	-0.9998	8	0.87932	D	0	.	.	.	.	.	39	Q8TD91	MAGC3_HUMAN	H	39	ENSP00000298296:Q39H	ENSP00000298296:Q39H	Q	+	3	2	MAGEC3	140753884	0.084000	0.21492	0.012000	0.15200	0.013000	0.08279	0.364000	0.20325	0.417000	0.25871	0.422000	0.28245	CAG		0.537	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702		25	93	1	0	1.26454e-06	0.005443	1.74627e-06	25	93				
KIF5A	3798	broad.mit.edu	37	12	57963420	57963420	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr12:57963420delG	ENST00000455537.2	+	11	1345	c.1071delG	c.(1069-1071)aagfs	p.K357fs	KIF5A_ENST00000286452.5_Frame_Shift_Del_p.K268fs	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	357					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						aggcccagaaggagaCGATTG	0.512																																							uc001sor.1		NA																	0				ovary(2)|skin(1)	3						c.(1069-1071)AAGfs		kinesin family member 5A							49.0	53.0	52.0					12																	57963420		2203	4300	6503	SO:0001589	frameshift_variant	3798				blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity	g.chr12:57963420delG	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1071delG	12.37:g.57963420delG	ENSP00000408979:p.Lys357fs					KIF5A_uc010srr.1_Frame_Shift_Del_p.K268fs	p.K357fs	NM_004984	NP_004975	Q12840	KIF5A_HUMAN			11	1279	+			357					A6H8M5|Q4LE26	Frame_Shift_Del	DEL	ENST00000455537.2	37	c.1071delG	CCDS8945.1																																																																																				0.512	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984		11	58	NA	NA	NA	NA	NA	11	58	---	---	---	---
NDN	4692	broad.mit.edu	37	15	23932034	23932034	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr15:23932034delC	ENST00000331837.4	-	1	416	c.331delG	c.(331-333)gtcfs	p.V111fs		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	111	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		TGGTCCTTGACCAGCACGTAC	0.652									Prader-Willi syndrome																														uc001ywk.2		NA																	0					0						c.(331-333)GTCfs		necdin							82.0	75.0	77.0					15																	23932034		2203	4300	6503	SO:0001589	frameshift_variant	4692	Prader-Willsyndrome	Familial Cancer Database	Prader-Labhart-Willi syndrome	negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding	g.chr15:23932034delC	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.331delG	15.37:g.23932034delC	ENSP00000332643:p.Val111fs						p.V111fs	NM_002487	NP_002478	Q99608	NECD_HUMAN		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)	1	417	-		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)	111			MAGE.		B2R6Z5	Frame_Shift_Del	DEL	ENST00000331837.4	37	c.331delG	CCDS10014.1																																																																																				0.652	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487		10	49	NA	NA	NA	NA	NA	10	49	---	---	---	---
PLD2	5338	broad.mit.edu	37	17	4713016	4713016	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr17:4713016delC	ENST00000263088.6	+	8	776	c.645delC	c.(643-645)ggcfs	p.G215fs	PLD2_ENST00000572940.1_Frame_Shift_Del_p.G215fs|RP11-81A22.5_ENST00000571067.1_lincRNA	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	215	PH.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	GCTCAGGTGGCCACCGTGTTC	0.637																																							uc002fzc.2		NA																	0				breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5						c.(643-645)GGCfs		phospholipase D2	Choline(DB00122)						116.0	117.0	116.0					17																	4713016		2203	4300	6503	SO:0001589	frameshift_variant	5338				cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity	g.chr17:4713016delC	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.645delC	17.37:g.4713016delC	ENSP00000263088:p.Gly215fs					PLD2_uc010vsj.1_Frame_Shift_Del_p.G72fs|PLD2_uc002fzd.2_Frame_Shift_Del_p.G215fs	p.G215fs	NM_002663	NP_002654	O14939	PLD2_HUMAN			8	746	+			215			PH.		I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Frame_Shift_Del	DEL	ENST00000263088.6	37	c.645delC	CCDS11057.1																																																																																				0.637	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663		30	129	NA	NA	NA	NA	NA	30	129	---	---	---	---
WDR19	57728	broad.mit.edu	37	4	39247011	39247011	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr4:39247011delC	ENST00000399820.3	+	24	2822	c.2668delC	c.(2668-2670)cccfs	p.P890fs	WDR19_ENST00000288634.7_Frame_Shift_Del_p.P730fs	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	890					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						TGATCTTCTGCCCCACGTTTC	0.413																																							uc003gtv.2		NA																	0				large_intestine(1)	1						c.(2668-2670)CCCfs		WD repeat domain 19							81.0	81.0	81.0					4																	39247011		1879	4113	5992	SO:0001589	frameshift_variant	57728				cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding	g.chr4:39247011delC	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.2668delC	4.37:g.39247011delC	ENSP00000382717:p.Pro890fs					WDR19_uc011byi.1_Frame_Shift_Del_p.P730fs|WDR19_uc003gtw.1_Frame_Shift_Del_p.P487fs	p.P890fs	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN			24	2822	+			890					B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Frame_Shift_Del	DEL	ENST00000399820.3	37	c.2668delC	CCDS47042.1																																																																																				0.413	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1			7	24	NA	NA	NA	NA	NA	7	24	---	---	---	---
CDH9	1007	broad.mit.edu	37	5	26902602	26902602	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr5:26902602delG	ENST00000231021.4	-	7	1408	c.1236delC	c.(1234-1236)gccfs	p.A412fs		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	412	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AATTGTTCCTGGCATCTGGAT	0.333																																					Melanoma(8;187 585 15745 40864 52829)	Melanoma(8;187 585 15745 40864 52829)	uc003jgs.1		NA																	0				ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						c.(1234-1236)GCCfs		cadherin 9, type 2 preproprotein							86.0	81.0	83.0					5																	26902602		2203	4299	6502	SO:0001589	frameshift_variant	1007				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:26902602delG	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1236delC	5.37:g.26902602delG	ENSP00000231021:p.Ala412fs						p.A412fs	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN			7	1405	-			412			Extracellular (Potential).|Cadherin 4.		Q3B7I5	Frame_Shift_Del	DEL	ENST00000231021.4	37	c.1236delC	CCDS3893.1																																																																																				0.333	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		21	75	NA	NA	NA	NA	NA	21	75	---	---	---	---
BAI3	577	broad.mit.edu	37	6	69666012	69666012	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:69666012delC	ENST00000370598.1	+	7	2113	c.1292delC	c.(1291-1293)gccfs	p.A431fs		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	431	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ACTGCAGCTGCCCATGGAGGC	0.552																																							uc003pev.3		NA																	0				lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(1291-1293)GCCfs		brain-specific angiogenesis inhibitor 3							72.0	65.0	67.0					6																	69666012		2203	4300	6503	SO:0001589	frameshift_variant	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69666012delC	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1292delC	6.37:g.69666012delC	ENSP00000359630:p.Ala431fs					BAI3_uc010kak.2_Frame_Shift_Del_p.A431fs	p.A431fs	NM_001704	NP_001695	O60242	BAI3_HUMAN			7	1740	+		all_lung(197;0.212)	431			TSP type-1 3.|Extracellular (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Frame_Shift_Del	DEL	ENST00000370598.1	37	c.1292delC	CCDS4968.1																																																																																				0.552	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			7	28	NA	NA	NA	NA	NA	7	28	---	---	---	---
AK9	221264	broad.mit.edu	37	6	109814724	109814726	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	TCT	TCT	-	-	TCT	TCT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chr6:109814724_109814726delTCT	ENST00000424296.2	-	41	5658_5660	c.5582_5584delAGA	c.(5581-5586)aagatg>atg	p.K1861del	RP5-919F19.5_ENST00000423747.2_RNA	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1861					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										AACTGCTCCATCTTCTTCTTATA	0.369																																							uc003ptn.2		NA																	0				ovary(1)	1						c.(5581-5586)AAGATG>ATG		adenylate kinase domain containing 1 isoform 1																																				SO:0001651	inframe_deletion	221264				nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity	g.chr6:109814724_109814726delTCT	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.5582_5584delAGA	6.37:g.109814730_109814732delTCT	ENSP00000410186:p.Lys1861del					AKD1_uc011eas.1_In_Frame_Del_p.K246del	p.K1861del	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN			41	5659_5661	-			1861					A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	In_Frame_Del	DEL	ENST00000424296.2	37	c.5582_5584delAGA	CCDS55048.1																																																																																				0.369	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001145128		44	136	NA	NA	NA	NA	NA	44	136	---	---	---	---
FAM47C	442444	broad.mit.edu	37	X	37026894	37026894	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:37026894delG	ENST00000358047.3	+	1	463	c.411delG	c.(409-411)ctgfs	p.L137fs		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	137										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						ACCCCAATCTGGGAGAAGATA	0.567																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(409-411)CTGfs		hypothetical protein LOC442444							93.0	81.0	85.0					X																	37026894		2202	4300	6502	SO:0001589	frameshift_variant	442444							g.chrX:37026894delG	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.411delG	X.37:g.37026894delG	ENSP00000367913:p.Leu137fs						p.L137fs	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	425	+			137					Q6ZU46	Frame_Shift_Del	DEL	ENST00000358047.3	37	c.411delG	CCDS35227.1																																																																																				0.567	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		16	69	NA	NA	NA	NA	NA	16	69	---	---	---	---
PASD1	139135	broad.mit.edu	37	X	150817142	150817144	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-44-6145-01A-11D-1753-08	TCGA-44-6145-10A-01D-1753-08	GCT	GCT	-	-	GCT	GCT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	220dc947-4afc-4485-bcc7-cea046100b4b	47ac71a9-20e1-43a4-b77c-c3d45a7df4d6	g.chrX:150817142_150817144delGCT	ENST00000370357.4	+	9	930_932	c.685_687delGCT	c.(685-687)gctdel	p.A236del		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	236	Poly-Ala.					nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.A229A(2)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CGTTGAACCCgctgctgctgctg	0.433																																							uc004fev.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(685-687)GCTdel		PAS domain containing 1																																				SO:0001651	inframe_deletion	139135					nucleus	signal transducer activity	g.chrX:150817142_150817144delGCT	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.685_687delGCT	X.37:g.150817151_150817153delGCT	ENSP00000359382:p.Ala236del						p.A236del	NM_173493	NP_775764	Q8IV76	PASD1_HUMAN			9	1017_1019	+	Acute lymphoblastic leukemia(192;6.56e-05)		236			Poly-Ala.		Q3MNE0|Q69HD7|Q8N7X9	In_Frame_Del	DEL	ENST00000370357.4	37	c.685_687delGCT	CCDS35431.1																																																																																				0.433	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493		7	183	NA	NA	NA	NA	NA	7	183	---	---	---	---
