#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MMEL1	79258	broad.mit.edu	37	1	2537763	2537763	+	Nonsense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:2537763G>C	ENST00000378412.3	-	8	835	c.674C>G	c.(673-675)tCa>tGa	p.S225*	MMEL1_ENST00000502556.1_Intron|MMEL1_ENST00000288709.6_Nonsense_Mutation_p.S216*			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	225						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S216*(1)		cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		GTTGAACTGTGAGTTCATCAG	0.672																																							uc001ajy.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(673-675)TCA>TGA		membrane metallo-endopeptidase-like 1							46.0	43.0	44.0					1																	2537763		2203	4300	6503	SO:0001587	stop_gained	79258				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity	g.chr1:2537763G>C	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.674C>G	1.37:g.2537763G>C	ENSP00000367668:p.Ser225*					MMEL1_uc009vlg.1_RNA	p.S225*	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)	8	888	-	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)	225			Lumenal (Potential).		B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Nonsense_Mutation	SNP	ENST00000378412.3	37	c.674C>G	CCDS30569.2	.	.	.	.	.	.	.	.	.	.	g	16.77	3.215708	0.58452	.	.	ENSG00000142606	ENST00000288709;ENST00000378412	.	.	.	4.76	2.77	0.32553	.	0.887941	0.10083	N	0.718172	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-0.0506	9.0715	0.36495	0.0:0.3051:0.5374:0.1575	.	.	.	.	X	216;225	.	ENSP00000288709:S216X	S	-	2	0	MMEL1	2527623	0.142000	0.22610	0.012000	0.15200	0.804000	0.45430	2.645000	0.46621	0.368000	0.24481	0.643000	0.83706	TCA		0.672	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467		3	29	0	0	0	0.004672	0	3	29				
H6PD	9563	broad.mit.edu	37	1	9323676	9323676	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:9323676A>T	ENST00000377403.2	+	5	1426	c.1124A>T	c.(1123-1125)aAc>aTc	p.N375I	H6PD_ENST00000602477.1_Missense_Mutation_p.N386I	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	375	Glucose 1-dehydrogenase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)	p.N375I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		TTGTTCAAGAACCAGGCCTGC	0.622																																							uc001apt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1123-1125)AAC>ATC		hexose-6-phosphate dehydrogenase precursor	NADH(DB00157)						75.0	79.0	78.0					1																	9323676		2203	4300	6503	SO:0001583	missense	9563					endoplasmic reticulum lumen	6-phosphogluconolactonase activity|glucose 1-dehydrogenase|glucose-6-phosphate dehydrogenase activity|NADP binding	g.chr1:9323676A>T	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.1124A>T	1.37:g.9323676A>T	ENSP00000366620:p.Asn375Ile						p.N375I	NM_004285	NP_004276	O95479	G6PE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)	5	1397	+	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	375			Glucose 1-dehydrogenase.		Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	ENST00000377403.2	37	c.1124A>T	CCDS101.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.030616	0.54790	.	.	ENSG00000049239	ENST00000377403	D	0.98474	-4.95	5.56	5.56	0.83823	Glucose-6-phosphate dehydrogenase, C-terminal (1);	0.171617	0.64402	D	0.000006	D	0.98529	0.9509	M	0.86740	2.835	0.48341	D	0.999631	P	0.43633	0.813	P	0.50270	0.636	D	0.99360	1.0917	10	0.72032	D	0.01	-50.1966	14.8994	0.70666	1.0:0.0:0.0:0.0	.	375	O95479	G6PE_HUMAN	I	375	ENSP00000366620:N375I	ENSP00000366620:N375I	N	+	2	0	H6PD	9246263	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	5.876000	0.69667	2.114000	0.64651	0.454000	0.30748	AAC		0.622	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285		17	46	0	0	0	0.004007	0	17	46				
CASZ1	54897	broad.mit.edu	37	1	10703261	10703261	+	Missense_Mutation	SNP	G	G	A	rs199630871		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:10703261G>A	ENST00000377022.3	-	19	4293	c.3976C>T	c.(3976-3978)Cgg>Tgg	p.R1326W	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1326					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R1326W(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		AGCATCCTCCGCATGTGCTTC	0.647																																							uc001aro.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(3976-3978)CGG>TGG		castor homolog 1, zinc finger isoform a							57.0	65.0	62.0					1																	10703261		2083	4210	6293	SO:0001583	missense	54897				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr1:10703261G>A	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3976C>T	1.37:g.10703261G>A	ENSP00000366221:p.Arg1326Trp						p.R1326W	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)	19	4296	-	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	1326					Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	c.3976C>T	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284484	0.80803	.	.	ENSG00000130940	ENST00000377022	.	.	.	4.94	4.94	0.65067	.	0.000000	0.43416	U	0.000575	T	0.75280	0.3828	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77807	-0.2450	9	0.87932	D	0	-13.3109	12.4746	0.55805	0.0:0.0:0.7168:0.2832	.	1326	Q86V15	CASZ1_HUMAN	W	1326	.	ENSP00000366221:R1326W	R	-	1	2	CASZ1	10625848	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.118000	0.50414	2.279000	0.76181	0.561000	0.74099	CGG		0.647	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766		12	43	0	0	0	0.016723	0	12	43				
PRAMEF1	65121	broad.mit.edu	37	1	12854181	12854181	+	Silent	SNP	A	A	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:12854181A>G	ENST00000332296.7	+	3	508	c.405A>G	c.(403-405)gcA>gcG	p.A135A	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	135					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.A135A(2)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGCAGACAGCAGAGGACTGTC	0.547																																							uc001auj.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(403-405)GCA>GCG		PRAME family member 1							135.0	149.0	144.0					1																	12854181		2203	4299	6502	SO:0001819	synonymous_variant	65121							g.chr1:12854181A>G	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.405A>G	1.37:g.12854181A>G							p.A135A	NM_023013	NP_075389	O95521	PRAM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	3	508	+	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)	135					Q9UQP2	Silent	SNP	ENST00000332296.7	37	c.405A>G	CCDS148.1																																																																																				0.547	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013		38	165	0	0	0	0.006999	0	38	165				
Unknown	0	broad.mit.edu	37	1	13183250	13183250	+	IGR	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:13183250T>C								RP13-221M14.3 (18782 upstream) : PRAMEF26 (33105 downstream)																							TTGTTTGCTCTGTTCCTTTTC	0.428																																							uc010obg.1		NA																	0					0						c.(622-624)CAG>CGG		heterogeneous nuclear ribonucleoprotein C-like							69.0	52.0	57.0					1																	13183250		692	1578	2270	SO:0001628	intergenic_variant	440563					ribonucleoprotein complex	nucleic acid binding|nucleotide binding	g.chr1:13183250T>C																													1.37:g.13183250T>C							p.Q208R	NM_001136561	NP_001130033	B2RXH8	B2RXH8_HUMAN			1	718	-			208						Missense_Mutation	SNP		37	c.623A>G																																																																																				0	0.428									9	244	0	0	0	0.006214	0	9	244				
HTR1D	3352	broad.mit.edu	37	1	23520467	23520467	+	Silent	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:23520467G>T	ENST00000374619.1	-	1	755	c.246C>A	c.(244-246)acC>acA	p.T82T	HTR1D_ENST00000314113.3_Silent_p.T82T	NM_000864.4	NP_000855.1	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled	82					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intestine smooth muscle contraction (GO:0014827)|regulation of behavior (GO:0050795)|regulation of locomotion (GO:0040012)|response to toxic substance (GO:0009636)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.T82T(1)		NS(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Naratriptan(DB00952)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	AGAGGTCGGTGGTGGCCAGGG	0.537																																							uc001bgn.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(244-246)ACC>ACA		5-hydroxytryptamine (serotonin) receptor 1D	Almotriptan(DB00918)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Tegaserod(DB01079)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)						242.0	222.0	228.0					1																	23520467		2203	4300	6503	SO:0001819	synonymous_variant	3352				G-protein signaling, coupled to cyclic nucleotide second messenger|intestine smooth muscle contraction|synaptic transmission	integral to plasma membrane	serotonin receptor activity	g.chr1:23520467G>T	M89955	CCDS231.1	1p36.3-p34.3	2012-08-08	2012-02-03		ENSG00000179546	ENSG00000179546		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5289	protein-coding gene	gene with protein product		182133	"""5-hydroxytryptamine (serotonin) receptor 1D"""	HTRL		2541503, 1662665	Standard	NM_000864		Approved	RDC4, HT1DA, 5-HT1D	uc001bgn.3	P28221	OTTHUMG00000003235	ENST00000374619.1:c.246C>A	1.37:g.23520467G>T							p.T82T	NM_000864	NP_000855	P28221	5HT1D_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	1	756	-		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)	82			Helical; Name=2; (By similarity).			Silent	SNP	ENST00000374619.1	37	c.246C>A	CCDS231.1																																																																																				0.537	HTR1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008924.1	NM_000864		17	87	1	0	1.01871e-10	0.008871	1.4553e-10	17	87				
IFNLR1	163702	broad.mit.edu	37	1	24484070	24484070	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:24484070C>A	ENST00000327535.1	-	7	1125	c.1113G>T	c.(1111-1113)agG>agT	p.R371S	IFNLR1_ENST00000327575.2_3'UTR|IFNLR1_ENST00000374421.3_Missense_Mutation_p.R342S	NM_170743.3|NM_173064.2	NP_734464.1|NP_775087.1	Q8IU57	INLR1_HUMAN	interferon, lambda receptor 1	371					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mucosal immune response (GO:0002385)|negative regulation of cell proliferation (GO:0008285)|regulation of defense response to virus by host (GO:0050691)|response to type III interferon (GO:0034342)	integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)		p.R371S(1)									CCAGAGGAGCCCTGGGCCTCC	0.627																																							uc001bis.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1111-1113)AGG>AGT		interleukin 28 receptor, alpha isoform 1							44.0	46.0	45.0					1																	24484070		2203	4300	6503	SO:0001583	missense	163702				cytokine-mediated signaling pathway|negative regulation of cell proliferation|regulation of defense response to virus by host	interleukin-28 receptor complex	protein binding|receptor activity	g.chr1:24484070C>A	AY129153	CCDS248.1, CCDS249.1, CCDS250.1	1p36.11	2012-11-27	2012-11-26	2012-11-26	ENSG00000185436	ENSG00000185436		"""Interferons"""	18584	protein-coding gene	gene with protein product	"""interferon lambda receptor 1"""	607404	"""interleukin 28 receptor, alpha"", ""interleukin 28 receptor, alpha (interferon, lambda receptor)"""	IL28RA			Standard	NM_173064		Approved	CRF2/12, IFNLR, IL-28R1	uc001bis.3	Q8IU57	OTTHUMG00000003036	ENST00000327535.1:c.1113G>T	1.37:g.24484070C>A	ENSP00000327824:p.Arg371Ser					IL28RA_uc001bir.2_Missense_Mutation_p.R342S|IL28RA_uc001bit.2_3'UTR|IL28RA_uc001biu.2_Missense_Mutation_p.R287S	p.R371S	NM_170743	NP_734464	Q8IU57	I28RA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.21e-24)|Colorectal(126;6.61e-08)|COAD - Colon adenocarcinoma(152;3.56e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00918)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.185)	7	1126	-		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00117)|all_lung(284;0.00151)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	371			Cytoplasmic (Potential).		Q5VTX5|Q5VTX7|Q5VTX8|Q6ZML8|Q8IV66|Q8IZI7|Q8IZI8	Missense_Mutation	SNP	ENST00000327535.1	37	c.1113G>T	CCDS248.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.210425	0.39003	.	.	ENSG00000185436	ENST00000327535;ENST00000374421	.	.	.	5.14	2.07	0.26955	.	4.923680	0.00166	N	0.000000	T	0.39200	0.1069	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.30592	-0.9973	9	0.20519	T	0.43	3.1388	13.3256	0.60457	0.0:0.4903:0.5097:0.0	.	371;342	Q8IU57;Q8IU57-2	I28RA_HUMAN;.	S	371;342	.	ENSP00000327824:R371S	R	-	3	2	IL28RA	24356657	0.000000	0.05858	0.000000	0.03702	0.667000	0.39255	0.147000	0.16202	0.206000	0.20587	0.655000	0.94253	AGG		0.627	IFNLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008402.1	NM_170743		8	33	1	0	7.48243e-07	0.006214	9.43437e-07	8	33				
ARID1A	8289	broad.mit.edu	37	1	27105723	27105723	+	Silent	SNP	A	A	G	rs375160070		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:27105723A>G	ENST00000324856.7	+	20	5705	c.5334A>G	c.(5332-5334)gaA>gaG	p.E1778E	ARID1A_ENST00000374152.2_Silent_p.E1395E|ARID1A_ENST00000457599.2_Silent_p.E1561E|ARID1A_ENST00000540690.1_Silent_p.E106E	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1778					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.E1778E(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGGAAGAAGAAGAGGAAGTAG	0.468			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		1	Substitution - coding silent(1)		lung(1)	ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(5332-5334)GAA>GAG		AT rich interactive domain 1A isoform a		A	,	1,4405		0,1,2202	64.0	62.0	63.0		5334,4683	-7.8	0.5	1		63	2,8598		0,2,4298	no	coding-synonymous,coding-synonymous	ARID1A	NM_006015.4,NM_139135.2	,	0,3,6500	GG,GA,AA		0.0233,0.0227,0.0231	,	1778/2286,1561/2069	27105723	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27105723A>G	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5334A>G	1.37:g.27105723A>G						ARID1A_uc001bmu.1_Silent_p.E1561E|ARID1A_uc001bmx.1_Silent_p.E624E|ARID1A_uc009vsm.1_Silent_p.E106E|ARID1A_uc009vsn.1_Silent_p.E20E	p.E1778E	NM_006015	NP_006006	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	20	5707	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	1778					D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	ENST00000324856.7	37	c.5334A>G	CCDS285.1	.	.	.	.	.	.	.	.	.	.	A	2.552	-0.303857	0.05495	2.27E-4	2.33E-4	ENSG00000117713	ENST00000430799	.	.	.	5.06	-7.79	0.01218	.	.	.	.	.	T	0.63581	0.2523	.	.	.	0.46149	D	0.998899	.	.	.	.	.	.	T	0.69000	-0.5261	4	.	.	.	-10.3166	17.0889	0.86617	0.0964:0.0:0.8211:0.0825	.	.	.	.	G	675	.	.	R	+	1	2	ARID1A	26978310	0.113000	0.22115	0.475000	0.27278	0.770000	0.43624	-0.362000	0.07602	-1.542000	0.01725	0.482000	0.46254	AGA		0.468	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		6	58	0	0	0	0.001984	0	6	58				
ARID1A	8289	broad.mit.edu	37	1	27106483	27106483	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:27106483G>A	ENST00000324856.7	+	20	6465	c.6094G>A	c.(6094-6096)Gaa>Aaa	p.E2032K	ARID1A_ENST00000374152.2_Missense_Mutation_p.E1649K|ARID1A_ENST00000457599.2_Missense_Mutation_p.E1815K|ARID1A_ENST00000540690.1_Missense_Mutation_p.E360K	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2032					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.E2032K(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ACTAACTTATGAAAAGGAGGA	0.552			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		1	Substitution - Missense(1)		lung(1)	ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(6094-6096)GAA>AAA		AT rich interactive domain 1A isoform a							134.0	128.0	130.0					1																	27106483		2203	4300	6503	SO:0001583	missense	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27106483G>A	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6094G>A	1.37:g.27106483G>A	ENSP00000320485:p.Glu2032Lys					ARID1A_uc001bmu.1_Missense_Mutation_p.E1815K|ARID1A_uc001bmx.1_Missense_Mutation_p.E878K|ARID1A_uc009vsm.1_Missense_Mutation_p.E360K|ARID1A_uc009vsn.1_Missense_Mutation_p.E274K	p.E2032K	NM_006015	NP_006006	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	20	6467	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	2032					D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	c.6094G>A	CCDS285.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250747	0.80135	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.0	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.51890	0.1701	M	0.63428	1.95	0.51233	D	0.999916	D;D;D	0.76494	0.999;0.998;0.961	D;D;P	0.74023	0.981;0.982;0.689	T	0.57112	-0.7867	10	0.72032	D	0.01	-3.657	14.9119	0.70764	0.0:0.0:0.8478:0.1522	.	1649;2032;1815	O14497-3;O14497;O14497-2	.;ARI1A_HUMAN;.	K	2032;1815;1649;360	ENSP00000320485:E2032K;ENSP00000387636:E1815K;ENSP00000363267:E1649K;ENSP00000442437:E360K	ENSP00000320485:E2032K	E	+	1	0	ARID1A	26979070	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.020000	0.93667	1.432000	0.47375	0.591000	0.81541	GAA		0.552	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		4	48	0	0	0	0.009096	0	4	48				
ARID1A	8289	broad.mit.edu	37	1	27106495	27106495	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:27106495G>T	ENST00000324856.7	+	20	6477	c.6106G>T	c.(6106-6108)Gaa>Taa	p.E2036*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.E1653*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.E1819*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.E364*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2036					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.E2036*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AAAGGAGGAGGAACAGGACCA	0.562			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		1	Substitution - Nonsense(1)		lung(1)	ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(6106-6108)GAA>TAA		AT rich interactive domain 1A isoform a							146.0	141.0	143.0					1																	27106495		2203	4300	6503	SO:0001587	stop_gained	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27106495G>T	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6106G>T	1.37:g.27106495G>T	ENSP00000320485:p.Glu2036*					ARID1A_uc001bmu.1_Nonsense_Mutation_p.E1819*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.E882*|ARID1A_uc009vsm.1_Nonsense_Mutation_p.E364*|ARID1A_uc009vsn.1_Nonsense_Mutation_p.E278*	p.E2036*	NM_006015	NP_006006	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	20	6479	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	2036					D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	c.6106G>T	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	44|44	10.692445|10.692445	0.99451|0.99451	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|.	.|.	.|.	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	0.050157|.	0.85682|.	D|.	0.000000|.	.|T	.|0.74673	.|0.3747	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73036	.|-0.4109	.|4	0.41790|.	T|.	0.15|.	-5.7923|-5.7923	18.8481|18.8481	0.92215|0.92215	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|V	2036;1819;1653;364|932	.|.	ENSP00000320485:E2036X|.	E|G	+|+	1|2	0|0	ARID1A|ARID1A	26979082|26979082	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.020000|9.020000	0.93667|0.93667	2.762000|2.762000	0.94881|0.94881	0.591000|0.591000	0.81541|0.81541	GAA|GGA		0.562	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		4	52	1	0	0.00024832	0.009096	0.000283515	4	52				
COL16A1	1307	broad.mit.edu	37	1	32145269	32145269	+	Silent	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:32145269G>T	ENST00000373672.3	-	42	3252	c.2736C>A	c.(2734-2736)ccC>ccA	p.P912P	COL16A1_ENST00000373668.3_Silent_p.P896P|COL16A1_ENST00000271069.6_Silent_p.P911P	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	912	Collagen-like 5.|Triple-helical region 4 (COL4) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.P912P(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTGGTGGTCCGGGAATACCTG	0.617																																					Colon(143;498 1786 21362 25193 36625)	Colon(143;498 1786 21362 25193 36625)	uc001btk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)	8						c.(2734-2736)CCC>CCA		alpha 1 type XVI collagen precursor							87.0	98.0	95.0					1																	32145269		1965	4157	6122	SO:0001819	synonymous_variant	1307				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity	g.chr1:32145269G>T	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2736C>A	1.37:g.32145269G>T						COL16A1_uc001btj.1_Silent_p.P725P|COL16A1_uc001btl.3_Silent_p.P896P	p.P912P	NM_001856	NP_001847	Q07092	COGA1_HUMAN		STAD - Stomach adenocarcinoma(196;0.059)	42	3101	-		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)	912			Triple-helical region 4 (COL4) with 2 imperfections.		Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	37	c.2736C>A	CCDS41297.1																																																																																				0.617	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856		7	116	1	0	5.18039e-06	0.00308	6.39282e-06	7	116				
CSMD2	114784	broad.mit.edu	37	1	34209109	34209109	+	Silent	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:34209109G>A	ENST00000373381.4	-	14	2121	c.1945C>T	c.(1945-1947)Ctg>Ttg	p.L649L		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	609	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L609L(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGCCTGGCCAGGATGAGCCAG	0.587																																							uc001bxn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(1825-1827)CTG>TTG		CUB and Sushi multiple domains 2							78.0	79.0	79.0					1																	34209109		2203	4300	6503	SO:0001819	synonymous_variant	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34209109G>A	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1945C>T	1.37:g.34209109G>A						CSMD2_uc001bxm.1_Silent_p.L649L	p.L609L	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN			14	1854	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	609			Extracellular (Potential).|CUB 4.		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37	c.1825C>T																																																																																					0.587	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		13	52	0	0	0	0.016723	0	13	52				
GADD45A	1647	broad.mit.edu	37	1	68153432	68153432	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:68153432C>T	ENST00000370986.4	+	4	907	c.473C>T	c.(472-474)cCa>cTa	p.P158L	GADD45A_ENST00000370985.3_Missense_Mutation_p.P124L	NM_001924.3	NP_001915.1	P24522	GA45A_HUMAN	growth arrest and DNA-damage-inducible, alpha	158					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|signal transduction in response to DNA damage (GO:0042770)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter binding (GO:0001047)	p.P158L(1)		lung(2)|ovary(2)	4						CAATGGGTTCCAGTGATTAAT	0.388																																							uc001ddz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(472-474)CCA>CTA		growth arrest and DNA-damage-inducible, alpha							98.0	90.0	93.0					1																	68153432		2203	4300	6503	SO:0001583	missense	1647				apoptosis|cell cycle arrest|cellular response to ionizing radiation|cellular response to mechanical stimulus|DNA repair|positive regulation of reactive oxygen species metabolic process|regulation of cyclin-dependent protein kinase activity|signal transduction in response to DNA damage	nucleus	protein binding	g.chr1:68153432C>T	M60974	CCDS640.1, CCDS55605.1, CCDS72806.1	1p31.2	2010-08-27			ENSG00000116717	ENSG00000116717			4095	protein-coding gene	gene with protein product		126335		DDIT1		1990262, 8226988	Standard	NM_001924		Approved	GADD45	uc001ddz.2	P24522	OTTHUMG00000009374	ENST00000370986.4:c.473C>T	1.37:g.68153432C>T	ENSP00000360025:p.Pro158Leu					GADD45A_uc009wbb.1_Missense_Mutation_p.P124L|GADD45A_uc009wbc.1_RNA|GADD45A_uc009wbd.1_RNA	p.P158L	NM_001924	NP_001915	P24522	GA45A_HUMAN			4	768	+			158					Q5TCA7|Q5TCA8	Missense_Mutation	SNP	ENST00000370986.4	37	c.473C>T	CCDS640.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.575575	0.86645	.	.	ENSG00000116717	ENST00000370986;ENST00000370985	T;T	0.70516	-0.49;-0.3	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.84620	0.5512	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.86469	0.1784	10	0.87932	D	0	-0.7094	19.0613	0.93095	0.0:1.0:0.0:0.0	.	124;158	Q5TCA7;P24522	.;GA45A_HUMAN	L	158;124	ENSP00000360025:P158L;ENSP00000360024:P124L	ENSP00000360024:P124L	P	+	2	0	GADD45A	67926020	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.386000	0.79775	2.675000	0.91044	0.650000	0.86243	CCA		0.388	GADD45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025988.2	NM_001924		8	77	0	0	0	0.00308	0	8	77				
MSH4	4438	broad.mit.edu	37	1	76345780	76345780	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:76345780A>G	ENST00000263187.3	+	13	1827	c.1723A>G	c.(1723-1725)Att>Gtt	p.I575V		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	575					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.I575V(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						AGCAGATTTAATTAAAATGAA	0.274								Mismatch excision repair (MMR)																															uc001dhd.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(2)	5						c.(1723-1725)ATT>GTT	MMR	mutS homolog 4							51.0	51.0	51.0					1																	76345780		2196	4260	6456	SO:0001583	missense	4438				chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding	g.chr1:76345780A>G	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.1723A>G	1.37:g.76345780A>G	ENSP00000263187:p.Ile575Val						p.I575V	NM_002440	NP_002431	O15457	MSH4_HUMAN			13	1764	+			575					Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	ENST00000263187.3	37	c.1723A>G	CCDS670.1	.	.	.	.	.	.	.	.	.	.	A	6.807	0.517942	0.13005	.	.	ENSG00000057468	ENST00000263187	D	0.89485	-2.52	5.51	4.36	0.52297	DNA mismatch repair protein MutS, clamp (1);DNA mismatch repair protein MutS, core (3);	0.189831	0.49916	D	0.000128	T	0.55816	0.1944	N	0.08118	0	0.34203	D	0.673409	B	0.20368	0.044	B	0.26310	0.068	T	0.38908	-0.9639	10	0.06494	T	0.89	-31.8859	7.8452	0.29421	0.7187:0.1439:0.0:0.1374	.	575	O15457	MSH4_HUMAN	V	575	ENSP00000263187:I575V	ENSP00000263187:I575V	I	+	1	0	MSH4	76118368	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.721000	0.74728	0.897000	0.36392	0.528000	0.53228	ATT		0.274	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440		11	39	0	0	0	0.003163	0	11	39				
COL24A1	255631	broad.mit.edu	37	1	86581035	86581035	+	Silent	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:86581035T>C	ENST00000370571.2	-	4	1884	c.1518A>G	c.(1516-1518)ccA>ccG	p.P506P	COL24A1_ENST00000436319.1_Silent_p.P506P	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	506	Collagen-like 1.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.P506P(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTGACGGACCTGGGATACCTG	0.418																																							uc001dlj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1516-1518)CCA>CCG		collagen, type XXIV, alpha 1 precursor							89.0	88.0	88.0					1																	86581035		1878	4114	5992	SO:0001819	synonymous_variant	255631				cell adhesion	collagen	extracellular matrix structural constituent	g.chr1:86581035T>C	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.1518A>G	1.37:g.86581035T>C						COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Silent_p.P506P	p.P506P	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN		all cancers(265;0.0627)|Epithelial(280;0.0689)	4	1560	-			506			Collagen-like 1.		C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Silent	SNP	ENST00000370571.2	37	c.1518A>G	CCDS41353.1																																																																																				0.418	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890		7	29	0	0	0	0.00308	0	7	29				
GBP5	115362	broad.mit.edu	37	1	89735197	89735197	+	Silent	SNP	G	G	A	rs372467199		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:89735197G>A	ENST00000370459.3	-	2	169	c.42C>T	c.(40-42)atC>atT	p.I14I	GBP5_ENST00000343435.5_Silent_p.I14I|RP4-620F22.2_ENST00000437128.1_RNA			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	14	GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.I14I(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		TAAAGTTCTCGATGAGGCACA	0.478													G|||	1	0.000199681	0.0008	0.0	5008	,	,		6408	0.0		0.0	False		,,,				2504	0.0						uc001dnc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(40-42)ATC>ATT		guanylate-binding protein 5		G	,	2,4404	4.2+/-10.8	0,2,2201	224.0	211.0	216.0		42,42	-1.4	1.0	1		216	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	GBP5	NM_001134486.2,NM_052942.3	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	14/587,14/587	89735197	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	115362					plasma membrane	GTP binding|GTPase activity	g.chr1:89735197G>A	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.42C>T	1.37:g.89735197G>A						GBP5_uc001dnd.2_Silent_p.I14I|GBP5_uc001dne.1_Silent_p.I14I	p.I14I	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN		all cancers(265;0.00784)|Epithelial(280;0.0286)	3	579	-			14					B2RCE1|Q86TM5	Silent	SNP	ENST00000370459.3	37	c.42C>T	CCDS722.1																																																																																				0.478	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027700.1	NM_052942		8	202	0	0	0	0.004482	0	8	202				
TMEM56	148534	broad.mit.edu	37	1	95615767	95615767	+	Silent	SNP	T	T	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:95615767T>G	ENST00000370203.4	+	4	540	c.249T>G	c.(247-249)ggT>ggG	p.G83G	RP11-57H12.6_ENST00000604534.1_Silent_p.G83G|TMEM56_ENST00000463375.1_3'UTR	NM_001199679.1|NM_152487.2	NP_001186608.1|NP_689700.1	Q96MV1	TMM56_HUMAN	transmembrane protein 56	83	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)		p.G83G(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	12		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.133)		TTTTCAGGGGTGGTCCATCAC	0.323																																							uc001drb.2		NA																	1	Substitution - coding silent(1)		central_nervous_system(1)		0						c.(247-249)GGT>GGG		transmembrane protein 56							140.0	125.0	130.0					1																	95615767		2203	4300	6503	SO:0001819	synonymous_variant	148534					integral to membrane		g.chr1:95615767T>G		CCDS753.1	1p21.3	2008-02-05			ENSG00000152078	ENSG00000152078			26477	protein-coding gene	gene with protein product							Standard	NM_152487		Approved	FLJ31842	uc001drb.3	Q96MV1	OTTHUMG00000010847	ENST00000370203.4:c.249T>G	1.37:g.95615767T>G						RWDD3_uc001drd.3_Silent_p.G83G|TMEM56_uc001drc.2_Silent_p.G83G	p.G83G	NM_152487	NP_689700	Q96MV1	TMM56_HUMAN		all cancers(265;0.133)	4	540	+		all_lung(203;0.0232)|Lung NSC(277;0.0739)	83			TLC.		B2RPI2|D3DT48	Silent	SNP	ENST00000370203.4	37	c.249T>G	CCDS753.1																																																																																				0.323	TMEM56-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029935.1	NM_152487		5	45	0	0	0	0.014323	0	5	45				
PLPPR4	9890	broad.mit.edu	37	1	99771298	99771298	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:99771298G>T	ENST00000370185.3	+	7	1521	c.1024G>T	c.(1024-1026)Gac>Tac	p.D342Y	LPPR4_ENST00000457765.1_Missense_Mutation_p.D284Y|LPPR4_ENST00000370184.1_Missense_Mutation_p.D184Y	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		342					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.D342Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TCAGCACAGAGACGCCCTCAG	0.448																																							uc001dse.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1024-1026)GAC>TAC		plasticity related gene 1							159.0	157.0	157.0					1																	99771298		2203	4300	6503	SO:0001583	missense	9890						phosphatidate phosphatase activity	g.chr1:99771298G>T																												ENST00000370185.3:c.1024G>T	1.37:g.99771298G>T	ENSP00000359204:p.Asp342Tyr					LPPR4_uc010oue.1_Missense_Mutation_p.D284Y	p.D342Y	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)	7	1130	+		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)	342					E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	c.1024G>T	CCDS757.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.549859	0.27652	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.26660	2.29;2.16;1.72	5.62	5.62	0.85841	.	1.603250	0.02991	N	0.146781	T	0.33381	0.0861	L	0.49126	1.545	0.29190	N	0.875936	D;B	0.56035	0.974;0.003	P;B	0.54312	0.748;0.002	T	0.54616	-0.8267	9	.	.	.	-10.6701	19.6473	0.95784	0.0:0.0:1.0:0.0	.	284;342	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	Y	342;284;342;184	ENSP00000359204:D342Y;ENSP00000394913:D284Y;ENSP00000359203:D184Y	.	D	+	1	0	RP4-788L13.1	99543886	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	4.056000	0.57448	2.633000	0.89246	0.655000	0.94253	GAC		0.448	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			42	97	1	0	1.22674e-20	0.00874	1.93345e-20	42	97				
CD101	9398	broad.mit.edu	37	1	117559956	117559957	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:117559956_117559957GG>TT	ENST00000256652.4	+	5	1531_1532	c.1473_1474GG>TT	c.(1471-1476)tgGGcc>tgTTcc	p.491_492WA>CS	CD101_ENST00000369470.1_Missense_Mutation_p.491_492WA>CS	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	491	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.W491_A492>CS(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AAATGGACTGGGCCACCTTCCA	0.55																																							uc010oxb.1		NA																	1	Complex - compound substitution(1)		lung(1)	skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(1471-1476)TGGGCC>TGTTCC		immunoglobulin superfamily, member 2 precursor																																				SO:0001583	missense	9398				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides	g.chr1:117559956_117559957GG>TT	Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	Exception_encountered	1.37:g.117559956_117559957delinsTT	ENSP00000256652:p.W491_A492delinsCS					CD101_uc009whd.2_Missense_Mutation_p.491_492WA>CS|CD101_uc010oxc.1_Missense_Mutation_p.491_492WA>CS|CD101_uc010oxd.1_Missense_Mutation_p.429_430WA>CS	p.491_492WA>CS	NM_004258	NP_004249	Q93033	IGSF2_HUMAN			5	1531_1532	+			491_492			Extracellular (Potential).|Ig-like C2-type 4.		Q15856	Missense_Mutation	DNP	ENST00000256652.4	37	c.1473_1474GG>TT	CCDS891.1																																																																																				0.550	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258		20	84	0	0	0	0.004672	0	20	84				
WDR3	10885	broad.mit.edu	37	1	118494942	118494942	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:118494942C>T	ENST00000349139.5	+	18	1974	c.1927C>T	c.(1927-1929)Ccc>Tcc	p.P643S		NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	643						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P643S(1)		breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		ACAGTTTGTACCCAAGTCTCA	0.363																																							uc010oxe.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(1927-1929)CCC>TCC		WD repeat-containing protein 3							126.0	112.0	117.0					1																	118494942		2203	4300	6503	SO:0001583	missense	10885					nuclear membrane|nucleolus		g.chr1:118494942C>T	AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.1927C>T	1.37:g.118494942C>T	ENSP00000308179:p.Pro643Ser					WDR3_uc001ehi.2_Intron	p.P643S	NM_006784	NP_006775	Q9UNX4	WDR3_HUMAN		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)	18	1993	+	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)	643			WD 12.			Missense_Mutation	SNP	ENST00000349139.5	37	c.1927C>T	CCDS898.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.187482	0.57909	.	.	ENSG00000065183	ENST00000349139	T	0.70399	-0.48	6.07	5.15	0.70609	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.138542	0.64402	D	0.000002	T	0.65893	0.2735	M	0.83852	2.665	0.80722	D	1	B	0.24576	0.106	B	0.29440	0.102	T	0.68014	-0.5521	10	0.42905	T	0.14	-14.0284	16.8681	0.86034	0.0:0.7591:0.2409:0.0	.	643	Q9UNX4	WDR3_HUMAN	S	643	ENSP00000308179:P643S	ENSP00000308179:P643S	P	+	1	0	WDR3	118296465	0.960000	0.32886	0.911000	0.35937	0.998000	0.95712	2.484000	0.45242	1.537000	0.49254	0.655000	0.94253	CCC		0.363	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033720.2	NM_006784		16	78	0	0	0	0.00499	0	16	78				
FLG	2312	broad.mit.edu	37	1	152279939	152279939	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:152279939C>A	ENST00000368799.1	-	3	7458	c.7423G>T	c.(7423-7425)Gga>Tga	p.G2475*	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2475	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G2475*(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGTGGGATCCCTGCCTTCCT	0.582									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(7423-7425)GGA>TGA		filaggrin							368.0	340.0	350.0					1																	152279939		2203	4300	6503	SO:0001587	stop_gained	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152279939C>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7423G>T	1.37:g.152279939C>A	ENSP00000357789:p.Gly2475*						p.G2475*	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	7459	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2475			Ser-rich.		Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	ENST00000368799.1	37	c.7423G>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	45	11.796301	0.99604	.	.	ENSG00000143631	ENST00000368799	.	.	.	3.41	-0.16	0.13375	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	5.765	0.18221	0.0:0.5067:0.3689:0.1244	.	.	.	.	X	2475	.	ENSP00000357789:G2475X	G	-	1	0	FLG	150546563	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.826000	0.04429	0.098000	0.17522	0.306000	0.20318	GGA		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		209	331	1	0	7.99439e-90	0.01441	1.3401e-89	209	331				
KPRP	448834	broad.mit.edu	37	1	152732100	152732100	+	Silent	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:152732100G>T	ENST00000606109.1	+	1	64	c.36G>T	c.(34-36)ccG>ccT	p.P12P	KPRP_ENST00000368773.1_Silent_p.P12P			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	12	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.P12P(2)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCGCCTGCCGCTCCAACAGT	0.582																																							uc001fal.1		NA																	2	Substitution - coding silent(2)		prostate(1)|lung(1)	ovary(4)|pancreas(1)	5						c.(34-36)CCG>CCT		keratinocyte proline-rich protein							71.0	70.0	71.0					1																	152732100		2203	4300	6503	SO:0001819	synonymous_variant	448834					cytoplasm		g.chr1:152732100G>T	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.36G>T	1.37:g.152732100G>T							p.P12P	NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	94	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		12			Gln-rich.			Silent	SNP	ENST00000606109.1	37	c.36G>T	CCDS30862.1																																																																																				0.582	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231		37	55	1	0	1.04594e-18	0.00623	1.61342e-18	37	55				
KIAA0907	22889	broad.mit.edu	37	1	155895471	155895471	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:155895471T>G	ENST00000368321.3	-	7	868	c.845A>C	c.(844-846)gAg>gCg	p.E282A	KIAA0907_ENST00000482337.1_5'UTR|SCARNA4_ENST00000516999.1_RNA|KIAA0907_ENST00000368319.3_Missense_Mutation_p.E282A|KIAA0907_ENST00000368320.3_Missense_Mutation_p.E282A	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	282							RNA binding (GO:0003723)	p.E282A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			AGATGCTGGCTCAATGCAGCC	0.483																																							uc001fmi.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(844-846)GAG>GCG		hypothetical protein LOC22889							96.0	91.0	92.0					1																	155895471		2203	4300	6503	SO:0001583	missense	22889							g.chr1:155895471T>G	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.845A>C	1.37:g.155895471T>G	ENSP00000357304:p.Glu282Ala					KIAA0907_uc001fmj.1_Missense_Mutation_p.E282A|KIAA0907_uc009wrk.1_Intron|KIAA0907_uc009wrl.1_RNA|KIAA0907_uc001fml.1_Missense_Mutation_p.E282A|KIAA0907_uc001fmm.2_3'UTR	p.E282A	NM_014949	NP_055764	Q7Z7F0	K0907_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)		7	869	-	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		282					O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	ENST00000368321.3	37	c.845A>C	CCDS30885.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.787980	0.90367	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	T;T;T	0.45276	0.9;0.9;0.9	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.66096	0.2755	M	0.90082	3.085	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.989	D;D;D	0.87578	0.997;0.998;0.997	T	0.74884	-0.3512	10	0.87932	D	0	-13.625	15.8421	0.78857	0.0:0.0:0.0:1.0	.	282;282;282	Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;K0907_HUMAN	A	282	ENSP00000357304:E282A;ENSP00000357303:E282A;ENSP00000357302:E282A	ENSP00000357302:E282A	E	-	2	0	KIAA0907	154162095	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.694000	0.84235	2.221000	0.72209	0.528000	0.53228	GAG		0.483	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949		5	120	0	0	0	0.001168	0	5	120				
ADCY10	55811	broad.mit.edu	37	1	167787447	167787447	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:167787447G>C	ENST00000367851.4	-	31	4529	c.4345C>G	c.(4345-4347)Ctt>Gtt	p.L1449V	ADCY10_ENST00000545172.1_Missense_Mutation_p.L1296V|ADCY10_ENST00000367848.1_Missense_Mutation_p.L1357V|RP1-313L4.3_ENST00000451545.1_RNA	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1449					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.L1449I(1)|p.L1449V(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CTTGGCAAAAGATTTTTAGCT	0.373																																							uc001ger.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	central_nervous_system(2)|ovary(1)	3						c.(4345-4347)CTT>GTT		adenylate cyclase 10							105.0	102.0	103.0					1																	167787447		2203	4300	6503	SO:0001583	missense	55811				intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding	g.chr1:167787447G>C	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4345C>G	1.37:g.167787447G>C	ENSP00000356825:p.Leu1449Val					ADCY10_uc009wvj.2_RNA|ADCY10_uc009wvk.2_Missense_Mutation_p.L1357V|ADCY10_uc010plj.1_Missense_Mutation_p.L1296V	p.L1449V	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN			31	4643	-			1449					B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	c.4345C>G	CCDS1265.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.82|14.82	2.649988|2.649988	0.47362|0.47362	.|.	.|.	ENSG00000143199|ENSG00000143199	ENST00000271426|ENST00000545172;ENST00000367851;ENST00000367848	.|T;T;T	.|0.40225	.|1.04;1.06;1.05	5.63|5.63	1.62|1.62	0.23740|0.23740	.|.	.|0.000000	.|0.38897	.|N	.|0.001535	T|T	0.44456|0.44456	0.1294|0.1294	M|M	0.69823|0.69823	2.125|2.125	.|0.29723	.|N	.|0.838527	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.83275	.|0.996;0.991	T|T	0.41197|0.41197	-0.9522|-0.9522	5|9	0.41790|0.38643	T|T	0.15|0.18	-12.431|-12.431	8.3238|8.3238	0.32145|0.32145	0.3266:0.0:0.6734:0.0|0.3266:0.0:0.6734:0.0	.|.	.|1357;1449	.|Q96PN6-2;Q96PN6	.|.;ADCYA_HUMAN	M|V	366|1296;1449;1357	.|ENSP00000441992:L1296V;ENSP00000356825:L1449V;ENSP00000356822:L1357V	ENSP00000271426:I366M|ENSP00000356822:L1357V	I|L	-|-	3|1	3|0	ADCY10|ADCY10	166054071|166054071	0.310000|0.310000	0.24527|0.24527	0.002000|0.002000	0.10522|0.10522	0.052000|0.052000	0.14988|0.14988	1.155000|1.155000	0.31700|0.31700	0.319000|0.319000	0.23209|0.23209	0.655000|0.655000	0.94253|0.94253	ATC|CTT		0.373	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417		5	109	0	0	0	0.014758	0	5	109				
PRRC2C	23215	broad.mit.edu	37	1	171511222	171511222	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:171511222A>T	ENST00000338920.4	+	16	4848	c.4611A>T	c.(4609-4611)gaA>gaT	p.E1537D	PRRC2C_ENST00000367742.3_Missense_Mutation_p.E1539D|PRRC2C_ENST00000392078.3_Missense_Mutation_p.E1539D|PRRC2C_ENST00000426496.2_Missense_Mutation_p.E1537D	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1537					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.E1539D(2)									CAAAGAGGGAAATTGCAAAGA	0.418																																							uc010pmg.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(4609-4611)GAA>GAT		HBxAg transactivated protein 2							51.0	53.0	52.0					1																	171511222		2203	4300	6503	SO:0001583	missense	23215						protein C-terminus binding	g.chr1:171511222A>T	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.4611A>T	1.37:g.171511222A>T	ENSP00000343629:p.Glu1537Asp					BAT2L2_uc010pmh.1_Missense_Mutation_p.E514D	p.E1537D	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN			16	4877	+			1537					Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	c.4611A>T	CCDS1296.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.943|8.943	0.966297|0.966297	0.18659|0.18659	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080|ENST00000495585	T;T;T;T|.	0.02579|.	4.25;4.24;4.24;4.24|.	5.87|5.87	0.789|0.789	0.18607|0.18607	.|.	0.000000|.	0.48286|.	D|.	0.000194|.	T|T	0.24928|0.24928	0.0605|0.0605	L|L	0.42632|0.42632	1.34|1.34	0.44927|0.44927	D|D	0.99794|0.99794	B|.	0.24043|.	0.096|.	B|.	0.22152|.	0.038|.	T|T	0.16335|0.16335	-1.0406|-1.0406	10|5	0.42905|.	T|.	0.14|.	.|.	1.7879|1.7879	0.03045|0.03045	0.5549:0.1275:0.1957:0.1219|0.5549:0.1275:0.1957:0.1219	.|.	1537|.	Q9Y520-4|.	.|.	D|I	1539;1538;1537;1539;1537;1294|85	ENSP00000375928:E1539D;ENSP00000410219:E1537D;ENSP00000356716:E1539D;ENSP00000343629:E1537D|.	ENSP00000343629:E1537D|.	E|K	+|+	3|2	2|0	PRRC2C|PRRC2C	169777846|169777846	0.917000|0.917000	0.31117|0.31117	0.996000|0.996000	0.52242|0.52242	0.818000|0.818000	0.46254|0.46254	0.049000|0.049000	0.14099|0.14099	-0.105000|-0.105000	0.12132|0.12132	0.529000|0.529000	0.55759|0.55759	GAA|AAA		0.418	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172		32	30	0	0	0	0.008361	0	32	30				
TNR	7143	broad.mit.edu	37	1	175362997	175362997	+	Silent	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:175362997C>T	ENST00000367674.2	-	6	1983	c.1275G>A	c.(1273-1275)acG>acA	p.T425T	TNR_ENST00000263525.2_Silent_p.T425T			Q92752	TENR_HUMAN	tenascin R	425	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.T425T(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TCTCTGTGATCGTCTTAAATT	0.498																																							uc001gkp.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(1273-1275)ACG>ACA		tenascin R precursor							186.0	180.0	182.0					1																	175362997		2203	4300	6503	SO:0001819	synonymous_variant	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175362997C>T	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1275G>A	1.37:g.175362997C>T						TNR_uc009wwu.1_Silent_p.T425T|TNR_uc010pmz.1_3'UTR	p.T425T	NM_003285	NP_003276	Q92752	TENR_HUMAN			4	1356	-	Renal(580;0.146)		425			Fibronectin type-III 2.		C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	c.1275G>A	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	7.928	0.740047	0.15642	.	.	ENSG00000116147	ENST00000422274	.	.	.	4.75	-9.49	0.00587	.	.	.	.	.	T	0.37073	0.0990	.	.	.	0.42021	D	0.990981	.	.	.	.	.	.	T	0.43940	-0.9360	4	.	.	.	.	4.4558	0.11642	0.135:0.1173:0.4572:0.2905	.	.	.	.	N	150	.	.	D	-	1	0	TNR	173629620	0.012000	0.17670	0.320000	0.25306	0.948000	0.59901	-1.150000	0.03178	-2.117000	0.00829	-0.149000	0.13747	GAT		0.498	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		16	200	0	0	0	0.004007	0	16	200				
BRINP2	57795	broad.mit.edu	37	1	177199216	177199216	+	Silent	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:177199216T>C	ENST00000361539.4	+	2	516	c.204T>C	c.(202-204)gcT>gcC	p.A68A		NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	68					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)		p.A68A(1)									TCCACCGCGCTCAGGAGTATG	0.642																																							uc001glf.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(202-204)GCT>GCC		family with sequence similarity 5, member B							51.0	55.0	54.0					1																	177199216		2203	4300	6503	SO:0001819	synonymous_variant	57795					extracellular region		g.chr1:177199216T>C		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.204T>C	1.37:g.177199216T>C							p.A68A	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN			2	516	+			68					O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	ENST00000361539.4	37	c.204T>C	CCDS1320.1																																																																																				0.642	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165		13	127	0	0	0	0.003163	0	13	127				
CACNA1E	777	broad.mit.edu	37	1	181753820	181753820	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:181753820G>T	ENST00000367573.2	+	41	5494	c.5494G>T	c.(5494-5496)Gac>Tac	p.D1832Y	CACNA1E_ENST00000360108.3_Missense_Mutation_p.D1813Y|CACNA1E_ENST00000357570.5_Missense_Mutation_p.D1783Y|CACNA1E_ENST00000358338.5_Missense_Mutation_p.D1764Y|CACNA1E_ENST00000367567.4_Missense_Mutation_p.D1439Y|CACNA1E_ENST00000367570.1_Missense_Mutation_p.D1832Y|CACNA1E_ENST00000526775.1_Missense_Mutation_p.D1813Y	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1832					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.D1832Y(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCAGCAGCTAGACTCAGAGCT	0.483																																							uc001gow.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(5494-5496)GAC>TAC		calcium channel, voltage-dependent, R type,							58.0	59.0	58.0					1																	181753820		1919	4124	6043	SO:0001583	missense	777				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr1:181753820G>T	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5494G>T	1.37:g.181753820G>T	ENSP00000356545:p.Asp1832Tyr					CACNA1E_uc009wxs.2_Missense_Mutation_p.D1720Y|CACNA1E_uc009wxt.2_Missense_Mutation_p.D1058Y	p.D1832Y	NM_000721	NP_000712	Q15878	CAC1E_HUMAN			41	5659	+			1832			Cytoplasmic (Potential).		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	c.5494G>T	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811084	0.90707	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.85440	0.5697	M	0.89287	3.02	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.963;0.999	D	0.87775	0.2608	10	0.87932	D	0	.	19.1535	0.93499	0.0:0.0:1.0:0.0	.	1813;1832	Q15878-2;Q15878-3	.;.	Y	1832;1813;1783;1764;1439;1813;1832	ENSP00000356542:D1832Y;ENSP00000434814:D1813Y;ENSP00000350183:D1783Y;ENSP00000351101:D1764Y;ENSP00000356539:D1439Y;ENSP00000353222:D1813Y;ENSP00000356545:D1832Y	ENSP00000350183:D1783Y	D	+	1	0	CACNA1E	180020443	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	9.731000	0.98807	2.610000	0.88304	0.563000	0.77884	GAC		0.483	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		3	6	1	0	0.004672	0.004672	0.00503673	3	6				
HMCN1	83872	broad.mit.edu	37	1	186056670	186056670	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:186056670G>A	ENST00000271588.4	+	60	9485	c.9256G>A	c.(9256-9258)Gtg>Atg	p.V3086M	HMCN1_ENST00000367492.2_Missense_Mutation_p.V3086M	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3086	Ig-like C2-type 29.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.V3086M(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTCGAACGCTGTGCCACCTCC	0.438																																							uc001grq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(22)|skin(1)	23						c.(9256-9258)GTG>ATG		hemicentin 1 precursor							121.0	118.0	119.0					1																	186056670		2203	4300	6503	SO:0001583	missense	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186056670G>A	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9256G>A	1.37:g.186056670G>A	ENSP00000271588:p.Val3086Met						p.V3086M	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN			60	9485	+			3086			Ig-like C2-type 29.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	c.9256G>A	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881385	0.51801	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68331	-0.32;-0.32	5.59	5.59	0.84812	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.107969	0.64402	D	0.000006	T	0.72914	0.3520	L	0.45285	1.41	0.53005	D	0.99996	D	0.76494	0.999	D	0.87578	0.998	T	0.70443	-0.4870	10	0.34782	T	0.22	.	9.8125	0.40831	0.1575:0.0:0.8425:0.0	.	3086	Q96RW7	HMCN1_HUMAN	M	3086	ENSP00000271588:V3086M;ENSP00000356462:V3086M	ENSP00000271588:V3086M	V	+	1	0	HMCN1	184323293	1.000000	0.71417	0.997000	0.53966	0.306000	0.27790	5.467000	0.66737	2.612000	0.88384	0.655000	0.94253	GTG		0.438	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		12	176	0	0	0	0.010729	0	12	176				
CACNA1S	779	broad.mit.edu	37	1	201044651	201044651	+	Silent	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:201044651G>A	ENST00000362061.3	-	13	2146	c.1920C>T	c.(1918-1920)taC>taT	p.Y640Y	CACNA1S_ENST00000367338.3_Silent_p.Y640Y	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	640					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.Y640Y(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGATGATGAAGTAAATGCACA	0.542																																							uc001gvv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1918-1920)TAC>TAT		calcium channel, voltage-dependent, L type,	Magnesium Sulfate(DB00653)|Verapamil(DB00661)						207.0	187.0	194.0					1																	201044651		2203	4300	6503	SO:0001819	synonymous_variant	779				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity	g.chr1:201044651G>A	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1920C>T	1.37:g.201044651G>A							p.Y640Y	NM_000069	NP_000060	Q13698	CAC1S_HUMAN			13	2147	-			640			Helical; Name=S6 of repeat II; (Potential).|II.		A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	ENST00000362061.3	37	c.1920C>T	CCDS1407.1																																																																																				0.542	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		26	181	0	0	0	0.010818	0	26	181				
ATP2B4	493	broad.mit.edu	37	1	203652429	203652429	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:203652429C>A	ENST00000357681.5	+	2	1219	c.96C>A	c.(94-96)ctC>ctA	p.L32L	ATP2B4_ENST00000367218.3_Silent_p.L32L|ATP2B4_ENST00000391954.2_Silent_p.L32L|ATP2B4_ENST00000341360.2_Silent_p.L32L|ATP2B4_ENST00000367219.3_Silent_p.L32L	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	32					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)	p.L32L(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGAGGAAGCTCATGGAGCTGC	0.522																																							uc001gzw.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(1)	3						c.(94-96)CTC>CTA		plasma membrane calcium ATPase 4 isoform 4b							172.0	159.0	163.0					1																	203652429		2203	4300	6503	SO:0001819	synonymous_variant	493				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding	g.chr1:203652429C>A	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.96C>A	1.37:g.203652429C>A						ATP2B4_uc001gzv.2_Silent_p.L32L|ATP2B4_uc009xaq.2_Silent_p.L32L	p.L32L	NM_001684	NP_001675	P23634	AT2B4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		2	980	+	all_cancers(21;0.071)|all_epithelial(62;0.228)		32			Cytoplasmic (Potential).		B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Silent	SNP	ENST00000357681.5	37	c.96C>A	CCDS1440.1																																																																																				0.522	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396		73	116	1	0	3.78398e-24	0.01441	6.06274e-24	73	116				
ZNF678	339500	broad.mit.edu	37	1	227843217	227843217	+	Silent	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:227843217C>T	ENST00000343776.5	+	4	1611	c.1266C>T	c.(1264-1266)agC>agT	p.S422S	ZNF678_ENST00000608949.1_Intron|ZNF678_ENST00000397097.3_Silent_p.S477S	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S422S(1)|p.S477S(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				ACCTAACTAGCCATAAGAGAA	0.368																																							uc001hqw.1		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(1264-1266)AGC>AGT		zinc finger protein 678							31.0	35.0	33.0					1																	227843217		2201	4289	6490	SO:0001819	synonymous_variant	339500				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr1:227843217C>T	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.1266C>T	1.37:g.227843217C>T						ZNF678_uc009xet.1_Intron|ZNF678_uc009xeu.1_Intron	p.S422S	NM_178549	NP_848644	F5GXA7	F5GXA7_HUMAN			4	1611	+		Prostate(94;0.0885)	477					Q8IVQ9	Silent	SNP	ENST00000343776.5	37	c.1266C>T																																																																																					0.368	ZNF678-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000091976.2	NM_178549		5	58	0	0	0	0.014758	0	5	58				
MAP10	54627	broad.mit.edu	37	1	232941882	232941882	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:232941882G>T	ENST00000418460.1	+	1	1240	c.1113G>T	c.(1111-1113)gaG>gaT	p.E371D		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	229					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)	p.E371D(2)									GCCCAAAAGAGGCTGATAAGC	0.542																																							uc001hvh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1111-1113)GAG>GAT		hypothetical protein LOC54627							90.0	98.0	96.0					1																	232941882		1945	4166	6111	SO:0001583	missense	54627							g.chr1:232941882G>T	AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.1113G>T	1.37:g.232941882G>T	ENSP00000403208:p.Glu371Asp						p.E371D	NM_019090	NP_061963	Q9P2G4	K1383_HUMAN			1	1245	+		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)	229					A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	ENST00000418460.1	37	c.1113G>T	CCDS44334.1	.	.	.	.	.	.	.	.	.	.	G	4.635	0.118006	0.08881	.	.	ENSG00000212916	ENST00000418460	.	.	.	4.09	0.0685	0.14370	.	0.489603	0.16310	N	0.220042	T	0.05823	0.0152	N	0.00642	-1.3	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30995	-0.9959	9	0.09590	T	0.72	-0.171	0.4197	0.00454	0.1764:0.2388:0.2017:0.3831	.	229	Q9P2G4	K1383_HUMAN	D	371	.	ENSP00000403208:E371D	E	+	3	2	KIAA1383	231008505	0.000000	0.05858	0.041000	0.18516	0.006000	0.05464	-0.312000	0.08113	0.230000	0.21059	-0.311000	0.09066	GAG		0.542	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092317.3	NM_019090		12	149	1	0	0.00010058	0.013537	0.00011857	12	149				
FMN2	56776	broad.mit.edu	37	1	240370635	240370635	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:240370635C>A	ENST00000319653.9	+	5	2753	c.2523C>A	c.(2521-2523)caC>caA	p.H841Q		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	841	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.H984Q(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AAACCAGCCACGAACACTCTG	0.562																																							uc010pyd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(2521-2523)CAC>CAA		formin 2							100.0	97.0	98.0					1																	240370635		2203	4300	6503	SO:0001583	missense	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240370635C>A	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2523C>A	1.37:g.240370635C>A	ENSP00000318884:p.His841Gln					FMN2_uc010pye.1_Missense_Mutation_p.H845Q	p.H841Q	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		5	2748	+	Ovarian(103;0.127)	all_cancers(173;0.013)	841			Pro-rich.|FH1.		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	c.2523C>A	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	5.929	0.355497	0.11239	.	.	ENSG00000155816	ENST00000319653	T	0.27104	1.69	4.09	-3.59	0.04583	Actin-binding FH2/DRF autoregulatory (1);	0.316033	0.26089	N	0.026414	T	0.11965	0.0291	N	0.20986	0.625	0.43122	D	0.994847	B	0.14805	0.011	B	0.12156	0.007	T	0.20806	-1.0264	9	.	.	.	.	7.9599	0.30066	0.0:0.4708:0.1594:0.3698	.	841	Q9NZ56	FMN2_HUMAN	Q	841	ENSP00000318884:H841Q	.	H	+	3	2	FMN2	238437258	0.037000	0.19845	0.661000	0.29709	0.529000	0.34654	-0.223000	0.09177	-0.824000	0.04295	-1.445000	0.01065	CAC		0.562	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		7	74	1	0	5.18039e-06	0.00308	6.39282e-06	7	74				
OR2M3	127062	broad.mit.edu	37	1	248366864	248366864	+	Silent	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:248366864C>T	ENST00000456743.1	+	1	533	c.495C>T	c.(493-495)tcC>tcT	p.S165S		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S165S(1)		endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CAACATTTTCCTTCTCCTACT	0.438																																							uc010pzg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(493-495)TCC>TCT		olfactory receptor, family 2, subfamily M,							217.0	205.0	209.0					1																	248366864		2203	4300	6503	SO:0001819	synonymous_variant	127062				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248366864C>T		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.495C>T	1.37:g.248366864C>T							p.S165S	NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	495	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		165			Extracellular (Potential).		B9EH06|Q6IEY0	Silent	SNP	ENST00000456743.1	37	c.495C>T	CCDS31107.1																																																																																				0.438	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689		17	325	0	0	0	0.004007	0	17	325				
OR2M4	26245	broad.mit.edu	37	1	248402835	248402835	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:248402835G>A	ENST00000306687.1	+	1	605	c.605G>A	c.(604-606)tGt>tAt	p.C202Y		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	202					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C202Y(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTTGTCATTTGTTGTGTGGTA	0.438																																							uc010pzh.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(604-606)TGT>TAT		olfactory receptor, family 2, subfamily M,							122.0	121.0	121.0					1																	248402835		2203	4300	6503	SO:0001583	missense	26245				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248402835G>A	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.605G>A	1.37:g.248402835G>A	ENSP00000306688:p.Cys202Tyr						p.C202Y	NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)		1	605	+	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		202			Helical; Name=5; (Potential).		Q15611|Q8NG82	Missense_Mutation	SNP	ENST00000306687.1	37	c.605G>A	CCDS31108.1	.	.	.	.	.	.	.	.	.	.	g	8.077	0.771588	0.16051	.	.	ENSG00000171180	ENST00000306687	T	0.00058	8.79	3.34	2.31	0.28768	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000315	T	0.00271	0.0008	L	0.48877	1.53	0.09310	N	1	D	0.63046	0.992	D	0.70487	0.969	T	0.51973	-0.8637	10	0.87932	D	0	.	8.0734	0.30701	0.0:0.0:0.5576:0.4423	.	202	Q96R27	OR2M4_HUMAN	Y	202	ENSP00000306688:C202Y	ENSP00000306688:C202Y	C	+	2	0	OR2M4	246469458	0.000000	0.05858	0.469000	0.27204	0.193000	0.23685	-0.084000	0.11268	1.840000	0.53500	0.543000	0.68304	TGT		0.438	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504		76	83	0	0	0	0.01441	0	76	83				
ITGA8	8516	broad.mit.edu	37	10	15688901	15688902	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr10:15688901_15688902CC>AA	ENST00000378076.3	-	12	1503_1504	c.1150_1151GG>TT	c.(1150-1152)GGg>TTg	p.G384L		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	384					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.G384L(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						ACCGAATCTCCCAAACGTCTCG	0.48																																							uc001ioc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(3)	6						c.(1150-1152)GGG>TTG		integrin, alpha 8 precursor																																				SO:0001583	missense	8516				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity	g.chr10:15688901_15688902CC>AA	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1150_1151delinsAA	10.37:g.15688901_15688902delinsAA	ENSP00000367316:p.Gly384Leu					ITGA8_uc010qcb.1_Missense_Mutation_p.G369L	p.G384L	NM_003638	NP_003629	P53708	ITA8_HUMAN			12	1150_1151	-			384			Extracellular (Potential).|FG-GAP 6.		B0YJ31|Q5VX94	Missense_Mutation	DNP	ENST00000378076.3	37	c.1150_1151GG>TT	CCDS31155.1																																																																																				0.480	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		18	40	0	0	0	0.004672	0	18	40				
CH25H	9023	broad.mit.edu	37	10	90966547	90966547	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr10:90966547G>A	ENST00000371852.2	-	1	524	c.503C>T	c.(502-504)gCg>gTg	p.A168V		NM_003956.3	NP_003947.1	O95992	CH25H_HUMAN	cholesterol 25-hydroxylase	168					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|fatty acid biosynthetic process (GO:0006633)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholesterol 25-hydroxylase activity (GO:0001567)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)	p.A168V(1)		kidney(1)|large_intestine(2)|lung(3)|stomach(1)	7		Colorectal(252;0.0161)		GBM - Glioblastoma multiforme(2;0.000133)		CGTTGCCAGCGCGAACGAGGA	0.577																																							uc001kfz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(502-504)GCG>GTG		cholesterol 25-hydroxylase							141.0	133.0	136.0					10																	90966547		2203	4300	6503	SO:0001583	missense	9023				bile acid biosynthetic process|fatty acid biosynthetic process|sterol biosynthetic process	cytosol|endoplasmic reticulum membrane|integral to membrane	cholesterol 25-hydroxylase activity|iron ion binding	g.chr10:90966547G>A	AF059212	CCDS7400.1	10q23	2013-03-04			ENSG00000138135	ENSG00000138135	1.14.99.38	"""Fatty acid hydroxylase domain containing"""	1907	protein-coding gene	gene with protein product		604551				9852097	Standard	NM_003956		Approved		uc001kfz.3	O95992	OTTHUMG00000018705	ENST00000371852.2:c.503C>T	10.37:g.90966547G>A	ENSP00000360918:p.Ala168Val						p.A168V	NM_003956	NP_003947	O95992	CH25H_HUMAN		GBM - Glioblastoma multiforme(2;0.000133)	1	525	-		Colorectal(252;0.0161)	168					B2RBY3	Missense_Mutation	SNP	ENST00000371852.2	37	c.503C>T	CCDS7400.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.930493	0.92389	.	.	ENSG00000138135	ENST00000371852	D	0.84370	-1.84	5.01	5.01	0.66863	Fatty acid hydroxylase (1);	0.056558	0.64402	D	0.000001	D	0.90858	0.7128	M	0.82517	2.595	0.51012	D	0.999907	P	0.49961	0.93	P	0.53102	0.718	D	0.92003	0.5612	10	0.66056	D	0.02	-46.8418	18.1835	0.89786	0.0:0.0:1.0:0.0	.	168	O95992	CH25H_HUMAN	V	168	ENSP00000360918:A168V	ENSP00000360918:A168V	A	-	2	0	CH25H	90956527	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.386000	0.66238	2.696000	0.92011	0.655000	0.94253	GCG		0.577	CH25H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049291.1	NM_003956		5	89	0	0	0	0.014758	0	5	89				
PIPSL	266971	broad.mit.edu	37	10	95720326	95720326	+	RNA	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr10:95720326G>T	ENST00000480546.1	-	0	971					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										CTATATTATGGATTGACATCA	0.473																																							uc009xuj.2		NA																	0					0						c.(826-828)ATC>ATA		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																						266971							g.chr10:95720326G>T	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95720326G>T							p.I276I	NR_002319						1	1347	-								Q6NUK8	Silent	SNP	ENST00000480546.1	37	c.828C>A																																																																																					0.473	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000351483.1	NR_002319		8	67	1	0	7.48243e-07	0.006214	9.43437e-07	8	67				
ENTPD7	57089	broad.mit.edu	37	10	101458381	101458381	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr10:101458381C>A	ENST00000370489.4	+	10	1279	c.1101C>A	c.(1099-1101)aaC>aaA	p.N367K		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	367						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.N367K(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		TGGAGAGGAACAGCCAAGTCT	0.567																																							uc001kqa.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1099-1101)AAC>AAA		ectonucleoside triphosphate diphosphohydrolase							115.0	102.0	106.0					10																	101458381		2203	4300	6503	SO:0001583	missense	57089					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity	g.chr10:101458381C>A	AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.1101C>A	10.37:g.101458381C>A	ENSP00000359520:p.Asn367Lys					ENTPD7_uc009xwl.2_Missense_Mutation_p.N369K	p.N367K	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)	10	1279	+		Colorectal(252;0.234)	367			Vesicular (Potential).		B2RB83|B3KP21|D3DR64	Missense_Mutation	SNP	ENST00000370489.4	37	c.1101C>A	CCDS7480.1	.	.	.	.	.	.	.	.	.	.	C	8.171	0.791674	0.16258	.	.	ENSG00000198018	ENST00000370489	T	0.10099	2.91	4.96	2.01	0.26516	.	0.290760	0.38436	N	0.001686	T	0.06462	0.0166	L	0.28740	0.885	0.28243	N	0.925599	B	0.16603	0.018	B	0.29440	0.102	T	0.41787	-0.9489	10	0.07813	T	0.8	-16.247	4.3467	0.11136	0.0:0.4055:0.1644:0.4301	.	367	Q9NQZ7	ENTP7_HUMAN	K	367	ENSP00000359520:N367K	ENSP00000359520:N367K	N	+	3	2	ENTPD7	101448371	0.032000	0.19561	0.867000	0.34043	0.746000	0.42486	-0.149000	0.10204	0.253000	0.21552	0.655000	0.94253	AAC		0.567	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049809.2	NM_020354		6	46	1	0	0.00116845	0.001168	0.00128352	6	46				
SORCS3	22986	broad.mit.edu	37	10	106907469	106907469	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr10:106907469C>A	ENST00000369701.3	+	9	1624	c.1397C>A	c.(1396-1398)aCg>aAg	p.T466K		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	466					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.T466K(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		ATCTCAGACACGCGTGGGATT	0.448																																					NSCLC(116;1497 1690 7108 13108 14106)	NSCLC(116;1497 1690 7108 13108 14106)	uc001kyi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|central_nervous_system(1)	10						c.(1396-1398)ACG>AAG		VPS10 domain receptor protein SORCS 3 precursor							258.0	205.0	223.0					10																	106907469		2203	4299	6502	SO:0001583	missense	22986					integral to membrane	neuropeptide receptor activity	g.chr10:106907469C>A	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1397C>A	10.37:g.106907469C>A	ENSP00000358715:p.Thr466Lys						p.T466K	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	9	1624	+		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)	466			Lumenal (Potential).		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	c.1397C>A	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995595	0.74703	.	.	ENSG00000156395	ENST00000369701	T	0.21932	1.98	5.42	3.57	0.40892	VPS10 (1);	0.173210	0.52532	D	0.000071	T	0.39118	0.1066	L	0.59436	1.845	0.53688	D	0.999979	D	0.69078	0.997	D	0.67103	0.949	T	0.12192	-1.0557	10	0.54805	T	0.06	.	12.4337	0.55588	0.0:0.8624:0.0:0.1376	.	466	Q9UPU3	SORC3_HUMAN	K	466	ENSP00000358715:T466K	ENSP00000358715:T466K	T	+	2	0	SORCS3	106897459	0.994000	0.37717	0.916000	0.36221	0.900000	0.52787	3.191000	0.50981	0.779000	0.33543	-0.142000	0.14014	ACG		0.448	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978		10	46	1	0	4.68919e-08	0.008291	6.20943e-08	10	46				
ATRNL1	26033	broad.mit.edu	37	10	116889227	116889227	+	Silent	SNP	C	C	T	rs200296037		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr10:116889227C>T	ENST00000355044.3	+	5	885	c.759C>T	c.(757-759)tgC>tgT	p.C253C	ATRNL1_ENST00000529665.1_3'UTR|ATRNL1_ENST00000527407.1_Silent_p.C253C	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	253					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.C253C(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AAGCCAATTGCGGCAGTCCAG	0.413													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15991	0.0		0.0	False		,,,				2504	0.0						uc001lcg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|lung(1)|central_nervous_system(1)	7						c.(757-759)TGC>TGT		attractin-like 1 precursor							172.0	157.0	162.0					10																	116889227		2203	4300	6503	SO:0001819	synonymous_variant	26033					integral to membrane	sugar binding	g.chr10:116889227C>T	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.759C>T	10.37:g.116889227C>T						ATRNL1_uc001lce.2_RNA|ATRNL1_uc001lcf.2_Silent_p.C253C|ATRNL1_uc009xyq.2_Silent_p.C253C	p.C253C	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	5	1145	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	253			Extracellular (Potential).		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	37	c.759C>T	CCDS7592.1																																																																																				0.413	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		17	43	0	0	0	0.004007	0	17	43				
CFAP46	54777	broad.mit.edu	37	10	134660763	134660763	+	Silent	SNP	T	T	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr10:134660763T>A	ENST00000368586.5	-	42	6115	c.6015A>T	c.(6013-6015)acA>acT	p.T2005T	TTC40_ENST00000263170.5_Silent_p.T166T	NM_001200049.2	NP_001186978.2												p.T166T(1)|p.T2005T(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TGCTGGACTTTGTGGCACCCT	0.657																																							uc010qux.1		NA																	2	Substitution - coding silent(2)		lung(2)		NA						c.(5191-5193)ACA>ACT		Homo sapiens cDNA, FLJ17989.							71.0	80.0	77.0					10																	134660763		2203	4300	6503	SO:0001819	synonymous_variant	0							g.chr10:134660763T>A																												ENST00000368586.5:c.6015A>T	10.37:g.134660763T>A							p.T1731T	NM_017609	NP_060079					34	5193	-									Silent	SNP	ENST00000368586.5	37	c.5193A>T	CCDS58101.1																																																																																				0.657	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3			23	61	0	0	0	0.01892	0	23	61				
LSP1	4046	broad.mit.edu	37	11	1905191	1905191	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:1905191C>A	ENST00000311604.3	+	5	703	c.528C>A	c.(526-528)ccC>ccA	p.P176P	LSP1_ENST00000406638.2_Silent_p.P114P|LSP1_ENST00000405957.2_Silent_p.P114P|LSP1_ENST00000381775.1_Silent_p.P304P|LSP1_ENST00000485341.1_3'UTR	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1	176					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)	p.P176P(1)|p.P114P(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		CCAGGACACCCAGCCCCTTGG	0.572																																							uc001lui.2		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(1)	1						c.(526-528)CCC>CCA		lymphocyte-specific protein 1 isoform 1							109.0	120.0	116.0					11																	1905191		2202	4299	6501	SO:0001819	synonymous_variant	4046				cellular component movement|cellular defense response	actin cytoskeleton|Golgi apparatus|plasma membrane	actin binding|signal transducer activity	g.chr11:1905191C>A	M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.528C>A	11.37:g.1905191C>A						LSP1_uc001luj.2_Silent_p.P304P|LSP1_uc001luk.2_Silent_p.P114P|LSP1_uc001lul.2_Silent_p.P114P|LSP1_uc001lum.2_Silent_p.P114P	p.P176P	NM_002339	NP_002330	P33241	LSP1_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)	5	703	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	176					B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Silent	SNP	ENST00000311604.3	37	c.528C>A	CCDS31334.1																																																																																				0.572	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034045.3	NM_002339		23	106	1	0	1.85244e-09	0.01892	2.5221e-09	23	106				
TNNT3	7140	broad.mit.edu	37	11	1955213	1955213	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:1955213A>T	ENST00000397301.1	+	12	382	c.374A>T	c.(373-375)gAg>gTg	p.E125V	TNNT3_ENST00000381548.3_Missense_Mutation_p.E116V|TNNT3_ENST00000493234.1_3'UTR|TNNT3_ENST00000381558.1_Missense_Mutation_p.E106V|TNNT3_ENST00000397304.2_Missense_Mutation_p.E95V|TNNT3_ENST00000278317.6_Missense_Mutation_p.E114V|TNNT3_ENST00000381549.3_Missense_Mutation_p.E106V|TNNT3_ENST00000381589.3_Missense_Mutation_p.E112V|TNNT3_ENST00000381561.4_Missense_Mutation_p.E117V|TNNT3_ENST00000446240.1_Missense_Mutation_p.E95V|TNNT3_ENST00000381579.3_Missense_Mutation_p.E106V|TNNT3_ENST00000360603.3_Missense_Mutation_p.E108V			P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)	125					ATP catabolic process (GO:0006200)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)|regulation of striated muscle contraction (GO:0006942)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium-dependent protein binding (GO:0048306)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)	p.E114V(1)|p.E112V(1)		breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		GCAGAGAAGGAGAGGGAGCGC	0.652																																							uc001luu.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(340-342)GAG>GTG		troponin T3, skeletal, fast isoform 1							41.0	42.0	41.0					11																	1955213		2199	4297	6496	SO:0001583	missense	7140				muscle filament sliding|regulation of ATPase activity|regulation of striated muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium-dependent protein binding|tropomyosin binding|troponin C binding|troponin I binding	g.chr11:1955213A>T	M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595			11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""			8172653	Standard	NM_001042782		Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000397301.1:c.374A>T	11.37:g.1955213A>T	ENSP00000380468:p.Glu125Val					TNNT3_uc001lun.2_Intron|TNNT3_uc001luw.3_Missense_Mutation_p.E106V|TNNT3_uc001luo.3_Missense_Mutation_p.E106V|TNNT3_uc001lup.3_Missense_Mutation_p.E112V|TNNT3_uc001luq.3_Missense_Mutation_p.E106V|TNNT3_uc001lur.2_Missense_Mutation_p.E106V|TNNT3_uc010qxf.1_Missense_Mutation_p.E112V|TNNT3_uc010qxg.1_Missense_Mutation_p.E46V	p.E114V	NM_006757	NP_006748	P45378	TNNT3_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)	11	553	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	125					A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	Missense_Mutation	SNP	ENST00000397301.1	37	c.341A>T		.	.	.	.	.	.	.	.	.	.	.	23.4	4.405941	0.83230	.	.	ENSG00000130595	ENST00000278317;ENST00000397309;ENST00000381561;ENST00000381548;ENST00000360603;ENST00000381549;ENST00000381589;ENST00000381579;ENST00000381557;ENST00000453458;ENST00000381563;ENST00000344578;ENST00000381558;ENST00000397301;ENST00000397304;ENST00000446240	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03	4.03	4.03	0.46877	.	0.120771	0.56097	D	0.000029	D	0.96386	0.8821	M	0.91196	3.185	0.80722	D	1	D;D;D;D	0.65815	0.995;0.987;0.995;0.993	D;D;D;D	0.69142	0.962;0.936;0.936;0.956	D	0.97157	0.9835	10	0.87932	D	0	-42.0621	13.4202	0.60994	1.0:0.0:0.0:0.0	.	114;106;112;106	P45378-2;P45378-7;P45378-6;P45378-4	.;.;.;.	V	114;126;117;116;108;106;112;106;100;95;117;101;106;125;95;95	ENSP00000278317:E114V;ENSP00000370973:E117V;ENSP00000370960:E116V;ENSP00000353815:E108V;ENSP00000370961:E106V;ENSP00000371001:E112V;ENSP00000370991:E106V;ENSP00000370969:E100V;ENSP00000415614:E95V;ENSP00000370975:E117V;ENSP00000344870:E101V;ENSP00000370970:E106V;ENSP00000380468:E125V;ENSP00000380471:E95V;ENSP00000413203:E95V	ENSP00000278317:E114V	E	+	2	0	TNNT3	1911789	1.000000	0.71417	0.995000	0.50966	0.960000	0.62799	6.801000	0.75170	1.829000	0.53265	0.260000	0.18958	GAG		0.652	TNNT3-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000142920.3	NM_006757		5	23	0	0	0	0.001168	0	5	23				
TRIM22	10346	broad.mit.edu	37	11	5730336	5730336	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:5730336G>T	ENST00000379965.3	+	8	1232	c.955G>T	c.(955-957)Gat>Tat	p.D319Y	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	319	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.D319Y(1)		kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		TATTTCTGTGGATCAGAGACA	0.418																																					GBM(104;491 2336 5222)	GBM(104;491 2336 5222)	uc001mbr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(955-957)GAT>TAT		tripartite motif-containing 22							145.0	135.0	138.0					11																	5730336		1948	4151	6099	SO:0001583	missense	10346				immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding	g.chr11:5730336G>T	X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.955G>T	11.37:g.5730336G>T	ENSP00000369299:p.Asp319Tyr					TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron|TRIM22_uc009yes.2_Missense_Mutation_p.D315Y|TRIM22_uc010qzm.1_Missense_Mutation_p.D147Y|TRIM22_uc009yeu.2_Missense_Mutation_p.D130Y|OR56B1_uc001mbs.1_Intron|OR56B1_uc009yev.1_Intron	p.D319Y	NM_006074	NP_006065	Q8IYM9	TRI22_HUMAN		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)	8	1232	+		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)	319			B30.2/SPRY.		Q05CQ0|Q15521	Missense_Mutation	SNP	ENST00000379965.3	37	c.955G>T	CCDS41612.1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715907	0.48622	.	.	ENSG00000132274	ENST00000379965;ENST00000545338;ENST00000454828;ENST00000455293	T;T	0.76578	-0.5;-1.03	3.94	0.879	0.19155	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	.	.	.	.	D	0.88614	0.6484	H	0.94503	3.545	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.994;1.0	T	0.75701	-0.3226	9	0.66056	D	0.02	.	4.2829	0.10841	0.2146:0.0:0.5994:0.186	.	241;315;319	F8WAP8;Q8IYM9-2;Q8IYM9	.;.;TRI22_HUMAN	Y	319;130;287;241	ENSP00000369299:D319Y;ENSP00000393250:D287Y	ENSP00000369299:D319Y	D	+	1	0	TRIM22	5686912	0.988000	0.35896	0.001000	0.08648	0.329000	0.28539	1.903000	0.39858	0.372000	0.24591	0.460000	0.39030	GAT		0.418	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143387.2	NM_006074		13	95	1	0	5.50884e-06	0.013537	6.74077e-06	13	95				
PARVA	55742	broad.mit.edu	37	11	12539189	12539190	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:12539189_12539190GG>TT	ENST00000550549.1	+	11	949_950	c.900_901GG>TT	c.(898-903)atGGgg>atTTgg	p.300_301MG>IW	PARVA_ENST00000334956.8_Missense_Mutation_p.340_341MG>IW|PARVA_ENST00000539723.1_Missense_Mutation_p.300_301MG>IW			Q9NVD7	PARVA_HUMAN	parvin, alpha	300	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|actin-mediated cell contraction (GO:0070252)|cell junction assembly (GO:0034329)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|heterotypic cell-cell adhesion (GO:0034113)|outflow tract septum morphogenesis (GO:0003148)|regulation of cell shape (GO:0008360)|smooth muscle cell chemotaxis (GO:0071670)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.M300_G301>IW(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)	11				Epithelial(150;0.00624)		TGCTGCTCATGGGGCTCCTGGA	0.614																																							uc001mki.2		NA																	1	Complex - compound substitution(1)		lung(1)	breast(3)	3						c.(898-903)ATGGGG>ATTTGG		parvin, alpha																																				SO:0001583	missense	55742				cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding	g.chr11:12539189_12539190GG>TT	AF237771	CCDS44541.1, CCDS44541.2	11p15.3	2014-06-13	2005-05-26		ENSG00000197702	ENSG00000197702		"""Parvins"""	14652	protein-coding gene	gene with protein product		608120	"""matrix-remodelling associated 2"""	MXRA2		11171322	Standard	NM_018222		Approved	FLJ12254, FLJ10793	uc001mki.4	Q9NVD7	OTTHUMG00000165778	Exception_encountered	11.37:g.12539189_12539190delinsTT	ENSP00000447198:p.M300_G301delinsIW						p.300_301MG>IW	NM_018222	NP_060692	Q9NVD7	PARVA_HUMAN		Epithelial(150;0.00624)	11	949_950	+			300_301			CH 2.		Q96C85|Q9HA48	Missense_Mutation	DNP	ENST00000550549.1	37	c.900_901GG>TT																																																																																					0.614	PARVA-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018222		5	3	0	0	0	0.004672	0	5	3				
LUZP2	338645	broad.mit.edu	37	11	25098931	25098931	+	Silent	SNP	A	A	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:25098931A>C	ENST00000336930.6	+	11	981	c.915A>C	c.(913-915)gcA>gcC	p.A305A	LUZP2_ENST00000533227.1_Silent_p.A219A			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	305						extracellular region (GO:0005576)		p.A305A(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						ATGCCACTGCAGAAACCGAGC	0.338																																							uc001mqs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(913-915)GCA>GCC		leucine zipper protein 2 precursor							142.0	142.0	142.0					11																	25098931		2203	4300	6503	SO:0001819	synonymous_variant	338645					extracellular region		g.chr11:25098931A>C	AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.915A>C	11.37:g.25098931A>C						LUZP2_uc009yif.2_Silent_p.A219A|LUZP2_uc009yig.2_Silent_p.A263A	p.A305A	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN			11	1149	+			305					A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Silent	SNP	ENST00000336930.6	37	c.915A>C	CCDS31446.1																																																																																				0.338	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909		22	69	0	0	0	0.004656	0	22	69				
ELP4	26610	broad.mit.edu	37	11	31648724	31648724	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:31648724G>C	ENST00000350638.5	+	6	756	c.721G>C	c.(721-723)Gat>Cat	p.D241H	ELP4_ENST00000395934.2_Missense_Mutation_p.D241H|ELP4_ENST00000379163.5_Missense_Mutation_p.D242H	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	241					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					GGAAGGATTTGATGGATCCAA	0.378																																							uc001mtb.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3						c.(721-723)GAT>CAT		elongation protein 4 homolog							104.0	89.0	94.0					11																	31648724		1801	4072	5873	SO:0001583	missense	26610				histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding	g.chr11:31648724G>C	AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.721G>C	11.37:g.31648724G>C	ENSP00000298937:p.Asp241His					ELP4_uc001mta.1_RNA|ELP4_uc001mtc.2_Missense_Mutation_p.D241H|ELP4_uc010rdz.1_Missense_Mutation_p.D242H	p.D241H	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN			6	756	+	Lung SC(675;0.225)		241					B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	ENST00000350638.5	37	c.721G>C	CCDS7875.2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163510	0.78226	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.45276	0.9;0.9;0.9	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.69214	0.3086	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.994;0.993	T	0.67898	-0.5551	10	0.40728	T	0.16	-9.952	20.024	0.97514	0.0:0.0:1.0:0.0	.	242;241;241	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	H	241;242;241	ENSP00000298937:D241H;ENSP00000368461:D242H;ENSP00000379267:D241H	ENSP00000298937:D241H	D	+	1	0	ELP4	31605300	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.705000	0.68355	2.809000	0.96659	0.655000	0.94253	GAT		0.378	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	NM_019040		3	80	0	0	0	0.004672	0	3	80				
CCDC73	493860	broad.mit.edu	37	11	32636029	32636029	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:32636029T>C	ENST00000335185.5	-	16	1878	c.1835A>G	c.(1834-1836)gAa>gGa	p.E612G	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	612								p.E612G(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					TAGAGCATGTTCTCGAGTCCC	0.333																																							uc001mtv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1834-1836)GAA>GGA		sarcoma antigen NY-SAR-79							77.0	70.0	72.0					11																	32636029		1835	4081	5916	SO:0001583	missense	493860							g.chr11:32636029T>C	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.1835A>G	11.37:g.32636029T>C	ENSP00000335325:p.Glu612Gly						p.E612G	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN			16	1879	-	Breast(20;0.112)		612					Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	c.1835A>G	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	T	8.503	0.864660	0.17250	.	.	ENSG00000186714	ENST00000335185	.	.	.	4.24	3.11	0.35812	.	0.140627	0.44902	D	0.000405	T	0.42517	0.1206	L	0.59436	1.845	0.20489	N	0.999899	B	0.19073	0.033	B	0.22601	0.04	T	0.43343	-0.9397	9	0.72032	D	0.01	.	8.3834	0.32486	0.0:0.0916:0.0:0.9084	.	612	Q6ZRK6	CCD73_HUMAN	G	612	.	ENSP00000335325:E612G	E	-	2	0	CCDC73	32592605	0.589000	0.26807	0.009000	0.14445	0.001000	0.01503	0.616000	0.24344	0.599000	0.29845	-0.353000	0.07706	GAA		0.333	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391		11	31	0	0	0	0.010729	0	11	31				
OR8H2	390151	broad.mit.edu	37	11	55872950	55872950	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:55872950C>A	ENST00000313503.1	+	1	432	c.432C>A	c.(430-432)ctC>ctA	p.L144L		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					GCCTCGCTCTCATCACTGGGC	0.443										HNSCC(53;0.14)																													uc010riy.1		NA																	0				ovary(1)|skin(1)	2						c.(430-432)CTC>CTA		olfactory receptor, family 8, subfamily H,							215.0	195.0	202.0					11																	55872950		2201	4296	6497	SO:0001819	synonymous_variant	390151				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55872950C>A	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.432C>A	11.37:g.55872950C>A		HNSCC(53;0.14)					p.L144L	NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN			1	432	+	Esophageal squamous(21;0.00693)		144			Helical; Name=4; (Potential).		Q6IFC1	Silent	SNP	ENST00000313503.1	37	c.432C>A	CCDS31518.1																																																																																				0.443	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200		7	196	1	0	1.06961e-07	0.00308	1.40356e-07	7	196				
OR5T2	219464	broad.mit.edu	37	11	56000426	56000426	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:56000426A>C	ENST00000313264.4	-	1	311	c.236T>G	c.(235-237)aTg>aGg	p.M79R		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M79R(1)		endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TAAATTTCCCATGAGAGTGAA	0.408																																							uc010rjc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(235-237)ATG>AGG		olfactory receptor, family 5, subfamily T,							73.0	69.0	71.0					11																	56000426		2201	4296	6497	SO:0001583	missense	219464				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56000426A>C	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.236T>G	11.37:g.56000426A>C	ENSP00000323688:p.Met79Arg						p.M79R	NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN			1	236	-	Esophageal squamous(21;0.00448)		79			Helical; Name=1; (Potential).		B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	37	c.236T>G	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	A	11.06	1.528372	0.27299	.	.	ENSG00000181718	ENST00000313264	T	0.00458	7.28	4.62	4.62	0.57501	.	1.003270	0.08038	U	0.994590	T	0.00524	0.0017	L	0.54908	1.71	0.09310	N	1	B	0.33883	0.43	B	0.33846	0.171	T	0.51434	-0.8706	10	0.72032	D	0.01	.	8.6971	0.34303	0.9076:0.0:0.0924:0.0	.	79	Q8NGG2	OR5T2_HUMAN	R	79	ENSP00000323688:M79R	ENSP00000323688:M79R	M	-	2	0	OR5T2	55757002	0.003000	0.15002	0.003000	0.11579	0.005000	0.04900	2.098000	0.41757	1.862000	0.54008	0.381000	0.24937	ATG		0.408	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746		11	69	0	0	0	0.010729	0	11	69				
CPT1A	1374	broad.mit.edu	37	11	68530172	68530172	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:68530172C>A	ENST00000265641.5	-	15	1952	c.1798G>T	c.(1798-1800)Ggg>Tgg	p.G600W	CPT1A_ENST00000540367.1_Missense_Mutation_p.G600W|CPT1A_ENST00000376618.2_Missense_Mutation_p.G600W|CPT1A_ENST00000539743.1_Missense_Mutation_p.G600W|CPT1A_ENST00000537756.2_5'UTR	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	600					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.G600W(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	TCCGTCCTCCCCTCTCGGAAG	0.612																																							uc001oog.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(1798-1800)GGG>TGG		carnitine palmitoyltransferase 1A liver isoform	L-Carnitine(DB00583)|Perhexiline(DB01074)						72.0	63.0	66.0					11																	68530172		2200	4294	6494	SO:0001583	missense	1374				carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity	g.chr11:68530172C>A	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1798G>T	11.37:g.68530172C>A	ENSP00000265641:p.Gly600Trp					CPT1A_uc001oof.3_Missense_Mutation_p.G600W|CPT1A_uc009ysj.2_Intron	p.G600W	NM_001876	NP_001867	P50416	CPT1A_HUMAN	LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		15	1968	-	Esophageal squamous(3;3.28e-14)		600			Cytoplasmic (Potential).		Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	c.1798G>T	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	C	31	5.061721	0.93846	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.94862	-3.54;-3.54;-3.54;-3.54	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.98573	0.9523	H	0.98559	4.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99612	1.0981	10	0.87932	D	0	.	19.2284	0.93827	0.0:1.0:0.0:0.0	.	600;600	P50416;P50416-2	CPT1A_HUMAN;.	W	600	ENSP00000439084:G600W;ENSP00000365803:G600W;ENSP00000265641:G600W;ENSP00000446108:G600W	ENSP00000265641:G600W	G	-	1	0	CPT1A	68286748	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.354000	0.79424	2.610000	0.88304	0.655000	0.94253	GGG		0.612	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876		11	27	1	0	0.000978159	0.010729	0.00109524	11	27				
FGF4	2249	broad.mit.edu	37	11	69588893	69588893	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:69588893G>T	ENST00000168712.1	-	2	661	c.343C>A	c.(343-345)Ctg>Atg	p.L115M	AP001888.1_ENST00000602104.1_5'Flank|FGF4_ENST00000538040.1_Intron	NM_002007.2	NP_001998.1	P08620	FGF4_HUMAN	fibroblast growth factor 4	115					apoptotic process involved in morphogenesis (GO:0060561)|cartilage condensation (GO:0001502)|cell-cell signaling (GO:0007267)|chondroblast differentiation (GO:0060591)|cranial suture morphogenesis (GO:0060363)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)	cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)	p.L115M(1)		lung(3)	3	Melanoma(5;1.89e-05)		LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)		Pentosan Polysulfate(DB00686)	AGCTCCAGCAGGCCTGGGGGC	0.692																																							uc001opg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(343-345)CTG>ATG		fibroblast growth factor 4 precursor	Pentosan Polysulfate(DB00686)						18.0	22.0	20.0					11																	69588893		2194	4290	6484	SO:0001583	missense	2249				cell-cell signaling|chondroblast differentiation|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|mesenchymal cell proliferation|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade	extracellular region	growth factor activity|heparin binding	g.chr11:69588893G>T	M17446	CCDS8194.1	11q13.3	2014-01-30	2008-08-01		ENSG00000075388	ENSG00000075388		"""Endogenous ligands"""	3682	protein-coding gene	gene with protein product	"""human stomach cancer, transforming factor from FGF-related oncogene"", ""kaposi sarcoma oncogene"", ""transforming protein KS3"""	164980	"""heparin secretory transforming protein 1"""	HSTF1		1611909	Standard	NM_002007		Approved	K-FGF, HBGF-4, HST, HST-1, KFGF	uc001opg.1	P08620	OTTHUMG00000167887	ENST00000168712.1:c.343C>A	11.37:g.69588893G>T	ENSP00000168712:p.Leu115Met					FGF4_uc010rqj.1_Intron	p.L115M	NM_002007	NP_001998	P08620	FGF4_HUMAN	LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)		2	662	-	Melanoma(5;1.89e-05)		115					B7U994	Missense_Mutation	SNP	ENST00000168712.1	37	c.343C>A	CCDS8194.1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885214	0.72410	.	.	ENSG00000075388	ENST00000168712	D	0.82619	-1.63	5.36	4.25	0.50352	.	0.000000	0.39407	N	0.001373	D	0.90786	0.7107	M	0.86502	2.82	0.52501	D	0.999956	D	0.76494	0.999	D	0.81914	0.995	D	0.91148	0.4951	9	.	.	.	.	10.9181	0.47148	0.1493:0.0:0.8507:0.0	.	115	P08620	FGF4_HUMAN	M	115	ENSP00000168712:L115M	.	L	-	1	2	FGF4	69298074	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.553000	0.53713	2.523000	0.85059	0.655000	0.94253	CTG		0.692	FGF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396834.2	NM_002007		4	8	1	0	0.00024832	0.009096	0.000283515	4	8				
MOGAT2	80168	broad.mit.edu	37	11	75431194	75431194	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:75431194G>T	ENST00000198801.5	+	2	319	c.249G>T	c.(247-249)atG>atT	p.M83I	MOGAT2_ENST00000526712.1_Start_Codon_SNP_p.M1I	NM_025098.2	NP_079374.2	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	83					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|intestinal absorption (GO:0050892)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|acetyltransferase activity (GO:0016407)	p.M83I(1)		NS(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	20	Ovarian(111;0.103)					GGAAGTACATGAAGGACTATT	0.602																																							uc010rru.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(247-249)ATG>ATT		monoacylglycerol O-acyltransferase 2							154.0	158.0	157.0					11																	75431194		2200	4293	6493	SO:0001583	missense	80168				glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity	g.chr11:75431194G>T	AY157608	CCDS8240.1	11q13.5	2008-02-05			ENSG00000166391	ENSG00000166391			23248	protein-coding gene	gene with protein product		610270				14970677	Standard	NM_025098		Approved	MGAT2, DGAT2L5, FLJ22644	uc010rru.2	Q3SYC2	OTTHUMG00000165341	ENST00000198801.5:c.249G>T	11.37:g.75431194G>T	ENSP00000198801:p.Met83Ile					MOGAT2_uc001oww.1_Missense_Mutation_p.M83I|MOGAT2_uc010rrv.1_Missense_Mutation_p.M1I	p.M83I	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN			2	249	+	Ovarian(111;0.103)		83					A8K7I3|Q3SYC1|Q6ZQZ2|Q86UH6|Q9H630	Missense_Mutation	SNP	ENST00000198801.5	37	c.249G>T	CCDS8240.1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887040	0.52014	.	.	ENSG00000166391	ENST00000198801;ENST00000526712	T;T	0.12984	2.63;2.63	5.04	4.13	0.48395	.	0.079974	0.85682	D	0.000000	T	0.12561	0.0305	L	0.49256	1.55	0.80722	D	1	B;B	0.28082	0.037;0.2	B;B	0.23574	0.034;0.047	T	0.05225	-1.0898	10	0.62326	D	0.03	0.6494	7.5827	0.27974	0.0843:0.0:0.7526:0.1631	.	83;83	Q3SYC2;Q3SYC2-3	MOGT2_HUMAN;.	I	83;1	ENSP00000198801:M83I;ENSP00000436283:M1I	ENSP00000198801:M83I	M	+	3	0	MOGAT2	75108842	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	1.712000	0.37940	1.348000	0.45733	0.561000	0.74099	ATG		0.602	MOGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383520.1	NM_025098		7	187	1	0	0.000157383	0.00308	0.000181837	7	187				
TMEM135	65084	broad.mit.edu	37	11	87013423	87013423	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:87013423C>T	ENST00000305494.5	+	8	676	c.637C>T	c.(637-639)Cat>Tat	p.H213Y	TMEM135_ENST00000532959.1_Missense_Mutation_p.H84Y|TMEM135_ENST00000535167.1_Missense_Mutation_p.H74Y|TMEM135_ENST00000340353.7_Missense_Mutation_p.H191Y	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	213					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)		p.H213Y(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GAGAGAGCAACATGAGGAAAA	0.383																																							uc001pch.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(637-639)CAT>TAT		transmembrane protein 135							150.0	161.0	157.0					11																	87013423		2201	4299	6500	SO:0001583	missense	65084					integral to membrane		g.chr11:87013423C>T	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.637C>T	11.37:g.87013423C>T	ENSP00000306344:p.His213Tyr					TMEM135_uc010rtt.1_Missense_Mutation_p.H74Y|TMEM135_uc001pci.2_Missense_Mutation_p.H191Y	p.H213Y	NM_022918	NP_075069	Q86UB9	TM135_HUMAN			8	660	+		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)	213					Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	ENST00000305494.5	37	c.637C>T	CCDS8280.1	.	.	.	.	.	.	.	.	.	.	C	8.404	0.842648	0.16963	.	.	ENSG00000166575	ENST00000340353;ENST00000544294;ENST00000532959;ENST00000305494;ENST00000535167	T;T;T;T	0.44482	0.96;0.92;0.95;0.92	5.55	4.64	0.57946	.	0.954412	0.08890	N	0.878771	T	0.23649	0.0572	N	0.08118	0	0.09310	N	1	B;B	0.21225	0.053;0.053	B;B	0.24394	0.053;0.036	T	0.25572	-1.0128	9	.	.	.	-11.2763	7.3962	0.26938	0.1378:0.7153:0.0:0.1469	.	191;213	Q86UB9-2;Q86UB9	.;TM135_HUMAN	Y	191;50;84;213;74	ENSP00000345513:H191Y;ENSP00000436179:H84Y;ENSP00000306344:H213Y;ENSP00000439525:H74Y	.	H	+	1	0	TMEM135	86691071	0.008000	0.16893	0.790000	0.31976	0.231000	0.25187	0.726000	0.25984	1.481000	0.48307	0.655000	0.94253	CAT		0.383	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918		16	99	0	0	0	0.003163	0	16	99				
CNTN5	53942	broad.mit.edu	37	11	100170106	100170106	+	Silent	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:100170106G>A	ENST00000524871.1	+	20	2888	c.2598G>A	c.(2596-2598)gtG>gtA	p.V866V	CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000528682.1_Silent_p.V866V|CNTN5_ENST00000279463.3_Silent_p.V866V|CNTN5_ENST00000418526.2_Silent_p.V792V|CNTN5_ENST00000527185.1_Silent_p.V866V	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	866	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.V866V(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GTCAAATTGTGGTCATCTGTT	0.328																																							uc001pga.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(2596-2598)GTG>GTA		contactin 5 isoform long							100.0	91.0	94.0					11																	100170106		1821	4072	5893	SO:0001819	synonymous_variant	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:100170106G>A	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2598G>A	11.37:g.100170106G>A						CNTN5_uc001pfz.2_Silent_p.V866V|CNTN5_uc001pgb.2_Silent_p.V792V|CNTN5_uc010ruk.1_Silent_p.V137V	p.V866V	NM_014361	NP_055176	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	20	2937	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	866			Fibronectin type-III 2.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	ENST00000524871.1	37	c.2598G>A	CCDS53696.1																																																																																				0.328	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		23	43	0	0	0	0.021523	0	23	43				
MMP3	4314	broad.mit.edu	37	11	102709383	102709383	+	Silent	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:102709383G>A	ENST00000299855.5	-	8	1384	c.1128C>T	c.(1126-1128)atC>atT	p.I376I	WTAPP1_ENST00000525739.2_RNA	NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	376					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.I376I(1)		endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	CTAGGGTGTGGATGCCTCTTG	0.383																																							uc001phj.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|kidney(1)	2						c.(1126-1128)ATC>ATT		matrix metalloproteinase 3 preproprotein	Marimastat(DB00786)|Simvastatin(DB00641)						110.0	102.0	105.0					11																	102709383		2203	4299	6502	SO:0001819	synonymous_variant	4314				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr11:102709383G>A	X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.1128C>T	11.37:g.102709383G>A							p.I376I	NM_002422	NP_002413	P08254	MMP3_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.0142)	8	1193	-		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	376			Hemopexin-like 2.		B2R8B8|Q3B7S0|Q6GRF8	Silent	SNP	ENST00000299855.5	37	c.1128C>T	CCDS8323.1	.	.	.	.	.	.	.	.	.	.	G	4.597	0.110886	0.08831	.	.	ENSG00000149968	ENST00000434103	.	.	.	5.07	4.15	0.48705	.	.	.	.	.	T	0.60508	0.2274	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58685	-0.7593	4	.	.	.	.	10.381	0.44113	0.1597:0.0:0.8403:0.0	.	.	.	.	F	20	.	.	S	-	2	0	MMP3	102214593	0.354000	0.24912	0.885000	0.34714	0.451000	0.32288	0.656000	0.24948	1.471000	0.48121	0.591000	0.81541	TCC		0.383	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109758.2	NM_002422		12	72	0	0	0	0.013537	0	12	72				
C11orf88	399949	broad.mit.edu	37	11	111385678	111385678	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:111385678C>A	ENST00000375618.4	+	1	169	c.169C>A	c.(169-171)Cgc>Agc	p.R57S	BTG4_ENST00000525791.1_5'Flank|BTG4_ENST00000356018.2_5'Flank|C11orf88_ENST00000529167.1_Missense_Mutation_p.R57S|MIR34C_ENST00000384831.1_RNA|C11orf88_ENST00000332814.6_Missense_Mutation_p.R57S|RP11-794P6.6_ENST00000530283.1_RNA|MIR34B_ENST00000385076.1_RNA	NM_001100388.1	NP_001093858.1	Q6PI97	CK088_HUMAN	chromosome 11 open reading frame 88	57								p.R57S(2)		endometrium(1)|large_intestine(3)|lung(2)	6						GCTGGTGCTGCGCAGAGACAG	0.587											OREG0021329	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001pln.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(169-171)CGC>AGC		hypothetical protein LOC399949 isoform 2							50.0	57.0	54.0					11																	111385678		2128	4261	6389	SO:0001583	missense	399949							g.chr11:111385678C>A	BC039505, AK128145	CCDS41712.1, CCDS41713.1	11q23.1	2012-08-10			ENSG00000183644	ENSG00000183644			25061	protein-coding gene	gene with protein product	"""hypothetical gene supported by BC039505"""					12477932	Standard	NM_001100388		Approved	FLJ46266	uc009yyd.3	Q6PI97	OTTHUMG00000166720	ENST00000375618.4:c.169C>A	11.37:g.111385678C>A	ENSP00000364768:p.Arg57Ser		OREG0021329	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1434	BTG4_uc001plj.2_5'Flank|BTG4_uc001plk.2_5'Flank|C11orf88_uc009yyd.2_Missense_Mutation_p.R57S|C11orf88_uc001plo.1_Missense_Mutation_p.R57S	p.R57S	NM_001100388	NP_001093858	Q6PI97	CK088_HUMAN			1	169	+			57					E9PAN0|Q6ZRL3	Missense_Mutation	SNP	ENST00000375618.4	37	c.169C>A	CCDS41713.1	.	.	.	.	.	.	.	.	.	.	C	6.255	0.415185	0.11870	.	.	ENSG00000183644	ENST00000375618;ENST00000529167;ENST00000332814	.	.	.	5.29	-4.67	0.03319	.	2.001890	0.02351	N	0.075902	T	0.07413	0.0187	N	0.01188	-0.97	0.09310	N	1	B;B	0.14805	0.011;0.002	B;B	0.10450	0.005;0.001	T	0.21655	-1.0239	9	0.02654	T	1	1.9628	0.6173	0.00771	0.354:0.2479:0.1104:0.2877	.	57;57	E9PAN0;Q6PI97	.;CK088_HUMAN	S	57	.	ENSP00000333845:R57S	R	+	1	0	C11orf88	110890888	0.000000	0.05858	0.008000	0.14137	0.446000	0.32137	-0.750000	0.04808	-1.012000	0.03387	-0.229000	0.12294	CGC		0.587	C11orf88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391181.1	NM_001100388		10	45	1	0	0.00621372	0.006214	0.00667399	10	45				
ALG10	84920	broad.mit.edu	37	12	34179553	34179553	+	Silent	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:34179553A>T	ENST00000266483.2	+	3	1444	c.1125A>T	c.(1123-1125)ccA>ccT	p.P375P	ALG10_ENST00000538927.1_Intron|AC046130.1_ENST00000401300.2_RNA|RP11-847H18.2_ENST00000501954.2_RNA	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	375					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)	p.P375P(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				TGTTAGTTCCAGCCTATATAT	0.299																																							uc001rlm.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1123-1125)CCA>CCT		asparagine-linked glycosylation 10 homolog							67.0	72.0	70.0					12																	34179553		2182	4294	6476	SO:0001819	synonymous_variant	84920				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:34179553A>T	AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.1125A>T	12.37:g.34179553A>T							p.P375P	NM_032834	NP_116223	Q5BKT4	AG10A_HUMAN			3	1444	+	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)	375			Helical; (Potential).		Q6NS98|Q96DU0|Q96SM6	Silent	SNP	ENST00000266483.2	37	c.1125A>T	CCDS41769.1																																																																																				0.299	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403309.1	NM_032834		34	88	0	0	0	0.013726	0	34	88				
NELL2	4753	broad.mit.edu	37	12	45059372	45059372	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:45059372C>A	ENST00000429094.2	-	13	1843	c.1339G>T	c.(1339-1341)Ggg>Tgg	p.G447W	NELL2_ENST00000452445.2_Missense_Mutation_p.G447W|NELL2_ENST00000437801.2_Missense_Mutation_p.G497W|NELL2_ENST00000549027.1_Missense_Mutation_p.G446W|NELL2_ENST00000395487.2_Missense_Mutation_p.G446W|NELL2_ENST00000551601.1_Missense_Mutation_p.G446W|NELL2_ENST00000333837.4_Missense_Mutation_p.G470W	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	447	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.G447W(1)|p.G497W(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TAATGGCGCCCTTCAGCACAC	0.418																																							uc001rog.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(1339-1341)GGG>TGG		NEL-like protein 2 isoform b precursor							87.0	86.0	86.0					12																	45059372		2203	4300	6503	SO:0001583	missense	4753				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity	g.chr12:45059372C>A	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1339G>T	12.37:g.45059372C>A	ENSP00000390680:p.Gly447Trp					NELL2_uc001rof.3_Missense_Mutation_p.G446W|NELL2_uc001roh.2_Missense_Mutation_p.G447W|NELL2_uc009zkd.2_Missense_Mutation_p.G446W|NELL2_uc010skz.1_Missense_Mutation_p.G497W|NELL2_uc010sla.1_Missense_Mutation_p.G470W|NELL2_uc001roi.1_Missense_Mutation_p.G447W|NELL2_uc010slb.1_Missense_Mutation_p.G446W|NELL2_uc001roj.2_Missense_Mutation_p.G447W	p.G447W	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN		GBM - Glioblastoma multiforme(48;0.092)	13	1934	-	Lung SC(27;0.192)	Lung NSC(34;0.144)	447			EGF-like 2; calcium-binding (Potential).		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	c.1339G>T	CCDS8746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.8|26.8	4.772128|4.772128	0.90108|0.90108	.|.	.|.	ENSG00000184613|ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684|ENST00000550313	D;D;D;D;D;D;D|.	0.93307|.	-3.2;-3.2;-3.2;-3.2;-3.2;-3.2;-3.2|.	5.28|5.28	5.28|5.28	0.74379|0.74379	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74535|0.74535	0.3729|0.3729	M|M	0.66378|0.66378	2.025|2.025	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;0.995;0.999;1.0;1.0;0.995|.	T|T	0.73332|0.73332	-0.4016|-0.4016	10|5	0.87932|.	D|.	0|.	-13.9032|-13.9032	18.9014|18.9014	0.92444|0.92444	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	470;497;446;447;447;446|.	B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2|.	.;.;.;.;NELL2_HUMAN;.|.	W|N	446;447;446;447;446;470;497;446|190	ENSP00000378866:G446W;ENSP00000390680:G447W;ENSP00000449332:G446W;ENSP00000394612:G447W;ENSP00000447927:G446W;ENSP00000327988:G470W;ENSP00000416341:G497W|.	ENSP00000327988:G470W|.	G|K	-|-	1|3	0|2	NELL2|NELL2	43345639|43345639	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.484000|7.484000	0.81180|0.81180	2.452000|2.452000	0.82932|0.82932	0.650000|0.650000	0.86243|0.86243	GGG|AAG		0.418	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159		8	43	1	0	2.17888e-05	0.006214	2.63281e-05	8	43				
KRT82	3888	broad.mit.edu	37	12	52797658	52797658	+	Silent	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:52797658C>T	ENST00000257974.2	-	2	524	c.447G>A	c.(445-447)gaG>gaA	p.E149E	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	149	Coil 1A.|Rod.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)	p.E149E(1)		endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		TCCACTTGGTCTCCAGCAGCT	0.567																																							uc001sai.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(445-447)GAG>GAA		keratin 82							42.0	39.0	40.0					12																	52797658		2203	4300	6503	SO:0001819	synonymous_variant	3888					keratin filament	protein binding|structural constituent of epidermis	g.chr12:52797658C>T	Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.447G>A	12.37:g.52797658C>T							p.E149E	NM_033033	NP_149022	Q9NSB4	KRT82_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.193)	2	562	-			149			Coil 1A.|Rod.			Silent	SNP	ENST00000257974.2	37	c.447G>A	CCDS8826.1																																																																																				0.567	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405189.1	NM_033033		4	28	0	0	0	0.009096	0	4	28				
ESPL1	9700	broad.mit.edu	37	12	53663492	53663492	+	Silent	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:53663492T>C	ENST00000257934.4	+	3	857	c.766T>C	c.(766-768)Ttg>Ctg	p.L256L	ESPL1_ENST00000552462.1_Silent_p.L256L	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	256					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.L256L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GGAGCTCACCTTGGAACACTG	0.587																																					Colon(53;1069 1201 2587 5382)	Colon(53;1069 1201 2587 5382)	uc001sck.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|kidney(1)|skin(1)	3						c.(766-768)TTG>CTG		separase							70.0	73.0	72.0					12																	53663492		2203	4300	6503	SO:0001819	synonymous_variant	9700				apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding	g.chr12:53663492T>C	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.766T>C	12.37:g.53663492T>C						ESPL1_uc001scj.2_5'UTR	p.L256L	NM_012291	NP_036423	Q14674	ESPL1_HUMAN			3	857	+			256						Silent	SNP	ENST00000257934.4	37	c.766T>C	CCDS8852.1																																																																																				0.587	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291		5	93	0	0	0	0.014758	0	5	93				
PDE1B	5153	broad.mit.edu	37	12	54967437	54967437	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:54967437G>T	ENST00000243052.3	+	10	1444	c.1008G>T	c.(1006-1008)atG>atT	p.M336I	PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000538346.1_Missense_Mutation_p.M295I|PDE1B_ENST00000550620.1_Missense_Mutation_p.M316I	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	336	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.M336I(1)		endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CCACAGACATGTCCTGCCATT	0.582																																							uc001sgd.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1006-1008)ATG>ATT		phosphodiesterase 1B isoform 1							147.0	133.0	138.0					12																	54967437		2203	4300	6503	SO:0001583	missense	5153				activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding	g.chr12:54967437G>T	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1008G>T	12.37:g.54967437G>T	ENSP00000243052:p.Met336Ile					PDE1B_uc010soz.1_Missense_Mutation_p.M199I|PDE1B_uc010spa.1_Missense_Mutation_p.M295I|PDE1B_uc001sgf.2_Missense_Mutation_p.M199I|PDE1B_uc001sge.2_Missense_Mutation_p.M316I|PDE1B_uc009znq.2_Missense_Mutation_p.M132I	p.M336I	NM_000924	NP_000915	Q01064	PDE1B_HUMAN			10	1174	+			336			Catalytic (By similarity).		Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	c.1008G>T	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887826	0.91814	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	D;D;D	0.82255	-1.59;-1.59;-1.59	5.24	5.24	0.73138	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.92146	0.7510	M	0.86502	2.82	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.91635	0.998;0.999	D	0.93248	0.6632	10	0.87932	D	0	.	16.7018	0.85351	0.0:0.0:1.0:0.0	.	316;336	Q01064-2;Q01064	.;PDE1B_HUMAN	I	336;295;316	ENSP00000243052:M336I;ENSP00000442559:M295I;ENSP00000448519:M316I	ENSP00000243052:M336I	M	+	3	0	PDE1B	53253704	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.732000	0.98816	2.618000	0.88619	0.655000	0.94253	ATG		0.582	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1			19	141	1	0	4.35082e-09	0.010504	5.86854e-09	19	141				
NEUROD4	58158	broad.mit.edu	37	12	55421051	55421051	+	Silent	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:55421051C>G	ENST00000242994.3	+	2	1206	c.828C>G	c.(826-828)tcC>tcG	p.S276S		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	276					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S276S(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						TAGAAAAATCCTACAGCTTCA	0.502																																							uc001sgp.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(826-828)TCC>TCG		neurogenic differentiation 4							192.0	185.0	188.0					12																	55421051		2203	4300	6503	SO:0001819	synonymous_variant	58158				amacrine cell differentiation|positive regulation of cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr12:55421051C>G	AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.828C>G	12.37:g.55421051C>G							p.S276S	NM_021191	NP_067014	Q9HD90	NDF4_HUMAN			2	1206	+			276					B2RAC9	Silent	SNP	ENST00000242994.3	37	c.828C>G	CCDS8886.1																																																																																				0.502	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406104.1			31	202	0	0	0	0.010818	0	31	202				
OR6C2	341416	broad.mit.edu	37	12	55846592	55846592	+	Missense_Mutation	SNP	C	C	T	rs141026850		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:55846592C>T	ENST00000322678.1	+	1	595	c.595C>T	c.(595-597)Ctt>Ttt	p.L199F	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	199					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L199F(1)		kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						GATGGTTATACTTATGGCTGT	0.398																																							uc001sgz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(595-597)CTT>TTT		olfactory receptor, family 6, subfamily C,		G	PHE/LEU	1,4405	2.1+/-5.4	0,1,2202	176.0	170.0	172.0		595	-10.8	0.0	12	dbSNP_134	172	0,8600		0,0,4300	no	missense	OR6C2	NM_054105.1	22	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	199/313	55846592	1,13005	2203	4300	6503	SO:0001583	missense	341416				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55846592C>T	AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.595C>T	12.37:g.55846592C>T	ENSP00000323606:p.Leu199Phe						p.L199F	NM_054105	NP_473446	Q9NZP2	OR6C2_HUMAN			1	595	+			199			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000322678.1	37	c.595C>T	CCDS31824.1	.	.	.	.	.	.	.	.	.	.	C	5.543	0.285134	0.10513	2.27E-4	0.0	ENSG00000179695	ENST00000322678	T	0.00058	8.79	5.42	-10.8	0.00216	GPCR, rhodopsin-like superfamily (1);	0.850231	0.10179	N	0.706165	T	0.00039	0.0001	N	0.05306	-0.075	0.09310	N	1	B	0.11235	0.004	B	0.16722	0.016	T	0.42849	-0.9427	10	0.23891	T	0.37	.	4.3516	0.11158	0.505:0.1645:0.2225:0.108	.	199	Q9NZP2	OR6C2_HUMAN	F	199	ENSP00000323606:L199F	ENSP00000323606:L199F	L	+	1	0	OR6C2	54132859	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-9.544000	0.00010	-4.340000	0.00055	-0.167000	0.13348	CTT		0.398	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406676.1	NM_054105		13	148	0	0	0	0.016723	0	13	148				
BEST3	144453	broad.mit.edu	37	12	70048953	70048953	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:70048953C>G	ENST00000330891.5	-	10	1967	c.1741G>C	c.(1741-1743)Gac>Cac	p.D581H	BEST3_ENST00000488961.1_Missense_Mutation_p.D368H|BEST3_ENST00000331471.4_Intron|BEST3_ENST00000553096.1_Missense_Mutation_p.D475H	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	581					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.D581H(1)		cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			TCACCAGGGTCTTCTTCACAG	0.532																																							uc001svg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1741-1743)GAC>CAC		vitelliform macular dystrophy 2-like 3 isoform							49.0	47.0	48.0					12																	70048953		1847	4088	5935	SO:0001583	missense	144453					chloride channel complex|plasma membrane	chloride channel activity	g.chr12:70048953C>G	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1741G>C	12.37:g.70048953C>G	ENSP00000332413:p.Asp581His					BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.D368H|BEST3_uc010stm.1_Missense_Mutation_p.D475H	p.D581H	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)		10	1968	-	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		581			Cytoplasmic (Potential).		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	37	c.1741G>C	CCDS8992.2	.	.	.	.	.	.	.	.	.	.	C	14.31	2.495904	0.44352	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.98178	-4.42;-4.77;-4.73	5.53	2.0	0.26442	.	1.450810	0.04085	N	0.310374	D	0.94778	0.8314	L	0.27053	0.805	0.09310	N	1	P;B	0.41041	0.736;0.077	B;B	0.38712	0.28;0.069	D	0.91398	0.5141	10	0.28530	T	0.3	-6.7448	3.8883	0.09108	0.2283:0.5066:0.0:0.2651	.	581;368	Q8N1M1;B5MDI8	BEST3_HUMAN;.	H	368;581;475	ENSP00000433213:D368H;ENSP00000332413:D581H;ENSP00000449548:D475H	ENSP00000332413:D581H	D	-	1	0	BEST3	68335220	0.001000	0.12720	0.008000	0.14137	0.099000	0.18886	1.134000	0.31442	0.558000	0.29135	-0.244000	0.11960	GAC		0.532	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439		3	36	0	0	0	0.004672	0	3	36				
CDK17	5128	broad.mit.edu	37	12	96688884	96688884	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:96688884A>G	ENST00000261211.3	-	10	1493	c.890T>C	c.(889-891)aTt>aCt	p.I297T	CDK17_ENST00000553042.1_5'UTR|CDK17_ENST00000542666.1_Missense_Mutation_p.I244T|CDK17_ENST00000543119.2_Missense_Mutation_p.I297T	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	297	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.I297T(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						ACCACGTAGAATTTGGTACAG	0.348																																							uc001tep.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7						c.(889-891)ATT>ACT		PCTAIRE protein kinase 2							97.0	92.0	94.0					12																	96688884		2203	4300	6503	SO:0001583	missense	5128						ATP binding|cyclin-dependent protein kinase activity	g.chr12:96688884A>G		CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.890T>C	12.37:g.96688884A>G	ENSP00000261211:p.Ile297Thr					CDK17_uc009ztk.2_Missense_Mutation_p.I297T|CDK17_uc010svb.1_Missense_Mutation_p.I244T	p.I297T	NM_002595	NP_002586	Q00537	CDK17_HUMAN			10	1379	-			297			Protein kinase.		A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	ENST00000261211.3	37	c.890T>C	CCDS9061.1	.	.	.	.	.	.	.	.	.	.	A	18.90	3.721862	0.68959	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666	T;T;T	0.69926	-0.44;-0.44;-0.44	4.98	4.98	0.66077	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045975	0.85682	D	0.000000	T	0.73659	0.3615	M	0.75884	2.315	0.58432	D	0.999997	P;P	0.45212	0.853;0.853	P;P	0.48089	0.566;0.566	T	0.78610	-0.2137	10	0.87932	D	0	-6.7867	14.9531	0.71091	1.0:0.0:0.0:0.0	.	297;297	A8K1U6;Q00537	.;CDK17_HUMAN	T	297;297;244	ENSP00000261211:I297T;ENSP00000444459:I297T;ENSP00000442926:I244T	ENSP00000261211:I297T	I	-	2	0	CDK17	95213015	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	9.195000	0.94971	2.003000	0.58678	0.402000	0.26972	ATT		0.348	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408751.1	NM_002595		7	62	0	0	0	0.001984	0	7	62				
TDG	6996	broad.mit.edu	37	12	104373742	104373742	+	Silent	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:104373742C>T	ENST00000392872.3	+	3	534	c.300C>T	c.(298-300)gaC>gaT	p.D100D	TDG_ENST00000542036.1_5'UTR|TDG_ENST00000266775.9_Silent_p.D96D|TDG_ENST00000544861.1_5'UTR	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase	100					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)	p.D100D(1)		large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		AAATTACAGACACATTTAAAG	0.358								Base excision repair (BER), DNA glycosylases																															uc001tkg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(3)	6						c.(298-300)GAC>GAT	BER_DNA_glycosylases	thymine-DNA glycosylase							71.0	69.0	69.0					12																	104373742		2203	4300	6503	SO:0001819	synonymous_variant	6996				depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity	g.chr12:104373742C>T	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.300C>T	12.37:g.104373742C>T						TDG_uc010swh.1_Silent_p.D100D|TDG_uc009zuk.2_Silent_p.D96D|TDG_uc010swi.1_5'UTR|TDG_uc010swj.1_5'UTR	p.D100D	NM_003211	NP_003202	Q13569	TDG_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.00114)	3	523	+			100					Q8IUZ6|Q8IZM3	Silent	SNP	ENST00000392872.3	37	c.300C>T	CCDS9095.1																																																																																				0.358	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2			4	61	0	0	0	0.014758	0	4	61				
RIMBP2	23504	broad.mit.edu	37	12	130926814	130926814	+	Silent	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr12:130926814G>A	ENST00000261655.4	-	8	1195	c.1032C>T	c.(1030-1032)ctC>ctT	p.L344L	RIMBP2_ENST00000536002.1_Silent_p.L252L|RIMBP2_ENST00000535703.1_Silent_p.L252L	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	344	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.L344L(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCCCCAGCGTGAGGTTCATGC	0.612																																							uc001uil.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11						c.(1030-1032)CTC>CTT		RIM-binding protein 2							194.0	184.0	188.0					12																	130926814		2203	4300	6503	SO:0001819	synonymous_variant	23504					cell junction|synapse		g.chr12:130926814G>A	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1032C>T	12.37:g.130926814G>A						RIMBP2_uc001uim.2_Silent_p.L252L|RIMBP2_uc001uin.1_Silent_p.L3L	p.L344L	NM_015347	NP_056162	O15034	RIMB2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)	8	1196	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	344			Fibronectin type-III 1.		Q96ID2	Silent	SNP	ENST00000261655.4	37	c.1032C>T	CCDS31925.1																																																																																				0.612	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347		10	76	0	0	0	0.008291	0	10	76				
FLT1	2321	broad.mit.edu	37	13	29012365	29012365	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr13:29012365A>G	ENST00000282397.4	-	4	757	c.506T>C	c.(505-507)tTa>tCa	p.L169S	FLT1_ENST00000539099.1_Missense_Mutation_p.L169S|FLT1_ENST00000541932.1_Missense_Mutation_p.L169S	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	169	Ig-like C2-type 2.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.L169S(2)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TACCTTTTTTAAAGTAACAGT	0.383																																							uc001usb.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24						c.(505-507)TTA>TCA		fms-related tyrosine kinase 1 isoform 1	Sunitinib(DB01268)						106.0	96.0	99.0					13																	29012365		2203	4300	6503	SO:0001583	missense	2321				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity	g.chr13:29012365A>G	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.506T>C	13.37:g.29012365A>G	ENSP00000282397:p.Leu169Ser					FLT1_uc010aar.1_Missense_Mutation_p.L169S|FLT1_uc001usc.3_Missense_Mutation_p.L169S|FLT1_uc010tdp.1_Missense_Mutation_p.L169S	p.L169S	NM_002019	NP_002010	P17948	VGFR1_HUMAN	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	4	791	-	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	169			Ig-like C2-type 2.|Extracellular (Potential).		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	c.506T>C	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.273222	0.80580	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000450836;ENST00000539099	T;T;T	0.05258	3.47;3.47;3.47	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.29321	0.0730	M	0.82517	2.595	0.54753	D	0.999982	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	T	0.01748	-1.1282	10	0.56958	D	0.05	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	169;169;169;169	P17948-4;P17948-3;P17948-2;P17948	.;.;.;VGFR1_HUMAN	S	169	ENSP00000282397:L169S;ENSP00000437631:L169S;ENSP00000442630:L169S	ENSP00000282397:L169S	L	-	2	0	FLT1	27910365	1.000000	0.71417	0.832000	0.32986	0.729000	0.41735	8.153000	0.89640	2.308000	0.77769	0.533000	0.62120	TTA		0.383	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			4	34	0	0	0	0.014758	0	4	34				
DCLK1	9201	broad.mit.edu	37	13	36382450	36382450	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr13:36382450C>A	ENST00000360631.3	-	14	1985	c.1774G>T	c.(1774-1776)Gat>Tat	p.D592Y	DCLK1_ENST00000379893.1_Missense_Mutation_p.D285Y|DCLK1_ENST00000255448.4_Missense_Mutation_p.D592Y			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	592	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.D592Y(2)|p.D285Y(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TCCTGGTCATCACCACTTCTG	0.448																																							uc001uvf.2		NA																	3	Substitution - Missense(3)		lung(3)	stomach(6)|ovary(2)|skin(1)	9						c.(1774-1776)GAT>TAT		doublecortin-like kinase 1							189.0	177.0	181.0					13																	36382450		2203	4300	6503	SO:0001583	missense	9201				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity	g.chr13:36382450C>A	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1774G>T	13.37:g.36382450C>A	ENSP00000353846:p.Asp592Tyr					DCLK1_uc001uve.3_Missense_Mutation_p.D285Y|DCLK1_uc010teh.1_Missense_Mutation_p.D285Y|DCLK1_uc010abk.2_Missense_Mutation_p.D112Y	p.D592Y	NM_004734	NP_004725	O15075	DCLK1_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)	14	2007	-		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	592			Protein kinase.		B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37	c.1774G>T		.	.	.	.	.	.	.	.	.	.	C	20.7	4.039839	0.75732	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.65916	-0.18;-0.18;-0.18	5.51	4.67	0.58626	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70202	0.3197	L	0.48935	1.535	0.80722	D	1	P;D;D;P	0.58970	0.82;0.984;0.964;0.711	P;P;P;P	0.59643	0.504;0.861;0.785;0.504	T	0.73652	-0.3915	10	0.87932	D	0	.	14.5124	0.67797	0.0:0.9292:0.0:0.0708	.	285;592;592;285	O15075-4;O15075;O15075-2;O15075-3	.;DCLK1_HUMAN;.;.	Y	284;592;592;285;574	ENSP00000255448:D592Y;ENSP00000353846:D592Y;ENSP00000369223:D285Y	ENSP00000255448:D592Y	D	-	1	0	DCLK1	35280450	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.731000	0.84895	1.330000	0.45394	0.563000	0.77884	GAT		0.448	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734		16	53	1	0	1.01871e-10	0.008871	1.4553e-10	16	53				
OR4M1	441670	broad.mit.edu	37	14	20248934	20248934	+	Silent	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr14:20248934G>T	ENST00000315957.4	+	1	534	c.453G>T	c.(451-453)ggG>ggT	p.G151G		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G151G(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTGGATGGGGGGCTTCATTC	0.502																																							uc010tku.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(451-453)GGG>GGT		olfactory receptor, family 4, subfamily M,							251.0	262.0	258.0					14																	20248934		2203	4300	6503	SO:0001819	synonymous_variant	441670				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20248934G>T		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.453G>T	14.37:g.20248934G>T							p.G151G	NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	453	+	all_cancers(95;0.00108)		151			Helical; Name=4; (Potential).		B9EH18|Q6IFA3	Silent	SNP	ENST00000315957.4	37	c.453G>T	CCDS32021.1																																																																																				0.502	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1			105	106	1	0	2.03867e-50	0.01441	3.39778e-50	105	106				
CTSG	1511	broad.mit.edu	37	14	25044575	25044575	+	Silent	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr14:25044575G>T	ENST00000216336.2	-	2	135	c.99C>A	c.(97-99)ccC>ccA	p.P33P		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	33	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.P33P(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		ACGCCATGTAGGGGCGGGAGT	0.572																																							uc001wpq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(97-99)CCC>CCA		cathepsin G preproprotein							115.0	116.0	116.0					14																	25044575		2203	4300	6503	SO:0001819	synonymous_variant	1511				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity	g.chr14:25044575G>T	M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.99C>A	14.37:g.25044575G>T							p.P33P	NM_001911	NP_001902	P08311	CATG_HUMAN		GBM - Glioblastoma multiforme(265;0.0269)	2	136	-			33			Peptidase S1.		Q6IBJ6|Q9UCA5|Q9UCU6	Silent	SNP	ENST00000216336.2	37	c.99C>A	CCDS9631.1																																																																																				0.572	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	NM_001911		53	66	1	0	1.19553e-41	0.01441	1.98116e-41	53	66				
FSCB	84075	broad.mit.edu	37	14	44973895	44973896	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr14:44973895_44973896CC>AA	ENST00000340446.4	-	1	2586_2587	c.2295_2296GG>TT	c.(2293-2298)gtGGca>gtTTca	p.A766S	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	766						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)	p.A766S(1)		breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GGAATTCCTGCCACCTGCGGTG	0.426																																							uc001wvn.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9						c.(2293-2298)GTGGCA>GTTTCA		fibrous sheath CABYR binding protein																																				SO:0001583	missense	84075					cilium		g.chr14:44973895_44973896CC>AA	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.2295_2296delinsAA	14.37:g.44973895_44973896delinsAA	ENSP00000344579:p.Ala766Ser						p.A766S	NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN		GBM - Glioblastoma multiforme(112;0.128)	1	2604_2605	-			766					Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	DNP	ENST00000340446.4	37	c.2295_2296GG>TT	CCDS9679.1																																																																																				0.426	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		43	107	0	0	0	0.004672	0	43	107				
FLVCR2	55640	broad.mit.edu	37	14	76045408	76045408	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr14:76045408C>A	ENST00000238667.4	+	1	449	c.93C>A	c.(91-93)ccC>ccA	p.P31P	AC007182.6_ENST00000455232.1_RNA	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	31	8 X 6 AA tandem repeats of P-S-[VS]-S- [VIAG]-[HNP].				heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)	p.P31P(2)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		CGGTCCATCCCAGCGTCTCGG	0.642																																							uc001xrs.2		NA																	2	Substitution - coding silent(2)		lung(1)|kidney(1)		0						c.(91-93)CCC>CCA		feline leukemia virus subgroup C cellular							100.0	103.0	102.0					14																	76045408		2203	4300	6503	SO:0001819	synonymous_variant	55640				transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity	g.chr14:76045408C>A	AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.93C>A	14.37:g.76045408C>A							p.P31P	NM_017791	NP_060261	Q9UPI3	FLVC2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.029)	1	469	+			31			8 X 6 AA tandem repeats of P-S-[VS]-S- [VIAG]-[HNP].|2.		B7Z485|Q53ZT9|Q96JY3|Q9NX90	Silent	SNP	ENST00000238667.4	37	c.93C>A	CCDS9844.1																																																																																				0.642	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413672.1	NM_017791		38	38	1	0	3.33393e-15	0.021022	5.08864e-15	38	38				
DISP2	85455	broad.mit.edu	37	15	40660665	40660665	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr15:40660665C>A	ENST00000267889.3	+	8	2439	c.2352C>A	c.(2350-2352)ggC>ggA	p.G784G	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	784					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)		p.G784G(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		TGGACACTGGCGACCCTCTGG	0.682																																							uc001zlk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(2350-2352)GGC>GGA		dispatched B							73.0	80.0	78.0					15																	40660665		2203	4299	6502	SO:0001819	synonymous_variant	85455				smoothened signaling pathway	integral to membrane		g.chr15:40660665C>A	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2352C>A	15.37:g.40660665C>A							p.G784G	NM_033510	NP_277045	A7MBM2	DISP2_HUMAN		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)	8	2441	+		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	784					Q6AHW3|Q9C0C1	Silent	SNP	ENST00000267889.3	37	c.2352C>A	CCDS10056.1																																																																																				0.682	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510		13	58	1	0	0.000151284	0.016723	0.000177621	13	58				
IQGAP1	8826	broad.mit.edu	37	15	90984897	90984897	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr15:90984897T>C	ENST00000268182.5	+	8	933	c.809T>C	c.(808-810)aTg>aCg	p.M270T	IQGAP1_ENST00000560738.1_Intron	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	270					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)	p.M270T(1)		breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CAGGACAAAATGACAAATGCT	0.348																																							uc002bpl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8						c.(808-810)ATG>ACG		IQ motif containing GTPase activating protein 1							61.0	57.0	59.0					15																	90984897		2198	4298	6496	SO:0001583	missense	8826				energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity	g.chr15:90984897T>C	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.809T>C	15.37:g.90984897T>C	ENSP00000268182:p.Met270Thr						p.M270T	NM_003870	NP_003861	P46940	IQGA1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)		8	910	+	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		270					A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	c.809T>C	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	T	5.292	0.239279	0.10023	.	.	ENSG00000140575	ENST00000268182	T	0.44083	0.93	5.15	5.15	0.70609	.	0.048636	0.85682	D	0.000000	T	0.23611	0.0571	N	0.17474	0.49	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10776	-1.0615	10	0.13853	T	0.58	-29.6752	8.8829	0.35384	0.0:0.0824:0.0:0.9176	.	270	P46940	IQGA1_HUMAN	T	270	ENSP00000268182:M270T	ENSP00000268182:M270T	M	+	2	0	IQGAP1	88785901	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.715000	0.37971	2.144000	0.66660	0.533000	0.62120	ATG		0.348	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870		8	41	0	0	0	0.00308	0	8	41				
PCSK6	5046	broad.mit.edu	37	15	101906498	101906498	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr15:101906498T>A	ENST00000348070.1	-	14	1757	c.1758A>T	c.(1756-1758)gaA>gaT	p.E586D	PCSK6_ENST00000331826.7_Missense_Mutation_p.E421D|PCSK6_ENST00000344273.2_Missense_Mutation_p.E586D|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000398181.2_Missense_Mutation_p.E586D|PCSK6_ENST00000358417.3_Missense_Mutation_p.E586D	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	587					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)	p.E586D(3)|p.E421D(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CAGTCATGAATTCCCAGTTTG	0.537																																							uc002bwy.2		NA																	4	Substitution - Missense(4)		lung(4)	pancreas(2)	2						c.(1759-1761)GAA>GAT		paired basic amino acid cleaving system 4							83.0	81.0	81.0					15																	101906498		1909	4125	6034	SO:0001583	missense	5046				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity	g.chr15:101906498T>A		CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.1758A>T	15.37:g.101906498T>A	ENSP00000305056:p.Glu586Asp					PCSK6_uc010bpd.2_Missense_Mutation_p.E383D|PCSK6_uc010bpe.2_Missense_Mutation_p.E587D|PCSK6_uc002bxa.2_Missense_Mutation_p.E587D|PCSK6_uc002bxb.2_Missense_Mutation_p.E587D|PCSK6_uc002bxc.1_Missense_Mutation_p.E587D|PCSK6_uc002bxd.1_Missense_Mutation_p.E587D|PCSK6_uc002bxe.2_Missense_Mutation_p.E587D|PCSK6_uc002bxf.1_Missense_Mutation_p.E87D	p.E587D	NM_002570	NP_002561	P29122	PCSK6_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		14	2075	-	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		587			Homo B/P.		Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Missense_Mutation	SNP	ENST00000348070.1	37	c.1761A>T		.	.	.	.	.	.	.	.	.	.	T	17.90	3.503043	0.64298	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185;ENST00000344273;ENST00000398181;ENST00000331826	T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05	5.1	1.58	0.23477	Proprotein convertase, P (1);Galactose-binding domain-like (1);	0.050783	0.85682	N	0.000000	D	0.82495	0.5049	L	0.58354	1.805	0.41065	D	0.9854	D;D;D;P;D;D;D;D;D	0.71674	0.982;0.977;0.967;0.951;0.985;0.961;0.998;0.982;0.973	P;P;P;P;D;P;D;P;D	0.77557	0.755;0.814;0.874;0.82;0.928;0.887;0.99;0.88;0.923	T	0.78362	-0.2233	10	0.40728	T	0.16	-28.5804	9.1596	0.37014	0.0:0.5972:0.0:0.4028	.	587;418;587;587;586;586;587;587;586	P29122;Q59H04;P29122-2;P29122-4;E7EWH5;E7EQ62;P29122-8;P29122-7;E7EM82	PCSK6_HUMAN;.;.;.;.;.;.;.;.	D	586;586;417;586;586;421	ENSP00000305056:E586D;ENSP00000351193:E586D;ENSP00000344410:E586D;ENSP00000381243:E586D;ENSP00000332052:E421D	ENSP00000332052:E421D	E	-	3	2	PCSK6	99724021	0.309000	0.24518	0.999000	0.59377	0.998000	0.95712	-0.378000	0.07446	0.026000	0.15269	0.533000	0.62120	GAA		0.537	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_002570		5	29	0	0	0	0.014758	0	5	29				
RBFOX1	54715	broad.mit.edu	37	16	7703884	7703884	+	Silent	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr16:7703884C>T	ENST00000550418.1	+	12	1813	c.825C>T	c.(823-825)cgC>cgT	p.R275R	RBFOX1_ENST00000535565.2_Silent_p.R232R|RBFOX1_ENST00000436368.2_Silent_p.R295R|RBFOX1_ENST00000422070.4_Silent_p.R318R|RBFOX1_ENST00000355637.4_Silent_p.R295R|RBFOX1_ENST00000552089.1_Silent_p.R292R|RBFOX1_ENST00000340209.4_Silent_p.R280R|RBFOX1_ENST00000311745.5_Silent_p.R295R|RBFOX1_ENST00000553186.1_Silent_p.R248R|RBFOX1_ENST00000547372.1_Silent_p.R318R|RBFOX1_ENST00000547338.1_Silent_p.R275R	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	275					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.R295R(2)|p.R275R(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						TGCGAGGCCGCGGTCGCACCG	0.731																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	3	Substitution - coding silent(3)		lung(3)		0						c.(823-825)CGC>CGT		ataxin 2-binding protein 1 isoform 4							12.0	15.0	14.0					16																	7703884		1878	3862	5740	SO:0001819	synonymous_variant	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7703884C>T	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.825C>T	16.37:g.7703884C>T						A2BP1_uc010buf.1_Silent_p.R275R|A2BP1_uc002cyr.1_Silent_p.R274R|A2BP1_uc002cyt.2_Silent_p.R248R|A2BP1_uc010uxz.1_Silent_p.R318R|A2BP1_uc010uya.1_Silent_p.R232R|A2BP1_uc002cyv.1_Silent_p.R275R|A2BP1_uc010uyb.1_Silent_p.R275R|A2BP1_uc002cyw.2_Silent_p.R295R|A2BP1_uc002cyy.2_Silent_p.R295R|A2BP1_uc002cyx.2_Silent_p.R295R|A2BP1_uc010uyc.1_Silent_p.R268R	p.R275R	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	12	1813	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	275					Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Silent	SNP	ENST00000550418.1	37	c.825C>T	CCDS55983.1																																																																																				0.731	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		4	29	0	0	0	0.009096	0	4	29				
NPIPA1	9284	broad.mit.edu	37	16	15026684	15026684	+	Splice_Site	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr16:15026684G>C	ENST00000472413.1	+	16	3444		c.e16-1					Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1						mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											CGCCTCTGCAGGGCTCAGCCC	0.642																																							uc002dcx.3		NA																	0					0						c.e8-1		Homo sapiens neuroblastoma cDNA, clone:Nbla00537, full insert sequence.																																				SO:0001630	splice_region_variant	9284				mRNA transport|protein transport|transmembrane transport	nuclear membrane|nuclear pore		g.chr16:15026684G>C	AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000472413.1:c.3445-1G>C	16.37:g.15026684G>C										Q9UND3	NPIP_HUMAN			8		+								O15102	Splice_Site	SNP	ENST00000472413.1	37	c.1247_splice																																																																																					0.642	NPIPA1-002	KNOWN	basic|readthrough_transcript	processed_transcript	protein_coding	OTTHUMT00000207327.1	NM_006985	Intron	14	80	0	0	0	0.016723	0	14	80				
ACSM2B	348158	broad.mit.edu	37	16	20548643	20548643	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr16:20548643T>G	ENST00000329697.6	-	14	1839	c.1671A>C	c.(1669-1671)aaA>aaC	p.K557N	ACSM2B_ENST00000567001.1_Missense_Mutation_p.K557N|ACSM2B_ENST00000565232.1_Missense_Mutation_p.K557N|ACSM2B_ENST00000565322.1_Missense_Mutation_p.K478N	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	557					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)	p.K557N(1)		breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						TTCGTTGAATTTTCCCTGTGA	0.473																																							uc002dhj.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|central_nervous_system(1)	5						c.(1669-1671)AAA>AAC		acyl-CoA synthetase medium-chain family member							242.0	224.0	230.0					16																	20548643		2202	4300	6502	SO:0001583	missense	348158				fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding	g.chr16:20548643T>G	AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.1671A>C	16.37:g.20548643T>G	ENSP00000327453:p.Lys557Asn					ACSM2B_uc002dhk.3_Missense_Mutation_p.K557N	p.K557N	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN			15	1881	-			557				ATP (By similarity).	Q86YT1	Missense_Mutation	SNP	ENST00000329697.6	37	c.1671A>C	CCDS10586.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.339284	0.41398	.	.	ENSG00000066813	ENST00000329697	D	0.82619	-1.63	3.09	3.09	0.35607	.	0.000000	0.46758	D	0.000267	D	0.93488	0.7922	H	0.99026	4.405	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92460	0.5977	10	0.87932	D	0	-16.2671	6.6619	0.23018	0.0:0.114:0.0:0.886	.	557	Q68CK6	ACS2B_HUMAN	N	557	ENSP00000327453:K557N	ENSP00000327453:K557N	K	-	3	2	ACSM2B	20456144	0.970000	0.33590	0.932000	0.37286	0.150000	0.21749	-0.062000	0.11674	1.395000	0.46643	0.496000	0.49642	AAA		0.473	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254417.2	NM_182617		65	222	0	0	0	0.01441	0	65	222				
CDIPT	10423	broad.mit.edu	37	16	29874031	29874031	+	Silent	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr16:29874031C>T	ENST00000219789.6	-	2	932	c.54G>A	c.(52-54)cgG>cgA	p.R18R	CDIPT_ENST00000566113.1_Intron|CDIPT_ENST00000570016.1_Silent_p.R18R|CDIPT_ENST00000569956.1_Silent_p.R18R|CDIPT_ENST00000563415.1_Silent_p.R18R|CDIPT_ENST00000561555.1_5'Flank|CDIPT-AS1_ENST00000565014.1_RNA|CDIPT-AS1_ENST00000398859.3_RNA	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase	18					CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)	p.R18R(1)		endometrium(1)|lung(3)	4						CGAAGACAATCCGGGCATAAC	0.652																																							uc002dum.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(52-54)CGG>CGA		CDP-diacylglycerol-inositol							76.0	74.0	75.0					16																	29874031		2197	4300	6497	SO:0001819	synonymous_variant	10423					endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity|phosphatidylinositol transporter activity	g.chr16:29874031C>T	AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144	ENST00000219789.6:c.54G>A	16.37:g.29874031C>T						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|CDIPT_uc002duk.2_5'Flank|CDIPT_uc002dul.2_5'UTR|CDIPT_uc002dun.2_Intron|LOC440356_uc010veb.1_5'Flank|LOC440356_uc002duo.2_5'Flank	p.R18R	NM_006319	NP_006310	O14735	CDIPT_HUMAN			2	454	-			18			Helical; (Potential).		B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	Silent	SNP	ENST00000219789.6	37	c.54G>A	CCDS10657.1																																																																																				0.652	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255147.3	NM_006319		11	47	0	0	0	0.008291	0	11	47				
ZNF720	124411	broad.mit.edu	37	16	31734594	31734594	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr16:31734594A>T	ENST00000316491.9	+	3	345	c.146A>T	c.(145-147)aAg>aTg	p.K49M	ZNF720_ENST00000534369.1_Intron|ZNF720_ENST00000399681.3_5'UTR|ZNF720_ENST00000531864.2_Intron|ZNF720_ENST00000398696.3_Intron|ZNF720_ENST00000539915.1_Intron	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720	49	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)	p.K49M(1)		endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						GCTGTCTCTAAGCCGGACCTG	0.468																																							uc002ecn.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(145-147)AAG>ATG		zinc finger protein 720							66.0	60.0	62.0					16																	31734594		692	1591	2283	SO:0001583	missense	124411				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding	g.chr16:31734594A>T	AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.146A>T	16.37:g.31734594A>T	ENSP00000319222:p.Lys49Met					ZNF720_uc010vfs.1_Translation_Start_Site|ZNF720_uc002eco.2_Intron|ZNF720_uc002ecp.1_Intron|ZNF720_uc002ecq.2_Missense_Mutation_p.K51M	p.K49M	NM_001130913	NP_001124385	Q7Z2F6	ZN720_HUMAN			3	350	+			49			KRAB.		Q6ZQX1	Missense_Mutation	SNP	ENST00000316491.9	37	c.146A>T	CCDS45473.1	.	.	.	.	.	.	.	.	.	.	a	0.376	-0.931327	0.02359	.	.	ENSG00000197302	ENST00000316491;ENST00000530881;ENST00000529515	T;T;T	0.00949	5.51;5.51;5.51	1.51	1.51	0.23008	Krueppel-associated box (3);	.	.	.	.	T	0.04497	0.0123	M	0.89904	3.07	0.21020	N	0.999801	D	0.64830	0.994	P	0.60173	0.87	T	0.22208	-1.0223	9	0.72032	D	0.01	.	5.0135	0.14324	1.0:0.0:0.0:0.0	.	49	Q7Z2F6	ZN720_HUMAN	M	49;90;49	ENSP00000319222:K49M;ENSP00000435171:K90M;ENSP00000437310:K49M	ENSP00000319222:K49M	K	+	2	0	ZNF720	31642095	0.002000	0.14202	0.172000	0.22920	0.411000	0.31082	0.990000	0.29642	0.696000	0.31696	0.260000	0.18958	AAG		0.468	ZNF720-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394883.3	NM_001004300		7	24	0	0	0	0.004482	0	7	24				
KCTD19	146212	broad.mit.edu	37	16	67328886	67328886	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr16:67328886C>T	ENST00000304372.5	-	10	1520	c.1465G>A	c.(1465-1467)Gaa>Aaa	p.E489K		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	489					protein homooligomerization (GO:0051260)			p.E489K(1)		endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		TTGTATGCTTCACATTGTGCA	0.443																																							uc002esu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1465-1467)GAA>AAA		potassium channel tetramerisation domain							78.0	74.0	75.0					16																	67328886		1912	4116	6028	SO:0001583	missense	146212					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr16:67328886C>T	AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.1465G>A	16.37:g.67328886C>T	ENSP00000305702:p.Glu489Lys					KCTD19_uc002est.2_Missense_Mutation_p.E261K|KCTD19_uc010vjj.1_Missense_Mutation_p.E232K	p.E489K	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)	10	1516	-		Ovarian(137;0.192)	489					B4DZ49|Q8N804	Missense_Mutation	SNP	ENST00000304372.5	37	c.1465G>A	CCDS42179.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.028905	0.54790	.	.	ENSG00000168676	ENST00000304372	T	0.42513	0.97	5.63	4.67	0.58626	BTB/POZ fold (2);	0.283792	0.30547	N	0.009397	T	0.26955	0.0660	N	0.16790	0.44	0.35327	D	0.785316	B	0.24258	0.1	B	0.19148	0.024	T	0.24584	-1.0156	10	0.23891	T	0.37	-9.7852	13.7203	0.62723	0.0:0.8458:0.1542:0.0	.	489	Q17RG1	KCD19_HUMAN	K	489	ENSP00000305702:E489K	ENSP00000305702:E489K	E	-	1	0	KCTD19	65886387	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	2.243000	0.43115	1.378000	0.46305	0.655000	0.94253	GAA		0.443	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367		14	40	0	0	0	0.016723	0	14	40				
PDXDC2P	283970	broad.mit.edu	37	16	70012166	70012166	+	RNA	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr16:70012166G>A	ENST00000531894.1	-	0	2519				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)	p.Q189*(2)|p.Q157*(1)									CGCAACTCTTGCGCACGTTGA	0.453																																							uc010vlq.1		NA																	3	Substitution - Nonsense(3)		lung(3)		0						c.(469-471)CAA>TAA		SubName: Full=Putative uncharacterized protein;																																						283970							g.chr16:70012166G>A			16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70012166G>A						CLEC18C_uc002exy.2_Intron|PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_Intron	p.Q157*							5	647	-								A8K9Z5	Nonsense_Mutation	SNP	ENST00000531894.1	37	c.469C>T		.	.	.	.	.	.	.	.	.	.	.	48	14.453677	0.99796	.	.	ENSG00000226232	ENST00000532298;ENST00000325845	.	.	.	0.659	-0.769	0.11009	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	.	.	.	.	.	.	.	X	189;157	.	ENSP00000449128:Q157X	Q	-	1	0	RP11-419C5.2	68569667	0.000000	0.05858	0.007000	0.13788	0.002000	0.02628	-0.384000	0.07389	-0.175000	0.10725	-0.976000	0.02587	CAA		0.453	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000395258.1			32	123	0	0	0	0.021022	0	32	123				
PSMD7	5713	broad.mit.edu	37	16	74339302	74339302	+	Missense_Mutation	SNP	G	G	A	rs115842956	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr16:74339302G>A	ENST00000219313.4	+	7	786	c.646G>A	c.(646-648)Gcc>Acc	p.A216T	AC009120.6_ENST00000565313.1_RNA|AC009120.6_ENST00000566411.1_RNA|PSMD7_ENST00000567958.1_Intron|PSMD7_ENST00000540379.1_Missense_Mutation_p.A139T	NM_002811.4	NP_002802.2	P51665	PSMD7_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 7	216				A -> G (in Ref. 1; BAA08780). {ECO:0000305}.	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	protein homodimerization activity (GO:0042803)	p.A216T(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	15						GGAAAAAGTCGCCACAGGCAA	0.552													.|||	3	0.000599042	0.0	0.0	5008	,	,		17475	0.003		0.0	False		,,,				2504	0.0						uc002fcq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(646-648)GCC>ACC		proteasome 26S non-ATPase subunit 7							58.0	53.0	54.0					16																	74339302		2198	4300	6498	SO:0001583	missense	5713				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding	g.chr16:74339302G>A	D50063	CCDS10910.1	16q22.3	2010-10-15	2007-07-06		ENSG00000103035	ENSG00000103035		"""Proteasome (prosome, macropain) subunits"""	9565	protein-coding gene	gene with protein product	"""Mov34 homolog"""	157970	"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog)"""			7755639	Standard	NM_002811		Approved	S12, P40, MOV34, Rpn8	uc002fcq.3	P51665	OTTHUMG00000137601	ENST00000219313.4:c.646G>A	16.37:g.74339302G>A	ENSP00000219313:p.Ala216Thr					PSMD7_uc010vmr.1_Missense_Mutation_p.A139T	p.A216T	NM_002811	NP_002802	P51665	PSD7_HUMAN			7	778	+			216	A -> G (in Ref. 1; BAA08780).				D3DWS9|Q6PKI2|Q96E97	Missense_Mutation	SNP	ENST00000219313.4	37	c.646G>A	CCDS10910.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	14.89	2.670609	0.47781	.	.	ENSG00000103035	ENST00000219313;ENST00000540379	T;T	0.44881	0.91;0.92	5.68	4.73	0.59995	.	0.202648	0.51477	N	0.000093	T	0.33352	0.0860	M	0.73962	2.25	0.50313	D	0.999869	B	0.18610	0.029	B	0.18561	0.022	T	0.23154	-1.0196	10	0.30078	T	0.28	-24.5903	9.7891	0.40695	0.0704:0.0:0.7917:0.138	.	216	P51665	PSD7_HUMAN	T	216;139	ENSP00000219313:A216T;ENSP00000443925:A139T	ENSP00000219313:A216T	A	+	1	0	PSMD7	72896803	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.630000	0.67805	1.397000	0.46682	0.650000	0.86243	GCC		0.552	PSMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269010.2	NM_002811		13	20	0	0	0	0.016723	0	13	20				
FOXL1	2300	broad.mit.edu	37	16	86613358	86613358	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr16:86613358C>A	ENST00000320241.3	+	1	1244	c.1029C>A	c.(1027-1029)caC>caA	p.H343Q		NM_005250.2	NP_005241.1	Q12952	FOXL1_HUMAN	forkhead box L1	343					heart development (GO:0007507)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|Peyer's patch morphogenesis (GO:0061146)|proteoglycan biosynthetic process (GO:0030166)|regulation of Wnt signaling pathway (GO:0030111)|transcription, DNA-templated (GO:0006351)|visceral mesoderm-endoderm interaction involved in midgut development (GO:0007495)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H343Q(1)		central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(2)|prostate(3)|skin(1)|urinary_tract(1)	15						CGGTACTCCACTTCCAGTAAA	0.587																																					NSCLC(163;308 2020 10889 11476 18208)	NSCLC(163;308 2020 10889 11476 18208)	uc002fjr.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1027-1029)CAC>CAA		forkhead box L1							32.0	36.0	35.0					16																	86613358		2198	4300	6498	SO:0001583	missense	2300				brain development|camera-type eye development|cartilage development|embryo development|forelimb morphogenesis|heart development|organ morphogenesis|pattern specification process|proteoglycan biosynthetic process|regulation of sequence-specific DNA binding transcription factor activity|regulation of Wnt receptor signaling pathway|visceral mesoderm-endoderm interaction involved in midgut development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr16:86613358C>A	AF315075	CCDS10959.1	16q24	2014-07-15			ENSG00000176678	ENSG00000176678		"""Forkhead boxes"""	3817	protein-coding gene	gene with protein product		603252		FKHL11		7957066	Standard	NM_005250		Approved	FREAC7, FKH6	uc002fjr.3	Q12952	OTTHUMG00000137653	ENST00000320241.3:c.1029C>A	16.37:g.86613358C>A	ENSP00000326272:p.His343Gln						p.H343Q	NM_005250	NP_005241	Q12952	FOXL1_HUMAN			1	1244	+			343					Q17RR1|Q9H242	Missense_Mutation	SNP	ENST00000320241.3	37	c.1029C>A	CCDS10959.1	.	.	.	.	.	.	.	.	.	.	C	8.974	0.973724	0.18736	.	.	ENSG00000176678	ENST00000320241	D	0.94376	-3.41	4.79	-1.83	0.07833	.	1.128570	0.06784	U	0.785859	D	0.82268	0.5000	N	0.08118	0	0.18873	N	0.999986	B	0.13145	0.007	B	0.08055	0.003	T	0.69128	-0.5227	10	0.22706	T	0.39	.	5.5538	0.17105	0.1346:0.4778:0.0:0.3876	.	343	Q12952	FOXL1_HUMAN	Q	343	ENSP00000326272:H343Q	ENSP00000326272:H343Q	H	+	3	2	FOXL1	85170859	0.000000	0.05858	0.286000	0.24833	0.463000	0.32649	-0.599000	0.05700	-0.175000	0.10725	0.456000	0.33151	CAC		0.587	FOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269105.2	NM_005250		12	28	1	0	4.3838e-07	0.016723	5.60045e-07	12	28				
ZZEF1	23140	broad.mit.edu	37	17	3984731	3984731	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:3984731T>C	ENST00000381638.2	-	18	2892	c.2768A>G	c.(2767-2769)aAg>aGg	p.K923R	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	923							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.K923R(1)		central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GATGTTCATCTTGGCCAGGTC	0.498																																							uc002fxe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(2767-2769)AAG>AGG		zinc finger, ZZ type with EF hand domain 1							136.0	123.0	128.0					17																	3984731		2203	4300	6503	SO:0001583	missense	23140						calcium ion binding|zinc ion binding	g.chr17:3984731T>C	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.2768A>G	17.37:g.3984731T>C	ENSP00000371051:p.Lys923Arg					ZZEF1_uc002fxk.1_Missense_Mutation_p.K924R	p.K923R	NM_015113	NP_055928	O43149	ZZEF1_HUMAN			18	2832	-			923					A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	c.2768A>G	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.066718	0.36470	.	.	ENSG00000074755	ENST00000381638	T	0.20598	2.06	5.36	-2.65	0.06095	.	0.667620	0.16257	N	0.222444	T	0.08891	0.0220	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.001	T	0.21655	-1.0239	10	0.87932	D	0	-0.1472	7.5719	0.27913	0.0:0.363:0.1179:0.5191	.	924;923	O43149-3;O43149	.;ZZEF1_HUMAN	R	923	ENSP00000371051:K923R	ENSP00000371051:K923R	K	-	2	0	ZZEF1	3931480	0.843000	0.29541	0.018000	0.16275	0.561000	0.35649	1.413000	0.34725	-0.389000	0.07786	-0.326000	0.08463	AAG		0.498	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113		28	44	0	0	0	0.007291	0	28	44				
WSCD1	23302	broad.mit.edu	37	17	6021387	6021387	+	Silent	SNP	T	T	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:6021387T>A	ENST00000574946.1	+	8	1644	c.1254T>A	c.(1252-1254)atT>atA	p.I418I	WSCD1_ENST00000539421.1_Silent_p.I418I|WSCD1_ENST00000317744.5_Silent_p.I418I|WSCD1_ENST00000574232.1_Silent_p.I418I|WSCD1_ENST00000573634.1_Silent_p.I302I			Q658N2	WSCD1_HUMAN	WSC domain containing 1	418						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.I418I(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						GGAGGGAGATTGAGATGTTTG	0.547																																							uc010cli.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1252-1254)ATT>ATA		WSC domain containing 1							83.0	78.0	80.0					17																	6021387		2203	4300	6503	SO:0001819	synonymous_variant	23302					integral to membrane	sulfotransferase activity	g.chr17:6021387T>A		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1254T>A	17.37:g.6021387T>A						WSCD1_uc002gcn.2_Silent_p.I418I|WSCD1_uc002gco.2_Silent_p.I418I|WSCD1_uc010clj.2_Silent_p.I109I	p.I418I	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN			8	1633	+			418					A8K0N8|D3DTM3|O60276|Q96G45	Silent	SNP	ENST00000574946.1	37	c.1254T>A	CCDS32538.1																																																																																				0.547	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253		13	33	0	0	0	0.016723	0	13	33				
TP53	7157	broad.mit.edu	37	17	7579358	7579358	+	Missense_Mutation	SNP	C	C	A	rs11540654|rs587780066	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:7579358C>A	ENST00000269305.4	-	4	518	c.329G>T	c.(328-330)cGt>cTt	p.R110L	TP53_ENST00000455263.2_Missense_Mutation_p.R110L|TP53_ENST00000413465.2_Missense_Mutation_p.R110L|TP53_ENST00000359597.4_Missense_Mutation_p.R110L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R110L|TP53_ENST00000445888.2_Missense_Mutation_p.R110L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	110	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in a sporadic cancer; somatic mutation).|R -> H (in sporadic cancers; somatic mutation).|R -> L (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation).|R -> P (in sporadic cancers; somatic mutation; dbSNP:rs11540654). {ECO:0000269|PubMed:17224074}.|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R110L(36)|p.R110P(9)|p.0?(8)|p.G59fs*23(3)|p.R110fs*13(2)|p.F109_R110delFR(2)|p.R110H(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.R110fs*39(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAGCCCAGACGGAAACCGTA	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		71	Substitution - Missense(47)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(3)|Complex - deletion inframe(2)|Insertion - Frameshift(1)	p.R110L(24)|p.R110P(8)|p.0?(7)|p.R110fs*13(5)|p.R110C(4)|p.G59fs*23(3)|p.F109_R110delFR(2)|p.R110H(2)|p.V73fs*9(1)|p.F109_R110insXX(1)|p.G105_T125del21(1)|p.R110fs*18(1)|p.Y107fs*44(1)|p.R110fs*39(1)|p.Y103_G112>C(1)|p.R110S(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.Y103_L111>L(1)	upper_aerodigestive_tract(15)|lung(13)|breast(8)|large_intestine(5)|urinary_tract(5)|liver(4)|bone(4)|soft_tissue(3)|oesophagus(3)|ovary(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|skin(1)|pancreas(1)|autonomic_ganglia(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM984590	TP53	M	rs11540654	c.(328-330)CGT>CTT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							63.0	60.0	61.0					17																	7579358		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579358C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.329G>T	17.37:g.7579358C>A	ENSP00000269305:p.Arg110Leu	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.R110L|TP53_uc002gih.2_Missense_Mutation_p.R110L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Missense_Mutation_p.R110L|TP53_uc010cni.1_Missense_Mutation_p.R110L|TP53_uc002gij.2_Missense_Mutation_p.R110L|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Missense_Mutation_p.R71L|TP53_uc010cnk.1_Missense_Mutation_p.R125L	p.R110L	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	523	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	110		R -> G (in a sporadic cancer; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> H (in sporadic cancers; somatic mutation).|R -> L (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).	Interaction with HIPK1 (By similarity).||Interaction with WWOX.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.329G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.091694	0.55968	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99766	-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69	4.75	-0.964	0.10326	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.808524	0.11806	N	0.527643	D	0.99242	0.9736	L	0.52759	1.655	0.09310	N	1	P;P;P;B;B;B;P	0.51537	0.946;0.941;0.459;0.347;0.373;0.362;0.782	P;P;B;B;B;P;B	0.57152	0.523;0.814;0.269;0.211;0.405;0.49;0.337	D	0.99938	1.1378	10	0.66056	D	0.02	-0.2466	4.9119	0.13825	0.0:0.3943:0.154:0.4517	rs11540654;rs11540654	71;110;110;110;110;110;110	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	110	ENSP00000410739:R110L;ENSP00000352610:R110L;ENSP00000269305:R110L;ENSP00000398846:R110L;ENSP00000391127:R110L;ENSP00000391478:R110L;ENSP00000424104:R110L;ENSP00000426252:R110L	ENSP00000269305:R110L	R	-	2	0	TP53	7520083	0.012000	0.17670	0.014000	0.15608	0.952000	0.60782	0.563000	0.23547	-0.185000	0.10550	0.655000	0.94253	CGT		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		21	44	1	0	1.96292e-10	0.010504	2.73677e-10	21	44				
MYH3	4621	broad.mit.edu	37	17	10535949	10535949	+	Silent	SNP	G	G	A	rs551564834		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:10535949G>A	ENST00000583535.1	-	34	4887	c.4800C>T	c.(4798-4800)agC>agT	p.S1600S	MYH3_ENST00000226209.7_Silent_p.S1600S	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1600					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.S1600S(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CGTCCAGGGCGCTCTGCATGG	0.527													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17688	0.0		0.0	False		,,,				2504	0.0						uc002gmq.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(4798-4800)AGC>AGT		myosin, heavy chain 3, skeletal muscle,							258.0	248.0	251.0					17																	10535949		2203	4300	6503	SO:0001819	synonymous_variant	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10535949G>A		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.4800C>T	17.37:g.10535949G>A							p.S1600S	NM_002470	NP_002461	P11055	MYH3_HUMAN			33	4877	-			1600			Potential.		Q15492	Silent	SNP	ENST00000583535.1	37	c.4800C>T	CCDS11157.1																																																																																				0.527	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		7	234	0	0	0	0.00308	0	7	234				
GGNBP2	79893	broad.mit.edu	37	17	34942353	34942353	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:34942353G>T	ENST00000304718.4	+	11	1766	c.1450G>T	c.(1450-1452)Gat>Tat	p.D484Y		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	484					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.D484Y(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GGAGGGTTCGGATGTTGCCTG	0.418																																							uc002hnb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1450-1452)GAT>TAT		zinc finger protein 403							166.0	168.0	167.0					17																	34942353		2203	4300	6503	SO:0001583	missense	79893				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle		g.chr17:34942353G>T	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1450G>T	17.37:g.34942353G>T	ENSP00000307617:p.Asp484Tyr					GGNBP2_uc002hna.2_3'UTR|GGNBP2_uc002hnc.1_Missense_Mutation_p.D313Y	p.D484Y	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)	11	1699	+		Breast(25;0.00957)|Ovarian(249;0.17)	484					B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	37	c.1450G>T	CCDS11314.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078820	0.76528	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.72	5.72	0.89469	.	0.095718	0.64402	D	0.000002	T	0.67411	0.2890	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.943	T	0.70425	-0.4875	9	0.87932	D	0	-21.7681	19.8729	0.96856	0.0:0.0:1.0:0.0	.	484;484	A8K3S2;Q9H3C7	.;GGNB2_HUMAN	Y	484	.	ENSP00000307617:D484Y	D	+	1	0	GGNBP2	32016466	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	7.220000	0.78008	2.699000	0.92147	0.561000	0.74099	GAT		0.418	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835		28	93	1	0	3.00307e-07	0.008361	3.85349e-07	28	93				
ADAM11	4185	broad.mit.edu	37	17	42850753	42850753	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:42850753G>A	ENST00000200557.6	+	11	1119	c.950G>A	c.(949-951)cGg>cAg	p.R317Q	ADAM11_ENST00000535346.1_Missense_Mutation_p.R117Q	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	317	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R317Q(2)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				GTCTACCGACGGGAGGGTCTG	0.622																																							uc002ihh.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)	1						c.(949-951)CGG>CAG		ADAM metallopeptidase domain 11 preproprotein							86.0	77.0	80.0					17																	42850753		2203	4300	6503	SO:0001583	missense	4185				integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr17:42850753G>A	D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.950G>A	17.37:g.42850753G>A	ENSP00000200557:p.Arg317Gln					ADAM11_uc010wjd.1_Missense_Mutation_p.R117Q	p.R317Q	NM_002390	NP_002381	O75078	ADA11_HUMAN			11	950	+		Prostate(33;0.0959)	317			Extracellular (Potential).|Peptidase M12B.		Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	37	c.950G>A	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.199849	0.38905	.	.	ENSG00000073670	ENST00000200557;ENST00000535346;ENST00000355638	T;T	0.62639	0.01;0.01	4.77	4.77	0.60923	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.079753	0.50627	D	0.000102	T	0.32526	0.0832	N	0.11131	0.1	0.40883	D	0.984011	B;P	0.40638	0.046;0.725	B;B	0.26969	0.007;0.075	T	0.31998	-0.9923	10	0.14252	T	0.57	.	10.9033	0.47065	0.0901:0.0:0.9099:0.0	.	117;317	B4DKD2;O75078	.;ADA11_HUMAN	Q	317;117;217	ENSP00000200557:R317Q;ENSP00000443773:R117Q	ENSP00000200557:R317Q	R	+	2	0	ADAM11	40206279	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.947000	0.29082	2.478000	0.83669	0.561000	0.74099	CGG		0.622	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390		4	49	0	0	0	0.014758	0	4	49				
MSI2	124540	broad.mit.edu	37	17	55478805	55478805	+	Silent	SNP	A	A	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:55478805A>C	ENST00000284073.2	+	6	587	c.378A>C	c.(376-378)gtA>gtC	p.V126V	MSI2_ENST00000579180.1_Silent_p.V22V|MSI2_ENST00000322684.3_Silent_p.V122V|MSI2_ENST00000442934.2_Silent_p.V65V|MSI2_ENST00000416426.2_Silent_p.V104V	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	126	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)	p.V126V(1)|p.V122V(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		TGGAAGATGTAAAGCAATATT	0.463			T	HOXA9	CML																																		uc002iuz.1		NA		Dom	yes		17	17q23.2	124540	T	musashi homolog 2 (Drosophila)			L	HOXA9		CML		2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)|pancreas(1)	2						c.(376-378)GTA>GTC		musashi 2 isoform a							142.0	131.0	135.0					17																	55478805		2203	4300	6503	SO:0001819	synonymous_variant	124540					cytoplasm	nucleotide binding|RNA binding	g.chr17:55478805A>C	BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.378A>C	17.37:g.55478805A>C						MSI2_uc010wnm.1_Silent_p.V104V|MSI2_uc002iva.2_Silent_p.V122V	p.V126V	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN		GBM - Glioblastoma multiforme(1;0.0025)	6	551	+	Breast(9;1.78e-08)		126			RRM 2.		Q7Z6M7|Q8N9T4	Silent	SNP	ENST00000284073.2	37	c.378A>C	CCDS11596.1																																																																																				0.463	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441813.1			14	82	0	0	0	0.004007	0	14	82				
PPM1D	8493	broad.mit.edu	37	17	58678193	58678193	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:58678193G>T	ENST00000305921.3	+	1	650	c.418G>T	c.(418-420)Gct>Tct	p.A140S		NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	140	PP2C-like.				G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.A140S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			TAAGGTTTGCGCTGCCATCCG	0.592																																							uc002iyt.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(418-420)GCT>TCT		protein phosphatase 1D							64.0	53.0	56.0					17																	58678193		1981	4022	6003	SO:0001583	missense	8493				negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity	g.chr17:58678193G>T	U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.418G>T	17.37:g.58678193G>T	ENSP00000306682:p.Ala140Ser					PPM1D_uc010ddm.1_RNA	p.A140S	NM_003620	NP_003611	O15297	PPM1D_HUMAN	Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)		1	640	+	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		140			PP2C-like.		Q53XP4|Q6P991|Q8IVR6	Missense_Mutation	SNP	ENST00000305921.3	37	c.418G>T	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023137	0.54683	.	.	ENSG00000170836	ENST00000305921;ENST00000392995	T;T	0.18502	2.21;2.21	5.07	4.07	0.47477	Protein phosphatase 2C-like (4);	0.268966	0.35407	N	0.003234	T	0.09468	0.0233	N	0.13003	0.285	0.44477	D	0.997417	P	0.37370	0.592	B	0.37304	0.246	T	0.15665	-1.0429	10	0.08381	T	0.77	-13.499	13.0514	0.58957	0.0817:0.0:0.9183:0.0	.	140	O15297	PPM1D_HUMAN	S	140	ENSP00000306682:A140S;ENSP00000376720:A140S	ENSP00000306682:A140S	A	+	1	0	PPM1D	56032975	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.508000	0.35769	2.628000	0.89032	0.655000	0.94253	GCT		0.592	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620		23	37	1	0	2.89027e-11	0.014323	4.17004e-11	23	37				
ABCA6	23460	broad.mit.edu	37	17	67119514	67119514	+	Silent	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:67119514G>A	ENST00000284425.2	-	10	1476	c.1302C>T	c.(1300-1302)ttC>ttT	p.F434F		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	434					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.F434L(1)|p.F434F(1)		breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					ATGAATTCAAGAAAAATAAAG	0.363																																							uc002jhw.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		large_intestine(1)|lung(1)	upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7						c.(1300-1302)TTC>TTT		ATP-binding cassette, sub-family A, member 6							95.0	92.0	93.0					17																	67119514		2203	4300	6503	SO:0001819	synonymous_variant	23460				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67119514G>A	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.1302C>T	17.37:g.67119514G>A							p.F434F	NM_080284	NP_525023	Q8N139	ABCA6_HUMAN			10	1477	-	Breast(10;5.65e-12)		434					Q6NSH9|Q8N856|Q8WWZ6	Silent	SNP	ENST00000284425.2	37	c.1302C>T	CCDS11683.1																																																																																				0.363	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284		6	32	0	0	0	0.001168	0	6	32				
KCNJ16	3773	broad.mit.edu	37	17	68128482	68128482	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:68128482G>A	ENST00000589377.1	+	2	417	c.254G>A	c.(253-255)tGg>tAg	p.W85*	KCNJ16_ENST00000585558.1_Nonsense_Mutation_p.W120*|KCNJ16_ENST00000586462.1_Nonsense_Mutation_p.W124*|KCNJ16_ENST00000283936.1_Nonsense_Mutation_p.W85*|KCNJ16_ENST00000392670.1_Nonsense_Mutation_p.W85*|KCNJ16_ENST00000392671.1_Nonsense_Mutation_p.W85*	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	85					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)	p.W85*(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					ATTCTCTCGTGGTTGATATTT	0.418																																							uc002jin.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(253-255)TGG>TAG		potassium inwardly-rectifying channel J16							236.0	208.0	217.0					17																	68128482		2203	4300	6503	SO:0001587	stop_gained	3773				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity	g.chr17:68128482G>A	AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.254G>A	17.37:g.68128482G>A	ENSP00000465967:p.Trp85*					KCNJ16_uc002jio.2_Nonsense_Mutation_p.W85*|KCNJ16_uc002jip.2_Nonsense_Mutation_p.W85*|KCNJ16_uc002jiq.2_Nonsense_Mutation_p.W117*	p.W85*	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN			5	740	+	Breast(10;2.96e-09)		85			Helical; Name=M1; (By similarity).			Nonsense_Mutation	SNP	ENST00000589377.1	37	c.254G>A	CCDS11687.1	.	.	.	.	.	.	.	.	.	.	G	36	5.779336	0.96929	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2348	0.98355	0.0:0.0:1.0:0.0	.	.	.	.	X	85	.	.	W	+	2	0	KCNJ16	65640077	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	9.771000	0.98977	2.880000	0.98712	0.650000	0.86243	TGG		0.418	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450880.1	NM_018658		8	92	0	0	0	0.004482	0	8	92				
GPR142	350383	broad.mit.edu	37	17	72368476	72368476	+	Missense_Mutation	SNP	G	G	A	rs199997380		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:72368476G>A	ENST00000335666.4	+	4	1174	c.1126G>A	c.(1126-1128)Gtc>Atc	p.V376I		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	376						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V376L(2)|p.V376I(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CCGGGTCTTCGTCATGCTCTA	0.662													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18964	0.0		0.0	False		,,,				2504	0.0						uc010wqy.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1126-1128)GTC>ATC		G protein-coupled receptor 142							116.0	99.0	105.0					17																	72368476		2203	4300	6503	SO:0001583	missense	350383					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity	g.chr17:72368476G>A	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.1126G>A	17.37:g.72368476G>A	ENSP00000335158:p.Val376Ile					GPR142_uc010wqx.1_Missense_Mutation_p.V288I	p.V376I	NM_181790	NP_861455	Q7Z601	GP142_HUMAN			4	1126	+			376			Helical; Name=6; (Potential).		A4CYJ8|Q86SL3	Missense_Mutation	SNP	ENST00000335666.4	37	c.1126G>A	CCDS11698.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	23.8	4.462387	0.84425	.	.	ENSG00000257008	ENST00000335666	T	0.72942	-0.7	4.62	4.62	0.57501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83631	0.5296	M	0.73598	2.24	0.47037	D	0.999299	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.993	D	0.84372	0.0544	10	0.48119	T	0.1	-38.2793	18.0348	0.89296	0.0:0.0:1.0:0.0	.	376;1338	Q7Z601;Q8NGB0	GP142_HUMAN;.	I	376	ENSP00000335158:V376I	ENSP00000335158:V376I	V	+	1	0	GPR142	69880071	1.000000	0.71417	0.951000	0.38953	0.936000	0.57629	4.493000	0.60341	2.524000	0.85096	0.556000	0.70494	GTC		0.662	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790		11	59	0	0	0	0.008291	0	11	59				
ITGB4	3691	broad.mit.edu	37	17	73748568	73748568	+	Missense_Mutation	SNP	G	G	T	rs140930313		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:73748568G>T	ENST00000200181.3	+	32	4205	c.4018G>T	c.(4018-4020)Ggg>Tgg	p.G1340W	ITGB4_ENST00000339591.3_Missense_Mutation_p.G1340W|ITGB4_ENST00000449880.2_Missense_Mutation_p.G1340W|GALK1_ENST00000225614.2_Intron|ITGB4_ENST00000579662.1_Missense_Mutation_p.G1340W|ITGB4_ENST00000450894.3_Missense_Mutation_p.G1340W	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1340					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)	p.G1340W(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGCCCAGAGCGGGGAGGACTA	0.652																																							uc002jpg.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)	4						c.(4018-4020)GGG>TGG		integrin beta 4 isoform 1 precursor							106.0	102.0	103.0					17																	73748568		2203	4300	6503	SO:0001583	missense	3691				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity	g.chr17:73748568G>T		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.4018G>T	17.37:g.73748568G>T	ENSP00000200181:p.Gly1340Trp					ITGB4_uc002jph.2_Missense_Mutation_p.G1340W|ITGB4_uc002jpi.3_Missense_Mutation_p.G1340W|ITGB4_uc002jpj.2_Missense_Mutation_p.G1340W|GALK1_uc010wsi.1_Intron	p.G1340W	NM_000213	NP_000204	P16144	ITB4_HUMAN	all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)		32	4205	+	all_cancers(13;1.5e-07)		1340			Cytoplasmic (Potential).		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	37	c.4018G>T	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668072	0.47677	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.79141	-1.24;-1.2;-1.2	4.31	4.31	0.51392	.	0.000000	0.85682	D	0.000000	D	0.83170	0.5196	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85769	0.1354	10	0.87932	D	0	.	16.9575	0.86263	0.0:0.0:1.0:0.0	.	1340;1340;1340	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	W	1340	ENSP00000200181:G1340W;ENSP00000344079:G1340W;ENSP00000400217:G1340W	ENSP00000200181:G1340W	G	+	1	0	ITGB4	71260163	1.000000	0.71417	0.988000	0.46212	0.965000	0.64279	7.694000	0.84235	2.207000	0.71202	0.561000	0.74099	GGG		0.652	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1			9	75	1	0	0.00829132	0.008291	0.00887263	9	75				
CYTH1	9267	broad.mit.edu	37	17	76705803	76705803	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:76705803G>T	ENST00000446868.3	-	2	104	c.34C>A	c.(34-36)Ctg>Atg	p.L12M	CYTH1_ENST00000361101.4_Missense_Mutation_p.L12M|CYTH1_ENST00000589296.1_Missense_Mutation_p.L12M|CYTH1_ENST00000585509.1_De_novo_Start_InFrame|CYTH1_ENST00000591455.1_Missense_Mutation_p.L12M|CYTH1_ENST00000589297.1_De_novo_Start_InFrame			Q15438	CYH1_HUMAN	cytohesin 1	12					establishment of epithelial cell polarity (GO:0090162)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)	p.L12M(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	19						TCTGCTGTCAGGTCACTGGGA	0.473																																							uc002jvw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(34-36)CTG>ATG		cytohesin 1 isoform 2							141.0	120.0	127.0					17																	76705803		2203	4300	6503	SO:0001583	missense	9267				regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding	g.chr17:76705803G>T	M85169	CCDS32754.1, CCDS42392.2	17q25	2014-05-02	2008-08-14	2008-08-14	ENSG00000108669	ENSG00000108669		"""Pleckstrin homology (PH) domain containing"""	9501	protein-coding gene	gene with protein product		182115	"""pleckstrin homology, Sec7 and coiled-coil domains 1"""	PSCD1		1511013, 8449036, 21628335, 20018626	Standard	XM_006722180		Approved	B2-1, D17S811E, cytohesin-1	uc002jvw.3	Q15438	OTTHUMG00000150253	ENST00000446868.3:c.34C>A	17.37:g.76705803G>T	ENSP00000389095:p.Leu12Met					CYTH1_uc010wtw.1_Translation_Start_Site|CYTH1_uc010wtx.1_Translation_Start_Site	p.L12M	NM_017456	NP_059430	Q15438	CYH1_HUMAN			2	105	-			12			Potential.		A6NFW7|B7Z1T4|Q9P123|Q9P124	Missense_Mutation	SNP	ENST00000446868.3	37	c.34C>A		.	.	.	.	.	.	.	.	.	.	G	28.0	4.883575	0.91740	.	.	ENSG00000108669	ENST00000446868;ENST00000361101;ENST00000392457;ENST00000262763;ENST00000434577;ENST00000416418	T;T	0.19806	2.12;2.12	5.56	5.56	0.83823	.	0.062035	0.64402	D	0.000003	T	0.54775	0.1879	M	0.87456	2.885	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.61153	-0.7120	10	0.66056	D	0.02	.	19.5343	0.95242	0.0:0.0:1.0:0.0	.	12	Q15438-2	.	M	12;12;12;12;23;14	ENSP00000389095:L12M;ENSP00000354398:L12M	ENSP00000262763:L12M	L	-	1	2	CYTH1	74217398	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.242000	0.78210	2.601000	0.87937	0.655000	0.94253	CTG		0.473	CYTH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317099.1	NM_004762		15	52	1	0	1.5739e-10	0.004007	2.21568e-10	15	52				
CARD14	79092	broad.mit.edu	37	17	78176159	78176159	+	Missense_Mutation	SNP	G	G	A	rs202094920		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:78176159G>A	ENST00000573882.1	+	17	2695	c.2159G>A	c.(2158-2160)cGc>cAc	p.R720H	CARD14_ENST00000344227.2_Missense_Mutation_p.R720H|RP11-334C17.5_ENST00000570309.1_RNA|CARD14_ENST00000570421.1_Missense_Mutation_p.R720H|RP11-334C17.5_ENST00000573935.1_RNA|RP11-334C17.5_ENST00000573346.1_RNA|CARD14_ENST00000392434.2_Missense_Mutation_p.A441T|RP11-334C17.5_ENST00000572730.1_RNA|RP11-334C17.5_ENST00000576824.1_RNA			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	720					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)	p.R720H(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CATGCCCACCGCGTGAACTCT	0.637																																							uc002jxw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(2158-2160)CGC>CAC		caspase recruitment domain protein 14 isoform 1							64.0	54.0	57.0					17																	78176159		2203	4300	6503	SO:0001583	missense	79092				activation of NF-kappaB-inducing kinase activity|positive regulation of protein phosphorylation|regulation of apoptosis	aggresome|cytoplasm|plasma membrane	CARD domain binding	g.chr17:78176159G>A	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.2159G>A	17.37:g.78176159G>A	ENSP00000458715:p.Arg720His					CARD14_uc002jxt.1_RNA|CARD14_uc002jxv.2_Missense_Mutation_p.R720H|CARD14_uc010wud.1_RNA	p.R720H	NM_024110	NP_077015	Q9BXL6	CAR14_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)		15	2354	+	all_neural(118;0.0952)		720					B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	37	c.2159G>A	CCDS11768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	9.681|9.681	1.149227|1.149227	0.21288|0.21288	.|.	.|.	ENSG00000141527|ENSG00000141527	ENST00000392434|ENST00000344227	T|T	0.17370|0.05139	2.28|3.49	4.63|4.63	0.343|0.343	0.16001|0.16001	.|.	.|0.405934	.|0.27393	.|N	.|0.019574	T|T	0.07593|0.07593	0.0191|0.0191	M|M	0.66378|0.66378	2.025|2.025	0.19575|0.19575	N|N	0.999963|0.999963	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.23904|0.23904	-1.0175|-1.0175	7|10	0.87932|0.45353	D|T	0|0.12	-9.8147|-9.8147	7.9975|7.9975	0.30277|0.30277	0.4465:0.0:0.5535:0.0|0.4465:0.0:0.5535:0.0	.|.	.|720	.|Q9BXL6	.|CAR14_HUMAN	T|H	441|720	ENSP00000376229:A441T|ENSP00000344549:R720H	ENSP00000376229:A441T|ENSP00000344549:R720H	A|R	+|+	1|2	0|0	CARD14|CARD14	75790754|75790754	0.763000|0.763000	0.28462|0.28462	0.253000|0.253000	0.24343|0.24343	0.780000|0.780000	0.44128|0.44128	1.428000|1.428000	0.34892|0.34892	0.065000|0.065000	0.16485|0.16485	-0.215000|-0.215000	0.12644|0.12644	GCG|CGC		0.637	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1			10	25	0	0	0	0.008291	0	10	25				
OR7G1	125962	broad.mit.edu	37	19	9226302	9226302	+	Silent	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:9226302G>C	ENST00000541538.1	-	1	137	c.138C>G	c.(136-138)ctC>ctG	p.L46L	OR7G1_ENST00000293614.1_Silent_p.L46L	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L46L(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						TGACAGCCAGGAGAATGAGCA	0.488																																							uc002mks.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(136-138)CTC>CTG		olfactory receptor, family 7, subfamily G,							146.0	137.0	140.0					19																	9226302		2203	4300	6503	SO:0001819	synonymous_variant	125962				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9226302G>C		CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.138C>G	19.37:g.9226302G>C							p.L46L	NM_001005192	NP_001005192	Q8NGA0	OR7G1_HUMAN			1	138	-			46			Helical; Name=1; (Potential).		Q6IFJ5|Q96RA1	Silent	SNP	ENST00000541538.1	37	c.138C>G	CCDS32898.2																																																																																				0.488	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397912.1			16	86	0	0	0	0.004007	0	16	86				
ZNF99	7652	broad.mit.edu	37	19	22940301	22940301	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:22940301G>A	ENST00000596209.1	-	4	2500	c.2410C>T	c.(2410-2412)Ctt>Ttt	p.L804F	ZNF99_ENST00000397104.3_Missense_Mutation_p.L713F|CTC-451A6.4_ENST00000442497.2_lincRNA	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	804					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L713F(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TGTTTTCTAAGGGTTGAGGAA	0.338																																							uc010xrh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2137-2139)CTT>TTT		zinc finger protein 99							30.0	33.0	32.0					19																	22940301		2038	4201	6239	SO:0001583	missense	7652							g.chr19:22940301G>A	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2410C>T	19.37:g.22940301G>A	ENSP00000472969:p.Leu804Phe						p.L713F	NM_001080409	NP_001073878					5	2137	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.2137C>T	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	g	10.39	1.337345	0.24253	.	.	ENSG00000213973	ENST00000397104	T	0.26810	1.71	1.26	1.26	0.21427	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39600	0.1084	L	0.60455	1.87	0.09310	N	1	D	0.71674	0.998	D	0.63488	0.915	T	0.11155	-1.0599	9	0.54805	T	0.06	.	7.5416	0.27742	0.0:0.0:1.0:0.0	.	713	A8MXY4	ZNF99_HUMAN	F	713	ENSP00000380293:L713F	ENSP00000380293:L713F	L	-	1	0	ZNF99	22732141	0.107000	0.21998	0.001000	0.08648	0.003000	0.03518	0.596000	0.24044	0.663000	0.31027	0.380000	0.24917	CTT		0.338	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		5	25	0	0	0	0.001168	0	5	25				
CEP89	84902	broad.mit.edu	37	19	33370117	33370117	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:33370117C>A	ENST00000305768.5	-	19	2391	c.2303G>T	c.(2302-2304)gGc>gTc	p.G768V	CTD-2085J24.4_ENST00000586628.2_lincRNA	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	768					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.G768V(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						GACATCGCAGCCGTCCAGCAG	0.617																																							uc002nty.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2302-2304)GGC>GTC		coiled-coil domain containing 123							108.0	101.0	103.0					19																	33370117		2203	4300	6503	SO:0001583	missense	84902					centrosome|spindle pole		g.chr19:33370117C>A	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.2303G>T	19.37:g.33370117C>A	ENSP00000306105:p.Gly768Val					CCDC123_uc002ntx.2_Missense_Mutation_p.G521V|CCDC123_uc010edg.2_RNA	p.G768V	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN			19	2392	-	Esophageal squamous(110;0.137)		768					B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	c.2303G>T	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.707864	0.48412	.	.	ENSG00000121289	ENST00000305768	T	0.56275	0.47	4.99	2.87	0.33458	.	0.361938	0.23199	N	0.050809	T	0.64692	0.2621	L	0.56769	1.78	0.19300	N	0.999979	D	0.76494	0.999	D	0.77557	0.99	T	0.54589	-0.8271	10	0.87932	D	0	-1.4199	8.9942	0.36041	0.0:0.8231:0.0:0.1769	.	768	Q96ST8	CEP89_HUMAN	V	768	ENSP00000306105:G768V	ENSP00000306105:G768V	G	-	2	0	CEP89	38061957	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.028000	0.13644	0.628000	0.30357	0.561000	0.74099	GGC		0.617	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816		5	89	1	0	3.62473e-10	0.012319	5.00558e-10	5	89				
CEP89	84902	broad.mit.edu	37	19	33370119	33370119	+	Silent	SNP	G	G	A	rs201311820		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:33370119G>A	ENST00000305768.5	-	19	2389	c.2301C>T	c.(2299-2301)gaC>gaT	p.D767D	CTD-2085J24.4_ENST00000586628.2_lincRNA	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	767					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.D767D(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						CATCGCAGCCGTCCAGCAGGT	0.612													g|||	1	0.000199681	0.0	0.0	5008	,	,		14095	0.001		0.0	False		,,,				2504	0.0						uc002nty.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2299-2301)GAC>GAT		coiled-coil domain containing 123							113.0	105.0	107.0					19																	33370119		2203	4300	6503	SO:0001819	synonymous_variant	84902					centrosome|spindle pole		g.chr19:33370119G>A	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.2301C>T	19.37:g.33370119G>A						CCDC123_uc002ntx.2_Silent_p.D520D|CCDC123_uc010edg.2_RNA	p.D767D	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN			19	2390	-	Esophageal squamous(110;0.137)		767					B9EGA6|Q8N5J8	Silent	SNP	ENST00000305768.5	37	c.2301C>T	CCDS32987.1																																																																																				0.612	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816		5	94	0	0	0	0.012319	0	5	94				
FFAR1	2864	broad.mit.edu	37	19	35842897	35842897	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:35842897G>A	ENST00000246553.2	+	1	453	c.443G>A	c.(442-444)gGa>gAa	p.G148E		NM_005303.2	NP_005294.1	O14842	FFAR1_HUMAN	free fatty acid receptor 1	148					energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|positive regulation of GTPase activity (GO:0043547)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)	p.G148E(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;4.58e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.67e-19)|all cancers(14;2.01e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)		Icosapent(DB00159)	GAGGCTCCAGGAGGCTGGCTG	0.682																																							uc002nzc.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(442-444)GGA>GAA		free fatty acid receptor 1	Icosapent(DB00159)						67.0	67.0	67.0					19																	35842897		2203	4300	6503	SO:0001583	missense	2864				energy reserve metabolic process|regulation of insulin secretion	integral to plasma membrane	G-protein coupled receptor activity|guanyl-nucleotide exchange factor activity|lipid binding	g.chr19:35842897G>A	AF024687	CCDS12458.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000126266	ENSG00000126266		"""GPCR / Class A : Fatty acid receptors"""	4498	protein-coding gene	gene with protein product		603820	"""G protein-coupled receptor 40"""	GPR40		15684720	Standard	NM_005303		Approved	FFA1R	uc002nzc.2	O14842		ENST00000246553.2:c.443G>A	19.37:g.35842897G>A	ENSP00000246553:p.Gly148Glu						p.G148E	NM_005303	NP_005294	O14842	FFAR1_HUMAN	Epithelial(14;4.58e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.67e-19)|all cancers(14;2.01e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)		1	453	+	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		148			Extracellular (Potential).		Q0VAS2|Q4VBL4	Missense_Mutation	SNP	ENST00000246553.2	37	c.443G>A	CCDS12458.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587657	0.28268	.	.	ENSG00000126266	ENST00000246553	T	0.73575	-0.76	4.13	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	0.653395	0.14148	N	0.338237	T	0.47507	0.1449	N	0.08118	0	0.22457	N	0.999087	B	0.25563	0.129	B	0.30316	0.114	T	0.46693	-0.9173	10	0.02654	T	1	-0.0189	6.0309	0.19679	0.1468:0.0:0.8532:0.0	.	148	O14842	FFAR1_HUMAN	E	148	ENSP00000246553:G148E	ENSP00000246553:G148E	G	+	2	0	FFAR1	40534737	0.001000	0.12720	0.749000	0.31150	0.601000	0.36947	0.026000	0.13599	2.113000	0.64589	0.561000	0.74099	GGA		0.682	FFAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466112.2	NM_005303		23	53	0	0	0	0.016522	0	23	53				
FCGBP	8857	broad.mit.edu	37	19	40368760	40368760	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:40368760G>C	ENST00000221347.6	-	28	12595	c.12588C>G	c.(12586-12588)gaC>gaG	p.D4196E		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4196	VWFD 10. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCCAGTTCCAGTCATAGCTGA	0.612																																							uc002omp.3		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(12586-12588)GAC>GAG		Fc fragment of IgG binding protein precursor							161.0	175.0	170.0					19																	40368760		2203	4300	6503	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40368760G>C	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12588C>G	19.37:g.40368760G>C	ENSP00000221347:p.Asp4196Glu						p.D4196E	NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		28	12596	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		4196			VWFD 10.		O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.12588C>G	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530805	0.27387	.	.	ENSG00000090920	ENST00000221347	T	0.60920	0.15	3.92	2.88	0.33553	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.59595	0.2205	M	0.86953	2.85	0.23943	N	0.996391	B	0.24963	0.115	B	0.23419	0.046	T	0.59069	-0.7523	9	0.87932	D	0	.	6.0325	0.19688	0.1022:0.0:0.7105:0.1873	.	4196	Q9Y6R7	FCGBP_HUMAN	E	4196	ENSP00000221347:D4196E	ENSP00000221347:D4196E	D	-	3	2	FCGBP	45060600	1.000000	0.71417	0.998000	0.56505	0.236000	0.25371	0.719000	0.25881	0.995000	0.38917	0.305000	0.20034	GAC		0.612	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		4	141	0	0	0	0.001984	0	4	141				
PSG7	5676	broad.mit.edu	37	19	43439665	43439665	+	RNA	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:43439665C>A	ENST00000406070.2	-	0	417				PSG7_ENST00000446844.3_RNA|PSG7_ENST00000471557.1_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				TCTGGATCAGCAGGGATGCAT	0.423																																							uc002ovl.3		NA																	0					0						c.(319-321)CTG>CTT		pregnancy specific beta-1-glycoprotein 7							356.0	338.0	344.0					19																	43439665		2201	4300	6501			5676				female pregnancy	extracellular region		g.chr19:43439665C>A			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43439665C>A						PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_Intron	p.L107L	NM_002783	NP_002774	Q13046	PSG7_HUMAN			3	423	-		Prostate(69;0.00682)	107			Ig-like V-type.		Q15232	Silent	SNP	ENST00000406070.2	37	c.321G>T																																																																																					0.423	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650		50	517	1	0	2.84144e-21	0.01441	4.50282e-21	50	517				
TEX101	83639	broad.mit.edu	37	19	43920644	43920644	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:43920644G>C	ENST00000598265.1	+	4	494	c.328G>C	c.(328-330)Gag>Cag	p.E110Q	TEX101_ENST00000253435.7_Missense_Mutation_p.E128Q|TEX101_ENST00000602198.1_Missense_Mutation_p.E128Q|TEX101_ENST00000601707.1_3'UTR	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	110						acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.E128Q(1)		large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				TAACTACTGTGAGGATTCCTT	0.527																																							uc010xwo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(328-330)GAG>CAG		testis expressed 101 isoform 2							219.0	204.0	209.0					19																	43920644		2203	4300	6503	SO:0001583	missense	83639					anchored to membrane|plasma membrane		g.chr19:43920644G>C	AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.328G>C	19.37:g.43920644G>C	ENSP00000472769:p.Glu110Gln					TEX101_uc002owk.2_Missense_Mutation_p.E128Q	p.E110Q	NM_001130011	NP_001123483	Q9BY14	TX101_HUMAN			4	523	+		Prostate(69;0.0199)	110					Q7L5R2|Q9BPY7	Missense_Mutation	SNP	ENST00000598265.1	37	c.328G>C	CCDS59393.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.198448	0.38806	.	.	ENSG00000131126	ENST00000253435;ENST00000407156	T	0.68903	-0.36	4.26	-0.287	0.12858	.	1.226530	0.05562	N	0.569422	T	0.65831	0.2729	L	0.57536	1.79	0.09310	N	1	P;P	0.50528	0.895;0.936	B;P	0.50192	0.43;0.634	T	0.52719	-0.8538	10	0.30854	T	0.27	-0.6046	3.609	0.08053	0.3297:0.1913:0.479:0.0	.	110;128	Q9BY14;Q9BY14-2	TX101_HUMAN;.	Q	128;123	ENSP00000253435:E128Q	ENSP00000253435:E128Q	E	+	1	0	TEX101	48612484	0.338000	0.24775	0.021000	0.16686	0.017000	0.09413	1.040000	0.30278	0.051000	0.15978	0.561000	0.74099	GAG		0.527	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000463176.1	NM_031451		10	279	0	0	0	0.013537	0	10	279				
ZNF226	7769	broad.mit.edu	37	19	44680542	44680542	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:44680542C>T	ENST00000590089.1	+	7	1494	c.1127C>T	c.(1126-1128)tCt>tTt	p.S376F	ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Missense_Mutation_p.S376F|ZNF226_ENST00000337433.5_Missense_Mutation_p.S376F			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S376F(1)					Prostate(69;0.0352)|all_neural(266;0.202)				AGTCAGGCCTCTCATCTTCAG	0.478																																					Pancreas(115;581 1665 13228 19278 50070)	Pancreas(115;581 1665 13228 19278 50070)	uc002oyp.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1126-1128)TCT>TTT		zinc finger protein 226 isoform a							72.0	78.0	76.0					19																	44680542		2182	4295	6477	SO:0001583	missense	7769				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44680542C>T	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.1127C>T	19.37:g.44680542C>T	ENSP00000465121:p.Ser376Phe					ZNF226_uc002oyq.2_Missense_Mutation_p.S259F|ZNF226_uc002oyr.2_Missense_Mutation_p.S259F|ZNF226_uc010ejg.2_3'UTR|ZNF226_uc002oys.2_Missense_Mutation_p.S376F|ZNF226_uc002oyt.2_Missense_Mutation_p.S376F	p.S376F	NM_001032373	NP_001027545	Q9NYT6	ZN226_HUMAN			6	1271	+		Prostate(69;0.0352)|all_neural(266;0.202)	376			C2H2-type 5.		Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	ENST00000590089.1	37	c.1127C>T	CCDS46102.1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780059	0.49891	.	.	ENSG00000167380	ENST00000337433;ENST00000454662	T;T	0.07567	3.18;3.18	4.28	3.21	0.36854	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.31949	N	0.006820	T	0.26268	0.0641	M	0.89353	3.025	0.09310	N	0.999997	D	0.62365	0.991	P	0.54629	0.757	T	0.16364	-1.0405	10	0.72032	D	0.01	.	13.2877	0.60253	0.0:0.8391:0.1609:0.0	.	376	Q9NYT6	ZN226_HUMAN	F	376	ENSP00000336719:S376F;ENSP00000393265:S376F	ENSP00000336719:S376F	S	+	2	0	ZNF226	49372382	0.000000	0.05858	0.998000	0.56505	0.997000	0.91878	-0.059000	0.11731	1.133000	0.42147	0.655000	0.94253	TCT		0.478	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1			20	58	0	0	0	0.010504	0	20	58				
QPCTL	54814	broad.mit.edu	37	19	46196733	46196733	+	Silent	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:46196733A>T	ENST00000012049.5	+	2	491	c.270A>T	c.(268-270)ccA>ccT	p.P90P	SNRPD2_ENST00000587579.1_5'Flank|SNRPD2_ENST00000391932.3_5'Flank|SNRPD2_ENST00000587367.1_5'Flank|SNRPD2_ENST00000585392.1_5'Flank|SNRPD2_ENST00000590212.1_5'Flank|SNRPD2_ENST00000588301.1_5'Flank|SNRPD2_ENST00000342669.3_5'Flank|SNRPD2_ENST00000588599.1_5'Flank|QPCTL_ENST00000366382.4_Silent_p.P90P	NM_017659.3	NP_060129.2	Q9NXS2	QPCTL_HUMAN	glutaminyl-peptide cyclotransferase-like	90					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)	p.P90P(1)		breast(1)|cervix(2)|endometrium(1)|lung(5)|skin(1)|stomach(1)	11		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)		AACTGGATCCACAGCGTCTCT	0.607											OREG0025560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010xxr.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(268-270)CCA>CCT		glutaminyl-peptide cyclotransferase-like isoform							90.0	97.0	95.0					19																	46196733		2203	4300	6503	SO:0001819	synonymous_variant	54814				peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	Golgi membrane|integral to membrane	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|protein binding|zinc ion binding	g.chr19:46196733A>T	AK000091	CCDS12672.1, CCDS54282.1	19q13.32	2014-09-04			ENSG00000011478	ENSG00000011478			25952	protein-coding gene	gene with protein product	"""glutaminyl cyclase-like"""						Standard	NM_017659		Approved	FLJ20084	uc010xxr.2	Q9NXS2	OTTHUMG00000182131	ENST00000012049.5:c.270A>T	19.37:g.46196733A>T			OREG0025560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	937	SNRPD2_uc002pcv.2_5'Flank|SNRPD2_uc002pcw.2_5'Flank|QPCTL_uc010ekn.2_Silent_p.P90P	p.P90P	NM_017659	NP_060129	Q9NXS2	QPCTL_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)	2	491	+		Ovarian(192;0.051)|all_neural(266;0.112)	90					Q53HE4|Q96F74	Silent	SNP	ENST00000012049.5	37	c.270A>T	CCDS12672.1																																																																																				0.607	QPCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459656.1	NM_017659		15	92	0	0	0	0.006122	0	15	92				
DMWD	1762	broad.mit.edu	37	19	46289666	46289666	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:46289666C>G	ENST00000270223.6	-	3	1133	c.1088G>C	c.(1087-1089)cGa>cCa	p.R363P	AC011530.4_ENST00000593999.1_5'Flank|DMWD_ENST00000377735.3_Missense_Mutation_p.R363P|DMWD_ENST00000601370.1_5'Flank	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	363								p.R363P(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		GCCATGGCCTCGAGCCACCAC	0.667																																							uc002pdj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1087-1089)CGA>CCA		dystrophia myotonica-containing WD repeat motif							60.0	57.0	58.0					19																	46289666		2203	4299	6502	SO:0001583	missense	1762				meiosis			g.chr19:46289666C>G	L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.1088G>C	19.37:g.46289666C>G	ENSP00000270223:p.Arg363Pro					DMWD_uc002pdk.1_Missense_Mutation_p.R363P|DMWD_uc010eko.1_Missense_Mutation_p.R48P	p.R363P	NM_004943	NP_004934	Q09019	DMWD_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)	3	1134	-		Ovarian(192;0.0308)|all_neural(266;0.112)	363			WD 3.			Missense_Mutation	SNP	ENST00000270223.6	37	c.1088G>C	CCDS33054.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747259	0.69418	.	.	ENSG00000185800	ENST00000377735;ENST00000270223	T;T	0.30981	1.51;1.51	4.11	4.11	0.48088	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000003	T	0.55784	0.1942	M	0.77103	2.36	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.998;0.998	T	0.61874	-0.6973	10	0.72032	D	0.01	-8.9323	14.2245	0.65850	0.0:1.0:0.0:0.0	.	48;363;363	Q8WUW6;G5E9A7;Q09019	.;.;DMWD_HUMAN	P	363	ENSP00000366964:R363P;ENSP00000270223:R363P	ENSP00000270223:R363P	R	-	2	0	DMWD	50981506	0.865000	0.29922	0.788000	0.31933	0.609000	0.37215	5.671000	0.68095	2.317000	0.78254	0.462000	0.41574	CGA		0.667	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402063.1	NM_004943		14	56	0	0	0	0.00499	0	14	56				
MEIS3	56917	broad.mit.edu	37	19	47920532	47920532	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:47920532C>A	ENST00000558555.1	-	2	275	c.88G>T	c.(88-90)Gca>Tca	p.A30S	MEIS3_ENST00000561096.1_Missense_Mutation_p.A118S|MEIS3_ENST00000561293.1_Missense_Mutation_p.A30S|MEIS3_ENST00000441740.2_Missense_Mutation_p.A30S|MEIS3_ENST00000331559.5_Missense_Mutation_p.A30S|MEIS3_ENST00000559524.1_Missense_Mutation_p.A30S			Q99687	MEIS3_HUMAN	Meis homeobox 3	30					negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.A30S(1)		breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		CCTGGTACTGCGGGCACTGTC	0.652																																							uc002pgu.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(88-90)GCA>TCA		Meis1, myeloid ecotropic viral integration site							42.0	51.0	48.0					19																	47920532		2202	4300	6502	SO:0001583	missense	56917					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:47920532C>A	BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.88G>T	19.37:g.47920532C>A	ENSP00000454073:p.Ala30Ser					MEIS3_uc002pgp.2_5'Flank|MEIS3_uc002pgq.2_Missense_Mutation_p.A111S|MEIS3_uc002pgr.2_5'UTR|MEIS3_uc002pgt.2_Missense_Mutation_p.A30S|MEIS3_uc002pgv.2_Missense_Mutation_p.A30S|MEIS3_uc002pgs.2_Missense_Mutation_p.A30S|MEIS3_uc010eld.2_Missense_Mutation_p.A30S|MEIS3_uc002pgw.2_Silent_p.P142P	p.A30S	NM_001009813	NP_001009813	Q99687	MEIS3_HUMAN		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)	2	535	-		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)	30					A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	SNP	ENST00000558555.1	37	c.88G>T		.	.	.	.	.	.	.	.	.	.	C	0.017	-1.505058	0.00992	.	.	ENSG00000105419	ENST00000331559;ENST00000441740	T;T	0.35421	1.31;1.31	3.5	-6.28	0.02020	.	1.847410	0.03152	N	0.168153	T	0.17577	0.0422	L	0.34521	1.04	0.09310	N	1	B;B;B	0.31193	0.001;0.004;0.312	B;B;B	0.28849	0.002;0.007;0.095	T	0.30268	-0.9984	10	0.02654	T	1	-4.971	1.3661	0.02201	0.1847:0.2462:0.3416:0.2276	.	30;30;30	Q99687;Q99687-3;Q99687-2	MEIS3_HUMAN;.;.	S	30	ENSP00000333552:A30S;ENSP00000388667:A30S	ENSP00000333552:A30S	A	-	1	0	MEIS3	52612344	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	-0.561000	0.05957	-1.733000	0.01357	-0.397000	0.06425	GCA		0.652	MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000417642.1	XM_085929		15	52	1	0	5.3912e-06	0.006122	6.62478e-06	15	52				
SYT3	84258	broad.mit.edu	37	19	51133135	51133135	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:51133135G>T	ENST00000338916.4	-	3	1601	c.968C>A	c.(967-969)gCc>gAc	p.A323D	SYT3_ENST00000544769.1_Missense_Mutation_p.A323D|SYT3_ENST00000600079.1_Missense_Mutation_p.A323D|SYT3_ENST00000593901.1_Missense_Mutation_p.A323D	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	323	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.A323D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GAGGTCCAGGGCCTGCAGGAT	0.617																																							uc002pst.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(967-969)GCC>GAC		synaptotagmin III							91.0	89.0	89.0					19																	51133135		2203	4300	6503	SO:0001583	missense	84258					cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr19:51133135G>T	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.968C>A	19.37:g.51133135G>T	ENSP00000340914:p.Ala323Asp					SYT3_uc002psv.2_Missense_Mutation_p.A323D|SYT3_uc010ycd.1_Missense_Mutation_p.A323D	p.A323D	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)	3	1602	-		all_neural(266;0.131)	323			C2 1.|Cytoplasmic (Potential).		Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	c.968C>A	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874767	0.91664	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.20463	2.07;2.07	4.67	4.67	0.58626	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.64402	U	0.000012	T	0.58935	0.2157	H	0.94964	3.605	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.73049	-0.4105	10	0.87932	D	0	.	16.7093	0.85381	0.0:0.0:1.0:0.0	.	323	Q9BQG1	SYT3_HUMAN	D	323	ENSP00000340914:A323D;ENSP00000438883:A323D	ENSP00000340914:A323D	A	-	2	0	SYT3	55824947	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.355000	0.97087	2.301000	0.77427	0.655000	0.94253	GCC		0.617	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298		5	86	1	0	0.00116845	0.001168	0.00128352	5	86				
LILRA6	79168	broad.mit.edu	37	19	54744954	54744954	+	Silent	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:54744954G>T	ENST00000396365.2	-	5	747	c.708C>A	c.(706-708)gcC>gcA	p.A236A	LILRA6_ENST00000245621.5_Silent_p.A236A|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000440558.2_Silent_p.A236A|LILRA6_ENST00000419410.2_Silent_p.A236A|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000391735.3_3'UTR	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	236	Ig-like C2-type 1.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.A236A(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCTGCCCAGGGGCCAGGACAG	0.642																																							uc002qeu.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(706-708)GCC>GCA		leukocyte immunoglobulin-like receptor,							38.0	46.0	43.0					19																	54744954		2203	4297	6500	SO:0001819	synonymous_variant	79168					integral to membrane	receptor activity	g.chr19:54744954G>T	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.708C>A	19.37:g.54744954G>T						LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Silent_p.A236A|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Silent_p.A236A|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Silent_p.A236A|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Silent_p.A236A|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Silent_p.A236A|LILRA6_uc010yeq.1_Silent_p.A236A|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_Silent_p.A97A	p.A236A	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN		GBM - Glioblastoma multiforme(193;0.105)	5	832	-	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		236			Extracellular (Potential).|Ig-like C2-type 1.			Silent	SNP	ENST00000396365.2	37	c.708C>A	CCDS42610.1																																																																																				0.642	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318		5	73	1	0	0.000602214	0.014758	0.000676908	5	73				
PPP1R12C	54776	broad.mit.edu	37	19	55603623	55603623	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr19:55603623C>A	ENST00000263433.3	-	19	2142	c.2127G>T	c.(2125-2127)gcG>gcT	p.A709A	PPP1R12C_ENST00000435544.2_Silent_p.A634A|PPP1R12C_ENST00000376393.2_Silent_p.A646A	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C									p.A709A(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		CCTTGAGCTGCGCCAGCCGCA	0.697																																							uc002qix.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2125-2127)GCG>GCT		protein phosphatase 1, regulatory subunit 12C							9.0	10.0	9.0					19																	55603623		2175	4266	6441	SO:0001819	synonymous_variant	54776					cytoplasm		g.chr19:55603623C>A	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.2127G>T	19.37:g.55603623C>A						PPP1R12C_uc010yfs.1_Silent_p.A634A|PPP1R12C_uc002qiy.2_Silent_p.A707A	p.A709A	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)	19	2143	-			709			Potential.			Silent	SNP	ENST00000263433.3	37	c.2127G>T	CCDS12916.1																																																																																				0.697	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607		3	7	1	0	0.004672	0.004672	0.00503673	3	7				
FSHR	2492	broad.mit.edu	37	2	49247259	49247259	+	Missense_Mutation	SNP	C	C	G	rs140960768	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:49247259C>G	ENST00000406846.2	-	3	384	c.265G>C	c.(265-267)Gat>Cat	p.D89H	FSHR_ENST00000304421.4_Missense_Mutation_p.D89H|FSHR_ENST00000346173.3_Missense_Mutation_p.D89H	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	89					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.D89H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	GAGAACACATCTGCCTCTATC	0.378									Gonadal Dysgenesis, 46 XX																														uc002rww.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8						c.(265-267)GAT>CAT		follicle stimulating hormone receptor isoform 1	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)						296.0	301.0	299.0					2																	49247259		2203	4300	6503	SO:0001583	missense	2492	Gonadal_Dysgenesis_46_XX	Familial Cancer Database		female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding	g.chr2:49247259C>G		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.265G>C	2.37:g.49247259C>G	ENSP00000384708:p.Asp89His					FSHR_uc002rwx.2_Missense_Mutation_p.D89H|FSHR_uc010fbn.2_Missense_Mutation_p.D89H|FSHR_uc010fbo.1_RNA	p.D89H	NM_000145	NP_000136	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		3	339	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	89			LRR 2.|Extracellular (Potential).		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	c.265G>C	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	C	1.099	-0.661593	0.03454	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	5.3	3.39	0.38822	.	0.700145	0.14606	N	0.309343	T	0.66127	0.2758	N	0.12182	0.205	0.09310	N	1	P;P;P	0.45176	0.498;0.852;0.723	B;P;B	0.46543	0.259;0.52;0.251	T	0.54437	-0.8294	9	.	.	.	.	4.6601	0.12637	0.0:0.6638:0.0:0.3362	.	89;89;89	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	H	89	ENSP00000384708:D89H;ENSP00000333908:D89H;ENSP00000306780:D89H;ENSP00000415504:D89H	.	D	-	1	0	FSHR	49100763	0.264000	0.24093	0.012000	0.15200	0.322000	0.28314	1.164000	0.31810	0.688000	0.31529	-0.145000	0.13849	GAT		0.378	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			13	438	0	0	0	0.020292	0	13	438				
VWA3B	200403	broad.mit.edu	37	2	98744867	98744867	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:98744867A>C	ENST00000477737.1	+	6	1072	c.868A>C	c.(868-870)Agc>Cgc	p.S290R	VWA3B_ENST00000435344.1_Missense_Mutation_p.S290R|VWA3B_ENST00000451075.2_Missense_Mutation_p.S140R	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	290								p.S290R(1)		NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CAAGACCCACAGCAGGTAGGC	0.517																																							uc002syo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)|skin(1)	6						c.(868-870)AGC>CGC		von Willebrand factor A domain containing 3B							85.0	84.0	84.0					2																	98744867		2011	4176	6187	SO:0001583	missense	200403							g.chr2:98744867A>C	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.868A>C	2.37:g.98744867A>C	ENSP00000417955:p.Ser290Arg					VWA3B_uc010yvh.1_Missense_Mutation_p.S140R|VWA3B_uc002syj.2_RNA|VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Missense_Mutation_p.S290R|VWA3B_uc002syn.1_RNA	p.S290R	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN			6	1132	+			290					B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	c.868A>C	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.958530	0.53400	.	.	ENSG00000168658	ENST00000435344;ENST00000477737;ENST00000451075	T;T;T	0.16073	7.41;7.41;2.37	5.24	-6.72	0.01755	.	0.471174	0.22819	N	0.055255	T	0.28599	0.0708	L	0.57536	1.79	0.09310	N	0.999998	P;D;D	0.60575	0.944;0.988;0.966	P;P;P	0.57846	0.462;0.828;0.735	T	0.40059	-0.9583	10	0.87932	D	0	.	19.0257	0.92931	0.185:0.0:0.815:0.0	.	140;290;290	B7Z7Q7;Q502W6;Q502W6-8	.;VWA3B_HUMAN;.	R	290;290;140	ENSP00000401959:S290R;ENSP00000417955:S290R;ENSP00000389463:S140R	ENSP00000411168:S290R	S	+	1	0	VWA3B	98111299	0.000000	0.05858	0.355000	0.25773	0.991000	0.79684	-0.615000	0.05597	-1.069000	0.03153	-0.263000	0.10527	AGC		0.517	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992		12	50	0	0	0	0.016723	0	12	50				
TSGA10	80705	broad.mit.edu	37	2	99636892	99636892	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:99636892C>G	ENST00000393483.3	-	18	2512	c.1668G>C	c.(1666-1668)caG>caC	p.Q556H	TSGA10_ENST00000539964.1_Missense_Mutation_p.Q556H|TSGA10_ENST00000410001.1_Missense_Mutation_p.Q556H|TSGA10_ENST00000355053.4_Missense_Mutation_p.Q556H	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	556	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.Q556H(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						CATTTGCCATCTGACTCCTCA	0.383																																							uc002szg.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1666-1668)CAG>CAC		testis specific, 10							62.0	62.0	62.0					2																	99636892		2203	4300	6503	SO:0001583	missense	80705				spermatogenesis	cytoplasm|nuclear membrane		g.chr2:99636892C>G	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1668G>C	2.37:g.99636892C>G	ENSP00000377123:p.Gln556His					TSGA10_uc002szh.3_Missense_Mutation_p.Q556H|TSGA10_uc002szi.3_Missense_Mutation_p.Q556H|TSGA10_uc010fin.1_Missense_Mutation_p.Q556H	p.Q556H	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN			16	2296	-			556			Interaction with HIF1A (By similarity).		B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	ENST00000393483.3	37	c.1668G>C	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286094	0.59867	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	T;T;T;T;T;T	0.78364	2.49;2.49;2.49;2.49;-1.17;2.49	5.49	2.64	0.31445	.	0.000000	0.64402	D	0.000001	T	0.80407	0.4617	L	0.43923	1.385	0.80722	D	1	D	0.64830	0.994	D	0.75484	0.986	T	0.76727	-0.2853	10	0.49607	T	0.09	-12.4125	7.0166	0.24890	0.0:0.5357:0.0:0.4643	.	556	Q9BZW7	TSG10_HUMAN	H	556;556;556;556;486;556	ENSP00000377123:Q556H;ENSP00000386956:Q556H;ENSP00000347161:Q556H;ENSP00000444419:Q556H;ENSP00000386508:Q486H;ENSP00000377122:Q556H	ENSP00000347161:Q556H	Q	-	3	2	TSGA10	99003324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.777000	0.26718	0.388000	0.25054	0.650000	0.86243	CAG		0.383	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911		8	49	0	0	0	0.008291	0	8	49				
TSGA10	80705	broad.mit.edu	37	2	99636894	99636894	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:99636894G>A	ENST00000393483.3	-	18	2510	c.1666C>T	c.(1666-1668)Cag>Tag	p.Q556*	TSGA10_ENST00000539964.1_Nonsense_Mutation_p.Q556*|TSGA10_ENST00000410001.1_Nonsense_Mutation_p.Q556*|TSGA10_ENST00000355053.4_Nonsense_Mutation_p.Q556*	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	556	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.Q556*(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						TTTGCCATCTGACTCCTCAGG	0.383																																							uc002szg.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1666-1668)CAG>TAG		testis specific, 10							60.0	60.0	60.0					2																	99636894		2203	4300	6503	SO:0001587	stop_gained	80705				spermatogenesis	cytoplasm|nuclear membrane		g.chr2:99636894G>A	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1666C>T	2.37:g.99636894G>A	ENSP00000377123:p.Gln556*					TSGA10_uc002szh.3_Nonsense_Mutation_p.Q556*|TSGA10_uc002szi.3_Nonsense_Mutation_p.Q556*|TSGA10_uc010fin.1_Nonsense_Mutation_p.Q556*	p.Q556*	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN			16	2294	-			556			Interaction with HIF1A (By similarity).		B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Nonsense_Mutation	SNP	ENST00000393483.3	37	c.1666C>T	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	G	43	10.089290	0.99333	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	.	.	.	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-12.4125	18.5489	0.91056	0.0:0.0:1.0:0.0	.	.	.	.	X	556;556;556;556;486;556	.	ENSP00000347161:Q556X	Q	-	1	0	TSGA10	99003326	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.076000	0.76806	2.857000	0.98124	0.650000	0.86243	CAG		0.383	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911		8	49	0	0	0	0.008291	0	8	49				
POTEE	445582	broad.mit.edu	37	2	132021537	132021537	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:132021537C>A	ENST00000356920.5	+	15	2603	c.2509C>A	c.(2509-2511)Cag>Aag	p.Q837K	PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	837	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.Q837K(1)									CGTGGCCATCCAGGCCGTGCC	0.607																																							uc002tsn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2509-2511)CAG>AAG		protein expressed in prostate, ovary, testis,							146.0	148.0	147.0					2																	132021537		2203	4300	6503	SO:0001583	missense	445582						ATP binding	g.chr2:132021537C>A	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2509C>A	2.37:g.132021537C>A	ENSP00000439189:p.Gln837Lys					PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.Q437K|POTEE_uc002tsl.2_Missense_Mutation_p.Q419K|POTEE_uc010fmy.1_Missense_Mutation_p.Q301K	p.Q837K	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN			15	2561	+			837			Actin-like.		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	c.2509C>A	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	12.63	1.996750	0.35226	.	.	ENSG00000188219	ENST00000356920	D	0.97505	-4.41	.	.	.	.	.	.	.	.	D	0.97949	0.9325	H	0.99516	4.605	0.80722	D	1	P	0.50156	0.932	P	0.45558	0.485	D	0.95672	0.8724	8	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	837	Q6S8J3	POTEE_HUMAN	K	837	ENSP00000439189:Q837K	ENSP00000439189:Q837K	Q	+	1	0	AC131180.1	131738007	1.000000	0.71417	0.118000	0.21660	0.119000	0.20118	5.240000	0.65378	0.119000	0.18210	0.121000	0.15741	CAG		0.607	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538		5	167	1	0	1.33987e-11	0.008291	1.95257e-11	5	167				
LRP1B	53353	broad.mit.edu	37	2	141214102	141214102	+	Silent	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:141214102G>T	ENST00000389484.3	-	62	10856	c.9885C>A	c.(9883-9885)acC>acA	p.T3295T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3295	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.T3295T(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CACAAGTGTGGGTTTTTCCAG	0.438										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - coding silent(1)	p.T3295S(1)	lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(9883-9885)ACC>ACA		low density lipoprotein-related protein 1B							118.0	109.0	112.0					2																	141214102		2203	4300	6503	SO:0001819	synonymous_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141214102G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9885C>A	2.37:g.141214102G>T		TSP Lung(27;0.18)					p.T3295T	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	62	10857	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3295			Extracellular (Potential).		Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	c.9885C>A	CCDS2182.1																																																																																				0.438	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		11	53	1	0	1.08611e-07	0.010729	1.41243e-07	11	53				
PLA2R1	22925	broad.mit.edu	37	2	160832630	160832630	+	Silent	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:160832630G>A	ENST00000283243.7	-	17	2750	c.2544C>T	c.(2542-2544)ctC>ctT	p.L848L	PLA2R1_ENST00000392771.1_Silent_p.L848L	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	848	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.L848L(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						AATGAATTGTGAGAAGATCAC	0.403																																							uc002ube.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(2542-2544)CTC>CTT		phospholipase A2 receptor 1 isoform 1 precursor							151.0	142.0	145.0					2																	160832630		2203	4300	6503	SO:0001819	synonymous_variant	22925				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr2:160832630G>A	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2544C>T	2.37:g.160832630G>A						PLA2R1_uc010zcp.1_Silent_p.L848L|PLA2R1_uc002ubf.2_Silent_p.L848L	p.L848L	NM_007366	NP_031392	Q13018	PLA2R_HUMAN			17	2751	-			848			Extracellular (Potential).|C-type lectin 5.		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	37	c.2544C>T	CCDS33309.1																																																																																				0.403	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1			26	81	0	0	0	0.00632	0	26	81				
KCNH7	90134	broad.mit.edu	37	2	163693088	163693088	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:163693088G>T	ENST00000332142.5	-	2	365	c.266C>A	c.(265-267)tCa>tAa	p.S89*	KCNH7_ENST00000328032.4_Nonsense_Mutation_p.S89*	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	89					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.S89*(2)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CCTCTCTTCTGACCCCAGCAA	0.443																																					GBM(196;1492 2208 17507 24132 45496)	GBM(196;1492 2208 17507 24132 45496)	uc002uch.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(3)|skin(2)	5						c.(265-267)TCA>TAA		potassium voltage-gated channel, subfamily H,	Ibutilide(DB00308)						78.0	70.0	73.0					2																	163693088		2203	4300	6503	SO:0001587	stop_gained	90134				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity	g.chr2:163693088G>T	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.266C>A	2.37:g.163693088G>T	ENSP00000331727:p.Ser89*					KCNH7_uc002uci.2_Nonsense_Mutation_p.S89*	p.S89*	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN			2	478	-			89			Cytoplasmic (Potential).		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Nonsense_Mutation	SNP	ENST00000332142.5	37	c.266C>A	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	G	39	7.687200	0.98434	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	19.1942	0.93681	0.0:0.0:1.0:0.0	.	.	.	.	X	89	.	ENSP00000333781:S89X	S	-	2	0	KCNH7	163401334	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.785000	0.95823	0.655000	0.94253	TCA		0.443	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		7	35	1	0	5.4927e-09	0.004482	7.34048e-09	7	35				
TTN	7273	broad.mit.edu	37	2	179445159	179445159	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:179445159T>G	ENST00000591111.1	-	267	62248	c.62024A>C	c.(62023-62025)gAc>gCc	p.D20675A	TTN-AS1_ENST00000419746.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D19748A|TTN_ENST00000342175.6_Missense_Mutation_p.D13443A|TTN-AS1_ENST00000438095.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D13376A|TTN_ENST00000460472.2_Missense_Mutation_p.D13251A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D22316A|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20675					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAGAAAGTGTCAAAGTCAGT	0.393																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(59242-59244)GAC>GCC		titin isoform N2-A							152.0	137.0	142.0					2																	179445159		1888	4104	5992	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179445159T>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.62024A>C	2.37:g.179445159T>G	ENSP00000465570:p.Asp20675Ala					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D13443A|TTN_uc010zfi.1_Missense_Mutation_p.D13376A|TTN_uc010zfj.1_Missense_Mutation_p.D13251A|uc002umv.1_3'UTR	p.D19748A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		266	59467	-			20675					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.59243A>C		.	.	.	.	.	.	.	.	.	.	T	11.70	1.718257	0.30503	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.34	4.15	0.48705	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65770	0.2723	L	0.28649	0.875	0.58432	D	0.999999	P;P;P;P	0.52692	0.955;0.955;0.955;0.919	P;P;P;P	0.54889	0.763;0.763;0.763;0.686	T	0.67703	-0.5602	9	0.87932	D	0	.	11.3388	0.49520	0.0:0.0726:0.0:0.9274	.	13251;13376;13443;20675	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	19748;13251;13443;13376;13249	ENSP00000343764:D19748A;ENSP00000434586:D13251A;ENSP00000340554:D13443A;ENSP00000352154:D13376A	ENSP00000340554:D13443A	D	-	2	0	TTN	179153405	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.179000	0.65043	0.825000	0.34637	0.460000	0.39030	GAC		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		3	94	0	0	0	0.004672	0	3	94				
TTN	7273	broad.mit.edu	37	2	179641023	179641023	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:179641023C>G	ENST00000591111.1	-	28	5792	c.5568G>C	c.(5566-5568)gaG>gaC	p.E1856D	TTN_ENST00000342992.6_Missense_Mutation_p.E1856D|TTN_ENST00000342175.6_Missense_Mutation_p.E1810D|TTN_ENST00000360870.5_Missense_Mutation_p.E1856D|TTN-AS1_ENST00000610005.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E1810D|TTN_ENST00000460472.2_Missense_Mutation_p.E1810D|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E1856D|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12693	Ig-like 9.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E1810D(3)|p.E1856D(3)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTTGCAGTCTCCCCTTCAA	0.483																																							uc010zfg.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(5566-5568)GAG>GAC		titin isoform N2-A							198.0	192.0	194.0					2																	179641023		2203	4300	6503	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179641023C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5568G>C	2.37:g.179641023C>G	ENSP00000465570:p.Glu1856Asp					TTN_uc010zfh.1_Missense_Mutation_p.E1810D|TTN_uc010zfi.1_Missense_Mutation_p.E1810D|TTN_uc010zfj.1_Missense_Mutation_p.E1810D|TTN_uc002unb.2_Missense_Mutation_p.E1856D|uc002unc.1_5'Flank	p.E1856D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		28	5792	-			1856					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.5568G>C		.	.	.	.	.	.	.	.	.	.	c	7.323	0.617322	0.14129	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	5.16	4.15	0.48705	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.18173	0.0436	N	0.21324	0.655	0.22954	N	0.998512	B;B;B;B;B	0.24186	0.011;0.011;0.011;0.011;0.099	B;B;B;B;B	0.22753	0.01;0.01;0.01;0.01;0.041	T	0.11397	-1.0589	9	0.87932	D	0	.	1.9418	0.03348	0.3028:0.441:0.0:0.2562	.	1810;1810;1810;1856;1856	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	D	1856;1810;1810;1810;1810;1856	ENSP00000343764:E1856D;ENSP00000434586:E1810D;ENSP00000340554:E1810D;ENSP00000352154:E1810D;ENSP00000354117:E1856D	ENSP00000340554:E1810D	E	-	3	2	TTN	179349268	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	1.354000	0.34056	2.417000	0.82017	0.651000	0.88453	GAG		0.483	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		7	153	0	0	0	0.00308	0	7	153				
DUSP19	142679	broad.mit.edu	37	2	183948268	183948268	+	Silent	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:183948268C>T	ENST00000354221.4	+	2	434	c.259C>T	c.(259-261)Ctg>Ttg	p.L87L	AC064871.3_ENST00000444562.1_RNA|DUSP19_ENST00000469344.1_3'UTR|DUSP19_ENST00000342619.6_Silent_p.L87L	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	87					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)	p.L87L(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						TTTGGATACACTGAAAAAGAA	0.294																																							uc002upd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(259-261)CTG>TTG		dual specificity phosphatase 19 isoform 1							98.0	103.0	101.0					2																	183948268		2203	4298	6501	SO:0001819	synonymous_variant	142679				JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity	g.chr2:183948268C>T	AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.259C>T	2.37:g.183948268C>T						DUSP19_uc010frp.2_Silent_p.L87L|DUSP19_uc010zfr.1_Intron|DUSP19_uc002upe.2_Silent_p.L87L	p.L87L	NM_080876	NP_543152	Q8WTR2	DUS19_HUMAN			2	634	+			87					B2RA79|Q547H4|Q8WYN4	Silent	SNP	ENST00000354221.4	37	c.259C>T	CCDS2289.1																																																																																				0.294	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255866.1			19	67	0	0	0	0.014323	0	19	67				
ZDBF2	57683	broad.mit.edu	37	2	207170978	207170978	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:207170978T>A	ENST00000374423.3	+	5	2112	c.1726T>A	c.(1726-1728)Tcg>Acg	p.S576T		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	576							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S576T(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TAACTATGGATCGAGTTGTTC	0.438																																							uc002vbp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1726-1728)TCG>ACG		zinc finger, DBF-type containing 2							98.0	88.0	91.0					2																	207170978		1886	4125	6011	SO:0001583	missense	57683						nucleic acid binding|zinc ion binding	g.chr2:207170978T>A	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.1726T>A	2.37:g.207170978T>A	ENSP00000363545:p.Ser576Thr						p.S576T	NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN			5	1976	+			576					Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	c.1726T>A	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.507371	0.64410	.	.	ENSG00000204186	ENST00000374423	T	0.45668	0.89	4.33	1.89	0.25635	.	0.000000	0.35805	N	0.002961	T	0.48892	0.1525	L	0.55481	1.735	0.09310	N	1	D	0.69078	0.997	D	0.63597	0.916	T	0.31081	-0.9956	10	0.59425	D	0.04	.	4.2933	0.10888	0.0:0.105:0.205:0.69	.	576	Q9HCK1	ZDBF2_HUMAN	T	576	ENSP00000363545:S576T	ENSP00000363545:S576T	S	+	1	0	ZDBF2	206879223	0.415000	0.25416	0.007000	0.13788	0.550000	0.35303	0.994000	0.29693	0.419000	0.25927	0.528000	0.53228	TCG		0.438	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		3	33	0	0	0	0.004672	0	3	33				
MAP2	4133	broad.mit.edu	37	2	210557723	210557723	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr2:210557723G>T	ENST00000360351.4	+	7	1335	c.829G>T	c.(829-831)Gag>Tag	p.E277*	MAP2_ENST00000447185.1_Nonsense_Mutation_p.E273*|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	277			E -> D (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.E277*(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAAAAAGGATGAGTGGGGTTT	0.458																																					Pancreas(27;423 979 28787 29963)	Pancreas(27;423 979 28787 29963)	uc002vde.1		NA																	1	Substitution - Nonsense(1)	p.E277D(1)	lung(1)	ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17						c.(829-831)GAG>TAG		microtubule-associated protein 2 isoform 1	Estramustine(DB01196)						51.0	53.0	52.0					2																	210557723		2203	4300	6503	SO:0001587	stop_gained	4133				central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity	g.chr2:210557723G>T		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.829G>T	2.37:g.210557723G>T	ENSP00000353508:p.Glu277*					MAP2_uc002vdc.1_Nonsense_Mutation_p.E277*|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Nonsense_Mutation_p.E273*	p.E277*	NM_002374	NP_002365	P11137	MAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	7	1077	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	277		E -> D (in a colorectal cancer sample; somatic mutation).			Q17S04|Q8IUX2|Q99975|Q99976	Nonsense_Mutation	SNP	ENST00000360351.4	37	c.829G>T	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793300	0.70452	.	.	ENSG00000078018	ENST00000360351;ENST00000445941;ENST00000447185	.	.	.	5.94	5.01	0.66863	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.1507	15.0516	0.71877	0.0:0.1412:0.8588:0.0	.	.	.	.	X	277;359;273	.	ENSP00000353508:E277X	E	+	1	0	MAP2	210265968	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.664000	0.54525	2.834000	0.97654	0.650000	0.86243	GAG		0.458	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		8	58	1	0	0.00307968	0.00308	0.00337021	8	58				
SIRPD	128646	broad.mit.edu	37	20	1517840	1517840	+	Missense_Mutation	SNP	C	C	T	rs143061754		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr20:1517840C>T	ENST00000381623.3	-	3	1727	c.538G>A	c.(538-540)Gtc>Atc	p.V180I	SIRPD_ENST00000381621.1_Missense_Mutation_p.V181I			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	180						extracellular region (GO:0005576)		p.V180I(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						CAGGGTTGGACGAAATAGTTT	0.612													c|||	1	0.000199681	0.0	0.0	5008	,	,		17006	0.001		0.0	False		,,,				2504	0.0						uc002wfi.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)|kidney(1)|skin(1)	3						c.(538-540)GTC>ATC		signal-regulatory protein delta precursor		T	ILE/VAL	0,4406		0,0,2203	141.0	124.0	129.0		538	-2.6	0.0	20	dbSNP_134	129	1,8599	1.2+/-3.3	0,1,4299	no	missense	SIRPD	NM_178460.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	180/198	1517840	1,13005	2203	4300	6503	SO:0001583	missense	128646					extracellular region		g.chr20:1517840C>T	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.538G>A	20.37:g.1517840C>T	ENSP00000371036:p.Val180Ile						p.V180I	NM_178460	NP_848555	Q9H106	SIRPD_HUMAN			3	582	-			180					B3KS88|Q5TFQ6	Missense_Mutation	SNP	ENST00000381623.3	37	c.538G>A	CCDS13018.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	0.027	-1.359757	0.01245	0.0	1.16E-4	ENSG00000125900	ENST00000381623;ENST00000381621	T;T	0.01963	4.53;4.58	2.8	-2.58	0.06228	.	7.689020	0.02608	N	0.101778	T	0.01353	0.0044	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45687	-0.9244	10	0.35671	T	0.21	.	1.4512	0.02376	0.258:0.4123:0.1072:0.2224	.	180	Q9H106	SIRPD_HUMAN	I	180;181	ENSP00000371036:V180I;ENSP00000371034:V181I	ENSP00000371034:V181I	V	-	1	0	SIRPD	1465840	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.098000	0.03346	-1.183000	0.02723	-4.364000	0.00006	GTC		0.612	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460		4	82	0	0	0	0.009096	0	4	82				
CD93	22918	broad.mit.edu	37	20	23066732	23066732	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr20:23066732C>G	ENST00000246006.4	-	1	245	c.98G>C	c.(97-99)gGg>gCg	p.G33A		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	33	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)	p.G33A(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCAGGCGGTCCCCACGCAGAC	0.697																																							uc002wsv.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)	2						c.(97-99)GGG>GCG		CD93 antigen precursor							21.0	19.0	20.0					20																	23066732		2196	4290	6486	SO:0001583	missense	22918				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding	g.chr20:23066732C>G	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.98G>C	20.37:g.23066732C>G	ENSP00000246006:p.Gly33Ala						p.G33A	NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN			1	246	-	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)		33			Extracellular (Potential).|C-type lectin.		O00274	Missense_Mutation	SNP	ENST00000246006.4	37	c.98G>C	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	C	8.782	0.928593	0.18131	.	.	ENSG00000125810	ENST00000246006;ENST00000413585	T	0.80123	-1.34	5.36	3.19	0.36642	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.432527	0.19863	N	0.104363	T	0.79598	0.4473	M	0.87617	2.895	0.09310	N	1	B	0.32918	0.39	B	0.28385	0.089	T	0.72956	-0.4134	10	0.66056	D	0.02	-28.4312	7.815	0.29254	0.0:0.6828:0.0:0.3172	.	33	Q9NPY3	C1QR1_HUMAN	A	33	ENSP00000246006:G33A	ENSP00000246006:G33A	G	-	2	0	CD93	23014732	0.000000	0.05858	0.011000	0.14972	0.007000	0.05969	-0.150000	0.10189	0.635000	0.30488	-0.140000	0.14226	GGG		0.697	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072		7	7	0	0	0	0.006214	0	7	7				
PHF20	51230	broad.mit.edu	37	20	34519298	34519298	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr20:34519298G>C	ENST00000374012.3	+	15	2361	c.2232G>C	c.(2230-2232)caG>caC	p.Q744H	PHF20_ENST00000439301.1_3'UTR|RNU6-937P_ENST00000384325.1_RNA			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	744					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.Q744H(1)		breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					CCACCCACCAGCTTCTTGGTG	0.527																																							uc002xek.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2230-2232)CAG>CAC		PHD finger protein 20							114.0	101.0	105.0					20																	34519298		2203	4300	6503	SO:0001583	missense	51230				regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding	g.chr20:34519298G>C	AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.2232G>C	20.37:g.34519298G>C	ENSP00000363124:p.Gln744His						p.Q744H	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN			15	2343	+	Breast(12;0.00631)|all_lung(11;0.0145)		744					A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	c.2232G>C	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023321	0.54683	.	.	ENSG00000025293	ENST00000374012	T	0.34072	1.38	5.02	4.08	0.47627	.	0.105116	0.64402	D	0.000002	T	0.44244	0.1284	N	0.25485	0.75	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.42783	-0.9431	10	0.72032	D	0.01	.	10.6782	0.45797	0.1528:0.0:0.8472:0.0	.	744	Q9BVI0	PHF20_HUMAN	H	744	ENSP00000363124:Q744H	ENSP00000363124:Q744H	Q	+	3	2	PHF20	33982712	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.321000	0.43805	1.335000	0.45486	0.643000	0.83706	CAG		0.527	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436		65	45	0	0	0	0.01441	0	65	45				
BPI	671	broad.mit.edu	37	20	36965569	36965569	+	Missense_Mutation	SNP	G	G	A	rs5743549	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr20:36965569G>A	ENST00000262865.4	+	15	1536	c.1447G>A	c.(1447-1449)Gac>Aac	p.D483N		NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	483					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)	p.D483N(1)		kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				GTTCGGTGCAGACGTTGTCTA	0.547																																							uc002xib.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(1447-1449)GAC>AAC		bactericidal/permeability-increasing protein							120.0	112.0	115.0					20																	36965569		2203	4300	6503	SO:0001583	missense	671				defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding	g.chr20:36965569G>A	J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.1447G>A	20.37:g.36965569G>A	ENSP00000262865:p.Asp483Asn						p.D483N	NM_001725	NP_001716	P17213	BPI_HUMAN			15	1509	+		Myeloproliferative disorder(115;0.00878)	483					B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Missense_Mutation	SNP	ENST00000262865.4	37	c.1447G>A	CCDS13303.1	.	.	.	.	.	.	.	.	.	.	G	0.994	-0.692959	0.03303	.	.	ENSG00000101425	ENST00000262865	T	0.12147	2.71	4.26	1.16	0.20824	Lipid-binding serum glycoprotein, C-terminal (1);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.264502	0.31721	N	0.007172	T	0.08758	0.0217	L	0.31294	0.92	0.09310	N	1	P	0.37731	0.607	B	0.41764	0.366	T	0.28004	-1.0057	10	0.10111	T	0.7	-9.4217	5.621	0.17457	0.3676:0.0:0.6324:0.0	.	483	P17213	BPI_HUMAN	N	483	ENSP00000262865:D483N	ENSP00000262865:D483N	D	+	1	0	BPI	36398983	0.119000	0.22226	0.002000	0.10522	0.041000	0.13682	0.524000	0.22940	0.285000	0.22329	0.655000	0.94253	GAC		0.547	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725		19	169	0	0	0	0.016522	0	19	169				
OPRL1	4987	broad.mit.edu	37	20	62729693	62729693	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr20:62729693C>A	ENST00000349451.3	+	6	1066	c.654C>A	c.(652-654)tgC>tgA	p.C218*	OPRL1_ENST00000336866.2_Nonsense_Mutation_p.C218*|OPRL1_ENST00000355631.4_Nonsense_Mutation_p.C218*	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	218					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)	p.C218*(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					TTGCCATCTGCATCTTCCTCT	0.622																																							uc002yic.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(652-654)TGC>TGA		opiate receptor-like 1							281.0	222.0	242.0					20																	62729693		2203	4299	6502	SO:0001587	stop_gained	4987				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity	g.chr20:62729693C>A		CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.654C>A	20.37:g.62729693C>A	ENSP00000336764:p.Cys218*					OPRL1_uc002yid.2_Nonsense_Mutation_p.C218*|OPRL1_uc002yif.3_Nonsense_Mutation_p.C213*	p.C218*	NM_182647	NP_872588	P41146	OPRX_HUMAN			5	1056	+	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)		218			Helical; Name=5; (Potential).		Q8TD34|Q8WYH9|Q9H4K4	Nonsense_Mutation	SNP	ENST00000349451.3	37	c.654C>A	CCDS13556.1	.	.	.	.	.	.	.	.	.	.	C	38	7.131329	0.98085	.	.	ENSG00000125510	ENST00000336866;ENST00000355631;ENST00000349451	.	.	.	4.64	4.64	0.57946	.	0.100261	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.5168	0.87776	0.0:1.0:0.0:0.0	.	.	.	.	X	218	.	ENSP00000336843:C218X	C	+	3	2	OPRL1	62200137	0.600000	0.26899	0.998000	0.56505	0.748000	0.42578	-0.155000	0.10115	2.130000	0.65690	0.505000	0.49811	TGC		0.622	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080295.1	NM_182647		37	48	1	0	1.04352e-10	0.017118	1.48343e-10	37	48				
SAMSN1	64092	broad.mit.edu	37	21	15872985	15872985	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr21:15872985C>A	ENST00000400566.1	-	6	714	c.633G>T	c.(631-633)gtG>gtT	p.V211V	SAMSN1_ENST00000285670.2_Silent_p.V279V|SAMSN1_ENST00000400564.1_Silent_p.V43V|SAMSN1_ENST00000463807.1_5'Flank	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	211	SH3.				negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)	p.V211V(1)|p.V279V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		TGAAGTTTCCCACTTTATTGT	0.388																																							uc002yju.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|pancreas(1)	4						c.(631-633)GTG>GTT		SAM domain, SH3 domain and nuclear localization							213.0	187.0	195.0					21																	15872985		1847	4108	5955	SO:0001819	synonymous_variant	64092				negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding	g.chr21:15872985C>A	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.633G>T	21.37:g.15872985C>A						SAMSN1_uc010gky.1_Silent_p.V43V|SAMSN1_uc002yjv.1_Silent_p.V279V	p.V211V	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)	6	715	-			211			SH3.		B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Silent	SNP	ENST00000400566.1	37	c.633G>T	CCDS42906.1																																																																																				0.388	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1			56	120	1	0	2.93687e-30	0.01441	4.81183e-30	56	120				
KCNJ6	3763	broad.mit.edu	37	21	39087237	39087237	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr21:39087237G>T	ENST00000609713.1	-	3	812	c.223C>A	c.(223-225)Cgc>Agc	p.R75S	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Missense_Mutation_p.R75S	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	75					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)	p.R75S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	GTCAGGTAGCGATAGGTCTCC	0.463																																					Pancreas(48;379 1118 2936 19024 28214)	Pancreas(48;379 1118 2936 19024 28214)	uc011aej.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(223-225)CGC>AGC		potassium inwardly-rectifying channel J6	Halothane(DB01159)						240.0	225.0	230.0					21																	39087237		2027	4169	6196	SO:0001583	missense	3763				synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr21:39087237G>T	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.223C>A	21.37:g.39087237G>T	ENSP00000477437:p.Arg75Ser					KCNJ6_uc002ywo.2_Missense_Mutation_p.R75S	p.R75S	NM_002240	NP_002231	P48051	IRK6_HUMAN			3	276	-			75			Cytoplasmic (By similarity).		Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	37	c.223C>A	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732992	0.89482	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.96685	-4.09;-4.09	5.95	5.95	0.96441	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.98435	0.9479	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.98810	1.0743	10	0.87932	D	0	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	75	P48051	IRK6_HUMAN	S	75	ENSP00000383330:R75S;ENSP00000288309:R75S	ENSP00000288309:R75S	R	-	1	0	KCNJ6	38009107	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	8.015000	0.88690	2.824000	0.97209	0.655000	0.94253	CGC		0.463	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240		46	84	1	0	4.44401e-20	0.010771	6.92884e-20	46	84				
KRTAP10-3	386682	broad.mit.edu	37	21	45978487	45978487	+	Missense_Mutation	SNP	C	C	A	rs587776082|rs386819171		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr21:45978487C>A	ENST00000391620.1	-	1	156	c.112G>T	c.(112-114)Gcc>Tcc	p.A38S	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198696.2	NP_941969.2	P60369	KR103_HUMAN	keratin associated protein 10-3	38	18 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.A38S(1)		kidney(1)|lung(4)|prostate(1)|skin(1)	7						GGGGCCGGGGCGCAGCAGCTG	0.697																																							uc002zfj.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(112-114)GCC>TCC		keratin associated protein 10-3							25.0	27.0	26.0					21																	45978487		2148	4234	6382	SO:0001583	missense	386682					keratin filament		g.chr21:45978487C>A	AJ566383	CCDS42956.1	21q22.3	2007-10-05			ENSG00000212935	ENSG00000212935		"""Keratin associated proteins"""	22968	protein-coding gene	gene with protein product				KRTAP18-3			Standard	NM_198696		Approved	KAP10.3, KAP18.3	uc002zfj.1	P60369	OTTHUMG00000057628	ENST00000391620.1:c.112G>T	21.37:g.45978487C>A	ENSP00000375478:p.Ala38Ser					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.A38S	NM_198696	NP_941969	P60369	KR103_HUMAN			1	157	-			38			3.|18 X 5 AA repeats of C-C-X(3).		A3KN67|Q70LJ4	Missense_Mutation	SNP	ENST00000391620.1	37	c.112G>T	CCDS42956.1	.	.	.	.	.	.	.	.	.	.	t	0.102	-1.150904	0.01700	.	.	ENSG00000212935	ENST00000391620	T	0.09630	2.96	3.49	-0.986	0.10252	.	.	.	.	.	T	0.09774	0.0240	M	0.73217	2.22	0.09310	N	0.999992	B	0.18610	0.029	B	0.17433	0.018	T	0.44877	-0.9299	9	0.11794	T	0.64	.	3.3581	0.07176	0.0:0.3889:0.2077:0.4034	.	38	P60369	KR103_HUMAN	S	38	ENSP00000375478:A38S	ENSP00000375478:A38S	A	-	1	0	KRTAP10-3	44802915	0.000000	0.05858	0.669000	0.29828	0.102000	0.19082	-3.095000	0.00607	-0.010000	0.14271	-0.231000	0.12243	GCC		0.697	KRTAP10-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128031.1			10	27	1	0	7.07596e-05	0.006122	8.47946e-05	10	27				
CSF2RB	1439	broad.mit.edu	37	22	37329941	37329941	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr22:37329941G>T	ENST00000403662.3	+	10	1442	c.1220G>T	c.(1219-1221)aGg>aTg	p.R407M	CSF2RB_ENST00000406230.1_Missense_Mutation_p.R413M|CSF2RB_ENST00000262825.5_Missense_Mutation_p.R413M|CSF2RB_ENST00000536485.1_Missense_Mutation_p.R354M			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	407	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.R407M(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CCCTCCACCAGGTACTGGGCC	0.682																																							uc003aqa.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|pancreas(1)	3						c.(1219-1221)AGG>ATG		colony stimulating factor 2 receptor, beta	Sargramostim(DB00020)						81.0	69.0	73.0					22																	37329941		2203	4300	6503	SO:0001583	missense	1439				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity	g.chr22:37329941G>T	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.1220G>T	22.37:g.37329941G>T	ENSP00000384053:p.Arg407Met					CSF2RB_uc003aqc.3_Missense_Mutation_p.R413M	p.R407M	NM_000395	NP_000386	P32927	IL3RB_HUMAN			10	1437	+			407			Extracellular (Potential).|Fibronectin type-III 2.		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	c.1220G>T	CCDS13936.1	.	.	.	.	.	.	.	.	.	.	G	4.699	0.130007	0.08981	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	4.83	-8.93	0.00771	Short hematopoietin receptor, family 1, conserved site (1);Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.530120	0.03925	N	0.284230	T	0.28200	0.0696	N	0.19112	0.55	0.09310	N	1	B;B	0.24882	0.068;0.113	B;B	0.14578	0.011;0.008	T	0.10894	-1.0610	10	0.42905	T	0.14	-4.4454	2.943	0.05836	0.4301:0.3285:0.1354:0.106	.	413;407	P32927-2;P32927	.;IL3RB_HUMAN	M	407;407;413;413;354	ENSP00000384053:R407M;ENSP00000262825:R413M;ENSP00000385271:R413M;ENSP00000440003:R354M	ENSP00000262825:R413M	R	+	2	0	CSF2RB	35659887	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.763000	0.04740	-1.542000	0.01725	-1.337000	0.01257	AGG		0.682	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395		6	25	1	0	3.59834e-05	0.001168	4.32995e-05	6	25				
SMC1B	27127	broad.mit.edu	37	22	45758883	45758883	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr22:45758883G>C	ENST00000357450.4	-	16	2443	c.2444C>G	c.(2443-2445)aCt>aGt	p.T815S	SMC1B_ENST00000404354.3_Missense_Mutation_p.T815S	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	815					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.T815S(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		ATTAAGCCGAGTTTTTTGTTT	0.299																																							uc003bgc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2443-2445)ACT>AGT		SMC1 structural maintenance of chromosomes							108.0	96.0	100.0					22																	45758883		1800	4066	5866	SO:0001583	missense	27127				chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding	g.chr22:45758883G>C	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.2444C>G	22.37:g.45758883G>C	ENSP00000350036:p.Thr815Ser					SMC1B_uc003bgd.2_Missense_Mutation_p.T815S	p.T815S	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)	16	2496	-		Ovarian(80;0.00965)|all_neural(38;0.0416)	815			Potential.		A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	ENST00000357450.4	37	c.2444C>G	CCDS43027.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605229	0.46423	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	T;T	0.78126	-1.15;-1.01	4.71	4.71	0.59529	.	0.000000	0.52532	D	0.000072	T	0.62196	0.2408	N	0.17379	0.485	0.53688	D	0.999979	B;B	0.27416	0.067;0.178	B;B	0.27076	0.051;0.076	T	0.60352	-0.7280	10	0.06365	T	0.9	.	17.6729	0.88223	0.0:0.0:1.0:0.0	.	815;815	Q8NDV3-2;Q8NDV3-3	.;.	S	815	ENSP00000350036:T815S;ENSP00000385902:T815S	ENSP00000350036:T815S	T	-	2	0	SMC1B	44137547	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.708000	0.68377	2.163000	0.67991	0.313000	0.20887	ACT		0.299	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674		3	50	0	0	0	0.004672	0	3	50				
GRM7	2917	broad.mit.edu	37	3	6903372	6903372	+	Silent	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:6903372G>C	ENST00000357716.4	+	1	571	c.297G>C	c.(295-297)gtG>gtC	p.V99V	GRM7_ENST00000486284.1_Silent_p.V99V|GRM7_ENST00000389336.4_Silent_p.V99V|GRM7_ENST00000402647.2_Silent_p.V99V|GRM7_ENST00000403881.1_Silent_p.V99V	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	99					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.V99V(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TGCCCAACGTGACGCTGGGCG	0.597																																							uc003bqm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|lung(3)	7						c.(295-297)GTG>GTC		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						47.0	40.0	42.0					3																	6903372		2203	4300	6503	SO:0001819	synonymous_variant	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:6903372G>C	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.297G>C	3.37:g.6903372G>C						GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Silent_p.V99V|GRM7_uc003bql.2_Silent_p.V99V	p.V99V	NM_000844	NP_000835	Q14831	GRM7_HUMAN			1	571	+			99			Extracellular (Potential).		Q8NFS2|Q8NFS3|Q8NFS4	Silent	SNP	ENST00000357716.4	37	c.297G>C	CCDS43042.1																																																																																				0.597	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		6	13	0	0	0	0.001984	0	6	13				
MTMR14	64419	broad.mit.edu	37	3	9726311	9726311	+	Missense_Mutation	SNP	G	G	T	rs121434509		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:9726311G>T	ENST00000296003.4	+	11	1129	c.1007G>T	c.(1006-1008)cGg>cTg	p.R336L	MTMR14_ENST00000351233.5_Missense_Mutation_p.R336L|MTMR14_ENST00000420925.1_Missense_Mutation_p.R90L|MTMR14_ENST00000353332.5_Missense_Mutation_p.R336L	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	336			R -> Q (in CNM1; may act as a phenotype modifier; drastically reduced enzymatic activity; dbSNP:rs121434509). {ECO:0000269|PubMed:17008356}.		phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)	p.R336L(1)		breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					GGCTGGGATCGGACCCCCCTC	0.577																																							uc003brz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1	GRCh37	CM065043	MTMR14	M	rs121434509	c.(1006-1008)CGG>CTG		jumpy isoform 2							132.0	129.0	130.0					3																	9726311		1987	4164	6151	SO:0001583	missense	64419					perinuclear region of cytoplasm|ruffle	phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity	g.chr3:9726311G>T	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1007G>T	3.37:g.9726311G>T	ENSP00000296003:p.Arg336Leu					MTMR14_uc003bsa.2_Missense_Mutation_p.R336L|MTMR14_uc003bsb.2_Missense_Mutation_p.R336L|MTMR14_uc011ath.1_RNA|MTMR14_uc010hcl.2_Missense_Mutation_p.R90L|MTMR14_uc003bsc.2_RNA	p.R336L	NM_001077525	NP_001070993	Q8NCE2	MTMRE_HUMAN			11	1131	+	Medulloblastoma(99;0.227)		336		R -> Q (in a ADCNM patient; drastically reduced enzymatic activity).			Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	ENST00000296003.4	37	c.1007G>T	CCDS43043.1	.	.	.	.	.	.	.	.	.	.	G	36	5.753211	0.96890	.	.	ENSG00000163719	ENST00000353332;ENST00000420925;ENST00000296003;ENST00000351233;ENST00000419048;ENST00000431250	D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78	5.72	5.72	0.89469	.	0.052507	0.85682	D	0.000000	D	0.96337	0.8805	M	0.89414	3.03	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.85130	0.997;0.94;0.994;0.995	D	0.96520	0.9385	10	0.87932	D	0	-11.3717	19.8766	0.96875	0.0:0.0:1.0:0.0	.	90;336;336;336	C9JSR1;Q8NCE2-3;Q8NCE2-2;Q8NCE2	.;.;.;MTMRE_HUMAN	L	336;90;336;336;336;108	ENSP00000323462:R336L;ENSP00000401993:R90L;ENSP00000296003:R336L;ENSP00000334070:R336L;ENSP00000388746:R108L	ENSP00000296003:R336L	R	+	2	0	MTMR14	9701311	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.114000	0.94329	2.698000	0.92095	0.561000	0.74099	CGG		0.577	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485		19	48	1	0	1.55795e-14	0.012319	2.35315e-14	19	48				
DCLK3	85443	broad.mit.edu	37	3	36779750	36779750	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:36779750C>A	ENST00000416516.2	-	2	891	c.401G>T	c.(400-402)gGt>gTt	p.G134V		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	134						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G134V(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						GATAATTTCACCCGAGGTCTT	0.572																																							uc003cgi.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						c.(400-402)GGT>GTT		doublecortin-like kinase 3							142.0	142.0	142.0					3																	36779750		1885	4116	6001	SO:0001583	missense	85443					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	g.chr3:36779750C>A	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.401G>T	3.37:g.36779750C>A	ENSP00000394484:p.Gly134Val						p.G134V	NM_033403	NP_208382	Q9C098	DCLK3_HUMAN			2	892	-			134						Missense_Mutation	SNP	ENST00000416516.2	37	c.401G>T	CCDS43064.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524214	0.27299	.	.	ENSG00000163673	ENST00000416516	T	0.67698	-0.28	4.7	4.7	0.59300	.	0.000000	0.33419	N	0.004924	T	0.69033	0.3066	L	0.34521	1.04	0.45962	D	0.998788	D	0.69078	0.997	D	0.66196	0.942	T	0.68228	-0.5464	10	0.42905	T	0.14	.	9.869	0.41162	0.0:0.866:0.0:0.134	.	134	Q9C098	DCLK3_HUMAN	V	134	ENSP00000394484:G134V	ENSP00000394484:G134V	G	-	2	0	DCLK3	36754754	0.179000	0.23135	0.117000	0.21633	0.886000	0.51366	1.120000	0.31271	2.339000	0.79563	0.655000	0.94253	GGT		0.572	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355		34	91	1	0	1.36615e-20	0.013726	2.14153e-20	34	91				
NKTR	4820	broad.mit.edu	37	3	42674246	42674246	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:42674246C>G	ENST00000232978.8	+	9	892	c.704C>G	c.(703-705)tCt>tGt	p.S235C	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	235	Arg/Lys-rich (basic).|Arg/Ser-rich.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.S235C(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		GTTAAACGTTCTAAAAAGAGG	0.408																																							uc003clo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(703-705)TCT>TGT		natural killer-tumor recognition sequence							107.0	113.0	111.0					3																	42674246		2203	4300	6503	SO:0001583	missense	4820				protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity	g.chr3:42674246C>G		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.704C>G	3.37:g.42674246C>G	ENSP00000232978:p.Ser235Cys					NKTR_uc003clm.1_5'UTR|NKTR_uc003clp.2_5'UTR|NKTR_uc011azp.1_Missense_Mutation_p.S125C|NKTR_uc003clq.1_Missense_Mutation_p.S125C|NKTR_uc003clr.1_5'UTR|NKTR_uc003cls.2_5'UTR	p.S235C	NM_005385	NP_005376	P30414	NKTR_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.24)	9	851	+			235			Arg/Lys-rich (basic).|Arg/Ser-rich.			Missense_Mutation	SNP	ENST00000232978.8	37	c.704C>G	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.789846	0.90367	.	.	ENSG00000114857	ENST00000232978	T	0.14391	2.51	5.83	5.83	0.93111	.	0.392749	0.29273	N	0.012624	T	0.31451	0.0797	M	0.62723	1.935	0.80722	D	1	D;D	0.58620	0.97;0.983	P;P	0.54499	0.554;0.754	T	0.00675	-1.1615	10	0.72032	D	0.01	-2.4184	20.1179	0.97943	0.0:1.0:0.0:0.0	.	115;235	Q59EC3;P30414	.;NKTR_HUMAN	C	235	ENSP00000232978:S235C	ENSP00000232978:S235C	S	+	2	0	NKTR	42649250	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.690000	0.68241	2.754000	0.94517	0.655000	0.94253	TCT		0.408	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385		3	55	0	0	0	0.009096	0	3	55				
ABHD5	51099	broad.mit.edu	37	3	43743969	43743969	+	Silent	SNP	G	G	A	rs373148191		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:43743969G>A	ENST00000458276.2	+	3	519	c.396G>A	c.(394-396)gtG>gtA	p.V132V		NM_016006.4	NP_057090.2	Q8WTS1	ABHD5_HUMAN	abhydrolase domain containing 5	132					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|negative regulation of sequestering of triglyceride (GO:0010891)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|lysophosphatidic acid acyltransferase activity (GO:0042171)	p.V132V(1)		kidney(3)|large_intestine(2)|liver(2)|lung(5)|ovary(1)|skin(1)	14		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)		ATCAGTTTGTGGAATCCATTG	0.468																																							uc003cmx.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(394-396)GTG>GTA		abhydrolase domain containing 5							257.0	249.0	252.0					3																	43743969		2203	4300	6503	SO:0001819	synonymous_variant	51099				cell differentiation|fatty acid metabolic process|negative regulation of sequestering of triglyceride|phosphatidic acid biosynthetic process|positive regulation of triglyceride catabolic process|triglyceride catabolic process	cytosol|lipid particle	1-acylglycerol-3-phosphate O-acyltransferase activity|lysophosphatidic acid acyltransferase activity	g.chr3:43743969G>A	AF007132	CCDS2711.1	3p21.33	2012-05-16			ENSG00000011198	ENSG00000011198		"""Abhydrolase domain containing"""	21396	protein-coding gene	gene with protein product		604780				11590543, 18606822	Standard	NM_016006		Approved	CGI-58, NCIE2	uc003cmx.3	Q8WTS1	OTTHUMG00000133039	ENST00000458276.2:c.396G>A	3.37:g.43743969G>A							p.V132V	NM_016006	NP_057090	Q8WTS1	ABHD5_HUMAN		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)	3	506	+		Renal(3;0.0134)	132					B2R9K0|Q9Y369	Silent	SNP	ENST00000458276.2	37	c.396G>A	CCDS2711.1																																																																																				0.468	ABHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256644.2	NM_016006		53	102	0	0	0	0.01441	0	53	102				
LRIG1	26018	broad.mit.edu	37	3	66436675	66436675	+	Missense_Mutation	SNP	T	T	C	rs368532355		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:66436675T>C	ENST00000273261.3	-	13	2043	c.1519A>G	c.(1519-1521)Atg>Gtg	p.M507V	SLC25A26_ENST00000536651.1_3'UTR|LRIG1_ENST00000383703.3_Missense_Mutation_p.M531V|LRIG1_ENST00000496559.2_5'UTR	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	507	Ig-like C2-type 1.				innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)		p.M507V(1)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TTGCCCACCATAGCCATGGTG	0.537																																							uc003dmx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(1519-1521)ATG>GTG		leucine-rich repeats and immunoglobulin-like		T	VAL/MET	0,4406		0,0,2203	227.0	225.0	226.0		1519	4.3	0.5	3		226	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRIG1	NM_015541.2	21	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	507/1094	66436675	1,13005	2203	4300	6503	SO:0001583	missense	26018					integral to membrane		g.chr3:66436675T>C	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.1519A>G	3.37:g.66436675T>C	ENSP00000273261:p.Met507Val					SLC25A26_uc011bft.1_RNA|LRIG1_uc011bfu.1_Missense_Mutation_p.M127V|LRIG1_uc003dmw.2_Missense_Mutation_p.M173V|LRIG1_uc010hnz.2_Missense_Mutation_p.M223V|LRIG1_uc010hoa.2_Missense_Mutation_p.M531V	p.M507V	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.00047)	13	1533	-		Lung NSC(201;0.0101)	507			Extracellular (Potential).|Ig-like C2-type 1.		Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	c.1519A>G	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.808609	0.00606	0.0	1.16E-4	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.66460	-0.21;-0.21	6.17	4.34	0.51931	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.125473	0.53938	N	0.000060	T	0.30634	0.0771	N	0.00707	-1.245	0.24686	N	0.993336	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.19844	-1.0293	10	0.08599	T	0.76	.	11.4256	0.50009	0.0:0.8051:0.1265:0.0684	.	531;507;507	Q96JA1-2;Q5XWD3;Q96JA1	.;.;LRIG1_HUMAN	V	507;531;410	ENSP00000273261:M507V;ENSP00000373208:M531V	ENSP00000273261:M507V	M	-	1	0	LRIG1	66519365	0.723000	0.28027	0.527000	0.27925	0.175000	0.22909	1.702000	0.37836	0.871000	0.35750	-0.242000	0.12053	ATG		0.537	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541		6	225	0	0	0	0.001168	0	6	225				
ROBO2	6092	broad.mit.edu	37	3	77629248	77629248	+	Missense_Mutation	SNP	G	G	A	rs571504400		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:77629248G>A	ENST00000461745.1	+	16	3379	c.2479G>A	c.(2479-2481)Gag>Aag	p.E827K	ROBO2_ENST00000332191.8_Missense_Mutation_p.E827K|ROBO2_ENST00000487694.3_Missense_Mutation_p.E843K	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	827	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.E843K(1)|p.E827K(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AGTAAAGAGTGAGCCACAGCC	0.448													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16063	0.0		0.0	False		,,,				2504	0.0						uc003dpy.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(2479-2481)GAG>AAG		roundabout, axon guidance receptor, homolog 2							83.0	86.0	85.0					3																	77629248		1938	4138	6076	SO:0001583	missense	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77629248G>A	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2479G>A	3.37:g.77629248G>A	ENSP00000417164:p.Glu827Lys					ROBO2_uc003dpz.2_Missense_Mutation_p.E831K|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.E831K	p.E827K	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	16	3122	+			827			Extracellular (Potential).		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	c.2479G>A	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	G	8.243	0.807297	0.16467	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.56444	0.46;0.46;0.46	5.53	5.53	0.82687	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.367137	0.19134	U	0.121850	T	0.41604	0.1166	N	0.25647	0.755	0.33741	D	0.619376	B;B;B	0.11235	0.002;0.004;0.002	B;B;B	0.08055	0.001;0.003;0.001	T	0.38222	-0.9671	9	0.11794	T	0.64	.	19.0503	0.93041	0.0:0.0:1.0:0.0	.	843;827;827	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	K	843;843;847;827;827;548	ENSP00000417335:E843K;ENSP00000417164:E827K;ENSP00000327536:E827K	ENSP00000327536:E827K	E	+	1	0	ROBO2	77711938	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	8.009000	0.88606	2.591000	0.87537	0.563000	0.77884	GAG		0.448	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		14	30	0	0	0	0.00499	0	14	30				
UROC1	131669	broad.mit.edu	37	3	126202291	126202291	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:126202291C>G	ENST00000290868.2	-	19	1864	c.1811G>C	c.(1810-1812)gGa>gCa	p.G604A	UROC1_ENST00000383579.3_Missense_Mutation_p.G664A	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	604					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)	p.G604A(1)|p.G664A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		GAGGCCGAATCCCCCGTTGAT	0.607																																							uc003eiz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1810-1812)GGA>GCA		urocanase domain containing 1 isoform 1							69.0	59.0	63.0					3																	126202291		2203	4300	6503	SO:0001583	missense	131669				histidine catabolic process	cytosol	urocanate hydratase activity	g.chr3:126202291C>G	AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.1811G>C	3.37:g.126202291C>G	ENSP00000290868:p.Gly604Ala					UROC1_uc010hsi.1_Missense_Mutation_p.G664A	p.G604A	NM_144639	NP_653240	Q96N76	HUTU_HUMAN		GBM - Glioblastoma multiforme(114;0.17)	19	1843	-			604					E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	ENST00000290868.2	37	c.1811G>C	CCDS3038.1	.	.	.	.	.	.	.	.	.	.	c	17.81	3.480483	0.63849	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.71817	-0.6;-0.6	5.19	5.19	0.71726	Urocanase domain (2);	0.000000	0.85682	D	0.000000	D	0.89150	0.6633	H	0.95917	3.74	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.994;1.0	D	0.92509	0.6015	10	0.87932	D	0	-0.453	16.2382	0.82393	0.0:1.0:0.0:0.0	.	664;604	E9PE13;Q96N76	.;HUTU_HUMAN	A	604;664	ENSP00000290868:G604A;ENSP00000373073:G664A	ENSP00000290868:G604A	G	-	2	0	UROC1	127684981	1.000000	0.71417	0.875000	0.34327	0.172000	0.22775	7.040000	0.76551	2.434000	0.82447	0.479000	0.44913	GGA		0.607	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639		3	25	0	0	0	0.004672	0	3	25				
HLTF	6596	broad.mit.edu	37	3	148760028	148760028	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:148760028G>C	ENST00000310053.5	-	19	2315	c.2122C>G	c.(2122-2124)Ctt>Gtt	p.L708V	HLTF_ENST00000392912.2_Missense_Mutation_p.L708V|HLTF_ENST00000494055.1_Missense_Mutation_p.L708V|HLTF_ENST00000465259.1_Missense_Mutation_p.L707V	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	708					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CTAAGCAAAAGACCCAGGACA	0.373																																							uc003ewq.1		NA																	0				ovary(1)	1						c.(2122-2124)CTT>GTT		helicase-like transcription factor							85.0	82.0	83.0					3																	148760028		2203	4300	6503	SO:0001583	missense	6596				chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr3:148760028G>C	L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.2122C>G	3.37:g.148760028G>C	ENSP00000308944:p.Leu708Val					HLTF_uc003ewr.1_Missense_Mutation_p.L708V|HLTF_uc003ews.1_Missense_Mutation_p.L707V|HLTF_uc010hve.1_Missense_Mutation_p.L707V	p.L708V	NM_139048	NP_620636	Q14527	HLTF_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		19	2340	-			708					D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Missense_Mutation	SNP	ENST00000310053.5	37	c.2122C>G	CCDS33875.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507078	0.27036	.	.	ENSG00000071794	ENST00000465259;ENST00000310053;ENST00000392912;ENST00000494055;ENST00000467858	T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13	5.57	5.57	0.84162	SNF2-related (1);	.	.	.	.	T	0.71771	0.3379	L	0.55017	1.72	0.34035	D	0.65426	B;B;B	0.26483	0.076;0.15;0.15	B;B;B	0.22753	0.02;0.041;0.041	T	0.72623	-0.4237	9	0.21014	T	0.42	-19.2246	13.49	0.61388	0.0:0.2622:0.7378:0.0	.	708;708;708	Q59GQ7;A8K5B6;Q14527	.;.;HLTF_HUMAN	V	707;708;708;708;172	ENSP00000420745:L707V;ENSP00000308944:L708V;ENSP00000376644:L708V;ENSP00000420429:L708V;ENSP00000420106:L172V	ENSP00000308944:L708V	L	-	1	0	HLTF	150242718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.661000	0.54503	2.775000	0.95449	0.650000	0.86243	CTT		0.373	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356064.1			3	68	0	0	0	0.004672	0	3	68				
KCNAB1	7881	broad.mit.edu	37	3	156234123	156234123	+	Silent	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:156234123G>A	ENST00000490337.1	+	11	994	c.930G>A	c.(928-930)ggG>ggA	p.G310G	KCNAB1_ENST00000389636.5_Silent_p.G281G|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Silent_p.G263G|KCNAB1_ENST00000302490.8_Silent_p.G292G|KCNAB1_ENST00000471742.1_Silent_p.G299G	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	310					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.G292G(1)|p.G299G(1)|p.G310G(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ACGGAAACGGGGTGCCTGAAA	0.453																																							uc003far.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(3)|skin(1)	4						c.(928-930)GGG>GGA		potassium voltage-gated channel, shaker-related							96.0	97.0	96.0					3																	156234123		2203	4300	6503	SO:0001819	synonymous_variant	7881					cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity	g.chr3:156234123G>A	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.930G>A	3.37:g.156234123G>A						KCNAB1_uc011bon.1_Silent_p.G281G|KCNAB1_uc003fas.2_Silent_p.G299G|KCNAB1_uc003fat.2_Silent_p.G292G|KCNAB1_uc010hvt.1_Silent_p.G263G|KCNAB1_uc011boo.1_Silent_p.G186G	p.G310G	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)		11	994	+			310					A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Silent	SNP	ENST00000490337.1	37	c.930G>A	CCDS3174.1																																																																																				0.453	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471		8	51	0	0	0	0.00308	0	8	51				
SPATA16	83893	broad.mit.edu	37	3	172835115	172835115	+	Missense_Mutation	SNP	C	C	A	rs185789602	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:172835115C>A	ENST00000351008.3	-	2	590	c.407G>T	c.(406-408)cGc>cTc	p.R136L		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	136					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			AAACTCATAGCGAACACCCAT	0.423																																							uc003fin.3		NA																	0				ovary(2)|skin(1)	3						c.(406-408)CGC>CTC		spermatogenesis associated 16							257.0	236.0	243.0					3																	172835115		2203	4300	6503	SO:0001583	missense	83893				cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding	g.chr3:172835115C>A	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.407G>T	3.37:g.172835115C>A	ENSP00000341765:p.Arg136Leu						p.R136L	NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)		2	565	-	Ovarian(172;0.00319)|Breast(254;0.197)		136					Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	37	c.407G>T	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	C	9.837	1.190017	0.21954	.	.	ENSG00000144962	ENST00000351008	T	0.16073	2.37	5.67	2.72	0.32119	.	0.613130	0.16268	N	0.221889	T	0.08980	0.0222	N	0.14661	0.345	0.23381	N	0.997795	B	0.25048	0.117	B	0.22753	0.041	T	0.24476	-1.0159	10	0.52906	T	0.07	-0.0848	5.2287	0.15410	0.0:0.4612:0.3104:0.2283	.	136	Q9BXB7	SPT16_HUMAN	L	136	ENSP00000341765:R136L	ENSP00000341765:R136L	R	-	2	0	SPATA16	174317809	0.995000	0.38212	1.000000	0.80357	0.225000	0.24961	0.817000	0.27281	0.683000	0.31428	0.555000	0.69702	CGC		0.423	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955		5	121	1	0	1.024e-07	0.014758	1.34982e-07	5	121				
KLHL6	89857	broad.mit.edu	37	3	183273319	183273319	+	Silent	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:183273319G>T	ENST00000341319.3	-	1	158	c.123C>A	c.(121-123)atC>atA	p.I41I		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	41					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)			p.I41I(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CCCCATTTAAGATCTCGACCA	0.517																																							uc003flr.2		NA																	1	Substitution - coding silent(1)		lung(1)	haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3						c.(121-123)ATC>ATA		kelch-like 6							147.0	157.0	153.0					3																	183273319		2203	4300	6503	SO:0001819	synonymous_variant	89857							g.chr3:183273319G>T	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.123C>A	3.37:g.183273319G>T						KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_Silent_p.I39I	p.I41I	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)		1	181	-	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		41					B2RB31|D3DNS8|Q8N5I1|Q8N892	Silent	SNP	ENST00000341319.3	37	c.123C>A	CCDS3245.2																																																																																				0.517	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446		11	159	1	0	2.27111e-07	0.013537	2.92721e-07	11	159				
FRYL	285527	broad.mit.edu	37	4	48583536	48583536	+	Silent	SNP	C	C	T	rs370236896	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr4:48583536C>T	ENST00000503238.1	-	18	2072	c.2073G>A	c.(2071-2073)gcG>gcA	p.A691A	FRYL_ENST00000358350.4_Silent_p.A691A|FRYL_ENST00000537810.1_Silent_p.A691A|FRYL_ENST00000506685.1_Silent_p.A397A|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507711.1_Silent_p.A691A			O94915	FRYL_HUMAN	FRY-like	691					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.A691A(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						GAATGACAAGCGCAAAGCCTT	0.468													C|||	3	0.000599042	0.0008	0.0	5008	,	,		13844	0.002		0.0	False		,,,				2504	0.0						uc003gyh.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(2071-2073)GCG>GCA		furry-like		C		4,3806		0,4,1901	59.0	55.0	56.0		2073	-11.7	0.0	4		56	1,8255		0,1,4127	no	coding-synonymous	FRYL	NM_015030.1		0,5,6028	TT,TC,CC		0.0121,0.105,0.0414		691/3014	48583536	5,12061	1905	4128	6033	SO:0001819	synonymous_variant	285527				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr4:48583536C>T	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2073G>A	4.37:g.48583536C>T						FRYL_uc003gyk.2_Silent_p.A691A	p.A691A	NM_015030	NP_055845	O94915	FRYL_HUMAN			21	2678	-			691					O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	37	c.2073G>A	CCDS43227.1																																																																																				0.468	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			4	50	0	0	0	0.009096	0	4	50				
PARM1	25849	broad.mit.edu	37	4	75937931	75937931	+	Missense_Mutation	SNP	G	G	A	rs34305542		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr4:75937931G>A	ENST00000307428.7	+	2	552	c.340G>A	c.(340-342)Ggt>Agt	p.G114S	PARM1_ENST00000513238.1_Intron|RP11-44F21.2_ENST00000513770.1_RNA	NM_015393.3	NP_056208.2	Q6UWI2	PARM1_HUMAN	prostate androgen-regulated mucin-like protein 1	114					positive regulation of telomerase activity (GO:0051973)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)		p.G114S(2)|p.G173S(1)		cervix(1)|endometrium(2)|lung(4)|ovary(1)	8						GTCAACAAGCGGTGGAGTCCA	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		21330	0.0		0.0	False		,,,				2504	0.001						uc003hih.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(340-342)GGT>AGT		prostatic androgen-repressed message-1							139.0	140.0	140.0					4																	75937931		2096	4224	6320	SO:0001583	missense	25849				positive regulation of telomerase activity	early endosome|endosome membrane|Golgi membrane|integral to membrane|late endosome|plasma membrane		g.chr4:75937931G>A	AK022311	CCDS47077.1	4q13.3-q21.3	2010-02-17	2009-09-28		ENSG00000169116	ENSG00000169116			24536	protein-coding gene	gene with protein product	"""Prostatic androgen-repressed message 1"", ""Castration-induced prostatic apoptosis-related protein 1"", ""WSC4, cell wall integrity and stress response component 4 homolog (S. cerevisiae)"""					10499539, 12772192, 18027867	Standard	NM_015393		Approved	DKFZP564O0823, Cipar1, WSC4	uc003hih.2	Q6UWI2	OTTHUMG00000160827	ENST00000307428.7:c.340G>A	4.37:g.75937931G>A	ENSP00000370224:p.Gly114Ser						p.G114S	NM_015393	NP_056208	Q6UWI2	PARM1_HUMAN			2	580	+			114			Extracellular (Potential).		B3KMQ9|Q96DV8|Q9Y4S1	Missense_Mutation	SNP	ENST00000307428.7	37	c.340G>A	CCDS47077.1	.	.	.	.	.	.	.	.	.	.	G	7.293	0.611446	0.14066	.	.	ENSG00000169116	ENST00000307428	T	0.38240	1.15	5.34	-6.7	0.01766	.	0.719537	0.12941	N	0.426584	T	0.13543	0.0328	N	0.05124	-0.11	0.09310	N	1	B	0.14805	0.011	B	0.15052	0.012	T	0.35076	-0.9803	10	0.05620	T	0.96	0.0205	15.3919	0.74751	0.7669:0.0:0.2331:0.0	rs34305542	114	Q6UWI2	PARM1_HUMAN	S	114	ENSP00000370224:G114S	ENSP00000370224:G114S	G	+	1	0	PARM1	76156955	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.098000	0.03346	-1.517000	0.01780	-0.244000	0.11960	GGT		0.567	PARM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362494.1	NM_015393		30	52	0	0	0	0.007291	0	30	52				
EEF1A1P9	441032	broad.mit.edu	37	4	106406047	106406047	+	IGR	SNP	C	C	A	rs530705279	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr4:106406047C>A								PPA2 (10809 upstream) : AC004066.3 (55299 downstream)																							GAAAGCTGAGCGTGAACATGG	0.443																																							uc003hxt.1		NA																	0					0						c.(55-57)CGT>AGT		SubName: Full=Eukaryotic translation elongation factor 1 alpha; Flags: Fragment;																																				SO:0001628	intergenic_variant	441032							g.chr4:106406047C>A																													4.37:g.106406047C>A							p.R19S	NR_003586						1	185	+									Missense_Mutation	SNP		37	c.55C>A																																																																																				0	0.443									16	41	1	0	1.5739e-10	0.004007	2.21568e-10	16	41				
ANK2	287	broad.mit.edu	37	4	114278606	114278606	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr4:114278606C>A	ENST00000357077.4	+	38	8885	c.8832C>A	c.(8830-8832)acC>acA	p.T2944T	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Silent_p.T2911T	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2944					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T2944T(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AAAGCAAAACCCAAACAGATG	0.408																																							uc003ibe.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(8830-8832)ACC>ACA		ankyrin 2 isoform 1							168.0	174.0	172.0					4																	114278606		2203	4300	6503	SO:0001819	synonymous_variant	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114278606C>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8832C>A	4.37:g.114278606C>A						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Silent_p.T246T|ANK2_uc011cgb.1_Silent_p.T2959T	p.T2944T	NM_001148	NP_001139	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	8932	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	2911					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	c.8832C>A	CCDS3702.1																																																																																				0.408	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		72	155	1	0	5.89852e-23	0.01441	9.39873e-23	72	155				
FSTL5	56884	broad.mit.edu	37	4	162577586	162577586	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr4:162577586C>T	ENST00000306100.5	-	7	1224	c.788G>A	c.(787-789)gGa>gAa	p.G263E	FSTL5_ENST00000379164.4_Missense_Mutation_p.G262E|FSTL5_ENST00000511170.1_5'UTR|FSTL5_ENST00000536695.1_Missense_Mutation_p.G262E|FSTL5_ENST00000427802.2_Missense_Mutation_p.G262E	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	263	Ig-like 1.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.G263E(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AGCACTTTGTCCCACAGTTGC	0.403																																							uc003iqh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8						c.(787-789)GGA>GAA		follistatin-like 5 isoform a							103.0	96.0	98.0					4																	162577586		2203	4300	6503	SO:0001583	missense	56884					extracellular region	calcium ion binding	g.chr4:162577586C>T	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.788G>A	4.37:g.162577586C>T	ENSP00000305334:p.Gly263Glu					FSTL5_uc003iqi.2_Missense_Mutation_p.G262E|FSTL5_uc010iqv.2_Missense_Mutation_p.G262E	p.G263E	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN		COAD - Colon adenocarcinoma(41;0.179)	7	1224	-	all_hematologic(180;0.24)		263			Ig-like 1.		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	c.788G>A	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506390	0.85282	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94	5.19	5.19	0.71726	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.049408	0.85682	D	0.000000	D	0.94301	0.8169	M	0.92367	3.3	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.987;0.988;0.998	D	0.95422	0.8508	10	0.87932	D	0	.	18.0519	0.89351	0.0:1.0:0.0:0.0	.	262;262;263	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	E	263;262;262;262	ENSP00000305334:G263E;ENSP00000368462:G262E;ENSP00000389270:G262E;ENSP00000440409:G262E	ENSP00000305334:G263E	G	-	2	0	FSTL5	162797036	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.445000	0.80570	2.572000	0.86782	0.650000	0.86243	GGA		0.403	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		4	52	0	0	0	0.001168	0	4	52				
CEP44	80817	broad.mit.edu	37	4	175220304	175220304	+	Missense_Mutation	SNP	G	G	A	rs73011419	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr4:175220304G>A	ENST00000503780.1	+	3	446	c.32G>A	c.(31-33)cGg>cAg	p.R11Q	CEP44_ENST00000457424.2_Missense_Mutation_p.R11Q|CEP44_ENST00000296519.4_Missense_Mutation_p.R11Q|CEP44_ENST00000426172.1_Missense_Mutation_p.R11Q	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	11						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)		p.R11Q(1)		endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						AGAAGCTTACGGAACCTAGAA	0.373													G|||	5	0.000998403	0.003	0.0014	5008	,	,		16742	0.0		0.0	False		,,,				2504	0.0						uc003itr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(31-33)CGG>CAG		HBV PreS1-transactivated protein 3 isoform a		G	GLN/ARG,GLN/ARG	15,4391	23.3+/-48.9	0,15,2188	100.0	102.0	102.0		32,32	5.2	1.0	4	dbSNP_130	102	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	CEP44	NM_001040157.2,NM_001145314.1	43,43	0,16,6487	AA,AG,GG		0.0116,0.3404,0.123	probably-damaging,probably-damaging	11/391,11/400	175220304	16,12990	2203	4300	6503	SO:0001583	missense	80817					centrosome|midbody|spindle pole		g.chr4:175220304G>A	AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.32G>A	4.37:g.175220304G>A	ENSP00000423153:p.Arg11Gln					KIAA1712_uc010iro.2_Missense_Mutation_p.R11Q|KIAA1712_uc003its.2_RNA	p.R11Q	NM_001040157	NP_001035247	Q9C0F1	CEP44_HUMAN		all cancers(43;4.06e-18)|Epithelial(43;1.18e-15)|OV - Ovarian serous cystadenocarcinoma(60;4.65e-09)|GBM - Glioblastoma multiforme(59;0.00098)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0949)	3	446	+		Prostate(90;0.00276)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)	11					A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Missense_Mutation	SNP	ENST00000503780.1	37	c.32G>A	CCDS34106.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	29.7	5.025852	0.93518	0.003404	1.16E-4	ENSG00000164118	ENST00000503780;ENST00000505124;ENST00000457424;ENST00000514712;ENST00000515299;ENST00000503053;ENST00000426172;ENST00000296519	T;T;T;T;T	0.50277	0.77;0.75;0.84;0.75;0.77	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000002	T	0.66228	0.2768	L	0.52905	1.665	0.49582	D	0.999807	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.68758	-0.5324	10	0.72032	D	0.01	.	18.694	0.91593	0.0:0.0:1.0:0.0	.	11;11	Q9C0F1-2;Q9C0F1	.;CEP44_HUMAN	Q	11	ENSP00000423153:R11Q;ENSP00000389427:R11Q;ENSP00000421128:R11Q;ENSP00000408221:R11Q;ENSP00000296519:R11Q	ENSP00000296519:R11Q	R	+	2	0	CEP44	175456879	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.387000	0.79785	2.414000	0.81942	0.585000	0.79938	CGG		0.373	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362109.2	NM_030633		6	52	0	0	0	0.001984	0	6	52				
CDH6	1004	broad.mit.edu	37	5	31299636	31299636	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:31299636C>A	ENST00000265071.2	+	5	974	c.709C>A	c.(709-711)Caa>Aaa	p.Q237K	CDH6_ENST00000514738.1_Missense_Mutation_p.Q182K	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	237	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q237K(1)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AGTGGTGATTCAAGCCAAGGA	0.498																																							uc003jhe.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|large_intestine(1)	7						c.(709-711)CAA>AAA		cadherin 6, type 2 preproprotein							145.0	135.0	138.0					5																	31299636		2203	4300	6503	SO:0001583	missense	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31299636C>A	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.709C>A	5.37:g.31299636C>A	ENSP00000265071:p.Gln237Lys					CDH6_uc003jhd.1_Missense_Mutation_p.Q237K	p.Q237K	NM_004932	NP_004923	P55285	CADH6_HUMAN			5	1035	+			237			Extracellular (Potential).|Cadherin 2.		A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	37	c.709C>A	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.299018	0.81025	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.59224	0.28;0.28	6.07	6.07	0.98685	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.62660	0.2446	N	0.13327	0.33	0.80722	D	1	P;P	0.45672	0.864;0.841	P;P	0.59761	0.863;0.592	T	0.66200	-0.5983	10	0.72032	D	0.01	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	237;237	P55285;P55285-2	CADH6_HUMAN;.	K	182;237	ENSP00000424843:Q182K;ENSP00000265071:Q237K	ENSP00000265071:Q237K	Q	+	1	0	CDH6	31335393	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	6.003000	0.70701	2.885000	0.99019	0.655000	0.94253	CAA		0.498	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		27	57	1	0	1.1804e-14	0.021523	1.79222e-14	27	57				
FYB	2533	broad.mit.edu	37	5	39201957	39201957	+	Missense_Mutation	SNP	G	G	A	rs201436179		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:39201957G>A	ENST00000351578.6	-	2	1296	c.1106C>T	c.(1105-1107)aCg>aTg	p.T369M	FYB_ENST00000540520.1_Missense_Mutation_p.T379M|FYB_ENST00000515010.1_Missense_Mutation_p.T369M|FYB_ENST00000505428.1_Missense_Mutation_p.T369M|FYB_ENST00000512982.1_Missense_Mutation_p.T369M	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	369	Interaction with SKAP1.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)	p.T369M(3)|p.T379M(1)		endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			GTGGAATTTCGTCAGGTCAAC	0.458																																							uc003jls.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(2)	2						c.(1105-1107)ACG>ATG		FYN binding protein (FYB-120/130) isoform 2							147.0	148.0	148.0					5																	39201957		1909	4114	6023	SO:0001583	missense	2533				cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding	g.chr5:39201957G>A	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1106C>T	5.37:g.39201957G>A	ENSP00000316460:p.Thr369Met					FYB_uc003jlt.2_Missense_Mutation_p.T369M|FYB_uc003jlu.2_Missense_Mutation_p.T369M|FYB_uc011cpl.1_Missense_Mutation_p.T379M	p.T369M	NM_199335	NP_955367	O15117	FYB_HUMAN	Epithelial(62;0.235)		1	1173	-	all_lung(31;0.000343)		369			Interaction with SKAP1.		A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	ENST00000351578.6	37	c.1106C>T	CCDS47200.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056118	0.36277	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9	5.79	4.87	0.63330	.	0.431444	0.25997	N	0.026968	T	0.27313	0.0670	L	0.51422	1.61	0.22500	N	0.99905	D;D	0.65815	0.992;0.995	P;P	0.47528	0.549;0.549	T	0.20706	-1.0267	10	0.48119	T	0.1	-3.5061	8.4698	0.32977	0.0:0.2234:0.4683:0.3083	.	379;369	B4DLN2;O15117	.;FYB_HUMAN	M	369;369;369;369;379;369	ENSP00000316460:T369M;ENSP00000426346:T369M;ENSP00000425845:T369M;ENSP00000427114:T369M;ENSP00000442840:T379M	ENSP00000316460:T369M	T	-	2	0	FYB	39237714	0.052000	0.20516	0.900000	0.35374	0.970000	0.65996	1.204000	0.32296	2.746000	0.94184	0.655000	0.94253	ACG		0.458	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465		4	44	0	0	0	0.014758	0	4	44				
FGF10	2255	broad.mit.edu	37	5	44388547	44388547	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:44388547T>C	ENST00000264664.4	-	1	352	c.238A>G	c.(238-240)Aga>Gga	p.R80G	RP11-473L15.2_ENST00000502457.1_RNA	NM_004465.1	NP_004456.1	O15520	FGF10_HUMAN	fibroblast growth factor 10	80					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchiole morphogenesis (GO:0060436)|bud elongation involved in lung branching (GO:0060449)|bud outgrowth involved in lung branching (GO:0060447)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell migration (GO:0010631)|epithelial cell proliferation (GO:0050673)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|ERK1 and ERK2 cascade (GO:0070371)|establishment of mitotic spindle orientation (GO:0000132)|Fc-epsilon receptor signaling pathway (GO:0038095)|female genitalia morphogenesis (GO:0048807)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|hair follicle morphogenesis (GO:0031069)|Harderian gland development (GO:0070384)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte proliferation (GO:0043616)|lacrimal gland development (GO:0032808)|limb bud formation (GO:0060174)|lung epithelium development (GO:0060428)|lung proximal/distal axis specification (GO:0061115)|lung saccule development (GO:0060430)|male genitalia morphogenesis (GO:0048808)|mammary gland bud formation (GO:0060615)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal-epithelial cell signaling involved in lung development (GO:0060496)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|metanephros morphogenesis (GO:0003338)|muscle cell fate commitment (GO:0042693)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|pancreas development (GO:0031016)|phosphatidylinositol-mediated signaling (GO:0048015)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of ATPase activity (GO:0032781)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urothelial cell proliferation (GO:0050677)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of white fat cell proliferation (GO:0070352)|prostatic bud formation (GO:0060513)|protein localization to cell surface (GO:0034394)|radial glial cell differentiation (GO:0060019)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of saliva secretion (GO:0046877)|regulation of smoothened signaling pathway (GO:0008589)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|salivary gland development (GO:0007431)|secretion by lung epithelial cell involved in lung growth (GO:0061033)|semicircular canal fusion (GO:0060879)|smooth muscle cell differentiation (GO:0051145)|somatic stem cell maintenance (GO:0035019)|spleen development (GO:0048536)|submandibular salivary gland formation (GO:0060661)|tear secretion (GO:0070075)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tissue regeneration (GO:0042246)|Type II pneumocyte differentiation (GO:0060510)|urothelial cell proliferation (GO:0050674)|white fat cell differentiation (GO:0050872)|wound healing (GO:0042060)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chemoattractant activity (GO:0042056)|fibroblast growth factor receptor binding (GO:0005104)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|type 2 fibroblast growth factor receptor binding (GO:0005111)			haematopoietic_and_lymphoid_tissue(1)|lung(11)|skin(1)	13	Lung NSC(6;1.12e-06)					AATAGCTTTCTCCAGCGGACA	0.507																																							uc003jog.1		NA																	0				lung(3)	3						c.(238-240)AGA>GGA		fibroblast growth factor 10 precursor							114.0	118.0	117.0					5																	44388547		2203	4300	6503	SO:0001583	missense	2255				actin cytoskeleton reorganization|activation of MAPK activity|bud outgrowth involved in lung branching|ERK1 and ERK2 cascade|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|insulin receptor signaling pathway|lacrimal gland development|lung saccule development|mesonephros development|negative regulation of cell cycle arrest|positive regulation of ATPase activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of DNA repair|positive regulation of DNA replication|positive regulation of epithelial cell migration|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of ERK1 and ERK2 cascade|positive regulation of hair follicle cell proliferation|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of lymphocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of urothelial cell proliferation|protein localization at cell surface|radial glial cell differentiation|regulation of saliva secretion|response to protein stimulus|secretion by lung epithelial cell involved in lung growth|tear secretion|thymus development|urothelial cell proliferation	cell surface|extracellular space|nucleus|plasma membrane	chemoattractant activity|growth factor activity|heparin binding|type 2 fibroblast growth factor receptor binding	g.chr5:44388547T>C		CCDS3950.1	5p13-p12	2008-02-05			ENSG00000070193	ENSG00000070193			3666	protein-coding gene	gene with protein product		602115				9287324	Standard	NM_004465		Approved		uc003jog.1	O15520	OTTHUMG00000131153	ENST00000264664.4:c.238A>G	5.37:g.44388547T>C	ENSP00000264664:p.Arg80Gly						p.R80G	NM_004465	NP_004456	O15520	FGF10_HUMAN			1	238	-	Lung NSC(6;1.12e-06)		80					C7FDY0|Q6FHR3|Q6FHT6|Q96P59	Missense_Mutation	SNP	ENST00000264664.4	37	c.238A>G	CCDS3950.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.555941	0.65425	.	.	ENSG00000070193	ENST00000264664	D	0.88975	-2.45	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.94095	0.8107	M	0.79011	2.435	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.94822	0.7988	10	0.87932	D	0	.	14.6456	0.68759	0.0:0.0:0.0:1.0	.	80	O15520	FGF10_HUMAN	G	80	ENSP00000264664:R80G	ENSP00000264664:R80G	R	-	1	2	FGF10	44424304	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.005000	0.40864	1.931000	0.55961	0.459000	0.35465	AGA		0.507	FGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253845.2	NM_004465		3	59	0	0	0	0.009096	0	3	59				
ISL1	3670	broad.mit.edu	37	5	50683565	50683565	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:50683565C>A	ENST00000230658.7	+	3	1045	c.460C>A	c.(460-462)Cgg>Agg	p.R154R	ISL1_ENST00000511384.1_Silent_p.R154R|ISL1_ENST00000505475.2_3'UTR	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	154					atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)	p.R154R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				GCATCCAGCGCGGCCACTGCA	0.647																																							uc003jor.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(460-462)CGG>AGG		islet-1							29.0	31.0	30.0					5																	50683565		2031	4166	6197	SO:0001819	synonymous_variant	3670				generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr5:50683565C>A	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.460C>A	5.37:g.50683565C>A							p.R154R	NM_002202	NP_002193	P61371	ISL1_HUMAN			3	1008	+		Lung NSC(810;0.000845)|Breast(144;0.0411)	154					P20663|P47894	Silent	SNP	ENST00000230658.7	37	c.460C>A	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	C	4.499	0.092591	0.08632	.	.	ENSG00000016082	ENST00000505475	.	.	.	5.41	4.52	0.55395	.	.	.	.	.	T	0.72859	0.3513	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75997	-0.3120	5	0.87932	D	0	.	12.8846	0.58036	0.4199:0.5801:0.0:0.0	.	.	.	.	E	100	.	ENSP00000421737:A100E	A	+	2	0	ISL1	50719322	0.420000	0.25457	0.961000	0.40146	0.627000	0.37826	1.619000	0.36965	1.240000	0.43803	0.456000	0.33151	GCG		0.647	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202		4	19	1	0	0.00909568	0.009096	0.00959181	4	19				
GZMA	3001	broad.mit.edu	37	5	54404187	54404187	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:54404187G>T	ENST00000274306.6	+	4	627	c.592G>T	c.(592-594)Gct>Tct	p.A198S		NM_006144.3	NP_006135	P12544	GRAA_HUMAN	granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)	198	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|immune response (GO:0006955)|negative regulation of DNA binding (GO:0043392)|negative regulation of endodeoxyribonuclease activity (GO:0032078)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of apoptotic process (GO:0043065)|proteolysis involved in cellular protein catabolic process (GO:0051603)	extracellular region (GO:0005576)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.A198S(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	25		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				TATGGTTTGTGCTGGAAGCCT	0.378																																							uc003jpm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(592-594)GCT>TCT		granzyme A precursor							80.0	82.0	81.0					5																	54404187		2203	4300	6503	SO:0001583	missense	3001				cleavage of lamin|cytolysis|immune response|negative regulation of DNA binding|negative regulation of endodeoxyribonuclease activity|negative regulation of oxidoreductase activity|positive regulation of apoptosis	extracellular region|immunological synapse|nucleus	protein homodimerization activity|serine-type endopeptidase activity	g.chr5:54404187G>T		CCDS3965.1	5q11-q12	2008-07-18			ENSG00000145649	ENSG00000145649			4708	protein-coding gene	gene with protein product	"""CTL tryptase"", ""Granzyme A (Cytotoxic T-lymphocyte-associated serine esterase-3; Hanukah factor serine protease)"""	140050		HFSP, CTLA3		3262682, 3533635	Standard	NM_006144		Approved		uc003jpm.3	P12544	OTTHUMG00000097011	ENST00000274306.6:c.592G>T	5.37:g.54404187G>T	ENSP00000274306:p.Ala198Ser						p.A198S	NM_006144	NP_006135	P12544	GRAA_HUMAN			4	629	+		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)	198			Peptidase S1.		A4PHN1|Q6IB36	Missense_Mutation	SNP	ENST00000274306.6	37	c.592G>T	CCDS3965.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.465179	0.63513	.	.	ENSG00000145649	ENST00000274306	D	0.91464	-2.85	5.93	5.93	0.95920	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.96144	0.8743	M	0.92833	3.35	0.51012	D	0.999909	D	0.89917	1.0	D	0.79108	0.992	D	0.96476	0.9352	10	0.87932	D	0	.	13.1805	0.59651	0.0732:0.0:0.9268:0.0	.	198	P12544	GRAA_HUMAN	S	198	ENSP00000274306:A198S	ENSP00000274306:A198S	A	+	1	0	GZMA	54439944	1.000000	0.71417	1.000000	0.80357	0.341000	0.28922	5.899000	0.69846	2.797000	0.96272	0.655000	0.94253	GCT		0.378	GZMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214100.2	NM_006144		7	67	1	0	0.000274275	0.004482	0.000311921	7	67				
RAB3C	115827	broad.mit.edu	37	5	58147149	58147149	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:58147149C>T	ENST00000282878.4	+	5	824	c.655C>T	c.(655-657)Cct>Tct	p.P219S	CTD-2176I21.2_ENST00000510198.1_RNA	NM_138453.2	NP_612462.1	Q96E17	RAB3C_HUMAN	RAB3C, member RAS oncogene family	219					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.P219S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)	21		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)		GGAAACTCCTCCTCCACCGCA	0.527																																							uc003jrp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(655-657)CCT>TCT		RAB3C, member RAS oncogene family							105.0	90.0	95.0					5																	58147149		2203	4300	6503	SO:0001583	missense	115827				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding	g.chr5:58147149C>T	AY026936	CCDS3976.1	5q13	2008-02-05			ENSG00000152932	ENSG00000152932		"""RAB, member RAS oncogene"""	30269	protein-coding gene	gene with protein product		612829				12296628	Standard	NM_138453		Approved		uc003jrp.3	Q96E17	OTTHUMG00000097053	ENST00000282878.4:c.655C>T	5.37:g.58147149C>T	ENSP00000282878:p.Pro219Ser						p.P219S	NM_138453	NP_612462	Q96E17	RAB3C_HUMAN		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)	5	752	+		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)	219						Missense_Mutation	SNP	ENST00000282878.4	37	c.655C>T	CCDS3976.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.594516	0.66219	.	.	ENSG00000152932	ENST00000282878	T	0.63255	-0.03	5.65	5.65	0.86999	.	0.000000	0.48286	D	0.000190	T	0.55401	0.1918	L	0.43152	1.355	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.52260	-0.8599	10	0.11485	T	0.65	-14.442	19.7321	0.96186	0.0:1.0:0.0:0.0	.	219	Q96E17	RAB3C_HUMAN	S	219	ENSP00000282878:P219S	ENSP00000282878:P219S	P	+	1	0	RAB3C	58182906	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.998000	0.57024	2.668000	0.90789	0.655000	0.94253	CCT		0.527	RAB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214156.2	NM_138453		12	29	0	0	0	0.010729	0	12	29				
ELL2	22936	broad.mit.edu	37	5	95234413	95234413	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:95234413C>G	ENST00000237853.4	-	8	1405	c.1056G>C	c.(1054-1056)ttG>ttC	p.L352F	ELL2_ENST00000431061.2_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	352					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.L352F(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TGGTGGGATTCAAATGACCAT	0.498																																							uc003klr.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1054-1056)TTG>TTC		elongation factor, RNA polymerase II, 2							108.0	130.0	123.0					5																	95234413		2197	4295	6492	SO:0001583	missense	22936				regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex		g.chr5:95234413C>G	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.1056G>C	5.37:g.95234413C>G	ENSP00000237853:p.Leu352Phe						p.L352F	NM_012081	NP_036213	O00472	ELL2_HUMAN		all cancers(79;2.16e-15)	8	1406	-		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)	352					B4DNK7	Missense_Mutation	SNP	ENST00000237853.4	37	c.1056G>C	CCDS4080.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927886	0.52759	.	.	ENSG00000118985	ENST00000237853	T	0.26660	1.72	5.08	4.21	0.49690	.	0.464408	0.23045	N	0.052573	T	0.26593	0.0650	L	0.52573	1.65	0.80722	D	1	B	0.26512	0.151	B	0.31812	0.136	T	0.09079	-1.0691	10	0.66056	D	0.02	-1.5238	11.2559	0.49054	0.0:0.8634:0.0:0.1366	.	352	O00472	ELL2_HUMAN	F	352	ENSP00000237853:L352F	ENSP00000237853:L352F	L	-	3	2	ELL2	95260169	0.977000	0.34250	1.000000	0.80357	0.994000	0.84299	1.190000	0.32126	2.735000	0.93741	0.650000	0.86243	TTG		0.498	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081		8	189	0	0	0	0.004482	0	8	189				
ZNF474	133923	broad.mit.edu	37	5	121487887	121487887	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:121487887C>A	ENST00000296600.4	+	2	585	c.202C>A	c.(202-204)Cta>Ata	p.L68I	ZNF474_ENST00000514925.1_Intron|CTC-441N14.2_ENST00000504829.1_RNA|CTC-441N14.1_ENST00000505209.1_RNA	NM_207317.1	NP_997200.1	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	68							metal ion binding (GO:0046872)	p.L68I(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|stomach(1)	21		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		GACTGTGATACTATCAAAACT	0.463																																							uc003ksv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(202-204)CTA>ATA		zinc finger protein 474							91.0	103.0	99.0					5																	121487887		2203	4300	6503	SO:0001583	missense	133923					intracellular	zinc ion binding	g.chr5:121487887C>A	AK057483	CCDS4130.1	5q23.2	2008-02-05			ENSG00000164185	ENSG00000164185		"""Zinc fingers, C2H2-type"""	23245	protein-coding gene	gene with protein product							Standard	NM_207317		Approved	4933409D10Rik, FLJ32921	uc003ksv.3	Q6S9Z5	OTTHUMG00000128911	ENST00000296600.4:c.202C>A	5.37:g.121487887C>A	ENSP00000296600:p.Leu68Ile						p.L68I	NM_207317	NP_997200	Q6S9Z5	ZN474_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)	2	578	+		all_cancers(142;0.229)|Prostate(80;0.0387)	68					A8K4M0|Q96M07	Missense_Mutation	SNP	ENST00000296600.4	37	c.202C>A	CCDS4130.1	.	.	.	.	.	.	.	.	.	.	C	3.272	-0.148840	0.06627	.	.	ENSG00000164185	ENST00000296600	T	0.54279	0.58	5.58	2.65	0.31530	.	0.185981	0.23714	U	0.045299	T	0.34135	0.0887	L	0.34521	1.04	0.09310	N	1	B	0.31485	0.325	B	0.25405	0.06	T	0.23904	-1.0175	10	0.56958	D	0.05	-9.0154	4.7208	0.12917	0.243:0.3335:0.3533:0.0702	.	68	Q6S9Z5	ZN474_HUMAN	I	68	ENSP00000296600:L68I	ENSP00000296600:L68I	L	+	1	2	ZNF474	121515786	0.000000	0.05858	0.051000	0.19133	0.016000	0.09150	-0.938000	0.03938	0.673000	0.31224	-0.176000	0.13171	CTA		0.463	ZNF474-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250883.2	NM_207317		40	91	1	0	6.33695e-27	0.007835	1.02666e-26	40	91				
CTNNA1	1495	broad.mit.edu	37	5	138118888	138118888	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:138118888A>T	ENST00000302763.7	+	3	218	c.128A>T	c.(127-129)aAt>aTt	p.N43I	CTNNA1_ENST00000355078.5_Intron|CTNNA1_ENST00000518825.1_Missense_Mutation_p.N43I	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	43	Involved in homodimerization.				adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.N43I(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTAAACACCAATAGTAAAGGG	0.363																																							uc003ldh.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11						c.(127-129)AAT>ATT		catenin, alpha 1							50.0	50.0	50.0					5																	138118888		2203	4300	6503	SO:0001583	missense	1495				adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding	g.chr5:138118888A>T	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.128A>T	5.37:g.138118888A>T	ENSP00000304669:p.Asn43Ile					CTNNA1_uc011cyx.1_Intron|CTNNA1_uc011cyy.1_5'UTR|CTNNA1_uc003ldi.2_5'UTR|CTNNA1_uc003ldj.2_Missense_Mutation_p.N43I	p.N43I	NM_001903	NP_001894	P35221	CTNA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		3	223	+			43			Involved in homodimerization.		Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	37	c.128A>T	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.243849	0.58995	.	.	ENSG00000044115	ENST00000517980;ENST00000522227;ENST00000524127;ENST00000523912;ENST00000520339;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518245;ENST00000519113;ENST00000520158;ENST00000518825	T;T;T;T;T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22	5.71	4.58	0.56647	.	0.115188	0.85682	D	0.000000	T	0.30479	0.0766	N	0.19112	0.55	0.80722	D	1	B;B	0.33637	0.137;0.42	B;P	0.47941	0.213;0.562	T	0.25187	-1.0139	10	0.41790	T	0.15	-22.3362	3.4918	0.07641	0.6799:0.0:0.3201:0.0	.	43;43	G3XAM7;P35221	.;CTNA1_HUMAN	I	43	ENSP00000428439:N43I;ENSP00000429636:N43I;ENSP00000428049:N43I;ENSP00000430304:N43I;ENSP00000428202:N43I;ENSP00000304669:N43I;ENSP00000428457:N43I;ENSP00000430078:N43I;ENSP00000429457:N43I;ENSP00000427821:N43I	ENSP00000304669:N43I	N	+	2	0	CTNNA1	138146787	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.575000	0.74018	2.184000	0.69523	0.459000	0.35465	AAT		0.363	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903		15	34	0	0	0	0.003163	0	15	34				
PCDHA5	56143	broad.mit.edu	37	5	140203586	140203586	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:140203586C>A	ENST00000529859.1	+	1	2226	c.2226C>A	c.(2224-2226)agC>agA	p.S742R	PCDHA5_ENST00000529619.1_Missense_Mutation_p.S742R|PCDHA5_ENST00000378126.3_Missense_Mutation_p.S742R|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	742					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S742R(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGCTCCAGCGCGGTGGGGA	0.652																																							uc003lhl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|skin(1)	3						c.(2224-2226)AGC>AGA		protocadherin alpha 5 isoform 1 precursor							62.0	58.0	59.0					5																	140203586		2203	4300	6503	SO:0001583	missense	56143				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140203586C>A	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.2226C>A	5.37:g.140203586C>A	ENSP00000436557:p.Ser742Arg					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.S742R|PCDHA5_uc003lhj.1_Missense_Mutation_p.S742R	p.S742R	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2226	+			742			Cytoplasmic (Potential).		O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	c.2226C>A	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851216	0.51270	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.16597	2.33;2.33;2.33	3.92	-2.86	0.05717	.	.	.	.	.	T	0.24586	0.0596	M	0.81112	2.525	0.21782	N	0.999546	B;B;P	0.39862	0.411;0.448;0.692	B;B;B	0.41813	0.202;0.347;0.367	T	0.21449	-1.0245	9	0.56958	D	0.05	.	11.5338	0.50626	0.0:0.5077:0.0:0.4923	.	742;742;742	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	R	742	ENSP00000433416:S742R;ENSP00000436557:S742R;ENSP00000367366:S742R	ENSP00000367366:S742R	S	+	3	2	PCDHA5	140183770	0.724000	0.28038	0.889000	0.34880	0.695000	0.40330	0.705000	0.25675	-0.694000	0.05113	-0.658000	0.03865	AGC		0.652	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908		8	25	1	0	0.000442599	0.006214	0.000501382	8	25				
PCDHA8	56140	broad.mit.edu	37	5	140220966	140220966	+	Silent	SNP	C	C	A	rs267600394		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:140220966C>A	ENST00000531613.1	+	1	60	c.60C>A	c.(58-60)ctC>ctA	p.L20L	PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.L20L|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	20					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.L20L(2)		NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTTCTGCTCCTCGCAGCCT	0.557																																							uc003lhs.2		NA																	2	Substitution - coding silent(2)	p.L20F(1)	lung(2)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(58-60)CTC>CTA		protocadherin alpha 8 isoform 1 precursor							68.0	71.0	70.0					5																	140220966		2203	4299	6502	SO:0001819	synonymous_variant	56140				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140220966C>A	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.60C>A	5.37:g.140220966C>A						PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.L20L	p.L20L	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	60	+			20					B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	c.60C>A	CCDS54919.1																																																																																				0.557	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911		17	41	1	0	1.99824e-07	0.00499	2.587e-07	17	41				
PCDHB11	56125	broad.mit.edu	37	5	140581504	140581504	+	Silent	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:140581504G>T	ENST00000354757.3	+	1	2157	c.2157G>T	c.(2155-2157)gcG>gcT	p.A719A	PCDHB11_ENST00000536699.1_Silent_p.A354A	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	719					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A719A(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAGCAGGGCGGCCTCGGTGG	0.652																																							uc003liy.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(2155-2157)GCG>GCT		protocadherin beta 11 precursor							95.0	105.0	102.0					5																	140581504		2203	4300	6503	SO:0001819	synonymous_variant	56125				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140581504G>T	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.2157G>T	5.37:g.140581504G>T						PCDHB11_uc011daj.1_Silent_p.A354A	p.A719A	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2157	+			719			Cytoplasmic (Potential).		B4DSF7|Q2M223	Silent	SNP	ENST00000354757.3	37	c.2157G>T	CCDS4253.1																																																																																				0.652	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		46	82	1	0	2.22293e-35	0.01441	3.66279e-35	46	82				
PCDHB18	54660	broad.mit.edu	37	5	140615910	140615910	+	RNA	SNP	A	A	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:140615910A>G	ENST00000526308.1	+	0	1973					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D542G(1)		endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						GTGGACGGCGACTCGGGCCAG	0.721																																							uc003ljc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1624-1626)GAC>GGC		SubName: Full=Similar to protocadherin-3 (Pcdh3);																																						54660							g.chr5:140615910A>G	AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615910A>G							p.D542G	NR_001281						1	1973	+								B3KTF8	Missense_Mutation	SNP	ENST00000526308.1	37	c.1625A>G																																																																																					0.721	PCDHB18-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000394776.1			13	33	0	0	0	0.016723	0	13	33				
KIF4B	285643	broad.mit.edu	37	5	154394152	154394152	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:154394152G>C	ENST00000435029.4	+	1	893	c.733G>C	c.(733-735)Gaa>Caa	p.E245Q		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	245	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CGCTGGATCAGAAAGACAGAA	0.428																																							uc010jih.1		NA																	0				ovary(1)	1						c.(733-735)GAA>CAA		kinesin family member 4B							108.0	109.0	109.0					5																	154394152		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154394152G>C	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.733G>C	5.37:g.154394152G>C	ENSP00000387875:p.Glu245Gln						p.E245Q	NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	893	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	245			Kinesin-motor.			Missense_Mutation	SNP	ENST00000435029.4	37	c.733G>C	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	g	17.09	3.300945	0.60195	.	.	ENSG00000226650	ENST00000435029	D	0.84516	-1.86	1.73	1.73	0.24493	Kinesin, motor domain (5);Kinesin, motor region, conserved site (1);	.	.	.	.	D	0.94656	0.8277	H	0.98980	4.39	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.94141	0.7397	9	0.87932	D	0	.	9.4402	0.38664	0.0:0.0:1.0:0.0	.	245	Q2VIQ3	KIF4B_HUMAN	Q	245	ENSP00000387875:E245Q	ENSP00000387875:E245Q	E	+	1	0	KIF4B	154374345	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.534000	0.73833	1.302000	0.44855	0.655000	0.94253	GAA		0.428	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			3	78	0	0	0	0.004672	0	3	78				
GABRA6	2559	broad.mit.edu	37	5	161116336	161116336	+	Missense_Mutation	SNP	G	G	C	rs374528220		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:161116336G>C	ENST00000274545.5	+	5	956	c.523G>C	c.(523-525)Ggg>Cgg	p.G175R	GABRA6_ENST00000523217.1_Missense_Mutation_p.G165R|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	175					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.G175R(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	ACTCAAGTTTGGGAGCTGTAA	0.383										TCGA Ovarian(5;0.080)																													uc003lyu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(523-525)GGG>CGG		gamma-aminobutyric acid A receptor, alpha 6	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						120.0	107.0	112.0					5																	161116336		2203	4300	6503	SO:0001583	missense	2559				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	g.chr5:161116336G>C		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.523G>C	5.37:g.161116336G>C	ENSP00000274545:p.Gly175Arg	TCGA Ovarian(5;0.080)				GABRA6_uc003lyv.2_5'Flank	p.G175R	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		5	861	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	175			Extracellular (Probable).		A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	c.523G>C	CCDS4356.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.5|26.5	4.740214|4.740214	0.89573|0.89573	.|.	.|.	ENSG00000145863|ENSG00000145863	ENST00000274545;ENST00000523217;ENST00000517823;ENST00000523691|ENST00000520000	T;T;T;T|.	0.80304|.	-1.36;-1.36;-1.36;-1.36|.	5.74|5.74	5.74|5.74	0.90152|0.90152	Neurotransmitter-gated ion-channel ligand-binding (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85013|0.85013	0.5600|0.5600	M|M	0.88842|0.88842	2.985|2.985	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.86351|0.86351	0.1711|0.1711	10|5	0.66056|.	D|.	0.02|.	.|.	19.9254|19.9254	0.97100|0.97100	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	175|.	Q16445|.	GBRA6_HUMAN|.	R|F	175;165;122;70|114	ENSP00000274545:G175R;ENSP00000430527:G165R;ENSP00000430212:G122R;ENSP00000427989:G70R|.	ENSP00000274545:G175R|.	G|L	+|+	1|3	0|2	GABRA6|GABRA6	161048914|161048914	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	9.751000|9.751000	0.98889|0.98889	2.710000|2.710000	0.92621|0.92621	0.655000|0.655000	0.94253|0.94253	GGG|TTG		0.383	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2			15	71	0	0	0	0.003163	0	15	71				
CDHR2	54825	broad.mit.edu	37	5	176008567	176008567	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:176008567T>A	ENST00000510636.1	+	17	2316	c.2042T>A	c.(2041-2043)gTc>gAc	p.V681D	CDHR2_ENST00000506348.1_Missense_Mutation_p.V681D|CDHR2_ENST00000261944.5_Missense_Mutation_p.V681D	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	681	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V681D(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						AAAGTCAATGTCACCATCACT	0.627																																							uc003mem.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2041-2043)GTC>GAC		protocadherin LKC precursor							51.0	52.0	52.0					5																	176008567		2203	4300	6503	SO:0001583	missense	54825				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding	g.chr5:176008567T>A	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2042T>A	5.37:g.176008567T>A	ENSP00000424565:p.Val681Asp					CDHR2_uc003men.1_Missense_Mutation_p.V681D	p.V681D	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN			17	2108	+			681			Extracellular (Potential).|Cadherin 6.		A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	c.2042T>A	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.098444	0.76870	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.70516	-0.49;-0.49;-0.49	5.47	5.47	0.80525	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.90628	0.7061	H	0.98866	4.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94294	0.7531	9	0.87932	D	0	-38.216	15.2041	0.73165	0.0:0.0:0.0:1.0	.	681	Q9BYE9	CDHR2_HUMAN	D	681	ENSP00000424565:V681D;ENSP00000261944:V681D;ENSP00000421078:V681D	ENSP00000261944:V681D	V	+	2	0	CDHR2	175941173	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	5.067000	0.64357	2.082000	0.62665	0.448000	0.29417	GTC		0.627	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		4	32	0	0	0	0.009096	0	4	32				
COL23A1	91522	broad.mit.edu	37	5	177715330	177715330	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:177715330A>G	ENST00000390654.3	-	5	793	c.436T>C	c.(436-438)Tac>Cac	p.Y146H	COL23A1_ENST00000407622.1_Intron	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	146	Collagen-like 1.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y146H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		ATTACCGGGTAGCCATCTCGT	0.418																																							uc003mje.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(436-438)TAC>CAC		collagen, type XXIII, alpha 1							156.0	153.0	154.0					5																	177715330		1877	4113	5990	SO:0001583	missense	91522					collagen|integral to membrane|plasma membrane	protein binding	g.chr5:177715330A>G	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.436T>C	5.37:g.177715330A>G	ENSP00000375069:p.Tyr146His						p.Y146H	NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)	5	794	-	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	146			Extracellular (Potential).|Collagen-like 1.|Gly-rich.		Q8IVR4|Q9NT93	Missense_Mutation	SNP	ENST00000390654.3	37	c.436T>C	CCDS4436.1	.	.	.	.	.	.	.	.	.	.	A	12.09	1.834017	0.32421	.	.	ENSG00000050767	ENST00000390654	D	0.93426	-3.22	5.59	5.59	0.84812	.	0.272597	0.23470	N	0.047825	D	0.92453	0.7604	N	0.20357	0.565	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.89374	0.3677	10	0.14656	T	0.56	-0.2615	12.1522	0.54055	1.0:0.0:0.0:0.0	.	146	Q86Y22	CONA1_HUMAN	H	146	ENSP00000375069:Y146H	ENSP00000375069:Y146H	Y	-	1	0	COL23A1	177647936	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	4.624000	0.61254	2.117000	0.64856	0.533000	0.62120	TAC		0.418	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465		29	144	0	0	0	0.00632	0	29	144				
TBC1D9B	23061	broad.mit.edu	37	5	179301942	179301942	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr5:179301942C>T	ENST00000356834.3	-	12	2183	c.2146G>A	c.(2146-2148)Ggc>Agc	p.G716S	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.G716S	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	716						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.G716S(2)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCGCTGCAGCCCAGCAGCTGC	0.647																																							uc003mlh.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|skin(1)	2						c.(2146-2148)GGC>AGC		TBC1 domain family, member 9B (with GRAM domain)							54.0	51.0	52.0					5																	179301942		2203	4300	6503	SO:0001583	missense	23061					integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity	g.chr5:179301942C>T	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.2146G>A	5.37:g.179301942C>T	ENSP00000349291:p.Gly716Ser					TBC1D9B_uc003mli.2_Missense_Mutation_p.G716S|TBC1D9B_uc003mlj.2_Missense_Mutation_p.G716S|TBC1D9B_uc011dgv.1_5'Flank	p.G716S	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		12	2183	-	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	716					D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	ENST00000356834.3	37	c.2146G>A	CCDS43408.1	.	.	.	.	.	.	.	.	.	.	C	4.493	0.091378	0.08632	.	.	ENSG00000197226	ENST00000356834;ENST00000355235	T;T	0.20200	2.09;2.09	5.29	2.11	0.27256	Rab-GAP/TBC domain (2);	0.834208	0.11218	N	0.587029	T	0.05777	0.0151	N	0.02011	-0.69	0.23984	N	0.996261	B;B;B	0.09022	0.0;0.002;0.001	B;B;B	0.10450	0.002;0.005;0.001	T	0.41305	-0.9516	10	0.05620	T	0.96	-12.1113	3.919	0.09236	0.0:0.3202:0.209:0.4708	.	716;716;716	A1L3A9;Q66K14-2;Q66K14	.;.;TBC9B_HUMAN	S	716	ENSP00000349291:G716S;ENSP00000347375:G716S	ENSP00000347375:G716S	G	-	1	0	TBC1D9B	179234548	0.061000	0.20836	0.998000	0.56505	0.960000	0.62799	0.310000	0.19356	0.618000	0.30179	0.491000	0.48974	GGC		0.647	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043		6	43	0	0	0	0.001168	0	6	43				
ZBED9	114821	broad.mit.edu	37	6	28541214	28541214	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr6:28541214T>A	ENST00000452236.2	-	4	3069	c.2452A>T	c.(2452-2454)Agt>Tgt	p.S818C	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1												p.S818C(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						cgcaaagcactaatgtttata	0.368																																							uc003nlo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2452-2454)AGT>TGT		SCAN domain containing 3							116.0	112.0	113.0					6																	28541214		2203	4300	6503	SO:0001583	missense	114821				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:28541214T>A																												ENST00000452236.2:c.2452A>T	6.37:g.28541214T>A	ENSP00000395259:p.Ser818Cys						p.S818C	NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN			4	3070	-			818						Missense_Mutation	SNP	ENST00000452236.2	37	c.2452A>T	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	T	14.54	2.564922	0.45694	.	.	ENSG00000232040	ENST00000452236	T	0.01572	4.76	2.27	2.27	0.28462	.	0.487586	0.16568	U	0.208751	T	0.00998	0.0033	L	0.43923	1.385	0.22001	N	0.999423	P	0.52463	0.953	P	0.46543	0.52	T	0.52275	-0.8597	10	0.87932	D	0	.	6.5198	0.22269	0.0:0.0:0.0:1.0	.	818	Q6R2W3	SCND3_HUMAN	C	818	ENSP00000395259:S818C	ENSP00000395259:S818C	S	-	1	0	SCAND3	28649193	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.896000	0.39789	1.296000	0.44742	0.533000	0.62120	AGT		0.368	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3			50	130	0	0	0	0.01441	0	50	130				
SKIV2L	6499	broad.mit.edu	37	6	31935558	31935558	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr6:31935558G>T	ENST00000375394.2	+	22	2763	c.2650G>T	c.(2650-2652)Gac>Tac	p.D884Y	SKIV2L_ENST00000544581.1_Missense_Mutation_p.D691Y|DXO_ENST00000478221.1_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	884					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.D884Y(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CTTGTCCCAGGACCCACAGGA	0.592																																							uc003nyn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						c.(2650-2652)GAC>TAC		superkiller viralicidic activity 2-like homolog							101.0	98.0	99.0					6																	31935558		1511	2709	4220	SO:0001583	missense	6499					nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding	g.chr6:31935558G>T		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.2650G>T	6.37:g.31935558G>T	ENSP00000364543:p.Asp884Tyr					SKIV2L_uc011dou.1_Missense_Mutation_p.D726Y|SKIV2L_uc011dov.1_Missense_Mutation_p.D691Y	p.D884Y	NM_006929	NP_008860	Q15477	SKIV2_HUMAN			22	3039	+			884					O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	c.2650G>T	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050618	0.36181	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.50277	0.88;0.75	4.61	2.79	0.32731	.	1.143580	0.06350	N	0.709630	T	0.13457	0.0326	N	0.08118	0	0.26278	N	0.978329	B	0.19073	0.033	B	0.26202	0.067	T	0.35724	-0.9777	10	0.62326	D	0.03	-2.8952	7.6734	0.28471	0.2047:0.0:0.7953:0.0	.	884	Q15477	SKIV2_HUMAN	Y	884;726;691	ENSP00000364543:D884Y;ENSP00000442645:D691Y	ENSP00000364543:D884Y	D	+	1	0	SKIV2L	32043537	0.997000	0.39634	0.007000	0.13788	0.972000	0.66771	3.440000	0.52886	0.653000	0.30826	0.655000	0.94253	GAC		0.592	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3			16	70	1	0	4.7546e-09	0.004007	6.3835e-09	16	70				
TULP1	7287	broad.mit.edu	37	6	35466187	35466187	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr6:35466187G>T	ENST00000229771.6	-	15	1625	c.1546C>A	c.(1546-1548)Cta>Ata	p.L516I	TEAD3_ENST00000338863.7_5'Flank|TEAD3_ENST00000402886.3_5'Flank|TULP1_ENST00000322263.4_Missense_Mutation_p.L463I	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	516					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.L516I(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						CGGTAGTCTAGGGTGAAGGCG	0.677																																					GBM(55;1027 1091 11115 23439)	GBM(55;1027 1091 11115 23439)	uc003okv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1546-1548)CTA>ATA		tubby like protein 1							48.0	47.0	47.0					6																	35466187		2203	4300	6503	SO:0001583	missense	7287				dendrite development|eye photoreceptor cell development|phagocytosis|photoreceptor cell maintenance|positive regulation of phagocytosis	cell junction|cytoplasm|extracellular region|photoreceptor inner segment|photoreceptor outer segment|synapse	actin filament binding|phosphatidylinositol-4,5-bisphosphate binding	g.chr6:35466187G>T	U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.1546C>A	6.37:g.35466187G>T	ENSP00000229771:p.Leu516Ile					TEAD3_uc003oku.3_5'Flank|TEAD3_uc010jvx.2_5'Flank|TULP1_uc003okw.3_Missense_Mutation_p.L463I	p.L516I	NM_003322	NP_003313	O00294	TULP1_HUMAN			15	1558	-			516					O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	ENST00000229771.6	37	c.1546C>A	CCDS4807.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291445	0.80914	.	.	ENSG00000112041	ENST00000229771;ENST00000322263	D;D	0.88975	-2.45;-2.45	5.1	4.22	0.49857	Tubby, C-terminal (4);	0.147452	0.44285	D	0.000480	D	0.91284	0.7252	M	0.82132	2.575	0.44234	D	0.997073	P;P	0.40000	0.506;0.698	P;P	0.59595	0.673;0.86	D	0.91742	0.5405	10	0.72032	D	0.01	-2.8204	8.1824	0.31319	0.0787:0.0:0.6645:0.2568	.	463;516	O00294-2;O00294	.;TULP1_HUMAN	I	516;463	ENSP00000229771:L516I;ENSP00000319414:L463I	ENSP00000229771:L516I	L	-	1	2	TULP1	35574165	1.000000	0.71417	0.976000	0.42696	0.995000	0.86356	2.043000	0.41231	1.141000	0.42275	0.555000	0.69702	CTA		0.677	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040307.2			4	26	1	0	0.00116845	0.001168	0.00128352	4	26				
GPR111	222611	broad.mit.edu	37	6	47647951	47647951	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr6:47647951T>A	ENST00000296862.1	+	5	616	c.616T>A	c.(616-618)Tgg>Agg	p.W206R	GPR111_ENST00000507065.1_Missense_Mutation_p.W138R|GPR111_ENST00000398742.2_Missense_Mutation_p.W138R			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	206					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W206R(1)|p.W138R(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						GCAGTCTCCCTGGATACCAGG	0.423																																							uc010jzj.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(616-618)TGG>AGG		G-protein coupled receptor 111							125.0	116.0	119.0					6																	47647951		1944	4138	6082	SO:0001583	missense	222611				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:47647951T>A	AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.616T>A	6.37:g.47647951T>A	ENSP00000296862:p.Trp206Arg					GPR111_uc010jzk.1_Missense_Mutation_p.W138R|GPR111_uc003oyy.2_RNA	p.W206R	NM_153839	NP_722581	Q8IZF7	GP111_HUMAN			5	617	+			206			Extracellular (Potential).		Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Missense_Mutation	SNP	ENST00000296862.1	37	c.616T>A		.	.	.	.	.	.	.	.	.	.	C	1.593	-0.528487	0.04112	.	.	ENSG00000164393	ENST00000507065;ENST00000296862;ENST00000398742	T;T;T	0.20738	2.05;2.05;2.05	5.32	4.44	0.53790	.	0.831796	0.10340	N	0.686434	T	0.01156	0.0038	N	0.00237	-1.79	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46952	-0.9154	10	0.11485	T	0.65	.	6.0896	0.19987	0.1318:0.6494:0.1432:0.0757	.	138;206	Q8IZF7-2;Q8IZF7	.;GP111_HUMAN	R	138;206;138	ENSP00000422934:W138R;ENSP00000296862:W206R;ENSP00000381727:W138R	ENSP00000296862:W206R	W	+	1	0	GPR111	47755910	0.021000	0.18746	0.068000	0.19968	0.193000	0.23685	1.164000	0.31810	0.827000	0.34685	-0.220000	0.12472	TGG		0.423	GPR111-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000106423.2	NM_153839		23	100	0	0	0	0.004656	0	23	100				
RHAG	6005	broad.mit.edu	37	6	49582478	49582478	+	Silent	SNP	C	C	A	rs376030876		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr6:49582478C>A	ENST00000371175.4	-	5	755	c.729G>T	c.(727-729)acG>acT	p.T243T	RHAG_ENST00000229810.7_Silent_p.T243T	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	243					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.T243T(1)		NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					GAGAGAAGTACGTGTTTACAA	0.537																																					Ovarian(176;476 2003 7720 43408 44749)	Ovarian(176;476 2003 7720 43408 44749)	uc003ozk.3		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|skin(1)	2						c.(727-729)ACG>ACT		Rh-associated glycoprotein							223.0	191.0	202.0					6																	49582478		2203	4300	6503	SO:0001819	synonymous_variant	6005				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding	g.chr6:49582478C>A		CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.729G>T	6.37:g.49582478C>A						RHAG_uc010jzl.2_Silent_p.T243T|RHAG_uc010jzm.2_Silent_p.T243T	p.T243T	NM_000324	NP_000315	Q02094	RHAG_HUMAN			5	791	-	Lung NSC(77;0.0255)		243			Helical; (Potential).		B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Silent	SNP	ENST00000371175.4	37	c.729G>T	CCDS4927.1																																																																																				0.537	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043806.1			15	79	1	0	1.05317e-09	0.020292	1.44066e-09	15	79				
FAM83B	222584	broad.mit.edu	37	6	54805254	54805254	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr6:54805254G>T	ENST00000306858.7	+	5	1601	c.1485G>T	c.(1483-1485)tgG>tgT	p.W495C	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	495								p.W495C(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TACGTAACTGGAGAATTGAAT	0.408																																							uc003pck.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)	6						c.(1483-1485)TGG>TGT		hypothetical protein LOC222584							94.0	94.0	94.0					6																	54805254		2203	4300	6503	SO:0001583	missense	222584							g.chr6:54805254G>T	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1485G>T	6.37:g.54805254G>T	ENSP00000304078:p.Trp495Cys						p.W495C	NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN			5	1601	+	Lung NSC(77;0.0178)|Renal(3;0.122)		495					Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	c.1485G>T	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.761340	0.49468	.	.	ENSG00000168143	ENST00000306858	T	0.32753	1.44	5.56	5.56	0.83823	.	0.075289	0.64402	D	0.000017	T	0.31734	0.0806	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	P	0.57283	0.817	T	0.10520	-1.0626	10	0.87932	D	0	-10.1023	19.8898	0.96926	0.0:0.0:1.0:0.0	.	495	Q5T0W9	FA83B_HUMAN	C	495	ENSP00000304078:W495C	ENSP00000304078:W495C	W	+	3	0	FAM83B	54913213	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.293000	0.59037	2.775000	0.95449	0.655000	0.94253	TGG		0.408	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139		16	94	1	0	7.81268e-19	0.00499	1.21159e-18	16	94				
COL19A1	1310	broad.mit.edu	37	6	70916660	70916660	+	Silent	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr6:70916660T>C	ENST00000322773.4	+	50	3381	c.3279T>C	c.(3277-3279)agT>agC	p.S1093S	COL19A1_ENST00000393344.1_Silent_p.S715S	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	1093	Triple-helical region 6 (COL6).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.S1093S(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TGCCAGGGAGTCCAGGTCTTC	0.443																																							uc003pfc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(2)	4						c.(3277-3279)AGT>AGC		alpha 1 type XIX collagen precursor							83.0	79.0	81.0					6																	70916660		2203	4300	6503	SO:0001819	synonymous_variant	1310				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging	g.chr6:70916660T>C		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.3279T>C	6.37:g.70916660T>C							p.S1093S	NM_001858	NP_001849	Q14993	COJA1_HUMAN			50	3396	+			1093			Triple-helical region 6 (COL6).		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Silent	SNP	ENST00000322773.4	37	c.3279T>C	CCDS4970.1																																																																																				0.443	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1			9	18	0	0	0	0.010729	0	9	18				
PREP	5550	broad.mit.edu	37	6	105781267	105781267	+	Missense_Mutation	SNP	C	C	A	rs144257084		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr6:105781267C>A	ENST00000369110.3	-	8	1129	c.937G>T	c.(937-939)Gtg>Ttg	p.V313L		NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	313					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.V313L(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	ATGTTGATCACGCGATAGTTG	0.443																																							uc003prc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(937-939)GTG>TTG		prolyl endopeptidase	Oxytocin(DB00107)						251.0	204.0	220.0					6																	105781267		2203	4300	6503	SO:0001583	missense	5550				proteolysis		serine-type endopeptidase activity	g.chr6:105781267C>A		CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.937G>T	6.37:g.105781267C>A	ENSP00000358106:p.Val313Leu						p.V313L	NM_002726	NP_002717	P48147	PPCE_HUMAN			8	1140	-		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)	313					Q8N6D4	Missense_Mutation	SNP	ENST00000369110.3	37	c.937G>T	CCDS5053.1	.	.	.	.	.	.	.	.	.	.	C	4.174	0.030896	0.08101	.	.	ENSG00000085377	ENST00000369110	T	0.28255	1.62	5.66	2.92	0.33932	Peptidase S9A, oligopeptidase, N-terminal (1);Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.063358	0.64402	N	0.000007	T	0.02193	0.0068	N	0.02345	-0.59	0.31454	N	0.67042	B	0.02656	0.0	B	0.11329	0.006	T	0.44298	-0.9337	10	0.02654	T	1	-7.2167	4.5467	0.12085	0.3621:0.1652:0.4727:0.0	.	313	P48147	PPCE_HUMAN	L	313	ENSP00000358106:V313L	ENSP00000358106:V313L	V	-	1	0	PREP	105887960	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	3.459000	0.53021	0.329000	0.23460	-0.499000	0.04595	GTG		0.443	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041658.1			4	87	1	0	0.00909568	0.009096	0.00959181	4	87				
MIOS	54468	broad.mit.edu	37	7	7629038	7629038	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:7629038A>T	ENST00000340080.4	+	9	2308	c.1887A>T	c.(1885-1887)ttA>ttT	p.L629F	MIOS_ENST00000405785.1_Missense_Mutation_p.L629F	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	629						lysosomal membrane (GO:0005765)		p.L629F(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTTTCCAGTTAAATAGATACA	0.313																																							uc003srf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1885-1887)TTA>TTT		missing oocyte, meiosis regulator, homolog							81.0	78.0	79.0					7																	7629038		1791	4066	5857	SO:0001583	missense	54468							g.chr7:7629038A>T		CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.1887A>T	7.37:g.7629038A>T	ENSP00000339881:p.Leu629Phe					MIOS_uc003srg.2_Missense_Mutation_p.L164F|MIOS_uc010ktq.2_Intron	p.L629F	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN			9	2195	+			629					B2RTV6|O75216|Q7L551|Q9H092	Missense_Mutation	SNP	ENST00000340080.4	37	c.1887A>T	CCDS43554.1	.	.	.	.	.	.	.	.	.	.	A	17.92	3.506593	0.64410	.	.	ENSG00000164654	ENST00000340080;ENST00000405785	T;T	0.67523	-0.27;-0.27	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000001	T	0.73164	0.3552	M	0.66560	2.04	0.80722	D	1	D	0.57899	0.981	P	0.59595	0.86	T	0.74671	-0.3587	10	0.49607	T	0.09	-10.4629	6.0384	0.19720	0.7287:0.156:0.1154:0.0	.	629	Q9NXC5	MIO_HUMAN	F	629	ENSP00000339881:L629F;ENSP00000384088:L629F	ENSP00000339881:L629F	L	+	3	2	MIOS	7595563	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.684000	0.37649	2.104000	0.64026	0.482000	0.46254	TTA		0.313	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326218.1	NM_019005		30	84	0	0	0	0.00632	0	30	84				
SNX13	23161	broad.mit.edu	37	7	17838743	17838743	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:17838743A>G	ENST00000409389.1	-	23	2538	c.2366T>C	c.(2365-2367)cTt>cCt	p.L789P	SNX13_ENST00000428135.3_Missense_Mutation_p.L778P|SNX13_ENST00000496855.1_5'UTR			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	789					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.L778P(1)		breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					ATCCATGAGAAGCAGCATTAC	0.333																																							uc003stw.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|kidney(1)	3						c.(2365-2367)CTT>CCT		SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;							135.0	120.0	125.0					7																	17838743		1853	4089	5942	SO:0001583	missense	23161				cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity	g.chr7:17838743A>G	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.2366T>C	7.37:g.17838743A>G	ENSP00000386705:p.Leu789Pro					SNX13_uc003stv.2_Missense_Mutation_p.L778P|SNX13_uc010kuc.2_Missense_Mutation_p.L575P|SNX13_uc010kub.2_Missense_Mutation_p.L184P	p.L789P			Q9Y5W8	SNX13_HUMAN			23	2579	-	Lung NSC(10;0.0261)|all_lung(11;0.0521)		789					B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	ENST00000409389.1	37	c.2366T>C		.	.	.	.	.	.	.	.	.	.	A	23.1	4.378105	0.82682	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	T;T	0.19669	2.13;2.43	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.46367	0.1389	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.87578	0.99;0.963;0.998	T	0.31752	-0.9932	10	0.36615	T	0.2	-16.3449	16.1429	0.81539	1.0:0.0:0.0:0.0	.	575;789;778	B3KN60;B8ZZT9;Q9Y5W8-2	.;.;.	P	789;778;826	ENSP00000386705:L789P;ENSP00000398789:L778P	ENSP00000242044:L826P	L	-	2	0	SNX13	17805268	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.826000	0.92034	2.209000	0.71365	0.460000	0.39030	CTT		0.333	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132		5	51	0	0	0	0.014758	0	5	51				
GPR141	353345	broad.mit.edu	37	7	37780032	37780032	+	Missense_Mutation	SNP	G	G	T	rs141399721	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:37780032G>T	ENST00000447769.1	+	4	326	c.37G>T	c.(37-39)Gat>Tat	p.D13Y	EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.D13Y|GPR141_ENST00000461610.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D13Y(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTCCTCTTGCGATCCTATAGT	0.468													G|||	2	0.000399361	0.0	0.0	5008	,	,		18628	0.002		0.0	False		,,,				2504	0.0						uc003tfm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(37-39)GAT>TAT		G protein-coupled receptor 141							175.0	179.0	178.0					7																	37780032		2203	4300	6503	SO:0001583	missense	353345					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr7:37780032G>T	AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.37G>T	7.37:g.37780032G>T	ENSP00000390410:p.Asp13Tyr					uc003tfl.2_Intron	p.D13Y	NM_181791	NP_861456	Q7Z602	GP141_HUMAN			1	37	+			13			Extracellular (Potential).		A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	ENST00000447769.1	37	c.37G>T	CCDS5451.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	11.36	1.616090	0.28801	.	.	ENSG00000187037	ENST00000450180;ENST00000447769;ENST00000334425	T;T;T	0.38077	1.16;1.16;1.16	5.03	-6.92	0.01644	.	1.532230	0.03629	N	0.237568	T	0.23410	0.0566	L	0.27053	0.805	0.09310	N	1	P	0.39282	0.666	B	0.32624	0.149	T	0.42515	-0.9447	10	0.87932	D	0	0.0462	12.4214	0.55522	0.2045:0.1239:0.6716:0.0	.	13	Q7Z602	GP141_HUMAN	Y	13	ENSP00000396300:D13Y;ENSP00000390410:D13Y;ENSP00000334540:D13Y	ENSP00000334540:D13Y	D	+	1	0	GPR141	37746557	0.000000	0.05858	0.001000	0.08648	0.063000	0.16089	-0.193000	0.09573	-1.303000	0.02332	-0.355000	0.07637	GAT		0.468	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219943.2	NM_181791		50	246	1	0	1.19403e-26	0.01441	1.92372e-26	50	246				
EPDR1	54749	broad.mit.edu	37	7	37988642	37988642	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:37988642C>G	ENST00000199448.4	+	2	849	c.470C>G	c.(469-471)gCt>gGt	p.A157G	EPDR1_ENST00000476620.1_Missense_Mutation_p.A55G|EPDR1_ENST00000559325.1_Missense_Mutation_p.A277G|EPDR1_ENST00000423717.1_Intron|EPDR1_ENST00000425345.1_Missense_Mutation_p.A96G	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1	157					cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.A277G(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						AGAAAGTCAGCTAGATCCTGT	0.463																																							uc003tfp.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(829-831)GCT>GGT		ependymin related protein 1 precursor							59.0	60.0	60.0					7																	37988642		2203	4300	6503	SO:0001583	missense	54749				cell-matrix adhesion	extracellular region	calcium ion binding	g.chr7:37988642C>G	BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.470C>G	7.37:g.37988642C>G	ENSP00000199448:p.Ala157Gly					EPDR1_uc003tfq.2_Intron|EPDR1_uc010kxh.2_Missense_Mutation_p.A96G	p.A277G	NM_017549	NP_060019	Q9UM22	EPDR1_HUMAN			2	849	+			157					A8K4C0|C9JYS3|Q06BL0|Q99M77	Missense_Mutation	SNP	ENST00000199448.4	37	c.830C>G	CCDS5454.2	.	.	.	.	.	.	.	.	.	.	C	13.98	2.398305	0.42512	.	.	ENSG00000086289	ENST00000476620;ENST00000199448;ENST00000425345	.	.	.	5.24	5.24	0.73138	.	0.053989	0.64402	D	0.000001	T	0.52613	0.1745	L	0.43757	1.38	0.80722	D	1	B;B	0.34329	0.116;0.449	B;B	0.35727	0.113;0.209	T	0.48536	-0.9027	9	0.28530	T	0.3	-17.7317	17.7611	0.88465	0.0:1.0:0.0:0.0	.	96;277	C9JYS3;A4D1W8	.;.	G	55;277;96	.	ENSP00000199448:A277G	A	+	2	0	EPDR1	37955167	1.000000	0.71417	0.778000	0.31720	0.184000	0.23303	5.864000	0.69575	2.729000	0.93468	0.655000	0.94253	GCT		0.463	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549		20	33	0	0	0	0.007413	0	20	33				
EGFR	1956	broad.mit.edu	37	7	55249005	55249005	+	Missense_Mutation	SNP	G	G	T	rs146024686|rs121913465|rs397517108		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:55249005G>T	ENST00000275493.2	+	20	2480	c.2303G>T	c.(2302-2304)aGc>aTc	p.S768I	EGFR_ENST00000454757.2_Missense_Mutation_p.S715I|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.S723I|EGFR-AS1_ENST00000442411.1_RNA	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	768	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		S -> I (found in a lung cancer sample; constitutively activated kinase with higher levels of basal autophosphorylation; more sensitive to gefitinib than wild-type; dbSNP:rs121913465). {ECO:0000269|PubMed:15623594}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.S768I(24)|p.S768N(1)|p.S768_V769insVAS(1)|p.S768_V769>IL(1)|p.S768T(1)|p.A767_S768insTLA(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GTGATGGCCAGCGTGGACAAC	0.637		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		29	Substitution - Missense(26)|Insertion - In frame(2)|Complex - compound substitution(1)	p.S768I(53)|p.S768_V769insAWT(1)|p.S768N(1)|p.S752_V769del(1)|p.S768_V769insVAS(1)|p.S768C(1)|p.S768_V769>IL(1)|p.A767_S768insTLA(1)	lung(25)|oesophagus(2)|large_intestine(1)|central_nervous_system(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2302-2304)AGC>ATC		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						102.0	94.0	97.0					7																	55249005		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55249005G>T		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2303G>T	7.37:g.55249005G>T	ENSP00000275493:p.Ser768Ile	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc010kzg.1_Missense_Mutation_p.S723I|EGFR_uc011kco.1_Missense_Mutation_p.S715I|uc003tqo.2_RNA	p.S768I	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		20	2549	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		768			Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2303G>T	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	32	5.151428	0.94645	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.83250	-1.7;-1.7;-1.7	5.85	5.85	0.93711	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90349	0.6980	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.91635	0.69;0.999	D	0.90589	0.4535	10	0.87932	D	0	.	18.7267	0.91716	0.0:0.0:1.0:0.0	.	723;768	Q504U8;P00533	.;EGFR_HUMAN	I	723;638;768;715	ENSP00000415559:S723I;ENSP00000275493:S768I;ENSP00000395243:S715I	ENSP00000275493:S768I	S	+	2	0	EGFR	55216499	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	9.830000	0.99415	2.760000	0.94817	0.655000	0.94253	AGC		0.637	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		19	78	1	0	3.28513e-13	0.021523	4.86065e-13	19	78				
EGFR	1956	broad.mit.edu	37	7	55249007	55249007	+	Missense_Mutation	SNP	G	G	T	rs147149347		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:55249007G>T	ENST00000275493.2	+	20	2482	c.2305G>T	c.(2305-2307)Gtg>Ttg	p.V769L	EGFR_ENST00000454757.2_Missense_Mutation_p.V716L|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.V724L|EGFR-AS1_ENST00000442411.1_RNA	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	769	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> M (found in a lung cancer sample; dbSNP:rs147149347). {ECO:0000269|PubMed:15623594}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.V769L(3)|p.S768_V769>IL(1)|p.V769M(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GATGGCCAGCGTGGACAACCC	0.637		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2		8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		5	Substitution - Missense(4)|Complex - compound substitution(1)	p.V769_D770insASV(20)|p.V769_D770insGVV(2)|p.V769M(2)|p.V769L(2)|p.V769_D770insMASVD(2)|p.V769_D770insDNV(1)|p.S768_V769insAWT(1)|p.V769_D770insCV(1)|p.S752_V769del(1)|p.V769_D770insGSV(1)|p.S768_V769insVAS(1)|p.V769_D770insGV(1)|p.S768_V769>IL(1)	lung(5)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2305-2307)GTG>TTG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						104.0	95.0	98.0					7																	55249007		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55249007G>T		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2305G>T	7.37:g.55249007G>T	ENSP00000275493:p.Val769Leu	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc010kzg.1_Missense_Mutation_p.V724L|EGFR_uc011kco.1_Missense_Mutation_p.V716L|uc003tqo.2_RNA	p.V769L	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		20	2551	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		769			Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2305G>T	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	17.52	3.411038	0.62399	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.56611	0.45;0.45;0.45	5.85	5.85	0.93711	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.32496	0.0831	N	0.00605	-1.335	0.58432	D	0.999992	P;P	0.52842	0.825;0.956	B;P	0.50231	0.069;0.635	T	0.52177	-0.8610	10	0.20046	T	0.44	.	18.7267	0.91716	0.0:0.0:1.0:0.0	.	724;769	Q504U8;P00533	.;EGFR_HUMAN	L	724;639;769;716	ENSP00000415559:V724L;ENSP00000275493:V769L;ENSP00000395243:V716L	ENSP00000275493:V769L	V	+	1	0	EGFR	55216501	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	9.830000	0.99415	2.760000	0.94817	0.655000	0.94253	GTG		0.637	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		19	77	1	0	3.28513e-13	0.021523	4.86065e-13	19	77				
KCTD7	154881	broad.mit.edu	37	7	66103260	66103260	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:66103260G>A	ENST00000275532.3	+	3	519	c.335G>A	c.(334-336)cGc>cAc	p.R112H	KCTD7_ENST00000443322.1_Missense_Mutation_p.R112H	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	112	BTB.				cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.R112H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						AATTTCCTGCGCTCAGGGGAC	0.567																																							uc003tve.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(334-336)CGC>CAC		potassium channel tetramerisation domain							104.0	97.0	99.0					7																	66103260		2203	4300	6503	SO:0001583	missense	154881					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr7:66103260G>A	AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.335G>A	7.37:g.66103260G>A	ENSP00000275532:p.Arg112His					RABGEF1_uc003tvf.2_5'UTR|KCTD7_uc003tvd.3_Missense_Mutation_p.R112H	p.R112H	NM_153033	NP_694578	Q96MP8	KCTD7_HUMAN			3	497	+			112			BTB.		A4D2M4|Q8IVR0	Missense_Mutation	SNP	ENST00000275532.3	37	c.335G>A	CCDS5534.1	.	.	.	.	.	.	.	.	.	.	g	35	5.437252	0.96168	.	.	ENSG00000243335	ENST00000275532;ENST00000443322	T;T	0.55760	0.5;0.5	5.61	5.61	0.85477	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	.	.	.	.	T	0.81254	0.4784	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86202	0.1619	9	0.87932	D	0	.	18.6402	0.91393	0.0:0.0:1.0:0.0	.	112	Q96MP8	KCTD7_HUMAN	H	112	ENSP00000275532:R112H;ENSP00000411624:R112H	ENSP00000275532:R112H	R	+	2	0	KCTD7	65740695	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.152000	0.94680	2.656000	0.90262	0.561000	0.74099	CGC		0.567	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2	NM_153033		7	92	0	0	0	0.001984	0	7	92				
PEX1	5189	broad.mit.edu	37	7	92147358	92147358	+	Splice_Site	SNP	T	T	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:92147358T>A	ENST00000248633.4	-	5	568		c.e5-2		PEX1_ENST00000438045.1_Intron|PEX1_ENST00000428214.1_Splice_Site|PEX1_ENST00000541751.1_5'Flank	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1						ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.?(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TTAGTGCAACTGTGTAGAAAA	0.388																																							uc003uly.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.e5-1		peroxin1							47.0	49.0	49.0					7																	92147358		2203	4300	6503	SO:0001630	splice_region_variant	5189				microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding	g.chr7:92147358T>A	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.473-2A>T	7.37:g.92147358T>A						PEX1_uc011khr.1_Splice_Site|PEX1_uc010ley.2_Splice_Site_p.V158_splice|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_Splice_Site	p.V158_splice	NM_000466	NP_000457	O43933	PEX1_HUMAN	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)		5	569	-	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)						A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Splice_Site	SNP	ENST00000248633.4	37	c.473_splice	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	T	11.19	1.566916	0.28003	.	.	ENSG00000127980	ENST00000248633;ENST00000428214;ENST00000545192	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2214	0.82262	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PEX1	91985294	1.000000	0.71417	0.928000	0.36995	0.058000	0.15608	6.905000	0.75714	2.219000	0.72066	0.528000	0.53228	.		0.388	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	Intron	6	37	0	0	0	0.001984	0	6	37				
MUC17	140453	broad.mit.edu	37	7	100686537	100686537	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:100686537C>A	ENST00000306151.4	+	3	11904	c.11840C>A	c.(11839-11841)aCc>aAc	p.T3947N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3947					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T3947N(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTCCTGTCACCAGTTCTACT	0.463																																							uc003uxp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(11839-11841)ACC>AAC		mucin 17 precursor							172.0	170.0	170.0					7																	100686537		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100686537C>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11840C>A	7.37:g.100686537C>A	ENSP00000302716:p.Thr3947Asn					MUC17_uc010lho.1_RNA	p.T3947N	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	11893	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3947			Extracellular (Potential).		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.11840C>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	3.359	-0.130890	0.06753	.	.	ENSG00000169876	ENST00000306151	T	0.01998	4.51	0.113	0.113	0.14631	.	.	.	.	.	T	0.01592	0.0051	N	0.14661	0.345	0.09310	N	1	D	0.54601	0.967	B	0.43809	0.432	T	0.52563	-0.8559	8	0.24483	T	0.36	.	.	.	.	.	3947	Q685J3	MUC17_HUMAN	N	3947	ENSP00000302716:T3947N	ENSP00000302716:T3947N	T	+	2	0	MUC17	100473257	0.000000	0.05858	0.061000	0.19648	0.068000	0.16541	-0.289000	0.08365	0.184000	0.20083	0.187000	0.17357	ACC		0.463	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		30	90	1	0	2.70662e-09	0.009535	3.66785e-09	30	90				
LAMB4	22798	broad.mit.edu	37	7	107692568	107692568	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:107692568G>T	ENST00000388781.3	-	26	3973	c.3890C>A	c.(3889-3891)tCc>tAc	p.S1297Y	LAMB4_ENST00000388780.3_Missense_Mutation_p.S1297Y|LAMB4_ENST00000205386.4_Missense_Mutation_p.S1297Y	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1297	Domain II.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.S1297Y(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						AAGGACACTGGATTGCAAATC	0.378																																							uc010ljo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						c.(3889-3891)TCC>TAC		laminin, beta 4 precursor							201.0	190.0	194.0					7																	107692568		2203	4300	6503	SO:0001583	missense	22798				cell adhesion	basement membrane		g.chr7:107692568G>T	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.3890C>A	7.37:g.107692568G>T	ENSP00000373433:p.Ser1297Tyr					LAMB4_uc003vey.2_Missense_Mutation_p.S1297Y|LAMB4_uc010ljp.1_Missense_Mutation_p.S266Y	p.S1297Y	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN			26	3974	-			1297			Domain II.|Potential.		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	c.3890C>A	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.502163	0.00157	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.34072	1.38;1.38;1.8;1.41	5.23	3.37	0.38596	.	0.931081	0.08978	N	0.866218	T	0.20170	0.0485	N	0.08118	0	0.09310	N	1	B;B	0.24092	0.007;0.097	B;B	0.26693	0.014;0.072	T	0.28332	-1.0047	10	0.51188	T	0.08	.	5.3918	0.16247	0.0744:0.1195:0.5613:0.2448	.	1297;1297	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	Y	1297;1297;323;1297	ENSP00000205386:S1297Y;ENSP00000373433:S1297Y;ENSP00000416562:S323Y;ENSP00000373432:S1297Y	ENSP00000205386:S1297Y	S	-	2	0	LAMB4	107479804	0.003000	0.15002	0.000000	0.03702	0.380000	0.30137	0.308000	0.19314	0.350000	0.24002	-0.797000	0.03246	TCC		0.378	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		38	149	1	0	6.5261e-18	0.00874	1.00136e-17	38	149				
PNPLA8	50640	broad.mit.edu	37	7	108119758	108119758	+	Silent	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:108119758T>C	ENST00000422087.1	-	11	2350	c.1944A>G	c.(1942-1944)ccA>ccG	p.P648P	PNPLA8_ENST00000426128.2_Silent_p.P586P|PNPLA8_ENST00000388728.5_Silent_p.P586P|PNPLA8_ENST00000257694.8_Silent_p.P648P|PNPLA8_ENST00000453144.1_Silent_p.P548P|PNPLA8_ENST00000436062.1_Silent_p.P648P	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	648					arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)	p.P648P(1)		breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						ACGGCACATCTGGCCAAAGAC	0.393																																							uc003vff.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(1942-1944)CCA>CCG		patatin-like phospholipase domain containing 8							168.0	139.0	149.0					7																	108119758		2203	4300	6503	SO:0001819	synonymous_variant	50640				fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity	g.chr7:108119758T>C	AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.1944A>G	7.37:g.108119758T>C						PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Silent_p.P648P|PNPLA8_uc003vfi.1_Silent_p.P548P|PNPLA8_uc003vfj.1_Silent_p.P648P|PNPLA8_uc003vfk.1_Silent_p.P548P	p.P648P	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN			11	2351	-			648					A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	Silent	SNP	ENST00000422087.1	37	c.1944A>G	CCDS34733.1																																																																																				0.393	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337475.1	NM_015723		24	61	0	0	0	0.01892	0	24	61				
CTTNBP2	83992	broad.mit.edu	37	7	117400700	117400700	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:117400700A>C	ENST00000160373.3	-	10	3052	c.2961T>G	c.(2959-2961)gaT>gaG	p.D987E		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	987					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.D987E(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		ATTCCAAGTCATCAGAACCAT	0.348																																							uc003vjf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(2959-2961)GAT>GAG		cortactin binding protein 2							135.0	131.0	133.0					7																	117400700		2203	4300	6503	SO:0001583	missense	83992							g.chr7:117400700A>C		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.2961T>G	7.37:g.117400700A>C	ENSP00000160373:p.Asp987Glu						p.D987E	NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN		LUSC - Lung squamous cell carcinoma(290;0.133)	10	3053	-	Lung NSC(10;0.0018)|all_lung(10;0.002)		987					O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	c.2961T>G	CCDS5774.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	13.38|13.38|13.38	2.218720|2.218720|2.218720	0.39201|0.39201|0.39201	.|.|.	.|.|.	ENSG00000077063|ENSG00000077063|ENSG00000077063	ENST00000160373|ENST00000435233|ENST00000446636	T|.|.	0.63255|.|.	-0.03|.|.	5.4|5.4|5.4	1.7|1.7|1.7	0.24286|0.24286|0.24286	.|.|.	0.490125|.|.	0.24899|.|.	N|.|.	0.034719|.|.	T|T|.	0.27559|0.27559|.	0.0677|0.0677|.	N|N|N	0.12182|0.12182|0.12182	0.205|0.205|0.205	0.34246|0.34246|0.34246	D|D|D	0.678208|0.678208|0.678208	B|.|.	0.06786|.|.	0.001|.|.	B|.|.	0.09377|.|.	0.004|.|.	T|T|.	0.30765|0.30765|.	-0.9967|-0.9967|.	10|5|.	0.31617|.|.	T|.|.	0.26|.|.	0.6121|0.6121|0.6121	6.4107|6.4107|6.4107	0.21690|0.21690|0.21690	0.6049:0.1593:0.2358:0.0|0.6049:0.1593:0.2358:0.0|0.6049:0.1593:0.2358:0.0	.|.|.	987|.|.	Q8WZ74|.|.	CTTB2_HUMAN|.|.	E|R|G	987|1|475	ENSP00000160373:D987E|.|.	ENSP00000160373:D987E|.|.	D|M|X	-|-|-	3|2|1	2|0|0	CTTNBP2|CTTNBP2|CTTNBP2	117187936|117187936|117187936	0.570000|0.570000|0.570000	0.26651|0.26651|0.26651	0.892000|0.892000|0.892000	0.35008|0.35008|0.35008	0.970000|0.970000|0.970000	0.65996|0.65996|0.65996	-0.263000|-0.263000|-0.263000	0.08670|0.08670|0.08670	0.443000|0.443000|0.443000	0.26582|0.26582|0.26582	0.528000|0.528000|0.528000	0.53228|0.53228|0.53228	GAT|ATG|TGA		0.348	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		30	134	0	0	0	0.008361	0	30	134				
CPA4	51200	broad.mit.edu	37	7	129939236	129939236	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:129939236G>T	ENST00000222482.4	+	3	305	c.277G>T	c.(277-279)Gac>Tac	p.D93Y	CPA4_ENST00000445470.2_Missense_Mutation_p.D93Y|CPA4_ENST00000493259.1_Intron	NM_016352.3	NP_057436.2	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4	93					histone acetylation (GO:0016573)	extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.D93Y(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Melanoma(18;0.0435)					GACAATTGAGGACCTGCAGGT	0.522																																							uc003vpr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(277-279)GAC>TAC		carboxypeptidase A4 preproprotein							91.0	77.0	82.0					7																	129939236		2203	4300	6503	SO:0001583	missense	51200				histone acetylation|proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding	g.chr7:129939236G>T	AF095719	CCDS5818.1, CCDS55163.1	7q32	2008-07-18			ENSG00000128510	ENSG00000128510			15740	protein-coding gene	gene with protein product	"""carboxypeptidase A3"""	607635				10383164, 10860668	Standard	NM_016352		Approved	CPA3	uc003vpr.3	Q9UI42	OTTHUMG00000157825	ENST00000222482.4:c.277G>T	7.37:g.129939236G>T	ENSP00000222482:p.Asp93Tyr					CPA4_uc011kpd.1_Missense_Mutation_p.D93Y|CPA4_uc011kpe.1_Intron	p.D93Y	NM_016352	NP_057436	Q9UI42	CBPA4_HUMAN			3	324	+	Melanoma(18;0.0435)		93					B7Z576|Q86UY9	Missense_Mutation	SNP	ENST00000222482.4	37	c.277G>T	CCDS5818.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175868	0.38413	.	.	ENSG00000128510	ENST00000445470;ENST00000222482;ENST00000492072;ENST00000473956	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	6.11	4.31	0.51392	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.149686	0.64402	D	0.000014	T	0.53029	0.1771	M	0.86953	2.85	0.52501	D	0.999951	D;D	0.71674	0.998;0.998	D;D	0.75484	0.986;0.95	T	0.57631	-0.7778	10	0.87932	D	0	.	9.9133	0.41419	0.1583:0.0:0.8417:0.0	.	93;93	B7Z576;Q9UI42	.;CBPA4_HUMAN	Y	93	ENSP00000412947:D93Y;ENSP00000222482:D93Y;ENSP00000417255:D93Y;ENSP00000418392:D93Y	ENSP00000222482:D93Y	D	+	1	0	CPA4	129726472	1.000000	0.71417	0.967000	0.41034	0.110000	0.19582	2.850000	0.48294	0.900000	0.36469	-0.137000	0.14449	GAC		0.522	CPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349725.1	NM_016352		13	46	1	0	4.36969e-10	0.016723	6.00574e-10	13	46				
EXOC4	60412	broad.mit.edu	37	7	133622733	133622733	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:133622733A>T	ENST00000253861.4	+	14	2146	c.2117A>T	c.(2116-2118)gAc>gTc	p.D706V	EXOC4_ENST00000541309.1_5'UTR|EXOC4_ENST00000539845.1_Missense_Mutation_p.D605V|EXOC4_ENST00000545148.1_Missense_Mutation_p.D316V	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	706					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)	p.D706V(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GACGTCAGTGACCTCAAAGCC	0.453																																							uc003vrk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9						c.(2116-2118)GAC>GTC		SEC8 protein isoform a							151.0	133.0	139.0					7																	133622733		2203	4300	6503	SO:0001583	missense	60412				vesicle docking involved in exocytosis	exocyst	protein N-terminus binding	g.chr7:133622733A>T	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.2117A>T	7.37:g.133622733A>T	ENSP00000253861:p.Asp706Val					EXOC4_uc011kpo.1_Missense_Mutation_p.D605V|EXOC4_uc003vrl.2_Missense_Mutation_p.D316V|EXOC4_uc011kpp.1_Missense_Mutation_p.D238V|EXOC4_uc011kpq.1_5'UTR	p.D706V	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN			14	2152	+		Esophageal squamous(399;0.129)	706					E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	c.2117A>T	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	A	18.74	3.687913	0.68271	.	.	ENSG00000131558	ENST00000253861;ENST00000546185;ENST00000539845;ENST00000545148	.	.	.	5.74	5.74	0.90152	.	0.046583	0.85682	D	0.000000	T	0.40498	0.1119	L	0.31420	0.93	0.80722	D	1	P;B;P	0.38335	0.627;0.216;0.456	B;B;B	0.33846	0.155;0.171;0.106	T	0.25606	-1.0127	9	0.26408	T	0.33	.	16.3305	0.83010	1.0:0.0:0.0:0.0	.	238;316;706	B7Z689;F5GZT1;Q96A65	.;.;EXOC4_HUMAN	V	706;325;605;316	.	ENSP00000253861:D706V	D	+	2	0	EXOC4	133273273	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.232000	0.95325	2.317000	0.78254	0.459000	0.35465	GAC		0.453	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807		30	73	0	0	0	0.008361	0	30	73				
MGAM	8972	broad.mit.edu	37	7	141730170	141730170	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:141730170G>T	ENST00000549489.2	+	11	1325	c.1230G>T	c.(1228-1230)caG>caT	p.Q410H	MGAM_ENST00000475668.2_Missense_Mutation_p.Q410H	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	410	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.Q410H(3)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGGATGTTCAGCATGCTGATA	0.328																																							uc003vwy.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(1228-1230)CAG>CAT		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						107.0	91.0	96.0					7																	141730170		1837	4090	5927	SO:0001583	missense	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141730170G>T	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.1230G>T	7.37:g.141730170G>T	ENSP00000447378:p.Gln410His						p.Q410H	NM_004668	NP_004659	O43451	MGA_HUMAN			11	1284	+	Melanoma(164;0.0272)		410			Lumenal (Potential).|Maltase.		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	c.1230G>T	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361870	0.61403	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.92805	-3.11	5.07	2.32	0.28847	Glycoside hydrolase, superfamily (1);	0.000000	0.48767	D	0.000176	D	0.96685	0.8918	H	0.96208	3.785	0.35343	D	0.786665	D	0.89917	1.0	D	0.97110	1.0	D	0.96680	0.9503	10	0.87932	D	0	.	8.5461	0.33421	0.2533:0.0:0.7467:0.0	.	410	O43451	MGA_HUMAN	H	410;410;287	ENSP00000447378:Q410H	ENSP00000316431:Q287H	Q	+	3	2	MGAM	141376639	0.997000	0.39634	1.000000	0.80357	0.981000	0.71138	0.295000	0.19065	0.330000	0.23485	-0.219000	0.12488	CAG		0.328	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			7	31	1	0	0.000157383	0.00308	0.000181837	7	31				
PRSS3P2	154754	broad.mit.edu	37	7	142480063	142480063	+	RNA	SNP	C	C	A	rs202169021	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:142480063C>A	ENST00000603901.1	+	0	195					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										GTCACTGCTACAAGCCGTAAG	0.567																																							uc011ksq.1		NA																	0					0						c.(193-195)TAC>TAA		SubName: Full=Protease, serine, 3; Flags: Fragment;							28.0	25.0	26.0					7																	142480063		692	1591	2283			154754							g.chr7:142480063C>A			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142480063C>A						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_RNA|uc003wan.1_Intron|TRY6_uc011kso.1_RNA|TRY6_uc011ksr.1_RNA	p.Y65*	NR_001296						2	278	+									Nonsense_Mutation	SNP	ENST00000603901.1	37	c.195C>A																																																																																					0.567	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470000.1	NR_001296		5	42	1	0	0.000157383	0.00308	0.000181837	5	42				
TRBV30	28557	broad.mit.edu	37	7	142510501	142510501	+	RNA	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:142510501C>A	ENST00000417977.2	-	0	216									T cell receptor beta variable 30 (gene/pseudogene)																		CCAGAGAGAGCGGGCTGCCCA	0.572																																							uc003wbp.2		NA																	0					NA						c.(103-105)CCG>CCT		SubName: Full=V_segment translation product; Flags: Fragment;							30.0	33.0	32.0					7																	142510501		1971	4147	6118			0							g.chr7:142510501C>A	L36092		7q34	2012-02-07	2008-09-12		ENSG00000237254	ENSG00000237254		"""T cell receptors / TRB locus"""	12214	other	T cell receptor gene			"""T cell receptor beta variable 30"""			8650574	Standard	NG_001333		Approved	TCRBV20S1A1N2, TCRBV30S1			OTTHUMG00000158907		7.37:g.142510501C>A							p.P35P							2	217	-									Silent	SNP	ENST00000417977.2	37	c.105G>T																																																																																					0.572	TRBV30-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000352519.1	NG_001333		5	12	1	0	0.00116845	0.001168	0.00128352	5	12				
ASB10	136371	broad.mit.edu	37	7	150884096	150884096	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:150884096G>C	ENST00000420175.2	-	1	146	c.122C>G	c.(121-123)tCt>tGt	p.S41C	ASB10_ENST00000434669.1_Missense_Mutation_p.S86C|ASB10_ENST00000422024.1_Missense_Mutation_p.S86C|ASB10_ENST00000275838.1_Missense_Mutation_p.S41C|ASB10_ENST00000377867.3_Intron			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	41					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S41C(2)		NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCCGGGCCAGACTTGAGGTG	0.662																																							uc003wjm.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(256-258)TCT>TGT		ankyrin repeat and SOCS box-containing 10							41.0	38.0	39.0					7																	150884096		2202	4300	6502	SO:0001583	missense	136371				intracellular signal transduction			g.chr7:150884096G>C	AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.122C>G	7.37:g.150884096G>C	ENSP00000391137:p.Ser41Cys					ASB10_uc003wjl.1_Missense_Mutation_p.S86C|ASB10_uc003wjn.1_Intron	p.S86C	NM_001142459	NP_001135931	Q8WXI3	ASB10_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	1	383	-			41					A0AVH0|Q6ZUL6	Missense_Mutation	SNP	ENST00000420175.2	37	c.257C>G	CCDS47750.2	.	.	.	.	.	.	.	.	.	.	G	8.474	0.858254	0.17178	.	.	ENSG00000146926	ENST00000275838;ENST00000422024;ENST00000434669;ENST00000420175	T;T;T;T	0.69040	-0.35;-0.37;-0.37;-0.33	4.47	2.47	0.30058	.	.	.	.	.	T	0.44871	0.1314	N	0.14661	0.345	0.09310	N	1	P;B	0.41643	0.758;0.289	B;B	0.36959	0.237;0.115	T	0.29941	-0.9995	9	0.54805	T	0.06	0.9172	6.6158	0.22776	0.0:0.1819:0.5387:0.2794	.	41;86	Q8WXI3;D5MNW9	ASB10_HUMAN;.	C	41;86;86;41	ENSP00000275838:S41C;ENSP00000401369:S86C;ENSP00000398247:S86C;ENSP00000391137:S41C	ENSP00000275838:S41C	S	-	2	0	ASB10	150515029	0.001000	0.12720	0.007000	0.13788	0.460000	0.32559	0.996000	0.29719	0.991000	0.38814	0.585000	0.79938	TCT		0.662	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347096.3	NM_080871		6	14	0	0	0	0.001168	0	6	14				
PTPRN2	5799	broad.mit.edu	37	7	157926709	157926709	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:157926709G>A	ENST00000389418.4	-	9	1225	c.1216C>T	c.(1216-1218)Cac>Tac	p.H406Y	PTPRN2_ENST00000404321.2_Missense_Mutation_p.H429Y|PTPRN2_ENST00000389413.3_Missense_Mutation_p.H406Y|PTPRN2_ENST00000409483.1_Missense_Mutation_p.H368Y|PTPRN2_ENST00000389416.4_Missense_Mutation_p.H389Y	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	406					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.H406Y(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CGAGACCCGTGGTCCTGCAGG	0.582																																							uc003wno.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7						c.(1216-1218)CAC>TAC		protein tyrosine phosphatase, receptor type, N							42.0	46.0	45.0					7																	157926709		2203	4300	6503	SO:0001583	missense	5799					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:157926709G>A	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1216C>T	7.37:g.157926709G>A	ENSP00000374069:p.His406Tyr					PTPRN2_uc003wnp.2_Missense_Mutation_p.H389Y|PTPRN2_uc003wnq.2_Missense_Mutation_p.H406Y|PTPRN2_uc003wnr.2_Missense_Mutation_p.H368Y|PTPRN2_uc011kwa.1_Missense_Mutation_p.H429Y	p.H406Y	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)	9	1337	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	406			Extracellular (Potential).		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	37	c.1216C>T	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	G	5.998	0.368105	0.11352	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.03094	4.06;4.05;4.06;4.06;4.05	3.74	2.83	0.33086	.	.	.	.	.	T	0.01835	0.0058	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B	0.09022	0.002;0.001;0.002;0.001;0.001	B;B;B;B;B	0.04013	0.001;0.0;0.001;0.0;0.0	T	0.47749	-0.9093	9	0.02654	T	1	.	5.289	0.15717	0.1136:0.0:0.6888:0.1976	.	429;368;406;389;406	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	Y	368;406;389;406;429	ENSP00000387114:H368Y;ENSP00000374064:H406Y;ENSP00000374067:H389Y;ENSP00000374069:H406Y;ENSP00000385464:H429Y	ENSP00000374064:H406Y	H	-	1	0	PTPRN2	157619470	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	1.188000	0.32102	0.633000	0.30452	0.471000	0.43371	CAC		0.582	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1			13	42	0	0	0	0.020292	0	13	42				
UNC5D	137970	broad.mit.edu	37	8	35624454	35624454	+	Missense_Mutation	SNP	G	G	A	rs112851152		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:35624454G>A	ENST00000404895.2	+	15	2676	c.2348G>A	c.(2347-2349)cGg>cAg	p.R783Q	UNC5D_ENST00000453357.2_Missense_Mutation_p.R778Q|UNC5D_ENST00000449677.1_Missense_Mutation_p.R359Q|UNC5D_ENST00000416672.1_Missense_Mutation_p.R788Q|UNC5D_ENST00000420357.1_Missense_Mutation_p.R716Q|UNC5D_ENST00000287272.2_Missense_Mutation_p.R714Q	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	783					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.R778Q(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGCAGTAACCGGCAGCCCCTG	0.587																																							uc003xjr.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(2347-2349)CGG>CAG		unc-5 homolog D precursor							100.0	86.0	91.0					8																	35624454		2203	4300	6503	SO:0001583	missense	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35624454G>A	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2348G>A	8.37:g.35624454G>A	ENSP00000385143:p.Arg783Gln					UNC5D_uc003xjs.1_Missense_Mutation_p.R778Q|UNC5D_uc003xju.1_Missense_Mutation_p.R359Q	p.R783Q	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	15	2676	+			783			Cytoplasmic (Potential).		Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	c.2348G>A	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	G	7.554	0.663212	0.14710	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.49139	0.82;1.3;1.32;0.82;0.79;2.75	5.79	4.92	0.64577	.	0.306161	0.36519	N	0.002543	T	0.11537	0.0281	N	0.00419	-1.52	0.31715	N	0.639042	B;B;B	0.14438	0.006;0.01;0.006	B;B;B	0.08055	0.002;0.003;0.002	T	0.26121	-1.0112	10	0.02654	T	1	-6.814	4.9962	0.14240	0.2583:0.1535:0.5882:0.0	.	359;778;783	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	Q	783;716;714;788;778;359	ENSP00000385143:R783Q;ENSP00000392739:R716Q;ENSP00000287272:R714Q;ENSP00000412652:R788Q;ENSP00000394303:R778Q;ENSP00000397211:R359Q	ENSP00000287272:R714Q	R	+	2	0	UNC5D	35743996	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.370000	0.59517	1.453000	0.47775	0.655000	0.94253	CGG		0.587	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			5	52	0	0	0	0.001168	0	5	52				
ADAM18	8749	broad.mit.edu	37	8	39537627	39537627	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:39537627C>A	ENST00000265707.5	+	16	1748	c.1703C>A	c.(1702-1704)aCa>aAa	p.T568K	ADAM18_ENST00000541111.1_5'UTR|ADAM18_ENST00000379866.1_Missense_Mutation_p.T544K	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	568	Cys-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T568K(1)		NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			GCTCAATCTACAGTTTATTCA	0.398																																							uc003xni.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6						c.(1702-1704)ACA>AAA		a disintegrin and metalloprotease domain 18							114.0	102.0	106.0					8																	39537627		2203	4300	6503	SO:0001583	missense	8749				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding	g.chr8:39537627C>A	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1703C>A	8.37:g.39537627C>A	ENSP00000265707:p.Thr568Lys					ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Missense_Mutation_p.T544K	p.T568K	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000199)		16	1703	+		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	568			Cys-rich.|Extracellular (Potential).		B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	ENST00000265707.5	37	c.1703C>A	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847878	0.32606	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000522198	T;T	0.23147	1.92;1.92	3.98	1.1	0.20463	ADAM, cysteine-rich (2);	0.607850	0.13715	N	0.367792	T	0.21841	0.0526	L	0.39898	1.24	0.09310	N	1	B;B	0.34255	0.391;0.445	B;B	0.39299	0.196;0.296	T	0.20840	-1.0263	10	0.72032	D	0.01	.	5.762	0.18205	0.0:0.6386:0.0:0.3614	.	544;568	Q9Y3Q7-2;Q9Y3Q7	.;ADA18_HUMAN	K	568;544;500	ENSP00000265707:T568K;ENSP00000369195:T544K	ENSP00000265707:T568K	T	+	2	0	ADAM18	39656784	0.000000	0.05858	0.000000	0.03702	0.256000	0.26092	0.004000	0.13106	0.230000	0.21059	0.655000	0.94253	ACA		0.398	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237		12	98	1	0	1.36491e-13	0.016723	2.04033e-13	12	98				
ADAM2	2515	broad.mit.edu	37	8	39679167	39679167	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:39679167G>T	ENST00000265708.4	-	5	385	c.282C>A	c.(280-282)taC>taA	p.Y94*	ADAM2_ENST00000523181.1_5'UTR|ADAM2_ENST00000347580.4_Nonsense_Mutation_p.Y94*|ADAM2_ENST00000521880.1_Nonsense_Mutation_p.Y94*|ADAM2_ENST00000379853.2_Nonsense_Mutation_p.Y94*	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	94					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TATACCCTTGGTAGTGGCAGA	0.299																																							uc003xnj.2		NA																	0				ovary(1)|lung(1)	2						c.(280-282)TAC>TAA		ADAM metallopeptidase domain 2 proprotein							78.0	77.0	77.0					8																	39679167		2203	4298	6501	SO:0001587	stop_gained	2515				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr8:39679167G>T	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.282C>A	8.37:g.39679167G>T	ENSP00000265708:p.Tyr94*					ADAM2_uc003xnk.2_Nonsense_Mutation_p.Y94*|ADAM2_uc011lck.1_Nonsense_Mutation_p.Y94*|ADAM2_uc003xnl.2_Nonsense_Mutation_p.Y94*	p.Y94*	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)	5	357	-		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	94					P78326|Q9UQQ8	Nonsense_Mutation	SNP	ENST00000265708.4	37	c.282C>A	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	G	34	5.325330	0.95708	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	.	.	.	5.51	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4722	0.55794	0.0833:0.0:0.9167:0.0	.	.	.	.	X	94	.	.	Y	-	3	2	ADAM2	39798324	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.546000	0.36179	2.582000	0.87167	0.650000	0.86243	TAC		0.299	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464		3	74	1	0	0.00024832	0.009096	0.000283515	3	74				
ANK1	286	broad.mit.edu	37	8	41572528	41572528	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:41572528A>T	ENST00000347528.4	-	15	1750	c.1667T>A	c.(1666-1668)cTg>cAg	p.L556Q	ANK1_ENST00000396945.1_Missense_Mutation_p.L556Q|ANK1_ENST00000265709.8_Missense_Mutation_p.L589Q|ANK1_ENST00000379758.2_Missense_Mutation_p.L556Q|ANK1_ENST00000396942.1_Missense_Mutation_p.L556Q|ANK1_ENST00000289734.7_Missense_Mutation_p.L556Q|ANK1_ENST00000352337.4_Missense_Mutation_p.L556Q	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	556	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.L589Q(1)|p.L556Q(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GTCCCGCTCCAGCAGCAGCTC	0.607																																							uc003xok.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9						c.(1666-1668)CTG>CAG		ankyrin 1 isoform 1							77.0	76.0	76.0					8																	41572528		2203	4300	6503	SO:0001583	missense	286				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	g.chr8:41572528A>T	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1667T>A	8.37:g.41572528A>T	ENSP00000339620:p.Leu556Gln					NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Missense_Mutation_p.L556Q|ANK1_uc003xoj.2_Missense_Mutation_p.L556Q|ANK1_uc003xol.2_Missense_Mutation_p.L556Q|ANK1_uc003xom.2_Missense_Mutation_p.L589Q	p.L556Q	NM_020476	NP_065209	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)		15	1751	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	556			89 kDa domain.|ANK 16.		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	c.1667T>A	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.852696	0.91355	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07;2.07	5.76	5.76	0.90799	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000001	T	0.60274	0.2256	H	0.95816	3.725	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.991;0.999;1.0	T	0.73180	-0.4064	10	0.66056	D	0.02	.	16.0718	0.80941	1.0:0.0:0.0:0.0	.	589;556;556;556;556	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	Q	556;556;556;556;556;556;589;556	ENSP00000339620:L556Q;ENSP00000289734:L556Q;ENSP00000369082:L556Q;ENSP00000380149:L556Q;ENSP00000380147:L556Q;ENSP00000309131:L556Q;ENSP00000265709:L589Q	ENSP00000265709:L589Q	L	-	2	0	ANK1	41691685	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	9.339000	0.96797	2.195000	0.70347	0.528000	0.53228	CTG		0.607	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		7	71	0	0	0	0.00308	0	7	71				
PREX2	80243	broad.mit.edu	37	8	68965476	68965476	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:68965476G>A	ENST00000288368.4	+	9	1365	c.1088G>A	c.(1087-1089)cGg>cAg	p.R363Q	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	363					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.R363Q(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGAGAACGGCGGAAAGGTGGG	0.373																																							uc003xxv.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						c.(1087-1089)CGG>CAG		DEP domain containing 2 isoform a							107.0	104.0	105.0					8																	68965476		2203	4300	6503	SO:0001583	missense	80243				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity	g.chr8:68965476G>A	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1088G>A	8.37:g.68965476G>A	ENSP00000288368:p.Arg363Gln					PREX2_uc003xxu.1_Missense_Mutation_p.R363Q|PREX2_uc011lez.1_Missense_Mutation_p.R298Q	p.R363Q	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN			9	1115	+			363					B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	c.1088G>A	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	36	5.643888	0.96704	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.61040	0.14	5.74	5.74	0.90152	Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.74114	0.3674	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.74197	-0.3743	10	0.62326	D	0.03	.	19.9189	0.97077	0.0:0.0:1.0:0.0	.	363;363;363	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	Q	363	ENSP00000288368:R363Q	ENSP00000288368:R363Q	R	+	2	0	PREX2	69128030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.707000	0.92482	0.655000	0.94253	CGG		0.373	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170		11	134	0	0	0	0.010729	0	11	134				
CSMD3	114788	broad.mit.edu	37	8	113323246	113323246	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:113323246C>A	ENST00000297405.5	-	50	8090	c.7846G>T	c.(7846-7848)Ggg>Tgg	p.G2616W	CSMD3_ENST00000343508.3_Missense_Mutation_p.G2576W|CSMD3_ENST00000455883.2_Missense_Mutation_p.G2512W|CSMD3_ENST00000352409.3_Missense_Mutation_p.G2546W	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2616	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G2576W(1)|p.G2616W(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GCATGATACCCATAGGAAGAC	0.468										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(7846-7848)GGG>TGG		CUB and Sushi multiple domains 3 isoform 1							144.0	117.0	126.0					8																	113323246		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113323246C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7846G>T	8.37:g.113323246C>A	ENSP00000297405:p.Gly2616Trp	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.G1818W|CSMD3_uc003ynt.2_Missense_Mutation_p.G2576W|CSMD3_uc011lhx.1_Missense_Mutation_p.G2512W|CSMD3_uc003ynw.1_Missense_Mutation_p.G327W	p.G2616W	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			50	8005	-			2616			Extracellular (Potential).|Sushi 14.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.7846G>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979696	0.92982	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	5.62	5.62	0.85841	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.62109	0.2401	M	0.90922	3.16	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.67776	-0.5583	10	0.48119	T	0.1	.	19.6449	0.95773	0.0:1.0:0.0:0.0	.	2512;2616;2576	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	W	2576;2616;1886;2512;2546	ENSP00000345799:G2576W;ENSP00000297405:G2616W;ENSP00000341558:G1886W;ENSP00000412263:G2512W;ENSP00000343124:G2546W	ENSP00000297405:G2616W	G	-	1	0	CSMD3	113392422	1.000000	0.71417	0.992000	0.48379	0.902000	0.53008	6.067000	0.71193	2.628000	0.89032	0.655000	0.94253	GGG		0.468	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		48	58	1	0	3.10996e-30	0.01441	5.06679e-30	48	58				
CSMD3	114788	broad.mit.edu	37	8	113563023	113563023	+	Missense_Mutation	SNP	G	G	T	rs563294987	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:113563023G>T	ENST00000297405.5	-	27	4685	c.4441C>A	c.(4441-4443)Ctt>Att	p.L1481I	CSMD3_ENST00000343508.3_Missense_Mutation_p.L1441I|CSMD3_ENST00000455883.2_Missense_Mutation_p.L1377I|CSMD3_ENST00000352409.3_Missense_Mutation_p.L1481I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1481	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1441I(1)|p.L1481I(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCCTTTAAAAGCATATCATTT	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(4441-4443)CTT>ATT		CUB and Sushi multiple domains 3 isoform 1							77.0	75.0	76.0					8																	113563023		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113563023G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4441C>A	8.37:g.113563023G>T	ENSP00000297405:p.Leu1481Ile	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.L753I|CSMD3_uc003ynt.2_Missense_Mutation_p.L1441I|CSMD3_uc011lhx.1_Missense_Mutation_p.L1377I	p.L1481I	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			27	4600	-			1481			Extracellular (Potential).|CUB 8.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.4441C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055493	0.55325	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0;-0.0	4.36	2.54	0.30619	CUB (5);	0.107096	0.37955	N	0.001863	T	0.65790	0.2725	M	0.77103	2.36	0.25870	N	0.983718	P;P;P	0.46457	0.823;0.853;0.878	B;P;P	0.48089	0.431;0.566;0.511	T	0.59300	-0.7480	10	0.45353	T	0.12	.	9.1599	0.37016	0.2519:0.0:0.7481:0.0	.	1377;1481;1441	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	1441;1481;821;1377;1481	ENSP00000345799:L1441I;ENSP00000297405:L1481I;ENSP00000341558:L821I;ENSP00000412263:L1377I;ENSP00000343124:L1481I	ENSP00000297405:L1481I	L	-	1	0	CSMD3	113632199	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	2.277000	0.43417	1.182000	0.42928	0.591000	0.81541	CTT		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		8	106	1	0	0.000157383	0.00308	0.000181837	8	106				
COL22A1	169044	broad.mit.edu	37	8	139611019	139611019	+	Silent	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:139611019C>T	ENST00000303045.6	-	61	4754	c.4308G>A	c.(4306-4308)gaG>gaA	p.E1436E	COL22A1_ENST00000435777.1_Silent_p.E1416E|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1436	Collagen-like 14.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.E1436E(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTGGTCCATTCTCCCCAGGTA	0.622										HNSCC(7;0.00092)																													uc003yvd.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(11)|pancreas(1)|skin(1)	13						c.(4306-4308)GAG>GAA		collagen, type XXII, alpha 1							65.0	67.0	67.0					8																	139611019		2203	4300	6503	SO:0001819	synonymous_variant	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139611019C>T	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4308G>A	8.37:g.139611019C>T		HNSCC(7;0.00092)				COL22A1_uc011ljo.1_Silent_p.E716E	p.E1436E	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		61	4755	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1436			Pro-rich.|Gly-rich.|Collagen-like 14.		B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	c.4308G>A	CCDS6376.1																																																																																				0.622	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		41	54	0	0	0	0.007835	0	41	54				
TSNARE1	203062	broad.mit.edu	37	8	143427140	143427140	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:143427140C>A	ENST00000307180.3	-	3	319	c.202G>T	c.(202-204)Gca>Tca	p.A68S	TSNARE1_ENST00000519651.1_Intron|TSNARE1_ENST00000524325.1_Missense_Mutation_p.A68S|TSNARE1_ENST00000520166.1_Missense_Mutation_p.A68S	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	68					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)	p.A68S(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GGCGTGCCTGCTGGCCCCAGA	0.622																																							uc003ywk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(202-204)GCA>TCA		t-SNARE domain containing 1							92.0	76.0	82.0					8																	143427140		2203	4300	6503	SO:0001583	missense	203062				vesicle-mediated transport	integral to membrane		g.chr8:143427140C>A			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.202G>T	8.37:g.143427140C>A	ENSP00000303437:p.Ala68Ser					TSNARE1_uc011lju.1_Missense_Mutation_p.A68S|TSNARE1_uc003ywj.2_Missense_Mutation_p.A68S|TSNARE1_uc003ywl.3_Intron	p.A68S	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN			3	320	-	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)		68					B7ZLB0|Q14D03	Missense_Mutation	SNP	ENST00000307180.3	37	c.202G>T	CCDS6384.1	.	.	.	.	.	.	.	.	.	.	C	3.957	-0.011145	0.07727	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000520462;ENST00000518720	T;T;T;T;T	0.23348	2.82;2.82;2.82;1.93;1.91	2.52	2.52	0.30459	.	1.056820	0.07630	U	0.928489	T	0.17280	0.0415	N	0.17082	0.46	0.09310	N	1	P;P;P	0.34522	0.455;0.455;0.455	B;B;B	0.34093	0.175;0.175;0.175	T	0.20874	-1.0262	10	0.87932	D	0	.	8.6827	0.34218	0.0:1.0:0.0:0.0	.	68;68;68	B7ZLB0;Q96NA8;A0AVG3	.;TSNA1_HUMAN;.	S	68;68;68;68;84	ENSP00000428763:A68S;ENSP00000303437:A68S;ENSP00000427770:A68S;ENSP00000429626:A68S;ENSP00000430789:A84S	ENSP00000303437:A68S	A	-	1	0	TSNARE1	143425047	0.000000	0.05858	0.003000	0.11579	0.059000	0.15707	0.490000	0.22403	1.714000	0.51371	0.650000	0.86243	GCA		0.622	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003		16	23	1	0	1.3612e-06	0.003163	1.7015e-06	16	23				
ZC3H3	23144	broad.mit.edu	37	8	144621188	144621188	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr8:144621188G>C	ENST00000262577.5	-	2	380	c.349C>G	c.(349-351)Ctc>Gtc	p.L117V	RP11-661A12.5_ENST00000530600.1_RNA	NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	117					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CCCTGACTGAGCTGGACCTGT	0.622																																							uc003yyd.2		NA																	0				skin(1)	1						c.(349-351)CTC>GTC		zinc finger CCCH-type containing 3							54.0	62.0	59.0					8																	144621188		2203	4299	6502	SO:0001583	missense	23144				mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding	g.chr8:144621188G>C	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.349C>G	8.37:g.144621188G>C	ENSP00000262577:p.Leu117Val						p.L117V	NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)		2	378	-	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		117					Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	c.349C>G	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	g	11.87	1.766180	0.31228	.	.	ENSG00000014164	ENST00000262577	T	0.59364	0.27	4.85	3.98	0.46160	.	0.353469	0.24174	N	0.040866	T	0.64057	0.2564	M	0.71581	2.175	0.22648	N	0.998896	D	0.61080	0.989	P	0.57679	0.825	T	0.55231	-0.8173	10	0.34782	T	0.22	-18.552	5.1138	0.14823	0.1923:0.1723:0.6354:0.0	.	117	Q8IXZ2	ZC3H3_HUMAN	V	117	ENSP00000262577:L117V	ENSP00000262577:L117V	L	-	1	0	ZC3H3	144692331	0.987000	0.35691	0.985000	0.45067	0.283000	0.27025	1.081000	0.30791	1.062000	0.40625	-0.215000	0.12644	CTC		0.622	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117		5	124	0	0	0	0.014758	0	5	124				
RIC1	57589	broad.mit.edu	37	9	5765728	5765728	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:5765728G>A	ENST00000414202.2	+	21	3258	c.3067G>A	c.(3067-3069)Gaa>Aaa	p.E1023K	KIAA1432_ENST00000449720.2_Missense_Mutation_p.E907K|KIAA1432_ENST00000251879.6_Missense_Mutation_p.E1023K|KIAA1432_ENST00000418622.3_Missense_Mutation_p.E944K|KIAA1432_ENST00000381532.2_Missense_Mutation_p.E944K	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		CCAGTCAGCTGAAAATGTTCC	0.398																																							uc003zji.2		NA																	0					0						c.(2830-2832)GAA>AAA		connexin 43-interacting protein 150 isoform a							119.0	126.0	124.0					9																	5765728		2203	4300	6503	SO:0001583	missense	57589					integral to membrane		g.chr9:5765728G>A																												ENST00000414202.2:c.3067G>A	9.37:g.5765728G>A	ENSP00000416696:p.Glu1023Lys					KIAA1432_uc003zjh.2_Missense_Mutation_p.E944K|KIAA1432_uc003zjl.3_Missense_Mutation_p.E907K|KIAA1432_uc003zjj.1_Missense_Mutation_p.E486K|ERMP1_uc011lme.1_RNA	p.E944K	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)	20	2923	+		Acute lymphoblastic leukemia(23;0.154)	1023						Missense_Mutation	SNP	ENST00000414202.2	37	c.2830G>A	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	G	14.50	2.554835	0.45487	.	.	ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720	.	.	.	6.04	6.04	0.98038	.	0.181870	0.64402	D	0.000019	T	0.58637	0.2136	L	0.54323	1.7	0.80722	D	1	B;B;B;B	0.22211	0.0;0.058;0.004;0.066	B;B;B;B	0.21708	0.001;0.033;0.004;0.036	T	0.56559	-0.7959	9	0.07644	T	0.81	-7.7682	20.5948	0.99439	0.0:0.0:1.0:0.0	.	907;944;1023;1023	B7ZM67;B2RN24;Q4ADV7;G5E932	.;.;RIC1_HUMAN;.	K	1023;1023;944;944;907	.	ENSP00000251879:E1023K	E	+	1	0	KIAA1432	5755728	1.000000	0.71417	0.999000	0.59377	0.668000	0.39293	9.476000	0.97823	2.873000	0.98535	0.563000	0.77884	GAA		0.398	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3			11	172	0	0	0	0.00499	0	11	172				
SPATA31A3	727830	broad.mit.edu	37	9	40702749	40702749	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:40702749C>A	ENST00000356699.5	+	4	435	c.406C>A	c.(406-408)Cag>Aag	p.Q136K	SPATA31A3_ENST00000463536.1_3'UTR|RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	136	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.Q136K(2)									TGGAGCCTCCCAGTCCTCTCA	0.602																																							uc010mmj.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|skin(1)	3						c.(406-408)CAG>AAG		hypothetical protein LOC727830							33.0	42.0	39.0					9																	40702749		1858	4062	5920	SO:0001583	missense	727830					integral to membrane		g.chr9:40702749C>A			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.406C>A	9.37:g.40702749C>A	ENSP00000349132:p.Gln136Lys						p.Q136K	NM_001083124	NP_001076593	Q5VYP0	F75A3_HUMAN		GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)	4	435	+			136			Pro-rich.			Missense_Mutation	SNP	ENST00000356699.5	37	c.406C>A	CCDS47969.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.342923	0.00222	.	.	ENSG00000147926	ENST00000356699	T	0.05025	3.51	2.19	-4.37	0.03633	.	2.660450	0.01320	N	0.010913	T	0.05823	0.0152	L	0.50333	1.59	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36986	-0.9725	10	0.22706	T	0.39	3.9543	0.2473	0.00200	0.3006:0.1845:0.1497:0.3652	.	136	Q5VYP0	F75A3_HUMAN	K	136	ENSP00000349132:Q136K	ENSP00000349132:Q136K	Q	+	1	0	FAM75A3	40692749	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.864000	0.04254	-2.240000	0.00710	-0.490000	0.04691	CAG		0.602	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124		9	211	1	0	0.00010058	0.013537	0.00011857	9	211				
SPATA31C2	645961	broad.mit.edu	37	9	90744703	90744703	+	IGR	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:90744703C>T								U6 (131453 upstream) : U3 (244480 downstream)																							CTTGAAACTGCTGTCTTTGCT	0.522																																							uc011lti.1		NA																	0					NA						c.(3247-3249)CAG>CAA		SubName: Full=cDNA FLJ59639;							30.0	30.0	30.0					9																	90744703		691	1590	2281	SO:0001628	intergenic_variant	0							g.chr9:90744703C>T																													9.37:g.90744703C>T						uc004apx.1_5'Flank	p.Q1083Q							4	3278	-									Silent	SNP		37	c.3249G>A																																																																																				0	0.522									12	77	0	0	0	0.003163	0	12	77				
SMC2	10592	broad.mit.edu	37	9	106901541	106901541	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:106901541C>T	ENST00000286398.7	+	25	3827	c.3539C>T	c.(3538-3540)tCa>tTa	p.S1180L	SMC2_ENST00000374793.3_Missense_Mutation_p.S1180L|SMC2_ENST00000374787.3_Missense_Mutation_p.S1180L	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	1180					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						GGAAAGATTTCAAAGGAAGCA	0.348																																							uc004bbv.2		NA																	0				ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						c.(3538-3540)TCA>TTA		structural maintenance of chromosomes 2							92.0	91.0	91.0					9																	106901541		2203	4300	6503	SO:0001583	missense	10592				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity	g.chr9:106901541C>T	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.3539C>T	9.37:g.106901541C>T	ENSP00000286398:p.Ser1180Leu					SMC2_uc004bbw.2_Missense_Mutation_p.S1180L|SMC2_uc011lvl.1_Missense_Mutation_p.S1180L|SMC2_uc004bbx.2_Missense_Mutation_p.S1180L|SMC2_uc004bby.2_RNA	p.S1180L	NM_001042551	NP_001036016	O95347	SMC2_HUMAN			25	3827	+			1180					Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	37	c.3539C>T	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114460	0.37339	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000374787	T;T;T	0.77877	-1.13;-1.13;-1.13	5.19	4.27	0.50696	.	0.442667	0.22687	N	0.056880	T	0.56077	0.1961	N	0.08118	0	0.45914	D	0.998754	B	0.09022	0.002	B	0.12156	0.007	T	0.52366	-0.8585	10	0.28530	T	0.3	-4.0815	8.8645	0.35278	0.0:0.7681:0.1498:0.0821	.	1180	O95347	SMC2_HUMAN	L	1180	ENSP00000286398:S1180L;ENSP00000363925:S1180L;ENSP00000363919:S1180L	ENSP00000286398:S1180L	S	+	2	0	SMC2	105941362	0.842000	0.29525	0.997000	0.53966	0.904000	0.53231	2.620000	0.46410	2.689000	0.91719	0.591000	0.81541	TCA		0.348	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1			7	42	0	0	0	0.00308	0	7	42				
TLR4	7099	broad.mit.edu	37	9	120474988	120474988	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:120474988C>G	ENST00000355622.6	+	3	683	c.582C>G	c.(580-582)gaC>gaG	p.D194E	TLR4_ENST00000394487.4_Missense_Mutation_p.D154E|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	194					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.D194E(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ATTGCACAGACTTGCGGGTTC	0.388																																							uc004bjz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(10)|ovary(4)|breast(1)|skin(1)	16						c.(580-582)GAC>GAG		toll-like receptor 4 precursor							76.0	85.0	82.0					9																	120474988		2200	4297	6497	SO:0001583	missense	7099				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity	g.chr9:120474988C>G	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.582C>G	9.37:g.120474988C>G	ENSP00000363089:p.Asp194Glu					TLR4_uc004bka.2_Missense_Mutation_p.D154E|TLR4_uc004bkb.2_5'UTR	p.D194E	NM_138554	NP_612564	O00206	TLR4_HUMAN			3	873	+			194			Extracellular (Potential).|LRR 6.		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	c.582C>G	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.010879	0.35511	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.39229	1.37;1.09	5.35	0.871	0.19107	.	0.084010	0.50627	D	0.000105	T	0.29556	0.0737	N	0.01454	-0.855	0.32681	N	0.515566	P	0.50617	0.937	P	0.60682	0.878	T	0.48352	-0.9043	10	0.44086	T	0.13	.	11.3486	0.49575	0.0:0.7078:0.0:0.2922	.	194	O00206	TLR4_HUMAN	E	154;194	ENSP00000377997:D154E;ENSP00000363089:D194E	ENSP00000363089:D194E	D	+	3	2	TLR4	119514809	0.996000	0.38824	0.193000	0.23327	0.163000	0.22366	0.383000	0.20651	0.257000	0.21650	0.655000	0.94253	GAC		0.388	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		21	62	0	0	0	0.014323	0	21	62				
OR1J2	26740	broad.mit.edu	37	9	125273566	125273566	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:125273566C>A	ENST00000335302.5	+	1	486	c.486C>A	c.(484-486)ctC>ctA	p.L162L		NM_054107.1	NP_473448.1	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J, member 2	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L162L(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(7)|stomach(1)	26						ACACCCTTCTCCTGACCCGGC	0.527																																							uc004bmj.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|pancreas(1)|breast(1)	5						c.(484-486)CTC>CTA		olfactory receptor, family 1, subfamily J,							189.0	153.0	165.0					9																	125273566		2203	4300	6503	SO:0001819	synonymous_variant	26740				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125273566C>A		CCDS35121.1	9q33.2	2013-09-20			ENSG00000197233	ENSG00000197233		"""GPCR / Class A : Olfactory receptors"""	8209	protein-coding gene	gene with protein product				OR1J3, OR1J5			Standard	XM_005251920		Approved	OST044	uc011lyv.2	Q8NGS2	OTTHUMG00000020604	ENST00000335302.5:c.486C>A	9.37:g.125273566C>A						OR1J2_uc011lyv.1_Silent_p.L162L	p.L162L	NM_054107	NP_473448	Q8NGS2	OR1J2_HUMAN			4	1341	+			162			Extracellular (Potential).		A3KFL9|Q6IF14|Q96R90|Q9NZP1	Silent	SNP	ENST00000335302.5	37	c.486C>A	CCDS35121.1																																																																																				0.527	OR1J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053932.1			27	95	1	0	2.48779e-11	0.005443	3.6073e-11	27	95				
ZNF79	7633	broad.mit.edu	37	9	130198191	130198191	+	Silent	SNP	T	T	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:130198191T>G	ENST00000342483.5	+	4	643	c.237T>G	c.(235-237)ctT>ctG	p.L79L	ZNF79_ENST00000543471.1_Silent_p.L55L	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	79	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L79L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						GAATAGGACTTCCAGTTTCCC	0.507																																							uc004bqw.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(235-237)CTT>CTG		zinc finger protein 79							122.0	118.0	119.0					9																	130198191		2203	4300	6503	SO:0001819	synonymous_variant	7633				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:130198191T>G	X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.237T>G	9.37:g.130198191T>G						ZNF79_uc011maf.1_Silent_p.L55L|ZNF79_uc011mag.1_Silent_p.L55L	p.L79L	NM_007135	NP_009066	Q15937	ZNF79_HUMAN			4	651	+			79			KRAB.		Q5VVW1|Q96NV1	Silent	SNP	ENST00000342483.5	37	c.237T>G	CCDS6871.1																																																																																				0.507	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054188.1	NM_007135		13	97	0	0	0	0.00499	0	13	97				
CIZ1	25792	broad.mit.edu	37	9	130942800	130942800	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:130942800G>A	ENST00000393608.1	-	7	887	c.685C>T	c.(685-687)Caa>Taa	p.Q229*	CIZ1_ENST00000538431.1_Nonsense_Mutation_p.Q229*|CIZ1_ENST00000277465.4_Nonsense_Mutation_p.Q229*|CIZ1_ENST00000372938.5_Nonsense_Mutation_p.Q229*|CIZ1_ENST00000325721.8_Nonsense_Mutation_p.Q200*|CIZ1_ENST00000357558.5_Nonsense_Mutation_p.Q229*|CIZ1_ENST00000372948.3_Nonsense_Mutation_p.Q229*|CIZ1_ENST00000372954.1_Nonsense_Mutation_p.Q205*|CIZ1_ENST00000541172.1_Nonsense_Mutation_p.Q128*|CIZ1_ENST00000476727.2_5'UTR	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	229					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						GGTAAATCTTGGTCTGGAATG	0.582																																							uc004btt.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(685-687)CAA>TAA		CDKN1A interacting zinc finger protein 1 isoform							205.0	175.0	185.0					9																	130942800		2203	4300	6503	SO:0001587	stop_gained	25792					nucleus	nucleic acid binding|protein binding|zinc ion binding	g.chr9:130942800G>A	AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.685C>T	9.37:g.130942800G>A	ENSP00000377232:p.Gln229*					CIZ1_uc004btr.2_Nonsense_Mutation_p.Q229*|CIZ1_uc004bts.2_Nonsense_Mutation_p.Q200*|CIZ1_uc011maq.1_Nonsense_Mutation_p.Q224*|CIZ1_uc004btu.2_Nonsense_Mutation_p.Q205*|CIZ1_uc011mar.1_Nonsense_Mutation_p.Q128*|CIZ1_uc011mas.1_Nonsense_Mutation_p.Q259*|CIZ1_uc004btw.2_Nonsense_Mutation_p.Q229*|CIZ1_uc004btv.2_Nonsense_Mutation_p.Q229*|CIZ1_uc004btx.2_Nonsense_Mutation_p.Q205*	p.Q229*	NM_001131016	NP_001124488	Q9ULV3	CIZ1_HUMAN			7	848	-			229					A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Nonsense_Mutation	SNP	ENST00000393608.1	37	c.685C>T	CCDS6894.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982368	0.74474	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372941;ENST00000372948;ENST00000372938;ENST00000415526;ENST00000324544	.	.	.	4.21	3.31	0.37934	.	0.345570	0.21299	N	0.076840	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-1.5073	7.7739	0.29026	0.1112:0.0:0.8888:0.0	.	.	.	.	X	205;229;229;229;200;196;128;229;205;229;229;151;229	.	ENSP00000277465:Q229X	Q	-	1	0	CIZ1	129982621	0.907000	0.30839	0.188000	0.23233	0.223000	0.24884	1.715000	0.37971	1.353000	0.45828	0.655000	0.94253	CAA		0.582	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127		3	69	0	0	0	0.009096	0	3	69				
SETX	23064	broad.mit.edu	37	9	135224674	135224674	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:135224674G>T	ENST00000224140.5	-	3	324	c.142C>A	c.(142-144)Cac>Aac	p.H48N	SETX_ENST00000393220.1_Missense_Mutation_p.H48N|SETX_ENST00000372169.2_Missense_Mutation_p.H48N	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	48					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.H48N(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CTTGCTTTGTGGTACTCAGCC	0.438																																							uc004cbk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(142-144)CAC>AAC		senataxin							104.0	94.0	97.0					9																	135224674		2203	4300	6503	SO:0001583	missense	23064				cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity	g.chr9:135224674G>T	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.142C>A	9.37:g.135224674G>T	ENSP00000224140:p.His48Asn						p.H48N	NM_015046	NP_055861	Q7Z333	SETX_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)	3	325	-		Myeloproliferative disorder(178;0.204)	48					A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	c.142C>A	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523385	0.85600	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.95482	-3.69;-3.72;-3.38	5.41	5.41	0.78517	.	0.063978	0.64402	D	0.000010	D	0.96275	0.8785	L	0.34521	1.04	0.38088	D	0.93687	D	0.76494	0.999	D	0.83275	0.996	D	0.97940	1.0325	10	0.72032	D	0.01	.	18.1834	0.89786	0.0:0.0:1.0:0.0	.	48	Q7Z333	SETX_HUMAN	N	48	ENSP00000224140:H48N;ENSP00000361242:H48N;ENSP00000376913:H48N	ENSP00000224140:H48N	H	-	1	0	SETX	134214495	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.141000	0.77330	2.530000	0.85305	0.591000	0.81541	CAC		0.438	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046		15	48	1	0	7.93312e-07	0.020292	9.95933e-07	15	48				
TUBBP5	643224	broad.mit.edu	37	9	141071154	141071154	+	RNA	SNP	T	T	C	rs202207360		TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr9:141071154T>C	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5									p.V258A(1)									GTGAACATGGTCCCGTTTCCC	0.632																																							uc004com.2		NA																	1	Substitution - Missense(1)		endometrium(1)		0						c.(556-558)GTC>GCC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141071154T>C	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071154T>C						TUBBP5_uc010ncq.2_3'UTR	p.V186A							4	818	+									Missense_Mutation	SNP	ENST00000503395.1	37	c.557T>C																																																																																					0.632	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		8	43	0	0	0	0.008291	0	8	43				
FRMPD4	9758	broad.mit.edu	37	X	12735649	12735649	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:12735649G>C	ENST00000380682.1	+	16	3210	c.2704G>C	c.(2704-2706)Gag>Cag	p.E902Q		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	902					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E892Q(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TTATAGTCCTGAGTCTTCGTC	0.453																																							uc004cuz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						c.(2704-2706)GAG>CAG		FERM and PDZ domain containing 4							94.0	90.0	91.0					X																	12735649		2203	4300	6503	SO:0001583	missense	9758				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chrX:12735649G>C	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2704G>C	X.37:g.12735649G>C	ENSP00000370057:p.Glu902Gln					FRMPD4_uc011mij.1_Missense_Mutation_p.E894Q	p.E902Q	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN			16	3210	+			902					A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	c.2704G>C	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850517	0.71719	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.12465	2.68	5.86	5.86	0.93980	.	0.056235	0.64402	D	0.000001	T	0.37919	0.1021	M	0.76002	2.32	0.44261	D	0.997113	D;D	0.71674	0.998;0.998	P;P	0.61800	0.894;0.894	T	0.11567	-1.0582	10	0.72032	D	0.01	-20.751	19.1728	0.93585	0.0:0.0:1.0:0.0	.	894;902	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	Q	902;893;891	ENSP00000370057:E902Q	ENSP00000304583:E891Q	E	+	1	0	FRMPD4	12645570	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	9.360000	0.97119	2.478000	0.83669	0.594000	0.82650	GAG		0.453	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		4	119	0	0	0	0.009096	0	4	119				
GPR64	10149	broad.mit.edu	37	X	19031921	19031921	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:19031921G>T	ENST00000379869.3	-	16	1145	c.982C>A	c.(982-984)Cct>Act	p.P328T	GPR64_ENST00000354791.3_Missense_Mutation_p.P312T|GPR64_ENST00000379876.1_Missense_Mutation_p.P304T|GPR64_ENST00000357544.3_Missense_Mutation_p.P298T|GPR64_ENST00000356606.4_Missense_Mutation_p.P314T|GPR64_ENST00000340581.3_Missense_Mutation_p.P298T|GPR64_ENST00000379878.3_Missense_Mutation_p.P312T|GPR64_ENST00000357991.3_Missense_Mutation_p.P325T|GPR64_ENST00000379873.2_Missense_Mutation_p.P328T|GPR64_ENST00000360279.4_Missense_Mutation_p.P306T	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	328					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.P325T(1)		breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					TGGGGCATAGGGGAAGAGATC	0.572																																							uc004cyx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(982-984)CCT>ACT		G protein-coupled receptor 64 isoform 1							151.0	136.0	141.0					X																	19031921		2203	4300	6503	SO:0001583	missense	10149				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity	g.chrX:19031921G>T	X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.982C>A	X.37:g.19031921G>T	ENSP00000369198:p.Pro328Thr					GPR64_uc004cyy.2_Missense_Mutation_p.P325T|GPR64_uc004cyz.2_Missense_Mutation_p.P314T|GPR64_uc004czb.2_Missense_Mutation_p.P328T|GPR64_uc004czc.2_Missense_Mutation_p.P312T|GPR64_uc004czd.2_Missense_Mutation_p.P304T|GPR64_uc004cze.2_Missense_Mutation_p.P298T|GPR64_uc004czf.2_Missense_Mutation_p.P290T|GPR64_uc004cza.2_Missense_Mutation_p.P306T|GPR64_uc004cyw.2_Missense_Mutation_p.P312T|GPR64_uc010nfj.2_Missense_Mutation_p.P298T	p.P328T	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN			16	1146	-	Hepatocellular(33;0.183)		328			Extracellular (Potential).		B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Missense_Mutation	SNP	ENST00000379869.3	37	c.982C>A	CCDS43923.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.335125	0.41398	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606;ENST00000340581	T;T;T;T;T;T;T;T;T;T	0.28069	1.65;1.75;1.76;1.74;1.74;1.8;1.73;1.8;1.78;1.63	5.49	-6.28	0.02020	.	0.941390	0.08866	N	0.882187	T	0.11367	0.0277	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B	0.11235	0.0;0.004;0.004;0.004;0.004;0.001;0.004;0.001;0.004;0.002;0.001	B;B;B;B;B;B;B;B;B;B;B	0.15484	0.002;0.013;0.013;0.013;0.013;0.004;0.013;0.004;0.013;0.006;0.002	T	0.32295	-0.9912	10	0.19590	T	0.45	.	6.045	0.19755	0.5708:0.0:0.1564:0.2728	.	298;290;298;304;312;328;306;314;325;328;312	Q14CE0;Q8IZP9-8;Q8IZP9-7;Q8IZP9-5;Q8IZP9-3;Q8IZP9-9;Q8IZP9-6;Q8IZP9-4;Q8IZP9-2;Q8IZP9;Q14CE1	.;.;.;.;.;.;.;.;.;GPR64_HUMAN;.	T	328;312;312;304;298;328;306;325;314;298	ENSP00000369202:P328T;ENSP00000369207:P312T;ENSP00000346845:P312T;ENSP00000369205:P304T;ENSP00000350152:P298T;ENSP00000369198:P328T;ENSP00000353421:P306T;ENSP00000350680:P325T;ENSP00000349015:P314T;ENSP00000344972:P298T	ENSP00000344972:P298T	P	-	1	0	GPR64	18941842	0.007000	0.16637	0.000000	0.03702	0.020000	0.10135	-0.175000	0.09825	-1.111000	0.02988	-0.353000	0.07706	CCT		0.572	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2			6	127	1	0	8.12818e-05	0.001984	9.66055e-05	6	127				
USP9X	8239	broad.mit.edu	37	X	41029762	41029762	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:41029762C>T	ENST00000324545.8	+	20	3550	c.2917C>T	c.(2917-2919)Cct>Tct	p.P973S	USP9X_ENST00000378308.2_Missense_Mutation_p.P973S	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	973					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.P966S(1)|p.P973S(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TTCCAATATGCCTTCAAGCCC	0.363																																					Ovarian(172;1807 2695 35459 49286)	Ovarian(172;1807 2695 35459 49286)	uc004dfb.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|breast(2)|ovary(1)	6						c.(2917-2919)CCT>TCT		ubiquitin specific protease 9, X-linked isoform							88.0	82.0	84.0					X																	41029762		2142	4272	6414	SO:0001583	missense	8239				BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity	g.chrX:41029762C>T	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.2917C>T	X.37:g.41029762C>T	ENSP00000316357:p.Pro973Ser					USP9X_uc004dfc.2_Missense_Mutation_p.P973S	p.P973S	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN			20	3550	+			973					O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	c.2917C>T	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	C	18.09	3.546844	0.65198	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.03035	4.07;4.07	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.07188	0.0182	L	0.35723	1.085	0.80722	D	1	P;P	0.49783	0.928;0.572	P;B	0.49887	0.625;0.124	T	0.52808	-0.8526	10	0.19590	T	0.45	.	18.4847	0.90824	0.0:1.0:0.0:0.0	.	973;973	Q93008-1;Q93008	.;USP9X_HUMAN	S	973	ENSP00000367558:P973S;ENSP00000316357:P973S	ENSP00000316357:P973S	P	+	1	0	USP9X	40914706	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.308000	0.77769	0.462000	0.41574	CCT		0.363	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652		4	66	0	0	0	0.014758	0	4	66				
ITIH6	347365	broad.mit.edu	37	X	54783839	54783839	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:54783839G>T	ENST00000218436.6	-	8	2697	c.2668C>A	c.(2668-2670)Cct>Act	p.P890T		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	890	Pro-rich.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P890T(1)									GGTCTGTCAGGTCTAGGAGGT	0.522																																							uc004dtj.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(2668-2670)CCT>ACT		inter-alpha (globulin) inhibitor H5-like							93.0	83.0	86.0					X																	54783839		2203	4300	6503	SO:0001583	missense	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54783839G>T	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.2668C>A	X.37:g.54783839G>T	ENSP00000218436:p.Pro890Thr						p.P890T	NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN			8	2698	-			890			Pro-rich.		A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	c.2668C>A	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	6.432	0.447921	0.12223	.	.	ENSG00000102313	ENST00000218436	T	0.05447	3.44	3.5	0.375	0.16188	.	14.071100	0.00166	U	0.000001	T	0.04815	0.0130	N	0.14661	0.345	0.09310	N	1	B	0.30793	0.295	B	0.28709	0.093	T	0.35101	-0.9802	10	0.38643	T	0.18	.	6.4445	0.21869	0.4158:0.0:0.5842:0.0	.	890	Q6UXX5	ITH5L_HUMAN	T	890	ENSP00000218436:P890T	ENSP00000218436:P890T	P	-	1	0	ITIH5L	54800564	0.030000	0.19436	0.045000	0.18777	0.036000	0.12997	0.150000	0.16263	0.006000	0.14734	-0.322000	0.08575	CCT		0.522	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		20	69	1	0	1.15919e-05	0.008871	1.41245e-05	20	69				
VSIG4	11326	broad.mit.edu	37	X	65252505	65252505	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:65252505C>A	ENST00000374737.4	-	3	607	c.499G>T	c.(499-501)Gct>Tct	p.A167S	VSIG4_ENST00000412866.2_Intron|VSIG4_ENST00000455586.2_Missense_Mutation_p.A167S	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	167	Ig-like 2.				complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A167S(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAACCCCGAGCCTGGCATTGA	0.488																																							uc004dwh.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(499-501)GCT>TCT		V-set and immunoglobulin domain containing 4							112.0	96.0	102.0					X																	65252505		2203	4300	6503	SO:0001583	missense	11326				complement activation, alternative pathway	integral to membrane	protein binding	g.chrX:65252505C>A	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.499G>T	X.37:g.65252505C>A	ENSP00000363869:p.Ala167Ser					VSIG4_uc004dwi.2_Intron|VSIG4_uc010nkq.1_Missense_Mutation_p.A167S|VSIG4_uc004dwj.2_Missense_Mutation_p.A167S|VSIG4_uc011moy.1_Intron|VSIG4_uc004dwk.2_Missense_Mutation_p.A167S|VSIG4_uc004dwl.2_Missense_Mutation_p.A63S	p.A167S	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN			3	626	-			167			Ig-like 2.|Extracellular (Potential).		Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	37	c.499G>T	CCDS14383.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.43|10.43	1.347791|1.347791	0.24426|0.24426	.|.	.|.	ENSG00000155659|ENSG00000155659	ENST00000374737;ENST00000455586;ENST00000423830|ENST00000427538	T;T;T|.	0.03580|.	3.88;3.88;3.88|.	3.91|3.91	3.04|3.04	0.35103|0.35103	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.253891|.	0.27442|.	N|.	0.019353|.	T|T	0.53238|0.53238	0.1784|0.1784	M|M	0.74389|0.74389	2.26|2.26	0.23838|0.23838	N|N	0.996705|0.996705	D;D;P;D|.	0.89917|.	1.0;0.999;0.607;1.0|.	D;D;P;D|.	0.85130|.	0.988;0.997;0.519;0.996|.	T|T	0.44832|0.44832	-0.9302|-0.9302	10|5	0.18276|.	T|.	0.48|.	-1.8244|-1.8244	7.1047|7.1047	0.25356|0.25356	0.0:0.8665:0.0:0.1335|0.0:0.8665:0.0:0.1335	.|.	167;90;157;167|.	Q9Y279-2;C9JTJ4;C9JH67;Q9Y279|.	.;.;.;VSIG4_HUMAN|.	S|V	167;167;90|93	ENSP00000363869:A167S;ENSP00000411581:A167S;ENSP00000414594:A90S|.	ENSP00000363869:A167S|.	A|G	-|-	1|2	0|0	VSIG4|VSIG4	65169230|65169230	0.998000|0.998000	0.40836|0.40836	0.491000|0.491000	0.27477|0.27477	0.418000|0.418000	0.31294|0.31294	2.861000|2.861000	0.48380|0.48380	0.493000|0.493000	0.27837|0.27837	0.506000|0.506000	0.49869|0.49869	GCT|GGC		0.488	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268		3	37	1	0	0.004672	0.004672	0.00503673	3	37				
ATRX	546	broad.mit.edu	37	X	76875878	76875878	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:76875878T>C	ENST00000373344.5	-	20	5471	c.5257A>G	c.(5257-5259)Aat>Gat	p.N1753D	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.N1715D	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1753	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.N1753D(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATTAGGTTATTTTGAAGTGGT	0.318			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		3	Substitution - Missense(2)|Unknown(1)		lung(2)|bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(5257-5259)AAT>GAT		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						82.0	71.0	75.0					X																	76875878		2201	4294	6495	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76875878T>C	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5257A>G	X.37:g.76875878T>C	ENSP00000362441:p.Asn1753Asp					ATRX_uc004ecq.3_Missense_Mutation_p.N1715D|ATRX_uc004eco.3_Missense_Mutation_p.N1538D	p.N1753D	NM_000489	NP_000480	P46100	ATRX_HUMAN			20	5489	-			1753			Helicase ATP-binding.		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.5257A>G	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.199292	0.79015	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.95069	-3.6;-3.6	4.57	4.57	0.56435	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98520	0.9506	H	0.99404	4.55	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.991;0.998	D	0.98829	1.0750	10	0.87932	D	0	-14.9933	13.1604	0.59540	0.0:0.0:0.0:1.0	.	1715;1753	P46100-4;P46100	.;ATRX_HUMAN	D	1753;1715	ENSP00000362441:N1753D;ENSP00000378967:N1715D	ENSP00000362441:N1753D	N	-	1	0	ATRX	76762534	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.669000	0.83911	1.475000	0.48197	0.486000	0.48141	AAT		0.318	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		24	43	0	0	0	0.00632	0	24	43				
TAF9B	51616	broad.mit.edu	37	X	77395088	77395088	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:77395088C>A	ENST00000341864.5	-	1	115	c.21G>T	c.(19-21)gcG>gcT	p.A7A		NM_015975.4	NP_057059.2	Q9HBM6	TAF9B_HUMAN	TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa	7					DNA-templated transcription, initiation (GO:0006352)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell growth (GO:0030307)|programmed cell death (GO:0012501)|protein stabilization (GO:0050821)|response to organic cyclic compound (GO:0014070)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	transcription corepressor activity (GO:0003714)	p.A7A(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	14						TCTTGGGAGGCGCCATCTTGC	0.657																																							uc004eda.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(19-21)GCG>GCT		transcription associated factor 9B							114.0	97.0	103.0					X																	77395088		2203	4296	6499	SO:0001819	synonymous_variant	51616				negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell growth|transcription initiation, DNA-dependent	transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding	g.chrX:77395088C>A	AF220509	CCDS35340.1	Xq13.1-q21.1	2010-08-16	2006-01-04	2006-01-04	ENSG00000187325	ENSG00000187325			17306	protein-coding gene	gene with protein product		300754	"""TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa"""	TAF9L		15899866	Standard	XM_005262142		Approved	TAFII31L, DN-7, DN7, TFIID-31	uc004eda.3	Q9HBM6	OTTHUMG00000021887	ENST00000341864.5:c.21G>T	X.37:g.77395088C>A							p.A7A	NM_015975	NP_057059	Q9HBM6	TAF9B_HUMAN			1	92	-			7					B2RUZ9|Q9Y2S3	Silent	SNP	ENST00000341864.5	37	c.21G>T	CCDS35340.1																																																																																				0.657	TAF9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057308.1	NM_015975		5	88	1	0	0.000602214	0.014758	0.000676908	5	88				
POF1B	79983	broad.mit.edu	37	X	84600895	84600895	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:84600895G>T	ENST00000262753.4	-	6	839	c.694C>A	c.(694-696)Cat>Aat	p.H232N	POF1B_ENST00000373145.3_Missense_Mutation_p.H232N	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	232						tight junction (GO:0005923)		p.H232N(1)		central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						GATCCACTATGGCACAGTTCA	0.408																																							uc004eer.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(694-696)CAT>AAT		premature ovarian failure, 1B							222.0	190.0	201.0					X																	84600895		2203	4300	6503	SO:0001583	missense	79983						actin binding	g.chrX:84600895G>T	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.694C>A	X.37:g.84600895G>T	ENSP00000262753:p.His232Asn					POF1B_uc004ees.2_Missense_Mutation_p.H232N	p.H232N	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN			6	840	-			232					A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	ENST00000262753.4	37	c.694C>A	CCDS14452.1	.	.	.	.	.	.	.	.	.	.	G	2.932	-0.220732	0.06061	.	.	ENSG00000124429	ENST00000262753;ENST00000373145;ENST00000276124	T;T	0.09445	2.98;2.98	4.32	2.44	0.29823	.	0.286938	0.25233	N	0.032147	T	0.06050	0.0157	L	0.29908	0.895	0.09310	N	1	B;B	0.22146	0.065;0.027	B;B	0.21546	0.035;0.023	T	0.38112	-0.9676	10	0.13470	T	0.59	.	3.6342	0.08143	0.1317:0.0:0.6189:0.2493	.	232;232	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	N	232	ENSP00000262753:H232N;ENSP00000362238:H232N	ENSP00000262753:H232N	H	-	1	0	POF1B	84487551	0.009000	0.17119	0.001000	0.08648	0.162000	0.22319	1.732000	0.38146	0.867000	0.35654	0.594000	0.82650	CAT		0.408	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057391.2	NM_024921		9	127	1	0	1.11149e-13	0.008291	1.67012e-13	9	127				
PCDH11X	27328	broad.mit.edu	37	X	91090841	91090841	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:91090841C>A	ENST00000373094.1	+	1	1183	c.338C>A	c.(337-339)gCc>gAc	p.A113D	PCDH11X_ENST00000298274.8_Missense_Mutation_p.A113D|PCDH11X_ENST00000373088.1_Missense_Mutation_p.A113D|PCDH11X_ENST00000395337.2_Missense_Mutation_p.A113D|PCDH11X_ENST00000373097.1_Missense_Mutation_p.A113D|PCDH11X_ENST00000361724.1_Missense_Mutation_p.A113D|PCDH11X_ENST00000504220.2_Missense_Mutation_p.A113D|PCDH11X_ENST00000406881.1_Missense_Mutation_p.A113D|PCDH11X_ENST00000361655.2_Missense_Mutation_p.A113D	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	113	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A113D(3)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GTGGAGGTTGCCATTTTGCCG	0.398																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(2)	2						c.(337-339)GCC>GAC		protocadherin 11 X-linked isoform c							85.0	77.0	80.0					X																	91090841		2202	4281	6483	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91090841C>A	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.338C>A	X.37:g.91090841C>A	ENSP00000362186:p.Ala113Asp					PCDH11X_uc004efl.1_Missense_Mutation_p.A113D|PCDH11X_uc004efo.1_Missense_Mutation_p.A113D|PCDH11X_uc010nmv.1_Missense_Mutation_p.A113D|PCDH11X_uc004efm.1_Missense_Mutation_p.A113D|PCDH11X_uc004efn.1_Missense_Mutation_p.A113D|PCDH11X_uc004efh.1_Missense_Mutation_p.A113D|PCDH11X_uc004efj.1_Missense_Mutation_p.A113D	p.A113D	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN			1	1183	+			113			Extracellular (Potential).|Cadherin 1.		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.338C>A	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	19.97	3.926027	0.73327	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.55760	0.5;0.54;0.56;0.51;0.58;0.55;0.54;0.56;0.59	4.44	4.44	0.53790	Cadherin (2);	0.000000	0.85682	D	0.000000	T	0.70219	0.3199	M	0.66939	2.045	0.58432	D	0.999996	D;D;D;D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.85130	0.994;0.947;0.994;0.994;0.994;0.997;0.994;0.989	T	0.74144	-0.3760	10	0.66056	D	0.02	.	15.4133	0.74943	0.0:1.0:0.0:0.0	.	113;113;113;113;113;113;113;113	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	D	113	ENSP00000378746:A113D;ENSP00000362186:A113D;ENSP00000362189:A113D;ENSP00000355040:A113D;ENSP00000362180:A113D;ENSP00000423762:A113D;ENSP00000355105:A113D;ENSP00000384758:A113D;ENSP00000298274:A113D	ENSP00000298274:A113D	A	+	2	0	PCDH11X	90977497	0.999000	0.42202	1.000000	0.80357	0.828000	0.46876	4.245000	0.58734	2.173000	0.68751	0.506000	0.49869	GCC		0.398	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		23	98	1	0	2.81731e-10	0.010818	3.90919e-10	23	98				
PCDH19	57526	broad.mit.edu	37	X	99663168	99663168	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:99663168C>A	ENST00000373034.4	-	1	2103	c.428G>T	c.(427-429)aGc>aTc	p.S143I	PCDH19_ENST00000420881.2_Missense_Mutation_p.S143I|PCDH19_ENST00000255531.7_Missense_Mutation_p.S143I	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	143	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S143I(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CGTGCCAGGGCTGGCTGCCTC	0.592																																							uc010nmz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						c.(427-429)AGC>ATC		protocadherin 19 isoform b							96.0	93.0	94.0					X																	99663168		2131	4227	6358	SO:0001583	missense	57526				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chrX:99663168C>A	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.428G>T	X.37:g.99663168C>A	ENSP00000362125:p.Ser143Ile					PCDH19_uc004efw.3_Missense_Mutation_p.S143I|PCDH19_uc004efx.3_Missense_Mutation_p.S143I	p.S143I	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN			1	2104	-			143			Cadherin 2.|Extracellular (Potential).		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	37	c.428G>T	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.250470	0.59212	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.53206	0.63;0.63;0.63	5.7	5.7	0.88788	Cadherin (3);Cadherin-like (1);	0.143677	0.64402	D	0.000004	T	0.56077	0.1961	L	0.37750	1.13	0.52099	D	0.999948	D;P;P	0.54772	0.968;0.58;0.633	P;B;P	0.56960	0.81;0.373;0.507	T	0.55490	-0.8133	10	0.49607	T	0.09	.	18.367	0.90394	0.0:1.0:0.0:0.0	.	143;143;143	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	I	143	ENSP00000400327:S143I;ENSP00000362125:S143I;ENSP00000255531:S143I	ENSP00000255531:S143I	S	-	2	0	PCDH19	99549824	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	3.567000	0.53813	2.385000	0.81259	0.544000	0.68410	AGC		0.592	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766		5	78	1	0	8.12818e-05	0.001984	9.66055e-05	5	78				
SYTL4	94121	broad.mit.edu	37	X	99955913	99955913	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:99955913C>G	ENST00000372989.1	-	7	850	c.519G>C	c.(517-519)caG>caC	p.Q173H	SYTL4_ENST00000276141.6_Missense_Mutation_p.Q173H|SYTL4_ENST00000372981.1_Missense_Mutation_p.Q173H|SYTL4_ENST00000454200.2_Missense_Mutation_p.Q173H|SYTL4_ENST00000263033.5_Missense_Mutation_p.Q173H|SYTL4_ENST00000455616.1_Missense_Mutation_p.Q173H	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	173					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.Q173H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCTGCCGCTCCTGAATGATCT	0.393																																							uc004egd.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(517-519)CAG>CAC		synaptotagmin-like 4	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						132.0	119.0	123.0					X																	99955913		2203	4300	6503	SO:0001583	missense	94121				exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding	g.chrX:99955913C>G		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.519G>C	X.37:g.99955913C>G	ENSP00000362080:p.Gln173His					SYTL4_uc010nnc.2_Missense_Mutation_p.Q173H|SYTL4_uc004ege.3_Missense_Mutation_p.Q173H|SYTL4_uc004egf.3_Missense_Mutation_p.Q173H|SYTL4_uc004egg.3_Missense_Mutation_p.Q173H	p.Q173H	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN			7	875	-			173					Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	c.519G>C	CCDS14472.1	.	.	.	.	.	.	.	.	.	.	c	7.265	0.605910	0.14002	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033;ENST00000372981	T;T;T;T;T;T	0.66280	1.98;1.98;2.0;1.98;1.98;-0.2	5.78	4.0	0.46444	.	0.771440	0.12728	N	0.444132	T	0.71796	0.3382	L	0.59436	1.845	0.27678	N	0.946536	D;P	0.71674	0.998;0.661	P;B	0.61477	0.889;0.332	T	0.61387	-0.7073	9	.	.	.	-19.9908	10.53	0.44971	0.0:0.8415:0.0:0.1585	.	173;173	Q96C24-2;Q96C24	.;SYTL4_HUMAN	H	173	ENSP00000362080:Q173H;ENSP00000390252:Q173H;ENSP00000403556:Q173H;ENSP00000276141:Q173H;ENSP00000263033:Q173H;ENSP00000362072:Q173H	.	Q	-	3	2	SYTL4	99842569	0.999000	0.42202	0.999000	0.59377	0.015000	0.08874	0.417000	0.21214	0.576000	0.29452	-0.220000	0.12472	CAG		0.393	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	NM_080737		8	137	0	0	0	0.004482	0	8	137				
NGFRAP1	27018	broad.mit.edu	37	X	102632569	102632569	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:102632569C>A	ENST00000372645.3	+	3	477	c.150C>A	c.(148-150)gcC>gcA	p.A50A	NGFRAP1_ENST00000299872.7_Silent_p.A50A|NGFRAP1_ENST00000361298.4_Silent_p.A40A|NGFRAP1_ENST00000372634.1_Silent_p.A40A|NGFRAP1_ENST00000372635.1_Silent_p.A50A			Q00994	BEX3_HUMAN	nerve growth factor receptor (TNFRSF16) associated protein 1	50					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|metal ion binding (GO:0046872)	p.A50A(1)		NS(2)|endometrium(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						TTCGATGGGCCATACCCAATA	0.517																																							uc004eki.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(148-150)GCC>GCA		nerve growth factor receptor (TNFRSF16)							185.0	172.0	177.0					X																	102632569		2203	4300	6503	SO:0001819	synonymous_variant	27018				apoptosis|multicellular organismal development|nerve growth factor receptor signaling pathway	cytosol|nucleus	caspase regulator activity|metal ion binding	g.chrX:102632569C>A	AF187064	CCDS14508.1, CCDS14509.1	Xq22.2	2014-03-21			ENSG00000166681	ENSG00000166681			13388	protein-coding gene	gene with protein product	"""brain expressed, X-linked 3"""	300361				10764727, 16221301, 2171551	Standard	NM_206915		Approved	BEX3, HGR74, Bex, NADE, DXS6984E	uc004ekj.1	Q00994	OTTHUMG00000022099	ENST00000372645.3:c.150C>A	X.37:g.102632569C>A						NGFRAP1_uc004ekh.2_Silent_p.A40A|NGFRAP1_uc004ekj.1_Silent_p.A50A	p.A50A	NM_206915	NP_996798	Q00994	BEX3_HUMAN			3	532	+			50					B2RD17|D3DXA3|Q5JQT4|Q5JQT5	Silent	SNP	ENST00000372645.3	37	c.150C>A	CCDS14508.1																																																																																				0.517	NGFRAP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057709.1	NM_014380		10	215	1	0	3.07112e-06	0.010729	3.82242e-06	10	215				
ESX1	80712	broad.mit.edu	37	X	103495442	103495442	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:103495442C>T	ENST00000372588.4	-	4	771	c.688G>A	c.(688-690)Gat>Aat	p.D230N		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	230					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)	p.D230N(1)		endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						AAAGCAGGATCCAGAGCAGGA	0.552																																					Pancreas(200;1705 2227 25194 28471 45274)	Pancreas(200;1705 2227 25194 28471 45274)	uc004ely.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(688-690)GAT>AAT		extraembryonic, spermatogenesis, homeobox							198.0	152.0	167.0					X																	103495442		2203	4300	6503	SO:0001583	missense	80712				negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:103495442C>T	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.688G>A	X.37:g.103495442C>T	ENSP00000361669:p.Asp230Asn						p.D230N	NM_153448	NP_703149	Q8N693	ESX1_HUMAN			4	746	-			230					B0QYU3|Q7Z6K7	Missense_Mutation	SNP	ENST00000372588.4	37	c.688G>A	CCDS14516.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.511521	0.44660	.	.	ENSG00000123576	ENST00000372588	T	0.70986	-0.53	4.3	2.43	0.29744	.	.	.	.	.	T	0.59756	0.2217	L	0.61218	1.895	0.09310	N	1	P	0.34977	0.478	B	0.31290	0.127	T	0.46541	-0.9184	9	0.25106	T	0.35	-4.3552	3.9364	0.09307	0.1623:0.5863:0.1556:0.0958	.	230	Q8N693	ESX1_HUMAN	N	230	ENSP00000361669:D230N	ENSP00000361669:D230N	D	-	1	0	ESX1	103382098	0.001000	0.12720	0.001000	0.08648	0.071000	0.16799	0.067000	0.14510	0.326000	0.23384	0.600000	0.82982	GAT		0.552	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057763.2	NM_153448		11	124	0	0	0	0.010729	0	11	124				
IRS4	8471	broad.mit.edu	37	X	107978288	107978288	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:107978288C>A	ENST00000372129.2	-	1	1363	c.1287G>T	c.(1285-1287)ccG>ccT	p.P429P	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	429					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.P429P(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AAAAGCTGGCCGGCACTGAAA	0.637																																							uc004eoc.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1285-1287)CCG>CCT		insulin receptor substrate 4							59.0	51.0	53.0					X																	107978288		2203	4300	6503	SO:0001819	synonymous_variant	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107978288C>A	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1287G>T	X.37:g.107978288C>A							p.P429P	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1320	-			429						Silent	SNP	ENST00000372129.2	37	c.1287G>T	CCDS14544.1																																																																																				0.637	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		10	70	1	0	1.76689e-08	0.006214	2.35045e-08	10	70				
LUZP4	51213	broad.mit.edu	37	X	114536683	114536683	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:114536683G>A	ENST00000371920.3	+	2	225	c.218G>A	c.(217-219)cGg>cAg	p.R73Q	LUZP4_ENST00000451986.2_Missense_Mutation_p.G31R	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	73						nucleus (GO:0005634)		p.R73Q(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						CATCGCCATCGGAGAGGTAAA	0.348																																							uc004eqa.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(217-219)CGG>CAG		leucine zipper protein 4							137.0	131.0	133.0					X																	114536683		2203	4300	6503	SO:0001583	missense	51213					nucleus		g.chrX:114536683G>A	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.218G>A	X.37:g.114536683G>A	ENSP00000360988:p.Arg73Gln					LUZP4_uc004eqb.2_Missense_Mutation_p.G31R	p.R73Q	NM_016383	NP_057467	Q9P127	LUZP4_HUMAN			2	252	+			73					B3KSD6	Missense_Mutation	SNP	ENST00000371920.3	37	c.218G>A	CCDS14567.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.851|5.851	0.341284|0.341284	0.11069|0.11069	.|.	.|.	ENSG00000102021|ENSG00000102021	ENST00000451986|ENST00000371921;ENST00000371920	T|T;T	0.45276|0.39787	0.9|1.06;1.71	3.01|3.01	-1.3|-1.3	0.09259|0.09259	.|.	.|1.289680	.|0.06192	.|N	.|0.681454	T|T	0.16428|0.16428	0.0395|0.0395	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	1|1	B|B	0.06786|0.06786	0.001|0.001	B|B	0.01281|0.01281	0.0|0.0	T|T	0.19712|0.19712	-1.0297|-1.0297	9|10	0.25106|0.87932	T|D	0.35|0	.|.	3.0146|3.0146	0.06055|0.06055	0.4795:0.231:0.2895:0.0|0.4795:0.231:0.2895:0.0	.|.	31|73	B3KSD6|Q9P127	.|LUZP4_HUMAN	R|Q	31|73	ENSP00000411212:G31R|ENSP00000360989:R73Q;ENSP00000360988:R73Q	ENSP00000411212:G31R|ENSP00000360988:R73Q	G|R	+|+	1|2	0|0	LUZP4|LUZP4	114442939|114442939	0.002000|0.002000	0.14202|0.14202	0.004000|0.004000	0.12327|0.12327	0.040000|0.040000	0.13550|0.13550	0.143000|0.143000	0.16115|0.16115	-0.333000|-0.333000	0.08476|0.08476	-0.536000|-0.536000	0.04276|0.04276	GGA|CGG		0.348	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	NM_016383		19	152	0	0	0	0.008871	0	19	152				
VGLL1	51442	broad.mit.edu	37	X	135631167	135631167	+	Splice_Site	SNP	T	T	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:135631167T>A	ENST00000370634.3	+	3	804	c.634T>A	c.(634-636)Tat>Aat	p.Y212N	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	212					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Y212N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					CTCAGTTCACTGTAAGGAAAT	0.547																																							uc004ezy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(634-636)TAT>AAT		vestigial like 1							34.0	35.0	35.0					X																	135631167		2203	4299	6502	SO:0001630	splice_region_variant	51442				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	transcription coactivator activity	g.chrX:135631167T>A	AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.634+1T>A	X.37:g.135631167T>A						MIR934_hsa-mir-934|MI0005756_5'Flank	p.Y212N	NM_016267	NP_057351	Q99990	VGLL1_HUMAN			3	804	+	Acute lymphoblastic leukemia(192;0.000127)		212					Q5H915	Missense_Mutation	SNP	ENST00000370634.3	37	c.634T>A	CCDS14658.1	.	.	.	.	.	.	.	.	.	.	T	0.319	-0.963183	0.02249	.	.	ENSG00000102243	ENST00000370634	T	0.45668	0.89	5.82	0.697	0.18081	.	1.600730	0.03064	N	0.156284	T	0.24586	0.0596	N	0.19112	0.55	0.20489	N	0.999897	P	0.46512	0.879	B	0.37943	0.261	T	0.11665	-1.0578	10	0.33141	T	0.24	1.0701	2.2582	0.04060	0.1442:0.0981:0.4098:0.3479	.	212	Q99990	VGLL1_HUMAN	N	212	ENSP00000359668:Y212N	ENSP00000359668:Y212N	Y	+	1	0	VGLL1	135458833	0.718000	0.27976	0.826000	0.32828	0.173000	0.22820	0.666000	0.25097	0.003000	0.14656	0.486000	0.48141	TAT		0.547	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	NM_016267	Missense_Mutation	5	47	0	0	0	0.001168	0	5	47				
CXorf66	347487	broad.mit.edu	37	X	139038879	139038879	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:139038879C>A	ENST00000370540.1	-	3	285	c.262G>T	c.(262-264)Gca>Tca	p.A88S		NM_001013403.2	NP_001013421.1	Q5JRM2	CX066_HUMAN	chromosome X open reading frame 66	88						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|skin(1)|stomach(1)	26						GACTTGGCTGCTATGCCTTTT	0.388																																							uc004fbb.2		NA																	0					0						c.(262-264)GCA>TCA		hypothetical protein LOC347487 precursor							134.0	118.0	123.0					X																	139038879		2203	4300	6503	SO:0001583	missense	347487					integral to membrane		g.chrX:139038879C>A		CCDS35411.1	Xq27.1	2014-05-30			ENSG00000203933	ENSG00000203933			33743	protein-coding gene	gene with protein product	"""secreted glycoprotein, X-linked"""					24709545	Standard	NM_001013403		Approved	RP11-35F15.2, SGPX	uc004fbb.3	Q5JRM2	OTTHUMG00000022539	ENST00000370540.1:c.262G>T	X.37:g.139038879C>A	ENSP00000359571:p.Ala88Ser						p.A88S	NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN			3	284	-			88			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000370540.1	37	c.262G>T	CCDS35411.1	.	.	.	.	.	.	.	.	.	.	c	13.29	2.193030	0.38707	.	.	ENSG00000203933	ENST00000370540	T	0.50813	0.73	4.21	-4.33	0.03677	.	1.933720	0.03077	N	0.158021	T	0.27241	0.0668	N	0.24115	0.695	0.09310	N	1	B	0.33044	0.395	B	0.30105	0.111	T	0.05273	-1.0895	9	.	.	.	0.0226	2.6629	0.05032	0.1344:0.1861:0.1312:0.5483	.	88	Q5JRM2	CX066_HUMAN	S	88	ENSP00000359571:A88S	.	A	-	1	0	CXorf66	138866545	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.497000	0.06428	-1.318000	0.02289	-1.013000	0.02462	GCA		0.388	CXorf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058572.1	NM_001013403		5	128	1	0	5.9392e-07	0.001168	7.55425e-07	5	128				
GABRQ	55879	broad.mit.edu	37	X	151821552	151821552	+	Silent	SNP	C	C	A			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chrX:151821552C>A	ENST00000370306.2	+	9	1727	c.1707C>A	c.(1705-1707)ggC>ggA	p.G569G		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	569					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.G569G(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGGCCCATGGCCAAGAGAAGG	0.498																																							uc004ffp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(1705-1707)GGC>GGA		gamma-aminobutyric acid (GABA) receptor, theta							107.0	86.0	93.0					X																	151821552		2203	4300	6503	SO:0001819	synonymous_variant	55879					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity	g.chrX:151821552C>A	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1707C>A	X.37:g.151821552C>A							p.G569G	NM_018558	NP_061028	Q9UN88	GBRT_HUMAN			9	1727	+	Acute lymphoblastic leukemia(192;6.56e-05)		569					A6NFN1|Q32MB4|Q9NZK8	Silent	SNP	ENST00000370306.2	37	c.1707C>A	CCDS14707.1																																																																																				0.498	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558		6	48	1	0	0.00116845	0.001168	0.00128352	6	48				
HMCN1	83872	broad.mit.edu	37	1	186106738	186106739	+	Frame_Shift_Ins	INS	-	-	T			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr1:186106738_186106739insT	ENST00000271588.4	+	88	13920_13921	c.13691_13692insT	c.(13690-13695)ggtgggfs	p.G4565fs	HMCN1_ENST00000367492.2_Frame_Shift_Ins_p.G4565fs	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4565	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CCAGCCAATGGTGGGAAGCCCT	0.485																																							uc001grq.1		NA																	0				ovary(22)|skin(1)	23						c.(13690-13692)GGTfs		hemicentin 1 precursor																																				SO:0001589	frameshift_variant	83872				response to stimulus|visual perception	basement membrane	calcium ion binding	g.chr1:186106738_186106739insT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13692dupT	1.37:g.186106739_186106739dupT	ENSP00000271588:p.Gly4565fs					HMCN1_uc001grs.1_Frame_Shift_Ins_p.G133fs	p.G4564fs	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN			88	13920_13921	+			4564			TSP type-1 1.		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Frame_Shift_Ins	INS	ENST00000271588.4	37	c.13691_13692insT	CCDS30956.1																																																																																				0.485	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		8	52	NA	NA	NA	NA	NA	8	52	---	---	---	---
DNA2	1763	broad.mit.edu	37	10	70191626	70191644	+	Frame_Shift_Del	DEL	CATATCGTAGTTGTTTTTC	CATATCGTAGTTGTTTTTC	-	rs61855090	byFrequency	TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	CATATCGTAGTTGTTTTTC	CATATCGTAGTTGTTTTTC	-	-	CATATCGTAGTTGTTTTTC	CATATCGTAGTTGTTTTTC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr10:70191626_70191644delCATATCGTAGTTGTTTTTC	ENST00000358410.3	-	13	2008_2026	c.1958_1976delGAAAAACAACTACGATATG	c.(1957-1977)ggaaaaacaactacgatatgtfs	p.GKTTTIC653fs	DNA2_ENST00000399180.2_Frame_Shift_Del_p.GKTTTIC739fs|DNA2_ENST00000399179.2_Frame_Shift_Del_p.GKTTTIC653fs	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	653	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						TACGAGAGTACATATCGTAGTTGTTTTTCCTGTCCCAGG	0.37																																							uc001jof.2		NA																	0					0						c.(2215-2235)GGAAAAACAACTACGATATGTfs		DNA replication helicase 2 homolog																																				SO:0001589	frameshift_variant	1763				base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base	g.chr10:70191626_70191644delCATATCGTAGTTGTTTTTC	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.1958_1976delGAAAAACAACTACGATATG	10.37:g.70191626_70191644delCATATCGTAGTTGTTTTTC	ENSP00000351185:p.Gly653fs					DNA2_uc001jog.1_Frame_Shift_Del_p.G653fs|DNA2_uc001joh.1_RNA	p.G739fs	NM_001080449	NP_001073918	P51530	DNA2L_HUMAN			13	2216_2234	-			653_659					Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Frame_Shift_Del	DEL	ENST00000358410.3	37	c.2216_2234delGAAAAACAACTACGATATG																																																																																					0.370	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2			10	166	NA	NA	NA	NA	NA	10	166	---	---	---	---
MUC6	4588	broad.mit.edu	37	11	1027368	1027368	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr11:1027368delG	ENST00000421673.2	-	17	2181	c.2131delC	c.(2131-2133)caafs	p.Q711fs		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	711					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCGCCCTTTTGGTTCAGGTAG	0.632																																							uc001lsw.2		NA																	0				ovary(1)	1						c.(2131-2133)CAAfs		mucin 6, gastric							122.0	137.0	132.0					11																	1027368		2168	4250	6418	SO:0001589	frameshift_variant	4588				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent	g.chr11:1027368delG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2131delC	11.37:g.1027368delG	ENSP00000406861:p.Gln711fs						p.Q711fs	NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	17	2182	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	711					O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Frame_Shift_Del	DEL	ENST00000421673.2	37	c.2131delC	CCDS44513.1																																																																																				0.632	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		42	126	NA	NA	NA	NA	NA	42	126	---	---	---	---
CWC25	54883	broad.mit.edu	37	17	36981429	36981429	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr17:36981429delC	ENST00000225428.5	-	1	305	c.8delG	c.(7-9)ggcfs	p.G4fs	MIR4727_ENST00000584037.1_RNA|CWC25_ENST00000536127.1_5'UTR	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	4										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						CAGGTCTCCGCCCCCCATGAC	0.607																																							uc002hqu.2		NA																	0					0						c.(7-9)GGCfs		coiled-coil domain containing 49							34.0	34.0	34.0					17																	36981429		1861	4083	5944	SO:0001589	frameshift_variant	54883							g.chr17:36981429delC	AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.8delG	17.37:g.36981429delC	ENSP00000225428:p.Gly4fs					CWC25_uc010wdv.1_5'UTR|CWC25_uc010wdx.1_Intron	p.G3fs	NM_017748	NP_060218	Q9NXE8	CWC25_HUMAN			1	161	-			3					A0JLM3|Q68DK5	Frame_Shift_Del	DEL	ENST00000225428.5	37	c.8delG	CCDS45663.1																																																																																				0.607	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442186.6	NM_017748		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
GALNT15	117248	broad.mit.edu	37	3	16250019	16250019	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr3:16250019delG	ENST00000339732.5	+	4	1424	c.921delG	c.(919-921)gtgfs	p.V308fs	GALNT15_ENST00000437509.1_Frame_Shift_Del_p.V308fs	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	308					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GGAGCCGAGTGGTATCTCCGG	0.498																																							uc003car.3		NA																	0				breast(1)	1						c.(919-921)GTGfs		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							158.0	164.0	162.0					3																	16250019		2203	4300	6503	SO:0001589	frameshift_variant	117248					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr3:16250019delG	AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.921delG	3.37:g.16250019delG	ENSP00000344260:p.Val308fs					GALNTL2_uc003caq.3_Frame_Shift_Del_p.V40fs	p.V307fs	NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN			4	1396	+			307			Lumenal (Potential).		A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Frame_Shift_Del	DEL	ENST00000339732.5	37	c.921delG	CCDS33711.1																																																																																				0.498	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110		13	259	NA	NA	NA	NA	NA	13	259	---	---	---	---
TRRAP	8295	broad.mit.edu	37	7	98498314	98498314	+	Frame_Shift_Del	DEL	T	T	-			TCGA-44-6147-01A-11D-1753-08	TCGA-44-6147-10A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7b6daa70-492e-4283-b3d2-b26f4e26a8d4	3ca8208a-ca5b-45e8-968d-9f47b6201fd1	g.chr7:98498314delT	ENST00000359863.4	+	11	1077	c.868delT	c.(868-870)tttfs	p.F290fs	TRRAP_ENST00000446306.3_Frame_Shift_Del_p.F290fs|TRRAP_ENST00000355540.3_Frame_Shift_Del_p.F290fs	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	290					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AACATTGTCATTTTTAGCTTA	0.328																																							uc003upp.2		NA																	0				ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37						c.(868-870)TTTfs		transformation/transcription domain-associated							181.0	165.0	170.0					7																	98498314		2203	4300	6503	SO:0001589	frameshift_variant	8295				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity	g.chr7:98498314delT	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.868delT	7.37:g.98498314delT	ENSP00000352925:p.Phe290fs					TRRAP_uc011kis.1_Frame_Shift_Del_p.F290fs|TRRAP_uc003upr.2_5'UTR	p.F290fs	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		11	1077	+	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		290					A4D265|O75218|Q9Y631|Q9Y6H4	Frame_Shift_Del	DEL	ENST00000359863.4	37	c.868delT	CCDS59066.1																																																																																				0.328	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		36	139	NA	NA	NA	NA	NA	36	139	---	---	---	---
