#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MMEL1	79258	broad.mit.edu	37	1	2524404	2524404	+	Splice_Site	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:2524404G>T	ENST00000378412.3	-	20	2030	c.1869C>A	c.(1867-1869)ggC>ggA	p.G623G	MMEL1_ENST00000502556.1_Splice_Site_p.G466G|MMEL1_ENST00000288709.6_Splice_Site_p.G614G			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	623						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G614G(1)		cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		CGAAGTTCCGGCCTGGGCAGG	0.632																																							uc001ajy.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1867-1869)GGC>GGA		membrane metallo-endopeptidase-like 1							91.0	88.0	89.0					1																	2524404		2203	4300	6503	SO:0001630	splice_region_variant	79258				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity	g.chr1:2524404G>T	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.1868-1C>A	1.37:g.2524404G>T						MMEL1_uc009vlg.1_RNA	p.G623G	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)	20	2083	-	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)	623			Lumenal (Potential).		B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Silent	SNP	ENST00000378412.3	37	c.1869C>A	CCDS30569.2																																																																																				0.632	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467	Silent	9	66	1	0	0.00185496	0.001855	0.00224548	9	66				
PHF13	148479	broad.mit.edu	37	1	6680330	6680331	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:6680330_6680331GG>TT	ENST00000377648.4	+	3	991_992	c.609_610GG>TT	c.(607-612)caGGga>caTTga	p.203_204QG>H*	PHF13_ENST00000495385.1_Intron	NM_153812.2	NP_722519.2	Q86YI8	PHF13_HUMAN	PHD finger protein 13	203					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.Q203_G204>H*(1)		endometrium(3)|large_intestine(1)|lung(3)	7	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)		TCGTCCGGCAGGGAAAGCAGGT	0.525																																							uc001aob.3		NA																	1	Complex - compound substitution(1)		lung(1)		0						c.(607-612)CAGGGA>CATTGA		PHD finger protein 13																																				SO:0001587	stop_gained	148479				cell division|chromatin modification|mitotic chromosome condensation	nucleoplasm	chromatin binding|methylated histone residue binding|zinc ion binding	g.chr1:6680330_6680331GG>TT	AK027492	CCDS85.1	1p36.23	2013-01-28			ENSG00000116273	ENSG00000116273		"""Zinc fingers, PHD-type"""	22983	protein-coding gene	gene with protein product							Standard	NM_153812		Approved	MGC43399	uc001aob.4	Q86YI8	OTTHUMG00000001439	Exception_encountered	1.37:g.6680330_6680331delinsTT	ENSP00000366876:p.Q203_G204delinsH*						p.203_204QG>H*	NM_153812	NP_722519	Q86YI8	PHF13_HUMAN		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)	3	980_981	+	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)	203_204					B3KUQ7|Q59FB6|Q5TH65|Q8N551|Q9UJP2	Nonsense_Mutation	DNP	ENST00000377648.4	37	c.609_610GG>TT	CCDS85.1																																																																																				0.525	PHF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004201.1	NM_153812		4	43	0	0	0	0.004672	0	4	43				
PRAMEF6	440561	broad.mit.edu	37	1	13001343	13001343	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:13001343T>C	ENST00000376189.1	-	3	439	c.340A>G	c.(340-342)Atg>Gtg	p.M114V	PRAMEF6_ENST00000376192.5_Intron|PRAMEF6_ENST00000415464.2_Missense_Mutation_p.M114V	NM_001010889.2	NP_001010889.1	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	114					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.M114V(1)		NS(1)|kidney(1)|lung(5)|urinary_tract(2)	9	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GACCAAACCATCCAGAAGTTC	0.483																																							uc001auq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(340-342)ATG>GTG		PRAME family member 6							158.0	235.0	207.0					1																	13001343		1465	2659	4124	SO:0001583	missense	440561							g.chr1:13001343T>C		CCDS30594.1	1p36.21	2013-01-17				ENSG00000232423		"""-"""	30583	protein-coding gene	gene with protein product							Standard	NM_001010889		Approved		uc001auq.2	Q5VXH4	OTTHUMG00000001984	ENST00000376189.1:c.340A>G	1.37:g.13001343T>C	ENSP00000365360:p.Met114Val					PRAMEF5_uc001aur.2_Intron	p.M114V	NM_001010889	NP_001010889	Q5VXH4	PRAM6_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	3	426	-	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	114					A0AUJ9	Missense_Mutation	SNP	ENST00000376189.1	37	c.340A>G	CCDS30594.1	.	.	.	.	.	.	.	.	.	.	.	7.966	0.747970	0.15710	.	.	ENSG00000232423	ENST00000376189;ENST00000415464;ENST00000355096	T;T;T	0.04603	3.59;3.59;3.59	1.52	0.168	0.15012	.	1.517230	0.03440	N	0.209173	T	0.04770	0.0129	L	0.34521	1.04	0.38584	D	0.950259	B	0.24576	0.106	B	0.17722	0.019	T	0.24693	-1.0153	10	0.56958	D	0.05	.	3.6824	0.08316	0.0:0.2271:0.0:0.7729	.	114	Q5VXH4	PRAM6_HUMAN	V	114	ENSP00000365360:M114V;ENSP00000401281:M114V;ENSP00000347211:M114V	ENSP00000347211:M114V	M	-	1	0	PRAMEF6	12923930	0.298000	0.24417	0.561000	0.28357	0.324000	0.28378	0.613000	0.24299	0.029000	0.15352	0.318000	0.21364	ATG		0.483	PRAMEF6-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001010889		27	385	0	0	0	0.00361	0	27	385				
HSPB7	27129	broad.mit.edu	37	1	16342123	16342123	+	Silent	SNP	C	C	A	rs527794958		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:16342123C>A	ENST00000311890.9	-	3	1291	c.465G>T	c.(463-465)ccG>ccT	p.P155P	HSPB7_ENST00000487046.1_Silent_p.P160P|HSPB7_ENST00000411503.1_Silent_p.P150P|HSPB7_ENST00000375718.4_Silent_p.P230P|HSPB7_ENST00000406363.2_Silent_p.P159P	NM_014424.4	NP_055239.1	Q9UBY9	HSPB7_HUMAN	heat shock 27kDa protein family, member 7 (cardiovascular)	155					regulation of heart contraction (GO:0008016)|response to unfolded protein (GO:0006986)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)	p.P155P(1)		breast(1)|large_intestine(1)|liver(1)|lung(6)|skin(1)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GTTCTGTATGCGGGTGACGCC	0.652																																							uc001axo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(463-465)CCG>CCT		cardiovascular heat shock protein							108.0	86.0	93.0					1																	16342123		2203	4300	6503	SO:0001819	synonymous_variant	27129				regulation of heart contraction|response to heat|response to unfolded protein	Cajal body	protein C-terminus binding	g.chr1:16342123C>A	AF155908	CCDS30611.1	1p36.23-p34.3	2011-09-02	2002-08-29		ENSG00000173641	ENSG00000173641		"""Heat shock proteins / HSPB"""	5249	protein-coding gene	gene with protein product		610692	"""heat shock 27kD protein family, member 7 (cardiovascular)"""			10593960	Standard	NM_014424		Approved	cvHSP	uc001axo.2	Q9UBY9	OTTHUMG00000009531	ENST00000311890.9:c.465G>T	1.37:g.16342123C>A						HSPB7_uc001axp.2_Silent_p.P238P|HSPB7_uc001axq.2_Silent_p.P247P|HSPB7_uc001axr.2_Silent_p.P248P|HSPB7_uc001axs.2_Silent_p.P230P	p.P155P	NM_014424	NP_055239	Q9UBY9	HSPB7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)	3	1292	-		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)	155					B3KQ37|C9K0Y0|Q9NU17	Silent	SNP	ENST00000311890.9	37	c.465G>T	CCDS30611.1																																																																																				0.652	HSPB7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026334.2	NM_014424		19	32	1	0	8.34094e-07	0.008871	1.17797e-06	19	32				
EPHA8	2046	broad.mit.edu	37	1	22920043	22920043	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:22920043C>A	ENST00000166244.3	+	7	1539	c.1467C>A	c.(1465-1467)acC>acA	p.T489T		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	489	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.T489T(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCTACTCCACCCTCAAGGCCG	0.697																																							uc001bfx.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13						c.(1465-1467)ACC>ACA		ephrin receptor EphA8 isoform 1 precursor							38.0	36.0	37.0					1																	22920043		2199	4298	6497	SO:0001819	synonymous_variant	2046					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr1:22920043C>A	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1467C>A	1.37:g.22920043C>A							p.T489T	NM_020526	NP_065387	P29322	EPHA8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	7	1592	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	489			Extracellular (Potential).|Fibronectin type-III 2.		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	37	c.1467C>A	CCDS225.1																																																																																				0.697	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526		7	23	1	0	2.7689e-08	0.001984	4.25916e-08	7	23				
RCAN3	11123	broad.mit.edu	37	1	24840900	24840900	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:24840900A>T	ENST00000374395.4	+	2	351	c.38A>T	c.(37-39)cAg>cTg	p.Q13L	RCAN3_ENST00000412742.2_Missense_Mutation_p.Q13L|RCAN3_ENST00000538532.1_Missense_Mutation_p.Q13L|RCAN3_ENST00000436717.2_Missense_Mutation_p.Q13L|RCAN3_ENST00000374393.2_Missense_Mutation_p.Q13L	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3	13					anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)	p.Q13L(1)		central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		AATGATAGCCAGTCAGATCTG	0.428																																							uc001bjj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(37-39)CAG>CTG		Down syndrome critical region gene 1-like 2							180.0	169.0	173.0					1																	24840900		2203	4300	6503	SO:0001583	missense	11123				anatomical structure morphogenesis|calcium-mediated signaling		nucleotide binding|RNA binding|troponin I binding	g.chr1:24840900A>T		CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.38A>T	1.37:g.24840900A>T	ENSP00000363516:p.Gln13Leu					RCAN3_uc009vrd.2_Missense_Mutation_p.Q13L|RCAN3_uc009vre.2_Missense_Mutation_p.Q13L|RCAN3_uc009vrf.2_Missense_Mutation_p.Q13L|RCAN3_uc009vrg.2_Missense_Mutation_p.Q13L	p.Q13L	NM_013441	NP_038469	Q9UKA8	RCAN3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)	2	351	+		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)	13					A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	Missense_Mutation	SNP	ENST00000374395.4	37	c.38A>T	CCDS254.1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.702220	0.68501	.	.	ENSG00000117602	ENST00000374395;ENST00000436717;ENST00000425530;ENST00000412742;ENST00000538532;ENST00000374393	T;T;T	0.46451	0.87;0.9;0.87	5.48	3.13	0.36017	.	0.271252	0.37857	N	0.001906	T	0.43897	0.1268	N	0.19112	0.55	0.37129	D	0.901189	P;P;B;D;D	0.63046	0.493;0.936;0.361;0.992;0.987	B;P;B;D;D	0.72982	0.367;0.885;0.051;0.979;0.953	T	0.49532	-0.8930	10	0.72032	D	0.01	-5.3983	7.0721	0.25183	0.7766:0.1484:0.075:0.0	.	13;13;13;13;13	E7EWD8;E7ENV1;A4GU14;Q9UKA8-2;Q9UKA8	.;.;.;.;RCAN3_HUMAN	L	13	ENSP00000363516:Q13L;ENSP00000414447:Q13L;ENSP00000445401:Q13L	ENSP00000363514:Q13L	Q	+	2	0	RCAN3	24713487	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	3.445000	0.52921	0.374000	0.24650	0.477000	0.44152	CAG		0.428	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009176.2			12	76	0	0	0	0.00245	0	12	76				
LAPTM5	7805	broad.mit.edu	37	1	31230519	31230519	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:31230519G>T	ENST00000294507.3	-	1	148	c.74C>A	c.(73-75)gCc>gAc	p.A25D	LAPTM5_ENST00000476492.1_5'UTR	NM_006762.2	NP_006753.1	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	25					transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)		p.A25D(1)		large_intestine(2)|lung(7)|skin(1)	10		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		ATGGTAGATGGCCAGGGCGGT	0.632																																							uc001bsc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(73-75)GCC>GAC		lysosomal protein transmembrane 5							71.0	67.0	69.0					1																	31230519		2203	4300	6503	SO:0001583	missense	7805				transport	integral to plasma membrane|lysosomal membrane		g.chr1:31230519G>T	U51240	CCDS337.1	1p34	2009-07-20	2009-07-20		ENSG00000162511	ENSG00000162511			29612	protein-coding gene	gene with protein product		601476	"""lysosomal multispanning membrane protein 5"""			8661146, 12527926	Standard	NM_006762		Approved		uc001bsc.2	Q13571	OTTHUMG00000003707	ENST00000294507.3:c.74C>A	1.37:g.31230519G>T	ENSP00000294507:p.Ala25Asp						p.A25D	NM_006762	NP_006753	Q13571	LAPM5_HUMAN		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)	1	165	-		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)	25			Helical; (Potential).		Q13240|Q14698|Q3KP54	Missense_Mutation	SNP	ENST00000294507.3	37	c.74C>A	CCDS337.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.132222	0.77662	.	.	ENSG00000162511	ENST00000294507;ENST00000424259	T	0.46819	0.86	5.2	4.25	0.50352	.	0.520250	0.18530	N	0.138540	T	0.43722	0.1260	N	0.24115	0.695	0.31953	N	0.609358	D	0.63880	0.993	P	0.52424	0.698	T	0.52779	-0.8530	10	0.87932	D	0	-39.5059	10.8253	0.46629	0.0:0.2061:0.7939:0.0	.	25	Q13571	LAPM5_HUMAN	D	25	ENSP00000294507:A25D	ENSP00000294507:A25D	A	-	2	0	LAPTM5	31003106	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	2.649000	0.46656	2.691000	0.91804	0.655000	0.94253	GCC		0.632	LAPTM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010463.1	NM_006762		11	59	1	0	0.00829132	0.008291	0.00981546	11	59				
PODN	127435	broad.mit.edu	37	1	53542969	53542969	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:53542969G>T	ENST00000312553.5	+	6	840	c.833G>T	c.(832-834)cGc>cTc	p.R278L	PODN_ENST00000395871.2_Intron|PODN_ENST00000371500.3_Missense_Mutation_p.R259L|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	230					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)	p.R278L(1)|p.R278H(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						AACTTCCTGCGCCACGTGCCC	0.637																																							uc001cuv.2		NA																	2	Substitution - Missense(2)	p.R278H(1)	ovary(1)|lung(1)	ovary(1)|pancreas(1)	2						c.(832-834)CGC>CTC		podocan							104.0	104.0	104.0					1																	53542969		2203	4300	6503	SO:0001583	missense	127435				negative regulation of cell migration|negative regulation of cell proliferation	cytoplasm|extracellular space|proteinaceous extracellular matrix	collagen binding	g.chr1:53542969G>T	AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.833G>T	1.37:g.53542969G>T	ENSP00000308315:p.Arg278Leu					PODN_uc001cuw.2_Missense_Mutation_p.R259L|PODN_uc010onr.1_Missense_Mutation_p.R259L|PODN_uc010ons.1_Intron	p.R278L	NM_153703	NP_714914	Q7Z5L7	PODN_HUMAN			6	840	+			230			LRR 6.		B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	ENST00000312553.5	37	c.833G>T	CCDS573.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.715496	0.68844	.	.	ENSG00000174348	ENST00000371500;ENST00000312553	T;T	0.18338	3.62;2.22	4.85	3.85	0.44370	.	0.210009	0.40640	N	0.001058	T	0.15435	0.0372	L	0.58669	1.825	0.80722	D	1	P;P	0.41232	0.743;0.535	B;B	0.41374	0.355;0.325	T	0.01863	-1.1258	10	0.30078	T	0.28	.	3.8959	0.09139	0.3179:0.0:0.6821:0.0	.	259;278	Q7Z5L7-2;Q7Z5L7-3	.;.	L	259;278	ENSP00000360555:R259L;ENSP00000308315:R278L	ENSP00000308315:R278L	R	+	2	0	PODN	53315557	0.997000	0.39634	1.000000	0.80357	0.974000	0.67602	2.854000	0.48325	2.505000	0.84491	0.655000	0.94253	CGC		0.637	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024735.1	NM_153703		27	147	1	0	8.24728e-16	0.004656	1.60623e-15	27	147				
C1orf87	127795	broad.mit.edu	37	1	60505798	60505798	+	Silent	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:60505798G>A	ENST00000371201.3	-	5	645	c.538C>T	c.(538-540)Ctg>Ttg	p.L180L	C1orf87_ENST00000450089.2_Intron	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	180							calcium ion binding (GO:0005509)	p.L180L(1)		breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						CTTCTGACCAGGGCAAGAAGA	0.433																																					NSCLC(75;811 1386 4923 13371 51772)	NSCLC(75;811 1386 4923 13371 51772)	uc001czs.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(538-540)CTG>TTG		hypothetical protein LOC127795							94.0	102.0	99.0					1																	60505798		2203	4300	6503	SO:0001819	synonymous_variant	127795						calcium ion binding	g.chr1:60505798G>A	AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.538C>T	1.37:g.60505798G>A							p.L180L	NM_152377	NP_689590	Q8N0U7	CA087_HUMAN			5	630	-			180					Q6ZU07|Q8IVS0	Silent	SNP	ENST00000371201.3	37	c.538C>T	CCDS614.1																																																																																				0.433	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024943.1	NM_152377		36	123	0	0	0	0.005524	0	36	123				
INADL	10207	broad.mit.edu	37	1	62626589	62626589	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:62626589G>T	ENST00000371158.2	+	43	5502	c.5388G>T	c.(5386-5388)ctG>ctT	p.L1796L		NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1796					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.L1796L(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GGGAGCAGCTGCAGATGACGG	0.408																																							uc001dab.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(5386-5388)CTG>CTT		InaD-like							102.0	98.0	99.0					1																	62626589		1904	4119	6023	SO:0001819	synonymous_variant	10207				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding	g.chr1:62626589G>T	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.5388G>T	1.37:g.62626589G>T						INADL_uc001dac.2_RNA|INADL_uc009wag.2_Intron	p.L1796L	NM_176877	NP_795352	Q8NI35	INADL_HUMAN			43	5502	+			1796					O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Silent	SNP	ENST00000371158.2	37	c.5388G>T	CCDS617.2																																																																																				0.408	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605		16	66	1	0	1.67942e-08	0.006122	2.59986e-08	16	66				
LPHN2	23266	broad.mit.edu	37	1	82432281	82432281	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:82432281G>T	ENST00000370728.1	+	15	2970	c.2325G>T	c.(2323-2325)ctG>ctT	p.L775L	LPHN2_ENST00000370715.1_Silent_p.L762L|LPHN2_ENST00000359929.3_Silent_p.L762L|LPHN2_ENST00000335786.5_Silent_p.L775L|LPHN2_ENST00000271029.4_Silent_p.L775L|LPHN2_ENST00000370721.1_Silent_p.L700L|LPHN2_ENST00000394879.1_Silent_p.L762L|LPHN2_ENST00000370725.1_Silent_p.L775L|LPHN2_ENST00000370713.1_Silent_p.L762L|LPHN2_ENST00000370723.1_Silent_p.L762L|LPHN2_ENST00000370727.1_Silent_p.L775L|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000319517.6_Silent_p.L762L|LPHN2_ENST00000370717.2_Silent_p.L775L|LPHN2_ENST00000370730.1_Silent_p.L775L			O95490	LPHN2_HUMAN	latrophilin 2	775					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.L762L(1)|p.L775L(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TTTTTACCCTGCCACACATTG	0.418																																							uc001dit.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9						c.(2284-2286)CTG>CTT		latrophilin 2 precursor							168.0	163.0	165.0					1																	82432281		2203	4300	6503	SO:0001819	synonymous_variant	23266				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding	g.chr1:82432281G>T	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.2325G>T	1.37:g.82432281G>T						LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Silent_p.L762L|LPHN2_uc001div.2_Silent_p.L762L|LPHN2_uc009wcd.2_Silent_p.L762L|LPHN2_uc001diw.2_Silent_p.L346L	p.L762L	NM_012302	NP_036434	O95490	LPHN2_HUMAN		all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)	12	2467	+			775			Extracellular (Potential).		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Silent	SNP	ENST00000370728.1	37	c.2286G>T		.	.	.	.	.	.	.	.	.	.	G	7.628	0.678315	0.14841	.	.	ENSG00000117114	ENST00000449420	.	.	.	6.17	-5.64	0.02466	.	.	.	.	.	T	0.17704	0.0425	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38156	-0.9674	4	.	.	.	.	0.914	0.01300	0.2655:0.1753:0.3801:0.1791	.	.	.	.	F	643	.	.	C	+	2	0	LPHN2	82204869	1.000000	0.71417	0.403000	0.26384	0.991000	0.79684	1.543000	0.36147	-1.531000	0.01749	-0.176000	0.13171	TGC		0.418	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302		24	141	1	0	2.32416e-17	0.002299	4.73657e-17	24	141				
BTBD8	284697	broad.mit.edu	37	1	92554451	92554451	+	Splice_Site	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:92554451C>T	ENST00000342818.3	+	2	582	c.346C>T	c.(346-348)Cag>Tag	p.Q116*	BTBD8_ENST00000540648.1_Splice_Site_p.Q116*|BTBD8_ENST00000370382.3_Splice_Site_p.Q116*	NM_183242.3	NP_899065.2	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	116	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.					nucleus (GO:0005634)		p.Q116*(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)	16		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		AACGTTTTTACAGTAAGTGCT	0.274																																							uc001doo.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(346-348)CAG>TAG		BTB (POZ) domain containing 8							81.0	75.0	77.0					1																	92554451		2202	4299	6501	SO:0001630	splice_region_variant	284697					nucleus		g.chr1:92554451C>T	AY346333	CCDS737.1	1p22.1	2013-01-08			ENSG00000189195	ENSG00000189195		"""BTB/POZ domain containing"""	21019	protein-coding gene	gene with protein product						14654994	Standard	NM_183242		Approved		uc001doo.3	Q5XKL5	OTTHUMG00000010289	ENST00000342818.3:c.347+1C>T	1.37:g.92554451C>T						BTBD8_uc010otc.1_RNA	p.Q116*	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN		all cancers(265;0.0153)|Epithelial(280;0.0982)	2	613	+		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)	116			BTB 1.		Q6V9S5	Nonsense_Mutation	SNP	ENST00000342818.3	37	c.346C>T	CCDS737.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.856663	0.91433	.	.	ENSG00000189195	ENST00000370382;ENST00000342818;ENST00000540648	.	.	.	5.31	5.31	0.75309	.	0.115952	0.39274	N	0.001401	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-14.8895	13.7169	0.62702	0.1548:0.8451:0.0:0.0	.	.	.	.	X	116	.	ENSP00000343686:Q116X	Q	+	1	0	BTBD8	92327039	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	1.961000	0.40432	2.654000	0.90174	0.591000	0.81541	CAG		0.274	BTBD8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028372.1	NM_183242	Nonsense_Mutation	7	49	0	0	0	0.001984	0	7	49				
CHI3L2	1117	broad.mit.edu	37	1	111773424	111773424	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:111773424G>A	ENST00000445067.2	+	5	902	c.131G>A	c.(130-132)gGa>gAa	p.G44E	CHI3L2_ENST00000369748.4_Missense_Mutation_p.G44E|CHI3L2_ENST00000369744.2_Missense_Mutation_p.G34E|CHI3L2_ENST00000524472.1_5'UTR|CHI3L2_ENST00000466741.1_5'UTR			Q15782	CH3L2_HUMAN	chitinase 3-like 2	44					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)	extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.G44E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(1)	19		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		CAGGAACCAGGAAAATTCACC	0.478																																							uc001eam.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(130-132)GGA>GAA		chitinase 3-like 2 isoform a							75.0	72.0	73.0					1																	111773424		2203	4300	6503	SO:0001583	missense	1117				chitin catabolic process	extracellular space	cation binding|chitinase activity	g.chr1:111773424G>A	U49835	CCDS30802.1, CCDS30803.1, CCDS41367.1	1p13.3	2008-02-05			ENSG00000064886	ENSG00000064886			1933	protein-coding gene	gene with protein product		601526				8702629	Standard	NM_001025197		Approved	YKL-39, YKL39	uc001eam.3	Q15782	OTTHUMG00000012174	ENST00000445067.2:c.131G>A	1.37:g.111773424G>A	ENSP00000437082:p.Gly44Glu					CHI3L2_uc001ean.2_Missense_Mutation_p.G34E|CHI3L2_uc001eao.2_5'UTR|CHI3L2_uc009wga.2_5'UTR	p.G44E	NM_004000	NP_003991	Q15782	CH3L2_HUMAN		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)	3	202	+		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)	44					A6NNY3|B4DPR7|Q15749|Q15783|Q5VUV7|Q96F97	Missense_Mutation	SNP	ENST00000445067.2	37	c.131G>A	CCDS30802.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.09|17.09	3.299866|3.299866	0.60195|0.60195	.|.	.|.	ENSG00000064886|ENSG00000064886	ENST00000533831|ENST00000445067;ENST00000528451;ENST00000486561;ENST00000369744;ENST00000369748;ENST00000474304	.|T;T;T;T;T	.|0.37752	.|3.54;1.18;1.18;3.54;3.54	4.09|4.09	3.12|3.12	0.35913|0.35913	.|Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.|0.189636	.|0.26026	.|N	.|0.026793	T|T	0.54224|0.54224	0.1845|0.1845	M|M	0.91818|0.91818	3.245|3.245	0.09310|0.09310	N|N	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.80764	.|0.994;0.994	T|T	0.44544|0.44544	-0.9321|-0.9321	5|10	.|0.87932	.|D	.|0	-8.1353|-8.1353	10.5906|10.5906	0.45308|0.45308	0.0:0.3496:0.6504:0.0|0.0:0.3496:0.6504:0.0	.|.	.|34;44	.|A6NNY3;Q15782	.|.;CH3L2_HUMAN	K|E	13|44;44;44;34;44;44	.|ENSP00000437082:G44E;ENSP00000436077:G44E;ENSP00000431968:G44E;ENSP00000358759:G34E;ENSP00000358763:G44E	.|ENSP00000358759:G34E	E|G	+|+	1|2	0|0	CHI3L2|CHI3L2	111574947|111574947	0.993000|0.993000	0.37304|0.37304	0.595000|0.595000	0.28798|0.28798	0.969000|0.969000	0.65631|0.65631	2.295000|2.295000	0.43576|0.43576	2.071000|2.071000	0.62044|0.62044	0.655000|0.655000	0.94253|0.94253	GAA|GGA		0.478	CHI3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033669.4	NM_004000		13	52	0	0	0	0.001855	0	13	52				
ANKRD34A	284615	broad.mit.edu	37	1	145473875	145473875	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:145473875T>A	ENST00000323397.4	+	4	1840	c.547T>A	c.(547-549)Tcg>Acg	p.S183T	RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	183						cytoplasm (GO:0005737)		p.S183T(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTTCTGCACGTCGCCTTCGGA	0.612																																							uc001enq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(547-549)TCG>ACG		ankyrin repeat domain 34							61.0	63.0	63.0					1																	145473875		2203	4300	6503	SO:0001583	missense	284615							g.chr1:145473875T>A	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.547T>A	1.37:g.145473875T>A	ENSP00000314103:p.Ser183Thr					NBPF10_uc001emp.3_Intron	p.S183T	NM_001039888	NP_001034977	Q69YU3	AN34A_HUMAN			4	1840	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		183					B3KSU3	Missense_Mutation	SNP	ENST00000323397.4	37	c.547T>A	CCDS30829.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.241622	0.39598	.	.	ENSG00000181039	ENST00000323397	T	0.74209	-0.82	5.1	5.1	0.69264	.	0.082287	0.50627	D	0.000101	T	0.65933	0.2739	N	0.22421	0.69	0.48341	D	0.999632	D	0.63880	0.993	D	0.68192	0.956	T	0.64659	-0.6355	10	0.17369	T	0.5	-10.453	12.9197	0.58224	0.0:0.0:0.0:1.0	.	183	Q69YU3	AN34A_HUMAN	T	183	ENSP00000314103:S183T	ENSP00000314103:S183T	S	+	1	0	ANKRD34A	144185232	1.000000	0.71417	0.986000	0.45419	0.955000	0.61496	3.989000	0.56958	2.144000	0.66660	0.397000	0.26171	TCG		0.612	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1			21	99	0	0	0	0.001882	0	21	99				
FLG	2312	broad.mit.edu	37	1	152283761	152283761	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:152283761G>T	ENST00000368799.1	-	3	3636	c.3601C>A	c.(3601-3603)Cag>Aag	p.Q1201K	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1201	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.Q1201K(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCTTCCCTGGGATGTGGTG	0.567									Ichthyosis																														uc001ezu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(3601-3603)CAG>AAG		filaggrin							318.0	326.0	323.0					1																	152283761		2203	4297	6500	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152283761G>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3601C>A	1.37:g.152283761G>T	ENSP00000357789:p.Gln1201Lys					uc001ezv.2_5'Flank	p.Q1201K	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	3637	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1201			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.3601C>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	5.447	0.267591	0.10294	.	.	ENSG00000143631	ENST00000368799	T	0.01647	4.71	2.85	-1.96	0.07525	.	.	.	.	.	T	0.00637	0.0021	M	0.73962	2.25	0.09310	N	1	B	0.25007	0.116	B	0.24701	0.055	T	0.48725	-0.9010	9	0.07990	T	0.79	.	5.1765	0.15137	0.0:0.3714:0.3026:0.3259	.	1201	P20930	FILA_HUMAN	K	1201	ENSP00000357789:Q1201K	ENSP00000357789:Q1201K	Q	-	1	0	FLG	150550385	0.004000	0.15560	0.000000	0.03702	0.036000	0.12997	0.649000	0.24843	-0.815000	0.04346	0.425000	0.28330	CAG		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		146	550	1	0	1.25085e-53	0.00361	2.90463e-53	146	550				
LCE2C	353140	broad.mit.edu	37	1	152648743	152648743	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:152648743C>A	ENST00000368783.1	+	2	307	c.252C>A	c.(250-252)cgC>cgA	p.R84R	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	84	Cys-rich.				keratinization (GO:0031424)			p.R84R(1)		endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCACCGGCGCCGGCACCAGA	0.682																																							uc001fah.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(250-252)CGC>CGA		late cornified envelope 2C							34.0	43.0	40.0					1																	152648743		2201	4297	6498	SO:0001819	synonymous_variant	353140				keratinization			g.chr1:152648743C>A		CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.252C>A	1.37:g.152648743C>A							p.R84R	NM_178429	NP_848516	Q5TA81	LCE2C_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	307	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		84			Cys-rich.			Silent	SNP	ENST00000368783.1	37	c.252C>A	CCDS1019.1																																																																																				0.682	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034509.1	NM_178429		28	95	1	0	7.41945e-09	0.005443	1.15228e-08	28	95				
IL6R	3570	broad.mit.edu	37	1	154422457	154422457	+	Splice_Site	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:154422457G>A	ENST00000368485.3	+	8	1503		c.e8+1		IL6R_ENST00000344086.4_Splice_Site|IL6R_ENST00000507256.1_Splice_Site	NM_000565.3	NP_000556.1	P08887	IL6RA_HUMAN	interleukin 6 receptor						acute-phase response (GO:0006953)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|endocrine pancreas development (GO:0031018)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatic immune response (GO:0002384)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of interleukin-8 production (GO:0032717)|neutrophil mediated immunity (GO:0002446)|positive regulation of activation of Janus kinase activity (GO:0010536)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|response to cytokine (GO:0034097)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)|plasma membrane (GO:0005886)	ciliary neurotrophic factor binding (GO:0070119)|cytokine receptor activity (GO:0004896)|enzyme binding (GO:0019899)|interleukin-6 binding (GO:0019981)|protein homodimerization activity (GO:0042803)	p.?(1)	IL6R/ATP8B2(2)	breast(2)|large_intestine(1)|ovary(3)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)		Tocilizumab(DB06273)	AGCCTCCCAGGTAAGGACTGG	0.433																																							uc001fez.1		NA																	1	Unknown(1)		lung(1)	ovary(3)|breast(1)	4						c.e8+1		interleukin 6 receptor isoform 1 precursor							102.0	104.0	103.0					1																	154422457		2203	4300	6503	SO:0001630	splice_region_variant	3570				acute-phase response|ciliary neurotrophic factor-mediated signaling pathway|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|endocrine pancreas development|hepatic immune response|negative regulation of collagen biosynthetic process|negative regulation of interleukin-8 production|positive regulation of activation of Janus kinase activity|positive regulation of anti-apoptosis|positive regulation of chemokine production|positive regulation of chemokine production|positive regulation of interleukin-6 production|positive regulation of leukocyte chemotaxis|positive regulation of MAPKKK cascade|positive regulation of osteoblast differentiation|positive regulation of smooth muscle cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of apoptosis	apical plasma membrane|basolateral plasma membrane|extracellular space|interleukin-6 receptor complex	ciliary neurotrophic factor binding|enzyme binding|protein homodimerization activity	g.chr1:154422457G>A	X12830	CCDS1067.1, CCDS1068.1, CCDS72927.1	1q21	2013-01-11			ENSG00000160712	ENSG00000160712		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6019	protein-coding gene	gene with protein product		147880					Standard	NM_000565		Approved	CD126	uc001fez.2	P08887	OTTHUMG00000036073	ENST00000368485.3:c.1066+1G>A	1.37:g.154422457G>A						IL6R_uc001ffa.1_Splice_Site_p.G356_splice	p.V356_splice	NM_000565	NP_000556	P08887	IL6RA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		8	1503	+	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)							A8KAE8|B2R6V4|Q16202|Q53EQ7|Q5FWG2|Q5VZ23	Splice_Site	SNP	ENST00000368485.3	37	c.1066_splice	CCDS1067.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208414	0.58343	.	.	ENSG00000160712	ENST00000368485;ENST00000344086;ENST00000515190	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1216	0.53895	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IL6R	152689081	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	3.671000	0.54576	2.567000	0.86603	0.563000	0.77884	.		0.433	IL6R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087911.1	NM_000565	Intron	4	83	0	0	0	0.000248	0	4	83				
RXRG	6258	broad.mit.edu	37	1	165370562	165370562	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:165370562C>A	ENST00000359842.5	-	10	1632	c.1330G>T	c.(1330-1332)Ggg>Tgg	p.G444W		NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	444	Ligand-binding. {ECO:0000250}.				gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.G444W(1)		endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	GGGGTGTCCCCGATGAGCTTG	0.602																																							uc001gda.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1330-1332)GGG>TGG		retinoid X receptor, gamma isoform a	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)						112.0	106.0	108.0					1																	165370562		2203	4300	6503	SO:0001583	missense	6258				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr1:165370562C>A	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.1330G>T	1.37:g.165370562C>A	ENSP00000352900:p.Gly444Trp						p.G444W	NM_006917	NP_008848	P48443	RXRG_HUMAN			10	1630	-	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)		444			Ligand-binding (By similarity).		A6NIP1|Q6IBU7	Missense_Mutation	SNP	ENST00000359842.5	37	c.1330G>T	CCDS1248.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.368836	0.82463	.	.	ENSG00000143171	ENST00000359842	T	0.72394	-0.65	4.62	4.62	0.57501	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.88937	0.6573	H	0.97806	4.08	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.92891	0.6331	9	0.87932	D	0	.	16.1865	0.81959	0.0:1.0:0.0:0.0	.	444	P48443	RXRG_HUMAN	W	444	ENSP00000352900:G444W	ENSP00000352900:G444W	G	-	1	0	RXRG	163637186	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.372000	0.79612	2.377000	0.81083	0.555000	0.69702	GGG		0.602	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2	NM_006917		41	114	1	0	4.01765e-15	0.002222	7.63987e-15	41	114				
F5	2153	broad.mit.edu	37	1	169510755	169510755	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:169510755G>T	ENST00000367797.3	-	13	3774	c.3573C>A	c.(3571-3573)agC>agA	p.S1191R	F5_ENST00000367796.3_Missense_Mutation_p.S1196R	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1191	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.S1191R(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GGGTCACCTGGCTGAGGTCTG	0.512																																							uc001ggg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(3571-3573)AGC>AGA		coagulation factor V precursor	Drotrecogin alfa(DB00055)						166.0	175.0	172.0					1																	169510755		2203	4300	6503	SO:0001583	missense	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169510755G>T	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3573C>A	1.37:g.169510755G>T	ENSP00000356771:p.Ser1191Arg						p.S1191R	NM_000130	NP_000121	P12259	FA5_HUMAN			13	3718	-	all_hematologic(923;0.208)		1191			2-1.|35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	c.3573C>A	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731249	0.48939	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.34072	1.38;1.38	5.49	-6.65	0.01795	.	1.093510	0.06879	N	0.802149	T	0.07638	0.0192	L	0.28115	0.83	0.21220	N	0.999751	P	0.45902	0.868	B	0.39876	0.312	T	0.12451	-1.0547	9	0.33940	T	0.23	0.2239	6.5651	0.22507	0.5211:0.0:0.2902:0.1886	.	1191	P12259	FA5_HUMAN	R	1191;1196	ENSP00000356771:S1191R;ENSP00000356770:S1196R	ENSP00000356770:S1196R	S	-	3	2	F5	167777379	0.210000	0.23517	0.000000	0.03702	0.083000	0.17756	0.388000	0.20735	-1.250000	0.02497	-0.181000	0.13052	AGC		0.512	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		102	313	1	0	8.27256e-43	0.00361	1.91179e-42	102	313				
TNN	63923	broad.mit.edu	37	1	175096160	175096160	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:175096160C>A	ENST00000239462.4	+	13	3097	c.2984C>A	c.(2983-2985)cCc>cAc	p.P995H		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	995	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.P995H(2)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACCTGGACGCCCCCCTCTGCT	0.502																																							uc001gkl.1		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2983-2985)CCC>CAC		tenascin N precursor							174.0	151.0	159.0					1																	175096160		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175096160C>A	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2984C>A	1.37:g.175096160C>A	ENSP00000239462:p.Pro995His						p.P995H	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	13	3097	+		Breast(1374;0.000962)	995			Fibronectin type-III 9.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2984C>A	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.991896	0.54041	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.61742	0.08	5.14	4.21	0.49690	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.170947	0.52532	D	0.000061	T	0.76905	0.4053	M	0.85373	2.75	0.32435	N	0.547511	D	0.65815	0.995	D	0.71184	0.972	D	0.84277	0.0492	10	0.87932	D	0	.	13.5267	0.61599	0.0:0.8432:0.1568:0.0	.	995	Q9UQP3	TENN_HUMAN	H	995;818	ENSP00000239462:P995H	ENSP00000239462:P995H	P	+	2	0	TNN	173362783	0.857000	0.29778	0.868000	0.34077	0.381000	0.30169	4.002000	0.57053	1.122000	0.41944	0.563000	0.77884	CCC		0.502	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		13	124	1	0	7.03913e-09	0.001368	1.09674e-08	13	124				
ASTN1	460	broad.mit.edu	37	1	176915238	176915238	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:176915238C>A	ENST00000367654.3	-	13	2308	c.2097G>T	c.(2095-2097)aaG>aaT	p.K699N	ASTN1_ENST00000361833.2_Missense_Mutation_p.K691N|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Missense_Mutation_p.K691N|ASTN1_ENST00000424564.2_Missense_Mutation_p.K691N	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	699	EGF-like 3.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.K691N(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CCACACCAAGCTTGTAGTCCT	0.517																																							uc001glc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(2071-2073)AAG>AAT		astrotactin isoform 1							103.0	89.0	94.0					1																	176915238		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176915238C>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2097G>T	1.37:g.176915238C>A	ENSP00000356626:p.Lys699Asn					ASTN1_uc001glb.1_Missense_Mutation_p.K691N|ASTN1_uc001gld.1_Missense_Mutation_p.K691N|ASTN1_uc009wwx.1_Missense_Mutation_p.K691N	p.K691N	NM_004319	NP_004310	O14525	ASTN1_HUMAN			13	2285	-			699			EGF-like 3.		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.2073G>T		.	.	.	.	.	.	.	.	.	.	C	17.31	3.357406	0.61293	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	D;D;D;D	0.96885	-2.26;-2.26;-4.16;-2.26	5.4	-0.934	0.10428	.	0.000000	0.85682	D	0.000000	D	0.95345	0.8489	L	0.27053	0.805	0.54753	D	0.999983	D;D;D	0.89917	1.0;0.989;0.989	D;D;D	0.83275	0.996;0.985;0.985	D	0.93000	0.6422	10	0.72032	D	0.01	-32.3537	10.9172	0.47144	0.0:0.4524:0.0:0.5476	.	699;691;691	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	N	691;691;699;691;691	ENSP00000356629:K691N;ENSP00000354536:K691N;ENSP00000356626:K699N;ENSP00000395041:K691N	ENSP00000354536:K691N	K	-	3	2	ASTN1	175181861	0.978000	0.34361	0.998000	0.56505	0.870000	0.49936	0.154000	0.16343	0.013000	0.14918	-0.136000	0.14681	AAG		0.517	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		20	97	1	0	0.00121646	0.008871	0.00148372	20	97				
BRINP3	339479	broad.mit.edu	37	1	190068080	190068080	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:190068080G>C	ENST00000367462.3	-	8	1600	c.1369C>G	c.(1369-1371)Cgc>Ggc	p.R457G	BRINP3_ENST00000534846.1_Missense_Mutation_p.R355G	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	457					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.R457G(1)									CAGCGGGTGCGGTTGTCTGGT	0.622																																							uc001gse.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(1369-1371)CGC>GGC		family with sequence similarity 5, member C							70.0	66.0	67.0					1																	190068080		2203	4300	6503	SO:0001583	missense	339479					extracellular region		g.chr1:190068080G>C	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1369C>G	1.37:g.190068080G>C	ENSP00000356432:p.Arg457Gly					FAM5C_uc010pot.1_Missense_Mutation_p.R355G	p.R457G	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN			8	1601	-	Prostate(682;0.198)		457					B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	c.1369C>G	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.087946	0.36855	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.41400	1.0;1.0	5.65	5.65	0.86999	Epidermal growth factor-like (1);	0.172374	0.52532	D	0.000063	T	0.31857	0.0810	N	0.19112	0.55	0.41827	D	0.99005	B;B	0.26483	0.15;0.026	B;B	0.28553	0.091;0.01	T	0.08086	-1.0739	10	0.26408	T	0.33	.	17.2216	0.86959	0.0:0.0:1.0:0.0	.	355;457	B7Z260;Q76B58	.;FAM5C_HUMAN	G	457;355	ENSP00000356432:R457G;ENSP00000438022:R355G	ENSP00000356432:R457G	R	-	1	0	FAM5C	188334703	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	5.650000	0.67944	2.656000	0.90262	0.591000	0.81541	CGC		0.622	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		24	113	0	0	0	0.002299	0	24	113				
CR1	1378	broad.mit.edu	37	1	207739213	207739213	+	Silent	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:207739213T>C	ENST00000367049.4	+	24	3897	c.3897T>C	c.(3895-3897)taT>taC	p.Y1299Y	CR1_ENST00000367053.1_Silent_p.Y849Y|CR1_ENST00000367052.1_Intron|CR1_ENST00000400960.2_Silent_p.Y849Y|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000367051.1_Silent_p.Y849Y	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	849	Sushi 20. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.Y854Y(1)|p.Y1299Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTGCTAGTTATTGTGTCTTGG	0.423																																							uc001hfy.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(2545-2547)TAT>TAC		complement receptor 1 isoform F precursor							267.0	238.0	247.0					1																	207739213		1840	4102	5942	SO:0001819	synonymous_variant	1378				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity	g.chr1:207739213T>C	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.3897T>C	1.37:g.207739213T>C						CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Silent_p.Y1299Y|CR1_uc009xck.1_Intron	p.Y849Y	NM_000573	NP_000564	P17927	CR1_HUMAN			16	2687	+			849			Extracellular (Potential).|Sushi 13.		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	ENST00000367049.4	37	c.2547T>C	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	t	6.811	0.518642	0.13005	.	.	ENSG00000203710	ENST00000529814	.	.	.	2.72	-5.44	0.02624	.	.	.	.	.	T	0.29783	0.0744	.	.	.	0.19300	N	0.999978	.	.	.	.	.	.	T	0.18555	-1.0333	4	.	.	.	.	8.6978	0.34307	0.0:0.6388:0.2146:0.1466	rs56229517	.	.	.	T	375	.	.	I	+	2	0	CR1	205805836	0.000000	0.05858	0.000000	0.03702	0.589000	0.36550	-7.561000	0.00034	-3.833000	0.00101	-2.885000	0.00097	ATT		0.423	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		13	166	0	0	0	0.001855	0	13	166				
RAB3GAP2	25782	broad.mit.edu	37	1	220406195	220406195	+	Silent	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:220406195T>C	ENST00000358951.2	-	2	242	c.126A>G	c.(124-126)acA>acG	p.T42T		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	42					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)	p.T42T(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CTTCCCAGTCTGTTGATTTAC	0.338																																							uc010puk.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(124-126)ACA>ACG		rab3 GTPase-activating protein, non-catalytic							180.0	166.0	171.0					1																	220406195		2203	4300	6503	SO:0001819	synonymous_variant	25782				intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity	g.chr1:220406195T>C	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.126A>G	1.37:g.220406195T>C						RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_5'UTR|RAB3GAP2_uc010pum.1_Silent_p.T42T	p.T42T	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN		GBM - Glioblastoma multiforme(131;0.0443)	2	290	-			42					A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Silent	SNP	ENST00000358951.2	37	c.126A>G	CCDS31028.1																																																																																				0.338	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414		13	94	0	0	0	0.001855	0	13	94				
TAF1A	9015	broad.mit.edu	37	1	222736579	222736579	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:222736579C>A	ENST00000352967.4	-	9	1209	c.1021G>T	c.(1021-1023)Gga>Tga	p.G341*	TAF1A_ENST00000366890.1_Nonsense_Mutation_p.G227*|TAF1A_ENST00000391882.1_Nonsense_Mutation_p.G227*|TAF1A_ENST00000350027.4_Nonsense_Mutation_p.G341*	NM_005681.3	NP_005672.1	Q15573	TAF1A_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa	341					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA binding (GO:0003677)	p.G341*(1)		kidney(3)|large_intestine(3)|lung(11)|urinary_tract(1)	18				GBM - Glioblastoma multiforme(131;0.0186)		TTAGTGCATCCGGCAAAATCT	0.333																																							uc009xdz.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1021-1023)GGA>TGA		TBP-associated factor 1A isoform 2							77.0	78.0	78.0					1																	222736579		2202	4297	6499	SO:0001587	stop_gained	9015				regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding	g.chr1:222736579C>A	L39060	CCDS1531.1, CCDS1532.1	1q42	2008-02-05	2002-08-29		ENSG00000143498	ENSG00000143498			11532	protein-coding gene	gene with protein product		604903	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kD"""			7801123	Standard	NM_005681		Approved	TAFI48, SL1	uc009xdz.2	Q15573	OTTHUMG00000037544	ENST00000352967.4:c.1021G>T	1.37:g.222736579C>A	ENSP00000327072:p.Gly341*					TAF1A_uc009xdy.1_Nonsense_Mutation_p.G32*|TAF1A_uc001hni.1_Nonsense_Mutation_p.G227*|TAF1A_uc001hnj.2_Nonsense_Mutation_p.G341*|TAF1A_uc001hnk.2_Nonsense_Mutation_p.G227*	p.G341*	NM_139352	NP_647603	Q15573	TAF1A_HUMAN		GBM - Glioblastoma multiforme(131;0.0186)	9	1210	-			341					B2RDZ8|D3DTB7|Q9NWA1	Nonsense_Mutation	SNP	ENST00000352967.4	37	c.1021G>T	CCDS1531.1	.	.	.	.	.	.	.	.	.	.	C	37	6.201987	0.97371	.	.	ENSG00000143498	ENST00000366890;ENST00000350027;ENST00000352967;ENST00000391882	.	.	.	6.04	6.04	0.98038	.	0.086995	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-8.2029	17.5116	0.87761	0.0:1.0:0.0:0.0	.	.	.	.	X	227;341;341;227	.	ENSP00000339976:G341X	G	-	1	0	TAF1A	220803202	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.325000	0.52030	2.873000	0.98535	0.563000	0.77884	GGA		0.333	TAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091493.2	NM_005681		12	58	1	0	1.08611e-07	0.000978	1.62412e-07	12	58				
RYR2	6262	broad.mit.edu	37	1	237656342	237656342	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:237656342G>T	ENST00000366574.2	+	19	2233	c.1916G>T	c.(1915-1917)gGa>gTa	p.G639V	RYR2_ENST00000360064.6_Missense_Mutation_p.G637V|RYR2_ENST00000542537.1_Missense_Mutation_p.G623V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	639	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.G637V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTCCTACCAGGAAGAGACTTG	0.438																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(1915-1917)GGA>GTA		cardiac muscle ryanodine receptor							126.0	127.0	127.0					1																	237656342		1994	4175	6169	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237656342G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1916G>T	1.37:g.237656342G>T	ENSP00000355533:p.Gly639Val						p.G639V	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		19	2036	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	639			Cytoplasmic (By similarity).|B30.2/SPRY 1.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.1916G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954902	0.53293	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97016	-4.21;-4.21;-4.21	6.16	6.16	0.99307	Intracellular calcium-release channel (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000008	D	0.97331	0.9127	M	0.66939	2.045	0.80722	D	1	D	0.53462	0.96	P	0.54815	0.761	D	0.97151	0.9831	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	639	Q92736	RYR2_HUMAN	V	639;637;623	ENSP00000355533:G639V;ENSP00000353174:G637V;ENSP00000443798:G623V	ENSP00000353174:G637V	G	+	2	0	RYR2	235722965	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	6.651000	0.74372	2.937000	0.99478	0.650000	0.86243	GGA		0.438	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		8	31	1	0	0.00307968	0.00308	0.00370021	8	31				
OR2M7	391196	broad.mit.edu	37	1	248486947	248486947	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:248486947G>T	ENST00000317965.2	-	1	952	c.924C>A	c.(922-924)ggC>ggA	p.G308G		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G308G(1)		breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTCCAGACTTGCCCTTTCCTA	0.378																																							uc010pzk.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(922-924)GGC>GGA		olfactory receptor, family 2, subfamily M,							62.0	62.0	62.0					1																	248486947		2203	4300	6503	SO:0001819	synonymous_variant	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248486947G>T	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.924C>A	1.37:g.248486947G>T							p.G308G	NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	924	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		308			Cytoplasmic (Potential).		B2RNL0|Q6IEX6	Silent	SNP	ENST00000317965.2	37	c.924C>A	CCDS31111.1																																																																																				0.378	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		14	53	1	0	4.7546e-09	0.004007	7.50482e-09	14	53				
OR2M7	391196	broad.mit.edu	37	1	248487446	248487446	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:248487446C>A	ENST00000317965.2	-	1	453	c.425G>T	c.(424-426)gGa>gTa	p.G142V		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G142V(1)		breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGTCATAAGTCCACAAATTTT	0.478																																							uc010pzk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(424-426)GGA>GTA		olfactory receptor, family 2, subfamily M,							217.0	222.0	220.0					1																	248487446		2203	4300	6503	SO:0001583	missense	391196				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248487446C>A	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.425G>T	1.37:g.248487446C>A	ENSP00000324557:p.Gly142Val						p.G142V	NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)		1	425	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		142			Helical; Name=4; (Potential).		B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	c.425G>T	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	C	2.974	-0.211878	0.06140	.	.	ENSG00000177186	ENST00000317965	T	0.35048	1.33	1.54	0.276	0.15663	GPCR, rhodopsin-like superfamily (1);	0.612210	0.12488	U	0.464490	T	0.17874	0.0429	N	0.16201	0.385	0.23361	N	0.997836	B	0.17038	0.02	B	0.20384	0.029	T	0.20207	-1.0282	10	0.28530	T	0.3	.	4.9308	0.13916	0.2205:0.5597:0.2198:0.0	.	142	Q8NG81	OR2M7_HUMAN	V	142	ENSP00000324557:G142V	ENSP00000324557:G142V	G	-	2	0	OR2M7	246554069	0.000000	0.05858	0.168000	0.22838	0.066000	0.16364	0.080000	0.14802	0.845000	0.35118	0.184000	0.17185	GGA		0.478	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		74	297	1	0	1.8615e-32	0.00361	4.24106e-32	74	297				
ARMC3	219681	broad.mit.edu	37	10	23244787	23244787	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:23244787C>A	ENST00000298032.5	+	4	302	c.218C>A	c.(217-219)aCt>aAt	p.T73N	ARMC3_ENST00000464017.1_3'UTR|ARMC3_ENST00000409049.3_Missense_Mutation_p.T73N|ARMC3_ENST00000409983.3_Missense_Mutation_p.T73N|ARMC3_ENST00000376528.4_5'UTR	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	73						extracellular vesicular exosome (GO:0070062)		p.T73N(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GAACCTTTAACTAAGCTACTC	0.348																																							uc001irm.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(217-219)ACT>AAT		armadillo repeat containing 3							101.0	98.0	99.0					10																	23244787		2203	4300	6503	SO:0001583	missense	219681						binding	g.chr10:23244787C>A	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.218C>A	10.37:g.23244787C>A	ENSP00000298032:p.Thr73Asn					ARMC3_uc010qcv.1_Missense_Mutation_p.T73N|ARMC3_uc010qcw.1_5'UTR|ARMC3_uc001irn.1_5'UTR	p.T73N	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN			4	301	+			73			ARM 2.		A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	c.218C>A	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	C	9.817	1.184715	0.21870	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049	T;T;T	0.69306	-0.39;-0.39;-0.39	5.36	3.46	0.39613	Armadillo-like helical (1);Armadillo-type fold (1);	0.358687	0.32785	N	0.005646	T	0.42607	0.1210	N	0.03608	-0.345	0.80722	D	1	B;P	0.48998	0.027;0.918	B;P	0.46585	0.037;0.521	T	0.25572	-1.0128	10	0.28530	T	0.3	-24.2014	5.742	0.18100	0.141:0.5452:0.2424:0.0714	.	73;73	Q5W041-4;Q5W041	.;ARMC3_HUMAN	N	73	ENSP00000298032:T73N;ENSP00000386943:T73N;ENSP00000387288:T73N	ENSP00000298032:T73N	T	+	2	0	ARMC3	23284793	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	2.329000	0.43876	0.726000	0.32339	-0.175000	0.13238	ACT		0.348	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081		8	49	1	0	1.12685e-05	0.004482	1.52456e-05	8	49				
ARMC3	219681	broad.mit.edu	37	10	23287230	23287230	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:23287230C>A	ENST00000298032.5	+	11	1413	c.1329C>A	c.(1327-1329)gcC>gcA	p.A443A	RNA5SP304_ENST00000411199.1_RNA|ARMC3_ENST00000409049.3_Silent_p.A443A|ARMC3_ENST00000409983.3_Silent_p.A443A|ARMC3_ENST00000376528.4_Silent_p.A180A	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	443						extracellular vesicular exosome (GO:0070062)		p.A443A(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TCATGCATGCCATCATCAGCC	0.542																																							uc001irm.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1327-1329)GCC>GCA		armadillo repeat containing 3							71.0	60.0	64.0					10																	23287230		2203	4300	6503	SO:0001819	synonymous_variant	219681						binding	g.chr10:23287230C>A	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1329C>A	10.37:g.23287230C>A						ARMC3_uc010qcv.1_Silent_p.A443A|ARMC3_uc010qcw.1_Silent_p.A180A	p.A443A	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN			11	1412	+			443			ARM 11.		A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Silent	SNP	ENST00000298032.5	37	c.1329C>A	CCDS7142.1																																																																																				0.542	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081		5	16	1	0	0.000602214	0.000602	0.000749664	5	16				
AGAP12P	414224	broad.mit.edu	37	10	49218470	49218470	+	IGR	SNP	C	C	T	rs201535362		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:49218470C>T								FAM25C (10652 upstream) : RNA5SP315 (30005 downstream)																							TCCTCATCAGCGGTGGCCCGC	0.617																																							uc001jgd.2		NA																	0					NA						c.(1669-1671)GCT>ACT		RecName: Full=Arf-GAP, GTPase, ANK repeat and PH domain-containing protein 11; AltName: Full=Centaurin-gamma-like protein KIAA1975;																																				SO:0001628	intergenic_variant	0							g.chr10:49218470C>T																													10.37:g.49218470C>T						uc001jge.1_5'Flank	p.A557T							8	1828	-									Missense_Mutation	SNP		37	c.1669G>A																																																																																				0	0.617									8	91	0	0	0	0.00308	0	8	91				
HKDC1	80201	broad.mit.edu	37	10	71010090	71010090	+	Missense_Mutation	SNP	C	C	T	rs370167561		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:71010090C>T	ENST00000354624.5	+	11	1748	c.1615C>T	c.(1615-1617)Cgg>Tgg	p.R539W	HKDC1_ENST00000395086.2_Missense_Mutation_p.R539W	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	539	Hexokinase type-1 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)	p.R539W(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						AACCAACTTCCGGGTCCTCCT	0.542																																							uc001jpf.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(1615-1617)CGG>TGG		hexokinase domain containing 1		C	TRP/ARG	0,4406		0,0,2203	125.0	130.0	129.0		1615	2.3	1.0	10		129	1,8599	1.2+/-3.3	0,1,4299	no	missense	HKDC1	NM_025130.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	539/918	71010090	1,13005	2203	4300	6503	SO:0001583	missense	80201				glycolysis	mitochondrion|nucleus	ATP binding|hexokinase activity	g.chr10:71010090C>T		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1615C>T	10.37:g.71010090C>T	ENSP00000346643:p.Arg539Trp					HKDC1_uc010qje.1_Missense_Mutation_p.R402W	p.R539W	NM_025130	NP_079406	Q2TB90	HKDC1_HUMAN			11	1748	+			539					B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	c.1615C>T	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648332	0.67358	0.0	1.16E-4	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.99730	-6.56;-6.56	5.09	2.27	0.28462	Hexokinase, N-terminal (1);	0.061993	0.64402	D	0.000005	D	0.99796	0.9913	H	0.99273	4.495	0.49213	D	0.999769	D	0.89917	1.0	D	0.97110	1.0	D	0.98023	1.0372	10	0.87932	D	0	-18.8117	5.6414	0.17567	0.1683:0.5974:0.0:0.2343	.	539	Q2TB90	HKDC1_HUMAN	W	539	ENSP00000346643:R539W;ENSP00000378521:R539W	ENSP00000346643:R539W	R	+	1	2	HKDC1	70680096	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	2.517000	0.45529	0.332000	0.23536	0.561000	0.74099	CGG		0.542	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130		22	208	0	0	0	0.001882	0	22	208				
MYOF	26509	broad.mit.edu	37	10	95066741	95066741	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:95066741C>A	ENST00000359263.4	-	54	6164	c.6165G>T	c.(6163-6165)aaG>aaT	p.K2055N	MYOF_ENST00000358334.5_Missense_Mutation_p.K2042N|MYOF_ENST00000371502.4_Missense_Mutation_p.K2045N|MYOF_ENST00000371501.4_Missense_Mutation_p.K2055N	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	2055					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)	p.K2055N(1)		NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GCTTTACAATCTTCATTGACA	0.348																																							uc001kin.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(6163-6165)AAG>AAT		myoferlin isoform a							150.0	147.0	148.0					10																	95066741		1866	4100	5966	SO:0001583	missense	26509				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding	g.chr10:95066741C>A	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.6165G>T	10.37:g.95066741C>A	ENSP00000352208:p.Lys2055Asn					MYOF_uc001kio.2_Missense_Mutation_p.K2042N|MYOF_uc009xue.2_RNA	p.K2055N	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN			54	6288	-			2055			Extracellular (Potential).		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	c.6165G>T	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554876	0.65425	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.9	5.19	3.34	0.38264	.	0.000000	0.85682	D	0.000000	D	0.91496	0.7315	M	0.79926	2.475	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.85130	0.994;0.997	D	0.91451	0.5181	10	0.59425	D	0.04	-23.5264	12.1499	0.54044	0.0:0.8753:0.0:0.1247	.	2042;2055	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	N	2042;2055;2055;2045	ENSP00000351094:K2042N;ENSP00000352208:K2055N;ENSP00000360556:K2055N;ENSP00000360557:K2045N	ENSP00000351094:K2042N	K	-	3	2	MYOF	95056731	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	3.368000	0.52357	0.900000	0.36469	0.644000	0.83932	AAG		0.348	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451		25	135	1	0	1.42536e-11	0.004656	2.46755e-11	25	135				
MYOF	26509	broad.mit.edu	37	10	95126285	95126285	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:95126285T>C	ENST00000359263.4	-	26	2616	c.2617A>G	c.(2617-2619)Aaa>Gaa	p.K873E	MYOF_ENST00000358334.5_Missense_Mutation_p.K860E|MYOF_ENST00000371502.4_Missense_Mutation_p.K873E|MYOF_ENST00000371501.4_Missense_Mutation_p.K873E	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	873					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)	p.K873E(1)		NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GTACCCCATTTTCCAAACATG	0.348																																							uc001kin.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(2617-2619)AAA>GAA		myoferlin isoform a							64.0	61.0	62.0					10																	95126285		1799	4065	5864	SO:0001583	missense	26509				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding	g.chr10:95126285T>C	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.2617A>G	10.37:g.95126285T>C	ENSP00000352208:p.Lys873Glu					MYOF_uc001kio.2_Missense_Mutation_p.K860E|MYOF_uc009xue.2_RNA	p.K873E	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN			26	2740	-			873			Cytoplasmic (Potential).		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	c.2617A>G	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.392874	0.83011	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.83837	-1.76;-1.76;-1.76;-1.77	5.5	5.5	0.81552	Ferlin/Peroxisome membrane (1);	0.094449	0.64402	D	0.000001	D	0.85035	0.5605	M	0.76002	2.32	0.80722	D	1	P;D	0.54772	0.712;0.968	P;P	0.46685	0.457;0.524	D	0.85588	0.1244	10	0.40728	T	0.16	-25.9812	15.7778	0.78236	0.0:0.0:0.0:1.0	.	860;873	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	E	860;873;873;873	ENSP00000351094:K860E;ENSP00000352208:K873E;ENSP00000360556:K873E;ENSP00000360557:K873E	ENSP00000351094:K860E	K	-	1	0	MYOF	95116275	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.482000	0.81143	2.313000	0.78055	0.454000	0.30748	AAA		0.348	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451		18	61	0	0	0	0.006122	0	18	61				
SLC35G1	159371	broad.mit.edu	37	10	95661109	95661109	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:95661109G>T	ENST00000427197.1	+	3	1021	c.960G>T	c.(958-960)atG>atT	p.M320I	SLC35G1_ENST00000371408.3_Missense_Mutation_p.M319I	NM_001134658.1|NM_153226.2	NP_001128130.1|NP_694958.1	Q2M3R5	S35G1_HUMAN	solute carrier family 35, member G1	320	EamA 2.				calcium ion export from cell (GO:1990034)|cytosolic calcium ion homeostasis (GO:0051480)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.M319I(1)									TGAAGACAATGGATGTGGTCT	0.403																																							uc001kjg.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(958-960)ATG>ATT		transmembrane protein 20 isoform 1							93.0	96.0	95.0					10																	95661109		2203	4300	6503	SO:0001583	missense	159371					integral to membrane		g.chr10:95661109G>T	AK091309	CCDS7432.1, CCDS44459.1	10q23.33	2013-05-22	2011-08-03	2011-08-03	ENSG00000176273	ENSG00000176273		"""Solute carriers"""	26607	protein-coding gene	gene with protein product			"""transmembrane protein 20"""	TMEM20		21569384	Standard	NM_153226		Approved	FLJ33990, C10orf60	uc001kjg.2	Q2M3R5	OTTHUMG00000018779	ENST00000427197.1:c.960G>T	10.37:g.95661109G>T	ENSP00000400932:p.Met320Ile					TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Missense_Mutation_p.M319I|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Missense_Mutation_p.M303I|TMEM20_uc001kjj.2_Intron	p.M320I	NM_001134658	NP_001128130	Q2M3R5	TMM20_HUMAN		STAD - Stomach adenocarcinoma(243;0.00345)	3	1021	+		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)	320			Helical; (Potential).|DUF6 2.		Q86YG5|Q8NBA5	Missense_Mutation	SNP	ENST00000427197.1	37	c.960G>T	CCDS44459.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558301	0.65538	.	.	ENSG00000176273	ENST00000371408;ENST00000427197	T;T	0.47869	0.83;0.83	6.06	5.16	0.70880	.	0.121633	0.85682	D	0.000000	T	0.54838	0.1883	L	0.58101	1.795	0.49483	D	0.999794	B;B;B	0.33528	0.416;0.372;0.05	P;B;B	0.46208	0.507;0.216;0.037	T	0.49273	-0.8957	10	0.16896	T	0.51	.	15.4757	0.75478	0.0662:0.0:0.9338:0.0	.	303;320;319	B7ZKP0;Q2M3R5;Q2M3R5-2	.;S35G1_HUMAN;.	I	319;320	ENSP00000360462:M319I;ENSP00000400932:M320I	ENSP00000360462:M319I	M	+	3	0	SLC35G1	95651099	1.000000	0.71417	0.999000	0.59377	0.852000	0.48524	6.257000	0.72480	1.577000	0.49804	0.650000	0.86243	ATG		0.403	SLC35G1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_153226		8	76	1	0	1.12685e-05	0.004482	1.52456e-05	8	76				
HELLS	3070	broad.mit.edu	37	10	96333850	96333850	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:96333850A>G	ENST00000348459.5	+	8	716	c.611A>G	c.(610-612)aAg>aGg	p.K204R	HELLS_ENST00000394044.1_Missense_Mutation_p.K204R|HELLS_ENST00000394036.1_3'UTR|HELLS_ENST00000239026.6_3'UTR|HELLS_ENST00000394045.1_Missense_Mutation_p.K204R|HELLS_ENST00000371332.4_Missense_Mutation_p.K204R	NM_018063.3	NP_060533.2			helicase, lymphoid-specific									p.K204R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		CCAGTCCGGAAGTGTAATGGT	0.393																																							uc001kjt.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)	2						c.(610-612)AAG>AGG		helicase, lymphoid-specific							143.0	143.0	143.0					10																	96333850		2203	4300	6503	SO:0001583	missense	3070				cell division|centromeric heterochromatin formation|lymphocyte proliferation|maintenance of DNA methylation|methylation-dependent chromatin silencing|mitosis|transcription, DNA-dependent	centromeric heterochromatin|nucleus	ATP binding|DNA binding|helicase activity	g.chr10:96333850A>G	AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.611A>G	10.37:g.96333850A>G	ENSP00000239027:p.Lys204Arg					HELLS_uc001kjs.2_Missense_Mutation_p.K188R|HELLS_uc009xul.2_Missense_Mutation_p.K204R|HELLS_uc009xum.2_Missense_Mutation_p.K204R|HELLS_uc009xun.2_Missense_Mutation_p.K80R|HELLS_uc009xuo.2_Missense_Mutation_p.K204R|HELLS_uc001kju.2_5'UTR|HELLS_uc009xup.2_RNA|HELLS_uc009xuq.2_Missense_Mutation_p.K66R|HELLS_uc009xur.2_RNA	p.K204R	NM_018063	NP_060533	Q9NRZ9	HELLS_HUMAN		all cancers(201;2.13e-05)	8	716	+		Colorectal(252;0.0429)	204						Missense_Mutation	SNP	ENST00000348459.5	37	c.611A>G	CCDS7434.1	.	.	.	.	.	.	.	.	.	.	A	8.379	0.837068	0.16891	.	.	ENSG00000119969	ENST00000419900;ENST00000348459;ENST00000394045;ENST00000394044;ENST00000371332	T;T;D;T	0.93426	0.54;0.54;-3.22;0.54	5.63	5.63	0.86233	.	0.092494	0.64402	D	0.000001	D	0.90577	0.7046	L	0.32530	0.975	0.80722	D	1	B;B;B;B;B	0.31680	0.006;0.014;0.2;0.335;0.044	B;B;B;B;B	0.37833	0.012;0.022;0.051;0.259;0.017	D	0.89187	0.3548	10	0.40728	T	0.16	-19.2864	15.0103	0.71545	1.0:0.0:0.0:0.0	.	188;204;204;204;204	Q9NRZ9-2;Q6I7N8;Q9NRZ9-6;Q9NRZ9-5;Q9NRZ9	.;.;.;.;HELLS_HUMAN	R	188;204;204;204;204	ENSP00000239027:K204R;ENSP00000377609:K204R;ENSP00000377608:K204R;ENSP00000360383:K204R	ENSP00000239027:K204R	K	+	2	0	HELLS	96323840	1.000000	0.71417	1.000000	0.80357	0.040000	0.13550	2.660000	0.46749	2.130000	0.65690	0.528000	0.53228	AAG		0.393	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1	NM_018063		32	170	0	0	0	0.002836	0	32	170				
FAM45A	404636	broad.mit.edu	37	10	120877099	120877099	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:120877099T>A	ENST00000361432.2	+	4	427	c.401T>A	c.(400-402)aTa>aAa	p.I134K	FAM45A_ENST00000535029.1_Missense_Mutation_p.I134K|FAM45A_ENST00000489988.1_3'UTR|FAM45A_ENST00000544016.1_Intron	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	134								p.I134K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		ACAAAGGGGATATGCCAGAGT	0.433																																							uc001ldw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(400-402)ATA>AAA		hypothetical protein LOC404636							125.0	126.0	125.0					10																	120877099		2203	4297	6500	SO:0001583	missense	404636							g.chr10:120877099T>A	AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.401T>A	10.37:g.120877099T>A	ENSP00000354688:p.Ile134Lys					FAM45A_uc010qsv.1_Missense_Mutation_p.I126K|FAM45A_uc010qsw.1_Intron|FAM45A_uc010qsx.1_RNA|FAM45A_uc010qsy.1_Missense_Mutation_p.I61K|FAM45A_uc010qsz.1_Missense_Mutation_p.I23K	p.I134K	NM_207009	NP_996892	Q8TCE6	FA45A_HUMAN		all cancers(201;0.0293)	4	445	+		Lung NSC(174;0.094)|all_lung(145;0.123)	134					B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	ENST00000361432.2	37	c.401T>A	CCDS7609.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008460	0.75046	.	.	ENSG00000119979	ENST00000535029;ENST00000546291;ENST00000361432	.	.	.	5.86	4.73	0.59995	.	0.294648	0.40640	N	0.001045	T	0.51278	0.1665	L	0.54323	1.7	0.80722	D	1	P;D;P	0.57899	0.839;0.981;0.913	B;P;B	0.47528	0.347;0.549;0.347	T	0.47262	-0.9131	9	0.32370	T	0.25	.	10.3222	0.43773	0.0:0.0739:0.0:0.9261	.	61;126;134	B4DNL9;Q8TCE6-2;Q8TCE6	.;.;FA45A_HUMAN	K	134	.	ENSP00000354688:I134K	I	+	2	0	FAM45A	120867089	1.000000	0.71417	0.955000	0.39395	0.994000	0.84299	4.465000	0.60141	1.055000	0.40461	0.477000	0.44152	ATA		0.433	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1	NM_207009		26	137	0	0	0	0.004656	0	26	137				
PAOX	196743	broad.mit.edu	37	10	135203244	135203244	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr10:135203244G>T	ENST00000278060.5	+	6	1468	c.1385G>T	c.(1384-1386)gGc>gTc	p.G462V	PAOX_ENST00000480071.2_Intron|PAOX_ENST00000368539.4_3'UTR|PAOX_ENST00000368535.2_3'UTR|RP11-108K14.8_ENST00000468317.2_5'Flank|PAOX_ENST00000357296.3_Intron	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	600					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)	p.G462V(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		GACGGCGCCGGCGCCCAGGTA	0.736																																							uc001lmv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1384-1386)GGC>GTC		polyamine oxidase isoform 1							13.0	15.0	14.0					10																	135203244		2185	4270	6455	SO:0001583	missense	196743				polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity	g.chr10:135203244G>T	BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.1385G>T	10.37:g.135203244G>T	ENSP00000278060:p.Gly462Val					PAOX_uc001lmw.2_Intron|PAOX_uc001lmx.2_Intron|PAOX_uc001lmy.2_Intron|PAOX_uc001lmz.2_RNA|PAOX_uc001lna.2_RNA|PAOX_uc001lnb.2_RNA|PAOX_uc001lnc.2_RNA	p.G462V	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)	6	1465	+		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)	600					D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Missense_Mutation	SNP	ENST00000278060.5	37	c.1385G>T	CCDS7683.1	.	.	.	.	.	.	.	.	.	.	N	10.51	1.370126	0.24771	.	.	ENSG00000148832	ENST00000368542;ENST00000368538;ENST00000278060	T	0.34859	1.34	4.94	-8.33	0.00992	.	2.441780	0.01085	N	0.005078	T	0.35335	0.0928	M	0.76170	2.325	0.09310	N	0.999995	B	0.32071	0.355	B	0.29524	0.103	T	0.28202	-1.0051	10	0.28530	T	0.3	0.6066	11.5809	0.50891	0.1623:0.0:0.7308:0.1069	.	462	Q6QHF9-2	.	V	414;183;462	ENSP00000278060:G462V	ENSP00000278060:G462V	G	+	2	0	PAOX	135053234	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.892000	0.28322	-1.257000	0.02475	-0.982000	0.02568	GGC		0.736	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051146.2	NM_152911		4	30	1	0	0.000602214	0.000602	0.000749664	4	30				
OR51E2	81285	broad.mit.edu	37	11	4703764	4703764	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:4703764G>A	ENST00000396950.3	-	2	417	c.178C>T	c.(178-180)Ctc>Ttc	p.L60F		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	60					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)	p.L60F(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		CAGAGAAAGAGGTACATCGGA	0.507																																							uc001lzk.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|ovary(2)	5						c.(178-180)CTC>TTC		olfactory receptor, family 51, subfamily E,							115.0	96.0	103.0					11																	4703764		2201	4298	6499	SO:0001583	missense	81285				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4703764G>A	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.178C>T	11.37:g.4703764G>A	ENSP00000380153:p.Leu60Phe						p.L60F	NM_030774	NP_110401	Q9H255	O51E2_HUMAN		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)	2	422	-		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	60			Helical; Name=2; (Potential).		B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	c.178C>T	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417184	0.25552	.	.	ENSG00000167332	ENST00000396950;ENST00000532598	T;T	0.01947	6.78;4.54	5.0	3.09	0.35607	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41823	D	0.000813	T	0.01156	0.0038	N	0.02708	-0.52	0.31749	N	0.63485	B	0.15719	0.014	B	0.16289	0.015	T	0.26985	-1.0087	10	0.51188	T	0.08	.	5.899	0.18955	0.1697:0.1602:0.6701:0.0	.	60	Q9H255	O51E2_HUMAN	F	60	ENSP00000380153:L60F;ENSP00000432644:L60F	ENSP00000380153:L60F	L	-	1	0	OR51E2	4660340	0.679000	0.27596	1.000000	0.80357	0.966000	0.64601	0.642000	0.24735	0.677000	0.31305	0.655000	0.94253	CTC		0.507	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774		18	73	0	0	0	0.00499	0	18	73				
CNGA4	1262	broad.mit.edu	37	11	6260974	6260974	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:6260974G>T	ENST00000379936.2	+	3	340	c.225G>T	c.(223-225)acG>acT	p.T75T	CNGA4_ENST00000533426.1_Silent_p.T35T	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	75					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.T75T(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGACTACACGAGTGACCTGC	0.537																																							uc001mco.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(223-225)ACG>ACT		cyclic nucleotide gated channel alpha 4							136.0	112.0	121.0					11																	6260974		2201	4296	6497	SO:0001819	synonymous_variant	1262				response to stimulus|sensory perception of smell		cAMP binding	g.chr11:6260974G>T	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.225G>T	11.37:g.6260974G>T						CNGA4_uc010raa.1_Silent_p.T35T|CNGA4_uc001mcn.2_Silent_p.T35T	p.T75T	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)	3	332	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	75			Helical; Name=H2; (Potential).			Silent	SNP	ENST00000379936.2	37	c.225G>T	CCDS31408.1																																																																																				0.537	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329		6	20	1	0	2.0095e-06	0.001984	2.79708e-06	6	20				
NLRP10	338322	broad.mit.edu	37	11	7981773	7981773	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:7981773G>T	ENST00000328600.2	-	2	1547	c.1386C>A	c.(1384-1386)taC>taA	p.Y462*		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	462	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)	p.Y462*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GGCGGAAGCTGTAGAACTTCT	0.507																																							uc001mfv.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9						c.(1384-1386)TAC>TAA		NLR family, pyrin domain containing 10							102.0	114.0	110.0					11																	7981773		2201	4296	6497	SO:0001587	stop_gained	338322						ATP binding	g.chr11:7981773G>T	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1386C>A	11.37:g.7981773G>T	ENSP00000327763:p.Tyr462*						p.Y462*	NM_176821	NP_789791	Q86W26	NAL10_HUMAN		Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	1403	-			462			NACHT.		Q2M3C4|Q6JGT0	Nonsense_Mutation	SNP	ENST00000328600.2	37	c.1386C>A	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.533643	0.64972	.	.	ENSG00000182261	ENST00000328600	.	.	.	4.86	-1.97	0.07503	.	0.000000	0.36893	N	0.002350	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.6675	0.39994	0.5533:0.0:0.4467:0.0	.	.	.	.	X	462	.	ENSP00000327763:Y462X	Y	-	3	2	NLRP10	7938349	0.994000	0.37717	0.652000	0.29579	0.035000	0.12851	0.197000	0.17197	-0.310000	0.08766	-0.137000	0.14449	TAC		0.507	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		24	146	1	0	3.7963e-18	0.00333	7.86959e-18	24	146				
IPO7	10527	broad.mit.edu	37	11	9438673	9438673	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:9438673T>C	ENST00000379719.3	+	6	846	c.704T>C	c.(703-705)gTt>gCt	p.V235A		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	235					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)	p.V235A(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		TTAAAGACTGTTGTGAACAGG	0.294																																							uc001mho.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(703-705)GTT>GCT		importin 7							128.0	133.0	131.0					11																	9438673		2201	4291	6492	SO:0001583	missense	10527				interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity	g.chr11:9438673T>C	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.704T>C	11.37:g.9438673T>C	ENSP00000369042:p.Val235Ala						p.V235A	NM_006391	NP_006382	O95373	IPO7_HUMAN		all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)	6	846	+			235					A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	37	c.704T>C	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.614345	0.66672	.	.	ENSG00000205339	ENST00000379719	T	0.66815	-0.23	5.58	4.45	0.53987	Armadillo-like helical (1);Armadillo-type fold (1);Exportin/Importin, Cse1-like (1);	0.053822	0.64402	D	0.000001	T	0.67571	0.2907	M	0.64260	1.97	0.58432	D	0.999999	B	0.30361	0.277	B	0.37731	0.257	T	0.66035	-0.6023	10	0.48119	T	0.1	.	12.9899	0.58612	0.0:0.0:0.1351:0.8649	.	235	O95373	IPO7_HUMAN	A	235	ENSP00000369042:V235A	ENSP00000369042:V235A	V	+	2	0	IPO7	9395249	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.281000	0.72632	0.960000	0.38005	-0.271000	0.10264	GTT		0.294	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391		18	87	0	0	0	0.001523	0	18	87				
IGSF22	283284	broad.mit.edu	37	11	18745745	18745745	+	Missense_Mutation	SNP	G	G	T	rs369906074		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:18745745G>T	ENST00000513874.1	-	2	178	c.39C>A	c.(37-39)caC>caA	p.H13Q	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	13								p.H13Q(2)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CCATGGACACGTGCTCCTGCA	0.597																																							uc009yht.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|kidney(1)	7						c.(37-39)CAC>CAA		immunoglobulin superfamily, member 22							136.0	142.0	140.0					11																	18745745		2141	4248	6389	SO:0001583	missense	283284							g.chr11:18745745G>T	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.39C>A	11.37:g.18745745G>T	ENSP00000421191:p.His13Gln					IGSF22_uc001mpa.2_RNA	p.H13Q	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN			2	229	-			13					A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	37	c.39C>A	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620160	0.66787	.	.	ENSG00000179057	ENST00000513874	T	0.50548	0.74	5.57	-1.39	0.08997	.	0.185330	0.25968	N	0.027159	T	0.22003	0.0530	N	0.14661	0.345	0.22171	N	0.999316	B	0.14805	0.011	B	0.09377	0.004	T	0.14144	-1.0483	10	0.18710	T	0.47	.	6.1284	0.20192	0.5284:0.0:0.3435:0.1281	.	13	D6RGV7	.	Q	13	ENSP00000421191:H13Q	ENSP00000322422:H13Q	H	-	3	2	IGSF22	18702321	0.011000	0.17503	0.893000	0.35052	0.986000	0.74619	-0.026000	0.12392	-0.122000	0.11766	-0.367000	0.07326	CAC		0.597	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588		27	120	1	0	1.17739e-12	0.005443	2.12194e-12	27	120				
NAV2	89797	broad.mit.edu	37	11	19735466	19735466	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:19735466G>T	ENST00000396087.3	+	1	324	c.225G>T	c.(223-225)ccG>ccT	p.P75P	NAV2_ENST00000360655.4_Intron|RP11-359E10.1_ENST00000603468.1_lincRNA|NAV2_ENST00000349880.4_Silent_p.P75P|NAV2_ENST00000396085.1_Silent_p.P75P	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	75					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)	p.P75P(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						AGGGGCTCCCGCTGCGGAAGA	0.602																																							uc010rdm.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(1)|pancreas(1)	6						c.(223-225)CCG>CCT		neuron navigator 2 isoform 2							25.0	29.0	28.0					11																	19735466		2199	4293	6492	SO:0001819	synonymous_variant	89797					nucleus	ATP binding|helicase activity	g.chr11:19735466G>T	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.225G>T	11.37:g.19735466G>T						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Silent_p.P75P|LOC100126784_uc010rdl.1_3'UTR	p.P75P	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN			1	586	+			75					A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	c.225G>T	CCDS58126.1																																																																																				0.602	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117		10	48	1	0	2.74318e-10	0.006214	4.60054e-10	10	48				
ANO3	63982	broad.mit.edu	37	11	26664731	26664731	+	Silent	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:26664731T>C	ENST00000256737.3	+	23	3130	c.2278T>C	c.(2278-2280)Ttg>Ctg	p.L760L	ANO3_ENST00000531568.1_Silent_p.L614L|ANO3_ENST00000537978.1_Silent_p.L744L|ANO3_ENST00000525139.1_Silent_p.L744L	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	760					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)	p.L760L(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TTTTGCAGTTTTGCAATTTGG	0.343																																							uc001mqt.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(2278-2280)TTG>CTG		transmembrane protein 16C							112.0	98.0	103.0					11																	26664731		2203	4299	6502	SO:0001819	synonymous_variant	63982					chloride channel complex	chloride channel activity	g.chr11:26664731T>C	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.2278T>C	11.37:g.26664731T>C						ANO3_uc010rdr.1_Silent_p.L744L|ANO3_uc010rds.1_Silent_p.L599L|ANO3_uc010rdt.1_Silent_p.L614L	p.L760L	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN			23	2423	+			760			Extracellular (Potential).		B7Z3F5	Silent	SNP	ENST00000256737.3	37	c.2278T>C	CCDS31447.1																																																																																				0.343	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418		24	86	0	0	0	0.003954	0	24	86				
SYT13	57586	broad.mit.edu	37	11	45275883	45275883	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:45275883T>C	ENST00000020926.3	-	3	593	c.482A>G	c.(481-483)aAa>aGa	p.K161R	CTD-2560E9.5_ENST00000534342.1_RNA|CTD-2560E9.5_ENST00000531663.1_RNA	NM_001247987.1|NM_020826.2	NP_001234916.1|NP_065877.1	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	161					vesicle-mediated transport (GO:0016192)	integral component of plasma membrane (GO:0005887)|transport vesicle (GO:0030133)		p.K161R(1)		breast(1)|large_intestine(3)|lung(16)|ovary(1)|skin(2)	23						GTAGTGGAGTTTGGGGGCCTG	0.517																																							uc001myq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(481-483)AAA>AGA		synaptotagmin XIII							140.0	116.0	124.0					11																	45275883		2203	4299	6502	SO:0001583	missense	57586					transport vesicle		g.chr11:45275883T>C	AB037848	CCDS31470.1	11p12-p11	2013-01-21			ENSG00000019505	ENSG00000019505		"""Synaptotagmins"""	14962	protein-coding gene	gene with protein product		607716				11171101	Standard	NM_020826		Approved	KIAA1427	uc001myq.2	Q7L8C5	OTTHUMG00000166504	ENST00000020926.3:c.482A>G	11.37:g.45275883T>C	ENSP00000020926:p.Lys161Arg					SYT13_uc009yku.1_Missense_Mutation_p.K17R	p.K161R	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN			3	608	-			161			Cytoplasmic (Potential).		A8K4P4|D3DQP1|Q9BQS3|Q9H041|Q9P2C0	Missense_Mutation	SNP	ENST00000020926.3	37	c.482A>G	CCDS31470.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.2|25.2	4.614273|4.614273	0.87359|0.87359	.|.	.|.	ENSG00000019505|ENSG00000019505	ENST00000020926|ENST00000528101	T|.	0.07800|.	3.16|.	5.57|5.57	5.57|5.57	0.84162|0.84162	C2 calcium/lipid-binding domain, CaLB (1);|.	0.054398|.	0.64402|.	D|.	0.000001|.	T|T	0.51736|0.51736	0.1692|0.1692	N|N	0.19112|0.19112	0.55|0.55	0.46167|0.46167	D|D	0.998907|0.998907	B|.	0.31485|.	0.325|.	B|.	0.31191|.	0.125|.	T|T	0.48703|0.48703	-0.9012|-0.9012	10|5	0.20519|.	T|.	0.43|.	.|.	16.0347|16.0347	0.80617|0.80617	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	161|.	Q7L8C5|.	SYT13_HUMAN|.	R|D	161|121	ENSP00000020926:K161R|.	ENSP00000020926:K161R|.	K|N	-|-	2|1	0|0	SYT13|SYT13	45232459|45232459	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.180000|5.180000	0.65048|0.65048	2.248000|2.248000	0.74166|0.74166	0.533000|0.533000	0.62120|0.62120	AAA|AAC		0.517	SYT13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390110.1	NM_020826		15	42	0	0	0	0.003163	0	15	42				
MAPK8IP1	9479	broad.mit.edu	37	11	45924235	45924235	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:45924235G>T	ENST00000241014.2	+	5	1087	c.917G>T	c.(916-918)cGg>cTg	p.R306L	MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.R296L	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	306	Interaction with MAP3K7.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)	p.R306L(2)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		ACTGAGAGCCGGATGTCAGTC	0.667																																							uc001nbr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|breast(1)|skin(1)	4						c.(916-918)CGG>CTG		mitogen-activated protein kinase 8 interacting							19.0	23.0	21.0					11																	45924235		2203	4299	6502	SO:0001583	missense	9479				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity	g.chr11:45924235G>T		CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.917G>T	11.37:g.45924235G>T	ENSP00000241014:p.Arg306Leu						p.R306L	NM_005456	NP_005447	Q9UQF2	JIP1_HUMAN		GBM - Glioblastoma multiforme(35;0.231)	5	1087	+			306					D3DQP4|O43407	Missense_Mutation	SNP	ENST00000241014.2	37	c.917G>T	CCDS7916.1	.	.	.	.	.	.	.	.	.	.	G	19.63	3.863030	0.71949	.	.	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.41400	1.0;1.02	4.58	4.58	0.56647	.	0.058859	0.64402	D	0.000002	T	0.53867	0.1823	L	0.29908	0.895	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.58381	-0.7646	10	0.66056	D	0.02	-27.4477	17.9065	0.88919	0.0:0.0:1.0:0.0	.	306	Q9UQF2	JIP1_HUMAN	L	306;296	ENSP00000241014:R306L;ENSP00000378991:R296L	ENSP00000241014:R306L	R	+	2	0	MAPK8IP1	45880811	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.907000	0.75724	2.541000	0.85698	0.561000	0.74099	CGG		0.667	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456		5	36	1	0	1.23904e-05	0.000602	1.66701e-05	5	36				
OR4A47	403253	broad.mit.edu	37	11	48510784	48510785	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:48510784_48510785GG>TT	ENST00000446524.1	+	1	516_517	c.440_441GG>TT	c.(439-441)tGG>tTT	p.W147F		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W147F(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						GTAGTGTCCTGGGTTGGAGGAT	0.441																																							uc010rhx.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(439-441)TGG>TTT		olfactory receptor, family 4, subfamily A,																																				SO:0001583	missense	403253				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48510784_48510785GG>TT	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	Exception_encountered	11.37:g.48510784_48510785delinsTT	ENSP00000412752:p.Trp147Phe						p.W147F	NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN			1	440_441	+			147			Helical; Name=4; (Potential).			Missense_Mutation	DNP	ENST00000446524.1	37	c.440_441GG>TT	CCDS31490.1																																																																																				0.441	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512		22	98	0	0	0	0.004672	0	22	98				
FOLH1	2346	broad.mit.edu	37	11	49175441	49175441	+	Missense_Mutation	SNP	C	C	A	rs566020349		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:49175441C>A	ENST00000256999.2	-	17	2187	c.1927G>T	c.(1927-1929)Gct>Tct	p.A643S	FOLH1_ENST00000533034.1_Missense_Mutation_p.A628S|FOLH1_ENST00000340334.7_Missense_Mutation_p.A628S|FOLH1_ENST00000343844.4_Missense_Mutation_p.A335S|FOLH1_ENST00000356696.3_Missense_Mutation_p.A643S	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	643					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.A643S(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	AACTTGGAAGCAATTTCTGTA	0.313																																							uc001ngy.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)|skin(1)	3						c.(1927-1929)GCT>TCT		folate hydrolase 1 isoform 1	Capromab(DB00089)|L-Glutamic Acid(DB00142)						84.0	85.0	85.0					11																	49175441		2200	4295	6495	SO:0001583	missense	2346				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity	g.chr11:49175441C>A	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1927G>T	11.37:g.49175441C>A	ENSP00000256999:p.Ala643Ser					FOLH1_uc001ngx.2_Missense_Mutation_p.A75S|FOLH1_uc001ngz.2_Missense_Mutation_p.A643S|FOLH1_uc009yly.2_Missense_Mutation_p.A628S|FOLH1_uc009ylz.2_Missense_Mutation_p.A628S|FOLH1_uc009yma.2_Missense_Mutation_p.A335S	p.A643S	NM_004476	NP_004467	Q04609	FOLH1_HUMAN			17	2188	-			643			Extracellular (Probable).		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	c.1927G>T	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.549752	0.45383	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000343844;ENST00000533034	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	3.79	2.86	0.33363	Transferrin receptor-like, dimerisation domain (3);	0.211412	0.32655	N	0.005805	T	0.43612	0.1255	M	0.69248	2.105	0.44807	D	0.99781	B;B;P;B;P	0.36712	0.155;0.041;0.538;0.1;0.566	B;B;B;B;B	0.42188	0.121;0.127;0.379;0.346;0.332	T	0.48305	-0.9047	10	0.56958	D	0.05	.	8.9922	0.36030	0.0:0.8834:0.0:0.1166	.	628;628;643;643;58	Q04609-9;Q04609-7;Q04609-8;Q04609;Q04609-3	.;.;.;FOLH1_HUMAN;.	S	643;643;628;335;628	ENSP00000256999:A643S;ENSP00000349129:A643S;ENSP00000344131:A628S;ENSP00000344086:A335S;ENSP00000431463:A628S	ENSP00000256999:A643S	A	-	1	0	FOLH1	49132017	0.991000	0.36638	1.000000	0.80357	0.823000	0.46562	1.212000	0.32394	2.131000	0.65755	0.536000	0.68110	GCT		0.313	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476		10	66	1	0	7.48243e-07	0.006214	1.06608e-06	10	66				
OR5L1	219437	broad.mit.edu	37	11	55579627	55579627	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:55579627G>T	ENST00000333973.2	+	1	774	c.685G>T	c.(685-687)Ggc>Tgc	p.G229C		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G229C(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CCTGAAGATGGGCTCTGCAGA	0.512																																							uc001nhw.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(2)	5						c.(685-687)GGC>TGC		olfactory receptor, family 5, subfamily L,							191.0	157.0	168.0					11																	55579627		2200	4296	6496	SO:0001583	missense	219437				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55579627G>T	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.685G>T	11.37:g.55579627G>T	ENSP00000335529:p.Gly229Cys						p.G229C	NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN			1	685	+		all_epithelial(135;0.208)	229			Cytoplasmic (Potential).		B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	37	c.685G>T	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	g	12.34	1.909167	0.33721	.	.	ENSG00000186117	ENST00000333973	T	0.37915	1.17	4.12	-0.553	0.11815	GPCR, rhodopsin-like superfamily (1);	1.198190	0.05911	N	0.631604	T	0.18593	0.0446	N	0.11698	0.16	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26189	-1.0110	10	0.59425	D	0.04	-0.0013	1.5197	0.02513	0.3917:0.3129:0.1294:0.1661	.	229	Q8NGL2	OR5L1_HUMAN	C	229	ENSP00000335529:G229C	ENSP00000335529:G229C	G	+	1	0	OR5L1	55336203	0.000000	0.05858	0.016000	0.15963	0.836000	0.47400	0.111000	0.15458	-0.072000	0.12864	-0.803000	0.03203	GGC		0.512	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738		30	117	1	0	3.1745e-13	0.008361	5.82997e-13	30	117				
HNRNPUL2	221092	broad.mit.edu	37	11	62490080	62490080	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:62490080C>A	ENST00000301785.5	-	6	1280	c.1088G>T	c.(1087-1089)tGc>tTc	p.C363F	HNRNPUL2-BSCL2_ENST00000403734.2_Missense_Mutation_p.C363F	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	363	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.C363F(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TACAGCAAAGCAGCCAATAAC	0.453																																							uc001nuw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1087-1089)TGC>TTC		heterogeneous nuclear ribonucleoprotein U-like							113.0	104.0	107.0					11																	62490080		1942	4136	6078	SO:0001583	missense	221092				cell killing	nucleus	ATP binding|nucleic acid binding	g.chr11:62490080C>A		CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.1088G>T	11.37:g.62490080C>A	ENSP00000301785:p.Cys363Phe					HNRNPUL2_uc001nuu.1_RNA	p.C363F	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN			6	1281	-			363			B30.2/SPRY.		Q8N3B3	Missense_Mutation	SNP	ENST00000301785.5	37	c.1088G>T	CCDS41659.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.614281	0.66672	.	.	ENSG00000214753	ENST00000301785	T	0.74002	-0.8	5.3	4.38	0.52667	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.105155	0.64402	N	0.000003	D	0.86176	0.5870	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88150	0.2850	10	0.87932	D	0	-13.0005	13.0888	0.59156	0.1616:0.8384:0.0:0.0	.	363	Q1KMD3	HNRL2_HUMAN	F	363	ENSP00000301785:C363F	ENSP00000301785:C363F	C	-	2	0	HNRNPUL2	62246656	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.651000	0.83577	1.437000	0.47472	-0.188000	0.12872	TGC		0.453	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396208.2	XM_495877		8	64	1	0	5.4927e-09	0.004482	8.61356e-09	8	64				
PC	5091	broad.mit.edu	37	11	66631269	66631269	+	Silent	SNP	C	C	A	rs148281644	byFrequency	TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:66631269C>A	ENST00000393958.2	-	11	1437	c.1344G>T	c.(1342-1344)gcG>gcT	p.A448A	PC_ENST00000355677.3_Silent_p.A448A|PC_ENST00000393955.2_Silent_p.A448A|PC_ENST00000393960.1_Silent_p.A448A|PC_ENST00000524491.1_Silent_p.A408A	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	448	Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)	p.A448A(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CGCGGAACTCCGCAAGGGCCC	0.662																																							uc001ojn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)|kidney(1)	4						c.(1342-1344)GCG>GCT		pyruvate carboxylase precursor	Biotin(DB00121)|Pyruvic acid(DB00119)						108.0	102.0	104.0					11																	66631269		2200	4295	6495	SO:0001819	synonymous_variant	5091				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity	g.chr11:66631269C>A	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1344G>T	11.37:g.66631269C>A						PC_uc001ojo.1_Silent_p.A448A|PC_uc001ojp.1_Silent_p.A448A	p.A448A	NM_022172	NP_071504	P11498	PYC_HUMAN		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	10	1393	-		Melanoma(852;0.0525)	448			Biotin carboxylation.		B4DN00|Q16705	Silent	SNP	ENST00000393958.2	37	c.1344G>T	CCDS8152.1																																																																																				0.662	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716		31	177	1	0	1.88708e-17	0.008361	3.86213e-17	31	177				
LRRC32	2615	broad.mit.edu	37	11	76372209	76372209	+	Missense_Mutation	SNP	C	C	A	rs202125228		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:76372209C>A	ENST00000407242.2	-	3	670	c.428G>T	c.(427-429)cGg>cTg	p.R143L	LRRC32_ENST00000404995.1_Missense_Mutation_p.R143L|LRRC32_ENST00000260061.5_Missense_Mutation_p.R143L|LRRC32_ENST00000464145.1_Intron|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	143					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)		p.R143L(1)		endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						CCCCAGCAGCCGCTCCAGCAG	0.687																																							uc001oxq.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(427-429)CGG>CTG		leucine rich repeat containing 32 precursor							31.0	39.0	36.0					11																	76372209		2199	4292	6491	SO:0001583	missense	2615					integral to plasma membrane		g.chr11:76372209C>A	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.428G>T	11.37:g.76372209C>A	ENSP00000384126:p.Arg143Leu					LRRC32_uc001oxr.3_Missense_Mutation_p.R143L|LRRC32_uc010rsf.1_Missense_Mutation_p.R143L	p.R143L	NM_005512	NP_005503	Q14392	LRC32_HUMAN			3	671	-			143			Extracellular (Potential).|LRR 4.		Q86V06	Missense_Mutation	SNP	ENST00000407242.2	37	c.428G>T	CCDS8245.1	.	.	.	.	.	.	.	.	.	.	C	0.400	-0.918850	0.02396	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995;ENST00000421973	T;T;T;T	0.79554	-1.28;-1.28;-1.28;0.3	4.74	-7.43	0.01383	.	0.946945	0.08918	N	0.874880	T	0.58736	0.2143	N	0.12961	0.28	0.09310	N	1	B;B	0.27594	0.182;0.182	B;B	0.26416	0.069;0.069	T	0.53655	-0.8408	10	0.07325	T	0.83	.	13.7541	0.62926	0.0:0.1292:0.1021:0.7686	.	143;143	C9JYU3;Q14392	.;LRC32_HUMAN	L	143	ENSP00000260061:R143L;ENSP00000384126:R143L;ENSP00000385766:R143L;ENSP00000413331:R143L	ENSP00000260061:R143L	R	-	2	0	LRRC32	76049857	0.000000	0.05858	0.390000	0.26220	0.395000	0.30598	-0.342000	0.07801	-1.360000	0.02172	-1.036000	0.02392	CGG		0.687	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512		14	55	1	0	0.000219431	0.00245	0.000278909	14	55				
TENM4	26011	broad.mit.edu	37	11	78387379	78387379	+	Silent	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:78387379G>A	ENST00000278550.7	-	30	5776	c.5314C>T	c.(5314-5316)Ctg>Ttg	p.L1772L		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1772					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.L1772L(2)									CCGTTGGCCAGCAGCAGCCGC	0.622																																							uc001ozl.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|pancreas(2)	4						c.(5314-5316)CTG>TTG		odz, odd Oz/ten-m homolog 4							27.0	34.0	32.0					11																	78387379		2144	4252	6396	SO:0001819	synonymous_variant	26011				signal transduction	integral to membrane		g.chr11:78387379G>A	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5314C>T	11.37:g.78387379G>A						ODZ4_uc001ozk.3_5'UTR|ODZ4_uc009yvb.1_Silent_p.L356L	p.L1772L	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN			30	5777	-			1772			Extracellular (Potential).		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	c.5314C>T	CCDS44688.1																																																																																				0.622	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			3	61	0	0	0	0.004672	0	3	61				
BIRC2	329	broad.mit.edu	37	11	102239138	102239138	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:102239138G>T	ENST00000227758.2	+	6	2624	c.1225G>T	c.(1225-1227)Gtg>Ttg	p.V409L	BIRC2_ENST00000530675.1_Missense_Mutation_p.V360L|BIRC2_ENST00000527910.1_3'UTR|BIRC2_ENST00000532672.1_Missense_Mutation_p.V388L	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	409					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V409L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		TAGAGACCTGGTGAAACAAAC	0.363																																							uc001pgy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(1225-1227)GTG>TTG		baculoviral IAP repeat-containing protein 2							108.0	109.0	108.0					11																	102239138		2203	4299	6502	SO:0001583	missense	329				cell surface receptor linked signaling pathway|cellular component disassembly involved in apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteasomal ubiquitin-dependent protein catabolic process|protein polyubiquitination	CD40 receptor complex|cytosol|internal side of plasma membrane	protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:102239138G>T	L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.1225G>T	11.37:g.102239138G>T	ENSP00000227758:p.Val409Leu					BIRC2_uc010ruq.1_Missense_Mutation_p.V360L|BIRC2_uc010rur.1_Missense_Mutation_p.V409L	p.V409L	NM_001166	NP_001157	Q13490	BIRC2_HUMAN	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)	6	2624	+	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	409					B4E026|Q16516|Q4TTG0	Missense_Mutation	SNP	ENST00000227758.2	37	c.1225G>T	CCDS8316.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.001784	0.35320	.	.	ENSG00000110330	ENST00000530675;ENST00000533742;ENST00000227758;ENST00000541741;ENST00000532672	T;T;T;T	0.30981	1.52;2.17;1.56;1.51	5.52	3.65	0.41850	.	0.115280	0.64402	N	0.000019	T	0.32010	0.0815	M	0.62723	1.935	0.58432	D	0.999994	B	0.24963	0.115	B	0.32149	0.141	T	0.09952	-1.0651	10	0.52906	T	0.07	-18.5354	8.2943	0.31976	0.1511:0.1303:0.7186:0.0	.	409	Q13490	BIRC2_HUMAN	L	360;71;409;409;388	ENSP00000431723:V360L;ENSP00000433851:V71L;ENSP00000227758:V409L;ENSP00000434979:V388L	ENSP00000227758:V409L	V	+	1	0	BIRC2	101744348	1.000000	0.71417	0.934000	0.37439	0.327000	0.28475	2.502000	0.45398	0.698000	0.31739	-0.314000	0.08810	GTG		0.363	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	NM_001166		17	103	1	0	4.14922e-12	0.004007	7.34092e-12	17	103				
GRIA4	2893	broad.mit.edu	37	11	105795225	105795225	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:105795225T>C	ENST00000530497.1	+	11	1577	c.1577T>C	c.(1576-1578)aTc>aCc	p.I526T	GRIA4_ENST00000393127.2_Missense_Mutation_p.I526T|GRIA4_ENST00000282499.5_Missense_Mutation_p.I526T|GRIA4_ENST00000525187.1_Missense_Mutation_p.I526T			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	526					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TCTATCATGATCAAAAAGCCT	0.438																																							uc001pix.2		NA																	0				ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8						c.(1576-1578)ATC>ACC		glutamate receptor, ionotrophic, AMPA 4 isoform	L-Glutamic Acid(DB00142)						159.0	155.0	157.0					11																	105795225		2202	4299	6501	SO:0001583	missense	2893				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity	g.chr11:105795225T>C	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1577T>C	11.37:g.105795225T>C	ENSP00000435775:p.Ile526Thr					GRIA4_uc001piw.2_Missense_Mutation_p.I526T	p.I526T	NM_000829	NP_000820	P48058	GRIA4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	12	2023	+		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)	526			Extracellular (Potential).		Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	c.1577T>C	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.069596	0.76301	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	5.55	5.55	0.83447	Ionotropic glutamate receptor (1);	0.000000	0.64402	D	0.000001	T	0.50514	0.1620	L	0.35487	1.065	0.80722	D	1	D;D	0.69078	0.984;0.997	P;D	0.83275	0.852;0.996	T	0.53330	-0.8454	10	0.87932	D	0	.	15.9859	0.80151	0.0:0.0:0.0:1.0	.	526;526	P48058;G3V164	GRIA4_HUMAN;.	T	526	ENSP00000282499:I526T;ENSP00000376835:I526T;ENSP00000435775:I526T;ENSP00000432180:I526T	ENSP00000282499:I526T	I	+	2	0	GRIA4	105300435	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.237000	0.73441	0.528000	0.53228	ATC		0.438	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1			4	229	0	0	0	0.000248	0	4	229				
CHEK1	1111	broad.mit.edu	37	11	125497573	125497573	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:125497573T>C	ENST00000534070.1	+	3	392	c.137T>C	c.(136-138)gTa>gCa	p.V46A	CHEK1_ENST00000532449.1_Intron|CHEK1_ENST00000438015.1_Missense_Mutation_p.V46A|CHEK1_ENST00000544373.1_Missense_Mutation_p.V46A|CHEK1_ENST00000428830.2_Missense_Mutation_p.V46A|CHEK1_ENST00000278916.3_Missense_Mutation_p.V46A|CHEK1_ENST00000427383.2_Intron|CHEK1_ENST00000524737.1_Missense_Mutation_p.V46A	NM_001274.5	NP_001265.2	O14757	CHK1_HUMAN	checkpoint kinase 1	46	Interaction with CLSPN. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to caffeine (GO:0071313)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to mechanical stimulus (GO:0071260)|chromatin-mediated maintenance of transcription (GO:0048096)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of mitosis (GO:0045839)|peptidyl-threonine phosphorylation (GO:0018107)|regulation of cell proliferation (GO:0042127)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of histone H3-K9 acetylation (GO:2000615)|regulation of mitotic centrosome separation (GO:0046602)|regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010767)|replicative senescence (GO:0090399)	centrosome (GO:0005813)|chromatin (GO:0000785)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	ATP binding (GO:0005524)|histone kinase activity (H3-T11 specific) (GO:0035402)|protein serine/threonine kinase activity (GO:0004674)	p.V46A(1)		central_nervous_system(3)|endometrium(3)|large_intestine(2)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	26	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		AAGCGTGCCGTAGACTGTCCA	0.343								Other conserved DNA damage response genes																															uc009zbo.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|lung(2)|skin(1)	6						c.(136-138)GTA>GCA	Other_conserved_DNA_damage_response_genes	checkpoint kinase 1							68.0	72.0	71.0					11																	125497573		2201	4299	6500	SO:0001583	missense	1111				cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr11:125497573T>C	AF016582, BC017575	CCDS8459.1, CCDS58191.1	11q24.2	2011-11-11	2011-11-11		ENSG00000149554	ENSG00000149554			1925	protein-coding gene	gene with protein product		603078	"""CHK1 (checkpoint, S.pombe) homolog"", ""CHK1 checkpoint homolog (S. pombe)"""			9278511, 9382850	Standard	NM_001114121		Approved	CHK1	uc001qcg.4	O14757	OTTHUMG00000165853	ENST00000534070.1:c.137T>C	11.37:g.125497573T>C	ENSP00000435371:p.Val46Ala					CHEK1_uc010sbh.1_Intron|CHEK1_uc010sbi.1_Missense_Mutation_p.V46A|CHEK1_uc001qcf.3_Missense_Mutation_p.V46A|CHEK1_uc009zbp.2_Missense_Mutation_p.V46A|CHEK1_uc001qcg.3_Missense_Mutation_p.V46A|CHEK1_uc009zbq.2_Missense_Mutation_p.V46A|CHEK1_uc001qci.1_RNA	p.V46A	NM_001114122	NP_001107594	O14757	CHK1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)	3	1029	+	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	46			Protein kinase.		A8K934|B4DDD0|B4DSK3|B5BTY6|F5H7S4|H2BI51	Missense_Mutation	SNP	ENST00000534070.1	37	c.137T>C	CCDS8459.1	.	.	.	.	.	.	.	.	.	.	T	5.373	0.254097	0.10185	.	.	ENSG00000149554	ENST00000438015;ENST00000525396;ENST00000428830;ENST00000544373;ENST00000527013;ENST00000526937;ENST00000534685;ENST00000534070;ENST00000524737;ENST00000278916	T;T;T;T;T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1	5.06	3.92	0.45320	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.458362	0.25030	N	0.033687	T	0.36496	0.0969	N	0.17312	0.475	0.19300	N	0.99997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.24190	-1.0167	10	0.05833	T	0.94	.	6.8019	0.23756	0.0:0.2264:0.0:0.7736	.	46;46;46	F5H7S4;B5BTY6;O14757	.;.;CHK1_HUMAN	A	46	ENSP00000388648:V46A;ENSP00000434141:V46A;ENSP00000412504:V46A;ENSP00000442317:V46A;ENSP00000431525:V46A;ENSP00000431815:V46A;ENSP00000432470:V46A;ENSP00000435371:V46A;ENSP00000432890:V46A;ENSP00000278916:V46A	ENSP00000278916:V46A	V	+	2	0	CHEK1	125002783	0.677000	0.27577	1.000000	0.80357	0.983000	0.72400	1.934000	0.40163	2.052000	0.61016	0.477000	0.44152	GTA		0.343	CHEK1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386714.1	NM_001274		3	89	0	0	0	0.004672	0	3	89				
NCAPD3	23310	broad.mit.edu	37	11	134051057	134051057	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:134051057C>A	ENST00000534548.2	-	20	2538	c.2474G>T	c.(2473-2475)gGg>gTg	p.G825V	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	825					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)	p.G825V(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GAGTACATCCCCACACACCTG	0.522																																							uc001qhd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5						c.(2473-2475)GGG>GTG		non-SMC condensin II complex, subunit D3							97.0	77.0	84.0					11																	134051057		2201	4297	6498	SO:0001583	missense	23310				cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding	g.chr11:134051057C>A	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2474G>T	11.37:g.134051057C>A	ENSP00000433681:p.Gly825Val					NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	p.G825V	NM_015261	NP_056076	P42695	CNDD3_HUMAN		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)	20	3080	-	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	825					A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	c.2474G>T	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.178061	0.38511	.	.	ENSG00000151503	ENST00000534548	T	0.65364	-0.15	6.16	2.01	0.26516	Armadillo-type fold (1);	0.139973	0.64402	N	0.000004	T	0.47284	0.1437	L	0.46885	1.475	0.80722	D	1	B	0.20052	0.041	B	0.15870	0.014	T	0.28396	-1.0045	10	0.22109	T	0.4	-13.819	6.1863	0.20500	0.2904:0.5705:0.0:0.1392	.	825	P42695	CNDD3_HUMAN	V	825	ENSP00000433681:G825V	ENSP00000434168:G825V	G	-	2	0	NCAPD3	133556267	0.926000	0.31397	0.929000	0.37066	0.748000	0.42578	1.175000	0.31944	0.893000	0.36288	0.650000	0.86243	GGG		0.522	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261		16	37	1	0	2.32078e-09	0.003163	3.72405e-09	16	37				
CACNA1C	775	broad.mit.edu	37	12	2714893	2714893	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:2714893G>T	ENST00000347598.4	+	25	3157	c.3157G>T	c.(3157-3159)Gtg>Ttg	p.V1053L	CACNA1C_ENST00000335762.5_Missense_Mutation_p.V1058L|CACNA1C_ENST00000399606.1_Missense_Mutation_p.V1053L|CACNA1C_ENST00000406454.3_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399601.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399603.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399591.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399597.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399621.1_Missense_Mutation_p.V1033L|CACNA1C-AS3_ENST00000543559.1_RNA|CACNA1C_ENST00000399644.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000402845.3_Missense_Mutation_p.V1033L|CACNA1C_ENST00000480911.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399655.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000327702.7_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399617.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399638.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399634.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399649.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000344100.3_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399595.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399629.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399637.1_Missense_Mutation_p.V1033L|CACNA1C_ENST00000399641.1_Missense_Mutation_p.V1033L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1053					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.V1033L(2)|p.V1083L(1)|p.V1053L(1)|p.V568L(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGGGAACATCGTGATTGTCAC	0.587																																							uc009zdu.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(10)|central_nervous_system(1)	11						c.(3157-3159)GTG>TTG		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						182.0	168.0	173.0					12																	2714893		2203	4300	6503	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2714893G>T	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3157G>T	12.37:g.2714893G>T	ENSP00000266376:p.Val1053Leu					CACNA1C_uc009zdv.1_Missense_Mutation_p.V1030L|CACNA1C_uc001qkb.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qkc.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qke.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qkf.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qjz.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qkd.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qkg.2_Missense_Mutation_p.V1033L|CACNA1C_uc009zdw.1_Missense_Mutation_p.V1033L|CACNA1C_uc001qkh.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qkl.2_Missense_Mutation_p.V1053L|CACNA1C_uc001qkn.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qko.2_Missense_Mutation_p.V1053L|CACNA1C_uc001qkp.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qkr.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qku.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qkq.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qks.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qkt.2_Missense_Mutation_p.V1033L|CACNA1C_uc001qka.1_Missense_Mutation_p.V568L|CACNA1C_uc001qki.1_Missense_Mutation_p.V769L|CACNA1C_uc001qkj.1_Missense_Mutation_p.V769L|CACNA1C_uc001qkk.1_Missense_Mutation_p.V769L|CACNA1C_uc001qkm.1_Missense_Mutation_p.V769L	p.V1053L	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	25	3470	+			1053			III.|Helical; Name=S5 of repeat III; (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.3157G>T	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.296964	0.60086	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98120	-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73;-4.73	4.33	4.33	0.51752	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97259	0.9104	N	0.21282	0.65	0.80722	D	1	D;D;B;D;D;D;D;B;B;D;D;B;D;D;D;D;P;D;B;D;D;D;D;D;D	0.76494	0.994;0.999;0.418;0.989;0.999;0.999;0.998;0.375;0.008;0.999;0.999;0.115;0.998;0.999;0.999;0.984;0.588;0.999;0.33;0.984;0.999;0.999;0.976;0.959;0.999	D;D;B;D;D;D;D;B;B;D;D;B;D;D;D;D;B;D;B;D;D;D;P;D;D	0.91635	0.987;0.997;0.208;0.987;0.997;0.997;0.997;0.218;0.042;0.997;0.993;0.108;0.997;0.996;0.999;0.972;0.32;0.997;0.09;0.972;0.997;0.997;0.866;0.959;0.995	D	0.97222	0.9878	10	0.38643	T	0.18	.	17.3763	0.87392	0.0:0.0:1.0:0.0	.	1033;1030;1053;1033;1033;1033;1033;1033;1033;1053;1033;1004;1053;1033;1033;1033;1033;1033;1033;1033;1033;1033;1033;1033;1033	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	L	1058;1033;1033;1033;1033;1033;1033;1033;1033;1033;1053;1053;1033;1033;1033;1033;1033;1033;1033;1033;1033;1033;1033;874	ENSP00000336982:V1058L;ENSP00000382563:V1033L;ENSP00000437936:V1033L;ENSP00000382552:V1033L;ENSP00000382547:V1033L;ENSP00000382506:V1033L;ENSP00000382530:V1033L;ENSP00000382546:V1033L;ENSP00000382500:V1033L;ENSP00000382549:V1033L;ENSP00000266376:V1053L;ENSP00000382515:V1053L;ENSP00000382510:V1033L;ENSP00000341092:V1033L;ENSP00000382537:V1033L;ENSP00000329877:V1033L;ENSP00000382557:V1033L;ENSP00000385724:V1033L;ENSP00000382512:V1033L;ENSP00000382542:V1033L;ENSP00000382526:V1033L;ENSP00000385896:V1033L;ENSP00000382504:V1033L	ENSP00000323129:V874L	V	+	1	0	CACNA1C	2585154	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	7.379000	0.79691	2.418000	0.82041	0.561000	0.74099	GTG		0.587	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		9	52	1	0	6.40141e-05	0.000978	8.33391e-05	9	52				
NTF3	4908	broad.mit.edu	37	12	5603979	5603979	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:5603979C>A	ENST00000331010.6	+	1	682	c.599C>A	c.(598-600)cCg>cAg	p.P200Q	NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Missense_Mutation_p.P213Q	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	200					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)	p.P200Q(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						GAAGCCAGGCCGGTCAAAAAC	0.483																																					GBM(194;1104 2182 8339 9578 18493)	GBM(194;1104 2182 8339 9578 18493)	uc001qnl.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(598-600)CCG>CAG		neurotrophin 3 isoform 2 preproprotein							56.0	54.0	55.0					12																	5603979		2203	4300	6503	SO:0001583	missense	4908				signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding	g.chr12:5603979C>A		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.599C>A	12.37:g.5603979C>A	ENSP00000328738:p.Pro200Gln					NTF3_uc001qnk.3_Missense_Mutation_p.P213Q	p.P200Q	NM_002527	NP_002518	P20783	NTF3_HUMAN			1	682	+			200					B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	37	c.599C>A	CCDS8538.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079617	0.76528	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.69306	-0.39;-0.39	5.45	5.45	0.79879	Nerve growth factor-related (4);	0.054240	0.85682	D	0.000000	T	0.82135	0.4971	M	0.75884	2.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.989	D	0.83981	0.0332	10	0.87932	D	0	-19.3461	18.2818	0.90101	0.0:1.0:0.0:0.0	.	200;213	P20783;B7Z1T5	NTF3_HUMAN;.	Q	213;200	ENSP00000397297:P213Q;ENSP00000328738:P200Q	ENSP00000328738:P200Q	P	+	2	0	NTF3	5474240	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	4.692000	0.61746	2.583000	0.87209	0.650000	0.86243	CCG		0.483	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1			14	63	1	0	1.5739e-10	0.004007	2.69572e-10	14	63				
CLEC1A	51267	broad.mit.edu	37	12	10241744	10241744	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:10241744G>C	ENST00000315330.4	-	2	255	c.193C>G	c.(193-195)Ctg>Gtg	p.L65V	CLEC1A_ENST00000457018.2_Intron|CLEC1A_ENST00000420265.2_Intron	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	65					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.L65L(1)|p.L65V(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						AGGGCTGCCAGCCCTATCAGC	0.552																																							uc001qxb.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	ovary(1)|central_nervous_system(1)	2						c.(193-195)CTG>GTG		C-type lectin-like receptor-1							54.0	52.0	53.0					12																	10241744		2203	4299	6502	SO:0001583	missense	51267				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity	g.chr12:10241744G>C	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.193C>G	12.37:g.10241744G>C	ENSP00000326407:p.Leu65Val					CLEC1A_uc009zhf.2_5'UTR|CLEC1A_uc001qxc.2_5'UTR|CLEC1A_uc001qxd.2_Intron|CLEC1A_uc010sgx.1_Intron	p.L65V	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN			2	277	-			65			Helical; Signal-anchor for type II membrane protein; (Potential).		Q8IUW7|Q9NZH3	Missense_Mutation	SNP	ENST00000315330.4	37	c.193C>G	CCDS8612.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105548	0.77096	.	.	ENSG00000150048	ENST00000315330;ENST00000414501	T;T	0.57107	5.08;0.42	5.35	5.35	0.76521	.	0.000000	0.41396	D	0.000892	T	0.56514	0.1990	L	0.33710	1.025	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.50320	-0.8842	10	0.02654	T	1	.	14.5822	0.68300	0.0:0.0:1.0:0.0	.	65	Q8NC01	CLC1A_HUMAN	V	65	ENSP00000326407:L65V;ENSP00000396272:L65V	ENSP00000326407:L65V	L	-	1	2	CLEC1A	10133011	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	3.210000	0.51129	2.499000	0.84300	0.655000	0.94253	CTG		0.552	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511		5	52	0	0	0	0.001168	0	5	52				
LRP6	4040	broad.mit.edu	37	12	12311984	12311984	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:12311984C>A	ENST00000261349.4	-	12	2646	c.2570G>T	c.(2569-2571)cGt>cTt	p.R857L	LRP6_ENST00000543091.1_Missense_Mutation_p.R857L	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	857	Beta-propeller 3.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R857L(1)|p.R857H(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TTTGTTGGCACGCTCAATGCT	0.488																																							uc001rah.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12						c.(2569-2571)CGT>CTT		low density lipoprotein receptor-related protein							209.0	144.0	166.0					12																	12311984		2203	4300	6503	SO:0001583	missense	4040				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding	g.chr12:12311984C>A	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.2570G>T	12.37:g.12311984C>A	ENSP00000261349:p.Arg857Leu					BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.R857L	p.R857L	NM_002336	NP_002327	O75581	LRP6_HUMAN			12	2712	-		Prostate(47;0.0865)	857			Extracellular (Potential).|Beta-propeller 3.|LDL-receptor class B 15.		Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	c.2570G>T	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	32	5.107470	0.94292	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.96041	-3.89;-3.89	5.78	5.78	0.91487	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.56097	U	0.000035	D	0.98516	0.9505	M	0.94142	3.5	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.993;1.0	D	0.98755	1.0722	10	0.59425	D	0.04	.	20.0124	0.97464	0.0:1.0:0.0:0.0	.	857;857	F5H7J9;O75581	.;LRP6_HUMAN	L	857	ENSP00000261349:R857L;ENSP00000442472:R857L	ENSP00000261349:R857L	R	-	2	0	LRP6	12203251	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.749000	0.94314	0.655000	0.94253	CGT		0.488	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1			14	72	1	0	1.3612e-06	0.003163	1.91122e-06	14	72				
TMTC1	83857	broad.mit.edu	37	12	29669312	29669312	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:29669312G>T	ENST00000539277.1	-	15	2335	c.2277C>A	c.(2275-2277)gcC>gcA	p.A759A	TMTC1_ENST00000552618.1_Silent_p.A783A|TMTC1_ENST00000551659.1_Silent_p.A821A|TMTC1_ENST00000256062.5_Silent_p.A651A|TMTC1_ENST00000319685.8_5'UTR	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	759						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.A651A(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					TGCTATAGATGGCTGACAAGA	0.448																																							uc001rjb.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1951-1953)GCC>GCA		transmembrane and tetratricopeptide repeat							157.0	139.0	145.0					12																	29669312		2203	4300	6503	SO:0001819	synonymous_variant	83857					integral to membrane	binding	g.chr12:29669312G>T		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.2277C>A	12.37:g.29669312G>T						TMTC1_uc001riz.2_Silent_p.A408A|TMTC1_uc001rja.2_Silent_p.A495A|TMTC1_uc001riy.2_Silent_p.A104A	p.A651A	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN			15	2427	-	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)		759			TPR 8.		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Silent	SNP	ENST00000539277.1	37	c.1953C>A	CCDS53772.1																																																																																				0.448	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920		27	119	1	0	2.44723e-14	0.004656	4.58144e-14	27	119				
DENND5B	160518	broad.mit.edu	37	12	31633191	31633191	+	Splice_Site	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:31633191T>A	ENST00000389082.5	-	3	502		c.e3-2		DENND5B_ENST00000354285.4_Splice_Site|DENND5B_ENST00000306833.6_Splice_Site|DENND5B_ENST00000536562.1_Splice_Site|DENND5B_ENST00000545147.1_Intron	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B						positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.?(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CATGCACAACTGTGAAAGAAA	0.363																																							uc001rki.1		NA																	1	Unknown(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.e3-1		DENN/MADD domain containing 5B							15.0	14.0	14.0					12																	31633191		1807	4070	5877	SO:0001630	splice_region_variant	160518					integral to membrane		g.chr12:31633191T>A	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.238-2A>T	12.37:g.31633191T>A						DENND5B_uc001rkh.1_Splice_Site_p.L115_splice|DENND5B_uc009zjq.1_Splice_Site|DENND5B_uc001rkj.2_Splice_Site_p.L102_splice|DENND5B_uc001rkk.1_Splice_Site_p.L2_splice	p.L80_splice	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN			3	424	-								B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Splice_Site	SNP	ENST00000389082.5	37	c.238_splice	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.677677	0.47886	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285;ENST00000546299	.	.	.	4.8	3.64	0.41730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6792	0.51448	0.0:0.0:0.1484:0.8516	.	.	.	.	.	-1	.	.	.	-	.	.	DENND5B	31524458	1.000000	0.71417	0.373000	0.26003	0.765000	0.43378	7.663000	0.83820	0.840000	0.34995	0.533000	0.62120	.		0.363	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	Intron	3	5	0	0	0	0.004672	0	3	5				
CSRNP2	81566	broad.mit.edu	37	12	51458343	51458343	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:51458343A>C	ENST00000228515.1	-	5	1115	c.818T>G	c.(817-819)aTt>aGt	p.I273S		NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	273					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I273S(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						CAGCTTCATAATGGTGTGGAG	0.592																																							uc001rxu.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(817-819)ATT>AGT		TGF-beta induced apoptosis protein 12							56.0	53.0	54.0					12																	51458343		2203	4300	6503	SO:0001583	missense	81566				apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:51458343A>C	AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.818T>G	12.37:g.51458343A>C	ENSP00000228515:p.Ile273Ser						p.I273S	NM_030809	NP_110436	Q9H175	CSRN2_HUMAN			5	1116	-			273						Missense_Mutation	SNP	ENST00000228515.1	37	c.818T>G	CCDS8807.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.980509	0.74474	.	.	ENSG00000110925	ENST00000228515	T	0.15256	2.44	4.53	4.53	0.55603	.	0.057190	0.64402	D	0.000003	T	0.40570	0.1122	M	0.78801	2.425	0.80722	D	1	D	0.71674	0.998	D	0.66351	0.943	T	0.40040	-0.9584	10	0.87932	D	0	-18.3118	13.265	0.60128	1.0:0.0:0.0:0.0	.	273	Q9H175	CSRN2_HUMAN	S	273	ENSP00000228515:I273S	ENSP00000228515:I273S	I	-	2	0	CSRNP2	49744610	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.081000	0.94049	2.034000	0.60081	0.402000	0.26972	ATT		0.592	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404893.1			25	88	0	0	0	0.00632	0	25	88				
TFCP2	7024	broad.mit.edu	37	12	51495784	51495784	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:51495784C>G	ENST00000257915.5	-	11	1543	c.1085G>C	c.(1084-1086)aGa>aCa	p.R362T	TFCP2_ENST00000548115.1_Missense_Mutation_p.R311T|TFCP2_ENST00000307660.4_Missense_Mutation_p.R311T|TFCP2_ENST00000549867.1_Intron	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	362	DNA-binding.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R362T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						CACATCATCTCTAGTTAATTT	0.323																																							uc001rxw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1084-1086)AGA>ACA		transcription factor CP2							64.0	67.0	66.0					12																	51495784		2203	4300	6503	SO:0001583	missense	7024				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr12:51495784C>G	U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.1085G>C	12.37:g.51495784C>G	ENSP00000257915:p.Arg362Thr					TFCP2_uc001rxv.1_Missense_Mutation_p.R362T|TFCP2_uc009zlx.1_Missense_Mutation_p.R311T|TFCP2_uc001rxx.2_Intron|TFCP2_uc009zly.1_Missense_Mutation_p.R264T	p.R362T	NM_005653	NP_005644	Q12800	TFCP2_HUMAN			11	1544	-			362			DNA-binding.		A8K5E9|Q12801|Q9UD75|Q9UD77	Missense_Mutation	SNP	ENST00000257915.5	37	c.1085G>C	CCDS8808.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234909	0.79800	.	.	ENSG00000135457	ENST00000257915;ENST00000307660;ENST00000548115;ENST00000548108	T;T;T;T	0.52983	1.99;0.66;0.64;2.02	5.19	4.29	0.51040	Sterile alpha motif/pointed domain (1);	0.000000	0.85682	D	0.000000	T	0.68769	0.3037	M	0.77486	2.375	0.52501	D	0.999951	D;P;B	0.76494	0.999;0.857;0.338	D;P;P	0.80764	0.994;0.613;0.452	T	0.74654	-0.3593	10	0.87932	D	0	-20.4335	14.9833	0.71327	0.0:0.8561:0.1438:0.0	.	311;362;362	Q12800-2;Q12800;Q12800-4	.;TFCP2_HUMAN;.	T	362;311;311;264	ENSP00000257915:R362T;ENSP00000304411:R311T;ENSP00000447991:R311T;ENSP00000449280:R264T	ENSP00000257915:R362T	R	-	2	0	TFCP2	49782051	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.479000	0.45197	1.534000	0.49203	0.563000	0.77884	AGA		0.323	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405119.1	NM_005653		3	85	0	0	0	0.004672	0	3	85				
PTPRB	5787	broad.mit.edu	37	12	70948941	70948941	+	Splice_Site	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:70948941A>T	ENST00000261266.5	-	18	4517	c.4488T>A	c.(4486-4488)gaT>gaA	p.D1496E	PTPRB_ENST00000538708.1_Splice_Site_p.D1406E|PTPRB_ENST00000451516.2_Missense_Mutation_p.D1406E|PTPRB_ENST00000550358.1_Splice_Site_p.D1626E|PTPRB_ENST00000334414.6_Splice_Site_p.D1714E|PTPRB_ENST00000550857.1_Splice_Site_p.D1406E	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1496	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.D1496E(2)|p.D1714E(1)		breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ATAACTTACCATCAGCCTCTC	0.423																																							uc001swb.3		NA																	3	Substitution - Missense(3)		lung(3)	lung(2)|skin(1)	3						c.(4486-4488)GAT>GAA		protein tyrosine phosphatase, receptor type, B							104.0	98.0	100.0					12																	70948941		1945	4159	6104	SO:0001630	splice_region_variant	5787				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:70948941A>T	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.4489+1T>A	12.37:g.70948941A>T						PTPRB_uc010sto.1_Missense_Mutation_p.D1406E|PTPRB_uc010stp.1_Missense_Mutation_p.D1406E|PTPRB_uc001swc.3_Missense_Mutation_p.D1714E|PTPRB_uc001swa.3_Missense_Mutation_p.D1626E	p.D1496E	NM_002837	NP_002828	P23467	PTPRB_HUMAN	GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)		18	4518	-	Renal(347;0.236)		1496			Fibronectin type-III 17.|Extracellular (Potential).		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	37	c.4488T>A	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.856947	0.51376	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266	T;T;T;T;T;T	0.76839	4.1;4.05;4.1;-1.05;4.09;4.13	5.8	-3.71	0.04424	Fibronectin, type III (3);	0.252514	0.45867	D	0.000333	T	0.55033	0.1895	N	0.19112	0.55	0.41878	D	0.990308	B;B;B;B;B	0.13145	0.004;0.004;0.004;0.004;0.007	B;B;B;B;B	0.15870	0.014;0.014;0.014;0.005;0.013	T	0.08229	-1.0732	10	0.26408	T	0.33	.	7.9072	0.29769	0.5466:0.1071:0.3463:0.0	.	1406;1406;1714;1496;1626	P23467-2;F5H3G6;P23467-3;P23467;F8VU56	.;.;.;PTPRB_HUMAN;.	E	1714;1406;1626;1406;1406;1496	ENSP00000334928:D1714E;ENSP00000393028:D1406E;ENSP00000448058:D1626E;ENSP00000438927:D1406E;ENSP00000447302:D1406E;ENSP00000261266:D1496E	ENSP00000261266:D1496E	D	-	3	2	PTPRB	69235208	0.035000	0.19736	0.962000	0.40283	0.806000	0.45545	-0.502000	0.06390	-0.688000	0.05155	0.383000	0.25322	GAT		0.423	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		Missense_Mutation	4	77	0	0	0	0.000248	0	4	77				
ZFC3H1	196441	broad.mit.edu	37	12	72056983	72056983	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:72056983C>A	ENST00000378743.3	-	1	766	c.408G>T	c.(406-408)cgG>cgT	p.R136R	ZFC3H1_ENST00000548100.1_Silent_p.R136R|ZFC3H1_ENST00000549407.1_5'UTR|ZFC3H1_ENST00000552037.1_Silent_p.R136R|THAP2_ENST00000547843.1_5'Flank|THAP2_ENST00000308086.2_5'UTR	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	136					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R136R(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CGAGGTGGCTCCGCTCCCAGA	0.647																																							uc001swo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(406-408)CGG>CGT		proline/serine-rich coiled-coil 2							65.0	72.0	70.0					12																	72056983		1963	4134	6097	SO:0001819	synonymous_variant	196441				RNA processing	intracellular	metal ion binding	g.chr12:72056983C>A	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.408G>T	12.37:g.72056983C>A						ZFC3H1_uc010sts.1_Silent_p.R136R|ZFC3H1_uc001swp.2_Silent_p.R136R|THAP2_uc001swq.2_5'Flank	p.R136R	NM_144982	NP_659419	O60293	ZC3H1_HUMAN			1	767	-			136					Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Silent	SNP	ENST00000378743.3	37	c.408G>T	CCDS41813.1																																																																																				0.647	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982		12	86	1	0	0.00010058	0.001368	0.000129202	12	86				
NAV3	89795	broad.mit.edu	37	12	78444565	78444565	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:78444565C>A	ENST00000397909.2	+	11	2327	c.2154C>A	c.(2152-2154)gaC>gaA	p.D718E	NAV3_ENST00000266692.7_Missense_Mutation_p.D718E|NAV3_ENST00000228327.6_Missense_Mutation_p.D718E|NAV3_ENST00000536525.2_Missense_Mutation_p.D718E|RP11-136F16.1_ENST00000549103.1_RNA			Q8IVL0	NAV3_HUMAN	neuron navigator 3	718						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.D718E(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CAACATTTGACAGCACTGTGA	0.473										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2152-2154)GAC>GAA		neuron navigator 3							131.0	122.0	125.0					12																	78444565		1959	4155	6114	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78444565C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2154C>A	12.37:g.78444565C>A	ENSP00000381007:p.Asp718Glu	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.D718E|NAV3_uc010sub.1_Missense_Mutation_p.D218E	p.D718E	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			11	2327	+			718					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2154C>A		.	.	.	.	.	.	.	.	.	.	C	20.5	3.993815	0.74703	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.14266	2.52;2.52;2.52;2.52	5.9	1.88	0.25563	.	0.000000	0.41712	U	0.000836	T	0.31575	0.0801	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	1.0;0.994;1.0	D;D;D	0.91635	0.999;0.978;0.996	T	0.01889	-1.1253	10	0.87932	D	0	-23.2228	8.7875	0.34830	0.0:0.6213:0.0:0.3787	.	718;718;718	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	E	718	ENSP00000446132:D718E;ENSP00000381007:D718E;ENSP00000228327:D718E;ENSP00000266692:D718E	ENSP00000228327:D718E	D	+	3	2	NAV3	76968696	0.989000	0.36119	1.000000	0.80357	0.996000	0.88848	1.188000	0.32102	0.348000	0.23949	-0.137000	0.14449	GAC		0.473	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		16	82	1	0	2.4624e-09	0.008871	3.92521e-09	16	82				
ATP2B1	490	broad.mit.edu	37	12	90028574	90028574	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:90028574C>A	ENST00000428670.3	-	5	1224	c.768G>T	c.(766-768)aaG>aaT	p.K256N	ATP2B1_ENST00000261173.2_Missense_Mutation_p.K256N|ATP2B1_ENST00000359142.3_Missense_Mutation_p.K256N|ATP2B1_ENST00000348959.3_Missense_Mutation_p.K256N			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	256					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.K256N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						GTAAGGGATCCTTATCTAAAG	0.348																																							uc001tbh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(766-768)AAG>AAT		plasma membrane calcium ATPase 1 isoform 1b							51.0	51.0	51.0					12																	90028574		2203	4297	6500	SO:0001583	missense	490				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding	g.chr12:90028574C>A	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.768G>T	12.37:g.90028574C>A	ENSP00000392043:p.Lys256Asn					ATP2B1_uc001tbg.2_Missense_Mutation_p.K256N	p.K256N	NM_001682	NP_001673	P20020	AT2B1_HUMAN			4	949	-			256			Cytoplasmic (Potential).		Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	ENST00000428670.3	37	c.768G>T	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.462678	0.43736	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670	D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74	5.68	1.01	0.19927	.	0.044153	0.85682	D	0.000000	T	0.81133	0.4759	N	0.20766	0.605	0.48762	D	0.999705	P;B	0.44478	0.836;0.133	B;B	0.42827	0.399;0.361	T	0.73597	-0.3932	9	.	.	.	-30.7652	7.4127	0.27025	0.0:0.3247:0.0:0.6753	.	256;256	P20020-3;P20020-2	.;.	N	256	ENSP00000261173:K256N;ENSP00000343599:K256N;ENSP00000352054:K256N;ENSP00000392043:K256N	.	K	-	3	2	ATP2B1	88552705	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.838000	0.27572	0.350000	0.24002	0.650000	0.86243	AAG		0.348	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682		8	38	1	0	7.48243e-07	0.006214	1.06608e-06	8	38				
DNAH10	196385	broad.mit.edu	37	12	124362333	124362333	+	Silent	SNP	G	G	T	rs538616792		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:124362333G>T	ENST00000409039.3	+	47	7921	c.7896G>T	c.(7894-7896)acG>acT	p.T2632T		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2632	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T1224T(1)|p.T2632T(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CATTCTGCACGCTAGCACTTT	0.453													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17602	0.0		0.0	False		,,,				2504	0.0						uc001uft.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(7894-7896)ACG>ACT		dynein, axonemal, heavy chain 10							105.0	113.0	110.0					12																	124362333		2119	4244	6363	SO:0001819	synonymous_variant	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124362333G>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7896G>T	12.37:g.124362333G>T							p.T2632T	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	47	7921	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		2632			AAA 3 (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	c.7896G>T	CCDS9255.2																																																																																				0.453	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			18	111	1	0	6.49762e-13	0.006122	1.17983e-12	18	111				
RIMBP2	23504	broad.mit.edu	37	12	130921572	130921572	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:130921572C>A	ENST00000261655.4	-	10	2033	c.1870G>T	c.(1870-1872)Gcc>Tcc	p.A624S	RIMBP2_ENST00000535703.1_Missense_Mutation_p.A532S|RIMBP2_ENST00000536002.1_Missense_Mutation_p.A532S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	624	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.A624S(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TGCTCCCAGGCCTCATCCATC	0.672																																							uc001uil.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11						c.(1870-1872)GCC>TCC		RIM-binding protein 2							62.0	55.0	57.0					12																	130921572		2203	4300	6503	SO:0001583	missense	23504					cell junction|synapse		g.chr12:130921572C>A	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1870G>T	12.37:g.130921572C>A	ENSP00000261655:p.Ala624Ser					RIMBP2_uc001uim.2_Missense_Mutation_p.A532S|RIMBP2_uc001uin.1_Missense_Mutation_p.A283S	p.A624S	NM_015347	NP_056162	O15034	RIMB2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)	10	2034	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	624			Pro-rich.		Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	c.1870G>T	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	C	0.214	-1.034415	0.02029	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.18960	2.18;3.02;3.02	4.52	-5.38	0.02673	.	0.712817	0.13597	N	0.376162	T	0.05593	0.0147	N	0.03115	-0.41	0.23478	N	0.997591	B;B;B	0.13145	0.003;0.007;0.0	B;B;B	0.14578	0.005;0.011;0.001	T	0.37314	-0.9711	10	0.05351	T	0.99	.	8.0731	0.30701	0.4376:0.3033:0.2591:0.0	.	532;532;624	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	S	624;532;532;532	ENSP00000261655:A624S;ENSP00000440347:A532S;ENSP00000439159:A532S	ENSP00000261655:A624S	A	-	1	0	RIMBP2	129487525	1.000000	0.71417	0.057000	0.19452	0.037000	0.13140	0.634000	0.24614	-0.978000	0.03533	-1.083000	0.02208	GCC		0.672	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347		5	30	1	0	0.000602214	0.000602	0.000749664	5	30				
STX2	2054	broad.mit.edu	37	12	131293251	131293251	+	Splice_Site	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr12:131293251T>A	ENST00000392373.2	-	5	375		c.e5-2		RP11-989F5.1_ENST00000546264.1_lincRNA|RP11-989F5.3_ENST00000542821.1_lincRNA|STX2_ENST00000261653.6_Splice_Site	NM_194356.2	NP_919337.1	P32856	STX2_HUMAN	syntaxin 2						acrosome reaction (GO:0007340)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|intracellular protein transport (GO:0006886)|organ morphogenesis (GO:0009887)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|signal transduction (GO:0007165)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)	calcium-dependent protein binding (GO:0048306)	p.?(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)	16	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)		GTTCAATAGCTAGGAACAAAT	0.353																																							uc001uio.2		NA																	2	Unknown(2)		lung(2)		0						c.e5-1		syntaxin 2 isoform 2							135.0	144.0	141.0					12																	131293251		2203	4300	6503	SO:0001630	splice_region_variant	2054				acrosome reaction|ectoderm development|intracellular protein transport|organ morphogenesis|signal transduction	basolateral plasma membrane|integral to membrane|microsome|soluble fraction	calcium-dependent protein binding|SNAP receptor activity	g.chr12:131293251T>A	D14582	CCDS9269.1, CCDS9270.1	12q24	2008-02-05	2006-04-25	2006-04-25	ENSG00000111450	ENSG00000111450			3403	protein-coding gene	gene with protein product		132350	"""epimorphin"""	STX2B, STX2C, STX2A, EPIM		8938452, 15943887	Standard	NM_001980		Approved	EPM	uc001uio.4	P32856	OTTHUMG00000168365	ENST00000392373.2:c.281-2A>T	12.37:g.131293251T>A						STX2_uc001uip.2_Splice_Site_p.A94_splice|STX2_uc010tbj.1_Splice_Site_p.A94_splice	p.A94_splice	NM_194356	NP_919337	P32856	STX2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)	5	448	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)							Q86VW8	Splice_Site	SNP	ENST00000392373.2	37	c.281_splice	CCDS9270.1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.729633	0.30684	.	.	ENSG00000111450	ENST00000261653;ENST00000392373	.	.	.	4.25	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7069	0.57065	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	STX2	129859204	1.000000	0.71417	0.704000	0.30370	0.166000	0.22503	6.609000	0.74173	1.781000	0.52344	0.379000	0.24179	.		0.353	STX2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399455.2	NM_194356	Intron	51	226	0	0	0	0.00361	0	51	226				
LATS2	26524	broad.mit.edu	37	13	21557438	21557438	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr13:21557438C>A	ENST00000382592.4	-	5	2812	c.2407G>T	c.(2407-2409)Ggt>Tgt	p.G803C	LATS2_ENST00000542899.1_Missense_Mutation_p.G803C	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2									p.G803C(2)		breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		TTAATGTGACCATCCAGATCT	0.458																																							uc009zzs.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10						c.(2407-2409)GGT>TGT		LATS, large tumor suppressor, homolog 2							103.0	94.0	97.0					13																	21557438		2203	4300	6503	SO:0001583	missense	26524				cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr13:21557438C>A	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.2407G>T	13.37:g.21557438C>A	ENSP00000372035:p.Gly803Cys					LATS2_uc001unr.3_Missense_Mutation_p.G803C	p.G803C	NM_014572	NP_055387	Q9NRM7	LATS2_HUMAN		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)	5	2772	-		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)	803			Protein kinase.			Missense_Mutation	SNP	ENST00000382592.4	37	c.2407G>T	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.297618	0.81025	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.11277	2.79;2.79	5.05	5.05	0.67936	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.43010	0.1228	M	0.90814	3.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.53005	-0.8499	10	0.87932	D	0	.	18.6639	0.91481	0.0:1.0:0.0:0.0	.	803	Q9NRM7	LATS2_HUMAN	C	803	ENSP00000372035:G803C;ENSP00000441817:G803C	ENSP00000372035:G803C	G	-	1	0	LATS2	20455438	1.000000	0.71417	0.930000	0.37139	0.994000	0.84299	7.237000	0.78164	2.633000	0.89246	0.555000	0.69702	GGT		0.458	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1			13	58	1	0	1.61879e-10	0.001368	2.74343e-10	13	58				
SGCG	6445	broad.mit.edu	37	13	23853548	23853548	+	Missense_Mutation	SNP	G	G	T	rs373442790		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr13:23853548G>T	ENST00000218867.3	+	5	560	c.436G>T	c.(436-438)Gac>Tac	p.D146Y	SGCG_ENST00000537476.1_Missense_Mutation_p.D146Y|SGCG_ENST00000545013.1_Missense_Mutation_p.D146Y	NM_000231.2	NP_000222	Q13326	SGCG_HUMAN	sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)	146					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.D146Y(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)		CAACTCCAACGACGGCAAGCC	0.383																																							uc001uom.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(436-438)GAC>TAC		gamma sarcoglycan							95.0	89.0	91.0					13																	23853548		2203	4300	6503	SO:0001583	missense	6445				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma		g.chr13:23853548G>T	U34976	CCDS9299.1	13q12-q13	2014-09-17	2002-08-29		ENSG00000102683	ENSG00000102683			10809	protein-coding gene	gene with protein product	"""Maghrebian myopathy (autosomal recessive)"", ""35kD dystrophin-associated glycoprotein"", ""limb girdle muscular dystrophy 2C (Duchenne-like muscular dystrophy, autosomal recessive)"", ""gamma sarcoglycan"""	608896	"""sarcoglycan, gamma (35kD dystrophin-associated glycoprotein)"""	DMDA1, MAM, LGMD2C		8968757	Standard	NM_000231		Approved	SCARMD2, DAGA4, SCG3, DMDA, TYPE, A4, MGC130048	uc001uom.2	Q13326	OTTHUMG00000016563	ENST00000218867.3:c.436G>T	13.37:g.23853548G>T	ENSP00000218867:p.Asp146Tyr					SGCG_uc009zzv.2_Missense_Mutation_p.D146Y|SGCG_uc009zzw.2_Missense_Mutation_p.D146Y	p.D146Y	NM_000231	NP_000222	Q13326	SGCG_HUMAN		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)	5	591	+		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)	146			Extracellular (Potential).		Q32M32|Q5T9J6	Missense_Mutation	SNP	ENST00000218867.3	37	c.436G>T	CCDS9299.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.186805	0.38609	.	.	ENSG00000102683	ENST00000218867;ENST00000537476;ENST00000545013	D;D;D	0.95001	-3.58;-3.58;-3.58	5.28	4.44	0.53790	.	0.323442	0.38663	N	0.001609	D	0.94951	0.8367	M	0.79475	2.455	0.50813	D	0.999895	P	0.43542	0.81	P	0.48400	0.576	D	0.94421	0.7641	10	0.66056	D	0.02	-5.9209	10.3821	0.44119	0.1501:0.0:0.8499:0.0	.	146	Q13326	SGCG_HUMAN	Y	146	ENSP00000218867:D146Y;ENSP00000444100:D146Y;ENSP00000442232:D146Y	ENSP00000218867:D146Y	D	+	1	0	SGCG	22751548	0.995000	0.38212	0.895000	0.35142	0.310000	0.27922	2.002000	0.40835	1.255000	0.44051	-0.225000	0.12378	GAC		0.383	SGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044151.1	NM_000231		10	39	1	0	0.000978159	0.000978	0.00120216	10	39				
SIAH3	283514	broad.mit.edu	37	13	46425646	46425646	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr13:46425646G>T	ENST00000400405.2	-	1	225	c.119C>A	c.(118-120)cCc>cAc	p.P40H		NM_198849.2	NP_942146.2	Q8IW03	SIAH3_HUMAN	siah E3 ubiquitin protein ligase family member 3	40					multicellular organismal development (GO:0007275)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.P40H(1)		large_intestine(3)|lung(7)|ovary(1)|skin(1)	12						GTTGTGTGTGGGGTTGACGAC	0.537																																							uc001vap.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(118-120)CCC>CAC		seven in absentia homolog 3							83.0	90.0	88.0					13																	46425646		1958	4161	6119	SO:0001583	missense	283514				multicellular organismal development|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding	g.chr13:46425646G>T		CCDS41883.1	13q14.12	2012-02-23	2012-02-23		ENSG00000215475	ENSG00000215475			30553	protein-coding gene	gene with protein product		615609	"""seven in absentia homolog 3 (Drosophila)"""			12477932	Standard	NM_198849		Approved	FLJ39203	uc001vap.3	Q8IW03	OTTHUMG00000016862	ENST00000400405.2:c.119C>A	13.37:g.46425646G>T	ENSP00000383256:p.Pro40His						p.P40H	NM_198849	NP_942146	Q8IW03	SIAH3_HUMAN			1	201	-			40					B7ZBP0|Q8N8M6	Missense_Mutation	SNP	ENST00000400405.2	37	c.119C>A	CCDS41883.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032547	0.54790	.	.	ENSG00000215475	ENST00000400405	.	.	.	5.25	5.25	0.73442	.	0.000000	0.64402	U	0.000001	T	0.65943	0.2740	N	0.24115	0.695	0.43750	D	0.996257	D	0.89917	1.0	D	0.85130	0.997	T	0.70432	-0.4873	9	0.87932	D	0	.	18.2056	0.89853	0.0:0.0:1.0:0.0	.	40	Q8IW03	SIAH3_HUMAN	H	40	.	ENSP00000383256:P40H	P	-	2	0	SIAH3	45323647	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	6.386000	0.73186	2.618000	0.88619	0.655000	0.94253	CCC		0.537	SIAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044788.2	NM_198849		11	76	1	0	0.00010058	0.001368	0.000129202	11	76				
HTR2A	3356	broad.mit.edu	37	13	47466725	47466725	+	Splice_Site	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr13:47466725C>A	ENST00000378688.4	-	2	544	c.413G>T	c.(412-414)gGg>gTg	p.G138V	HTR2A_ENST00000543956.1_Splice_Site_p.W54L|HTR2A_ENST00000542664.1_Splice_Site_p.G138V			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	138					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.G138V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CCACCGGTACCCTATGAGGCA	0.567																																							uc001vbq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6						c.(412-414)GGG>GTG		5-hydroxytryptamine receptor 2A isoform 1	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)						78.0	77.0	77.0					13																	47466725		2203	4300	6503	SO:0001630	splice_region_variant	3356				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity	g.chr13:47466725C>A	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.413-1G>T	13.37:g.47466725C>A						HTR2A_uc001vbr.2_Missense_Mutation_p.W38L|HTR2A_uc010acr.2_Missense_Mutation_p.G138V	p.G138V	NM_000621	NP_000612	P28223	5HT2A_HUMAN		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	2	547	-		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)	138			Extracellular (By similarity).		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	ENST00000378688.4	37	c.413G>T	CCDS9405.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.58|15.58	2.876279|2.876279	0.51801|0.51801	.|.	.|.	ENSG00000102468|ENSG00000102468	ENST00000378688;ENST00000542664|ENST00000543956	T;T|T	0.26518|0.70282	1.73;1.73|-0.47	6.16|6.16	6.16|6.16	0.99307|0.99307	GPCR, rhodopsin-like superfamily (1);|.	0.119144|.	0.56097|.	D|.	0.000030|.	T|T	0.70631|0.70631	0.3246|0.3246	M|M	0.84948|0.84948	2.725|2.725	0.80722|0.80722	D|D	1|1	D|B	0.57257|0.22414	0.979|0.069	P|B	0.59825|0.21360	0.864|0.034	T|T	0.64385|0.64385	-0.6420|-0.6420	10|9	0.87932|0.09590	D|T	0|0.72	.|.	13.0629|13.0629	0.59018|0.59018	0.0:0.9276:0.0:0.0724|0.0:0.9276:0.0:0.0724	.|.	138|54	P28223|F5GWE8	5HT2A_HUMAN|.	V|L	138|54	ENSP00000367959:G138V;ENSP00000437737:G138V|ENSP00000441861:W54L	ENSP00000367959:G138V|ENSP00000441861:W54L	G|W	-|-	2|2	0|0	HTR2A|HTR2A	46364726|46364726	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.279000|0.279000	0.26890|0.26890	3.208000|3.208000	0.51114|0.51114	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GGG|TGG		0.567	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621	Missense_Mutation	16	58	1	0	6.94344e-10	0.006122	1.14071e-09	16	58				
LECT1	11061	broad.mit.edu	37	13	53286963	53286963	+	Silent	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr13:53286963A>T	ENST00000377962.3	-	5	588	c.510T>A	c.(508-510)ctT>ctA	p.L170L	LECT1_ENST00000448904.2_Silent_p.L170L			O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1	170	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				cartilage development (GO:0051216)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|proteoglycan metabolic process (GO:0006029)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)		p.L170L(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		CCACCCAGATAAGAGAATTTT	0.398																																							uc001vhf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(508-510)CTT>CTA		leukocyte cell derived chemotaxin 1 isoform 1							72.0	73.0	73.0					13																	53286963		2203	4300	6503	SO:0001819	synonymous_variant	11061				cartilage development|proteoglycan metabolic process	endomembrane system|extracellular region|integral to membrane		g.chr13:53286963A>T	AB006000	CCDS9437.1, CCDS45051.1	13q14.3	2012-10-10			ENSG00000136110	ENSG00000136110		"""BRICHOS domain containing"""	17005	protein-coding gene	gene with protein product	"""BRICHOS domain containing 3"""	605147	"""multiple myeloma tumor suppressor 1"""	MYETS1		9731231, 10103018	Standard	XM_006719760		Approved	CHM-I, CHM1, chondromodulin, BRICD3	uc001vhf.2	O75829	OTTHUMG00000016980	ENST00000377962.3:c.510T>A	13.37:g.53286963A>T						LECT1_uc001vhg.2_Silent_p.L170L|LECT1_uc001vhh.2_Silent_p.L159L	p.L170L	NM_007015	NP_008946	O75829	LECT1_HUMAN		GBM - Glioblastoma multiforme(99;3.38e-08)	5	621	-		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	170			BRICHOS.		Q5TAM4|Q8TAY6|Q9UM18	Silent	SNP	ENST00000377962.3	37	c.510T>A	CCDS9437.1																																																																																				0.398	LECT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045110.3			30	94	0	0	0	0.008361	0	30	94				
GPR18	2841	broad.mit.edu	37	13	99908075	99908075	+	Missense_Mutation	SNP	G	G	T	rs138394107		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr13:99908075G>T	ENST00000340807.3	-	3	608	c.52C>A	c.(52-54)Cca>Aca	p.P18T	UBAC2_ENST00000376440.2_Intron|UBAC2_ENST00000403766.3_Intron|GPR18_ENST00000397473.2_Missense_Mutation_p.P18T|GPR18_ENST00000397470.2_Missense_Mutation_p.P18T			Q14330	GPR18_HUMAN	G protein-coupled receptor 18	18					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P18T(1)		endometrium(2)|large_intestine(2)|lung(6)	10	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Glycine(DB00145)	TATTCATCTGGATGTGAGCTG	0.358																																							uc001voe.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(52-54)CCA>ACA		G protein-coupled receptor 18	Glycine(DB00145)						142.0	139.0	140.0					13																	99908075		2203	4300	6503	SO:0001583	missense	2841					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr13:99908075G>T	L42324	CCDS9491.1	13q32	2014-01-30			ENSG00000125245	ENSG00000125245		"""GPCR / Class A : Orphans"""	4472	protein-coding gene	gene with protein product		602042				9205118	Standard	NM_005292		Approved		uc010afv.3	Q14330	OTTHUMG00000017266	ENST00000340807.3:c.52C>A	13.37:g.99908075G>T	ENSP00000343428:p.Pro18Thr					UBAC2_uc001voa.3_Intron|UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron|GPR18_uc010afv.2_Missense_Mutation_p.P18T	p.P18T	NM_005292	NP_005283	Q14330	GPR18_HUMAN			3	553	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		18			Extracellular (Potential).		Q6GTM3|Q96HI6|Q9H2L2	Missense_Mutation	SNP	ENST00000340807.3	37	c.52C>A	CCDS9491.1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.473244	0.26423	.	.	ENSG00000125245	ENST00000397473;ENST00000397470;ENST00000340807;ENST00000416594	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.95	5.1	0.69264	.	0.060355	0.64402	D	0.000002	T	0.18923	0.0454	N	0.08118	0	0.48288	D	0.999625	P	0.48407	0.91	B	0.40636	0.335	T	0.04537	-1.0944	9	.	.	.	-10.7439	10.977	0.47472	0.1416:0.0:0.8584:0.0	.	18	Q14330	GPR18_HUMAN	T	18	ENSP00000380613:P18T;ENSP00000380610:P18T;ENSP00000343428:P18T;ENSP00000401611:P18T	.	P	-	1	0	GPR18	98706076	1.000000	0.71417	0.305000	0.25099	0.091000	0.18340	4.329000	0.59260	1.512000	0.48834	0.563000	0.77884	CCA		0.358	GPR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045585.1			30	112	1	0	8.88839e-20	0.002096	1.90804e-19	30	112				
NALCN	259232	broad.mit.edu	37	13	102047695	102047695	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr13:102047695T>A	ENST00000251127.6	-	3	211	c.130A>T	c.(130-132)Atc>Ttc	p.I44F	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376200.5_Missense_Mutation_p.I44F|NALCN_ENST00000376196.3_Missense_Mutation_p.I44F	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	44					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.I44F(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATGGCACAGATGCGCAGCAAA	0.433																																							uc001vox.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(130-132)ATC>TTC		voltage gated channel like 1							126.0	103.0	111.0					13																	102047695		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:102047695T>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.130A>T	13.37:g.102047695T>A	ENSP00000251127:p.Ile44Phe					NALCN_uc001voy.2_5'UTR|NALCN_uc001voz.2_Missense_Mutation_p.I44F|NALCN_uc001vpa.2_Missense_Mutation_p.I44F	p.I44F	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			3	319	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		44			Helical; Name=S1 of repeat I; (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.130A>T	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.462048	0.43736	.	.	ENSG00000102452	ENST00000251127;ENST00000376196;ENST00000376200;ENST00000449582	D;D;D	0.97114	-4.25;-4.25;-4.25	5.67	4.5	0.54988	.	0.157770	0.64402	D	0.000019	D	0.89406	0.6706	N	0.02539	-0.55	0.53688	D	0.999978	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	D	0.83671	0.0166	10	0.26408	T	0.33	.	11.5037	0.50451	0.0:0.0702:0.0:0.9298	.	44;44	F2Z323;Q8IZF0	.;NALCN_HUMAN	F	44	ENSP00000251127:I44F;ENSP00000365367:I44F;ENSP00000365373:I44F	ENSP00000251127:I44F	I	-	1	0	NALCN	100845696	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.365000	0.59486	0.992000	0.38840	0.459000	0.35465	ATC		0.433	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		9	54	0	0	0	0.004482	0	9	54				
OR4M1	441670	broad.mit.edu	37	14	20248962	20248962	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:20248962G>T	ENST00000315957.4	+	1	562	c.481G>T	c.(481-483)Gct>Tct	p.A161S		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A161S(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AATACAGGTGGCTCTCATTGT	0.512																																							uc010tku.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(481-483)GCT>TCT		olfactory receptor, family 4, subfamily M,							248.0	256.0	253.0					14																	20248962		2203	4300	6503	SO:0001583	missense	441670				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20248962G>T		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.481G>T	14.37:g.20248962G>T	ENSP00000319654:p.Ala161Ser						p.A161S	NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	481	+	all_cancers(95;0.00108)		161			Extracellular (Potential).		B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	c.481G>T	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	9.711	1.157048	0.21454	.	.	ENSG00000176299	ENST00000315957	T	0.37058	1.22	4.43	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	0.133415	0.34435	N	0.003970	T	0.16385	0.0394	N	0.10837	0.055	0.27130	N	0.961925	B	0.20887	0.049	B	0.26693	0.072	T	0.12016	-1.0564	10	0.27785	T	0.31	-0.0056	3.3328	0.07091	0.0953:0.1716:0.5561:0.177	.	161	Q8NGD0	OR4M1_HUMAN	S	161	ENSP00000319654:A161S	ENSP00000319654:A161S	A	+	1	0	OR4M1	19318802	0.000000	0.05858	0.997000	0.53966	0.984000	0.73092	-0.104000	0.10923	0.603000	0.29913	0.506000	0.49869	GCT		0.512	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1			31	244	1	0	8.16721e-17	0.002096	1.63007e-16	31	244				
DHRS4	10901	broad.mit.edu	37	14	24435560	24435560	+	Silent	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:24435560G>C	ENST00000313250.5	+	6	803	c.600G>C	c.(598-600)ctG>ctC	p.L200L	DHRS4_ENST00000558263.1_Intron|DHRS4_ENST00000397073.2_Intron|DHRS4_ENST00000558581.1_Silent_p.L166L|DHRS4_ENST00000397075.3_Intron|DHRS4_ENST00000421831.1_Silent_p.L148L|DHRS4_ENST00000397074.3_Intron|DHRS4_ENST00000559632.1_Intron|DHRS4_ENST00000543741.2_Intron|DHRS4_ENST00000308178.8_Intron|DHRS4_ENST00000382761.3_Intron	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4	200					alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)	p.L200L(1)		central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	CCATAGAGCTGGCCCCAAGGA	0.507																																							uc001wla.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(598-600)CTG>CTC		peroxisomal short-chain alcohol dehydrogenase	Vitamin A(DB00162)						155.0	134.0	141.0					14																	24435560		2201	4300	6501	SO:0001819	synonymous_variant	10901					mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity	g.chr14:24435560G>C	AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.600G>C	14.37:g.24435560G>C						DHRS4_uc010aky.2_Intron|DHRS4_uc001wlb.2_Silent_p.L166L|DHRS4_uc010akz.2_Intron|DHRS4_uc001wlc.3_Silent_p.L200L|DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron	p.L200L	NM_021004	NP_066284	Q9BTZ2	DHRS4_HUMAN		GBM - Glioblastoma multiforme(265;0.00962)	6	633	+			200					B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Silent	SNP	ENST00000313250.5	37	c.600G>C	CCDS9605.1																																																																																				0.507	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071857.3			14	180	0	0	0	0.003163	0	14	180				
LRFN5	145581	broad.mit.edu	37	14	42355863	42355863	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:42355863G>A	ENST00000298119.4	+	3	1224	c.35G>A	c.(34-36)gGc>gAc	p.G12D	LRFN5_ENST00000554120.1_Missense_Mutation_p.G12D|LRFN5_ENST00000554171.1_Missense_Mutation_p.G12D	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	12						integral component of membrane (GO:0016021)		p.G12D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TTTCTCATTGGCATAGCAGTG	0.373										HNSCC(30;0.082)																													uc001wvm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(34-36)GGC>GAC		leucine rich repeat and fibronectin type III							71.0	67.0	69.0					14																	42355863		2203	4300	6503	SO:0001583	missense	145581					integral to membrane		g.chr14:42355863G>A	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.35G>A	14.37:g.42355863G>A	ENSP00000298119:p.Gly12Asp	HNSCC(30;0.082)				LRFN5_uc010ana.2_Missense_Mutation_p.G12D	p.G12D	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	3	1233	+			12					B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	c.35G>A	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071219	0.55646	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.52295	0.78;0.67;0.67	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000020	T	0.52853	0.1760	M	0.62723	1.935	0.58432	D	0.999999	P;P	0.40794	0.696;0.729	B;B	0.43413	0.419;0.317	T	0.54289	-0.8316	10	0.48119	T	0.1	.	17.0193	0.86429	0.0:0.0:1.0:0.0	.	12;12	G3V364;Q96NI6	.;LRFN5_HUMAN	D	12	ENSP00000298119:G12D;ENSP00000451897:G12D;ENSP00000451067:G12D	ENSP00000298119:G12D	G	+	2	0	LRFN5	41425613	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.274000	0.65569	2.595000	0.87683	0.650000	0.86243	GGC		0.373	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		11	52	0	0	0	0.000978	0	11	52				
FSCB	84075	broad.mit.edu	37	14	44975985	44975985	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:44975985G>T	ENST00000340446.4	-	1	497	c.206C>A	c.(205-207)aCt>aAt	p.T69N	RP11-163M18.1_ENST00000556228.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	69						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)	p.T69N(1)		breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		AGACTTACTAGTCATTTCCTG	0.423																																							uc001wvn.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9						c.(205-207)ACT>AAT		fibrous sheath CABYR binding protein							171.0	165.0	167.0					14																	44975985		2203	4300	6503	SO:0001583	missense	84075					cilium		g.chr14:44975985G>T	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.206C>A	14.37:g.44975985G>T	ENSP00000344579:p.Thr69Asn						p.T69N	NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN		GBM - Glioblastoma multiforme(112;0.128)	1	515	-			69					Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	c.206C>A	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	G	9.487	1.099784	0.20552	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.14516	2.5	5.25	-4.5	0.03493	.	.	.	.	.	T	0.11410	0.0278	L	0.50333	1.59	0.09310	N	1	B	0.31790	0.34	B	0.35971	0.215	T	0.34650	-0.9820	9	0.72032	D	0.01	-1.0E-4	3.0033	0.06020	0.5239:0.1241:0.2256:0.1264	.	69	Q5H9T9	FSCB_HUMAN	N	69	ENSP00000344579:T69N	ENSP00000344579:T69N	T	-	2	0	FSCB	44045735	0.004000	0.15560	0.000000	0.03702	0.046000	0.14306	0.018000	0.13422	-0.936000	0.03723	-1.102000	0.02115	ACT		0.423	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		27	129	1	0	7.92952e-12	0.003954	1.38767e-11	27	129				
RPL10L	140801	broad.mit.edu	37	14	47120853	47120853	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:47120853G>T	ENST00000298283.3	-	1	175	c.87C>A	c.(85-87)gcC>gcA	p.A29A		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	29					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)	p.A29A(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						TGCGGATCTTGGCATCAGGAA	0.527																																							uc001wwg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(85-87)GCC>GCA		ribosomal protein L10-like protein							106.0	110.0	109.0					14																	47120853		2203	4300	6503	SO:0001819	synonymous_variant	140801				spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome	g.chr14:47120853G>T	AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.87C>A	14.37:g.47120853G>T							p.A29A	NM_080746	NP_542784	Q96L21	RL10L_HUMAN			1	176	-			29					Q8IUD1	Silent	SNP	ENST00000298283.3	37	c.87C>A	CCDS32071.1																																																																																				0.527	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349819.1			18	148	1	0	4.75885e-15	0.00499	9.01382e-15	18	148				
KCNH5	27133	broad.mit.edu	37	14	63447817	63447817	+	Nonsense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:63447817T>A	ENST00000322893.7	-	6	983	c.715A>T	c.(715-717)Aaa>Taa	p.K239*	KCNH5_ENST00000420622.2_Nonsense_Mutation_p.K239*|KCNH5_ENST00000394964.2_Nonsense_Mutation_p.K181*|KCNH5_ENST00000394968.1_Nonsense_Mutation_p.K181*	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	239					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.K181*(1)|p.K239*(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TGCTTTGTTTTGAAGGAAACA	0.368																																							uc001xfx.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(715-717)AAA>TAA		potassium voltage-gated channel, subfamily H,							78.0	79.0	79.0					14																	63447817		2203	4300	6503	SO:0001587	stop_gained	27133				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity	g.chr14:63447817T>A	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.715A>T	14.37:g.63447817T>A	ENSP00000321427:p.Lys239*					KCNH5_uc001xfy.2_Nonsense_Mutation_p.K239*|KCNH5_uc001xfz.1_Nonsense_Mutation_p.K181*|KCNH5_uc001xga.2_Nonsense_Mutation_p.K181*	p.K239*	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)	6	766	-			239			Extracellular (Potential).		C9JP98	Nonsense_Mutation	SNP	ENST00000322893.7	37	c.715A>T	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	T	38	6.692931	0.97768	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4682	0.75419	0.0:0.0:0.0:1.0	.	.	.	.	X	239;239;181;181	.	ENSP00000321427:K239X	K	-	1	0	KCNH5	62517570	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.985000	0.88162	2.059000	0.61396	0.477000	0.44152	AAA		0.368	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318		7	48	0	0	0	0.001984	0	7	48				
GPHB5	122876	broad.mit.edu	37	14	63784422	63784422	+	RNA	SNP	G	G	T	rs536665506	byFrequency	TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:63784422G>T	ENST00000539258.1	-	0	198							Q86YW7	GPHB5_HUMAN	glycoprotein hormone beta 5						regulation of thyroid hormone mediated signaling pathway (GO:0002155)	extracellular region (GO:0005576)		p.P48T(2)		breast(1)|endometrium(1)|lung(4)|urinary_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(108;0.00372)|all cancers(60;0.0226)|BRCA - Breast invasive adenocarcinoma(234;0.0978)		CTGCAGCCTGGCTTCTTGGCC	0.597																																							uc010apu.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(142-144)CCA>ACA		glycoprotein beta 5							41.0	45.0	44.0					14																	63784422		2011	4172	6183			122876					extracellular region	hormone activity	g.chr14:63784422G>T	AF467770	CCDS73643.1	14q23.3	2006-09-25				ENSG00000179600			18055	protein-coding gene	gene with protein product		609652					Standard	NM_145171		Approved	ZLUT1, GPB5	uc021rud.1	Q86YW7			14.37:g.63784422G>T						GPHB5_uc001xgc.2_Missense_Mutation_p.P38T	p.P48T	NM_145171	NP_660154	Q86YW7	GPHB5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00372)|all cancers(60;0.0226)|BRCA - Breast invasive adenocarcinoma(234;0.0978)	1	142	-			48					Q6NTD0|Q8NFW2	Missense_Mutation	SNP	ENST00000539258.1	37	c.142C>A																																																																																					0.597	GPHB5-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000400582.1	NM_145171		8	40	1	0	5.18039e-06	0.00308	7.14894e-06	8	40				
SYNE2	23224	broad.mit.edu	37	14	64516346	64516346	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:64516346G>C	ENST00000344113.4	+	47	7607	c.7395G>C	c.(7393-7395)ttG>ttC	p.L2465F	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.L2498F|SYNE2_ENST00000358025.3_Missense_Mutation_p.L2465F	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2465					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.L2465F(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATACCCAGTTGGAAGCAAAGA	0.358																																							uc001xgm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(7393-7395)TTG>TTC		spectrin repeat containing, nuclear envelope 2							63.0	61.0	62.0					14																	64516346		1832	4089	5921	SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64516346G>C	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.7395G>C	14.37:g.64516346G>C	ENSP00000341781:p.Leu2465Phe					SYNE2_uc001xgl.2_Missense_Mutation_p.L2465F	p.L2465F	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	47	7625	+			2465			Potential.|Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.7395G>C	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.338363	0.24253	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.71934	-0.04;-0.04;-0.61	5.68	1.79	0.24919	.	0.000000	0.46758	D	0.000279	T	0.54743	0.1877	L	0.32530	0.975	0.80722	D	1	P;P	0.41041	0.618;0.736	B;B	0.38500	0.142;0.275	T	0.50127	-0.8864	10	0.72032	D	0.01	.	6.2519	0.20850	0.2042:0.0:0.667:0.1288	.	2465;2465	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	F	2465;2465;2498;2498	ENSP00000350719:L2465F;ENSP00000341781:L2465F;ENSP00000452570:L2498F	ENSP00000261678:L2498F	L	+	3	2	SYNE2	63586099	1.000000	0.71417	0.852000	0.33557	0.298000	0.27526	1.855000	0.39378	0.070000	0.16634	-0.237000	0.12165	TTG		0.358	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		7	43	0	0	0	0.001984	0	7	43				
YBX1P1	50631	broad.mit.edu	37	14	66480164	66480164	+	RNA	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:66480164C>T	ENST00000458915.1	-	0	0																		p.G94D(1)									TGCCTTCGCACCCTTTTCTCC	0.483																																							uc001xit.2		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(343-345)GGT>GAT		SubName: Full=Nuclease sensitive element binding protein-1;																																						0							g.chr14:66480164C>T																													14.37:g.66480164C>T							p.G115D							1	469	-									Missense_Mutation	SNP	ENST00000458915.1	37	c.344G>A																																																																																					0.483	AL391261.1-201	NOVEL	basic	miRNA	miRNA				32	147	0	0	0	0.003271	0	32	147				
SERPINA6	866	broad.mit.edu	37	14	94770786	94770786	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:94770786A>G	ENST00000341584.3	-	5	1333	c.1187T>C	c.(1186-1188)cTt>cCt	p.L396P		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	396					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)	p.L396P(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	CGCCAGGAAAAGGCTGCTCCA	0.527																																							uc001ycv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|central_nervous_system(1)	5						c.(1186-1188)CTT>CCT		corticosteroid binding globulin precursor	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)						151.0	129.0	136.0					14																	94770786		2203	4300	6503	SO:0001583	missense	866				regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding	g.chr14:94770786A>G	J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.1187T>C	14.37:g.94770786A>G	ENSP00000342850:p.Leu396Pro					SERPINA6_uc010auv.2_RNA	p.L396P	NM_001756	NP_001747	P08185	CBG_HUMAN		COAD - Colon adenocarcinoma(157;0.211)	5	1291	-		all_cancers(154;0.0482)|all_epithelial(191;0.166)	396					A8K456|Q7Z2Q9	Missense_Mutation	SNP	ENST00000341584.3	37	c.1187T>C	CCDS9924.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.792172	0.50102	.	.	ENSG00000170099	ENST00000341584	D	0.91631	-2.88	4.83	3.68	0.42216	Serpin domain (3);	0.118547	0.36854	N	0.002373	D	0.95924	0.8673	M	0.93150	3.385	0.80722	D	1	D	0.55800	0.973	P	0.60068	0.868	D	0.95443	0.8527	10	0.87932	D	0	.	8.9798	0.35957	0.914:0.0:0.086:0.0	.	396	P08185	CBG_HUMAN	P	396	ENSP00000342850:L396P	ENSP00000342850:L396P	L	-	2	0	SERPINA6	93840539	0.871000	0.30034	0.238000	0.24106	0.511000	0.34104	6.170000	0.71920	0.977000	0.38444	0.533000	0.62120	CTT		0.527	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413065.1	NM_001756		3	107	0	0	0	0.000248	0	3	107				
EVL	51466	broad.mit.edu	37	14	100604129	100604129	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:100604129C>G	ENST00000402714.2	+	11	1682	c.1078C>G	c.(1078-1080)Cct>Gct	p.P360A	EVL_ENST00000392920.3_Missense_Mutation_p.P362A|EVL_ENST00000544450.2_Missense_Mutation_p.P366A			Q9UI08	EVL_HUMAN	Enah/Vasp-like	360	EVH2.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)	p.P362A(1)		cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				TCAGTCGCAGCCTCACTCTAG	0.607																																							uc001ygt.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)	3						c.(1078-1080)CCT>GCT		Enah/Vasp-like							107.0	104.0	105.0					14																	100604129		2203	4300	6503	SO:0001583	missense	51466				actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding	g.chr14:100604129C>G	AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.1078C>G	14.37:g.100604129C>G	ENSP00000384720:p.Pro360Ala					EVL_uc001ygv.2_Missense_Mutation_p.P366A|EVL_uc001ygu.2_Missense_Mutation_p.P362A|EVL_uc010avu.2_Missense_Mutation_p.P219A	p.P360A	NM_016337	NP_057421	Q9UI08	EVL_HUMAN			11	1317	+		Melanoma(154;0.152)	360			EVH2.		A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	ENST00000402714.2	37	c.1078C>G		.	.	.	.	.	.	.	.	.	.	C	14.15	2.450265	0.43531	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470	T;T;T	0.70869	-0.44;-0.52;-0.46	4.73	4.73	0.59995	.	0.300842	0.23494	N	0.047569	T	0.62466	0.2430	L	0.44542	1.39	0.29694	N	0.840732	P;B;B	0.37061	0.58;0.143;0.147	B;B;B	0.35114	0.196;0.143;0.046	T	0.63278	-0.6673	10	0.34782	T	0.22	-6.6797	14.4492	0.67372	0.0:0.8408:0.1592:0.0	.	366;362;360	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	A	360;366;362;325	ENSP00000384720:P360A;ENSP00000437904:P366A;ENSP00000376652:P362A	ENSP00000376652:P362A	P	+	1	0	EVL	99673882	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.768000	0.47645	2.163000	0.67991	0.561000	0.74099	CCT		0.607	EVL-006	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000413958.1			16	91	0	0	0	0.004007	0	16	91				
DLK1	8788	broad.mit.edu	37	14	101200835	101200835	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:101200835C>T	ENST00000341267.4	+	5	996	c.754C>T	c.(754-756)Ccc>Tcc	p.P252S	DLK1_ENST00000331224.6_Intron	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	252					cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.P252S(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				CGCGCTGAGCCCCCAGCAGGT	0.677																																							uc001yhs.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|skin(1)	4						c.(754-756)CCC>TCC		delta-like 1 homolog precursor							34.0	40.0	38.0					14																	101200835		2203	4299	6502	SO:0001583	missense	8788				multicellular organismal development	extracellular space|integral to membrane|soluble fraction		g.chr14:101200835C>T	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.754C>T	14.37:g.101200835C>T	ENSP00000340292:p.Pro252Ser					DLK1_uc001yhu.3_Intron	p.P252S	NM_003836	NP_003827	P80370	DLK1_HUMAN			5	907	+		Melanoma(154;0.155)	252			Extracellular (Potential).		P15803|Q96DW5	Missense_Mutation	SNP	ENST00000341267.4	37	c.754C>T	CCDS9963.1	.	.	.	.	.	.	.	.	.	.	C	3.212	-0.161466	0.06502	.	.	ENSG00000185559	ENST00000341267	D	0.87103	-2.21	3.94	2.05	0.26809	.	0.635159	0.14454	N	0.318581	T	0.72614	0.3482	N	0.17082	0.46	0.39245	D	0.963936	B	0.14012	0.009	B	0.08055	0.003	T	0.58504	-0.7625	9	.	.	.	.	5.3881	0.16229	0.0:0.6236:0.1693:0.207	.	252	P80370	DLK1_HUMAN	S	252	ENSP00000340292:P252S	.	P	+	1	0	DLK1	100270588	0.000000	0.05858	0.687000	0.30102	0.480000	0.33159	-0.930000	0.03972	0.253000	0.21552	0.491000	0.48974	CCC		0.677	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1			12	58	0	0	0	0.001855	0	12	58				
AHNAK2	113146	broad.mit.edu	37	14	105419467	105419467	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:105419467T>C	ENST00000333244.5	-	7	2440	c.2321A>G	c.(2320-2322)aAg>aGg	p.K774R	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	774						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.K774R(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTTGGGGCCCTTGAGGTCCAC	0.632																																							uc010axc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2320-2322)AAG>AGG		AHNAK nucleoprotein 2							118.0	130.0	126.0					14																	105419467		1866	4095	5961	SO:0001583	missense	113146					nucleus		g.chr14:105419467T>C	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2321A>G	14.37:g.105419467T>C	ENSP00000353114:p.Lys774Arg					AHNAK2_uc001ypx.2_Missense_Mutation_p.K674R	p.K774R	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	2441	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	774					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.2321A>G	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	t	14.78	2.638313	0.47153	.	.	ENSG00000185567	ENST00000333244	T	0.00882	5.58	2.33	2.33	0.28932	.	.	.	.	.	T	0.03959	0.0111	M	0.81802	2.56	0.09310	N	1	D	0.69078	0.997	D	0.66979	0.948	T	0.37842	-0.9688	9	0.21014	T	0.42	-12.8967	8.9	0.35487	0.0:0.0:0.0:1.0	.	774	Q8IVF2	AHNK2_HUMAN	R	774	ENSP00000353114:K774R	ENSP00000353114:K774R	K	-	2	0	AHNAK2	104490512	0.012000	0.17670	0.003000	0.11579	0.020000	0.10135	1.131000	0.31406	1.028000	0.39785	0.397000	0.26171	AAG		0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		46	275	0	0	0	0.00361	0	46	275				
PLCB2	5330	broad.mit.edu	37	15	40586546	40586546	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr15:40586546A>G	ENST00000260402.3	-	19	2231	c.1982T>C	c.(1981-1983)aTg>aCg	p.M661T	PLCB2_ENST00000456256.2_Missense_Mutation_p.M661T|PLCB2_ENST00000557821.1_Missense_Mutation_p.M657T	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	661	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.M657T(1)|p.M661T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CGGCCGGCGCATGAACTCATG	0.582																																							uc001zld.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|breast(3)|kidney(1)|pancreas(1)	8						c.(1981-1983)ATG>ACG		phospholipase C, beta 2							71.0	77.0	75.0					15																	40586546		2157	4256	6413	SO:0001583	missense	5330				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr15:40586546A>G		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.1982T>C	15.37:g.40586546A>G	ENSP00000260402:p.Met661Thr					PLCB2_uc010bbo.2_Missense_Mutation_p.M657T|PLCB2_uc010ucm.1_Missense_Mutation_p.M661T	p.M661T	NM_004573	NP_004564	Q00722	PLCB2_HUMAN		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)	19	2283	-		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	661			PI-PLC Y-box.		A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	37	c.1982T>C	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.969266	0.74246	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.56611	0.45;0.45	4.69	4.69	0.59074	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.047717	0.85682	D	0.000000	T	0.81688	0.4875	H	0.97240	3.965	0.80722	D	1	D;D;D	0.89917	0.998;0.997;1.0	D;D;D	0.87578	0.963;0.998;0.993	D	0.88309	0.2955	10	0.87932	D	0	.	14.3151	0.66443	1.0:0.0:0.0:0.0	.	661;657;661	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	T	661	ENSP00000260402:M661T;ENSP00000411991:M661T	ENSP00000260402:M661T	M	-	2	0	PLCB2	38373838	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.139000	0.94554	1.984000	0.57885	0.459000	0.35465	ATG		0.582	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1			15	56	0	0	0	0.00245	0	15	56				
TRIM69	140691	broad.mit.edu	37	15	45059693	45059693	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr15:45059693C>T	ENST00000559390.1	+	8	2154	c.1226C>T	c.(1225-1227)cCt>cTt	p.P409L	TRIM69_ENST00000558329.1_Missense_Mutation_p.P188L|TRIM69_ENST00000558173.1_Missense_Mutation_p.P205L|TRIM69_ENST00000560442.1_Missense_Mutation_p.P205L|TRIM69_ENST00000338264.4_Missense_Mutation_p.P250L|TRIM69_ENST00000561043.1_Missense_Mutation_p.P172L|TRIM69_ENST00000329464.4_Missense_Mutation_p.P409L			Q86WT6	TRI69_HUMAN	tripartite motif containing 69	409	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P409L(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(9)|skin(1)	20		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)		CCTCTAACTCCTGAGCAAGGA	0.448																																					Pancreas(84;519 1450 1802 20427 34706)	Pancreas(84;519 1450 1802 20427 34706)	uc001zuf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1225-1227)CCT>CTT		tripartite motif-containing 69 isoform a							93.0	90.0	91.0					15																	45059693		2198	4298	6496	SO:0001583	missense	140691				apoptosis	nuclear speck	zinc ion binding	g.chr15:45059693C>T	AF302088	CCDS10114.1, CCDS32220.1, CCDS73719.1	15q15-q21	2013-01-09	2011-01-25	2006-09-26	ENSG00000185880	ENSG00000185880		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	17857	protein-coding gene	gene with protein product			"""ring finger protein 36"", ""tripartite motif-containing 69"""	RNF36			Standard	XM_005254162		Approved	Trif, TRIMLESS	uc001zug.1	Q86WT6	OTTHUMG00000131246	ENST00000559390.1:c.1226C>T	15.37:g.45059693C>T	ENSP00000453177:p.Pro409Leu					TRIM69_uc001zui.1_Missense_Mutation_p.P205L|TRIM69_uc010bdy.1_Missense_Mutation_p.P188L|TRIM69_uc001zug.1_Missense_Mutation_p.P409L|TRIM69_uc001zuh.1_Missense_Mutation_p.P250L	p.P409L	NM_182985	NP_892030	Q86WT6	TRI69_HUMAN		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)	8	2121	+		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)	409			B30.2/SPRY.		A8MX03|Q309B0|Q4G1A5|Q6W897|Q8IYY3|Q8WY16|Q8WY17	Missense_Mutation	SNP	ENST00000559390.1	37	c.1226C>T	CCDS32220.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561621	0.86335	.	.	ENSG00000185880	ENST00000329464;ENST00000338264	T;T	0.70516	-0.49;-0.49	5.21	5.21	0.72293	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000004	D	0.85234	0.5650	M	0.82630	2.6	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87152	0.2209	10	0.72032	D	0.01	.	16.615	0.84904	0.0:1.0:0.0:0.0	.	188;250;409	Q86WT6-4;Q86WT6-2;Q86WT6	.;.;TRI69_HUMAN	L	409;250	ENSP00000332284:P409L;ENSP00000342922:P250L	ENSP00000332284:P409L	P	+	2	0	TRIM69	42846985	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.871000	0.63042	2.593000	0.87608	0.655000	0.94253	CCT		0.448	TRIM69-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416171.1			5	84	0	0	0	0.000602	0	5	84				
SCG3	29106	broad.mit.edu	37	15	51991556	51991556	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr15:51991556G>C	ENST00000220478.3	+	9	1429	c.1026G>C	c.(1024-1026)aaG>aaC	p.K342N	SCG3_ENST00000542355.2_Missense_Mutation_p.K110N	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	342					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)	p.K342N(1)		breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		CCAAAAACAAGCTAGAAAAAA	0.313																																							uc002abh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1024-1026)AAG>AAC		secretogranin III isoform 1 precursor							104.0	111.0	108.0					15																	51991556		2195	4293	6488	SO:0001583	missense	29106				platelet activation|platelet degranulation	extracellular region|stored secretory granule		g.chr15:51991556G>C	AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.1026G>C	15.37:g.51991556G>C	ENSP00000220478:p.Lys342Asn					SCG3_uc010ufz.1_Missense_Mutation_p.K110N	p.K342N	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN		all cancers(107;0.00488)	9	1434	+			342					A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Missense_Mutation	SNP	ENST00000220478.3	37	c.1026G>C	CCDS10142.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432779	0.62844	.	.	ENSG00000104112	ENST00000220478;ENST00000542355	T;T	0.35605	1.3;1.3	5.14	-0.0148	0.13979	.	0.000000	0.85682	D	0.000000	T	0.43010	0.1228	L	0.34521	1.04	0.58432	D	0.999992	D	0.89917	1.0	D	0.85130	0.997	T	0.28586	-1.0039	10	0.87932	D	0	-15.3779	9.2358	0.37466	0.5482:0.0:0.4518:0.0	.	342	Q8WXD2	SCG3_HUMAN	N	342;110	ENSP00000220478:K342N;ENSP00000445205:K110N	ENSP00000220478:K342N	K	+	3	2	SCG3	49778848	0.999000	0.42202	0.999000	0.59377	0.994000	0.84299	0.413000	0.21148	0.075000	0.16796	-0.150000	0.13652	AAG		0.313	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254670.2	NM_013243		12	128	0	0	0	0.00245	0	12	128				
PTPLAD1	51495	broad.mit.edu	37	15	65847232	65847232	+	Silent	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr15:65847232A>T	ENST00000261875.5	+	3	304	c.138A>T	c.(136-138)ggA>ggT	p.G46G	PTPLAD1_ENST00000569894.1_5'UTR|PTPLAD1_ENST00000566511.1_5'UTR|PTPLAD1_ENST00000442729.2_Silent_p.G46G|PTPLAD1_ENST00000565299.1_Silent_p.G84G|PTPLAD1_ENST00000566074.1_5'UTR|PTPLAD1_ENST00000562901.1_5'UTR|RNU6-19P_ENST00000384718.1_RNA|PTPLAD1_ENST00000568793.1_Silent_p.G21G	NM_016395.2	NP_057479.2	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain containing 1	46	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				activation of JUN kinase activity (GO:0007257)|fatty acid biosynthetic process (GO:0006633)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|positive regulation of GTPase activity (GO:0043547)|Rac protein signal transduction (GO:0016601)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)	GTPase activator activity (GO:0005096)|lyase activity (GO:0016829)	p.G46G(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|pancreas(1)	5						TAGCTCAAGGACATGGTGCCA	0.438																																							uc002apc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(136-138)GGA>GGT		protein tyrosine phosphatase-like A domain							209.0	198.0	201.0					15																	65847232		1885	4117	6002	SO:0001819	synonymous_variant	51495				activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding	g.chr15:65847232A>T		CCDS45282.1	15q22.2	2005-11-11				ENSG00000074696			24175	protein-coding gene	gene with protein product		615940				10747961, 11042152	Standard	NM_016395		Approved	B-ind1, HSPC121	uc002apc.3	Q9P035		ENST00000261875.5:c.138A>T	15.37:g.65847232A>T						PTPLAD1_uc002apb.1_RNA|PTPLAD1_uc010uiw.1_Silent_p.G46G	p.G46G	NM_016395	NP_057479	Q9P035	HACD3_HUMAN			3	286	+			46			CS.|Cytoplasmic (Potential).		A0PJA1|B4DRF4|Q280Z3|Q6PD63|Q8IUI5|Q8NC86|Q8NCB1|Q96T12|Q9NQA7	Silent	SNP	ENST00000261875.5	37	c.138A>T	CCDS45282.1																																																																																				0.438	PTPLAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419739.1	NM_016395		27	198	0	0	0	0.005443	0	27	198				
CCDC33	80125	broad.mit.edu	37	15	74573106	74573106	+	Silent	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr15:74573106C>T	ENST00000398814.3	+	9	1418	c.987C>T	c.(985-987)ggC>ggT	p.G329G	CCDC33_ENST00000321288.5_Silent_p.G532G	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	532	C2.							p.G329G(1)|p.G532G(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CAGGGAAAGGCTTGGACGGGC	0.642																																							uc002axo.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|skin(2)	5						c.(985-987)GGC>GGT		coiled-coil domain containing 33 isoform 1							72.0	81.0	78.0					15																	74573106		1963	4150	6113	SO:0001819	synonymous_variant	80125						protein binding	g.chr15:74573106C>T	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.987C>T	15.37:g.74573106C>T						CCDC33_uc002axp.2_Silent_p.G151G	p.G329G	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN			9	1381	+			532					A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Silent	SNP	ENST00000398814.3	37	c.987C>T	CCDS42058.1																																																																																				0.642	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2	NM_182791		10	56	0	0	0	0.001855	0	10	56				
PEAK1	79834	broad.mit.edu	37	15	77471208	77471208	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr15:77471208C>A	ENST00000560626.2	-	4	3536	c.3061G>T	c.(3061-3063)Gag>Tag	p.E1021*	PEAK1_ENST00000558305.1_Nonsense_Mutation_p.E1021*|PEAK1_ENST00000312493.4_Nonsense_Mutation_p.E1021*			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1021					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.E1021Q(2)|p.E1021*(2)									AATGCATTCTCTGCTCTACCC	0.468																																							uc002bcm.2		NA																	4	Substitution - Nonsense(2)|Substitution - Missense(2)		lung(4)		0						c.(3061-3063)GAG>TAG		NKF3 kinase family member							135.0	128.0	130.0					15																	77471208		2038	4197	6235	SO:0001587	stop_gained	79834				cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr15:77471208C>A		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.3061G>T	15.37:g.77471208C>A	ENSP00000452796:p.Glu1021*					SGK269_uc002bcn.2_Nonsense_Mutation_p.E1021*	p.E1021*	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN		STAD - Stomach adenocarcinoma(199;0.124)	3	3369	-			1021					Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Nonsense_Mutation	SNP	ENST00000560626.2	37	c.3061G>T	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	C	43	10.075250	0.99331	.	.	ENSG00000173517	ENST00000312493	.	.	.	5.92	4.99	0.66335	.	0.283949	0.33938	N	0.004410	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-12.9324	13.7454	0.62872	0.0:0.6852:0.3148:0.0	.	.	.	.	X	1021	.	ENSP00000309230:E1021X	E	-	1	0	AC087465.1	75258263	0.915000	0.31059	0.162000	0.22713	0.005000	0.04900	2.029000	0.41098	1.481000	0.48307	0.655000	0.94253	GAG		0.468	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3			9	63	1	0	0.00448238	0.004482	0.00534565	9	63				
SLC28A1	9154	broad.mit.edu	37	15	85448795	85448795	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr15:85448795G>T	ENST00000286749.3	+	7	719	c.629G>T	c.(628-630)gGa>gTa	p.G210V	SLC28A1_ENST00000537703.1_Missense_Mutation_p.G132V|SLC28A1_ENST00000394573.1_Missense_Mutation_p.G210V|SLC28A1_ENST00000537624.1_Missense_Mutation_p.G210V|SLC28A1_ENST00000537216.1_Missense_Mutation_p.G210V|SLC28A1_ENST00000538177.1_Missense_Mutation_p.G210V			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	210					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)	p.G210V(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	GTGTCTTGGGGACTTGGACTG	0.582																																							uc002blg.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(628-630)GGA>GTA		solute carrier family 28, member 1 isoform 1							214.0	171.0	185.0					15																	85448795		2203	4299	6502	SO:0001583	missense	9154				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding	g.chr15:85448795G>T	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.629G>T	15.37:g.85448795G>T	ENSP00000286749:p.Gly210Val					SLC28A1_uc010upd.1_Missense_Mutation_p.G132V|SLC28A1_uc010bnb.2_Missense_Mutation_p.G210V|SLC28A1_uc010upe.1_Missense_Mutation_p.G210V|SLC28A1_uc010upf.1_Missense_Mutation_p.G210V|SLC28A1_uc010upg.1_Missense_Mutation_p.G210V	p.G210V	NM_004213	NP_004204	O00337	S28A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		8	831	+			210			Helical; (Potential).		A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	ENST00000286749.3	37	c.629G>T	CCDS10334.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373480	0.61624	.	.	ENSG00000156222	ENST00000537216;ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573;ENST00000537703	T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38	4.16	4.16	0.48862	Na dependent nucleoside transporter (1);	0.000000	0.85682	D	0.000000	T	0.55194	0.1905	H	0.97365	3.99	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0	T	0.70245	-0.4925	10	0.87932	D	0	-0.2289	12.167	0.54135	0.0:0.0:1.0:0.0	.	210;210;210;132;210	B7Z533;F5H560;B7Z3L6;B7Z3M4;O00337	.;.;.;.;S28A1_HUMAN	V	210;210;210;210;210;132	ENSP00000440546:G210V;ENSP00000443752:G210V;ENSP00000444700:G210V;ENSP00000286749:G210V;ENSP00000378074:G210V;ENSP00000443764:G132V	ENSP00000286749:G210V	G	+	2	0	SLC28A1	83249799	1.000000	0.71417	0.997000	0.53966	0.625000	0.37756	7.017000	0.76399	2.310000	0.77875	0.650000	0.86243	GGA		0.582	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2			15	54	1	0	1.02788e-11	0.00499	1.78586e-11	15	54				
SLC28A1	9154	broad.mit.edu	37	15	85487830	85487830	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr15:85487830C>T	ENST00000286749.3	+	16	1787	c.1697C>T	c.(1696-1698)tCc>tTc	p.S566F	SLC28A1_ENST00000394573.1_Missense_Mutation_p.S566F|SLC28A1_ENST00000537624.1_Missense_Mutation_p.S566F|SLC28A1_ENST00000537216.1_Intron|SLC28A1_ENST00000538177.1_Missense_Mutation_p.S400F			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	566					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)	p.S566F(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	AGCGACTTCTCCCAGATAGTG	0.637																																							uc002blg.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1696-1698)TCC>TTC		solute carrier family 28, member 1 isoform 1							50.0	44.0	46.0					15																	85487830		2203	4299	6502	SO:0001583	missense	9154				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding	g.chr15:85487830C>T	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.1697C>T	15.37:g.85487830C>T	ENSP00000286749:p.Ser566Phe					SLC28A1_uc010bnb.2_Missense_Mutation_p.S566F|SLC28A1_uc010upe.1_Missense_Mutation_p.S400F|SLC28A1_uc010upf.1_Missense_Mutation_p.S566F|SLC28A1_uc010upg.1_Intron	p.S566F	NM_004213	NP_004204	O00337	S28A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		17	1899	+			566					A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	ENST00000286749.3	37	c.1697C>T	CCDS10334.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240168	0.79912	.	.	ENSG00000156222	ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573	T;T;T;T	0.08370	3.1;3.1;3.1;3.1	4.57	4.57	0.56435	Na dependent nucleoside transporter, C-terminal (1);	0.312432	0.35320	N	0.003289	T	0.38321	0.1036	M	0.93462	3.42	0.80722	D	1	P;D;D	0.64830	0.946;0.991;0.994	P;D;D	0.73708	0.894;0.93;0.981	T	0.52646	-0.8548	10	0.87932	D	0	-5.1139	14.9218	0.70843	0.0:1.0:0.0:0.0	.	566;400;566	F5H560;B7Z3L6;O00337	.;.;S28A1_HUMAN	F	400;566;566;566	ENSP00000443752:S400F;ENSP00000444700:S566F;ENSP00000286749:S566F;ENSP00000378074:S566F	ENSP00000286749:S566F	S	+	2	0	SLC28A1	83288834	1.000000	0.71417	0.988000	0.46212	0.803000	0.45373	6.453000	0.73488	2.357000	0.79964	0.561000	0.74099	TCC		0.637	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2			3	35	0	0	0	0.004672	0	3	35				
LINS	55180	broad.mit.edu	37	15	101114229	101114229	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr15:101114229C>A	ENST00000314742.8	-	5	1071	c.849G>T	c.(847-849)atG>atT	p.M283I	LINS_ENST00000560133.1_Missense_Mutation_p.M164I|LINS_ENST00000559149.1_5'UTR|LINS_ENST00000561308.1_Missense_Mutation_p.M283I	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	283								p.M283I(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						TAACTTCTAGCATGCAAGATG	0.413																																							uc002bwe.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(847-849)ATG>ATT		lines homolog 1							69.0	69.0	69.0					15																	101114229		2203	4300	6503	SO:0001583	missense	55180							g.chr15:101114229C>A	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.849G>T	15.37:g.101114229C>A	ENSP00000318423:p.Met283Ile					LINS1_uc002bwd.2_5'Flank|LINS1_uc002bwf.2_Missense_Mutation_p.M283I|LINS1_uc002bwg.2_Missense_Mutation_p.M283I|LINS1_uc002bwh.2_Missense_Mutation_p.M283I|LINS1_uc010usa.1_Missense_Mutation_p.M164I|LINS1_uc002bwi.2_Missense_Mutation_p.M283I	p.M283I	NM_001040614	NP_001035704	Q8NG48	LINES_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00095)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		6	1140	-	Lung NSC(78;0.0018)|all_lung(78;0.00223)|Melanoma(26;0.00852)		283					Q96FW2|Q9NVQ3	Missense_Mutation	SNP	ENST00000314742.8	37	c.849G>T	CCDS10385.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577892	0.28180	.	.	ENSG00000140471	ENST00000314742	T	0.16196	2.36	6.07	1.33	0.21861	.	0.594242	0.18915	N	0.127641	T	0.06416	0.0165	N	0.08118	0	0.09310	N	1	B;B;B	0.18968	0.032;0.0;0.0	B;B;B	0.13407	0.009;0.001;0.002	T	0.32241	-0.9914	10	0.25106	T	0.35	-0.732	2.9986	0.06007	0.5331:0.2256:0.0902:0.1511	.	164;283;283	B4DQT3;Q8NG48-2;Q8NG48	.;.;LINES_HUMAN	I	283	ENSP00000318423:M283I	ENSP00000318423:M283I	M	-	3	0	LINS	98931752	0.809000	0.29036	0.082000	0.20525	0.993000	0.82548	0.156000	0.16382	0.314000	0.23086	0.655000	0.94253	ATG		0.413	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148		8	50	1	0	1.26484e-09	0.00308	2.04321e-09	8	50				
OR1F1	4992	broad.mit.edu	37	16	3255074	3255074	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:3255074G>T	ENST00000304646.2	+	1	828	c.828G>T	c.(826-828)gtG>gtT	p.V276V	AJ003147.9_ENST00000576468.1_RNA	NM_012360.1	NP_036492.1	O43749	OR1F1_HUMAN	olfactory receptor, family 1, subfamily F, member 1	276					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V276V(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(7)	11						TGGCTACTGTGTTGTATACAG	0.478																																							uc010uwu.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(826-828)GTG>GTT		olfactory receptor, family 1, subfamily F,							136.0	133.0	134.0					16																	3255074		2197	4300	6497	SO:0001819	synonymous_variant	4992				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr16:3255074G>T	Y14442	CCDS10496.1	16p13.3	2012-08-09			ENSG00000168124	ENSG00000168124		"""GPCR / Class A : Olfactory receptors"""	8194	protein-coding gene	gene with protein product		603232		OR1F4, OR1F6, OR1F7, OR1F8, OR1F9, OR1F5, OR1F10, OR1F13P		9288094, 9500546	Standard	NM_012360		Approved	Olfmf, OR16-36, OR16-37, OR16-88, OR16-89, OR16-90, OLFMF, OR3-145	uc010uwu.2	O43749	OTTHUMG00000133153	ENST00000304646.2:c.828G>T	16.37:g.3255074G>T							p.V276V	NM_012360	NP_036492	O43749	OR1F1_HUMAN			1	828	+			276			Helical; Name=7; (Potential).		O15246|Q6IFL5	Silent	SNP	ENST00000304646.2	37	c.828G>T	CCDS10496.1																																																																																				0.478	OR1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206985.1			27	167	1	0	1.75199e-13	0.007291	3.24218e-13	27	167				
UBN1	29855	broad.mit.edu	37	16	4910738	4910738	+	Silent	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:4910738C>T	ENST00000396658.4	+	6	1448	c.745C>T	c.(745-747)Cta>Tta	p.L249L	UBN1_ENST00000590769.1_Silent_p.L249L|UBN1_ENST00000262376.6_Silent_p.L249L|UBN1_ENST00000545171.1_Silent_p.L249L	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	249	Lys-rich.				chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L249L(1)		NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						TAAAGAGATGCTAAAGAAATT	0.478																																							uc002cyb.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(745-747)CTA>TTA		ubinuclein 1							100.0	112.0	108.0					16																	4910738		2197	4300	6497	SO:0001819	synonymous_variant	29855				chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:4910738C>T	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.745C>T	16.37:g.4910738C>T						UBN1_uc010uxw.1_Silent_p.L249L|UBN1_uc002cyc.2_Silent_p.L249L	p.L249L	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN			7	1084	+			249			Lys-rich.		B7Z6D3|D3DUE8|Q13079|Q9P1P7	Silent	SNP	ENST00000396658.4	37	c.745C>T	CCDS10525.1																																																																																				0.478	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936		38	171	0	0	0	0.003755	0	38	171				
PPL	5493	broad.mit.edu	37	16	4940293	4940293	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:4940293G>C	ENST00000345988.2	-	18	2294	c.2205C>G	c.(2203-2205)ttC>ttG	p.F735L	PPL_ENST00000590782.2_Missense_Mutation_p.F733L	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	735					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.F735L(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						GGCCGCGGTGGAAGTGCTCGT	0.607																																							uc002cyd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(2203-2205)TTC>TTG		periplakin							118.0	94.0	102.0					16																	4940293		2197	4300	6497	SO:0001583	missense	5493				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton	g.chr16:4940293G>C	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2205C>G	16.37:g.4940293G>C	ENSP00000340510:p.Phe735Leu						p.F735L	NM_002705	NP_002696	O60437	PEPL_HUMAN			18	2295	-			735			Spectrin 4.|Potential.		O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	c.2205C>G	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637459	0.47049	.	.	ENSG00000118898	ENST00000345988	T	0.22945	1.93	5.19	3.24	0.37175	.	0.224209	0.39475	N	0.001346	T	0.19005	0.0456	L	0.29908	0.895	0.26388	N	0.97663	B	0.20368	0.044	B	0.19148	0.024	T	0.14699	-1.0463	10	0.46703	T	0.11	.	11.7108	0.51625	0.1435:0.0:0.8565:0.0	.	735	O60437	PEPL_HUMAN	L	735	ENSP00000340510:F735L	ENSP00000340510:F735L	F	-	3	2	PPL	4880294	1.000000	0.71417	0.002000	0.10522	0.002000	0.02628	5.337000	0.65941	0.599000	0.29845	-0.191000	0.12829	TTC		0.607	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705		6	50	0	0	0	0.001984	0	6	50				
USP7	7874	broad.mit.edu	37	16	8995984	8995984	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:8995984C>A	ENST00000344836.4	-	18	2200	c.2002G>T	c.(2002-2004)Gag>Tag	p.E668*	USP7_ENST00000535863.1_Nonsense_Mutation_p.E569*|USP7_ENST00000381886.4_Nonsense_Mutation_p.E652*	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	668	Interaction with ICP0/VMW110.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.E668*(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						GCAGCCAGCTCGGGATCAACT	0.463																																							uc002czl.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(2002-2004)GAG>TAG		ubiquitin specific peptidase 7							140.0	128.0	132.0					16																	8995984		2197	4300	6497	SO:0001587	stop_gained	7874				interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr16:8995984C>A	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.2002G>T	16.37:g.8995984C>A	ENSP00000343535:p.Glu668*					USP7_uc010uyk.1_Nonsense_Mutation_p.E569*|USP7_uc002czj.2_RNA|USP7_uc010uyj.1_Nonsense_Mutation_p.E569*|USP7_uc002czk.2_Nonsense_Mutation_p.E652*|USP7_uc010uyl.1_RNA	p.E668*	NM_003470	NP_003461	Q93009	UBP7_HUMAN			18	2201	-			668			Interaction with ICP0/VMW110.		A6NMY8|B7Z815|H0Y3G8	Nonsense_Mutation	SNP	ENST00000344836.4	37	c.2002G>T	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	C	43	10.104691	0.99337	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549	.	.	.	5.42	5.42	0.78866	.	0.043724	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	19.2247	0.93814	0.0:1.0:0.0:0.0	.	.	.	.	X	668;676;569;569	.	ENSP00000343535:E668X	E	-	1	0	USP7	8903485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.726000	0.84824	2.549000	0.85964	0.561000	0.74099	GAG		0.463	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2			8	84	1	0	0.000442599	0.006214	0.000556707	8	84				
GRIN2A	2903	broad.mit.edu	37	16	10031860	10031860	+	Silent	SNP	G	G	A	rs368200727		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:10031860G>A	ENST00000396573.2	-	4	1272	c.963C>T	c.(961-963)taC>taT	p.Y321Y	GRIN2A_ENST00000562109.1_Silent_p.Y321Y|GRIN2A_ENST00000404927.2_Silent_p.Y321Y|GRIN2A_ENST00000396575.2_Silent_p.Y321Y|GRIN2A_ENST00000535259.1_Silent_p.Y164Y|GRIN2A_ENST00000330684.3_Silent_p.Y321Y|GRIN2A_ENST00000566670.1_5'Flank	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	321					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.Y321Y(2)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCATCTGCCCGTAGCAGCTGG	0.562																																							uc002czo.3		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(961-963)TAC>TAT		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	G	,,	3,4391	6.2+/-15.9	0,3,2194	67.0	58.0	61.0		963,963,963	-3.6	1.0	16		61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	GRIN2A	NM_000833.3,NM_001134407.1,NM_001134408.1	,,	0,4,6493	AA,AG,GG		0.0116,0.0683,0.0308	,,	321/1465,321/1465,321/1282	10031860	4,12990	2197	4300	6497	SO:0001819	synonymous_variant	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:10031860G>A		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.963C>T	16.37:g.10031860G>A						GRIN2A_uc010uym.1_Silent_p.Y321Y|GRIN2A_uc010uyn.1_Silent_p.Y164Y|GRIN2A_uc002czr.3_Silent_p.Y321Y	p.Y321Y	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN			3	1511	-			321			Extracellular (Potential).		O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	c.963C>T	CCDS10539.1																																																																																				0.562	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			8	50	0	0	0	0.00308	0	8	50				
ABCC6P1	653190	broad.mit.edu	37	16	18602624	18602625	+	RNA	DNP	GC	GC	AT			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:18602624_18602625GC>AT	ENST00000546162.2	+	0	1198_1199					NR_003569.1				ATP-binding cassette, sub-family C, member 6 pseudogene 1 (functional)																		TCCCCAAGCTGCTCAGGTGAGT	0.584																																							uc002dfg.2		NA																	0					0						c.(820-825)CTGCTC>CTATTC		SubName: Full=cDNA FLJ51267, highly similar to Multidrug resistance-associated protein 6;																																						653190							g.chr16:18602624_18602625GC>AT	BC075833		16p12.3	2014-09-11	2014-05-09		ENSG00000256340	ENSG00000256340		"""-"""	33352	pseudogene	pseudogene			"""ATP-binding cassette, sub-family C, member 6 pseudogene 1"""			18405356, 22873774	Standard	NR_003569		Approved		uc002dfg.3		OTTHUMG00000177192	Exception_encountered	16.37:g.18602624_18602625delinsAT						ABCC6P1_uc010vam.1_Missense_Mutation_p.L218F	p.L275F	NR_003569						8	1022_1023	+									Missense_Mutation	DNP	ENST00000546162.2	37	c.822_823GC>AT																																																																																					0.584	ABCC6P1-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000435772.2	NR_003569		13	85	0	0	0	0.004672	0	13	85				
ARMC5	79798	broad.mit.edu	37	16	31476036	31476036	+	Silent	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:31476036A>T	ENST00000563544.1	+	5	2238	c.1692A>T	c.(1690-1692)ccA>ccT	p.P564P	ARMC5_ENST00000457010.2_Silent_p.P564P|ARMC5_ENST00000408912.3_Silent_p.P659P|ARMC5_ENST00000538189.1_Silent_p.P596P|ARMC5_ENST00000268314.4_Silent_p.P564P|ARMC5_ENST00000412665.2_Silent_p.P208P			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	564								p.P564P(1)|p.P659P(1)		central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CGCCCAGCCCACGTGCACTGC	0.706																																							uc002ecc.2		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(1)	1						c.(1690-1692)CCA>CCT		armadillo repeat containing 5 isoform a							13.0	15.0	14.0					16																	31476036		2116	4232	6348	SO:0001819	synonymous_variant	79798						binding	g.chr16:31476036A>T	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1692A>T	16.37:g.31476036A>T						ARMC5_uc010vfn.1_Silent_p.P659P|ARMC5_uc010vfo.1_Silent_p.P596P|ARMC5_uc002eca.3_Silent_p.P564P|ARMC5_uc010vfp.1_Silent_p.P372P|ARMC5_uc002ecb.2_Silent_p.P564P	p.P564P	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN			4	2221	+			564					Q86WM9|Q9H7P8|Q9H925	Silent	SNP	ENST00000563544.1	37	c.1692A>T	CCDS45472.1																																																																																				0.706	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742		3	14	0	0	0	0.004672	0	3	14				
BBS2	583	broad.mit.edu	37	16	56519510	56519510	+	Missense_Mutation	SNP	C	C	T	rs138913160	byFrequency	TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:56519510C>T	ENST00000245157.5	-	16	2471	c.2051G>A	c.(2050-2052)cGt>cAt	p.R684H	BBS2_ENST00000568104.1_Missense_Mutation_p.R638H	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	684					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)	p.R684H(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						ACCCCGCAGACGACCTGCTCT	0.388									Bardet-Biedl syndrome																														uc002ejd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2050-2052)CGT>CAT		Bardet-Biedl syndrome 2 protein		C	HIS/ARG	2,4394	4.2+/-10.8	0,2,2196	235.0	231.0	232.0		2051	0.4	0.8	16	dbSNP_134	232	1,8599	1.2+/-3.3	0,1,4299	yes	missense	BBS2	NM_031885.3	29	0,3,6495	TT,TC,CC		0.0116,0.0455,0.0231	benign	684/722	56519510	3,12993	2198	4300	6498	SO:0001583	missense	583	Bardet-Biedl_syndrome	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	adult behavior|brain morphogenesis|cerebral cortex development|cilium morphogenesis|fat cell differentiation|hippocampus development|melanosome transport|negative regulation of multicellular organism growth|photoreceptor cell maintenance|protein localization to organelle|regulation of cilium beat frequency involved in ciliary motility|sperm axoneme assembly|striatum development	BBSome|cilium membrane|microtubule basal body|motile cilium	protein binding	g.chr16:56519510C>T	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.2051G>A	16.37:g.56519510C>T	ENSP00000245157:p.Arg684His						p.R684H	NM_031885	NP_114091	Q9BXC9	BBS2_HUMAN			16	2285	-			684					Q96CM0|Q96SN9	Missense_Mutation	SNP	ENST00000245157.5	37	c.2051G>A	CCDS32451.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.805871	0.50421	4.55E-4	1.16E-4	ENSG00000125124	ENST00000245157	D	0.91843	-2.92	5.65	0.392	0.16288	.	0.192834	0.53938	N	0.000052	D	0.90469	0.7015	M	0.83953	2.67	0.48571	D	0.999674	B	0.23735	0.09	B	0.18263	0.021	D	0.84445	0.0585	10	0.62326	D	0.03	-0.0851	10.0562	0.42246	0.0:0.6033:0.0:0.3967	.	684	Q9BXC9	BBS2_HUMAN	H	684	ENSP00000245157:R684H	ENSP00000245157:R684H	R	-	2	0	BBS2	55077011	0.988000	0.35896	0.792000	0.32020	0.927000	0.56198	1.086000	0.30853	-0.124000	0.11724	-0.218000	0.12543	CGT		0.388	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885		5	184	0	0	0	0.000602	0	5	184				
SMPD3	55512	broad.mit.edu	37	16	68405827	68405827	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:68405827G>T	ENST00000219334.5	-	3	861	c.258C>A	c.(256-258)tcC>tcA	p.S86S	SMPD3_ENST00000566009.1_5'Flank|SMPD3_ENST00000563226.1_Silent_p.S86S|SMPD3_ENST00000568373.1_Silent_p.S86S	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	86					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.S86S(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	ACTGCAGTGGGGACCAGAAGA	0.657																																							uc002ewa.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(256-258)TCC>TCA		neutral sphingomyelin phosphodiesterase 3	Phosphatidylserine(DB00144)						17.0	19.0	18.0					16																	68405827		2195	4297	6492	SO:0001819	synonymous_variant	55512				cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity	g.chr16:68405827G>T	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.258C>A	16.37:g.68405827G>T						SMPD3_uc010cfe.2_Silent_p.S86S|SMPD3_uc010vlh.1_Silent_p.S86S	p.S86S	NM_018667	NP_061137	Q9NY59	NSMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	3	680	-		Ovarian(137;0.0563)	86			Lumenal (Potential).		B7ZL82|Q2M1S8	Silent	SNP	ENST00000219334.5	37	c.258C>A	CCDS10867.1																																																																																				0.657	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667		5	63	1	0	0.000602214	0.000602	0.000749664	5	63				
PDPR	55066	broad.mit.edu	37	16	70190519	70190519	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:70190519G>T	ENST00000288050.4	+	19	3334	c.2377G>T	c.(2377-2379)Ggg>Tgg	p.G793W	RP11-296I10.3_ENST00000566989.1_RNA|PDPR_ENST00000562100.1_3'UTR|PDPR_ENST00000398122.3_Missense_Mutation_p.G693W|PDPR_ENST00000567046.1_Missense_Mutation_p.G151W|PDPR_ENST00000542659.1_Missense_Mutation_p.G138W|RP11-296I10.3_ENST00000502126.1_RNA|PDPR_ENST00000568530.1_Missense_Mutation_p.G793W	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	793					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)	p.G793W(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		TTACCGGAATGGGCAGTATGT	0.542																																							uc002eyf.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)	1						c.(2377-2379)GGG>TGG		pyruvate dehydrogenase phosphatase regulatory							226.0	249.0	241.0					16																	70190519		2093	4228	6321	SO:0001583	missense	55066				glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity	g.chr16:70190519G>T		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.2377G>T	16.37:g.70190519G>T	ENSP00000288050:p.Gly793Trp					CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Missense_Mutation_p.G693W|PDPR_uc002eyg.1_Missense_Mutation_p.G460W|PDPR_uc002eyh.2_Missense_Mutation_p.G138W|PDPR_uc010vls.1_Missense_Mutation_p.G138W	p.G793W	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.124)	19	3334	+			793					A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	37	c.2377G>T	CCDS45520.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.981066	0.92982	.	.	ENSG00000090857	ENST00000288050;ENST00000398122;ENST00000205055;ENST00000542659	T;T;T	0.80738	-1.41;-1.41;-1.41	6.03	6.03	0.97812	Glycine cleavage T-protein, C-terminal barrel (1);	0.051230	0.85682	D	0.000000	D	0.93549	0.7941	H	0.96518	3.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94704	0.7886	10	0.87932	D	0	.	19.5634	0.95382	0.0:0.0:1.0:0.0	.	460;793	Q9NWE6;Q8NCN5	.;PDPR_HUMAN	W	793;693;460;138	ENSP00000288050:G793W;ENSP00000381190:G693W;ENSP00000441690:G138W	ENSP00000205055:G460W	G	+	1	0	PDPR	68748020	1.000000	0.71417	0.985000	0.45067	0.899000	0.52679	7.931000	0.87625	2.868000	0.98415	0.557000	0.71058	GGG		0.542	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990		51	267	1	0	7.91745e-34	0.00361	1.81238e-33	51	267				
SF3B3	23450	broad.mit.edu	37	16	70599102	70599102	+	Silent	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:70599102C>T	ENST00000302516.5	+	19	2809	c.2598C>T	c.(2596-2598)atC>atT	p.I866I		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	866					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)	p.I866I(1)		breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CCTCTGTGATCCGAGTGATGA	0.542																																							uc002ezf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2596-2598)ATC>ATT		splicing factor 3b, subunit 3							87.0	85.0	85.0					16																	70599102		2198	4300	6498	SO:0001819	synonymous_variant	23450				protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding	g.chr16:70599102C>T	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2598C>T	16.37:g.70599102C>T							p.I866I	NM_012426	NP_036558	Q15393	SF3B3_HUMAN			19	2809	+		Ovarian(137;0.0694)	866					Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Silent	SNP	ENST00000302516.5	37	c.2598C>T	CCDS10894.1																																																																																				0.542	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426		26	71	0	0	0	0.00333	0	26	71				
CHST4	10164	broad.mit.edu	37	16	71570875	71570875	+	Silent	SNP	C	C	A	rs373676045		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr16:71570875C>A	ENST00000338482.5	+	3	638	c.295C>A	c.(295-297)Cgg>Agg	p.R99R	CHST4_ENST00000572450.1_Silent_p.R99R|CHST4_ENST00000539698.3_Silent_p.R99R|ZNF19_ENST00000568446.1_Intron|RP11-510M2.5_ENST00000568523.1_RNA			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	99					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.R99R(1)		cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						GGATCTGATACGGGCCGTCTT	0.592																																							uc002fan.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(295-297)CGG>AGG		carbohydrate (N-acetylglucosamine 6-O)							84.0	88.0	87.0					16																	71570875		2198	4300	6498	SO:0001819	synonymous_variant	10164				cell-cell signaling|immune response|inflammatory response|N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity	g.chr16:71570875C>A	AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.295C>A	16.37:g.71570875C>A						CHST4_uc002fao.2_Silent_p.R99R	p.R99R	NM_005769	NP_005760	Q8NCG5	CHST4_HUMAN			2	476	+			99			Lumenal (Potential).		Q8IV46|Q9Y5R3	Silent	SNP	ENST00000338482.5	37	c.295C>A	CCDS10902.1																																																																																				0.592	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268992.4	NM_005769		28	69	1	0	4.59853e-10	0.005443	7.60647e-10	28	69				
OR1A1	8383	broad.mit.edu	37	17	3119679	3119679	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:3119679G>T	ENST00000304094.1	+	1	765	c.765G>T	c.(763-765)atG>atT	p.M255I		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M255I(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						GTACAGTCATGGGCACGTATT	0.488																																							uc010vrc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(763-765)ATG>ATT		olfactory receptor, family 1, subfamily A,							158.0	135.0	143.0					17																	3119679		2203	4300	6503	SO:0001583	missense	8383				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr17:3119679G>T	AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.765G>T	17.37:g.3119679G>T	ENSP00000305207:p.Met255Ile						p.M255I	NM_014565	NP_055380	Q9P1Q5	OR1A1_HUMAN			1	765	+			255			Helical; Name=6; (Potential).		A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	ENST00000304094.1	37	c.765G>T	CCDS11022.1	.	.	.	.	.	.	.	.	.	.	G	0.165	-1.077329	0.01903	.	.	ENSG00000172146	ENST00000304094	T	0.32988	1.43	5.05	5.05	0.67936	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000006	T	0.05823	0.0152	N	0.00185	-1.9	0.26738	N	0.97046	B	0.12630	0.006	B	0.18871	0.023	T	0.37619	-0.9698	10	0.02654	T	1	.	7.1413	0.25558	0.0895:0.1743:0.7362:0.0	.	255	Q9P1Q5	OR1A1_HUMAN	I	255	ENSP00000305207:M255I	ENSP00000305207:M255I	M	+	3	0	OR1A1	3066429	0.000000	0.05858	1.000000	0.80357	0.552000	0.35366	-0.230000	0.09083	2.632000	0.89209	0.511000	0.50034	ATG		0.488	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207292.1	NM_014565		29	156	1	0	3.1745e-13	0.008361	5.82997e-13	29	156				
TEKT1	83659	broad.mit.edu	37	17	6703489	6703489	+	Silent	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:6703489G>A	ENST00000338694.2	-	8	1243	c.1114C>T	c.(1114-1116)Ctg>Ttg	p.L372L	TEKT1_ENST00000535086.1_Silent_p.L226L	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	372						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.L372L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				TCCTCCTGCAGGGCAAGCTGT	0.483																																							uc002gdt.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1114-1116)CTG>TTG		tektin 1							115.0	99.0	105.0					17																	6703489		2203	4300	6503	SO:0001819	synonymous_variant	83659				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule		g.chr17:6703489G>A		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.1114C>T	17.37:g.6703489G>A						TEKT1_uc010vth.1_Silent_p.L226L	p.L372L	NM_053285	NP_444515	Q969V4	TEKT1_HUMAN			8	1224	-		Myeloproliferative disorder(207;0.0255)	372			Potential.		D3DTM7	Silent	SNP	ENST00000338694.2	37	c.1114C>T	CCDS11083.1																																																																																				0.483	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285		13	105	0	0	0	0.001855	0	13	105				
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	A	rs28934575|rs397516437		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:7577548C>A	ENST00000269305.4	-	7	922	c.733G>T	c.(733-735)Ggc>Tgc	p.G245C	TP53_ENST00000413465.2_Missense_Mutation_p.G245C|TP53_ENST00000420246.2_Missense_Mutation_p.G245C|TP53_ENST00000455263.2_Missense_Mutation_p.G245C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245C|TP53_ENST00000445888.2_Missense_Mutation_p.G245C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2	G245S(SKLMS1_SOFT_TISSUE)|G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKMEL2_SKIN)	111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	p.G245S(274)|p.G245D(93)|p.G245V(50)|p.G245C(47)|p.G245R(10)|p.G245A(8)|p.0?(7)|p.G245G(3)|p.G245fs*2(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.G245fs*22(1)|p.M243fs*18(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	c.(733-735)GGC>TGC	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							149.0	112.0	125.0					17																	7577548		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577548C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>T	17.37:g.7577548C>A	ENSP00000269305:p.Gly245Cys	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Missense_Mutation_p.G245C|TP53_uc002gih.2_Missense_Mutation_p.G245C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G113C|TP53_uc010cng.1_Missense_Mutation_p.G113C|TP53_uc002gii.1_Missense_Mutation_p.G113C|TP53_uc010cnh.1_Missense_Mutation_p.G245C|TP53_uc010cni.1_Missense_Mutation_p.G245C|TP53_uc002gij.2_Missense_Mutation_p.G245C|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G152C|TP53_uc002gio.2_Missense_Mutation_p.G113C	p.G245C	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	927	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	245		G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> A (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.733G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579580	0.86645	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99901	-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96045	0.9027	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245C;ENSP00000352610:G245C;ENSP00000269305:G245C;ENSP00000398846:G245C;ENSP00000391127:G245C;ENSP00000391478:G245C;ENSP00000425104:G113C;ENSP00000423862:G152C	ENSP00000269305:G245C	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		38	63	1	0	2.75727e-19	0.004878	5.84106e-19	38	63				
ARHGEF15	22899	broad.mit.edu	37	17	8221720	8221720	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:8221720A>T	ENST00000361926.3	+	10	1830	c.1720A>T	c.(1720-1722)Aca>Tca	p.T574S	AC135178.7_ENST00000458568.1_RNA|ARHGEF15_ENST00000421050.1_Missense_Mutation_p.T574S	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	574	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T574S(1)		breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						CCTGCGCCAGACAGAAGAGGG	0.632																																							uc002glc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1720-1722)ACA>TCA		Rho guanine exchange factor 15							78.0	85.0	83.0					17																	8221720		2203	4300	6503	SO:0001583	missense	22899				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr17:8221720A>T	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1720A>T	17.37:g.8221720A>T	ENSP00000355026:p.Thr574Ser					ARHGEF15_uc002gld.2_Missense_Mutation_p.T574S|ARHGEF15_uc010vuw.1_Missense_Mutation_p.T463S	p.T574S	NM_173728	NP_776089	O94989	ARHGF_HUMAN			10	1841	+			574			DH.		A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	ENST00000361926.3	37	c.1720A>T	CCDS11139.1	.	.	.	.	.	.	.	.	.	.	a	17.90	3.501096	0.64298	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	T;T	0.40476	1.03;1.03	5.29	3.09	0.35607	Dbl homology (DH) domain (5);	0.173187	0.49305	D	0.000158	T	0.51601	0.1684	M	0.63428	1.95	0.30893	N	0.730134	D;D	0.61697	0.99;0.99	P;P	0.60173	0.87;0.87	T	0.56469	-0.7974	10	0.87932	D	0	-7.7423	6.1752	0.20439	0.8033:0.0:0.1967:0.0	.	574;574	D3DTR7;O94989	.;ARHGF_HUMAN	S	574;364;574	ENSP00000355026:T574S;ENSP00000412505:T574S	ENSP00000355026:T574S	T	+	1	0	ARHGEF15	8162445	1.000000	0.71417	0.996000	0.52242	0.837000	0.47467	3.546000	0.53656	0.853000	0.35312	0.454000	0.30748	ACA		0.632	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728		15	141	0	0	0	0.00499	0	15	141				
MYH8	4626	broad.mit.edu	37	17	10296216	10296216	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:10296216G>A	ENST00000403437.2	-	37	5489	c.5395C>T	c.(5395-5397)Cgt>Tgt	p.R1799C	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1799					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.R1799C(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCATCTAGACGATGCTGCAGG	0.572									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)|ovary(3)|breast(2)	11						c.(5395-5397)CGT>TGT		myosin, heavy chain 8, skeletal muscle,							132.0	132.0	132.0					17																	10296216		2203	4300	6503	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10296216G>A		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.5395C>T	17.37:g.10296216G>A	ENSP00000384330:p.Arg1799Cys					uc002gml.1_Intron	p.R1799C	NM_002472	NP_002463	P13535	MYH8_HUMAN			37	5490	-			1799			Potential.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.5395C>T	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357569	0.82243	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.82711	-1.64	5.06	5.06	0.68205	Myosin tail (1);	0.000000	0.42548	U	0.000684	D	0.94460	0.8217	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.96092	0.9062	10	0.87932	D	0	.	18.6259	0.91338	0.0:0.0:1.0:0.0	.	1799	P13535	MYH8_HUMAN	C	1799	ENSP00000384330:R1799C	ENSP00000252173:R1799C	R	-	1	0	MYH8	10236941	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.553000	0.82203	2.643000	0.89663	0.650000	0.86243	CGT		0.572	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		54	175	0	0	0	0.00361	0	54	175				
MYH2	4620	broad.mit.edu	37	17	10443964	10443964	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:10443964C>A	ENST00000245503.5	-	11	1339	c.955G>T	c.(955-957)Ggg>Tgg	p.G319W	MYH2_ENST00000532183.2_Missense_Mutation_p.G319W|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.G319W|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	319	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.G319W(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CTGATCTCCCCTTGACTGACA	0.383																																							uc010coi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(955-957)GGG>TGG		myosin heavy chain IIa							109.0	97.0	101.0					17																	10443964		2203	4300	6503	SO:0001583	missense	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10443964C>A		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.955G>T	17.37:g.10443964C>A	ENSP00000245503:p.Gly319Trp					uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.G319W|MYH2_uc010coj.2_Missense_Mutation_p.G319W	p.G319W	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN			11	1083	-			319			Myosin head-like.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	c.955G>T	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.841484	0.91197	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	T;T;T	0.74421	-0.84;-0.84;-0.84	5.25	5.25	0.73442	Myosin head, motor domain (2);	0.000000	0.40064	U	0.001195	D	0.93452	0.7911	H	0.99906	4.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96427	0.9316	10	0.87932	D	0	.	18.0234	0.89261	0.0:1.0:0.0:0.0	.	319;319	Q567P6;Q9UKX2	.;MYH2_HUMAN	W	319	ENSP00000433944:G319W;ENSP00000245503:G319W;ENSP00000380367:G319W	ENSP00000245503:G319W	G	-	1	0	MYH2	10384689	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.640000	0.83355	2.742000	0.94016	0.650000	0.86243	GGG		0.383	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		13	54	1	0	0.00400662	0.004007	0.00480198	13	54				
DNAH9	1770	broad.mit.edu	37	17	11592912	11592912	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:11592912T>A	ENST00000262442.4	+	20	3841	c.3773T>A	c.(3772-3774)cTg>cAg	p.L1258Q	DNAH9_ENST00000454412.2_Missense_Mutation_p.L1258Q	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1258	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.L1258Q(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CATCAAATGCTGGATGCCAGG	0.483																																							uc002gne.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(3772-3774)CTG>CAG		dynein, axonemal, heavy chain 9 isoform 2							108.0	100.0	103.0					17																	11592912		2203	4300	6503	SO:0001583	missense	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11592912T>A	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3773T>A	17.37:g.11592912T>A	ENSP00000262442:p.Leu1258Gln					DNAH9_uc010coo.2_Missense_Mutation_p.L552Q	p.L1258Q	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	20	3841	+		Breast(5;0.0122)|all_epithelial(5;0.131)	1258			Stem (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	c.3773T>A	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232743	0.79688	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.21543	2.0;2.0	5.6	5.6	0.85130	.	0.000000	0.56097	D	0.000027	T	0.52175	0.1718	M	0.87971	2.92	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.61078	-0.7135	10	0.87932	D	0	.	15.7992	0.78439	0.0:0.0:0.0:1.0	.	1258	Q9NYC9	DYH9_HUMAN	Q	1258	ENSP00000262442:L1258Q;ENSP00000414874:L1258Q	ENSP00000262442:L1258Q	L	+	2	0	DNAH9	11533637	1.000000	0.71417	0.992000	0.48379	0.930000	0.56654	8.040000	0.89188	2.143000	0.66587	0.460000	0.39030	CTG		0.483	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		42	83	0	0	0	0.002522	0	42	83				
FAM83G	644815	broad.mit.edu	37	17	18907267	18907267	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:18907267C>T	ENST00000388995.6	-	2	311	c.88G>A	c.(88-90)Gag>Aag	p.E30K	SLC5A10_ENST00000317977.6_Intron|FAM83G_ENST00000345041.4_Missense_Mutation_p.E30K|FAM83G_ENST00000585154.2_Missense_Mutation_p.E30K|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395642.1_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	30					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.E30K(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						AGCCGCTGCTCCTCGCTGTAG	0.652																																							uc002guw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(88-90)GAG>AAG		hypothetical protein LOC644815							25.0	31.0	29.0					17																	18907267		2089	4221	6310	SO:0001583	missense	644815							g.chr17:18907267C>T	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.88G>A	17.37:g.18907267C>T	ENSP00000373647:p.Glu30Lys					SLC5A10_uc002gur.1_Intron|SLC5A10_uc002guu.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guv.1_Intron|SLC5A10_uc010vyl.1_Intron	p.E30K	NM_001039999	NP_001035088	A6ND36	FA83G_HUMAN			2	255	-			30					Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	ENST00000388995.6	37	c.88G>A	CCDS42276.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560457	0.65538	.	.	ENSG00000188522	ENST00000388995;ENST00000345041;ENST00000399096	T;T	0.12039	2.72;2.72	5.15	4.17	0.49024	.	0.167244	0.52532	D	0.000074	T	0.11324	0.0276	L	0.44542	1.39	0.46185	D	0.998913	P	0.39352	0.669	B	0.34931	0.192	T	0.05632	-1.0873	10	0.08837	T	0.75	-21.2632	15.6131	0.76744	0.0:0.8619:0.1381:0.0	.	30	A6ND36	FA83G_HUMAN	K	30	ENSP00000373647:E30K;ENSP00000343279:E30K	ENSP00000343279:E30K	E	-	1	0	FAM83G	18847992	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.987000	0.70571	1.155000	0.42497	0.491000	0.48974	GAG		0.652	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4			18	46	0	0	0	0.00499	0	18	46				
WSB1	26118	broad.mit.edu	37	17	25630509	25630509	+	Missense_Mutation	SNP	T	T	C	rs142114425		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:25630509T>C	ENST00000262394.2	+	3	642	c.326T>C	c.(325-327)aTa>aCa	p.I109T	WSB1_ENST00000348811.2_Intron|WSB1_ENST00000581185.1_Missense_Mutation_p.I109T|WSB1_ENST00000583193.1_Intron|WSB1_ENST00000579733.1_Intron|WSB1_ENST00000427287.2_Missense_Mutation_p.I78T	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1	109					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)		p.I109T(1)		lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TGTGGAGATATAGTCTGGAGT	0.383																																							uc002gzd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(325-327)ATA>ACA		WD repeat and SOCS box-containing 1 isoform 1		T	THR/ILE,	2,4404	4.2+/-10.8	0,2,2201	153.0	154.0	154.0		326,	4.9	1.0	17	dbSNP_134	154	0,8600		0,0,4300	no	missense,intron	WSB1	NM_015626.8,NM_134265.2	89,	0,2,6501	CC,CT,TT		0.0,0.0454,0.0154	probably-damaging,	109/422,	25630509	2,13004	2203	4300	6503	SO:0001583	missense	26118				intracellular signal transduction	intracellular	protein binding	g.chr17:25630509T>C	AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.326T>C	17.37:g.25630509T>C	ENSP00000262394:p.Ile109Thr					WSB1_uc010vzy.1_Missense_Mutation_p.I109T|WSB1_uc010vzz.1_Missense_Mutation_p.I78T|WSB1_uc010crf.1_Intron|WSB1_uc002gze.1_Intron|WSB1_uc002gzf.1_RNA	p.I109T	NM_015626	NP_056441	Q9Y6I7	WSB1_HUMAN	BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	3	642	+	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		109					Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	Missense_Mutation	SNP	ENST00000262394.2	37	c.326T>C	CCDS11220.1	.	.	.	.	.	.	.	.	.	.	T	15.78	2.933233	0.52866	4.54E-4	0.0	ENSG00000109046	ENST00000262394;ENST00000427287	T;T	0.62364	0.03;0.15	6.03	4.94	0.65067	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53578	0.1805	N	0.25647	0.755	0.80722	D	1	P;P;P	0.47484	0.896;0.896;0.501	P;P;B	0.46419	0.489;0.516;0.118	T	0.48822	-0.9001	10	0.28530	T	0.3	-19.5364	12.7745	0.57439	0.0:0.0:0.137:0.863	.	78;109;109	B4DGB8;B4DTL1;Q9Y6I7	.;.;WSB1_HUMAN	T	109;78	ENSP00000262394:I109T;ENSP00000416112:I78T	ENSP00000262394:I109T	I	+	2	0	WSB1	22654636	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.574000	0.82434	1.075000	0.40932	-0.316000	0.08728	ATA		0.383	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255391.4	NM_015626		32	123	0	0	0	0.002445	0	32	123				
WSB1	26118	broad.mit.edu	37	17	25631888	25631888	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:25631888G>T	ENST00000262394.2	+	4	877	c.561G>T	c.(559-561)gtG>gtT	p.V187V	WSB1_ENST00000348811.2_Silent_p.V41V|WSB1_ENST00000581185.1_Silent_p.V187V|WSB1_ENST00000583193.1_Intron|WSB1_ENST00000579733.1_Silent_p.V41V|WSB1_ENST00000427287.2_Silent_p.V156V	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1	187					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)		p.V187V(1)		lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TGATCCTGGTGTCAGCTTCAA	0.378																																							uc002gzd.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(559-561)GTG>GTT		WD repeat and SOCS box-containing 1 isoform 1							133.0	129.0	130.0					17																	25631888		2203	4300	6503	SO:0001819	synonymous_variant	26118				intracellular signal transduction	intracellular	protein binding	g.chr17:25631888G>T	AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.561G>T	17.37:g.25631888G>T						WSB1_uc010vzy.1_Silent_p.V187V|WSB1_uc010vzz.1_Silent_p.V156V|WSB1_uc010crf.1_Silent_p.V41V|WSB1_uc002gze.1_Silent_p.V41V|WSB1_uc002gzf.1_RNA	p.V187V	NM_015626	NP_056441	Q9Y6I7	WSB1_HUMAN	BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	4	877	+	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		187			WD 3.		Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	Silent	SNP	ENST00000262394.2	37	c.561G>T	CCDS11220.1																																																																																				0.378	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255391.4	NM_015626		28	117	1	0	6.38683e-12	0.008361	1.12176e-11	28	117				
OMG	4974	broad.mit.edu	37	17	29622582	29622582	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:29622582G>T	ENST00000247271.4	-	2	1029	c.768C>A	c.(766-768)acC>acA	p.T256T	NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron	NM_002544.4	NP_002535.3	P23515	OMGP_HUMAN	oligodendrocyte myelin glycoprotein	256					cell adhesion (GO:0007155)|negative regulation of axonogenesis (GO:0050771)|neuron projection regeneration (GO:0031102)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|regulation of collateral sprouting of intact axon in response to injury (GO:0048683)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.0?(8)|p.?(3)|p.T256T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|stomach(1)	13		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;1.81e-13)|Epithelial(4;4.04e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.49e-12)|GBM - Glioblastoma multiforme(4;0.121)		ATGATATTTGGGTAGAACATG	0.398																																							uc002hgj.2		NA																	12	Whole gene deletion(8)|Unknown(3)|Substitution - coding silent(1)		soft_tissue(7)|lung(2)|autonomic_ganglia(2)|central_nervous_system(1)	ovary(1)|central_nervous_system(1)	2						c.(766-768)ACC>ACA		oligodendrocyte myelin glycoprotein precursor							163.0	140.0	148.0					17																	29622582		2203	4300	6503	SO:0001819	synonymous_variant	4974				cell adhesion|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	anchored to membrane|plasma membrane		g.chr17:29622582G>T		CCDS11265.1	17q11-q12	2008-07-18			ENSG00000126861	ENSG00000126861			8135	protein-coding gene	gene with protein product		164345				1899288, 2277079	Standard	NM_002544		Approved	OMGP	uc002hgj.3	P23515	OTTHUMG00000132870	ENST00000247271.4:c.768C>A	17.37:g.29622582G>T						NF1_uc002hgg.2_Intron|NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron	p.T256T	NM_002544	NP_002535	P23515	OMGP_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;1.81e-13)|Epithelial(4;4.04e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.49e-12)|GBM - Glioblastoma multiforme(4;0.121)	2	981	-		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)	256			Ser/Thr-rich.		E1P659	Silent	SNP	ENST00000247271.4	37	c.768C>A	CCDS11265.1																																																																																				0.398	OMG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256350.2	NM_002544		15	112	1	0	3.27435e-08	0.00245	5.00479e-08	15	112				
SLC35G3	146861	broad.mit.edu	37	17	33520803	33520803	+	Missense_Mutation	SNP	G	G	T	rs540149479		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:33520803G>T	ENST00000297307.5	-	1	609	c.524C>A	c.(523-525)cCt>cAt	p.P175H	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	175						integral component of membrane (GO:0016021)		p.P175H(1)									CCAGAGTCCAGGTCCCACAAT	0.607																																							uc002hjd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(523-525)CCT>CAT		acyl-malonyl condensing enzyme 1							167.0	167.0	167.0					17																	33520803		2203	4300	6503	SO:0001583	missense	146861					integral to membrane		g.chr17:33520803G>T	AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.524C>A	17.37:g.33520803G>T	ENSP00000297307:p.Pro175His						p.P175H	NM_152462	NP_689675	Q8N808	AMAC1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0917)	1	610	-			175			Helical; (Potential).		B9EGE9	Missense_Mutation	SNP	ENST00000297307.5	37	c.524C>A	CCDS11293.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.569669	0.28003	.	.	ENSG00000164729	ENST00000297307	T	0.70282	-0.47	.	.	.	.	0.000000	0.47455	D	0.000224	T	0.70833	0.3269	L	0.32530	0.975	0.33941	D	0.643244	D	0.89917	1.0	D	0.87578	0.998	T	0.73445	-0.3980	9	0.87932	D	0	-5.0009	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	175	Q8N808	S35G3_HUMAN	H	175	ENSP00000297307:P175H	ENSP00000297307:P175H	P	-	2	0	SLC35G3	30544916	0.996000	0.38824	0.340000	0.25575	0.341000	0.28922	2.895000	0.48648	0.064000	0.16427	0.064000	0.15345	CCT		0.607	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256445.2	NM_152462		51	218	1	0	2.81731e-22	0.00361	6.15728e-22	51	218				
CCL4	6351	broad.mit.edu	37	17	34432678	34432678	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:34432678G>T	ENST00000250151.4	+	3	568	c.252G>T	c.(250-252)gaG>gaT	p.E84D	CCL4_ENST00000394495.1_Missense_Mutation_p.S46I	NM_002984.2	NP_002975.1	P13236	CCL4_HUMAN	chemokine (C-C motif) ligand 4	84					cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|establishment or maintenance of cell polarity (GO:0007163)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation by host of viral transcription (GO:0043922)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of natural killer cell chemotaxis (GO:2000503)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|CCR5 chemokine receptor binding (GO:0031730)|chemokine activity (GO:0008009)|cytokine activity (GO:0005125)|identical protein binding (GO:0042802)	p.E84D(1)		endometrium(1)|large_intestine(1)|lung(2)	4		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGTCCAGGAGTACGTGTATG	0.502																																					Colon(139;824 1752 21188 21615 24765)	Colon(139;824 1752 21188 21615 24765)	uc002hkw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(250-252)GAG>GAT		chemokine C-C motif ligand 4 isoform 1							191.0	175.0	181.0					17																	34432678		2203	4300	6503	SO:0001583	missense	6351				cell adhesion|cell-cell signaling|cellular component movement|chemotaxis|establishment or maintenance of cell polarity|immune response|inflammatory response|response to virus|viral genome replication	extracellular space	chemokine activity|receptor signaling protein tyrosine kinase activity	g.chr17:34432678G>T	M23502	CCDS11308.1	17q21-q23	2014-05-06	2002-08-22	2002-08-23	ENSG00000129277	ENSG00000275302		"""Chemokine ligands"", ""Endogenous ligands"""	10630	protein-coding gene	gene with protein product		182284	"""small inducible cytokine A4 (homologous to mouse Mip-1b)"""	LAG1, SCYA4		1972563	Standard	NM_002984		Approved	MIP-1-beta, Act-2, AT744.1	uc002hkw.1	P13236	OTTHUMG00000188414	ENST00000250151.4:c.252G>T	17.37:g.34432678G>T	ENSP00000250151:p.Glu84Asp					CCL4_uc002hkx.1_RNA	p.E84D	NM_002984	NP_002975	P13236	CCL4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	3	331	+		Ovarian(249;0.17)	84					P22617|Q13704|Q3SXL8|Q6FGI8	Missense_Mutation	SNP	ENST00000250151.4	37	c.252G>T	CCDS11308.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	5.464|5.464	0.270758|0.270758	0.10349|0.10349	.|.	.|.	ENSG00000129277|ENSG00000129277	ENST00000250151|ENST00000394495	T|T	0.04706|0.74002	3.57|-0.8	5.03|5.03	-5.07|-5.07	0.02938|0.02938	Chemokine interleukin-8-like domain (3);|.	0.371406|.	0.19702|.	U|.	0.108006|.	T|T	0.62454|0.62454	0.2429|0.2429	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999999|0.999999	B|.	0.06786|.	0.001|.	B|.	0.12156|.	0.007|.	T|T	0.59637|0.59637	-0.7417|-0.7417	9|6	0.15066|0.87932	T|D	0.55|0	.|.	1.6968|1.6968	0.02863|0.02863	0.43:0.2468:0.1978:0.1254|0.43:0.2468:0.1978:0.1254	.|.	84|.	P13236|.	CCL4_HUMAN|.	D|I	84|46	ENSP00000250151:E84D|ENSP00000378004:S46I	ENSP00000250151:E84D|ENSP00000378004:S46I	E|S	+|+	3|2	2|0	CCL4|CCL4	31456791|31456791	0.858000|0.858000	0.29795|0.29795	0.740000|0.740000	0.30986|0.30986	0.283000|0.283000	0.27025|0.27025	-0.413000|-0.413000	0.07123|0.07123	-0.457000|-0.457000	0.07033|0.07033	-0.794000|-0.794000	0.03295|0.03295	GAG|AGT		0.502	CCL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256592.2	NM_002984		17	122	1	0	1.56452e-12	0.007413	2.78843e-12	17	122				
MEOX1	4222	broad.mit.edu	37	17	41738726	41738726	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:41738726G>T	ENST00000318579.4	-	1	596	c.177C>A	c.(175-177)taC>taA	p.Y59*	MEOX1_ENST00000329168.3_Nonsense_Mutation_p.Y59*|MEOX1_ENST00000393661.2_5'UTR|MEOX1_ENST00000549132.1_Missense_Mutation_p.T30N	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	P50221	MEOX1_HUMAN	mesenchyme homeobox 1	59					multicellular organismal development (GO:0007275)|somite specification (GO:0001757)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Y59*(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		AGAAGTCAGGGTACGCTGCCG	0.647																																							uc002idz.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(175-177)TAC>TAA		mesenchyme homeobox 1 isoform 1							49.0	53.0	52.0					17																	41738726		2203	4300	6503	SO:0001587	stop_gained	4222					nucleus	sequence-specific DNA binding	g.chr17:41738726G>T		CCDS11466.1, CCDS11467.1, CCDS42343.1	17q21.31	2014-07-15	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	7013	protein-coding gene	gene with protein product		600147	"""mesenchyme homeo box 1"""			7987315	Standard	NM_013999		Approved	MOX1	uc002idz.3	P50221	OTTHUMG00000170513	ENST00000318579.4:c.177C>A	17.37:g.41738726G>T	ENSP00000321684:p.Tyr59*					MEOX1_uc002iea.2_Nonsense_Mutation_p.Y59*|MEOX1_uc002ieb.2_5'UTR	p.Y59*	NM_004527	NP_004518	P50221	MEOX1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0753)	1	206	-		Breast(137;0.00908)	59					A8K524|A8MWF9|Q15069	Nonsense_Mutation	SNP	ENST00000318579.4	37	c.177C>A	CCDS11466.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.947425|6.947425	0.97956|0.97956	.|.	.|.	ENSG00000005102|ENSG00000005102	ENST00000549132|ENST00000318579;ENST00000329168	.|.	.|.	.|.	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.23451|.	0.0567|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.28870|.	-1.0030|.	4|.	0.87932|0.02654	D|T	0|1	-57.1011|-57.1011	9.1868|9.1868	0.37176|0.37176	0.1481:0.0:0.8519:0.0|0.1481:0.0:0.8519:0.0	.|.	.|.	.|.	.|.	N|X	30|59	.|.	ENSP00000449049:T30N|ENSP00000321684:Y59X	T|Y	-|-	2|3	0|2	MEOX1|MEOX1	39094252|39094252	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.613000|0.613000	0.37349|0.37349	3.017000|3.017000	0.49615|0.49615	2.430000|2.430000	0.82344|0.82344	0.563000|0.563000	0.77884|0.77884	ACC|TAC		0.647	MEOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409452.1			11	72	1	0	3.86212e-05	0.008291	5.08284e-05	11	72				
LRRC37A	9884	broad.mit.edu	37	17	44408380	44408380	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:44408380C>A	ENST00000320254.5	+	9	3740	c.3737C>A	c.(3736-3738)tCt>tAt	p.S1246Y	ARL17B_ENST00000570618.1_Intron|ARL17B_ENST00000434041.2_Intron|ARL17B_ENST00000575960.1_Intron|ARL17B_ENST00000575698.1_Intron|LRRC37A_ENST00000393465.3_Missense_Mutation_p.S1246Y|LRRC37A_ENST00000496930.1_Missense_Mutation_p.S284Y	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	1246						integral component of membrane (GO:0016021)		p.S1246Y(1)		endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		GCAGCAGTCTCTGTGCTGAAA	0.557																																							uc002ikg.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3736-3738)TCT>TAT		leucine rich repeat containing 37A precursor							19.0	9.0	14.0					17																	44408380		1684	1792	3476	SO:0001583	missense	9884					integral to membrane		g.chr17:44408380C>A	BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.3737C>A	17.37:g.44408380C>A	ENSP00000326324:p.Ser1246Tyr					ARL17A_uc002iki.3_Intron|ARL17A_uc002ikh.3_Intron|ARL17B_uc002ikf.2_Intron|LRRC37A_uc002ikj.2_Missense_Mutation_p.S207Y|LRRC37A_uc010daw.1_Missense_Mutation_p.S176Y	p.S1246Y	NM_014834	NP_055649	A6NMS7	L37A1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.232)	9	3740	+		Melanoma(429;0.211)	1246			Extracellular (Potential).		Q68DY2|Q8IWC7	Missense_Mutation	SNP	ENST00000320254.5	37	c.3737C>A	CCDS11504.2	.	.	.	.	.	.	.	.	.	.	c	12.95	2.091180	0.36855	.	.	ENSG00000176681	ENST00000496930;ENST00000393466;ENST00000393465;ENST00000320254	T;T;T	0.67523	0.72;-0.27;-0.26	2.15	2.15	0.27550	.	.	.	.	.	T	0.77491	0.4138	M	0.72118	2.19	0.21064	N	0.999794	D;D;D	0.89917	1.0;0.992;0.99	D;P;D	0.76071	0.987;0.907;0.962	T	0.62647	-0.6810	9	0.87932	D	0	.	7.9213	0.29848	0.0:1.0:0.0:0.0	.	284;366;1246	E9PP10;Q5YKG5;A6NMS7	.;.;L37A1_HUMAN	Y	284;1246;1246;1246	ENSP00000437021:S284Y;ENSP00000377108:S1246Y;ENSP00000326324:S1246Y	ENSP00000326324:S1246Y	S	+	2	0	LRRC37A	41764141	0.012000	0.17670	0.006000	0.13384	0.044000	0.14063	1.152000	0.31663	1.516000	0.48900	0.423000	0.28283	TCT		0.557	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313519.3	NM_014834		11	18	1	0	0.00074312	0.006122	0.000920326	11	18				
KIF2B	84643	broad.mit.edu	37	17	51901012	51901012	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:51901012G>T	ENST00000268919.4	+	1	774	c.618G>T	c.(616-618)ctG>ctT	p.L206L		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	206					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L206L(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TCTCAGTCCTGGAGCCCCCGC	0.552																																							uc002iua.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(3)	8						c.(616-618)CTG>CTT		kinesin family member 2B							74.0	63.0	66.0					17																	51901012		2203	4300	6503	SO:0001819	synonymous_variant	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51901012G>T	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.618G>T	17.37:g.51901012G>T						uc010wna.1_RNA	p.L206L	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN			1	774	+			206					Q96MA2|Q9BXG6	Silent	SNP	ENST00000268919.4	37	c.618G>T	CCDS32685.1																																																																																				0.552	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		10	64	1	0	1.58986e-06	0.008291	2.21938e-06	10	64				
SMG8	55181	broad.mit.edu	37	17	57288024	57288024	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:57288024C>G	ENST00000543872.2	+	2	876	c.612C>G	c.(610-612)ttC>ttG	p.F204L	SMG8_ENST00000578922.1_Missense_Mutation_p.F204L|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000300917.5_Missense_Mutation_p.F204L|SMG8_ENST00000580498.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	204					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)		p.F204L(1)		NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						TTTACCTATTCTCTGTCTGTC	0.498																																							uc002ixi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(610-612)TTC>TTG		SMG8 protein							92.0	79.0	83.0					17																	57288024		2203	4300	6503	SO:0001583	missense	55181				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding	g.chr17:57288024C>G	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.612C>G	17.37:g.57288024C>G	ENSP00000438748:p.Phe204Leu						p.F204L	NM_018149	NP_060619	Q8ND04	SMG8_HUMAN			1	654	+	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)		204					Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	37	c.612C>G	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698250	0.48307	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.38887	1.11;1.11	5.69	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.41143	0.1146	L	0.48986	1.54	0.51233	D	0.999915	B	0.29301	0.241	B	0.35770	0.21	T	0.39231	-0.9624	10	0.87932	D	0	-15.3841	11.3442	0.49550	0.0:0.855:0.0:0.145	.	204	Q8ND04	SMG8_HUMAN	L	204	ENSP00000300917:F204L;ENSP00000438748:F204L	ENSP00000300917:F204L	F	+	3	2	SMG8	54642806	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.621000	0.46418	0.878000	0.35920	0.655000	0.94253	TTC		0.498	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149		13	64	0	0	0	0.001855	0	13	64				
SCN4A	6329	broad.mit.edu	37	17	62018615	62018615	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:62018615C>A	ENST00000435607.1	-	24	5103	c.5027G>T	c.(5026-5028)tGc>tTc	p.C1676F	SCN4A_ENST00000578147.1_Missense_Mutation_p.C1676F	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1676					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.C1676F(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GATGTCCAGGCAGTGGATCTT	0.567																																							uc002jds.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(5026-5028)TGC>TTC		voltage-gated sodium channel type 4 alpha	Lamotrigine(DB00555)						111.0	109.0	110.0					17																	62018615		2099	4212	6311	SO:0001583	missense	6329				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr17:62018615C>A	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.5027G>T	17.37:g.62018615C>A	ENSP00000396320:p.Cys1676Phe						p.C1676F	NM_000334	NP_000325	P35499	SCN4A_HUMAN			24	5104	-			1676					Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	c.5027G>T	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.200450	0.58126	.	.	ENSG00000007314	ENST00000435607	D	0.95756	-3.8	3.89	3.89	0.44902	.	0.046981	0.85682	D	0.000000	D	0.97052	0.9037	M	0.68317	2.08	0.54753	D	0.999986	D	0.89917	1.0	D	0.85130	0.997	D	0.97498	1.0058	10	0.66056	D	0.02	.	15.399	0.74823	0.0:1.0:0.0:0.0	.	1676	P35499	SCN4A_HUMAN	F	1676	ENSP00000396320:C1676F	ENSP00000396320:C1676F	C	-	2	0	SCN4A	59372347	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.809000	0.69172	2.180000	0.69256	0.561000	0.74099	TGC		0.567	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334		23	89	1	0	1.85244e-09	0.00333	2.98243e-09	23	89				
GPR142	350383	broad.mit.edu	37	17	72368403	72368403	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:72368403G>T	ENST00000335666.4	+	4	1101	c.1053G>T	c.(1051-1053)cgG>cgT	p.R351R		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	351						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R351R(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						TGCAGCCCCGGGTGGGCAAGA	0.632																																							uc010wqy.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1051-1053)CGG>CGT		G protein-coupled receptor 142							97.0	79.0	85.0					17																	72368403		2203	4300	6503	SO:0001819	synonymous_variant	350383					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity	g.chr17:72368403G>T	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.1053G>T	17.37:g.72368403G>T						GPR142_uc010wqx.1_Silent_p.R263R	p.R351R	NM_181790	NP_861455	Q7Z601	GP142_HUMAN			4	1053	+			351			Cytoplasmic (Potential).		A4CYJ8|Q86SL3	Silent	SNP	ENST00000335666.4	37	c.1053G>T	CCDS11698.1																																																																																				0.632	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790		14	43	1	0	2.61681e-11	0.00245	4.51401e-11	14	43				
CD300LB	124599	broad.mit.edu	37	17	72527477	72527477	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:72527477G>T	ENST00000392621.1	-	1	128	c.124C>A	c.(124-126)Cct>Act	p.P42T	CD300LB_ENST00000314401.3_Missense_Mutation_p.P42T	NM_174892.2	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	5	Ig-like V-type.				cellular response to lipopolysaccharide (GO:0071222)|innate immune response (GO:0045087)|neutrophil mediated immunity (GO:0002446)|positive regulation of mast cell activation (GO:0033005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P42T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(1)	21						AGCAGAGCAGGGGGCAGCCAC	0.627																																							uc002jkx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(124-126)CCT>ACT		CD300 molecule-like family member b							54.0	54.0	54.0					17																	72527477		2203	4300	6503	SO:0001583	missense	124599					integral to membrane|plasma membrane	receptor activity	g.chr17:72527477G>T	AF427618	CCDS11700.1, CCDS11700.2	17q25.1	2013-01-11	2006-03-29		ENSG00000178789	ENSG00000178789		"""Immunoglobulin superfamily / V-set domain containing"""	30811	protein-coding gene	gene with protein product	"""triggering receptor expressed on myeloid cells 5"""	610705	"""CD300 antigen like family member B"""			12975309	Standard	NM_174892		Approved	TREM5, CLM7	uc002jkx.2	A8K4G0	OTTHUMG00000067606	ENST00000392621.1:c.124C>A	17.37:g.72527477G>T	ENSP00000376397:p.Pro42Thr					CD300LB_uc010wqz.1_Missense_Mutation_p.P42T	p.P42T	NM_174892	NP_777552	A8K4G0	CLM7_HUMAN			1	137	-			5					Q1EG73|Q8IX40|Q8N6D1	Missense_Mutation	SNP	ENST00000392621.1	37	c.124C>A	CCDS11700.1	.	.	.	.	.	.	.	.	.	.	G	0.643	-0.812391	0.02798	.	.	ENSG00000178789	ENST00000392621;ENST00000314401	T	0.04083	3.71	4.3	-0.0116	0.13991	Immunoglobulin-like (1);	1.107710	0.06970	N	0.817923	T	0.10035	0.0246	L	0.58969	1.84	0.09310	N	1	D;D	0.58268	0.982;0.982	P;P	0.55667	0.781;0.648	T	0.32534	-0.9903	10	0.27785	T	0.31	-7.6399	3.5369	0.07796	0.3285:0.1949:0.4766:0.0	.	42;5	B4DQ71;A8K4G0	.;CLM7_HUMAN	T	5;42	ENSP00000317337:P42T	ENSP00000317337:P42T	P	-	1	0	CD300LB	70039072	0.000000	0.05858	0.001000	0.08648	0.057000	0.15508	-0.331000	0.07914	0.177000	0.19895	0.563000	0.77884	CCT		0.627	CD300LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145082.2	NM_174892		13	47	1	0	9.04627e-18	0.001855	1.8593e-17	13	47				
CCDC40	55036	broad.mit.edu	37	17	78023992	78023992	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr17:78023992A>T	ENST00000397545.4	+	7	1096	c.1069A>T	c.(1069-1071)Agc>Tgc	p.S357C	CCDC40_ENST00000269318.5_Missense_Mutation_p.S357C|CCDC40_ENST00000374876.4_Missense_Mutation_p.S357C|CCDC40_ENST00000374877.3_Missense_Mutation_p.S357C	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	357					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.S357C(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			AATGGCCTCGAGCGAGCGCAG	0.632																																							uc010dht.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1069-1071)AGC>TGC		coiled-coil domain containing 40							14.0	18.0	17.0					17																	78023992		2147	4262	6409	SO:0001583	missense	55036				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm		g.chr17:78023992A>T	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1069A>T	17.37:g.78023992A>T	ENSP00000380679:p.Ser357Cys					CCDC40_uc010wub.1_Missense_Mutation_p.S357C|CCDC40_uc002jxm.3_Missense_Mutation_p.S140C	p.S357C	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)		7	1096	+	all_neural(118;0.167)		357			Potential.		A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	37	c.1069A>T	CCDS42395.1	.	.	.	.	.	.	.	.	.	.	A	11.29	1.596245	0.28445	.	.	ENSG00000141519	ENST00000374877;ENST00000269318;ENST00000374876;ENST00000397545	T;T;T;T	0.46063	0.88;1.96;0.9;0.89	4.85	-2.56	0.06268	.	.	.	.	.	T	0.14830	0.0358	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.001;0.002;0.004	T	0.17379	-1.0371	9	0.28530	T	0.3	-10.491	2.203	0.03928	0.4392:0.0726:0.2242:0.2641	.	357;357;140	Q4G0X9-5;Q4G0X9;Q4G0X9-3	.;CCD40_HUMAN;.	C	357	ENSP00000364011:S357C;ENSP00000269318:S357C;ENSP00000364010:S357C;ENSP00000380679:S357C	ENSP00000269318:S357C	S	+	1	0	CCDC40	75638587	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.889000	0.01614	-0.334000	0.08463	-0.339000	0.08088	AGC		0.632	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082		8	22	0	0	0	0.00308	0	8	22				
ASXL3	80816	broad.mit.edu	37	18	31323602	31323602	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr18:31323602C>G	ENST00000269197.5	+	12	3790	c.3790C>G	c.(3790-3792)Cta>Gta	p.L1264V		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1264	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L1264V(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ATCCTCTGTCCTAATGTCTGT	0.378																																							uc010dmg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(3790-3792)CTA>GTA		additional sex combs like 3							79.0	73.0	75.0					18																	31323602		1861	4098	5959	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31323602C>G	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3790C>G	18.37:g.31323602C>G	ENSP00000269197:p.Leu1264Val					ASXL3_uc002kxq.2_Missense_Mutation_p.L971V	p.L1264V	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN			12	3845	+			1264			Ser-rich.		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.3790C>G	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.594348	0.46214	.	.	ENSG00000141431	ENST00000269197	T	0.52057	0.68	5.68	1.12	0.20585	.	.	.	.	.	T	0.28928	0.0718	L	0.29908	0.895	0.27107	N	0.962461	B	0.33857	0.429	B	0.27608	0.081	T	0.17137	-1.0379	9	0.48119	T	0.1	.	4.8017	0.13299	0.0:0.4779:0.1602:0.3619	.	1264	Q9C0F0	ASXL3_HUMAN	V	1264	ENSP00000269197:L1264V	ENSP00000269197:L1264V	L	+	1	2	ASXL3	29577600	0.954000	0.32549	0.762000	0.31397	0.990000	0.78478	1.359000	0.34113	0.753000	0.32945	0.655000	0.94253	CTA		0.378	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			19	76	0	0	0	0.007413	0	19	76				
ZNF397	84307	broad.mit.edu	37	18	32822650	32822650	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr18:32822650G>C	ENST00000330501.7	+	2	369	c.216G>C	c.(214-216)caG>caC	p.Q72H	ZNF397_ENST00000589420.1_Intron|ZNF397_ENST00000261333.6_Missense_Mutation_p.Q72H|ZNF397_ENST00000592264.1_Missense_Mutation_p.Q72H|ZNF397_ENST00000591206.1_Missense_Mutation_p.Q72H|ZNF397_ENST00000355632.4_Missense_Mutation_p.Q72H|ZNF397_ENST00000585800.1_Missense_Mutation_p.Q72H	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	72	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q72H(2)		breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						GCCGACTCCAGGAACTTTGCT	0.512																																							uc010dmp.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(214-216)CAG>CAC		zinc finger protein 397 isoform 1							51.0	55.0	54.0					18																	32822650		2203	4300	6503	SO:0001583	missense	84307				viral reproduction	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:32822650G>C	BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.216G>C	18.37:g.32822650G>C	ENSP00000331577:p.Gln72His					ZNF397_uc002kyi.2_Missense_Mutation_p.Q72H|ZNF397_uc010dmq.2_Missense_Mutation_p.Q72H|ZNF397_uc010dmr.2_Intron|ZNF397_uc002kyj.2_Missense_Mutation_p.Q72H|ZNF397_uc002kyk.1_Missense_Mutation_p.Q72H	p.Q72H	NM_001135178	NP_001128650	Q8NF99	ZN397_HUMAN			2	372	+			72			SCAN box.		Q9BRM2	Missense_Mutation	SNP	ENST00000330501.7	37	c.216G>C	CCDS45852.1	.	.	.	.	.	.	.	.	.	.	G	9.439	1.087567	0.20390	.	.	ENSG00000186812	ENST00000261333;ENST00000330501;ENST00000355632	T;T;T	0.04551	3.6;3.6;3.6	4.19	1.31	0.21738	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.260739	0.20308	N	0.094890	T	0.05090	0.0136	L	0.55481	1.735	0.27471	N	0.952867	B;B;B;B	0.15719	0.014;0.002;0.009;0.002	B;B;B;B	0.17722	0.019;0.005;0.007;0.003	T	0.30650	-0.9971	10	0.66056	D	0.02	.	3.295	0.06963	0.1728:0.1452:0.5509:0.1311	.	72;72;72;72	Q96K65;Q8NF99;Q8NF99-2;Q8NF99-3	.;ZN397_HUMAN;.;.	H	72	ENSP00000261333:Q72H;ENSP00000331577:Q72H;ENSP00000347850:Q72H	ENSP00000261333:Q72H	Q	+	3	2	ZNF397	31076648	0.335000	0.24748	0.991000	0.47740	0.733000	0.41908	0.441000	0.21611	0.031000	0.15407	-1.094000	0.02160	CAG		0.512	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442398.1	NM_032347		13	71	0	0	0	0.001855	0	13	71				
SYT4	6860	broad.mit.edu	37	18	40853633	40853633	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr18:40853633A>T	ENST00000255224.3	-	2	1129	c.761T>A	c.(760-762)aTt>aAt	p.I254N	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.I236N	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	254	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.I254N(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						AACTTCCCCAATGATATCATC	0.353																																					NSCLC(85;81 1419 2855 22820 35912)	NSCLC(85;81 1419 2855 22820 35912)	uc002law.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(5)	5						c.(760-762)ATT>AAT		synaptotagmin IV							57.0	59.0	58.0					18																	40853633		2201	4300	6501	SO:0001583	missense	6860					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity	g.chr18:40853633A>T	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.761T>A	18.37:g.40853633A>T	ENSP00000255224:p.Ile254Asn					SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_Missense_Mutation_p.I236N|SYT4_uc010dnh.2_Intron	p.I254N	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN			2	1130	-			254			Phospholipid binding (Probable).|C2 1.|Cytoplasmic (Potential).		B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	c.761T>A	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.057374	0.76074	.	.	ENSG00000132872	ENST00000255224;ENST00000442661	T	0.12147	2.71	5.72	5.72	0.89469	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.85682	D	0.000000	T	0.48589	0.1508	M	0.92604	3.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.61098	-0.7131	10	0.87932	D	0	.	16.2988	0.82793	1.0:0.0:0.0:0.0	.	236;254	B4DEU3;Q9H2B2	.;SYT4_HUMAN	N	254;59	ENSP00000255224:I254N	ENSP00000255224:I254N	I	-	2	0	SYT4	39107631	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.229000	0.95273	2.311000	0.77944	0.533000	0.62120	ATT		0.353	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783		8	53	0	0	0	0.00308	0	8	53				
SERPINB5	5268	broad.mit.edu	37	18	61166417	61166417	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr18:61166417G>A	ENST00000382771.4	+	6	924	c.632G>A	c.(631-633)aGt>aAt	p.S211N	SERPINB5_ENST00000464346.1_3'UTR	NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	211					cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S211N(1)		kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						AACATTGACAGTATCAATTGT	0.423																																							uc002liz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(631-633)AGT>AAT		serine (or cysteine) proteinase inhibitor, clade							131.0	113.0	120.0					18																	61166417		2203	4300	6503	SO:0001583	missense	5268				cellular component movement|regulation of proteolysis	cytoplasm|extracellular space	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61166417G>A	U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.632G>A	18.37:g.61166417G>A	ENSP00000372221:p.Ser211Asn						p.S211N	NM_002639	NP_002630	P36952	SPB5_HUMAN			6	774	+			211					B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	ENST00000382771.4	37	c.632G>A	CCDS32839.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.962606	0.34659	.	.	ENSG00000206075	ENST00000382771	T	0.16743	2.32	5.14	0.988	0.19796	Serpin domain (3);	0.587323	0.17423	N	0.174743	T	0.08802	0.0218	N	0.05441	-0.05	0.27750	N	0.944183	B	0.02656	0.0	B	0.06405	0.002	T	0.21965	-1.0230	10	0.87932	D	0	.	10.2677	0.43464	0.8833:0.0:0.1167:0.0	.	211	P36952	SPB5_HUMAN	N	211	ENSP00000372221:S211N	ENSP00000372221:S211N	S	+	2	0	SERPINB5	59317397	0.970000	0.33590	0.000000	0.03702	0.856000	0.48823	3.904000	0.56325	-0.034000	0.13713	0.511000	0.50034	AGT		0.423	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280629.1	NM_002639		9	60	0	0	0	0.006214	0	9	60				
SERPINB13	5275	broad.mit.edu	37	18	61259614	61259614	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr18:61259614C>A	ENST00000344731.5	+	4	360	c.258C>A	c.(256-258)ttC>ttA	p.F86L	SERPINB13_ENST00000269489.5_Missense_Mutation_p.F86L	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	86					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.F86L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						ATCAACAATTCCAAAAGTTTT	0.353																																							uc002ljc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(256-258)TTC>TTA		serine (or cysteine) proteinase inhibitor, clade							103.0	96.0	98.0					18																	61259614		2203	4300	6503	SO:0001583	missense	5275				regulation of proteolysis|response to UV	cytoplasm|extracellular region	serine-type endopeptidase inhibitor activity	g.chr18:61259614C>A	AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.258C>A	18.37:g.61259614C>A	ENSP00000341584:p.Phe86Leu					SERPINB13_uc002ljd.2_5'UTR|SERPINB13_uc010xep.1_Missense_Mutation_p.F95L|SERPINB13_uc010xeq.1_Intron|SERPINB13_uc010xer.1_Intron	p.F86L	NM_012397	NP_036529	Q9UIV8	SPB13_HUMAN			4	426	+			86					A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Missense_Mutation	SNP	ENST00000344731.5	37	c.258C>A	CCDS11985.1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.159496	0.38119	.	.	ENSG00000197641	ENST00000431153;ENST00000269489;ENST00000344731	T;T;D	0.83506	-0.94;2.74;-1.73	4.78	1.99	0.26369	Serpin domain (3);	0.216900	0.33127	N	0.005256	T	0.78162	0.4240	L	0.49455	1.56	0.42989	D	0.994488	B;B	0.21381	0.055;0.001	B;B	0.35971	0.215;0.004	T	0.71073	-0.4698	10	0.52906	T	0.07	.	5.0897	0.14702	0.1494:0.599:0.0:0.2516	.	95;86	B7ZKV6;Q9UIV8	.;SPB13_HUMAN	L	116;86;86	ENSP00000388300:F116L;ENSP00000269489:F86L;ENSP00000341584:F86L	ENSP00000269489:F86L	F	+	3	2	SERPINB13	59410594	0.000000	0.05858	0.283000	0.24790	0.836000	0.47400	-0.378000	0.07446	0.465000	0.27167	0.650000	0.86243	TTC		0.353	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1	NM_012397		12	62	1	0	0.000151284	0.001855	0.000193821	12	62				
SOCS6	9306	broad.mit.edu	37	18	67992886	67992886	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr18:67992886G>T	ENST00000397942.3	+	2	1298	c.982G>T	c.(982-984)Gga>Tga	p.G328*	SOCS6_ENST00000582322.1_Nonsense_Mutation_p.G328*	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	328					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)		p.G328*(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GAACTTCAGTGGACTCACTGG	0.493																																					Melanoma(84;1024 1361 24382 36583 42651)	Melanoma(84;1024 1361 24382 36583 42651)	uc002lkr.1		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)|lung(1)	2						c.(982-984)GGA>TGA		suppressor of cytokine signaling 6							69.0	65.0	67.0					18																	67992886		2203	4300	6503	SO:0001587	stop_gained	9306				defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm		g.chr18:67992886G>T	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.982G>T	18.37:g.67992886G>T	ENSP00000381034:p.Gly328*					SOCS6_uc010dqq.2_Nonsense_Mutation_p.G328*	p.G328*	NM_004232	NP_004223	O14544	SOCS6_HUMAN			2	1298	+		Esophageal squamous(42;0.129)|Colorectal(73;0.152)	328					Q8WUM3	Nonsense_Mutation	SNP	ENST00000397942.3	37	c.982G>T	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	G	37	6.472286	0.97594	.	.	ENSG00000170677	ENST00000397942	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-11.4495	18.497	0.90869	0.0:0.0:1.0:0.0	.	.	.	.	X	328	.	ENSP00000381034:G328X	G	+	1	0	SOCS6	66143866	1.000000	0.71417	0.088000	0.20740	0.950000	0.60333	5.510000	0.67018	2.354000	0.79902	0.561000	0.74099	GGA		0.493	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2			12	53	1	0	6.40141e-05	0.000978	8.33391e-05	12	53				
ZNF555	148254	broad.mit.edu	37	19	2852695	2852695	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:2852695G>T	ENST00000334241.4	+	4	770	c.632G>T	c.(631-633)cGt>cTt	p.R211L	AC006130.3_ENST00000589365.1_RNA|ZNF555_ENST00000591539.1_Missense_Mutation_p.R210L	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	211					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R211L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCTTTCCTCGTACTTCCTCC	0.448																																							uc002lwo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(631-633)CGT>CTT		zinc finger protein 555							126.0	106.0	112.0					19																	2852695		2203	4300	6503	SO:0001583	missense	148254				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:2852695G>T	AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.632G>T	19.37:g.2852695G>T	ENSP00000334853:p.Arg211Leu					ZNF555_uc002lwn.3_Missense_Mutation_p.R210L	p.R211L	NM_152791	NP_690004	Q8NEP9	ZN555_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	4	721	+			211			C2H2-type 2.		A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	ENST00000334241.4	37	c.632G>T	CCDS12096.1	.	.	.	.	.	.	.	.	.	.	G	8.601	0.886793	0.17540	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.35236	1.32	3.4	0.557	0.17260	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19248	0.0462	N	0.26092	0.79	0.09310	N	1	B;B	0.34161	0.439;0.436	B;B	0.32211	0.142;0.056	T	0.21109	-1.0255	9	0.13853	T	0.58	.	5.2387	0.15460	0.1361:0.384:0.4798:0.0	.	211;210	Q8NEP9;A8KA89	ZN555_HUMAN;.	L	211;210	ENSP00000334853:R211L	ENSP00000334853:R211L	R	+	2	0	ZNF555	2803695	0.000000	0.05858	0.000000	0.03702	0.972000	0.66771	-2.943000	0.00682	0.096000	0.17463	0.561000	0.74099	CGT		0.448	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451637.3	NM_152791		24	75	1	0	2.27525e-19	0.003954	4.8626e-19	24	75				
MUC16	94025	broad.mit.edu	37	19	9061138	9061138	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:9061138T>C	ENST00000397910.4	-	3	26511	c.26308A>G	c.(26308-26310)Atc>Gtc	p.I8770V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8772	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.I8770V(2)|p.I4403V(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATTCTAGTGATGGTTTCCGTG	0.493																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(26308-26310)ATC>GTC		mucin 16							155.0	139.0	144.0					19																	9061138		1966	4155	6121	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9061138T>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.26308A>G	19.37:g.9061138T>C	ENSP00000381008:p.Ile8770Val						p.I8770V	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	26512	-			8772			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.26308A>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	N	4.011	-0.000674	0.07819	.	.	ENSG00000181143	ENST00000397910	T	0.02236	4.38	2.28	-3.0	0.05480	.	.	.	.	.	T	0.01558	0.0050	L	0.27053	0.805	.	.	.	B	0.12013	0.005	B	0.10450	0.005	T	0.48479	-0.9032	8	0.87932	D	0	.	0.3574	0.00359	0.2033:0.2861:0.2071:0.3035	.	8770	B5ME49	.	V	8770	ENSP00000381008:I8770V	ENSP00000381008:I8770V	I	-	1	0	MUC16	8922138	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.437000	0.02419	-0.935000	0.03728	0.248000	0.18094	ATC		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		26	96	0	0	0	0.00632	0	26	96				
MUC16	94025	broad.mit.edu	37	19	9074617	9074617	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:9074617T>A	ENST00000397910.4	-	3	13032	c.12829A>T	c.(12829-12831)Acc>Tcc	p.T4277S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4279	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T4277S(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGTGGGAGGTAACCAATGGA	0.493																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(12829-12831)ACC>TCC		mucin 16							134.0	131.0	132.0					19																	9074617		2015	4184	6199	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9074617T>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12829A>T	19.37:g.9074617T>A	ENSP00000381008:p.Thr4277Ser						p.T4277S	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	13033	-			4279			Thr-rich.|Extracellular (Potential).|Ser-rich.		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.12829A>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	4.810	0.150578	0.09185	.	.	ENSG00000181143	ENST00000397910	T	0.46451	0.87	1.98	0.941	0.19519	.	.	.	.	.	T	0.38585	0.1046	L	0.46157	1.445	.	.	.	P	0.44659	0.84	P	0.47744	0.556	T	0.46428	-0.9192	8	0.87932	D	0	.	3.6074	0.08048	0.0:0.2062:0.0:0.7938	.	4277	B5ME49	.	S	4277	ENSP00000381008:T4277S	ENSP00000381008:T4277S	T	-	1	0	MUC16	8935617	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.070000	0.11523	0.215000	0.20761	0.260000	0.18958	ACC		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		17	66	0	0	0	0.00499	0	17	66				
ICAM3	3385	broad.mit.edu	37	19	10444193	10444193	+	IGR	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:10444193C>T	ENST00000160262.5	-	0	1934				RAVER1_ENST00000293677.6_Silent_p.G14G	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3						extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)	p.G14G(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			TCTTGGGAAACCCGGCGCCTT	0.716																																							uc002moa.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(40-42)GGG>GGA		RAVER1							9.0	12.0	11.0					19																	10444193		1842	4037	5879	SO:0001628	intergenic_variant	125950					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding	g.chr19:10444193C>T		CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942			19.37:g.10444193C>T							p.G14G	NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)		1	122	-			Error:Variant_position_missing_in_Q8IY67_after_alignment					Q6PD68	Silent	SNP	ENST00000160262.5	37	c.42G>A	CCDS12235.1																																																																																				0.716	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451234.1			3	22	0	0	0	0.004672	0	3	22				
ZNF260	339324	broad.mit.edu	37	19	37005408	37005408	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:37005408C>A	ENST00000523638.1	-	3	1854	c.733G>T	c.(733-735)Gag>Tag	p.E245*	ZNF260_ENST00000588993.1_Nonsense_Mutation_p.E245*|ZNF260_ENST00000592282.1_Nonsense_Mutation_p.E245*|ZNF260_ENST00000593142.1_Nonsense_Mutation_p.E245*	NM_001166036.1|NM_001166037.1|NM_001166038.1	NP_001159508.1|NP_001159509.1|NP_001159510.1	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	245					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E245*(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)	15	Esophageal squamous(110;0.162)					TAAGGTTTCTCTCCTGTGTGA	0.418																																							uc002oee.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(733-735)GAG>TAG		zinc finger protein 260							117.0	115.0	116.0					19																	37005408		2203	4300	6503	SO:0001587	stop_gained	339324				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37005408C>A	AK122854	CCDS33003.1	19q13.12	2013-01-08				ENSG00000254004		"""Zinc fingers, C2H2-type"""	13499	protein-coding gene	gene with protein product		613749					Standard	NM_001166036		Approved	ozrf1, Zfp260	uc002oed.2	Q3ZCT1		ENST00000523638.1:c.733G>T	19.37:g.37005408C>A	ENSP00000429803:p.Glu245*					ZNF260_uc002oed.1_Nonsense_Mutation_p.E242*|ZNF260_uc010eey.1_Nonsense_Mutation_p.E242*|ZNF260_uc002oef.1_Nonsense_Mutation_p.E242*	p.E245*	NM_001012756	NP_001012774	Q3ZCT1	ZN260_HUMAN			4	1577	-	Esophageal squamous(110;0.162)		245					Q0VF43	Nonsense_Mutation	SNP	ENST00000523638.1	37	c.733G>T	CCDS33003.1	.	.	.	.	.	.	.	.	.	.	C	47	13.193241	0.99726	.	.	ENSG00000254004	ENST00000523638	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.5614	0.84567	0.0:1.0:0.0:0.0	.	.	.	.	X	245	.	ENSP00000429803:E245X	E	-	1	0	ZNF260	41697248	0.992000	0.36948	1.000000	0.80357	0.977000	0.68977	3.006000	0.49529	2.496000	0.84212	0.561000	0.74099	GAG		0.418	ZNF260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109564.2	NM_001012756		30	129	1	0	5.90632e-09	0.002445	9.23221e-09	30	129				
ZFP36	7538	broad.mit.edu	37	19	39898874	39898874	+	Silent	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:39898874G>A	ENST00000248673.3	+	2	574	c.516G>A	c.(514-516)ctG>ctA	p.L172L	MIR4530_ENST00000581459.1_RNA|ZFP36_ENST00000597629.1_Silent_p.L178L	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	172					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)	p.L172L(1)		large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCGAAGACCTGGCGGCCCCGG	0.662																																					NSCLC(67;1164 1324 12056 21056 30097)	NSCLC(67;1164 1324 12056 21056 30097)	uc002olh.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(514-516)CTG>CTA		zinc finger protein 36, C3H type, homolog							55.0	66.0	62.0					19																	39898874		2203	4297	6500	SO:0001819	synonymous_variant	7538				positive regulation of nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	AU-rich element binding|DNA binding|mRNA binding|protein binding|single-stranded RNA binding|zinc ion binding	g.chr19:39898874G>A	M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.516G>A	19.37:g.39898874G>A						ZFP36_uc010egn.1_Nonsense_Mutation_p.W45*	p.L172L	NM_003407	NP_003398	P26651	TTP_HUMAN	Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)		2	574	+	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		172					B2RA54	Silent	SNP	ENST00000248673.3	37	c.516G>A																																																																																					0.662	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				27	122	0	0	0	0.004656	0	27	122				
ZNF546	339327	broad.mit.edu	37	19	40520110	40520110	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:40520110T>A	ENST00000347077.4	+	7	1149	c.933T>A	c.(931-933)agT>agA	p.S311R	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Missense_Mutation_p.S285R	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S311R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AAGCCTTTAGTCGTGTTAGAG	0.408																																							uc002oms.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(931-933)AGT>AGA		zinc finger protein 546							108.0	112.0	110.0					19																	40520110		2203	4300	6503	SO:0001583	missense	339327				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:40520110T>A	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.933T>A	19.37:g.40520110T>A	ENSP00000339823:p.Ser311Arg					ZNF546_uc002omt.2_Missense_Mutation_p.S285R	p.S311R	NM_178544	NP_848639	Q86UE3	ZN546_HUMAN			7	1189	+	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		311			C2H2-type 4.		A8K913	Missense_Mutation	SNP	ENST00000347077.4	37	c.933T>A	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	t	0.671	-0.801787	0.02841	.	.	ENSG00000187187	ENST00000347077	T	0.07567	3.18	2.7	-2.5	0.06384	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03695	0.0105	L	0.31207	0.915	0.09310	N	1	B;B	0.33345	0.409;0.022	B;B	0.17433	0.018;0.012	T	0.42749	-0.9433	9	0.18276	T	0.48	.	2.6386	0.04965	0.3359:0.2293:0.0:0.4347	.	285;311	B3KVL3;Q86UE3	.;ZN546_HUMAN	R	311	ENSP00000339823:S311R	ENSP00000339823:S311R	S	+	3	2	ZNF546	45211950	0.000000	0.05858	0.003000	0.11579	0.621000	0.37620	-3.643000	0.00405	-0.773000	0.04596	-0.256000	0.11100	AGT		0.408	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544		18	109	0	0	0	0.006122	0	18	109				
APOC4	346	broad.mit.edu	37	19	45448463	45448463	+	Silent	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:45448463G>A	ENST00000592954.1	+	3	325	c.285G>A	c.(283-285)ccG>ccA	p.P95P	APOC4_ENST00000419266.2_Silent_p.P95P|APOC2_ENST00000590360.1_5'Flank|APOC4-APOC2_ENST00000589057.1_Intron|APOC2_ENST00000591597.1_5'Flank|APOC2_ENST00000252490.4_5'Flank|APOC2_ENST00000592257.1_5'Flank	NM_001646.2	NP_001637.1	P55056	APOC4_HUMAN	apolipoprotein C-IV	95					lipid metabolic process (GO:0006629)|positive regulation of sequestering of triglyceride (GO:0010890)|triglyceride homeostasis (GO:0070328)	high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	lipid transporter activity (GO:0005319)	p.P95P(1)		breast(1)|endometrium(1)|lung(2)	4	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00334)|Epithelial(262;0.178)		ACCTGGGTCCGCTCACCAAGG	0.592																																							uc002pag.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(283-285)CCG>CCA		apolipoprotein C-IV precursor							178.0	176.0	176.0					19																	45448463		2203	4300	6503	SO:0001819	synonymous_variant	346				lipid metabolic process|positive regulation of sequestering of triglyceride|triglyceride homeostasis	high-density lipoprotein particle|very-low-density lipoprotein particle	lipid transporter activity	g.chr19:45448463G>A	U32576	CCDS12649.1	19q13.2	2013-09-30			ENSG00000267467	ENSG00000267467		"""Apolipoproteins"""	611	protein-coding gene	gene with protein product		600745				8530039	Standard	NM_001646		Approved			P55056	OTTHUMG00000180845	ENST00000592954.1:c.285G>A	19.37:g.45448463G>A						APOC2_uc002pah.2_5'Flank	p.P95P	NM_001646	NP_001637	P55056	APOC4_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00334)|Epithelial(262;0.178)	3	325	+	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)	95					B3KWY6|Q53YY8	Silent	SNP	ENST00000592954.1	37	c.285G>A	CCDS12649.1																																																																																				0.592	APOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453255.1	NM_001646		6	298	0	0	0	0.001984	0	6	298				
FUZ	80199	broad.mit.edu	37	19	50314895	50314895	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:50314895T>G	ENST00000313777.4	-	4	543	c.380A>C	c.(379-381)gAc>gCc	p.D127A	FUZ_ENST00000528094.1_Missense_Mutation_p.D91A|AC006942.4_ENST00000600669.1_RNA|FUZ_ENST00000534008.1_5'UTR|FUZ_ENST00000526575.1_3'UTR|FUZ_ENST00000445575.2_Missense_Mutation_p.D127A|FUZ_ENST00000533418.1_Missense_Mutation_p.D77A	NM_025129.4	NP_079405.2	Q9BT04	FUZZY_HUMAN	fuzzy planar cell polarity protein	127					cilium assembly (GO:0042384)|embryonic body morphogenesis (GO:0010172)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of planar polarity (GO:0001736)|hair follicle development (GO:0001942)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)|negative regulation of neural crest formation (GO:0090301)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|positive regulation of cilium assembly (GO:0045724)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)		p.D127A(1)		endometrium(1)|lung(3)	4		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)		CACCCTCAAGTCCTTCTTCAG	0.547																																							uc002ppq.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(379-381)GAC>GCC		fuzzy homolog							399.0	359.0	372.0					19																	50314895		2203	4300	6503	SO:0001583	missense	80199				cilium assembly|embryonic body morphogenesis|embryonic skeletal system morphogenesis|establishment of planar polarity|hair follicle development|neural tube closure|protein transport|regulation of smoothened signaling pathway	cytoplasm|cytoskeleton		g.chr19:50314895T>G	BC016793	CCDS12781.1, CCDS54293.1	19q13.33	2013-03-05	2013-03-05			ENSG00000010361			26219	protein-coding gene	gene with protein product		610622	"""fuzzy homolog (Drosophila)"""			21761479	Standard	NM_001171937		Approved	FLJ22688, Fy	uc002ppq.2	Q9BT04		ENST00000313777.4:c.380A>C	19.37:g.50314895T>G	ENSP00000313309:p.Asp127Ala					FUZ_uc002ppr.1_Missense_Mutation_p.D27A|FUZ_uc002pps.1_RNA|FUZ_uc002ppt.1_RNA|FUZ_uc002ppu.1_Missense_Mutation_p.D91A|FUZ_uc002ppv.1_Missense_Mutation_p.D77A|FUZ_uc010ybd.1_Missense_Mutation_p.D127A	p.D127A	NM_025129	NP_079405	Q9BT04	FUZZY_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)	4	485	-		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)	127					B2RD86|B5MDH0|Q6PJY0|Q9H613	Missense_Mutation	SNP	ENST00000313777.4	37	c.380A>C	CCDS12781.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.304720	0.60305	.	.	ENSG00000010361	ENST00000528094;ENST00000533418;ENST00000529634;ENST00000313777;ENST00000377092;ENST00000445575;ENST00000529004;ENST00000421740	T;T;T;T	0.20069	2.1;2.1;2.1;2.1	4.62	4.62	0.57501	.	0.181999	0.46145	D	0.000317	T	0.22003	0.0530	L	0.58810	1.83	0.40114	D	0.976528	P;P;P	0.41232	0.59;0.649;0.743	B;B;B	0.38755	0.117;0.254;0.281	T	0.05484	-1.0882	10	0.72032	D	0.01	-14.8682	10.3369	0.43854	0.0:0.0:0.0:1.0	.	127;91;127	B4DHF8;Q9BT04-3;Q9BT04	.;.;FUZZY_HUMAN	A	91;77;127;127;27;127;77;127	ENSP00000435177:D91A;ENSP00000431731:D77A;ENSP00000313309:D127A;ENSP00000408018:D127A	ENSP00000313309:D127A	D	-	2	0	FUZ	55006707	1.000000	0.71417	0.998000	0.56505	0.908000	0.53690	4.709000	0.61867	1.939000	0.56221	0.379000	0.24179	GAC		0.547	FUZ-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393986.1	NM_025129		13	495	0	0	0	0.004007	0	13	495				
BIRC8	112401	broad.mit.edu	37	19	53793473	53793473	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:53793473T>A	ENST00000426466.1	-	1	1402	c.155A>T	c.(154-156)aAg>aTg	p.K52M		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	52					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.K52M(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		AGGATCTTCCTTGGGCTTCCA	0.428																																							uc002qbk.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(154-156)AAG>ATG		baculoviral IAP repeat-containing 8							92.0	89.0	90.0					19																	53793473		2203	4300	6503	SO:0001583	missense	112401				apoptosis		zinc ion binding	g.chr19:53793473T>A	AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.155A>T	19.37:g.53793473T>A	ENSP00000412957:p.Lys52Met						p.K52M	NM_033341	NP_203127	Q96P09	BIRC8_HUMAN		GBM - Glioblastoma multiforme(134;0.00304)	1	1403	-			52			BIR.		Q6IPY1|Q96RW5	Missense_Mutation	SNP	ENST00000426466.1	37	c.155A>T	CCDS12863.1	.	.	.	.	.	.	.	.	.	.	T	6.459	0.452864	0.12283	.	.	ENSG00000163098	ENST00000426466	T	0.04049	3.72	0.502	-0.833	0.10782	Baculoviral inhibition of apoptosis protein repeat (5);	.	.	.	.	T	0.03434	0.0099	L	0.42245	1.32	0.09310	N	1	P	0.35628	0.513	B	0.24974	0.057	T	0.37776	-0.9691	9	0.87932	D	0	-5.1313	2.1572	0.03815	0.0:0.2838:0.328:0.3883	.	52	Q96P09	BIRC8_HUMAN	M	52	ENSP00000412957:K52M	ENSP00000412957:K52M	K	-	2	0	BIRC8	58485285	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.256000	0.18351	-0.373000	0.07979	0.344000	0.21773	AAG		0.428	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464357.1	NM_033341		19	80	0	0	0	0.006122	0	19	80				
NLRP12	91662	broad.mit.edu	37	19	54310879	54310879	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:54310879G>C	ENST00000324134.6	-	4	2281	c.2113C>G	c.(2113-2115)Ctg>Gtg	p.L705V	NLRP12_ENST00000351894.4_Missense_Mutation_p.L705V|NLRP12_ENST00000354278.3_Missense_Mutation_p.L705V|NLRP12_ENST00000391773.1_Missense_Mutation_p.L706V|NLRP12_ENST00000345770.5_Missense_Mutation_p.L706V|NLRP12_ENST00000391775.3_Missense_Mutation_p.L705V|NLRP12_ENST00000391772.1_Missense_Mutation_p.L706V|NLRP12_ENST00000535162.1_Missense_Mutation_p.L705V	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	705					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.L705V(1)		NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCCGCTGCCAGATGTTCACTG	0.562																																							uc002qch.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(2113-2115)CTG>GTG		NLR family, pyrin domain containing 12 isoform							107.0	91.0	96.0					19																	54310879		2203	4300	6503	SO:0001583	missense	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54310879G>C	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2113C>G	19.37:g.54310879G>C	ENSP00000319377:p.Leu705Val					NLRP12_uc010eqw.2_Translation_Start_Site|NLRP12_uc002qci.3_Missense_Mutation_p.L705V|NLRP12_uc002qcj.3_Missense_Mutation_p.L706V|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.L706V	p.L705V	NM_144687	NP_653288	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	4	2333	-	Ovarian(34;0.19)		705					A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	c.2113C>G	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666877	0.47677	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.92199	-2.8;-2.8;-2.8;-2.8;-2.8;-2.99;-2.99	3.77	3.77	0.43336	.	0.000000	0.31519	U	0.007507	D	0.95661	0.8589	M	0.85197	2.74	0.80722	D	1	D;D;P;D	0.76494	0.997;0.999;0.821;0.999	D;D;B;D	0.85130	0.967;0.997;0.338;0.997	D	0.95118	0.8244	10	0.45353	T	0.12	.	11.8691	0.52511	0.0:0.0:1.0:0.0	.	706;705;705;705	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	V	705;705;705;705;705;706;706;706	ENSP00000319377:L705V;ENSP00000438030:L705V;ENSP00000340473:L705V;ENSP00000346231:L705V;ENSP00000375655:L705V;ENSP00000375653:L706V;ENSP00000375652:L706V	ENSP00000319377:L705V	L	-	1	2	NLRP12	59002691	1.000000	0.71417	0.029000	0.17559	0.094000	0.18550	3.439000	0.52878	2.080000	0.62538	0.485000	0.47835	CTG		0.562	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		11	35	0	0	0	0.001855	0	11	35				
CNOT3	4849	broad.mit.edu	37	19	54647235	54647235	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:54647235G>A	ENST00000406403.1	+	3	1754	c.151G>A	c.(151-153)Gag>Aag	p.E51K	CNOT3_ENST00000358389.3_5'UTR|CNOT3_ENST00000221232.5_Missense_Mutation_p.E51K			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	51					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.E51K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CCTAAAGAAGGAGATTAAGAA	0.552																																							uc002qdj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(151-153)GAG>AAG		CCR4-NOT transcription complex, subunit 3							76.0	76.0	76.0					19																	54647235		2203	4300	6503	SO:0001583	missense	4849				nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding	g.chr19:54647235G>A	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.151G>A	19.37:g.54647235G>A	ENSP00000383954:p.Glu51Lys					CNOT3_uc010yel.1_Missense_Mutation_p.E51K|CNOT3_uc002qdi.2_5'UTR|CNOT3_uc002qdk.1_Missense_Mutation_p.E51K|CNOT3_uc010ere.1_5'Flank	p.E51K	NM_014516	NP_055331	O75175	CNOT3_HUMAN			4	462	+	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		51					Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	c.151G>A	CCDS12880.1	.	.	.	.	.	.	.	.	.	.	G	31	5.104260	0.94245	.	.	ENSG00000088038	ENST00000221232;ENST00000406403	T;T	0.61274	0.12;0.12	4.52	4.52	0.55395	Not CCR4-Not complex component, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80210	0.4581	M	0.89904	3.07	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	D	0.84940	0.0865	10	0.87932	D	0	-32.2546	16.5341	0.84368	0.0:0.0:1.0:0.0	.	51;51	B7Z6J7;O75175	.;CNOT3_HUMAN	K	51	ENSP00000221232:E51K;ENSP00000383954:E51K	ENSP00000221232:E51K	E	+	1	0	CNOT3	59339047	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.010000	0.93611	2.512000	0.84698	0.655000	0.94253	GAG		0.552	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516		18	77	0	0	0	0.007413	0	18	77				
ZSCAN5B	342933	broad.mit.edu	37	19	56704299	56704299	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:56704299C>A	ENST00000586855.2	-	2	436	c.123G>T	c.(121-123)gaG>gaT	p.E41D	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.E41D			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	41					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.E41D(2)		breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TGTGCCAAGTCTCAGGGTTCC	0.577																																							uc010ygh.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(121-123)GAG>GAT		zinc finger and SCAN domain containing 5B							45.0	44.0	44.0					19																	56704299		2203	4300	6503	SO:0001583	missense	342933				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:56704299C>A		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.123G>T	19.37:g.56704299C>A	ENSP00000466072:p.Glu41Asp						p.E41D	NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN			1	123	-			41						Missense_Mutation	SNP	ENST00000586855.2	37	c.123G>T	CCDS46203.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320336	0.41096	.	.	ENSG00000197213	ENST00000358992	T	0.09255	3.0	2.48	-1.24	0.09435	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (2);	.	.	.	.	T	0.18002	0.0432	M	0.79011	2.435	0.09310	N	1	D	0.58268	0.982	P	0.52909	0.713	T	0.11470	-1.0586	9	0.51188	T	0.08	.	2.3367	0.04250	0.2389:0.4589:0.0:0.3022	.	41	A6NJL1	ZSA5B_HUMAN	D	41	ENSP00000351883:E41D	ENSP00000351883:E41D	E	-	3	2	ZSCAN5B	61396111	0.129000	0.22400	0.001000	0.08648	0.111000	0.19643	0.828000	0.27435	-0.156000	0.11079	0.313000	0.20887	GAG		0.577	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456		9	16	1	0	3.09899e-07	0.004482	4.54957e-07	9	16				
USP29	57663	broad.mit.edu	37	19	57641649	57641649	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:57641649A>G	ENST00000254181.4	+	4	2060	c.1606A>G	c.(1606-1608)Agt>Ggt	p.S536G	USP29_ENST00000598197.1_Missense_Mutation_p.S536G	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	536	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAAATCTTTAAGTTTATCTTC	0.423																																							uc002qny.2		NA																	0				lung(6)|ovary(2)|breast(2)|pancreas(1)	11						c.(1606-1608)AGT>GGT		ubiquitin specific peptidase 29							131.0	141.0	138.0					19																	57641649		2203	4300	6503	SO:0001583	missense	57663				protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chr19:57641649A>G		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1606A>G	19.37:g.57641649A>G	ENSP00000254181:p.Ser536Gly						p.S536G	NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	1962	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	536						Missense_Mutation	SNP	ENST00000254181.4	37	c.1606A>G	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	A	10.97	1.501172	0.26861	.	.	ENSG00000131864	ENST00000254181	T	0.74209	-0.82	2.52	1.47	0.22746	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.	.	.	.	T	0.68091	0.2963	L	0.46157	1.445	0.20196	N	0.99992	P	0.43542	0.81	P	0.45946	0.498	T	0.55166	-0.8183	9	0.32370	T	0.25	-1.5664	6.2785	0.20993	0.7776:0.0:0.0:0.2224	.	536	Q9HBJ7	UBP29_HUMAN	G	536	ENSP00000254181:S536G	ENSP00000254181:S536G	S	+	1	0	USP29	62333461	0.926000	0.31397	0.004000	0.12327	0.210000	0.24377	2.673000	0.46858	0.345000	0.23873	0.383000	0.25322	AGT		0.423	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1			3	247	0	0	0	0.004672	0	3	247				
GREB1	9687	broad.mit.edu	37	2	11732998	11732998	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:11732998C>T	ENST00000381486.2	+	11	1742	c.1442C>T	c.(1441-1443)gCg>gTg	p.A481V	GREB1_ENST00000234142.5_Missense_Mutation_p.A481V	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	481						integral component of membrane (GO:0016021)		p.A481V(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TACCAGCAGGCGCCGCCGCAG	0.731																																					Ovarian(39;850 945 2785 23371 33093)	Ovarian(39;850 945 2785 23371 33093)	uc002rbk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1441-1443)GCG>GTG		growth regulation by estrogen in breast cancer 1							7.0	8.0	7.0					2																	11732998		1872	3936	5808	SO:0001583	missense	9687					integral to membrane		g.chr2:11732998C>T		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.1442C>T	2.37:g.11732998C>T	ENSP00000370896:p.Ala481Val					GREB1_uc002rbo.1_Missense_Mutation_p.A115V	p.A481V	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	11	1742	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		481					A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	c.1442C>T	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252374	0.59212	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000432985	T;T;T	0.44881	3.25;3.25;0.91	4.83	1.92	0.25849	.	0.616197	0.15322	N	0.268483	T	0.25082	0.0609	L	0.29908	0.895	0.22096	N	0.999364	B;P	0.52170	0.003;0.951	B;B	0.38921	0.003;0.285	T	0.09465	-1.0673	10	0.30854	T	0.27	-36.4226	7.2481	0.26133	0.0:0.6629:0.122:0.2151	.	115;481	C9JIG0;Q4ZG55	.;GREB1_HUMAN	V	481;481;115	ENSP00000370896:A481V;ENSP00000234142:A481V;ENSP00000403886:A115V	ENSP00000234142:A481V	A	+	2	0	GREB1	11650449	0.117000	0.22190	0.976000	0.42696	0.998000	0.95712	0.590000	0.23954	0.072000	0.16694	0.585000	0.79938	GCG		0.731	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		4	14	0	0	0	0.000602	0	4	14				
ACTG2	72	broad.mit.edu	37	2	74146648	74146648	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:74146648C>A	ENST00000409624.1	+	10	1720	c.1077C>A	c.(1075-1077)agC>agA	p.S359R	ACTG2_ENST00000345517.3_Missense_Mutation_p.S359R|ACTG2_ENST00000409731.3_Missense_Mutation_p.S316R			P63267	ACTH_HUMAN	actin, gamma 2, smooth muscle, enteric	359					muscle contraction (GO:0006936)	blood microparticle (GO:0072562)|cell periphery (GO:0071944)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.S359R(1)		large_intestine(3)|lung(14)|skin(1)	18						TGTGGATCAGCAAGCCTGAGT	0.532																																							uc002sjw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1075-1077)AGC>AGA		actin, gamma 2 propeptide							80.0	79.0	79.0					2																	74146648		2203	4300	6503	SO:0001583	missense	72				muscle contraction	cytoskeleton|cytosol	ATP binding	g.chr2:74146648C>A		CCDS1930.1, CCDS56124.1	2p13.1	2008-05-20			ENSG00000163017	ENSG00000163017			145	protein-coding gene	gene with protein product		102545		ACTL3, ACTA3		1710027, 1673027	Standard	NM_001199893		Approved	ACTSG	uc002sjw.3	P63267	OTTHUMG00000129813	ENST00000409624.1:c.1077C>A	2.37:g.74146648C>A	ENSP00000386857:p.Ser359Arg					ACTG2_uc010fey.2_Missense_Mutation_p.S359R|ACTG2_uc010yrn.1_Missense_Mutation_p.S316R	p.S359R	NM_001615	NP_001606	P63267	ACTH_HUMAN			9	1199	+			359					B2R7E7|B4E315|D6W5H8|E9PG30|P12718|Q504R1|Q6FI22	Missense_Mutation	SNP	ENST00000409624.1	37	c.1077C>A	CCDS1930.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.894908	0.52121	.	.	ENSG00000163017	ENST00000409731;ENST00000345517;ENST00000409624	D;D;D	0.96200	-3.94;-3.94;-3.94	4.8	4.8	0.61643	Actin, conserved site (1);	0.396124	0.23014	N	0.052934	D	0.98264	0.9425	M	0.91768	3.24	0.53005	D	0.999961	P;P	0.39696	0.683;0.683	P;D	0.63793	0.59;0.918	D	0.99019	1.0817	10	0.87932	D	0	.	17.1435	0.86760	0.0:1.0:0.0:0.0	.	316;359	E9PG30;P63267	.;ACTH_HUMAN	R	316;359;359	ENSP00000386929:S316R;ENSP00000295137:S359R;ENSP00000386857:S359R	ENSP00000295137:S359R	S	+	3	2	ACTG2	74000156	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.516000	0.45520	2.651000	0.90000	0.591000	0.81541	AGC		0.532	ACTG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328086.1	NM_001615		27	80	1	0	8.24728e-16	0.004656	1.60623e-15	27	80				
TRABD2A	129293	broad.mit.edu	37	2	85051250	85051250	+	Silent	SNP	C	C	T	rs375900394		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:85051250C>T	ENST00000409520.2	-	6	1203	c.1161G>A	c.(1159-1161)ccG>ccA	p.P387P	TRABD2A_ENST00000479944.1_5'UTR|TRABD2A_ENST00000335459.5_Silent_p.P338P	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	387					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)	p.P387P(1)|p.P338P(1)									CTTCTGGTGCCGGTACTTCCA	0.587																																							uc010ysl.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1159-1161)CCG>CCA		hypothetical protein LOC129293 precursor				0,4368		0,0,2184	55.0	64.0	61.0		1014	2.1	0.0	2		61	1,8583		0,1,4291	no	coding-synonymous	C2orf89	NM_001080824.1		0,1,6475	TT,TC,CC		0.0116,0.0,0.0077		338/457	85051250	1,12951	2184	4292	6476	SO:0001819	synonymous_variant	129293					integral to membrane		g.chr2:85051250C>T	BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.1161G>A	2.37:g.85051250C>T						C2orf89_uc002sou.3_Silent_p.P338P	p.P387P	NM_001080824	NP_001074293	Q86V40	CB089_HUMAN			6	1250	-			387			Extracellular (Potential).		B4DKK8|I6UMB9	Silent	SNP	ENST00000409520.2	37	c.1161G>A																																																																																					0.587	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001080824		7	27	0	0	0	0.004482	0	7	27				
GPAT2	150763	broad.mit.edu	37	2	96687911	96687911	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:96687911C>A	ENST00000434632.1	-	23	2843	c.2384G>T	c.(2383-2385)aGc>aTc	p.S795I	GPAT2_ENST00000359548.4_Missense_Mutation_p.S795I|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Missense_Mutation_p.S724I|GPAT2_ENST00000377137.3_3'UTR			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	795					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.S795I(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						ACAGTTCTAGCTACAAATGAA	0.552																																							uc002svf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2383-2385)AGC>ATC		glycerol-3-phosphate acyltransferase 2,							28.0	27.0	28.0					2																	96687911		1803	4077	5880	SO:0001583	missense	150763				glycerol-3-phosphate metabolic process|phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity	g.chr2:96687911C>A	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.2384G>T	2.37:g.96687911C>A	ENSP00000389395:p.Ser795Ile					LOC729234_uc010fht.2_Intron|GPAT2_uc002svd.2_Missense_Mutation_p.S614I|GPAT2_uc002sve.2_Missense_Mutation_p.S597I|GPAT2_uc002svg.2_Missense_Mutation_p.S674I|GPAT2_uc010yuh.1_Missense_Mutation_p.S724I|GPAT2_uc002svh.2_3'UTR	p.S795I	NM_207328	NP_997211	Q6NUI2	GPAT2_HUMAN			22	2607	-			795					Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	ENST00000434632.1	37	c.2384G>T	CCDS42714.1	.	.	.	.	.	.	.	.	.	.	c	17.25	3.341762	0.61073	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542	T;T;T	0.78595	-1.19;-1.19;-0.19	4.97	0.827	0.18835	.	.	.	.	.	T	0.76990	0.4065	L	0.36672	1.1	0.22378	N	0.999152	P;P;P;D	0.64830	0.514;0.911;0.911;0.994	B;P;P;P	0.62184	0.264;0.702;0.702;0.899	T	0.63857	-0.6542	9	0.87932	D	0	.	4.3897	0.11334	0.0:0.5518:0.1654:0.2828	.	724;801;795;724	E9PE95;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;GPAT2_HUMAN;.	I	795;795;724	ENSP00000352547:S795I;ENSP00000389395:S795I;ENSP00000393770:S724I	ENSP00000352547:S795I	S	-	2	0	GPAT2	96051638	0.816000	0.29132	0.969000	0.41365	0.929000	0.56500	0.274000	0.18680	0.237000	0.21200	-0.170000	0.13304	AGC		0.552	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338786.1	NM_207328		9	38	1	0	0.00829132	0.008291	0.00981546	9	38				
SLC5A7	60482	broad.mit.edu	37	2	108604753	108604753	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:108604753G>T	ENST00000264047.2	+	2	418	c.142G>T	c.(142-144)Gat>Tat	p.D48Y	SLC5A7_ENST00000409059.1_Missense_Mutation_p.D48Y|SLC5A7_ENST00000540517.1_Intron	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	48					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)	p.D48Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	TGGTGGCCGAGATATTGGTTT	0.527																																							uc002tdv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(142-144)GAT>TAT		solute carrier family 5 (choline transporter),	Choline(DB00122)						148.0	131.0	137.0					2																	108604753		2203	4300	6503	SO:0001583	missense	60482				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity	g.chr2:108604753G>T	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.142G>T	2.37:g.108604753G>T	ENSP00000264047:p.Asp48Tyr					SLC5A7_uc010ywm.1_5'UTR|SLC5A7_uc010fjj.2_Missense_Mutation_p.D48Y|SLC5A7_uc010ywn.1_Intron	p.D48Y	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN			2	418	+			48			Extracellular (Potential).		Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	c.142G>T	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605027	0.87157	.	.	ENSG00000115665	ENST00000409059;ENST00000264047	D;D	0.88431	-2.38;-2.38	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.94443	0.8212	M	0.74881	2.28	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	D	0.94151	0.7405	10	0.72032	D	0.01	-27.7342	20.3242	0.98691	0.0:0.0:1.0:0.0	.	48	Q9GZV3	SC5A7_HUMAN	Y	48	ENSP00000387346:D48Y;ENSP00000264047:D48Y	ENSP00000264047:D48Y	D	+	1	0	SLC5A7	107971185	1.000000	0.71417	0.992000	0.48379	0.691000	0.40173	9.420000	0.97426	2.882000	0.98803	0.655000	0.94253	GAT		0.527	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1			11	60	1	0	1.58986e-06	0.008291	2.21938e-06	11	60				
RANBP2	5903	broad.mit.edu	37	2	109383771	109383771	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:109383771G>T	ENST00000283195.6	+	20	6902	c.6776G>T	c.(6775-6777)cGt>cTt	p.R2259L		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2259					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R2259L(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AATCTTTTCCGTTTTGGTGAG	0.408																																							uc002tem.3		NA																RANBP2/ALK(16)	2	Substitution - Missense(2)		lung(2)	soft_tissue(16)|lung(1)|pancreas(1)	18						c.(6775-6777)CGT>CTT		RAN binding protein 2							262.0	275.0	271.0					2																	109383771		2203	4300	6503	SO:0001583	missense	5903				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding	g.chr2:109383771G>T	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.6776G>T	2.37:g.109383771G>T	ENSP00000283195:p.Arg2259Leu						p.R2259L	NM_006267	NP_006258	P49792	RBP2_HUMAN			20	6902	+			2259					Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	c.6776G>T	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249423	0.59103	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.28454	1.61	5.8	4.92	0.64577	.	.	.	.	.	T	0.41143	0.1146	L	0.32530	0.975	0.38477	D	0.947627	D	0.89917	1.0	D	0.70716	0.97	T	0.08617	-1.0713	9	0.17369	T	0.5	-3.2817	15.2807	0.73781	0.0684:0.0:0.9316:0.0	.	2259	P49792	RBP2_HUMAN	L	1283;2259	ENSP00000283195:R2259L	ENSP00000283195:R2259L	R	+	2	0	RANBP2	108750203	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.813000	0.99286	2.753000	0.94483	0.455000	0.32223	CGT		0.408	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267		80	507	1	0	4.21487e-37	0.00361	9.69421e-37	80	507				
CNTNAP5	129684	broad.mit.edu	37	2	125232346	125232346	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:125232346A>T	ENST00000431078.1	+	7	1313	c.949A>T	c.(949-951)Aaa>Taa	p.K317*		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	317	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.K317*(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGTACCAGGAAAACCTGGGAC	0.368																																							uc002tno.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(10)	10						c.(949-951)AAA>TAA		contactin associated protein-like 5 precursor							39.0	36.0	37.0					2																	125232346		1798	4065	5863	SO:0001587	stop_gained	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125232346A>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.949A>T	2.37:g.125232346A>T	ENSP00000399013:p.Lys317*					CNTNAP5_uc010flu.2_Nonsense_Mutation_p.K317*	p.K317*	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	7	1313	+			317			Laminin G-like 1.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Nonsense_Mutation	SNP	ENST00000431078.1	37	c.949A>T	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	A	41	9.077199	0.99057	.	.	ENSG00000155052	ENST00000431078	.	.	.	5.67	5.67	0.87782	.	0.000000	0.53938	D	0.000058	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.379	0.74637	1.0:0.0:0.0:0.0	.	.	.	.	X	317	.	ENSP00000399013:K317X	K	+	1	0	CNTNAP5	124948816	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.891000	0.75639	2.277000	0.76020	0.482000	0.46254	AAA		0.368	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			7	22	0	0	0	0.001984	0	7	22				
MAP3K19	80122	broad.mit.edu	37	2	135779380	135779380	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:135779380G>T	ENST00000375845.3	-	2	73	c.43C>A	c.(43-45)Ctt>Att	p.L15I	MAP3K19_ENST00000375844.3_Missense_Mutation_p.L15I|MAP3K19_ENST00000392915.1_Missense_Mutation_p.L32I|MAP3K19_ENST00000358371.4_Missense_Mutation_p.L15I|MAP3K19_ENST00000392918.3_Missense_Mutation_p.L15I|MAP3K19_ENST00000392917.3_Missense_Mutation_p.L15I|MAP3K19_ENST00000315513.3_5'UTR	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	15							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L15I(1)									CAAATGTCAAGCAATGACTCA	0.338																																							uc002tue.1		NA																	1	Substitution - Missense(1)		lung(1)	stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5						c.(43-45)CTT>ATT		Yeast Sps1/Ste20-related kinase 4 isoform 1							137.0	122.0	127.0					2																	135779380		2203	4300	6503	SO:0001583	missense	80122						ATP binding|protein serine/threonine kinase activity	g.chr2:135779380G>T	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.43C>A	2.37:g.135779380G>T	ENSP00000365005:p.Leu15Ile					YSK4_uc010fne.1_5'UTR|YSK4_uc002tuf.1_Missense_Mutation_p.L15I|YSK4_uc010fnc.1_Missense_Mutation_p.L15I|YSK4_uc010fnd.1_Missense_Mutation_p.L15I|YSK4_uc010zbg.1_Missense_Mutation_p.L15I|YSK4_uc002tui.3_Missense_Mutation_p.L32I	p.L15I	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	2	74	-			15					B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	c.43C>A	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760203	0.69763	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915	T;D;T;T;T;T	0.82711	-1.13;-1.64;-1.22;-1.27;-1.08;1.22	4.34	4.34	0.51931	.	0.000000	0.33980	N	0.004372	D	0.89403	0.6705	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D;D	0.76494	0.993;0.999;0.996;0.999;0.996;0.999	D;D;D;D;D;D	0.83275	0.967;0.996;0.986;0.996;0.986;0.991	D	0.90283	0.4316	10	0.87932	D	0	.	12.2267	0.54463	0.0:0.0:1.0:0.0	.	15;15;15;32;15;15	B7ZMH9;Q56UN5-3;Q56UN5-4;A8MWG7;Q56UN5-5;Q56UN5	.;.;.;.;.;YSK4_HUMAN	I	15;15;15;15;15;32	ENSP00000365005:L15I;ENSP00000351140:L15I;ENSP00000365004:L15I;ENSP00000376650:L15I;ENSP00000376649:L15I;ENSP00000376647:L32I	ENSP00000351140:L15I	L	-	1	0	YSK4	135495850	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.061000	0.41403	2.254000	0.74563	0.585000	0.79938	CTT		0.338	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052		10	63	1	0	1.08611e-07	0.000978	1.62412e-07	10	63				
LRP1B	53353	broad.mit.edu	37	2	141093256	141093256	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:141093256C>T	ENST00000389484.3	-	78	13015	c.12044G>A	c.(12043-12045)gGc>gAc	p.G4015D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4015					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.G4015D(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCAGTTGGGGCCATTCAGCTG	0.418										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(12043-12045)GGC>GAC		low density lipoprotein-related protein 1B							141.0	137.0	138.0					2																	141093256		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141093256C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12044G>A	2.37:g.141093256C>T	ENSP00000374135:p.Gly4015Asp	TSP Lung(27;0.18)					p.G4015D	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	78	13016	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4015			Extracellular (Potential).|LDL-receptor class B 34.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.12044G>A	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.2|29.2	4.986792|4.986792	0.93106|0.93106	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000437977|ENST00000389484;ENST00000544579	.|D	.|0.92965	.|-3.14	5.49|5.49	5.49|5.49	0.81192|0.81192	.|Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96849|0.96849	0.8971|0.8971	M|M	0.89214|0.89214	3.015|3.015	0.58432|0.58432	D|D	0.999996|0.999996	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.96886|0.96886	0.9649|0.9649	5|10	.|0.62326	.|D	.|0.03	.|.	19.7341|19.7341	0.96195|0.96195	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|4015	.|Q9NZR2	.|LRP1B_HUMAN	T|D	247|4015;3953	.|ENSP00000374135:G4015D	.|ENSP00000374135:G4015D	A|G	-|-	1|2	0|0	LRP1B|LRP1B	140809726|140809726	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.356000|7.356000	0.79445|0.79445	2.732000|2.732000	0.93576|0.93576	0.585000|0.585000	0.79938|0.79938	GCC|GGC		0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		51	149	0	0	0	0.00361	0	51	149				
KIF5C	3800	broad.mit.edu	37	2	149840154	149840154	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:149840154G>T	ENST00000435030.1	+	15	1958	c.1590G>T	c.(1588-1590)caG>caT	p.Q530H	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Missense_Mutation_p.Q435H|KIF5C_ENST00000397413.1_Missense_Mutation_p.Q298H			O60282	KIF5C_HUMAN	kinesin family member 5C	530					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.Q530H(1)|p.Q433H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		CAACCACACAGAGAGAGCTGA	0.413																																							uc010zbu.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1588-1590)CAG>CAT		kinesin family member 5C							89.0	87.0	88.0					2																	149840154		1902	4131	6033	SO:0001583	missense	3800				microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity	g.chr2:149840154G>T	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.1590G>T	2.37:g.149840154G>T	ENSP00000393379:p.Gln530His					KIF5C_uc002tws.1_RNA|KIF5C_uc002twt.2_Missense_Mutation_p.Q82H	p.Q530H	NM_004522	NP_004513	O60282	KIF5C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.108)	15	1958	+			530					O95079|Q2YDC5	Missense_Mutation	SNP	ENST00000435030.1	37	c.1590G>T		.	.	.	.	.	.	.	.	.	.	G	16.81	3.225550	0.58668	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	T;T;T	0.77877	-1.13;-1.13;-1.13	5.46	2.67	0.31697	.	0.069029	0.64402	D	0.000009	T	0.81795	0.4898	.	.	.	0.40232	D	0.977857	P;P	0.51147	0.587;0.942	B;P	0.55824	0.401;0.785	T	0.81385	-0.0957	9	0.51188	T	0.08	.	9.0678	0.36473	0.3436:0.0:0.6564:0.0	.	530;96	O60282;Q3LIE3	KIF5C_HUMAN;.	H	530;435;433;298	ENSP00000393379:Q530H;ENSP00000410115:Q435H;ENSP00000380560:Q298H	ENSP00000334176:Q433H	Q	+	3	2	KIF5C	149548400	1.000000	0.71417	0.995000	0.50966	0.803000	0.45373	2.161000	0.42358	0.879000	0.35944	-0.140000	0.14226	CAG		0.413	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522		9	50	1	0	7.48243e-07	0.006214	1.06608e-06	9	50				
CCDC173	129881	broad.mit.edu	37	2	170502572	170502572	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:170502572C>T	ENST00000447353.1	-	9	1543	c.1438G>A	c.(1438-1440)Gaa>Aaa	p.E480K		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	480								p.E474K(1)									GATTCAAGTTCAATTACCTCT	0.413																																							uc002ufe.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1438-1440)GAA>AAA		hypothetical protein LOC129881							208.0	209.0	208.0					2																	170502572		1859	4086	5945	SO:0001583	missense	129881							g.chr2:170502572C>T	BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.1438G>A	2.37:g.170502572C>T	ENSP00000391504:p.Glu480Lys						p.E480K	NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN			9	1532	-			480			Potential.		Q6PJF6	Missense_Mutation	SNP	ENST00000447353.1	37	c.1438G>A	CCDS46445.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.041307	0.35989	.	.	ENSG00000154479	ENST00000447353	.	.	.	5.72	-2.16	0.07080	.	1.358740	0.06010	U	0.649396	T	0.40498	0.1119	L	0.43152	1.355	0.28461	N	0.91588	B	0.10296	0.003	B	0.12156	0.007	T	0.36696	-0.9737	9	0.30078	T	0.28	.	12.3958	0.55384	0.0:0.4594:0.0:0.5406	.	480	Q0VFZ6	CB077_HUMAN	K	480	.	ENSP00000391504:E480K	E	-	1	0	C2orf77	170210818	0.967000	0.33354	0.031000	0.17742	0.689000	0.40095	0.130000	0.15850	-0.693000	0.05121	0.655000	0.94253	GAA		0.413	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333954.2	NM_001085447		9	397	0	0	0	0.004482	0	9	397				
ATP5G3	518	broad.mit.edu	37	2	176043042	176043042	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:176043042C>G	ENST00000284727.4	-	5	3427	c.403G>C	c.(403-405)Gct>Cct	p.A135P	Y_RNA_ENST00000363251.1_RNA|ATP5G3_ENST00000392541.3_Missense_Mutation_p.A135P|ATP5G3_ENST00000409194.1_Missense_Mutation_p.A135P	NM_001002258.4|NM_001689.4	NP_001002258.1|NP_001680.1	P48201	AT5G3_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)	135					ATP hydrolysis coupled proton transport (GO:0015991)|ATP synthesis coupled proton transport (GO:0015986)	integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.A135P(1)		large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.147)			ATCAAGAAAGCAACCATCAAA	0.398																																					GBM(30;387 605 18606 28805 47989)	GBM(30;387 605 18606 28805 47989)	uc002ujz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(403-405)GCT>CCT		ATP synthase, H+ transporting, mitochondrial F0							125.0	123.0	124.0					2																	176043042		2203	4300	6503	SO:0001583	missense	518				ATP hydrolysis coupled proton transport|ATP synthesis coupled proton transport	integral to membrane|mitochondrial proton-transporting ATP synthase complex|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity|lipid binding|protein binding	g.chr2:176043042C>G	BC106881	CCDS2263.1	2q31.1	2012-10-12	2010-06-11		ENSG00000154518	ENSG00000154518		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	843	protein-coding gene	gene with protein product		602736	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9) isoform 3"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9)"""			7698763	Standard	NM_001002258		Approved		uc002ujz.4	P48201	OTTHUMG00000132425	ENST00000284727.4:c.403G>C	2.37:g.176043042C>G	ENSP00000284727:p.Ala135Pro					ATP5G3_uc002uka.3_Missense_Mutation_p.A135P|ATP5G3_uc002ukb.1_3'UTR	p.A135P	NM_001002258	NP_001002258	P48201	AT5G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.147)		4	673	-			135			Helical; (Potential).		B2R4Z0|D3DPF0|Q4ZFX7	Missense_Mutation	SNP	ENST00000284727.4	37	c.403G>C	CCDS2263.1	.	.	.	.	.	.	.	.	.	.	C	33	5.252507	0.95336	.	.	ENSG00000154518	ENST00000284727;ENST00000409194;ENST00000392541	T;T;T	0.57436	0.4;0.4;0.4	5.93	5.93	0.95920	ATPase, F0/V0 complex, subunit C (3);	0.141404	0.64402	D	0.000005	T	0.79118	0.4392	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81658	-0.0833	10	0.87932	D	0	0.0015	20.3539	0.98825	0.0:1.0:0.0:0.0	.	135	P48201	AT5G3_HUMAN	P	135	ENSP00000284727:A135P;ENSP00000387317:A135P;ENSP00000376324:A135P	ENSP00000284727:A135P	A	-	1	0	ATP5G3	175751288	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.771000	0.85420	2.826000	0.97356	0.655000	0.94253	GCT		0.398	ATP5G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255563.1	NM_001689		15	110	0	0	0	0.003163	0	15	110				
ZNF804A	91752	broad.mit.edu	37	2	185801850	185801850	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:185801850A>C	ENST00000302277.6	+	4	2321	c.1727A>C	c.(1726-1728)aAa>aCa	p.K576T		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	576							metal ion binding (GO:0046872)	p.K576T(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CTAGATGAAAAATACAACAAA	0.303																																							uc002uph.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(1726-1728)AAA>ACA		zinc finger protein 804A							31.0	38.0	36.0					2																	185801850		2146	4272	6418	SO:0001583	missense	91752					intracellular	zinc ion binding	g.chr2:185801850A>C	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1727A>C	2.37:g.185801850A>C	ENSP00000303252:p.Lys576Thr						p.K576T	NM_194250	NP_919226	Q7Z570	Z804A_HUMAN			4	2321	+			576					A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	c.1727A>C	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.123464	0.56613	.	.	ENSG00000170396	ENST00000302277	T	0.12039	2.72	5.5	5.5	0.81552	.	0.095542	0.46145	D	0.000320	T	0.30572	0.0769	L	0.59436	1.845	0.42028	D	0.991011	D	0.69078	0.997	P	0.60173	0.87	T	0.02654	-1.1128	10	0.87932	D	0	-15.0454	14.793	0.69857	1.0:0.0:0.0:0.0	.	576	Q7Z570	Z804A_HUMAN	T	576	ENSP00000303252:K576T	ENSP00000303252:K576T	K	+	2	0	ZNF804A	185510095	1.000000	0.71417	0.996000	0.52242	0.892000	0.51952	4.843000	0.62838	2.083000	0.62718	0.528000	0.53228	AAA		0.303	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		3	80	0	0	0	0.004672	0	3	80				
COL3A1	1281	broad.mit.edu	37	2	189859522	189859522	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:189859522G>T	ENST00000304636.3	+	20	1590	c.1420G>T	c.(1420-1422)Ggt>Tgt	p.G474C	COL3A1_ENST00000317840.5_Missense_Mutation_p.G474C	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	474	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.G474C(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGGAGAACCTGGTGCAAATGG	0.448																																							uc002uqj.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(1420-1422)GGT>TGT		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						84.0	91.0	89.0					2																	189859522		2203	4300	6503	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189859522G>T	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.1420G>T	2.37:g.189859522G>T	ENSP00000304408:p.Gly474Cys						p.G474C	NM_000090	NP_000081	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		20	1537	+			474			Triple-helical region.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.1420G>T	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351927	0.82132	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.99637	-6.29;-6.29	6.17	6.17	0.99709	.	0.000000	0.52532	D	0.000072	D	0.99674	0.9878	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98389	1.0562	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	474	P02461	CO3A1_HUMAN	C	474	ENSP00000304408:G474C;ENSP00000315243:G474C	ENSP00000304408:G474C	G	+	1	0	COL3A1	189567767	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	9.810000	0.99221	2.941000	0.99782	0.655000	0.94253	GGT		0.448	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		12	93	1	0	7.93312e-07	0.00245	1.12697e-06	12	93				
COL3A1	1281	broad.mit.edu	37	2	189873907	189873907	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:189873907C>G	ENST00000304636.3	+	48	3953	c.3783C>G	c.(3781-3783)aaC>aaG	p.N1261K	COL3A1_ENST00000317840.5_Missense_Mutation_p.N958K	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1261	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.N1261K(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	CCGCTAGAAACTGCAGAGACC	0.403																																							uc002uqj.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(3781-3783)AAC>AAG		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						63.0	68.0	66.0					2																	189873907		2203	4300	6503	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189873907C>G	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3783C>G	2.37:g.189873907C>G	ENSP00000304408:p.Asn1261Lys						p.N1261K	NM_000090	NP_000081	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		48	3900	+			1261			Fibrillar collagen NC1.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.3783C>G	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.387232	0.42308	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	T;T	0.72725	-0.68;-0.68	5.6	3.44	0.39384	Fibrillar collagen, C-terminal (3);	0.000000	0.56097	D	0.000030	T	0.73148	0.3550	M	0.62723	1.935	0.26392	N	0.976568	P	0.49185	0.92	P	0.50860	0.652	T	0.66799	-0.5832	10	0.56958	D	0.05	.	11.054	0.47907	0.0:0.776:0.0:0.224	.	1261	P02461	CO3A1_HUMAN	K	1261;958	ENSP00000304408:N1261K;ENSP00000315243:N958K	ENSP00000304408:N1261K	N	+	3	2	COL3A1	189582152	0.995000	0.38212	1.000000	0.80357	0.972000	0.66771	0.501000	0.22578	1.333000	0.45449	0.591000	0.81541	AAC		0.403	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		4	136	0	0	0	0.000248	0	4	136				
SF3B1	23451	broad.mit.edu	37	2	198265462	198265462	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:198265462C>A	ENST00000335508.6	-	18	2786	c.2695G>T	c.(2695-2697)Gct>Tct	p.A899S	SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	899					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.A899S(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TCTTGGAAAGCATAAAGAATA	0.313			Mis		myelodysplastic syndrome																																		uc002uue.2		NA		Dom	yes		2	2q33.1	23451		"""splicing factor 3b, subunit 1, 155kDa"""			L					1	Substitution - Missense(1)		lung(1)	pancreas(3)|ovary(1)|breast(1)|skin(1)	6						c.(2695-2697)GCT>TCT		splicing factor 3b, subunit 1 isoform 1							130.0	128.0	128.0					2																	198265462		2202	4300	6502	SO:0001583	missense	23451				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	g.chr2:198265462C>A	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2695G>T	2.37:g.198265462C>A	ENSP00000335321:p.Ala899Ser						p.A899S	NM_012433	NP_036565	O75533	SF3B1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)		18	2743	-			899					E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	c.2695G>T	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.866804	0.91511	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.61	5.61	0.85477	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74854	0.3771	M	0.86573	2.825	0.80722	D	1	P	0.42961	0.795	P	0.45577	0.486	T	0.78140	-0.2320	9	0.52906	T	0.07	.	20.0015	0.97412	0.0:1.0:0.0:0.0	.	899	O75533	SF3B1_HUMAN	S	899	.	ENSP00000335321:A899S	A	-	1	0	SF3B1	197973707	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.717000	0.84732	2.803000	0.96430	0.655000	0.94253	GCT		0.313	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2			11	78	1	0	4.36969e-10	0.001855	7.25279e-10	11	78				
ADAM23	8745	broad.mit.edu	37	2	207460798	207460798	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:207460798C>A	ENST00000264377.3	+	24	2599	c.2271C>A	c.(2269-2271)tgC>tgA	p.C757*	ADAM23_ENST00000374416.1_Nonsense_Mutation_p.C757*|ADAM23_ENST00000374415.3_Nonsense_Mutation_p.C757*	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	757	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C757*(2)		NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		AAGCCACCTGCATTTGTGATT	0.433																																					Melanoma(194;1127 2130 19620 24042 27855)	Melanoma(194;1127 2130 19620 24042 27855)	uc002vbq.2		NA																	2	Substitution - Nonsense(2)		lung(2)	skin(2)|ovary(1)	3						c.(2269-2271)TGC>TGA		ADAM metallopeptidase domain 23 preproprotein							89.0	79.0	82.0					2																	207460798		2203	4300	6503	SO:0001587	stop_gained	8745				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr2:207460798C>A	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.2271C>A	2.37:g.207460798C>A	ENSP00000264377:p.Cys757*					ADAM23_uc010ziv.1_Intron	p.C757*	NM_003812	NP_003803	O75077	ADA23_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)	24	2494	+			757			EGF-like.|Extracellular (Potential).		A2RU59	Nonsense_Mutation	SNP	ENST00000264377.3	37	c.2271C>A	CCDS2369.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.573782|7.573782	0.98368|0.98368	.|.	.|.	ENSG00000114948|ENSG00000114948	ENST00000444281|ENST00000264377;ENST00000374416;ENST00000374415	.|.	.|.	.|.	5.7|5.7	3.91|3.91	0.45181|0.45181	.|.	.|0.000000	.|0.64402	.|D	.|0.000002	T|.	0.24044|.	0.0582|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.32375|.	-0.9909|.	3|.	.|0.02654	.|T	.|1	.|.	9.3065|9.3065	0.37878|0.37878	0.0:0.7828:0.0:0.2172|0.0:0.7828:0.0:0.2172	.|.	.|.	.|.	.|.	E|X	32|757	.|.	.|ENSP00000264377:C757X	A|C	+|+	2|3	0|2	ADAM23|ADAM23	207169043|207169043	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.578000|1.578000	0.36525|0.36525	0.764000|0.764000	0.33197|0.33197	0.655000|0.655000	0.94253|0.94253	GCA|TGC		0.433	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812		8	49	1	0	3.09899e-07	0.004482	4.54957e-07	8	49				
PIKFYVE	200576	broad.mit.edu	37	2	209142361	209142361	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:209142361G>T	ENST00000264380.4	+	5	700	c.542G>T	c.(541-543)cGa>cTa	p.R181L	PIKFYVE_ENST00000407449.1_Missense_Mutation_p.R181L|PIKFYVE_ENST00000392202.3_Intron|PIKFYVE_ENST00000308862.6_Intron	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	181					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.R181L(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						CACCATTGCCGACTATGTGGG	0.403																																							uc002vcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						c.(541-543)CGA>CTA		phosphatidylinositol-3-phosphate 5-kinase type							138.0	141.0	140.0					2																	209142361		2203	4300	6503	SO:0001583	missense	200576				cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding	g.chr2:209142361G>T	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.542G>T	2.37:g.209142361G>T	ENSP00000264380:p.Arg181Leu					PIKFYVE_uc010fun.1_Intron|PIKFYVE_uc002vcy.1_Missense_Mutation_p.R181L|PIKFYVE_uc002vcv.2_Intron|PIKFYVE_uc002vcw.2_Missense_Mutation_p.R181L|PIKFYVE_uc002vcx.2_Intron	p.R181L	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN			5	700	+			181			FYVE-type.		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	c.542G>T	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	G	30	5.055700	0.93793	.	.	ENSG00000115020	ENST00000264380;ENST00000407449;ENST00000422495;ENST00000452564	T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47	5.92	5.05	0.67936	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.084638	0.49305	D	0.000147	D	0.94608	0.8262	H	0.99740	4.74	0.80722	D	1	D;D;B	0.76494	0.999;0.991;0.218	D;P;B	0.85130	0.997;0.878;0.191	D	0.96923	0.9675	10	0.87932	D	0	-6.283	15.0625	0.71967	0.0678:0.0:0.9322:0.0	.	181;181;181	Q9Y2I7;E9PDH4;Q08AR7	FYV1_HUMAN;.;.	L	181;181;193;181	ENSP00000264380:R181L;ENSP00000384356:R181L;ENSP00000414477:R193L;ENSP00000405736:R181L	ENSP00000264380:R181L	R	+	2	0	PIKFYVE	208850606	1.000000	0.71417	0.922000	0.36590	0.996000	0.88848	9.799000	0.99117	1.525000	0.49052	0.561000	0.74099	CGA		0.403	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040		34	121	1	0	2.42023e-17	0.003271	4.8911e-17	34	121				
CPS1	1373	broad.mit.edu	37	2	211513216	211513216	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:211513216C>T	ENST00000233072.5	+	27	3552	c.3356C>T	c.(3355-3357)gCa>gTa	p.A1119V	CPS1_ENST00000451903.2_Missense_Mutation_p.A668V|CPS1_ENST00000430249.2_Missense_Mutation_p.A1125V	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1119	ATP-grasp 2.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.A1119V(1)|p.A1125V(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CTGGAATTTGCAAAGTCTGTG	0.323																																							uc002vee.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(3355-3357)GCA>GTA		carbamoyl-phosphate synthetase 1 isoform b							147.0	142.0	144.0					2																	211513216		2203	4300	6503	SO:0001583	missense	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211513216C>T	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3356C>T	2.37:g.211513216C>T	ENSP00000233072:p.Ala1119Val					CPS1_uc010fur.2_Missense_Mutation_p.A1125V|CPS1_uc010fus.2_Missense_Mutation_p.A668V	p.A1119V	NM_001875	NP_001866	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	27	3488	+			1119			ATP-grasp 2.		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	c.3356C>T	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810142	0.90707	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.98150	-4.75;-4.75;-4.75	6.17	6.17	0.99709	ATP-grasp fold (1);ATP-grasp fold, subdomain 1 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.046732	0.85682	D	0.000000	D	0.98588	0.9528	M	0.77712	2.385	0.54753	D	0.999988	D;D	0.58970	0.984;0.984	P;P	0.61275	0.886;0.886	D	0.98808	1.0742	10	0.66056	D	0.02	-11.1711	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1129;1119	Q59HF8;P31327	.;CPSM_HUMAN	V	1125;1127;1119;668	ENSP00000402608:A1125V;ENSP00000233072:A1119V;ENSP00000406136:A668V	ENSP00000233072:A1119V	A	+	2	0	CPS1	211221461	1.000000	0.71417	0.984000	0.44739	0.998000	0.95712	7.081000	0.76844	2.941000	0.99782	0.655000	0.94253	GCA		0.323	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			24	140	0	0	0	0.004656	0	24	140				
OBSL1	23363	broad.mit.edu	37	2	220422763	220422763	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:220422763A>G	ENST00000404537.1	-	11	3628	c.3572T>C	c.(3571-3573)gTg>gCg	p.V1191A	OBSL1_ENST00000265318.4_Missense_Mutation_p.V1099A|OBSL1_ENST00000265317.5_Missense_Mutation_p.V182A|RP11-256I23.2_ENST00000597192.1_RNA|OBSL1_ENST00000373876.1_Missense_Mutation_p.V1191A|OBSL1_ENST00000603926.1_Missense_Mutation_p.V1191A	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1191	Ig-like 10.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)	p.V1191A(1)					Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GCTCAGCACCACTGGCTCCCC	0.647																																							uc010fwk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3571-3573)GTG>GCG		obscurin-like 1							24.0	27.0	26.0					2																	220422763		1992	4143	6135	SO:0001583	missense	23363				cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity	g.chr2:220422763A>G	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.3572T>C	2.37:g.220422763A>G	ENSP00000385636:p.Val1191Ala					OBSL1_uc002vmh.1_Missense_Mutation_p.V182A|OBSL1_uc010zli.1_Missense_Mutation_p.V90A|OBSL1_uc010fwl.1_Missense_Mutation_p.V666A	p.V1191A	NM_015311	NP_056126	O75147	OBSL1_HUMAN		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)	11	3629	-		Renal(207;0.0376)	1191			Ig-like 10.		A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	c.3572T>C	CCDS46520.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.71|15.71	2.914537|2.914537	0.52546|0.52546	.|.	.|.	ENSG00000124006|ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000265317|ENST00000456147	T;T;T;T|.	0.04809|.	3.55;3.55;3.55;3.55|.	3.63|3.63	3.63|3.63	0.41609|0.41609	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.60077|0.60077	0.2241|0.2241	L|L	0.49571|0.49571	1.57|1.57	0.46774|0.46774	D|D	0.999196|0.999196	D;P;D;D|.	0.76494|.	0.999;0.855;0.969;0.999|.	D;P;P;D|.	0.66716|.	0.946;0.59;0.855;0.944|.	T|T	0.58070|0.58070	-0.7701|-0.7701	9|5	0.13853|.	T|.	0.58|.	.|.	11.9037|11.9037	0.52699|0.52699	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	90;1192;1191;182|.	B7Z5P5;A4KVA4;O75147;E7ER99|.	.;.;OBSL1_HUMAN;.|.	A|R	1099;1191;1191;182|185	ENSP00000265318:V1099A;ENSP00000385636:V1191A;ENSP00000362983:V1191A;ENSP00000265317:V182A|.	ENSP00000265317:V182A|.	V|W	-|-	2|1	0|0	OBSL1|OBSL1	220131007|220131007	0.006000|0.006000	0.16342|0.16342	0.912000|0.912000	0.35992|0.35992	0.361000|0.361000	0.29550|0.29550	2.418000|2.418000	0.44662|0.44662	1.676000|1.676000	0.50930|0.50930	0.260000|0.260000	0.18958|0.18958	GTG|TGG		0.647	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1			5	36	0	0	0	0.000602	0	5	36				
SCG2	7857	broad.mit.edu	37	2	224462975	224462975	+	Silent	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:224462975A>T	ENST00000305409.2	-	2	1258	c.1026T>A	c.(1024-1026)ccT>ccA	p.P342P		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0	Interaction with FANCD2.		A -> D (in MEN1; dbSNP:rs2071312). {ECO:0000269|PubMed:12112656}.|A -> P (in MEN1). {ECO:0000269|PubMed:10849016}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.P342P(1)		NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GAGAATCAAGAGGTTTCTCAA	0.418																																							uc002vnm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1024-1026)CCT>CCA		secretogranin II precursor							97.0	102.0	100.0					2																	224462975		2203	4300	6503	SO:0001819	synonymous_variant	7857				angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity	g.chr2:224462975A>T	M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1026T>A	2.37:g.224462975A>T							p.P342P	NM_003469	NP_003460	P13521	SCG2_HUMAN		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)	2	1159	-		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)	342					A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	ENST00000305409.2	37	c.1026T>A	CCDS2457.1																																																																																				0.418	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469		19	152	0	0	0	0.007413	0	19	152				
MFF	56947	broad.mit.edu	37	2	228205013	228205013	+	Silent	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:228205013A>T	ENST00000353339.3	+	6	876	c.435A>T	c.(433-435)cgA>cgT	p.R145R	MFF_ENST00000524634.1_5'UTR|MFF_ENST00000337110.7_Silent_p.R119R|MFF_ENST00000349901.7_Silent_p.R119R|MFF_ENST00000476924.1_3'UTR|MFF_ENST00000409616.1_Silent_p.R119R|MFF_ENST00000409565.1_Silent_p.R119R|MFF_ENST00000392059.1_Silent_p.R145R|MFF_ENST00000304593.9_Silent_p.R119R|MFF_ENST00000354503.6_Silent_p.R119R	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	145					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)	p.R145R(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						AACAGATCCGAGCAGTTGGCA	0.428																																							uc002vos.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(433-435)CGA>CGT		mitochondrial fission factor							76.0	73.0	74.0					2																	228205013		2203	4300	6503	SO:0001819	synonymous_variant	56947					integral to membrane|mitochondrial outer membrane		g.chr2:228205013A>T	AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.435A>T	2.37:g.228205013A>T						MFF_uc002vot.2_Silent_p.R119R|MFF_uc002vou.2_Silent_p.R145R|MFF_uc002vov.2_Silent_p.R119R|MFF_uc002vow.2_Silent_p.R119R|MFF_uc002vox.2_Silent_p.R119R|MFF_uc002voy.2_Silent_p.R145R|MFF_uc002voz.2_Silent_p.R119R	p.R145R	NM_020194	NP_064579	Q9GZY8	MFF_HUMAN			6	853	+			145			Cytoplasmic (Potential).		Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Silent	SNP	ENST00000353339.3	37	c.435A>T	CCDS2465.1																																																																																				0.428	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256887.2	NM_020194		14	55	0	0	0	0.00245	0	14	55				
ATG16L1	55054	broad.mit.edu	37	2	234200895	234200895	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:234200895C>T	ENST00000392017.4	+	15	1809	c.1552C>T	c.(1552-1554)Cga>Tga	p.R518*	ATG16L1_ENST00000392018.1_Nonsense_Mutation_p.R535*|ATG16L1_ENST00000347464.5_Nonsense_Mutation_p.R355*|ATG16L1_ENST00000392020.4_Nonsense_Mutation_p.R499*|ATG16L1_ENST00000373525.5_Nonsense_Mutation_p.R339*	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	518					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)	p.R518*(1)|p.R177*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		TATTGATCTCCGAACAAATGC	0.502																																							uc002vty.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(1552-1554)CGA>TGA		APG16 autophagy 16-like isoform 1							104.0	99.0	101.0					2																	234200895		2203	4300	6503	SO:0001587	stop_gained	55054				autophagic vacuole assembly|protein homooligomerization|protein transport	autophagic vacuole|pre-autophagosomal structure membrane	protein binding	g.chr2:234200895C>T	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.1552C>T	2.37:g.234200895C>T	ENSP00000375872:p.Arg518*					ATG16L1_uc002vtx.1_Nonsense_Mutation_p.R355*|ATG16L1_uc002vua.2_Nonsense_Mutation_p.R499*|ATG16L1_uc002vub.2_Nonsense_Mutation_p.R376*|ATG16L1_uc002vtz.2_Nonsense_Mutation_p.R339*|ATG16L1_uc002vud.3_Nonsense_Mutation_p.R434*	p.R518*	NM_030803	NP_110430	Q676U5	A16L1_HUMAN		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)	15	1809	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)	518			WD 5.		A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Nonsense_Mutation	SNP	ENST00000392017.4	37	c.1552C>T	CCDS2503.2	.	.	.	.	.	.	.	.	.	.	C	37	6.267165	0.97426	.	.	ENSG00000085978	ENST00000392017;ENST00000347464;ENST00000373525;ENST00000392020;ENST00000392018;ENST00000334050	.	.	.	5.7	2.96	0.34315	.	0.119241	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	6.0082	0.19559	0.2669:0.5934:0.0:0.1397	.	.	.	.	X	518;355;339;499;535;177	.	ENSP00000334016:R177X	R	+	1	2	ATG16L1	233865634	1.000000	0.71417	0.001000	0.08648	0.869000	0.49853	5.451000	0.66632	0.351000	0.24027	-0.899000	0.02877	CGA		0.502	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974		16	56	0	0	0	0.003163	0	16	56				
AGAP1	116987	broad.mit.edu	37	2	236706518	236706518	+	Silent	SNP	G	G	T	rs375060286	byFrequency	TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:236706518G>T	ENST00000304032.8	+	7	1369	c.789G>T	c.(787-789)gtG>gtT	p.V263V	AGAP1_ENST00000336665.5_Silent_p.V263V|AGAP1_ENST00000409457.1_Silent_p.V263V|AGAP1_ENST00000428334.2_Silent_p.V102V|AGAP1_ENST00000409538.1_Silent_p.V528V	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	263	Small GTPase-like.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)	p.V263V(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						TGTCTGCCGTGCACATCAGCC	0.493																																							uc002vvs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(787-789)GTG>GTT		centaurin, gamma 2 isoform 1							173.0	167.0	169.0					2																	236706518		2203	4300	6503	SO:0001819	synonymous_variant	116987				protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding	g.chr2:236706518G>T	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.789G>T	2.37:g.236706518G>T						AGAP1_uc002vvt.2_Silent_p.V263V	p.V263V	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN			7	1384	+			263			Small GTPase-like.		B2RTX7|Q541S5|Q6P9D7|Q9NV93	Silent	SNP	ENST00000304032.8	37	c.789G>T	CCDS33408.1																																																																																				0.493	AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914		42	205	1	0	1.62957e-23	0.00874	3.61047e-23	42	205				
SIRPA	140885	broad.mit.edu	37	20	1895886	1895886	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:1895886C>A	ENST00000358771.4	+	2	373	c.221C>A	c.(220-222)cCa>cAa	p.P74Q	SIRPA_ENST00000356025.3_Missense_Mutation_p.P74Q|SIRPA_ENST00000400068.3_Missense_Mutation_p.P74Q	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	74	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.P74Q(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GGAGCTGGACCAGGCCGGGAA	0.537																																					GBM(155;1668 1920 5945 42733 48121)	GBM(155;1668 1920 5945 42733 48121)	uc002wfq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(220-222)CCA>CAA		signal-regulatory protein alpha precursor							65.0	60.0	62.0					20																	1895886		2203	4297	6500	SO:0001583	missense	140885				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding	g.chr20:1895886C>A	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.221C>A	20.37:g.1895886C>A	ENSP00000351621:p.Pro74Gln					SIRPA_uc010zps.1_Missense_Mutation_p.P54Q|SIRPA_uc002wfr.2_Missense_Mutation_p.P74Q|SIRPA_uc002wfs.2_Missense_Mutation_p.P74Q|SIRPA_uc002wft.2_Missense_Mutation_p.P74Q	p.P74Q	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN		Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)	3	581	+			74			Ig-like V-type.|Extracellular (Potential).		A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	37	c.221C>A	CCDS13022.1	.	.	.	.	.	.	.	.	.	.	C	7.902	0.734566	0.15574	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.01871	4.59;4.59;4.59	5.11	0.654	0.17833	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.622200	0.15220	N	0.274017	T	0.02304	0.0071	L	0.46614	1.455	0.09310	N	1	B;B;B	0.27416	0.004;0.178;0.024	B;B;B	0.25759	0.043;0.031;0.063	T	0.46582	-0.9181	10	0.21014	T	0.42	.	7.7314	0.28789	0.3048:0.3985:0.2966:0.0	.	54;74;74	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	Q	74	ENSP00000382941:P74Q;ENSP00000348307:P74Q;ENSP00000351621:P74Q	ENSP00000348307:P74Q	P	+	2	0	SIRPA	1843886	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.288000	0.18939	0.008000	0.14787	-0.315000	0.08773	CCA		0.537	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792		20	100	1	0	1.55795e-14	0.001882	2.92797e-14	20	100				
MCM8	84515	broad.mit.edu	37	20	5958578	5958578	+	Silent	SNP	C	C	T	rs113442872	byFrequency	TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:5958578C>T	ENST00000378896.3	+	13	1829	c.1452C>T	c.(1450-1452)acC>acT	p.T484T	MCM8_ENST00000378886.2_Silent_p.T524T|MCM8_ENST00000265187.4_Silent_p.T468T|MCM8_ENST00000378883.1_Silent_p.T437T	NM_001281520.1|NM_032485.4|NM_182802.1	NP_001268449.1|NP_115874.3|NP_877954.1	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	484	MCM.|Thr-rich.				cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)|G1/S transition of mitotic cell cycle (GO:0000082)|male gamete generation (GO:0048232)|mitotic cell cycle (GO:0000278)	MCM8-MCM9 complex (GO:0097362)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.T484T(1)|p.T468T(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	23						CCACGACCACCTCTGGTCTGA	0.473																																							uc002wmi.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(1)	1						c.(1450-1452)ACC>ACT		minichromosome maintenance complex component 8		C	,	4,4402	8.1+/-20.4	0,4,2199	112.0	94.0	100.0		1452,1404	-1.2	1.0	20	dbSNP_132	100	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	MCM8	NM_032485.4,NM_182802.1	,	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	,	484/841,468/825	5958578	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	84515				cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity	g.chr20:5958578C>T	AJ439063	CCDS13094.1, CCDS13095.1, CCDS63226.1, CCDS63227.1	20p12.3	2007-04-04	2007-04-04	2003-07-09	ENSG00000125885	ENSG00000125885			16147	protein-coding gene	gene with protein product	"""REC homolog (Drosophila)"""	608187	"""chromosome 20 open reading frame 154"""	C20orf154		12527764	Standard	NM_032485		Approved	MGC4816, MGC12866, MGC119522, MGC119523, dJ967N21.5, REC	uc002wmi.3	Q9UJA3	OTTHUMG00000031822	ENST00000378896.3:c.1452C>T	20.37:g.5958578C>T						MCM8_uc002wmj.2_Silent_p.T468T|MCM8_uc002wmk.2_Silent_p.T524T|MCM8_uc002wml.2_Silent_p.T484T|MCM8_uc010gbp.2_Silent_p.T437T|MCM8_uc002wmm.2_Silent_p.T22T	p.T484T	NM_032485	NP_115874	Q9UJA3	MCM8_HUMAN			13	1829	+			484			Thr-rich.|MCM.		B2RBG7|D3DW08|E7EQU7|Q495R4|Q495R6|Q495R7|Q86US4|Q969I5	Silent	SNP	ENST00000378896.3	37	c.1452C>T	CCDS13094.1																																																																																				0.473	MCM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077900.1	NM_032485		15	59	0	0	0	0.003163	0	15	59				
PLCB4	5332	broad.mit.edu	37	20	9374320	9374320	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:9374320A>T	ENST00000378493.1	+	15	1424	c.1409A>T	c.(1408-1410)gAa>gTa	p.E470V	PLCB4_ENST00000378501.2_Missense_Mutation_p.E470V|PLCB4_ENST00000278655.4_Missense_Mutation_p.E470V|PLCB4_ENST00000334005.3_Missense_Mutation_p.E470V|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000414679.2_Missense_Mutation_p.E470V|PLCB4_ENST00000378473.3_Missense_Mutation_p.E470V			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	470					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.E470V(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CCTGAAGTTGAAAAAAGTAAG	0.363											OREG0025771	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002wnf.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(11)|ovary(3)|pancreas(1)	15						c.(1408-1410)GAA>GTA		phospholipase C beta 4 isoform b							48.0	49.0	49.0					20																	9374320		2203	4300	6503	SO:0001583	missense	5332				intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity	g.chr20:9374320A>T		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.1409A>T	20.37:g.9374320A>T	ENSP00000367754:p.Glu470Val		OREG0025771	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	656	PLCB4_uc010gbw.1_Missense_Mutation_p.E470V|PLCB4_uc010gbx.2_Missense_Mutation_p.E470V|PLCB4_uc002wne.2_Missense_Mutation_p.E470V|PLCB4_uc002wnh.2_Missense_Mutation_p.E317V	p.E470V	NM_182797	NP_877949	Q15147	PLCB4_HUMAN			17	1545	+			470					B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	c.1409A>T	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.771534	0.90108	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47;0.47	5.89	5.89	0.94794	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.102198	0.64402	D	0.000002	T	0.69151	0.3079	L	0.54323	1.7	0.80722	D	1	D;P;D;D	0.89917	1.0;0.68;0.981;1.0	D;B;D;D	0.87578	0.998;0.433;0.966;0.997	T	0.71115	-0.4686	10	0.66056	D	0.02	.	16.3558	0.83235	1.0:0.0:0.0:0.0	.	470;317;470;470	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	V	470;470;470;470;470;306	ENSP00000334105:E470V;ENSP00000367734:E470V;ENSP00000278655:E470V;ENSP00000367754:E470V;ENSP00000367762:E470V;ENSP00000390616:E306V	ENSP00000278655:E470V	E	+	2	0	PLCB4	9322320	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.651000	0.91078	2.254000	0.74563	0.529000	0.55759	GAA		0.363	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2			20	63	0	0	0	0.00278	0	20	63				
PLCB4	5332	broad.mit.edu	37	20	9438112	9438112	+	Silent	SNP	G	G	C	rs369688642		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:9438112G>C	ENST00000378493.1	+	30	3027	c.3012G>C	c.(3010-3012)acG>acC	p.T1004T	PLCB4_ENST00000378501.2_Silent_p.T1004T|PLCB4_ENST00000278655.4_Silent_p.T1004T|PLCB4_ENST00000334005.3_Silent_p.T1004T|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000414679.2_Silent_p.T1016T|PLCB4_ENST00000378473.3_Silent_p.T1016T			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	1004					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.T1004T(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						AAATTCAGACGCTGACATCAG	0.348																																							uc002wnf.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(11)|ovary(3)|pancreas(1)	15						c.(3010-3012)ACG>ACC		phospholipase C beta 4 isoform b							67.0	68.0	68.0					20																	9438112		2203	4300	6503	SO:0001819	synonymous_variant	5332				intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity	g.chr20:9438112G>C		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.3012G>C	20.37:g.9438112G>C						PLCB4_uc010gbw.1_Silent_p.T1004T|PLCB4_uc010gbx.2_Silent_p.T1016T|PLCB4_uc002wne.2_Silent_p.T1004T|PLCB4_uc002wnh.2_Silent_p.T851T	p.T1004T	NM_182797	NP_877949	Q15147	PLCB4_HUMAN			32	3148	+			1004					B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	37	c.3012G>C	CCDS13105.1																																																																																				0.348	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2			15	73	0	0	0	0.006122	0	15	73				
KIF16B	55614	broad.mit.edu	37	20	16352333	16352333	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:16352333T>A	ENST00000354981.2	-	21	3581	c.3424A>T	c.(3424-3426)Agt>Tgt	p.S1142C	KIF16B_ENST00000378003.2_Missense_Mutation_p.S368C|KIF16B_ENST00000408042.1_Missense_Mutation_p.S1142C|KIF16B_ENST00000355755.3_Missense_Mutation_p.S1142C	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	1142					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)	p.S1142C(2)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GCAGATGTACTGCAGCCTTCA	0.388																																							uc002wpg.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						c.(3424-3426)AGT>TGT		kinesin-like motor protein C20orf23							136.0	112.0	120.0					20																	16352333		2203	4300	6503	SO:0001583	missense	55614				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity	g.chr20:16352333T>A	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3424A>T	20.37:g.16352333T>A	ENSP00000347076:p.Ser1142Cys					KIF16B_uc002wpe.1_Missense_Mutation_p.S524C|KIF16B_uc002wpf.1_Missense_Mutation_p.S524C|KIF16B_uc010gch.1_Missense_Mutation_p.S1091C|KIF16B_uc010gci.1_Missense_Mutation_p.S1142C	p.S1142C	NM_024704	NP_078980	Q96L93	KI16B_HUMAN			21	3582	-			1142					A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	ENST00000354981.2	37	c.3424A>T	CCDS13122.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.095912	0.36952	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000378003;ENST00000408042	T;T;T;T	0.72725	-0.65;-0.68;2.31;-0.62	5.8	-3.54	0.04653	.	1.454990	0.03593	N	0.232130	T	0.66548	0.2800	L	0.29908	0.895	0.09310	N	1	D;P;P	0.63880	0.993;0.914;0.861	P;P;B	0.56343	0.796;0.575;0.371	T	0.57797	-0.7749	10	0.45353	T	0.12	.	3.4169	0.07378	0.1012:0.3788:0.2168:0.3032	.	1142;1142;1142	Q96L93-2;Q96L93-6;Q96L93	.;.;KI16B_HUMAN	C	1142;1142;986;368;1142	ENSP00000347076:S1142C;ENSP00000347995:S1142C;ENSP00000367242:S368C;ENSP00000384164:S1142C	ENSP00000347076:S1142C	S	-	1	0	KIF16B	16300333	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.173000	0.09854	-0.710000	0.05001	-0.269000	0.10298	AGT		0.388	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683		26	61	0	0	0	0.00632	0	26	61				
ZNF133	7692	broad.mit.edu	37	20	18297153	18297153	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:18297153G>T	ENST00000316358.4	+	4	1755	c.1658G>T	c.(1657-1659)aGg>aTg	p.R553M	ZNF133_ENST00000535822.1_Missense_Mutation_p.R458M|ZNF133_ENST00000402618.2_Missense_Mutation_p.R490M|ZNF133_ENST00000377671.3_Missense_Mutation_p.R552M|ZNF133_ENST00000396026.3_Missense_Mutation_p.R556M|ZNF133_ENST00000462170.1_3'UTR|RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000538547.1_Missense_Mutation_p.R458M|ZNF133_ENST00000401790.1_Missense_Mutation_p.R553M	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	553					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R552M(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						TACATGTGCAGGCAGTGTGGA	0.582																																							uc010gcq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1657-1659)AGG>ATG		zinc finger protein 133							103.0	85.0	91.0					20																	18297153		2203	4300	6503	SO:0001583	missense	7692					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:18297153G>T	AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.1658G>T	20.37:g.18297153G>T	ENSP00000346090:p.Arg553Met					ZNF133_uc010zrv.1_Missense_Mutation_p.R556M|ZNF133_uc010zrw.1_Missense_Mutation_p.R490M|ZNF133_uc010gcr.2_Missense_Mutation_p.R553M|ZNF133_uc010zrx.1_Missense_Mutation_p.R458M|ZNF133_uc002wql.3_Missense_Mutation_p.R552M|ZNF133_uc010gcs.2_Missense_Mutation_p.R552M|ZNF133_uc010zry.1_Missense_Mutation_p.R458M|ZNF133_uc002wqm.2_Missense_Mutation_p.R553M	p.R553M	NM_003434	NP_003425	P52736	ZN133_HUMAN			5	1963	+			553			C2H2-type 13.		A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Missense_Mutation	SNP	ENST00000316358.4	37	c.1658G>T		.	.	.	.	.	.	.	.	.	.	G	12.42	1.934114	0.34096	.	.	ENSG00000125846	ENST00000377671;ENST00000396026;ENST00000402618;ENST00000401790;ENST00000538547;ENST00000535822;ENST00000316358	T;T;T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24;2.24;2.24	4.59	2.6	0.31112	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.128646	0.35525	N	0.003142	T	0.25531	0.0621	L	0.37697	1.125	0.23611	N	0.9973	D;D;P;D	0.67145	0.993;0.996;0.77;0.989	D;D;P;D	0.70487	0.969;0.968;0.593;0.941	T	0.01961	-1.1239	10	0.66056	D	0.02	-18.4941	6.8363	0.23937	0.0926:0.3431:0.5642:0.0	.	490;556;553;552	B4DIB8;B4DHU7;P52736;P52736-2	.;.;ZN133_HUMAN;.	M	552;556;490;553;458;458;553	ENSP00000366899:R552M;ENSP00000400897:R556M;ENSP00000385279:R490M;ENSP00000383945:R553M;ENSP00000442978:R458M;ENSP00000439427:R458M;ENSP00000346090:R553M	ENSP00000346090:R553M	R	+	2	0	ZNF133	18245153	0.000000	0.05858	0.997000	0.53966	0.543000	0.35085	0.268000	0.18571	0.836000	0.34901	0.655000	0.94253	AGG		0.582	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000127616.1	NM_003434		11	73	1	0	0.00010058	0.001368	0.000129202	11	73				
PTPRT	11122	broad.mit.edu	37	20	41306576	41306576	+	Silent	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:41306576G>C	ENST00000373187.1	-	7	1082	c.1083C>G	c.(1081-1083)ctC>ctG	p.L361L	PTPRT_ENST00000373201.1_Silent_p.L361L|PTPRT_ENST00000373184.1_Silent_p.L361L|PTPRT_ENST00000356100.2_Silent_p.L361L|PTPRT_ENST00000373193.3_Silent_p.L361L|PTPRT_ENST00000373190.1_Silent_p.L361L|PTPRT_ENST00000373198.4_Silent_p.L361L			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	361	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.L361L(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GTCGTGTGAGGAGCACTCGGA	0.572																																							uc002xkg.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(8)|ovary(7)|lung(5)	20						c.(1081-1083)CTC>CTG		protein tyrosine phosphatase, receptor type, T							111.0	112.0	112.0					20																	41306576		1966	4166	6132	SO:0001819	synonymous_variant	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:41306576G>C	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1083C>G	20.37:g.41306576G>C						PTPRT_uc010ggj.2_Silent_p.L361L	p.L361L	NM_007050	NP_008981	O14522	PTPRT_HUMAN			7	1267	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	361			Extracellular (Potential).|Fibronectin type-III 1.		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	c.1083C>G	CCDS42874.1																																																																																				0.572	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			8	138	0	0	0	0.004482	0	8	138				
JPH2	57158	broad.mit.edu	37	20	42815287	42815288	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:42815287_42815288CC>AA	ENST00000372980.3	-	1	930_931	c.58_59GG>TT	c.(58-60)GGg>TTg	p.G20L	JPH2_ENST00000342272.3_Missense_Mutation_p.G20L	NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	20	Gly-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)	p.G20L(2)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GGCCTTTCCCCCCTCCCAGCCC	0.629																																							uc002xli.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(58-60)GGG>TTG		junctophilin 2 isoform 1																																				SO:0001583	missense	57158				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane		g.chr20:42815287_42815288CC>AA	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.58_59delinsAA	20.37:g.42815287_42815288delinsAA	ENSP00000362071:p.Gly20Leu					JPH2_uc002xlj.2_Missense_Mutation_p.G20L	p.G20L	NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		1	931_932	-		Myeloproliferative disorder(115;0.0122)	20			MORN 1.|Gly-rich.|Cytoplasmic (Potential).		E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	DNP	ENST00000372980.3	37	c.58_59GG>TT	CCDS13325.1																																																																																				0.629	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1			13	32	0	0	0	0.004672	0	13	32				
EYA2	2139	broad.mit.edu	37	20	45633640	45633640	+	Missense_Mutation	SNP	C	C	A	rs373669958		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:45633640C>A	ENST00000327619.5	+	4	589	c.215C>A	c.(214-216)aCg>aAg	p.T72K	EYA2_ENST00000317304.6_Missense_Mutation_p.T72K|EYA2_ENST00000357410.3_Missense_Mutation_p.T72K	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	72					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)	p.T72K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				TACGGCCAGACGCAGTACAGT	0.562																																					Pancreas(120;56 1725 18501 25218 43520)	Pancreas(120;56 1725 18501 25218 43520)	uc002xsm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(214-216)ACG>AAG		eyes absent 2 isoform a							92.0	89.0	90.0					20																	45633640		2203	4300	6503	SO:0001583	missense	2139				DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity	g.chr20:45633640C>A		CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.215C>A	20.37:g.45633640C>A	ENSP00000333640:p.Thr72Lys					EYA2_uc010ghp.2_Missense_Mutation_p.T72K|EYA2_uc002xsn.2_Missense_Mutation_p.T77K|EYA2_uc002xso.2_Missense_Mutation_p.T72K|EYA2_uc002xsp.2_Missense_Mutation_p.T72K|EYA2_uc002xsq.2_Missense_Mutation_p.T72K	p.T72K	NM_005244	NP_005235	O00167	EYA2_HUMAN			4	589	+		Myeloproliferative disorder(115;0.0241)	72					Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Missense_Mutation	SNP	ENST00000327619.5	37	c.215C>A	CCDS13403.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041236	0.93685	.	.	ENSG00000064655	ENST00000327619;ENST00000357410;ENST00000484200;ENST00000317304;ENST00000458636	D;D;D;T	0.92149	-2.98;-2.57;-2.91;-0.91	5.53	5.53	0.82687	.	0.049112	0.85682	D	0.000000	D	0.95667	0.8591	M	0.76328	2.33	0.58432	D	0.999999	D;D;D;D	0.69078	0.997;0.991;0.987;0.987	D;P;P;P	0.66497	0.944;0.773;0.838;0.826	D	0.95910	0.8922	10	0.87932	D	0	-21.502	18.2443	0.89979	0.0:1.0:0.0:0.0	.	72;72;72;72	O00167-3;E7ETN2;A8KAG7;O00167	.;.;.;EYA2_HUMAN	K	72;72;72;72;25	ENSP00000333640:T72K;ENSP00000349986:T72K;ENSP00000321590:T72K;ENSP00000395427:T25K	ENSP00000321590:T72K	T	+	2	0	EYA2	45067047	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	6.985000	0.76193	2.608000	0.88229	0.561000	0.74099	ACG		0.562	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080326.2	NM_005244		31	137	1	0	3.57733e-08	0.001786	5.43349e-08	31	137				
SNAI1	6615	broad.mit.edu	37	20	48600678	48600678	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:48600678C>T	ENST00000244050.2	+	2	461	c.400C>T	c.(400-402)Caa>Taa	p.Q134*		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	134	Required for FBXL14-triggered degradation.				cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)	p.Q134*(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			AGGCTTGGGCCAAGTGCCCAA	0.607																																							uc002xuz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(400-402)CAA>TAA		snail 1 homolog							41.0	48.0	45.0					20																	48600678		2203	4300	6503	SO:0001587	stop_gained	6615				epithelial to mesenchymal transition|mesoderm formation|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|zinc ion binding	g.chr20:48600678C>T	AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.400C>T	20.37:g.48600678C>T	ENSP00000244050:p.Gln134*						p.Q134*	NM_005985	NP_005976	O95863	SNAI1_HUMAN	BRCA - Breast invasive adenocarcinoma(9;4.03e-06)		2	470	+			134			Required for FBXL14-triggered degradation.		B2R842|Q9P113|Q9UBP7|Q9UHH7	Nonsense_Mutation	SNP	ENST00000244050.2	37	c.400C>T	CCDS13423.1	.	.	.	.	.	.	.	.	.	.	C	36	5.625499	0.96671	.	.	ENSG00000124216	ENST00000244050	.	.	.	4.86	4.86	0.63082	.	0.340110	0.33161	N	0.005210	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.691	18.3482	0.90329	0.0:1.0:0.0:0.0	.	.	.	.	X	134	.	ENSP00000244050:Q134X	Q	+	1	0	SNAI1	48034085	1.000000	0.71417	0.989000	0.46669	0.861000	0.49209	2.119000	0.41958	2.398000	0.81561	0.557000	0.71058	CAA		0.607	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080350.1			23	74	0	0	0	0.001882	0	23	74				
TSHZ2	128553	broad.mit.edu	37	20	51871779	51871780	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:51871779_51871780GG>AT	ENST00000371497.5	+	2	2669_2670	c.1782_1783GG>AT	c.(1780-1785)ctGGcc>ctATcc	p.A595S	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.A592S|TSHZ2_ENST00000603338.2_Missense_Mutation_p.A592S	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	595					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A595S(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CCACACACCTGGCCCCTTACAC	0.515																																							uc002xwo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6						c.(1780-1785)CTGGCC>CTATCC		teashirt zinc finger homeobox 2																																				SO:0001583	missense	128553				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:51871779_51871780GG>AT	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	Exception_encountered	20.37:g.51871779_51871780delinsAT	ENSP00000360552:p.Ala595Ser						p.A595S	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)		2	2738_2739	+			595					B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	DNP	ENST00000371497.5	37	c.1782_1783GG>AT	CCDS33490.1																																																																																				0.515	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		29	150	0	0	0	0.004672	0	29	150				
DIDO1	11083	broad.mit.edu	37	20	61528277	61528277	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:61528277C>A	ENST00000266070.4	-	7	1985	c.1660G>T	c.(1660-1662)Ggc>Tgc	p.G554C	DIDO1_ENST00000395335.2_Missense_Mutation_p.G554C|DIDO1_ENST00000395343.1_Missense_Mutation_p.G554C|DIDO1_ENST00000395340.1_Missense_Mutation_p.G554C	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	554					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G554C(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					ACCGCGGAGCCTGGAGGGGCT	0.552																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	uc002ydr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)	6						c.(1660-1662)GGC>TGC		death inducer-obliterator 1 isoform c							32.0	35.0	34.0					20																	61528277		2203	4300	6503	SO:0001583	missense	11083				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding	g.chr20:61528277C>A	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1660G>T	20.37:g.61528277C>A	ENSP00000266070:p.Gly554Cys					DIDO1_uc002yds.1_Missense_Mutation_p.G554C|DIDO1_uc002ydt.1_Missense_Mutation_p.G554C|DIDO1_uc002ydu.1_Missense_Mutation_p.G554C	p.G554C	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN			7	1924	-	Breast(26;5.68e-08)		554					A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	c.1660G>T	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.014199	0.54468	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.12255	3.06;3.06;2.7;2.7	5.71	2.73	0.32206	.	0.871299	0.09446	N	0.801055	T	0.17323	0.0416	N	0.22421	0.69	0.09310	N	0.999999	D;D	0.65815	0.995;0.991	P;P	0.58873	0.847;0.707	T	0.20140	-1.0284	10	0.41790	T	0.15	-30.573	6.4324	0.21805	0.0:0.6586:0.0:0.3414	.	554;554	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	C	554	ENSP00000266070:G554C;ENSP00000378752:G554C;ENSP00000378749:G554C;ENSP00000378744:G554C	ENSP00000266070:G554C	G	-	1	0	DIDO1	60998722	0.030000	0.19436	0.014000	0.15608	0.029000	0.11900	0.734000	0.26101	1.412000	0.46977	0.563000	0.77884	GGC		0.552	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796		8	57	1	0	2.17888e-05	0.006214	2.89917e-05	8	57				
RTEL1	51750	broad.mit.edu	37	20	62292695	62292695	+	Silent	SNP	G	G	C	rs114124243		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr20:62292695G>C	ENST00000360203.5	+	3	472	c.147G>C	c.(145-147)acG>acC	p.T49T	RTEL1_ENST00000370018.3_Silent_p.T49T|RTEL1_ENST00000318100.4_Silent_p.T49T|RTEL1_ENST00000488316.1_3'UTR|RTEL1_ENST00000508582.2_Silent_p.T49T|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.T49T					regulator of telomere elongation helicase 1									p.T49T(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CAGGGAAGACGCTGTGCCTGC	0.627																																							uc002yfu.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(145-147)ACG>ACC		regulator of telomere elongation helicase 1							69.0	63.0	65.0					20																	62292695		2203	4300	6503	SO:0001819	synonymous_variant	51750				DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding	g.chr20:62292695G>C	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.147G>C	20.37:g.62292695G>C						RTEL1_uc011abc.1_RNA|RTEL1_uc002yft.1_Silent_p.T49T|RTEL1_uc011abd.1_Silent_p.T49T|RTEL1_uc002yfv.2_Silent_p.T49T|RTEL1_uc011abe.1_5'UTR|RTEL1_uc002yfw.2_RNA	p.T49T	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)		3	490	+	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		49			Helicase ATP-binding.|ATP (Probable).			Silent	SNP	ENST00000360203.5	37	c.147G>C																																																																																					0.627	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957		13	52	0	0	0	0.003163	0	13	52				
LIPI	149998	broad.mit.edu	37	21	15561488	15561488	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr21:15561488A>T	ENST00000536861.1	-	2	298	c.299T>A	c.(298-300)tTg>tAg	p.L100*	LIPI_ENST00000344577.2_Nonsense_Mutation_p.L121*			Q6XZB0	LIPI_HUMAN	lipase, member I	100					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)	p.L121*(1)		endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TTCATTCAGCAAAATCCTTAC	0.373																																							uc002yjm.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)	2						c.(361-363)TTG>TAG		lipase, member I							91.0	86.0	87.0					21																	15561488		2203	4300	6503	SO:0001587	stop_gained	149998				lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity	g.chr21:15561488A>T	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.299T>A	21.37:g.15561488A>T	ENSP00000440381:p.Leu100*					LIPI_uc010gkw.1_Nonsense_Mutation_p.L54*	p.L121*	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)	2	372	-			100					G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Nonsense_Mutation	SNP	ENST00000536861.1	37	c.362T>A		.	.	.	.	.	.	.	.	.	.	A	25.1	4.601012	0.87055	.	.	ENSG00000188992	ENST00000344577;ENST00000536861	.	.	.	5.3	5.3	0.74995	.	0.139609	0.49305	D	0.000153	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.2108	0.73222	1.0:0.0:0.0:0.0	.	.	.	.	X	121;100	.	ENSP00000343331:L121X	L	-	2	0	LIPI	14483359	0.915000	0.31059	0.961000	0.40146	0.174000	0.22865	6.135000	0.71696	2.139000	0.66308	0.533000	0.62120	TTG		0.373	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996		8	61	0	0	0	0.00308	0	8	61				
SAMSN1	64092	broad.mit.edu	37	21	15872992	15872992	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr21:15872992T>C	ENST00000400566.1	-	6	707	c.626A>G	c.(625-627)aAt>aGt	p.N209S	SAMSN1_ENST00000285670.2_Missense_Mutation_p.N277S|SAMSN1_ENST00000463807.1_5'Flank|SAMSN1_ENST00000400564.1_Missense_Mutation_p.N41S	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	209	SH3.				negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)	p.N209S(1)|p.N277S(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		TCCCACTTTATTGTTCAACAT	0.383																																							uc002yju.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|pancreas(1)	4						c.(625-627)AAT>AGT		SAM domain, SH3 domain and nuclear localization							214.0	188.0	196.0					21																	15872992		1847	4107	5954	SO:0001583	missense	64092				negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding	g.chr21:15872992T>C	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.626A>G	21.37:g.15872992T>C	ENSP00000383411:p.Asn209Ser					SAMSN1_uc010gky.1_Missense_Mutation_p.N41S|SAMSN1_uc002yjv.1_Missense_Mutation_p.N277S	p.N209S	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)	6	708	-			209			SH3.		B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	ENST00000400566.1	37	c.626A>G	CCDS42906.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.276725	0.80580	.	.	ENSG00000155307	ENST00000285670;ENST00000400566;ENST00000400564	T;T;T	0.28895	3.07;3.07;1.59	5.87	5.87	0.94306	Src homology-3 domain (2);Variant SH3 (1);	0.141002	0.64402	D	0.000004	T	0.46229	0.1382	L	0.60455	1.87	0.43242	D	0.995158	D;D;D	0.61697	0.962;0.99;0.977	P;P;P	0.54544	0.656;0.737;0.755	T	0.42120	-0.9470	10	0.59425	D	0.04	-35.0754	16.2718	0.82624	0.0:0.0:0.0:1.0	.	41;277;209	Q9NSI8-2;F8WAA1;Q9NSI8	.;.;SAMN1_HUMAN	S	277;209;41	ENSP00000285670:N277S;ENSP00000383411:N209S;ENSP00000383409:N41S	ENSP00000285670:N277S	N	-	2	0	SAMSN1	14794863	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.834000	0.62774	2.239000	0.73571	0.528000	0.53228	AAT		0.383	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1			23	130	0	0	0	0.002299	0	23	130				
USP16	10600	broad.mit.edu	37	21	30403014	30403014	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr21:30403014G>T	ENST00000334352.4	+	4	391	c.160G>T	c.(160-162)Gac>Tac	p.D54Y	USP16_ENST00000535828.1_Intron|USP16_ENST00000399975.3_Missense_Mutation_p.D54Y|USP16_ENST00000399976.2_Missense_Mutation_p.D54Y	NM_001032410.1	NP_001027582.1			ubiquitin specific peptidase 16									p.D54Y(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(2)	34						CTGTAAGACTGACAATAAAGT	0.373																																					Melanoma(92;625 1444 27493 34101 44971)	Melanoma(92;625 1444 27493 34101 44971)	uc002ymy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|pancreas(1)	4						c.(160-162)GAC>TAC		ubiquitin specific protease 16 isoform a							103.0	97.0	99.0					21																	30403014		2203	4300	6503	SO:0001583	missense	10600				cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	g.chr21:30403014G>T	AF126736	CCDS13583.1, CCDS42912.1	21q21	2008-04-11	2005-08-08		ENSG00000156256	ENSG00000156256		"""Ubiquitin-specific peptidases"""	12614	protein-coding gene	gene with protein product		604735	"""ubiquitin specific protease 16"""			12838346	Standard	NM_006447		Approved	Ubp-M	uc002ymy.3	Q9Y5T5	OTTHUMG00000078802	ENST00000334352.4:c.160G>T	21.37:g.30403014G>T	ENSP00000334808:p.Asp54Tyr					USP16_uc002ymx.2_Missense_Mutation_p.D54Y|USP16_uc002ymw.2_Missense_Mutation_p.D54Y|USP16_uc011acm.1_Missense_Mutation_p.D40Y|USP16_uc011acn.1_Intron	p.D54Y	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN			3	362	+			54						Missense_Mutation	SNP	ENST00000334352.4	37	c.160G>T	CCDS13583.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046855	0.75846	.	.	ENSG00000156256	ENST00000399975;ENST00000399976;ENST00000334352;ENST00000399973	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.15	5.15	0.70609	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (1);	0.046152	0.85682	D	0.000000	T	0.64080	0.2566	M	0.63428	1.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	T	0.66312	-0.5955	10	0.87932	D	0	.	18.8094	0.92052	0.0:0.0:1.0:0.0	.	40;54;54	Q9Y5T5-3;Q9Y5T5-2;Q9Y5T5	.;.;UBP16_HUMAN	Y	54	ENSP00000382857:D54Y;ENSP00000382858:D54Y;ENSP00000334808:D54Y;ENSP00000382855:D54Y	ENSP00000334808:D54Y	D	+	1	0	USP16	29324885	1.000000	0.71417	0.961000	0.40146	0.770000	0.43624	8.334000	0.90028	2.680000	0.91292	0.305000	0.20034	GAC		0.373	USP16-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171847.1			11	66	1	0	0.00136819	0.001368	0.00166458	11	66				
KRTAP15-1	254950	broad.mit.edu	37	21	31812741	31812741	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr21:31812741C>G	ENST00000334067.3	+	1	145	c.96C>G	c.(94-96)agC>agG	p.S32R		NM_181623.1	NP_853654.1	Q3LI76	KR151_HUMAN	keratin associated protein 15-1	32						intermediate filament (GO:0005882)		p.S32R(1)		kidney(1)|large_intestine(3)|lung(6)|skin(1)	11						TCTACCCCAGCAATGCCATCT	0.478																																							uc002yod.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(94-96)AGC>AGG		keratin associated protein 15-1							88.0	88.0	88.0					21																	31812741		2203	4300	6503	SO:0001583	missense	254950					intermediate filament		g.chr21:31812741C>G	AP001708	CCDS13593.1	21q22.1	2008-05-21			ENSG00000186970	ENSG00000186970		"""Keratin associated proteins"""	18927	protein-coding gene	gene with protein product						12359730	Standard	NM_181623		Approved	KAP15.1	uc002yod.3	Q3LI76	OTTHUMG00000057784	ENST00000334067.3:c.96C>G	21.37:g.31812741C>G	ENSP00000334866:p.Ser32Arg						p.S32R	NM_181623	NP_853654	Q3LI76	KR151_HUMAN			1	96	+			32					Q2M3F4	Missense_Mutation	SNP	ENST00000334067.3	37	c.96C>G	CCDS13593.1	.	.	.	.	.	.	.	.	.	.	C	6.989	0.552499	0.13374	.	.	ENSG00000186970	ENST00000334067	T	0.03496	3.91	4.68	2.87	0.33458	.	0.844799	0.10356	N	0.684467	T	0.04003	0.0112	L	0.41632	1.29	0.09310	N	1	B	0.25904	0.137	B	0.25291	0.059	T	0.40924	-0.9537	10	0.44086	T	0.13	-5.0213	5.9225	0.19091	0.1882:0.7166:0.0:0.0952	.	32	Q3LI76	KR151_HUMAN	R	32	ENSP00000334866:S32R	ENSP00000334866:S32R	S	+	3	2	KRTAP15-1	30734612	0.086000	0.21541	0.254000	0.24359	0.038000	0.13279	0.189000	0.17037	0.888000	0.36160	0.655000	0.94253	AGC		0.478	KRTAP15-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128236.1			18	96	0	0	0	0.00499	0	18	96				
PCNT	5116	broad.mit.edu	37	21	47783460	47783460	+	Silent	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr21:47783460G>A	ENST00000359568.5	+	14	2327	c.2220G>A	c.(2218-2220)ctG>ctA	p.L740L	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	740	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.L740L(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGACTGAGCTGATGAAACAGG	0.388																																							uc002zji.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|breast(2)|pancreas(2)	8						c.(2218-2220)CTG>CTA		pericentrin							138.0	140.0	139.0					21																	47783460		2203	4300	6503	SO:0001819	synonymous_variant	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47783460G>A	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2220G>A	21.37:g.47783460G>A						PCNT_uc002zjj.2_Silent_p.L622L	p.L740L	NM_006031	NP_006022	O95613	PCNT_HUMAN			14	2327	+	Breast(49;0.112)		740			Glu-rich.|Potential.		O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	c.2220G>A	CCDS33592.1																																																																																				0.388	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		39	137	0	0	0	0.004289	0	39	137				
MED15	51586	broad.mit.edu	37	22	20922826	20922826	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:20922826G>T	ENST00000263205.7	+	8	1129	c.1060G>T	c.(1060-1062)Gtg>Ttg	p.V354L	MED15_ENST00000541476.1_Missense_Mutation_p.V328L|MED15_ENST00000478831.1_3'UTR|MED15_ENST00000425759.2_Missense_Mutation_p.V243L|MED15_ENST00000292733.7_Missense_Mutation_p.V354L|MED15_ENST00000406969.1_Missense_Mutation_p.V328L|MED15_ENST00000382974.2_Missense_Mutation_p.V283L|MED15_ENST00000542773.1_Missense_Mutation_p.V159L	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	354	Pro-rich.				gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.V354L(2)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			TCCGATGGTGGTGCAGCAGCC	0.597																																							uc002zsp.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(1)	1						c.(1060-1062)GTG>TTG		mediator complex subunit 15 isoform a							32.0	33.0	33.0					22																	20922826		2202	4300	6502	SO:0001583	missense	51586				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding	g.chr22:20922826G>T	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.1060G>T	22.37:g.20922826G>T	ENSP00000263205:p.Val354Leu					MED15_uc002zsq.2_Missense_Mutation_p.V354L|MED15_uc010gso.2_Missense_Mutation_p.V354L|MED15_uc002zsr.2_Missense_Mutation_p.V328L|MED15_uc011ahs.1_Missense_Mutation_p.V328L|MED15_uc002zss.2_Missense_Mutation_p.V273L|MED15_uc011ahu.1_Missense_Mutation_p.V80L	p.V354L	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)		8	1140	+	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	354			Pro-rich.		D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	ENST00000263205.7	37	c.1060G>T	CCDS33602.1	.	.	.	.	.	.	.	.	.	.	G	10.63	1.404365	0.25378	.	.	ENSG00000099917	ENST00000425759;ENST00000292733;ENST00000542773;ENST00000263205;ENST00000406969;ENST00000382974;ENST00000541476;ENST00000542312	D;T;D;D	0.83914	-1.78;0.95;-1.78;-1.78	5.4	4.38	0.52667	Mediator complex, subunit Med15, metazoa (1);	0.839605	0.10961	N	0.614996	T	0.71626	0.3362	N	0.24115	0.695	0.34798	D	0.736467	B;B;B;B;B	0.23937	0.094;0.094;0.077;0.077;0.094	B;B;B;B;B	0.27076	0.029;0.076;0.045;0.045;0.076	T	0.66268	-0.5966	10	0.12766	T	0.61	.	9.6663	0.39986	0.0929:0.0:0.9071:0.0	.	300;373;328;354;354	B4DGD6;Q6PKB8;G3V1P5;Q96RN5-2;Q96RN5	.;.;.;.;MED15_HUMAN	L	243;354;159;354;328;283;328;300	ENSP00000292733:V354L;ENSP00000263205:V354L;ENSP00000384344:V328L;ENSP00000443137:V328L	ENSP00000263205:V354L	V	+	1	0	MED15	19252826	1.000000	0.71417	0.994000	0.49952	0.040000	0.13550	2.000000	0.40816	1.514000	0.48869	0.655000	0.94253	GTG		0.597	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2	NM_015889		4	27	1	0	1.23904e-05	0.000602	1.66701e-05	4	27				
PI4KA	5297	broad.mit.edu	37	22	21178643	21178643	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:21178643C>A	ENST00000572273.1	-	4	483	c.253G>T	c.(253-255)Gcc>Tcc	p.A85S	PI4KA_ENST00000255882.6_Missense_Mutation_p.A143S			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	85					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.A85S(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TCCCTATAGGCCACATCAGAC	0.433																																					GBM(136;1332 1831 3115 23601 50806)	GBM(136;1332 1831 3115 23601 50806)	uc002zsz.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4						c.(253-255)GCC>TCC		phosphatidylinositol 4-kinase type 3 alpha							111.0	89.0	97.0					22																	21178643		2203	4300	6503	SO:0001583	missense	5297				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding	g.chr22:21178643C>A	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.253G>T	22.37:g.21178643C>A	ENSP00000458238:p.Ala85Ser					PI4KA_uc010gsq.1_Missense_Mutation_p.A143S	p.A85S	NM_058004	NP_477352	P42356	PI4KA_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		4	484	-	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	85					Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37	c.253G>T		.	.	.	.	.	.	.	.	.	.	C	35	5.544597	0.96488	.	.	ENSG00000241973	ENST00000255882;ENST00000449120	T	0.40756	1.02	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.68201	0.2975	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.995	T	0.72347	-0.4321	10	0.72032	D	0.01	-16.1491	18.7164	0.91677	0.0:1.0:0.0:0.0	.	143;85	D3DX33;P42356	.;PI4KA_HUMAN	S	85	ENSP00000402437:A85S	ENSP00000255882:A85S	A	-	1	0	PI4KA	19508643	1.000000	0.71417	0.998000	0.56505	0.889000	0.51656	5.379000	0.66196	2.654000	0.90174	0.655000	0.94253	GCC		0.433	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004		6	59	1	0	0.00307968	0.00308	0.00370021	6	59				
LZTR1	8216	broad.mit.edu	37	22	21343151	21343151	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:21343151G>T	ENST00000215739.8	+	6	942	c.583G>T	c.(583-585)Ggc>Tgc	p.G195C	LZTR1_ENST00000389355.3_Missense_Mutation_p.G176C|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	195					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G195C(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TGGCTATGACGGCAACGCCAG	0.637																																							uc002zto.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)	4						c.(583-585)GGC>TGC		leucine-zipper-like transcription regulator 1							152.0	113.0	127.0					22																	21343151		2203	4300	6503	SO:0001583	missense	8216				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity	g.chr22:21343151G>T	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.583G>T	22.37:g.21343151G>T	ENSP00000215739:p.Gly195Cys					LZTR1_uc002ztn.2_Missense_Mutation_p.G154C|LZTR1_uc011ahy.1_Missense_Mutation_p.G176C|LZTR1_uc010gsr.1_Missense_Mutation_p.G66C	p.G195C	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		6	686	+	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	195			Kelch 3.		Q14776|Q20WK0	Missense_Mutation	SNP	ENST00000215739.8	37	c.583G>T	CCDS33606.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923579	0.92319	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.71579	-0.58;-0.58	5.87	5.87	0.94306	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.87438	0.6177	M	0.89601	3.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.89238	0.3582	10	0.87932	D	0	-43.9936	17.6998	0.88291	0.0:0.0:1.0:0.0	.	176;154;195;154	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	C	154;195;176	ENSP00000215739:G195C;ENSP00000374006:G176C	ENSP00000215739:G195C	G	+	1	0	LZTR1	19673151	1.000000	0.71417	0.999000	0.59377	0.799000	0.45148	9.834000	0.99428	2.785000	0.95823	0.655000	0.94253	GGC		0.637	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767		29	86	1	0	1.39806e-14	0.008361	2.63774e-14	29	86				
TPST2	8459	broad.mit.edu	37	22	26937214	26937214	+	Missense_Mutation	SNP	A	A	C	rs200758682		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:26937214A>C	ENST00000338754.4	-	3	653	c.383T>G	c.(382-384)gTg>gGg	p.V128G	TPST2_ENST00000403880.1_Missense_Mutation_p.V128G|TPST2_ENST00000398110.2_Missense_Mutation_p.V128G	NM_003595.3	NP_003586.3	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	128					fusion of sperm to egg plasma membrane (GO:0007342)|peptidyl-tyrosine sulfation (GO:0006478)|prevention of polyspermy (GO:0060468)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)	p.V128G(1)		central_nervous_system(1)|large_intestine(1)|lung(5)	7						CTCATCCGTCACCCCCGCCTC	0.672																																							uc003acv.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(382-384)GTG>GGG		tyrosylprotein sulfotransferase 2							34.0	28.0	30.0					22																	26937214		2201	4298	6499	SO:0001583	missense	8459				peptidyl-tyrosine sulfation	endoplasmic reticulum|Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity	g.chr22:26937214A>C	AF049891	CCDS13839.1	22q12.1	2012-12-13			ENSG00000128294	ENSG00000128294	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12021	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog B (Drosophila)"""	603126				9736702, 9733778	Standard	NM_003595		Approved	TANGO13B	uc003acx.3	O60704	OTTHUMG00000150987	ENST00000338754.4:c.383T>G	22.37:g.26937214A>C	ENSP00000339813:p.Val128Gly					TPST2_uc003acw.2_Missense_Mutation_p.V128G|TPST2_uc003acx.2_Missense_Mutation_p.V128G|TPST2_uc011akf.1_Missense_Mutation_p.V128G	p.V128G	NM_003595	NP_003586	O60704	TPST2_HUMAN			2	551	-			128			Lumenal (Potential).		B3KQA7|Q6FI98|Q9H0V4	Missense_Mutation	SNP	ENST00000338754.4	37	c.383T>G	CCDS13839.1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.681749	0.47991	.	.	ENSG00000128294	ENST00000338754;ENST00000398110;ENST00000403880;ENST00000528868;ENST00000442495	.	.	.	5.33	5.33	0.75918	Sulfotransferase domain (1);	0.000000	0.64402	D	0.000003	T	0.78685	0.4322	M	0.79475	2.455	0.80722	D	1	D	0.64830	0.994	D	0.74674	0.984	T	0.80939	-0.1158	9	0.56958	D	0.05	-31.6206	14.4823	0.67592	1.0:0.0:0.0:0.0	.	128	O60704	TPST2_HUMAN	G	128;128;128;61;128	.	ENSP00000339813:V128G	V	-	2	0	TPST2	25267214	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	6.838000	0.75359	2.023000	0.59567	0.496000	0.49642	GTG		0.672	TPST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320820.3	NM_003595		7	17	0	0	0	0.00499	0	7	17				
EWSR1	2130	broad.mit.edu	37	22	29664333	29664333	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:29664333C>T	ENST00000397938.2	+	1	327	c.8C>T	c.(7-9)tCc>tTc	p.S3F	EWSR1_ENST00000332035.6_Missense_Mutation_p.S3F|RHBDD3_ENST00000216085.7_5'Flank|EWSR1_ENST00000406548.1_Missense_Mutation_p.S3F|EWSR1_ENST00000333395.6_Missense_Mutation_p.S3F|EWSR1_ENST00000332050.6_Missense_Mutation_p.S3F|EWSR1_ENST00000331029.7_Missense_Mutation_p.S3F|EWSR1_ENST00000414183.2_Missense_Mutation_p.S3F	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	3	EAD (Gln/Pro/Thr-rich).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.S3F(2)	EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						AAAATGGCGTCCACGGGTGAG	0.632			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																		uc003aet.2		NA		Dom	yes		22	22q12	2130	T	Ewing sarcoma breakpoint region 1 (EWS)			"""L, M"""	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1		Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma	EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	2	Substitution - Missense(2)		lung(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						c.(7-9)TCC>TTC		Ewing sarcoma breakpoint region 1 isoform 2							176.0	170.0	172.0					22																	29664333		2203	4300	6503	SO:0001583	missense	2130				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding	g.chr22:29664333C>T		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.8C>T	22.37:g.29664333C>T	ENSP00000381031:p.Ser3Phe					RHBDD3_uc003aeq.1_5'Flank|RHBDD3_uc003aer.1_5'Flank|EWSR1_uc003aes.3_Missense_Mutation_p.S3F|EWSR1_uc003aev.2_Missense_Mutation_p.S3F|EWSR1_uc003aew.2_Missense_Mutation_p.S3F|EWSR1_uc003aex.2_Missense_Mutation_p.S3F	p.S3F	NM_005243	NP_005234	Q01844	EWS_HUMAN			1	336	+			3			EAD (Gln/Pro/Thr-rich).		B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	ENST00000397938.2	37	c.8C>T	CCDS13851.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179971	0.57800	.	.	ENSG00000182944	ENST00000444626;ENST00000332050;ENST00000397938;ENST00000436425;ENST00000447973;ENST00000406548;ENST00000437155;ENST00000415761;ENST00000331029;ENST00000414183;ENST00000333395;ENST00000455726;ENST00000332035	T;T;T;T;T;T;T;T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3	4.06	2.94	0.34122	.	0.648859	0.13733	U	0.366543	D	0.84942	0.5584	L	0.51914	1.62	0.36702	D	0.880199	P;D;D;P;P	0.67145	0.676;0.972;0.996;0.676;0.782	P;P;D;P;P	0.80764	0.485;0.831;0.994;0.485;0.683	D	0.86141	0.1581	10	0.87932	D	0	.	9.1379	0.36886	0.0:0.7758:0.2242:0.0	.	3;3;3;3;3	Q96FE8;B0QYK1;Q96MX4;Q01844;Q9BWA2	.;.;.;EWS_HUMAN;.	F	3	ENSP00000416171:S3F;ENSP00000330896:S3F;ENSP00000381031:S3F;ENSP00000406824:S3F;ENSP00000405947:S3F;ENSP00000385726:S3F;ENSP00000412670:S3F;ENSP00000330516:S3F;ENSP00000400142:S3F;ENSP00000327456:S3F;ENSP00000393637:S3F;ENSP00000331699:S3F	ENSP00000330516:S3F	S	+	2	0	EWSR1	27994333	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.849000	0.39318	1.964000	0.57103	0.467000	0.42956	TCC		0.632	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243		5	214	0	0	0	0.001168	0	5	214				
AP1B1	162	broad.mit.edu	37	22	29737726	29737726	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:29737726C>A	ENST00000405198.1	-	12	1591	c.1560G>T	c.(1558-1560)cgG>cgT	p.R520R	AP1B1_ENST00000357586.2_Silent_p.R520R|AP1B1_ENST00000415447.1_Silent_p.R520R|AP1B1_ENST00000432560.2_Silent_p.R520R|AP1B1_ENST00000356015.2_Silent_p.R520R|AP1B1_ENST00000472057.1_5'Flank|AP1B1_ENST00000402502.1_Silent_p.R520R|AP1B1_ENST00000317368.7_Silent_p.R520R			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	520					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)	p.R520R(1)		endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AGCCACGGTCCCGCAGGTCTG	0.597																																							uc003afj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1558-1560)CGG>CGT		adaptor-related protein complex 1 beta 1 subunit							54.0	49.0	50.0					22																	29737726		2203	4300	6503	SO:0001819	synonymous_variant	162				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity	g.chr22:29737726C>A	L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.1560G>T	22.37:g.29737726C>A						AP1B1_uc003afi.2_Silent_p.R520R|AP1B1_uc003afk.2_Silent_p.R520R|AP1B1_uc003afl.2_Silent_p.R520R|AP1B1_uc011ako.1_Silent_p.R73R	p.R520R	NM_001127	NP_001118	Q10567	AP1B1_HUMAN			13	1744	-			520					C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Silent	SNP	ENST00000405198.1	37	c.1560G>T	CCDS13855.1																																																																																				0.597	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127		8	47	1	0	0.000157383	0.00308	0.00020057	8	47				
OSBP2	23762	broad.mit.edu	37	22	31285535	31285535	+	Missense_Mutation	SNP	G	G	A	rs372873880		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:31285535G>A	ENST00000332585.6	+	7	1639	c.1535G>A	c.(1534-1536)cGc>cAc	p.R512H	OSBP2_ENST00000407373.1_Missense_Mutation_p.R339H|OSBP2_ENST00000401475.1_Missense_Mutation_p.R145H|OSBP2_ENST00000446658.2_Missense_Mutation_p.R511H|OSBP2_ENST00000437268.2_Missense_Mutation_p.R254H|OSBP2_ENST00000382310.3_Intron|OSBP2_ENST00000535268.1_Missense_Mutation_p.R56H|OSBP2_ENST00000403222.3_Missense_Mutation_p.R346H	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	512					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						AGGCGAGTCCGCATTCCCAAC	0.597																																							uc003aiy.1		NA																	0				breast(1)|skin(1)	2						c.(1534-1536)CGC>CAC		oxysterol binding protein 2 isoform a		G	HIS/ARG	1,4245		0,1,2122	125.0	139.0	134.0		1535	5.0	1.0	22		134	1,8491		0,1,4245	no	missense	OSBP2	NM_030758.3	29	0,2,6367	AA,AG,GG		0.0118,0.0236,0.0157	possibly-damaging	512/917	31285535	2,12736	2123	4246	6369	SO:0001583	missense	23762				lipid transport	membrane	lipid binding	g.chr22:31285535G>A		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.1535G>A	22.37:g.31285535G>A	ENSP00000332576:p.Arg512His					OSBP2_uc011ala.1_Missense_Mutation_p.R346H|OSBP2_uc010gwc.1_Missense_Mutation_p.R339H|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Missense_Mutation_p.R511H|OSBP2_uc003aja.1_Missense_Mutation_p.R145H|OSBP2_uc011alc.1_Missense_Mutation_p.R254H|OSBP2_uc003ajb.2_Missense_Mutation_p.R57H|OSBP2_uc011ald.1_Missense_Mutation_p.R56H|OSBP2_uc010gwd.1_Missense_Mutation_p.R57H	p.R512H	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN			7	1639	+			512					B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	ENST00000332585.6	37	c.1535G>A	CCDS43002.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.131670|4.131670	0.77662|0.77662	2.36E-4|2.36E-4	1.18E-4|1.18E-4	ENSG00000184792|ENSG00000184792	ENST00000454145;ENST00000453621;ENST00000431368|ENST00000403222;ENST00000407373;ENST00000332585;ENST00000446658;ENST00000401475;ENST00000424224;ENST00000437268;ENST00000535268;ENST00000452656	.|T;T;T;T;T;T;T	.|0.46451	.|0.87;0.88;1.44;1.45;0.9;0.88;0.89	5.03|5.03	5.03|5.03	0.67393|0.67393	.|.	.|0.301060	.|0.36778	.|N	.|0.002414	T|T	0.32102|0.32102	0.0818|0.0818	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B;B	.|0.34241	.|0.085;0.109;0.051;0.109;0.444;0.444	.|B;B;B;B;B;B	.|0.24701	.|0.045;0.02;0.02;0.02;0.055;0.055	T|T	0.15636|0.15636	-1.0430|-1.0430	5|10	.|0.48119	.|T	.|0.1	-34.9833|-34.9833	18.165|18.165	0.89722|0.89722	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|254;346;254;339;511;512	.|F5H2A3;B4DKE4;B4DK24;Q6ZN50;Q0VF99;Q969R2	.|.;.;.;.;.;OSBP2_HUMAN	T|H	174;183;184|346;339;512;511;145;146;254;56;143	.|ENSP00000384213:R346H;ENSP00000385237:R339H;ENSP00000332576:R512H;ENSP00000392080:R511H;ENSP00000385254:R145H;ENSP00000389200:R254H;ENSP00000438713:R56H	.|ENSP00000332576:R512H	A|R	+|+	1|2	0|0	OSBP2|OSBP2	29615535|29615535	1.000000|1.000000	0.71417|0.71417	0.955000|0.955000	0.39395|0.39395	0.006000|0.006000	0.05464|0.05464	7.666000|7.666000	0.83877|0.83877	2.620000|2.620000	0.88729|0.88729	0.655000|0.655000	0.94253|0.94253	GCA|CGC		0.597	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321547.2	NM_030758		5	199	0	0	0	0.000602	0	5	199				
SYN3	8224	broad.mit.edu	37	22	33260992	33260992	+	Splice_Site	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:33260992C>A	ENST00000358763.2	-	6	864		c.e6-1		SYN3_ENST00000332840.5_Splice_Site	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III						neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)	p.?(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GCTGAGAGAACTAGGATAGAA	0.473																																							uc003amx.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e5-1		synapsin III isoform IIIa							151.0	153.0	152.0					22																	33260992		2203	4300	6503	SO:0001630	splice_region_variant	8224				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity	g.chr22:33260992C>A	AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.622-1G>T	22.37:g.33260992C>A						SYN3_uc003amy.2_Splice_Site_p.F208_splice|SYN3_uc003amz.2_Splice_Site_p.F207_splice	p.F208_splice	NM_003490	NP_003481	O14994	SYN3_HUMAN			5	781	-								B1B1F9	Splice_Site	SNP	ENST00000358763.2	37	c.622_splice	CCDS13908.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692017	0.88735	.	.	ENSG00000185666	ENST00000358763;ENST00000332840;ENST00000390686	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYN3	31590992	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	5.813000	0.69201	2.793000	0.96121	0.655000	0.94253	.		0.473	SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075892.4		Intron	25	150	1	0	6.12954e-19	0.004656	1.28163e-18	25	150				
APOL4	80832	broad.mit.edu	37	22	36587606	36587606	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:36587606G>C	ENST00000352371.1	-	6	794	c.570C>G	c.(568-570)atC>atG	p.I190M	APOL4_ENST00000429038.2_3'UTR|APOL4_ENST00000479929.1_5'UTR|APOL4_ENST00000404685.3_3'UTR|APOL4_ENST00000405511.1_3'UTR|APOL4_ENST00000332987.1_Missense_Mutation_p.I187M			Q9BPW4	APOL4_HUMAN	apolipoprotein L, 4	191					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	extracellular space (GO:0005615)	lipid binding (GO:0008289)	p.I190M(1)		lung(1)	1						TGTTCTCCACGATGCTGGAGG	0.547																																							uc003aox.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(571-573)ATC>ATG		apolipoprotein L4 isoform 2 precursor							73.0	68.0	70.0					22																	36587606		2198	4299	6497	SO:0001583	missense	80832				lipid metabolic process|lipid transport|lipoprotein metabolic process	extracellular region	lipid binding	g.chr22:36587606G>C	AF305226	CCDS74851.1, CCDS74852.1	22q11.2-q13.2	2013-01-24			ENSG00000100336	ENSG00000100336		"""Apolipoproteins"""	14867	protein-coding gene	gene with protein product		607254				11374903	Standard	NM_030643		Approved	APOLIV	uc003aox.3	Q9BPW4	OTTHUMG00000150630	ENST00000352371.1:c.570C>G	22.37:g.36587606G>C	ENSP00000338260:p.Ile190Met					APOL4_uc003aow.2_Missense_Mutation_p.I188M|APOL4_uc010gww.2_Missense_Mutation_p.I33M	p.I191M	NM_145660	NP_663693	Q9BPW4	APOL4_HUMAN			6	798	-			191					Q9BQ37|Q9BXQ8	Missense_Mutation	SNP	ENST00000352371.1	37	c.573C>G		.	.	.	.	.	.	.	.	.	.	g	10.42	1.346509	0.24426	.	.	ENSG00000100336	ENST00000352371;ENST00000332987	T;T	0.05649	3.41;3.41	2.39	-4.77	0.03219	.	0.536722	0.19752	N	0.106870	T	0.13970	0.0338	M	0.65975	2.015	0.09310	N	0.999999	D;D	0.65815	0.995;0.994	D;D	0.73380	0.98;0.966	T	0.01524	-1.1333	10	0.56958	D	0.05	.	5.0659	0.14582	0.6396:0.0:0.1939:0.1665	.	191;187	Q9BPW4;Q9BPW4-3	APOL4_HUMAN;.	M	190;187	ENSP00000338260:I190M;ENSP00000333229:I187M	ENSP00000333229:I187M	I	-	3	3	APOL4	34917552	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.643000	0.00862	-1.504000	0.01810	-0.501000	0.04562	ATC		0.547	APOL4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_145660		10	23	0	0	0	0.006214	0	10	23				
CBX6	23466	broad.mit.edu	37	22	39262426	39262426	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:39262426C>A	ENST00000407418.3	-	5	1150	c.1027G>T	c.(1027-1029)Gcc>Tcc	p.A343S	CBX6_ENST00000216083.6_Missense_Mutation_p.A325S			O95503	CBX6_HUMAN	chromobox homolog 6	343					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)	single-stranded RNA binding (GO:0003727)	p.A343S(1)		large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(58;0.04)					GGCTCAGGGGCCGTGGGAGGT	0.716																																							uc003awl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1027-1029)GCC>TCC		chromobox homolog 6							14.0	17.0	16.0					22																	39262426		2192	4287	6479	SO:0001583	missense	23466				chromatin modification|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex		g.chr22:39262426C>A		CCDS13980.1	22q13.1	2013-04-23			ENSG00000183741	ENSG00000183741			1556	protein-coding gene	gene with protein product							Standard	NM_014292		Approved		uc003awl.3	O95503	OTTHUMG00000150456	ENST00000407418.3:c.1027G>T	22.37:g.39262426C>A	ENSP00000384490:p.Ala343Ser						p.A343S	NM_014292	NP_055107	O95503	CBX6_HUMAN			5	1090	-	Melanoma(58;0.04)		343					A8KAH0|Q96EM5	Missense_Mutation	SNP	ENST00000407418.3	37	c.1027G>T	CCDS13980.1	.	.	.	.	.	.	.	.	.	.	C	9.550	1.115675	0.20795	.	.	ENSG00000183741	ENST00000407418;ENST00000216083	.	.	.	4.76	3.69	0.42338	.	2.209160	0.01718	N	0.028133	T	0.27134	0.0665	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11991	-1.0565	9	0.48119	T	0.1	.	6.5348	0.22346	0.3822:0.4814:0.1365:0.0	.	343	O95503	CBX6_HUMAN	S	343;325	.	ENSP00000216083:A325S	A	-	1	0	CBX6	37592372	0.270000	0.24152	0.030000	0.17652	0.531000	0.34715	0.857000	0.27831	2.185000	0.69588	0.407000	0.27541	GCC		0.716	CBX6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318190.1	NM_014292		7	29	1	0	8.12818e-05	0.001984	0.000105252	7	29				
MPPED1	758	broad.mit.edu	37	22	43821177	43821177	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr22:43821177C>A	ENST00000417669.2	+	2	630	c.186C>A	c.(184-186)aaC>aaA	p.N62K	MPPED1_ENST00000414469.2_Intron|MPPED1_ENST00000538182.1_Missense_Mutation_p.N95K|MPPED1_ENST00000443721.1_Missense_Mutation_p.N62K|MPPED1_ENST00000542779.1_Missense_Mutation_p.N62K|MPPED1_ENST00000439548.1_Intron			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	62							hydrolase activity (GO:0016787)	p.N62K(1)		endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				CCTTCTACAACATCAACCAGG	0.662																																							uc011apv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(184-186)AAC>AAA		metallophosphoesterase domain containing 1							47.0	52.0	50.0					22																	43821177		2164	4282	6446	SO:0001583	missense	758						hydrolase activity	g.chr22:43821177C>A	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.186C>A	22.37:g.43821177C>A	ENSP00000388137:p.Asn62Lys					MPPED1_uc011apw.1_Intron|MPPED1_uc011apx.1_Intron|MPPED1_uc011apy.1_Missense_Mutation_p.N62K|MPPED1_uc011apz.1_Missense_Mutation_p.N95K	p.N62K	NM_001044370	NP_001037835	O15442	MPPD1_HUMAN			2	409	+		all_neural(38;0.0244)|Ovarian(80;0.0694)	62					A8K159|B7Z2S9|Q8N361	Missense_Mutation	SNP	ENST00000417669.2	37	c.186C>A	CCDS46723.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.079979	0.55753	.	.	ENSG00000186732	ENST00000417669;ENST00000334209;ENST00000443721;ENST00000545165;ENST00000447567;ENST00000542779;ENST00000538182	T;T;T;T;T	0.47869	0.95;0.83;0.95;0.95;0.96	5.2	0.745	0.18359	.	0.000000	0.85682	D	0.000000	T	0.45377	0.1339	L	0.27053	0.805	0.80722	D	1	D;P	0.89917	1.0;0.936	D;B	0.87578	0.998;0.231	T	0.39121	-0.9629	10	0.09843	T	0.71	-40.1599	7.9024	0.29742	0.0:0.6666:0.0:0.3334	.	95;62	B7Z2S9;O15442	.;MPPD1_HUMAN	K	62;62;62;40;62;62;95	ENSP00000388137:N62K;ENSP00000335568:N62K;ENSP00000400686:N62K;ENSP00000444532:N62K;ENSP00000438335:N95K	ENSP00000335568:N62K	N	+	3	2	MPPED1	42151121	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.812000	0.27211	0.198000	0.20407	0.655000	0.94253	AAC		0.662	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318938.2	NM_001044370		7	34	1	0	1.76689e-08	0.006214	2.72655e-08	7	34				
NUP210	23225	broad.mit.edu	37	3	13417095	13417095	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:13417095T>A	ENST00000254508.5	-	11	1422	c.1340A>T	c.(1339-1341)gAg>gTg	p.E447V		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	447					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.E447G(1)|p.E447V(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					AATTTCCACCTCCTGCTGGTT	0.527																																							uc003bxv.1		NA																	2	Substitution - Missense(2)		lung(1)|endometrium(1)	ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11						c.(1339-1341)GAG>GTG		nucleoporin 210 precursor							186.0	168.0	174.0					3																	13417095		2203	4300	6503	SO:0001583	missense	23225				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore		g.chr3:13417095T>A	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.1340A>T	3.37:g.13417095T>A	ENSP00000254508:p.Glu447Val					NUP210_uc003bxx.2_Missense_Mutation_p.E119V	p.E447V	NM_024923	NP_079199	Q8TEM1	PO210_HUMAN			11	1423	-	all_neural(104;0.187)		447			Lumenal (Probable).		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	c.1340A>T	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.689765	0.88735	.	.	ENSG00000132182	ENST00000254508	T	0.51817	0.69	5.25	5.25	0.73442	Invasin/intimin cell-adhesion (1);	0.099110	0.64402	D	0.000002	T	0.61961	0.2389	L	0.61387	1.9	0.80722	D	1	D;D	0.61080	0.989;0.966	P;P	0.58266	0.836;0.543	T	0.66272	-0.5965	10	0.72032	D	0.01	-27.9305	15.1556	0.72739	0.0:0.0:0.0:1.0	.	447;447	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	V	447	ENSP00000254508:E447V	ENSP00000254508:E447V	E	-	2	0	NUP210	13392095	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.000000	0.88501	1.974000	0.57490	0.533000	0.62120	GAG		0.527	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923		27	121	0	0	0	0.002096	0	27	121				
GALNT15	117248	broad.mit.edu	37	3	16268973	16268973	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:16268973G>A	ENST00000339732.5	+	10	2389	c.1886G>A	c.(1885-1887)cGt>cAt	p.R629H	GALNT15_ENST00000437509.1_Intron	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	629	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R629H(2)									CAGCAGTGGCGTTTTGACCAG	0.443																																							uc003car.3		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	breast(1)	1						c.(1885-1887)CGT>CAT		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							124.0	122.0	123.0					3																	16268973		2203	4300	6503	SO:0001583	missense	117248					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr3:16268973G>A	AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.1886G>A	3.37:g.16268973G>A	ENSP00000344260:p.Arg629His					GALNTL2_uc003caq.3_Missense_Mutation_p.R362H|GALNTL2_uc003cas.3_Missense_Mutation_p.R159H	p.R629H	NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN			10	2361	+			629			Ricin B-type lectin.|Lumenal (Potential).		A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Missense_Mutation	SNP	ENST00000339732.5	37	c.1886G>A	CCDS33711.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.377|2.377	-0.343012|-0.343012	0.05243|0.05243	.|.	.|.	ENSG00000131386|ENSG00000131386	ENST00000339732|ENST00000543679	T|.	0.30448|.	1.53|.	5.4|5.4	0.574|0.574	0.17368|0.17368	Ricin B-related lectin (1);Ricin B lectin (2);|.	0.922020|.	0.09245|.	N|.	0.828632|.	T|T	0.39963|0.39963	0.1098|0.1098	L|L	0.46885|0.46885	1.475|1.475	0.30424|0.30424	N|N	0.77783|0.77783	B|.	0.11235|.	0.004|.	B|.	0.04013|.	0.001|.	T|T	0.41251|0.41251	-0.9519|-0.9519	10|6	0.18276|0.16896	T|T	0.48|0.51	.|.	7.9471|7.9471	0.29993|0.29993	0.4212:0.0:0.5788:0.0|0.4212:0.0:0.5788:0.0	.|.	629|.	Q8N3T1|.	GLTL2_HUMAN|.	H|I	629|159	ENSP00000344260:R629H|.	ENSP00000344260:R629H|ENSP00000445852:V159I	R|V	+|+	2|1	0|0	GALNTL2|GALNTL2	16243977|16243977	0.001000|0.001000	0.12720|0.12720	0.554000|0.554000	0.28268|0.28268	0.088000|0.088000	0.18126|0.18126	-0.853000|-0.853000	0.04303|0.04303	-0.111000|-0.111000	0.12001|0.12001	-0.140000|-0.140000	0.14226|0.14226	CGT|GTT		0.443	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110		9	77	0	0	0	0.001368	0	9	77				
ZNF385D	79750	broad.mit.edu	37	3	21606170	21606170	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:21606170G>T	ENST00000281523.2	-	3	690	c.172C>A	c.(172-174)Ccg>Acg	p.P58T	ZNF385D-AS1_ENST00000412369.1_RNA|ZNF385D_ENST00000494118.1_5'UTR	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	58						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P58T(1)		NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						TTCTGAATCGGGTCCATCTGT	0.358																																							uc003cce.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|skin(2)|ovary(1)	5						c.(172-174)CCG>ACG		zinc finger protein 385D							109.0	107.0	108.0					3																	21606170		2203	4300	6503	SO:0001583	missense	79750					nucleus	nucleic acid binding|zinc ion binding	g.chr3:21606170G>T	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.172C>A	3.37:g.21606170G>T	ENSP00000281523:p.Pro58Thr					ZNF385D_uc010hfb.1_RNA	p.P58T	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN			3	580	-			58						Missense_Mutation	SNP	ENST00000281523.2	37	c.172C>A	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787263	0.90367	.	.	ENSG00000151789	ENST00000281523	T	0.43688	0.94	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.62575	0.2439	L	0.49350	1.555	0.51767	D	0.999937	D	0.89917	1.0	D	0.83275	0.996	T	0.60905	-0.7170	10	0.66056	D	0.02	-3.427	20.3632	0.98871	0.0:0.0:1.0:0.0	.	58	Q9H6B1	Z385D_HUMAN	T	58	ENSP00000281523:P58T	ENSP00000281523:P58T	P	-	1	0	ZNF385D	21581174	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.866000	0.99616	2.826000	0.97356	0.561000	0.74099	CCG		0.358	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697		13	57	1	0	4.3838e-07	0.001855	6.33945e-07	13	57				
CYP8B1	1582	broad.mit.edu	37	3	42916116	42916116	+	Missense_Mutation	SNP	G	G	T	rs141302264		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:42916116G>T	ENST00000316161.4	-	1	1517	c.1193C>A	c.(1192-1194)cCt>cAt	p.P398H	KRBOX1_ENST00000426937.1_Intron|RP11-141M3.5_ENST00000471537.1_RNA|CYP8B1_ENST00000437102.1_Missense_Mutation_p.P398H	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	398					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)	p.P398H(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		GGTGGGCTCAGGGTGGATGTC	0.547																																							uc003cmh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1192-1194)CCT>CAT		cytochrome P450, family 8, subfamily B,							131.0	129.0	129.0					3																	42916116		2203	4300	6503	SO:0001583	missense	1582				bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity|electron carrier activity|heme binding|oxygen binding|sterol 12-alpha-hydroxylase activity	g.chr3:42916116G>T	AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.1193C>A	3.37:g.42916116G>T	ENSP00000318867:p.Pro398His					CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Missense_Mutation_p.P398H	p.P398H	NM_004391	NP_004382	Q9UNU6	CP8B1_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)	1	1518	-			398					B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	37	c.1193C>A	CCDS2707.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540732	0.85917	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.01572	4.76;4.76	5.41	5.41	0.78517	.	0.079048	0.50627	D	0.000104	T	0.11410	0.0278	M	0.88842	2.985	0.47862	D	0.999539	P;P	0.51933	0.949;0.949	P;P	0.56916	0.752;0.809	T	0.00265	-1.1865	10	0.66056	D	0.02	-16.5667	17.9417	0.89027	0.0:0.0:1.0:0.0	.	398;398	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	H	398	ENSP00000404499:P398H;ENSP00000318867:P398H	ENSP00000318867:P398H	P	-	2	0	CYP8B1	42891120	1.000000	0.71417	0.908000	0.35775	0.773000	0.43773	6.618000	0.74214	2.523000	0.85059	0.561000	0.74099	CCT		0.547	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	NM_004391		34	142	1	0	1.67305e-13	0.00623	3.10801e-13	34	142				
KIF15	56992	broad.mit.edu	37	3	44867888	44867888	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:44867888G>T	ENST00000326047.4	+	22	2871	c.2722G>T	c.(2722-2724)Gca>Tca	p.A908S	KIF15_ENST00000425755.1_Missense_Mutation_p.A543S	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	908					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.A908S(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		GCTTCTTGAGGCAGAAAAAGA	0.318																																							uc003cnx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(2722-2724)GCA>TCA		kinesin family member 15							75.0	80.0	78.0					3																	44867888		2203	4300	6503	SO:0001583	missense	56992				blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity	g.chr3:44867888G>T	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.2722G>T	3.37:g.44867888G>T	ENSP00000324020:p.Ala908Ser					KIF15_uc010hiq.2_Missense_Mutation_p.A811S|KIF15_uc010hir.2_5'UTR	p.A908S	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)	22	2871	+			908			Potential.		Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	37	c.2722G>T	CCDS33744.1	.	.	.	.	.	.	.	.	.	.	G	9.768	1.171815	0.21704	.	.	ENSG00000163808	ENST00000326047;ENST00000481166;ENST00000396031;ENST00000425755	T;T;T	0.52526	0.66;0.66;0.66	5.38	3.21	0.36854	.	0.136028	0.33438	N	0.004918	T	0.32734	0.0839	L	0.47716	1.5	0.34095	D	0.661214	B	0.18461	0.028	B	0.17433	0.018	T	0.27020	-1.0086	10	0.12103	T	0.63	.	5.069	0.14596	0.3845:0.0:0.6155:0.0	.	908	Q9NS87	KIF15_HUMAN	S	908;680;907;543	ENSP00000324020:A908S;ENSP00000425499:A680S;ENSP00000389982:A543S	ENSP00000324020:A908S	A	+	1	0	KIF15	44842892	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	1.681000	0.37618	1.430000	0.47334	-0.225000	0.12378	GCA		0.318	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2			8	46	1	0	7.48243e-07	0.006214	1.06608e-06	8	46				
FBXW12	285231	broad.mit.edu	37	3	48416855	48416855	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:48416855G>T	ENST00000296438.5	+	5	484	c.298G>T	c.(298-300)Gag>Tag	p.E100*	FBXW12_ENST00000415155.1_Nonsense_Mutation_p.E100*|FBXW12_ENST00000445170.1_Nonsense_Mutation_p.E81*|FBXW12_ENST00000436231.1_5'UTR	NM_207102.2	NP_996985.2	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12	100								p.E100*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ATTTGAGACGGAGTTGGCTTA	0.393																																							uc003csr.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(298-300)GAG>TAG		F-box and WD repeat domain containing 12 isoform							116.0	109.0	111.0					3																	48416855		2203	4300	6503	SO:0001587	stop_gained	285231							g.chr3:48416855G>T	AK097594, AY247969	CCDS2764.1, CCDS54577.1, CCDS54578.1	3p21.31	2011-07-01	2007-02-08	2004-07-21	ENSG00000164049	ENSG00000164049		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	20729	protein-coding gene	gene with protein product		609075	"""F-box only protein 35"", ""F-box and WD-40 domain protein 12"""	FBXO35		15040455	Standard	NM_207102		Approved	Fbw12	uc010hjv.3	Q6X9E4	OTTHUMG00000133530	ENST00000296438.5:c.298G>T	3.37:g.48416855G>T	ENSP00000296438:p.Glu100*					FBXW12_uc010hjv.2_Nonsense_Mutation_p.E81*|FBXW12_uc003css.2_Nonsense_Mutation_p.E100*|FBXW12_uc010hjw.2_Nonsense_Mutation_p.E21*	p.E100*	NM_207102	NP_996985	Q6X9E4	FBW12_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	5	484	+			100			WD 1.		E9PG36|Q494Y9|Q494Z0	Nonsense_Mutation	SNP	ENST00000296438.5	37	c.298G>T	CCDS2764.1	.	.	.	.	.	.	.	.	.	.	G	8.484	0.860419	0.17178	.	.	ENSG00000164049	ENST00000458736;ENST00000296438;ENST00000445170;ENST00000415155	.	.	.	3.54	-6.73	0.01749	.	2.785040	0.01891	N	0.038534	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-7.7038	0.6055	0.00752	0.2912:0.3134:0.1603:0.2351	.	.	.	.	X	21;100;81;100	.	ENSP00000296438:E100X	E	+	1	0	FBXW12	48391859	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.396000	0.02513	-1.135000	0.02895	-0.705000	0.03659	GAG		0.393	FBXW12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257505.1	NM_207102		9	69	1	0	9.70103e-10	0.008291	1.58297e-09	9	69				
BSN	8927	broad.mit.edu	37	3	49694474	49694474	+	Silent	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:49694474G>A	ENST00000296452.4	+	5	7599	c.7485G>A	c.(7483-7485)ttG>ttA	p.L2495L		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2495					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.L2495L(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CTGCTGAGTTGGCCCAGAATG	0.637																																							uc003cxe.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						c.(7483-7485)TTG>TTA		bassoon protein							23.0	26.0	25.0					3																	49694474		2198	4289	6487	SO:0001819	synonymous_variant	8927				synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding	g.chr3:49694474G>A	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.7485G>A	3.37:g.49694474G>A							p.L2495L	NM_003458	NP_003449	Q9UPA5	BSN_HUMAN		BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)	5	7599	+			2495					O43161|Q7LGH3	Silent	SNP	ENST00000296452.4	37	c.7485G>A	CCDS2800.1																																																																																				0.637	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458		8	32	0	0	0	0.00308	0	8	32				
CACNA1D	776	broad.mit.edu	37	3	53752403	53752403	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:53752403G>T	ENST00000350061.5	+	10	1977	c.1466G>T	c.(1465-1467)tGt>tTt	p.C489F	CACNA1D_ENST00000422281.2_Missense_Mutation_p.C489F|CACNA1D_ENST00000288139.4_Missense_Mutation_p.C489F	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	489					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.C489F(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGAGGCTGCTGTGGAAGTCTC	0.597																																							uc003dgv.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11						c.(1465-1467)TGT>TTT		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						124.0	104.0	111.0					3																	53752403		2203	4300	6503	SO:0001583	missense	776				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr3:53752403G>T	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.1466G>T	3.37:g.53752403G>T	ENSP00000288133:p.Cys489Phe					CACNA1D_uc003dgu.3_Missense_Mutation_p.C489F|CACNA1D_uc003dgy.3_Missense_Mutation_p.C489F|CACNA1D_uc003dgw.3_Missense_Mutation_p.C136F	p.C489F	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	10	1629	+			489			Cytoplasmic (Potential).		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	c.1466G>T	CCDS46848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.70|18.70	3.680272|3.680272	0.68042|0.68042	.|.	.|.	ENSG00000157388|ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478|ENST00000481085	D;D;D;D|.	0.93763|.	-3.28;-3.28;-3.28;-3.28|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	2.669440|.	0.00911|.	N|.	0.002473|.	T|T	0.75503|0.75503	0.3858|0.3858	M|M	0.70595|0.70595	2.14|2.14	0.80722|0.80722	D|D	1|1	P;B;B;P|.	0.36282|.	0.546;0.144;0.004;0.465|.	B;B;B;B|.	0.41299|.	0.258;0.183;0.004;0.353|.	T|T	0.74569|0.74569	-0.3622|-0.3622	10|5	0.54805|.	T|.	0.06|.	.|.	18.2466|18.2466	0.89988|0.89988	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	489;162;489;489|.	B0FYA3;Q59GD8;Q01668;Q01668-2|.	.;.;CAC1D_HUMAN;.|.	F|L	489;489;489;162|203	ENSP00000288133:C489F;ENSP00000288139:C489F;ENSP00000409174:C489F;ENSP00000418014:C162F|.	ENSP00000288139:C489F|.	C|V	+|+	2|1	0|0	CACNA1D|CACNA1D	53727443|53727443	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.678000|0.678000	0.39670|0.39670	9.808000|9.808000	0.99193|0.99193	2.553000|2.553000	0.86117|0.86117	0.655000|0.655000	0.94253|0.94253	TGT|GTG		0.597	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720		4	50	1	0	0.00024832	0.000248	0.000313975	4	50				
WNT5A	7474	broad.mit.edu	37	3	55504432	55504433	+	Missense_Mutation	DNP	CC	CC	AA	rs369954366		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:55504432_55504433CC>AA	ENST00000474267.1	-	6	1351_1352	c.830_831GG>TT	c.(829-831)cGG>cTT	p.R277L	WNT5A_ENST00000493406.1_5'Flank|WNT5A_ENST00000497027.1_Missense_Mutation_p.R262L|WNT5A_ENST00000264634.4_Missense_Mutation_p.R277L			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	277					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R370L(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		GGCTGTTGAGCCGCATGGCCGC	0.614																																							uc003dhn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(829-831)CGG>CTT		wingless-type MMTV integration site family,																																				SO:0001583	missense	7474				activation of JUN kinase activity|activation of protein kinase B activity|axon guidance|cartilage development|cellular protein localization|cellular response to calcium ion|cellular response to interferon-gamma|cellular response to lipopolysaccharide|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|cervix development|cochlea morphogenesis|convergent extension involved in organogenesis|dopaminergic neuron differentiation|dorsal/ventral axis specification|embryonic digit morphogenesis|embryonic skeletal system development|epithelial cell proliferation involved in mammary gland duct elongation|epithelial to mesenchymal transition|face development|genitalia development|heart looping|hemopoietic stem cell proliferation|keratinocyte differentiation|lateral sprouting involved in mammary gland duct morphogenesis|lens development in camera-type eye|male gonad development|mammary gland branching involved in thelarche|negative regulation of apoptosis|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of mesenchymal cell proliferation|negative regulation of transcription, DNA-dependent|neural tube closure|olfactory bulb interneuron development|optic cup formation involved in camera-type eye development|palate development|positive regulation of angiogenesis|positive regulation of cartilage development|positive regulation of cGMP metabolic process|positive regulation of chemokine biosynthetic process|positive regulation of cytokine secretion involved in immune response|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of macrophage activation|positive regulation of macrophage cytokine production|positive regulation of mesenchymal cell proliferation|positive regulation of neuron projection development|positive regulation of NF-kappaB transcription factor activity|positive regulation of ossification|positive regulation of protein catabolic process|positive regulation of protein kinase C signaling cascade|positive regulation of T cell chemotaxis|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|primitive streak formation|regulation of branching involved in mammary gland duct morphogenesis|somitogenesis|tail morphogenesis|type B pancreatic cell development|urinary bladder development|uterus development|vagina development|Wnt receptor signaling pathway, calcium modulating pathway|wound healing	extracellular space|membrane fraction|plasma membrane|proteinaceous extracellular matrix	frizzled binding|frizzled-2 binding|receptor tyrosine kinase-like orphan receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr3:55504432_55504433CC>AA	L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.830_831delinsAA	3.37:g.55504432_55504433delinsAA	ENSP00000417310:p.Arg277Leu					WNT5A_uc003dhm.2_Missense_Mutation_p.R262L|WNT5A_uc010hmw.2_Missense_Mutation_p.R262L|WNT5A_uc010hmx.2_Missense_Mutation_p.R188L	p.R277L	NM_003392	NP_003383	P41221	WNT5A_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)	5	1148_1149	-			277					A8K4A4|Q6P278	Missense_Mutation	DNP	ENST00000474267.1	37	c.830_831GG>TT	CCDS46850.1																																																																																				0.614	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350793.3	NM_003392		3	18	0	0	0	0.004672	0	3	18				
NXPE3	91775	broad.mit.edu	37	3	101520396	101520396	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:101520396G>T	ENST00000491511.2	+	5	1367	c.411G>T	c.(409-411)aaG>aaT	p.K137N	NXPE3_ENST00000422132.1_Missense_Mutation_p.K137N|NXPE3_ENST00000477909.1_Missense_Mutation_p.K137N|NXPE3_ENST00000273347.5_Missense_Mutation_p.K137N	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	137						extracellular region (GO:0005576)		p.K137N(1)									GAAAGCCCAAGAAGTATGGTG	0.512																																							uc003dvn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(409-411)AAG>AAT		hypothetical protein LOC91775 precursor							85.0	87.0	87.0					3																	101520396		2203	4300	6503	SO:0001583	missense	91775					extracellular region		g.chr3:101520396G>T	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.411G>T	3.37:g.101520396G>T	ENSP00000417485:p.Lys137Asn					FAM55C_uc010hpn.2_Missense_Mutation_p.K137N	p.K137N	NM_145037	NP_659474	Q969Y0	FA55C_HUMAN			5	1048	+			137					A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	c.411G>T	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038207	0.75617	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.67	5.67	0.87782	Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	M	0.91872	3.25	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	T	0.62343	-0.6874	10	0.87932	D	0	-22.7556	13.3646	0.60676	0.072:0.0:0.928:0.0	.	137	Q969Y0	FA55C_HUMAN	N	137	ENSP00000273347:K137N;ENSP00000417485:K137N;ENSP00000418369:K137N;ENSP00000396421:K137N	ENSP00000273347:K137N	K	+	3	2	FAM55C	103003086	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.436000	0.44819	2.836000	0.97738	0.655000	0.94253	AAG		0.512	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037		11	65	1	0	3.86212e-05	0.008291	5.08284e-05	11	65				
C3orf27	23434	broad.mit.edu	37	3	128292497	128292497	+	Missense_Mutation	SNP	C	C	T	rs141693917		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:128292497C>T	ENST00000356020.2	-	3	1042	c.76G>A	c.(76-78)Gtc>Atc	p.V26I		NM_007354.2	NP_031380.1	O15544	GR6_HUMAN	chromosome 3 open reading frame 27	26								p.V26I(2)		large_intestine(2)|lung(5)|prostate(1)	8				GBM - Glioblastoma multiforme(114;0.176)		AGGCGGGAGACGCTGAGTCTA	0.592																																							uc003ekq.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)		0						c.(76-78)GTC>ATC		putative GR6 protein		C	ILE/VAL	0,4402		0,0,2201	28.0	29.0	29.0		76	-1.2	0.0	3	dbSNP_134	29	1,8597		0,1,4298	no	missense	C3orf27	NM_007354.2	29	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	26/150	128292497	1,12999	2201	4299	6500	SO:0001583	missense	23434							g.chr3:128292497C>T	AF008192	CCDS3050.1	3q21	2005-12-19			ENSG00000198685	ENSG00000198685			17099	protein-coding gene	gene with protein product						9307271	Standard	NR_125802		Approved	GR6	uc003ekq.3	O15544	OTTHUMG00000159688	ENST00000356020.2:c.76G>A	3.37:g.128292497C>T	ENSP00000348302:p.Val26Ile						p.V26I	NM_007354	NP_031380	O15544	GR6_HUMAN		GBM - Glioblastoma multiforme(114;0.176)	3	1043	-			26						Missense_Mutation	SNP	ENST00000356020.2	37	c.76G>A	CCDS3050.1	.	.	.	.	.	.	.	.	.	.	C	9.932	1.215195	0.22373	0.0	1.16E-4	ENSG00000198685	ENST00000356020	.	.	.	2.35	-1.23	0.09465	.	.	.	.	.	T	0.11750	0.0286	N	0.08118	0	0.09310	N	1	P	0.39404	0.672	B	0.29942	0.109	T	0.16158	-1.0412	8	0.87932	D	0	.	6.0846	0.19960	0.157:0.6855:0.0:0.1575	.	26	O15544	GR6_HUMAN	I	26	.	ENSP00000348302:V26I	V	-	1	0	C3orf27	129775187	0.000000	0.05858	0.001000	0.08648	0.388000	0.30384	-0.996000	0.03709	-0.054000	0.13266	0.313000	0.20887	GTC		0.592	C3orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356924.1	NM_007354		10	28	0	0	0	0.000978	0	10	28				
PCOLCE2	26577	broad.mit.edu	37	3	142567310	142567310	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:142567310G>T	ENST00000295992.3	-	3	503	c.197C>A	c.(196-198)cCc>cAc	p.P66H	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.P66H	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	66	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.P66H(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						TTTTCCTTCGGGAACCTGCCA	0.413																																							uc003evd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(196-198)CCC>CAC		procollagen C-endopeptidase enhancer 2							47.0	49.0	49.0					3																	142567310		2203	4300	6503	SO:0001583	missense	26577					extracellular region	collagen binding|heparin binding|peptidase activator activity	g.chr3:142567310G>T	AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.197C>A	3.37:g.142567310G>T	ENSP00000295992:p.Pro66His						p.P66H	NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN			3	393	-			66			CUB 1.		B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	ENST00000295992.3	37	c.197C>A	CCDS3127.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521323	0.64747	.	.	ENSG00000163710	ENST00000295992;ENST00000485766	T;T	0.36699	1.24;1.24	5.1	5.1	0.69264	CUB (5);	0.103175	0.64402	D	0.000002	T	0.69260	0.3091	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.77024	-0.2741	10	0.87932	D	0	-7.3331	18.7404	0.91772	0.0:0.0:1.0:0.0	.	66	Q9UKZ9	PCOC2_HUMAN	H	66	ENSP00000295992:P66H;ENSP00000419842:P66H	ENSP00000295992:P66H	P	-	2	0	PCOLCE2	144050000	1.000000	0.71417	0.964000	0.40570	0.937000	0.57800	9.263000	0.95617	2.666000	0.90696	0.644000	0.83932	CCC		0.413	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363		21	63	1	0	8.04996e-18	0.001882	1.66159e-17	21	63				
TM4SF1	4071	broad.mit.edu	37	3	149093324	149093324	+	Missense_Mutation	SNP	A	A	T	rs140811683		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:149093324A>T	ENST00000305366.3	-	3	636	c.319T>A	c.(319-321)Tgt>Agt	p.C107S	TM4SF1_ENST00000472441.1_Missense_Mutation_p.C18S|TM4SF1-AS1_ENST00000484046.1_RNA|TM4SF1-AS1_ENST00000496491.1_RNA	NM_014220.2	NP_055035.1	P30408	T4S1_HUMAN	transmembrane 4 L six family member 1	107						integral component of plasma membrane (GO:0005887)		p.C107S(1)		endometrium(3)|large_intestine(1)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACAATGACACAGTAGCCAGAT	0.512																																							uc003exb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(319-321)TGT>AGT		transmembrane 4 superfamily member 1							89.0	75.0	80.0					3																	149093324		2203	4300	6503	SO:0001583	missense	4071					integral to plasma membrane		g.chr3:149093324A>T	M90657	CCDS3143.1	3q21-q25	2005-03-21	2005-03-21		ENSG00000169908	ENSG00000169908			11853	protein-coding gene	gene with protein product		191155	"""transmembrane 4 superfamily member 1"""	M3S1		1565644	Standard	NM_014220		Approved	L6	uc003exb.1	P30408	OTTHUMG00000159597	ENST00000305366.3:c.319T>A	3.37:g.149093324A>T	ENSP00000304277:p.Cys107Ser					TM4SF1_uc003exc.1_Missense_Mutation_p.C18S	p.C107S	NM_014220	NP_055035	P30408	T4S1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)		3	553	-			107			Helical; (Probable).		Q6IB51	Missense_Mutation	SNP	ENST00000305366.3	37	c.319T>A	CCDS3143.1	.	.	.	.	.	.	.	.	.	.	A	19.27	3.795916	0.70452	.	.	ENSG00000169908	ENST00000305366;ENST00000472441;ENST00000383054	T;T	0.38887	1.11;1.11	5.77	5.77	0.91146	.	0.066390	0.64402	N	0.000005	T	0.57725	0.2073	L	0.48174	1.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.52975	-0.8503	10	0.31617	T	0.26	-26.8919	16.0885	0.81076	1.0:0.0:0.0:0.0	.	18;107	C9J611;P30408	.;T4S1_HUMAN	S	107;18;107	ENSP00000304277:C107S;ENSP00000417084:C18S	ENSP00000304277:C107S	C	-	1	0	TM4SF1	150576014	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.385000	0.79763	2.192000	0.70111	0.533000	0.62120	TGT		0.512	TM4SF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356368.1			8	56	0	0	0	0.00308	0	8	56				
ERICH6	131831	broad.mit.edu	37	3	150421307	150421307	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:150421307G>C	ENST00000295910.6	-	1	431	c.379C>G	c.(379-381)Ccc>Gcc	p.P127A	RP11-103G8.2_ENST00000475393.1_RNA|FAM194A_ENST00000491361.1_Intron|RP11-103G8.2_ENST00000471093.1_RNA	NM_152394.3	NP_689607.2												p.P127A(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GTGCTGGAGGGTGGGCTTGCG	0.667																																							uc003eyg.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(379-381)CCC>GCC		hypothetical protein LOC131831							46.0	43.0	44.0					3																	150421307		2203	4300	6503	SO:0001583	missense	131831							g.chr3:150421307G>C																												ENST00000295910.6:c.379C>G	3.37:g.150421307G>C	ENSP00000295910:p.Pro127Ala					FAM194A_uc003eyh.2_Intron	p.P127A	NM_152394	NP_689607	Q7L0X2	F194A_HUMAN			1	436	-			127						Missense_Mutation	SNP	ENST00000295910.6	37	c.379C>G	CCDS3151.2	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728906	0.30684	.	.	ENSG00000163645	ENST00000295910;ENST00000313811;ENST00000474463;ENST00000498386	T;T;T	0.46819	2.82;0.86;1.0	2.93	-3.79	0.04320	.	3.251390	0.01116	N	0.005691	T	0.29524	0.0736	N	0.19112	0.55	0.09310	N	0.999995	B	0.10296	0.003	B	0.08055	0.003	T	0.07597	-1.0764	10	0.24483	T	0.36	15.2326	5.1709	0.15110	0.5753:0.1648:0.2599:0.0	.	127	Q7L0X2	F194A_HUMAN	A	127;85;101;87	ENSP00000295910:P127A;ENSP00000419304:P101A;ENSP00000417780:P87A	ENSP00000295910:P127A	P	-	1	0	FAM194A	151903997	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.999000	0.01467	-1.036000	0.03287	0.561000	0.74099	CCC		0.667	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1			7	55	0	0	0	0.001984	0	7	55				
IGSF10	285313	broad.mit.edu	37	3	151176498	151176499	+	5'Flank	DNP	CC	CC	AT			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:151176498_151176499CC>AT	ENST00000282466.3	-	0	0					NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTACCTTCATCCTGAAAAAACA	0.535																																							uc011bod.1		NA																	0				skin(7)|ovary(5)|central_nervous_system(1)	13						c.e1-1		immunoglobulin superfamily, member 10 precursor																																				SO:0001631	upstream_gene_variant	285313				cell differentiation|multicellular organismal development|ossification	extracellular region		g.chr3:151176498_151176499CC>AT	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.1_1delinsAT	3.37:g.151176498_151176499delinsAT	Exception_encountered						p.M1_splice	NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		1	1	-								Q86YJ9|Q8N772|Q8NA84	Splice_Site	DNP	ENST00000282466.3	37	c.1_splice	CCDS3160.1																																																																																				0.535	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822		9	37	0	0	0	0.004672	0	9	37				
SKIL	6498	broad.mit.edu	37	3	170078605	170078605	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:170078605A>C	ENST00000458537.3	+	1	1195	c.486A>C	c.(484-486)gaA>gaC	p.E162D	SKIL_ENST00000259119.4_Missense_Mutation_p.E162D|SKIL_ENST00000426052.2_Missense_Mutation_p.E142D|SKIL_ENST00000413427.2_Missense_Mutation_p.E162D	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	162					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)	p.E162D(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TTGGAGGAGAAAAGAGACTCT	0.408																																							uc003fgu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(484-486)GAA>GAC		SKI-like isoform 1							106.0	116.0	113.0					3																	170078605		2203	4300	6503	SO:0001583	missense	6498				cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity	g.chr3:170078605A>C	X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.486A>C	3.37:g.170078605A>C	ENSP00000415243:p.Glu162Asp					SKIL_uc011bps.1_Missense_Mutation_p.E142D|SKIL_uc003fgv.2_Missense_Mutation_p.E162D|SKIL_uc003fgw.2_Missense_Mutation_p.E162D	p.E162D	NM_005414	NP_005405	P12757	SKIL_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		2	1198	+	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		162					A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	ENST00000458537.3	37	c.486A>C	CCDS33890.1	.	.	.	.	.	.	.	.	.	.	A	19.30	3.800346	0.70567	.	.	ENSG00000136603	ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78	5.42	-0.857	0.10693	DNA binding domain, putative (1);Transforming protein Ski (2);	0.246869	0.46145	D	0.000303	D	0.85936	0.5813	L	0.55990	1.75	0.43632	D	0.996026	D;D	0.65815	0.966;0.995	P;D	0.73708	0.879;0.981	D	0.83888	0.0283	10	0.62326	D	0.03	-22.4805	10.2859	0.43566	0.67:0.0:0.33:0.0	.	162;162	P12757-3;P12757	.;SKIL_HUMAN	D	162;142;162;162	ENSP00000259119:E162D;ENSP00000406520:E142D;ENSP00000400193:E162D;ENSP00000415243:E162D	ENSP00000259119:E162D	E	+	3	2	SKIL	171561299	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.571000	0.36450	0.068000	0.16574	-0.370000	0.07254	GAA		0.408	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352351.4	NM_005414		3	134	0	0	0	0.000248	0	3	134				
TNIK	23043	broad.mit.edu	37	3	170858245	170858245	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:170858245C>A	ENST00000436636.2	-	13	1619	c.1275G>T	c.(1273-1275)cgG>cgT	p.R425R	TNIK_ENST00000284483.8_Silent_p.R425R|TNIK_ENST00000488470.1_Silent_p.R425R|TNIK_ENST00000538048.1_Silent_p.R425R|TNIK_ENST00000475336.1_Silent_p.R425R|TNIK_ENST00000357327.5_Silent_p.R425R|TNIK_ENST00000341852.6_Silent_p.R425R|TNIK_ENST00000460047.1_Silent_p.R425R|TNIK_ENST00000470834.1_Silent_p.R425R|TNIK_ENST00000369326.5_Silent_p.R425R	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	425	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R425R(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			CCTCATAGTGCCGGCGCTGCT	0.652																																							uc003fhh.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|large_intestine(1)	5						c.(1273-1275)CGG>CGT		TRAF2 and NCK interacting kinase isoform 1							95.0	105.0	101.0					3																	170858245		2067	4195	6262	SO:0001819	synonymous_variant	23043				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr3:170858245C>A	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.1275G>T	3.37:g.170858245C>A						TNIK_uc003fhi.2_Silent_p.R425R|TNIK_uc003fhj.2_Silent_p.R425R|TNIK_uc003fhk.2_Silent_p.R425R|TNIK_uc003fhl.2_Silent_p.R425R|TNIK_uc003fhm.2_Silent_p.R425R|TNIK_uc003fhn.2_Silent_p.R425R|TNIK_uc003fho.2_Silent_p.R425R	p.R425R	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		13	1620	-	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		425			Mediates interaction with NEDD4.		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Silent	SNP	ENST00000436636.2	37	c.1275G>T	CCDS46956.1																																																																																				0.652	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	XM_039796		40	181	1	0	5.44703e-19	0.002222	1.14887e-18	40	181				
DVL3	1857	broad.mit.edu	37	3	183885372	183885372	+	Silent	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr3:183885372A>T	ENST00000313143.3	+	12	1451	c.1203A>T	c.(1201-1203)ctA>ctT	p.L401L	DVL3_ENST00000431765.1_Silent_p.L384L|EIF2B5_ENST00000444495.1_Intron	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	401					canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)	p.L401L(1)		breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			CCCCAGGCCTAGACGACTTCC	0.527																																							uc003fms.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(1201-1203)CTA>CTT		dishevelled 3							98.0	76.0	84.0					3																	183885372		2203	4300	6503	SO:0001819	synonymous_variant	1857				canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity	g.chr3:183885372A>T	D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.1203A>T	3.37:g.183885372A>T						DVL3_uc011bqw.1_Silent_p.L384L|DVL3_uc003fmt.2_Silent_p.L72L|DVL3_uc003fmu.2_Silent_p.L233L	p.L401L	NM_004423	NP_004414	Q92997	DVL3_HUMAN	Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)		12	1343	+	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		401					B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Silent	SNP	ENST00000313143.3	37	c.1203A>T	CCDS3253.1																																																																																				0.527	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	NM_004423		7	32	0	0	0	0.00308	0	7	32				
PDE6B	5158	broad.mit.edu	37	4	647771	647771	+	Missense_Mutation	SNP	C	C	A	rs370941664		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:647771C>A	ENST00000496514.1	+	4	863	c.842C>A	c.(841-843)aCc>aAc	p.T281N	RP11-1191J2.2_ENST00000468356.1_RNA|PDE6B_ENST00000429163.2_Missense_Mutation_p.T2N|RP11-1191J2.2_ENST00000598370.1_RNA|RP11-1191J2.2_ENST00000489312.1_RNA|RP11-1191J2.2_ENST00000599030.1_RNA|PDE6B_ENST00000255622.6_Missense_Mutation_p.T281N			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	281	GAF 2.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.T281N(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CTGGACATGACCAAGGAGAAG	0.652																																					GBM(71;463 1194 9848 25922 46834)	GBM(71;463 1194 9848 25922 46834)	uc003gap.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(841-843)ACC>AAC		phosphodiesterase 6B isoform 1							89.0	77.0	81.0					4																	647771		2203	4300	6503	SO:0001583	missense	5158				cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding	g.chr4:647771C>A	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.842C>A	4.37:g.647771C>A	ENSP00000420295:p.Thr281Asn					PDE6B_uc003gao.3_Missense_Mutation_p.T281N|PDE6B_uc011buy.1_Missense_Mutation_p.T2N|PDE6B_uc010ibg.2_Missense_Mutation_p.T2N|uc003gaq.1_Intron	p.T281N	NM_000283	NP_000274	P35913	PDE6B_HUMAN			4	895	+			281			GAF 2.		B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	c.842C>A	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	C	9.832	1.188669	0.21954	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000465426;ENST00000487902;ENST00000488061;ENST00000429163	T;T;T;T;T	0.75821	-0.1;-0.1;-0.68;-0.97;-0.5	5.26	3.43	0.39272	GAF (2);	0.156649	0.56097	D	0.000030	T	0.75774	0.3895	M	0.71920	2.185	0.50467	D	0.999879	B;B;B	0.29671	0.022;0.254;0.214	B;B;B	0.37346	0.03;0.247;0.159	T	0.76825	-0.2816	10	0.54805	T	0.06	.	13.2657	0.60133	0.0:0.6959:0.3041:0.0	.	2;281;281	B4DHV7;P35913;P35913-2	.;PDE6B_HUMAN;.	N	281;281;2;2;2;2	ENSP00000255622:T281N;ENSP00000420295:T281N;ENSP00000418454:T2N;ENSP00000418256:T2N;ENSP00000406334:T2N	ENSP00000255622:T281N	T	+	2	0	PDE6B	637771	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	3.746000	0.55127	1.221000	0.43506	-0.225000	0.12378	ACC		0.652	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283		8	61	1	0	1.06961e-07	0.00308	1.61445e-07	8	61				
UVSSA	57654	broad.mit.edu	37	4	1343559	1343559	+	Missense_Mutation	SNP	G	G	T	rs376077428		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:1343559G>T	ENST00000389851.4	+	3	793	c.346G>T	c.(346-348)Gcc>Tcc	p.A116S	UVSSA_ENST00000511216.1_Missense_Mutation_p.A116S|UVSSA_ENST00000507531.1_Missense_Mutation_p.A116S	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	116	VHS-like.				protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)	p.A116S(1)									GACCACCCGGGCCGTGGAAGG	0.632																																							uc003gde.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(346-348)GCC>TCC		hypothetical protein LOC57654							28.0	34.0	32.0					4																	1343559		2203	4300	6503	SO:0001583	missense	57654							g.chr4:1343559G>T	BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.346G>T	4.37:g.1343559G>T	ENSP00000374501:p.Ala116Ser						p.A116S	NM_020894	NP_065945	Q2YD98	K1530_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0138)		3	793	+			116					A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	ENST00000389851.4	37	c.346G>T	CCDS33938.1	.	.	.	.	.	.	.	.	.	.	G	5.766	0.325733	0.10900	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531	T;T;T	0.22336	1.96;1.96;1.96	4.89	3.94	0.45596	.	0.176334	0.50627	D	0.000115	T	0.13884	0.0336	L	0.37466	1.105	0.80722	D	1	B	0.33904	0.431	B	0.30316	0.114	T	0.05321	-1.0892	10	0.32370	T	0.25	.	7.8057	0.29200	0.0917:0.0:0.6699:0.2384	.	116	Q2YD98	K1530_HUMAN	S	116	ENSP00000425130:A116S;ENSP00000374501:A116S;ENSP00000421741:A116S	ENSP00000374501:A116S	A	+	1	0	KIAA1530	1333559	0.998000	0.40836	0.091000	0.20842	0.068000	0.16541	2.252000	0.43196	2.267000	0.75376	0.591000	0.81541	GCC		0.632	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359480.1	NM_020894		9	46	1	0	9.70103e-10	0.008291	1.58297e-09	9	46				
HAUS3	79441	broad.mit.edu	37	4	2238091	2238091	+	Missense_Mutation	SNP	T	T	C	rs150101454		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:2238091T>C	ENST00000243706.4	-	4	1671	c.1442A>G	c.(1441-1443)aAt>aGt	p.N481S	POLN_ENST00000511885.2_Intron|POLN_ENST00000515357.1_Intron|HAUS3_ENST00000506763.1_Intron|HAUS3_ENST00000443786.2_Missense_Mutation_p.N481S	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	481					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.N481S(1)		breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TAAAGAAATATTCTGTTTCAA	0.368																																							uc003ges.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|breast(2)	4						c.(1441-1443)AAT>AGT		HAUS augmin-like complex, subunit 3		T	SER/ASN	1,4405	2.1+/-5.4	0,1,2202	90.0	86.0	88.0		1442	5.7	1.0	4	dbSNP_134	88	0,8600		0,0,4300	no	missense	HAUS3	NM_024511.5	46	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign	481/604	2238091	1,13005	2203	4300	6503	SO:0001583	missense	79441				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle		g.chr4:2238091T>C	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.1442A>G	4.37:g.2238091T>C	ENSP00000243706:p.Asn481Ser					POLN_uc011bvi.1_Intron|HAUS3_uc011bvj.1_Intron|HAUS3_uc003get.1_Missense_Mutation_p.N481S	p.N481S	NM_024511	NP_078787	Q68CZ6	HAUS3_HUMAN			4	1672	-			481			Potential.		B4DF64|O43606|Q8TAZ5|Q9BTJ9	Missense_Mutation	SNP	ENST00000243706.4	37	c.1442A>G	CCDS33941.1	.	.	.	.	.	.	.	.	.	.	T	15.01	2.705336	0.48412	2.27E-4	0.0	ENSG00000214367	ENST00000243706;ENST00000443786	T;T	0.39997	1.05;1.05	5.71	5.71	0.89125	.	0.309656	0.30060	U	0.010502	T	0.27063	0.0663	N	0.08118	0	0.27953	N	0.937056	B	0.06786	0.001	B	0.06405	0.002	T	0.25950	-1.0117	10	0.72032	D	0.01	-34.1628	15.1666	0.72833	0.0:0.0:0.0:1.0	.	481	Q68CZ6	HAUS3_HUMAN	S	481	ENSP00000243706:N481S;ENSP00000392903:N481S	ENSP00000243706:N481S	N	-	2	0	HAUS3	2207889	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.116000	0.71571	2.179000	0.69175	0.528000	0.53228	AAT		0.368	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357446.1	NM_024511		22	66	0	0	0	0.00333	0	22	66				
FAM193A	8603	broad.mit.edu	37	4	2661632	2661632	+	Silent	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:2661632A>T	ENST00000324666.5	+	8	1074	c.723A>T	c.(721-723)ccA>ccT	p.P241P	FAM193A_ENST00000502458.1_Silent_p.P265P|FAM193A_ENST00000545951.1_Silent_p.P241P|FAM193A_ENST00000505311.1_Silent_p.P241P|FAM193A_ENST00000382839.3_Silent_p.P241P	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	241								p.P241P(1)		NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						ACCAGCTCCCACTTCAAGTGG	0.557																																							uc010icl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)	3						c.(721-723)CCA>CCT		hypothetical protein LOC8603							141.0	121.0	128.0					4																	2661632		2203	4300	6503	SO:0001819	synonymous_variant	8603							g.chr4:2661632A>T	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.723A>T	4.37:g.2661632A>T						FAM193A_uc010ick.2_Silent_p.P441P|FAM193A_uc003gfd.2_Silent_p.P241P|FAM193A_uc011bvm.1_Silent_p.P265P|FAM193A_uc011bvn.1_Silent_p.P241P|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Silent_p.P95P	p.P241P	NM_003704	NP_003695	P78312	F193A_HUMAN			8	1074	+			241					B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Silent	SNP	ENST00000324666.5	37	c.723A>T	CCDS58875.1																																																																																				0.557	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704		21	87	0	0	0	0.008871	0	21	87				
LRRC66	339977	broad.mit.edu	37	4	52860731	52860731	+	Silent	SNP	C	C	A	rs137931708		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:52860731C>A	ENST00000343457.3	-	4	2463	c.2457G>T	c.(2455-2457)ccG>ccT	p.P819P		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	819						integral component of membrane (GO:0016021)		p.P819P(1)		central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						TGAACATGCCCGGAAACTCAT	0.468																																							uc003gzi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2455-2457)CCG>CCT		leucine rich repeat containing 66							66.0	68.0	67.0					4																	52860731		1885	4117	6002	SO:0001819	synonymous_variant	339977					integral to membrane		g.chr4:52860731C>A	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.2457G>T	4.37:g.52860731C>A							p.P819P	NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN			4	2470	-			819						Silent	SNP	ENST00000343457.3	37	c.2457G>T	CCDS43229.1																																																																																				0.468	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611		13	71	1	0	1.61879e-10	0.001368	2.74343e-10	13	71				
YTHDC1	91746	broad.mit.edu	37	4	69195782	69195782	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:69195782C>A	ENST00000344157.4	-	9	1622	c.1287G>T	c.(1285-1287)gtG>gtT	p.V429V	YTHDC1_ENST00000579690.1_Silent_p.V429V|YTHDC1_ENST00000355665.3_Silent_p.V411V	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	429	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V429V(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						CTGCTGGAAGCACCCAGTGTA	0.353																																							uc003hdx.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(1285-1287)GTG>GTT		splicing factor YT521-B isoform 1							57.0	57.0	57.0					4																	69195782		2203	4298	6501	SO:0001819	synonymous_variant	91746							g.chr4:69195782C>A	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1287G>T	4.37:g.69195782C>A						YTHDC1_uc003hdy.2_Silent_p.V411V	p.V429V	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN			9	1640	-			429			YTH.		Q4W5Q3|Q7Z622|Q8TF35	Silent	SNP	ENST00000344157.4	37	c.1287G>T	CCDS33992.1																																																																																				0.353	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370		19	97	1	0	1.56452e-12	0.007413	2.78843e-12	19	97				
FAT4	79633	broad.mit.edu	37	4	126370833	126370833	+	Missense_Mutation	SNP	G	G	C	rs377468892		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:126370833G>C	ENST00000394329.3	+	9	8675	c.8662G>C	c.(8662-8664)Ggc>Cgc	p.G2888R	FAT4_ENST00000335110.5_Missense_Mutation_p.G1186R	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2888	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G2888R(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TACTGAGATTGGCTCCAAAGT	0.353																																							uc003ifj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(8662-8664)GGC>CGC		FAT tumor suppressor homolog 4 precursor							93.0	95.0	94.0					4																	126370833		2203	4299	6502	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126370833G>C	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.8662G>C	4.37:g.126370833G>C	ENSP00000377862:p.Gly2888Arg					FAT4_uc011cgp.1_Missense_Mutation_p.G1186R|FAT4_uc003ifi.1_Missense_Mutation_p.G366R	p.G2888R	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN			9	8662	+			2888			Cadherin 28.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.8662G>C	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939554	0.73557	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.68624	-0.34;-0.34	5.51	5.51	0.81932	Cadherin (3);Cadherin-like (1);	0.000000	0.35013	U	0.003511	D	0.86781	0.6015	M	0.92604	3.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.88861	0.3326	10	0.62326	D	0.03	.	19.7859	0.96437	0.0:0.0:1.0:0.0	.	1186;2888;2888	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	R	2888;1186	ENSP00000377862:G2888R;ENSP00000335169:G1186R	ENSP00000335169:G1186R	G	+	1	0	FAT4	126590283	1.000000	0.71417	0.972000	0.41901	0.894000	0.52154	9.611000	0.98342	2.746000	0.94184	0.655000	0.94253	GGC		0.353	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		17	124	0	0	0	0.006122	0	17	124				
PCDH18	54510	broad.mit.edu	37	4	138453002	138453002	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:138453002C>A	ENST00000344876.4	-	1	627	c.241G>T	c.(241-243)Gag>Tag	p.E81*	PCDH18_ENST00000412923.2_Nonsense_Mutation_p.E81*|PCDH18_ENST00000507846.1_Intron|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000511115.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	81	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E81*(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					CCATTATCCTCGTTTACTACA	0.428																																							uc003ihe.3		NA																	1	Substitution - Nonsense(1)		lung(1)	pancreas(3)|skin(2)	5						c.(241-243)GAG>TAG		protocadherin 18 precursor							161.0	158.0	159.0					4																	138453002		2203	4300	6503	SO:0001587	stop_gained	54510				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:138453002C>A	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.241G>T	4.37:g.138453002C>A	ENSP00000355082:p.Glu81*					PCDH18_uc003ihf.3_Nonsense_Mutation_p.E74*|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Intron|PCDH18_uc011cha.1_Intron	p.E81*	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN			1	628	-	all_hematologic(180;0.24)		81			Extracellular (Potential).|Cadherin 1.		A8K7K3|B7ZKT1|Q52LS2	Nonsense_Mutation	SNP	ENST00000344876.4	37	c.241G>T	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	C	38	6.764132	0.97821	.	.	ENSG00000189184	ENST00000344876;ENST00000412923	.	.	.	5.96	5.96	0.96718	.	0.000000	0.43579	U	0.000550	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	20.4192	0.99033	0.0:1.0:0.0:0.0	.	.	.	.	X	81	.	ENSP00000355082:E81X	E	-	1	0	PCDH18	138672452	1.000000	0.71417	0.297000	0.24988	0.010000	0.07245	7.770000	0.85390	2.831000	0.97527	0.650000	0.86243	GAG		0.428	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035		25	153	1	0	4.26978e-12	0.00333	7.52665e-12	25	153				
FGB	2244	broad.mit.edu	37	4	155490895	155490895	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:155490895C>A	ENST00000302068.4	+	7	1251	c.1188C>A	c.(1186-1188)acC>acA	p.T396T	FGB_ENST00000502545.1_Intron|FGB_ENST00000509493.1_Silent_p.T177T	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	396	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)	p.T396T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AAAACAGGACCATGACCATTC	0.458																																					NSCLC(106;1133 1613 21870 46110 52656)	NSCLC(106;1133 1613 21870 46110 52656)	uc003ioa.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(1186-1188)ACC>ACA		fibrinogen, beta chain preproprotein	Sucralfate(DB00364)						168.0	138.0	148.0					4																	155490895		2203	4300	6503	SO:0001819	synonymous_variant	2244				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155490895C>A		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.1188C>A	4.37:g.155490895C>A						FGB_uc003iob.3_Intron|FGB_uc010ipv.2_Silent_p.T334T|FGB_uc010ipw.2_Intron|FGB_uc003ioc.3_Silent_p.T177T	p.T396T	NM_005141	NP_005132	P02675	FIBB_HUMAN			7	1227	+	all_hematologic(180;0.215)	Renal(120;0.0458)	396			Fibrinogen C-terminal.		A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Silent	SNP	ENST00000302068.4	37	c.1188C>A	CCDS3786.1																																																																																				0.458	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1	NM_005141		25	91	1	0	4.7796e-09	0.004656	7.5197e-09	25	91				
LRAT	9227	broad.mit.edu	37	4	155670176	155670176	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:155670176G>T	ENST00000336356.3	+	3	834	c.581G>T	c.(580-582)aGt>aTt	p.S194I	LRAT_ENST00000507827.1_Missense_Mutation_p.S194I	NM_004744.3	NP_004735.2	O95237	LRAT_HUMAN	lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)	194					phototransduction, visible light (GO:0007603)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)	phosphatidylcholine-retinol O-acyltransferase activity (GO:0047173)|retinoic acid binding (GO:0001972)|retinol binding (GO:0019841)|transferase activity, transferring acyl groups (GO:0016746)	p.S194I(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)	16	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	GATCAGAGAAGTGTTCTTGCT	0.383																																							uc003iom.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(580-582)AGT>ATT		lecithin retinol acyltransferase	Vitamin A(DB00162)						237.0	207.0	217.0					4																	155670176		2203	4300	6503	SO:0001583	missense	9227				response to stimulus|retinoid metabolic process|steroid metabolic process|visual perception	endoplasmic reticulum membrane|integral to membrane|multivesicular body|perinuclear region of cytoplasm|rough endoplasmic reticulum	phosphatidylcholine-retinol O-acyltransferase activity	g.chr4:155670176G>T	AF071510	CCDS3789.1	4q32.1	2014-01-28			ENSG00000121207	ENSG00000121207	2.3.1.135		6685	protein-coding gene	gene with protein product		604863				9920938	Standard	XM_006714412		Approved	LCA14	uc003ion.1	O95237	OTTHUMG00000161418	ENST00000336356.3:c.581G>T	4.37:g.155670176G>T	ENSP00000337224:p.Ser194Ile					LRAT_uc003ion.1_Missense_Mutation_p.S194I	p.S194I	NM_004744	NP_004735	O95237	LRAT_HUMAN			2	908	+	all_hematologic(180;0.215)	Renal(120;0.0458)	194			Cytoplasmic (By similarity).		A8K983|Q8N716	Missense_Mutation	SNP	ENST00000336356.3	37	c.581G>T	CCDS3789.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997253	0.74818	.	.	ENSG00000121207	ENST00000507827;ENST00000336356	T;T	0.50277	0.75;0.75	5.95	5.95	0.96441	.	0.036818	0.85682	D	0.000000	T	0.66934	0.2840	M	0.73962	2.25	0.58432	D	0.999996	D	0.61080	0.989	P	0.56788	0.806	T	0.68534	-0.5383	10	0.72032	D	0.01	-38.0861	20.3812	0.98933	0.0:0.0:1.0:0.0	.	194	O95237	LRAT_HUMAN	I	194	ENSP00000426761:S194I;ENSP00000337224:S194I	ENSP00000337224:S194I	S	+	2	0	LRAT	155889626	1.000000	0.71417	0.995000	0.50966	0.999000	0.98932	5.022000	0.64078	2.821000	0.97095	0.650000	0.86243	AGT		0.383	LRAT-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365246.1	NM_004744		15	121	1	0	3.27435e-08	0.00245	5.00479e-08	15	121				
FSTL5	56884	broad.mit.edu	37	4	162380417	162380417	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:162380417G>A	ENST00000306100.5	-	14	2099	c.1663C>T	c.(1663-1665)Cag>Tag	p.Q555*	FSTL5_ENST00000379164.4_Nonsense_Mutation_p.Q554*|FSTL5_ENST00000427802.2_Nonsense_Mutation_p.Q545*|FSTL5_ENST00000536695.1_Nonsense_Mutation_p.Q554*	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	555						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.Q555*(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		ACCCAGACCTGATCATGTGAT	0.358																																							uc003iqh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8						c.(1663-1665)CAG>TAG		follistatin-like 5 isoform a							132.0	122.0	125.0					4																	162380417		2203	4300	6503	SO:0001587	stop_gained	56884					extracellular region	calcium ion binding	g.chr4:162380417G>A	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1663C>T	4.37:g.162380417G>A	ENSP00000305334:p.Gln555*					FSTL5_uc003iqi.2_Nonsense_Mutation_p.Q554*|FSTL5_uc010iqv.2_Nonsense_Mutation_p.Q545*	p.Q555*	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN		COAD - Colon adenocarcinoma(41;0.179)	14	2099	-	all_hematologic(180;0.24)		555					E9PCP6|Q9NSW7|Q9ULF7	Nonsense_Mutation	SNP	ENST00000306100.5	37	c.1663C>T	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	g	42	9.546435	0.99201	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	.	.	.	5.36	5.36	0.76844	.	0.052139	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.4765	0.90795	0.0:0.0:1.0:0.0	.	.	.	.	X	555;554;545;554	.	ENSP00000305334:Q555X	Q	-	1	0	FSTL5	162599867	1.000000	0.71417	0.990000	0.47175	0.934000	0.57294	9.139000	0.94554	2.669000	0.90835	0.645000	0.84053	CAG		0.358	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		13	70	0	0	0	0.00245	0	13	70				
CEP44	80817	broad.mit.edu	37	4	175237375	175237375	+	Silent	SNP	A	A	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:175237375A>C	ENST00000503780.1	+	10	1434	c.1020A>C	c.(1018-1020)acA>acC	p.T340T	CEP44_ENST00000457424.2_Silent_p.T340T|CEP44_ENST00000296519.4_Silent_p.T340T|CEP44_ENST00000426172.1_Silent_p.T340T	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	340						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)		p.T340T(1)		endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						GCTATAGTACAGCATCATCAG	0.373																																							uc003itr.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1018-1020)ACA>ACC		HBV PreS1-transactivated protein 3 isoform a							129.0	139.0	135.0					4																	175237375		2203	4300	6503	SO:0001819	synonymous_variant	80817					centrosome|midbody|spindle pole		g.chr4:175237375A>C	AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.1020A>C	4.37:g.175237375A>C						KIAA1712_uc010iro.2_Silent_p.T340T|KIAA1712_uc003its.2_RNA	p.T340T	NM_001040157	NP_001035247	Q9C0F1	CEP44_HUMAN		all cancers(43;4.06e-18)|Epithelial(43;1.18e-15)|OV - Ovarian serous cystadenocarcinoma(60;4.65e-09)|GBM - Glioblastoma multiforme(59;0.00098)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0949)	10	1434	+		Prostate(90;0.00276)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)	340					A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Silent	SNP	ENST00000503780.1	37	c.1020A>C	CCDS34106.1																																																																																				0.373	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362109.2	NM_030633		29	150	0	0	0	0.002096	0	29	150				
ASB5	140458	broad.mit.edu	37	4	177142368	177142368	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:177142368G>A	ENST00000296525.3	-	5	721	c.608C>T	c.(607-609)aCt>aTt	p.T203I	ASB5_ENST00000512254.1_Missense_Mutation_p.T150I|ASB5_ENST00000511879.1_5'Flank	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	203					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.T203I(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		ATAGAGAGGAGTTCCCAAATG	0.408																																							uc003iuq.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(607-609)ACT>ATT		ankyrin repeat and SOCS box-containing protein							108.0	100.0	103.0					4																	177142368		2203	4300	6503	SO:0001583	missense	140458				intracellular signal transduction			g.chr4:177142368G>A	AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.608C>T	4.37:g.177142368G>A	ENSP00000296525:p.Thr203Ile					ASB5_uc003iup.1_Missense_Mutation_p.T150I	p.T203I	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)	5	624	-		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	203			ANK 5.		Q8N7B5	Missense_Mutation	SNP	ENST00000296525.3	37	c.608C>T	CCDS3827.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810564	0.50421	.	.	ENSG00000164122	ENST00000296525;ENST00000512254	T;T	0.75050	-0.06;-0.9	5.91	5.07	0.68467	Ankyrin repeat-containing domain (4);	0.047074	0.85682	D	0.000000	D	0.86104	0.5853	M	0.88105	2.93	0.80722	D	1	P;P	0.51791	0.876;0.948	P;P	0.57468	0.639;0.821	D	0.88819	0.3297	10	0.72032	D	0.01	-19.4855	15.118	0.72419	0.0677:0.0:0.9323:0.0	.	203;150	Q8WWX0;Q8N7B5	ASB5_HUMAN;.	I	203;150	ENSP00000296525:T203I;ENSP00000422877:T150I	ENSP00000296525:T203I	T	-	2	0	ASB5	177379362	1.000000	0.71417	0.949000	0.38748	0.001000	0.01503	7.031000	0.76491	1.512000	0.48834	-0.140000	0.14226	ACT		0.408	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362344.1			20	65	0	0	0	0.008871	0	20	65				
TRIML2	205860	broad.mit.edu	37	4	189012705	189012705	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr4:189012705C>G	ENST00000512729.1	-	7	1360	c.986G>C	c.(985-987)gGg>gCg	p.G329A	TRIML2_ENST00000326754.3_Missense_Mutation_p.G354A	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	329	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)	p.G329A(1)		central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TGATATCTGCCCGTGTTCGCA	0.507																																							uc003izl.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)	2						c.(985-987)GGG>GCG		tripartite motif family-like 2							151.0	164.0	160.0					4																	189012705		2203	4300	6503	SO:0001583	missense	205860						ligase activity	g.chr4:189012705C>G	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.986G>C	4.37:g.189012705C>G	ENSP00000422581:p.Gly329Ala					TRIML2_uc003izj.1_Missense_Mutation_p.G157A|TRIML2_uc003izk.1_Missense_Mutation_p.G137A|TRIML2_uc011cle.1_Missense_Mutation_p.G404A	p.G329A	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)	7	1022	-		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)	329			B30.2/SPRY.		B7Z6J6	Missense_Mutation	SNP	ENST00000512729.1	37	c.986G>C	CCDS3850.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414760	0.42817	.	.	ENSG00000179046	ENST00000512729;ENST00000326754	T;T	0.71579	-0.58;-0.58	5.85	4.11	0.48088	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.52532	D	0.000077	D	0.86079	0.5847	M	0.93420	3.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.969	D	0.88191	0.2877	10	0.66056	D	0.02	.	10.2809	0.43539	0.0:0.8412:0.0:0.1588	.	354;329	B7ZLC3;Q8N7C3	.;TRIMM_HUMAN	A	329;354	ENSP00000422581:G329A;ENSP00000317498:G354A	ENSP00000317498:G354A	G	-	2	0	TRIML2	189249699	0.995000	0.38212	0.150000	0.22450	0.167000	0.22549	3.948000	0.56660	1.634000	0.50500	0.655000	0.94253	GGG		0.507	TRIML2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359733.1	NM_173553		38	176	0	0	0	0.006999	0	38	176				
DNAH5	1767	broad.mit.edu	37	5	13864666	13864666	+	Missense_Mutation	SNP	C	C	A	rs369935072		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:13864666C>A	ENST00000265104.4	-	28	4540	c.4436G>T	c.(4435-4437)tGt>tTt	p.C1479F	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1479	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.C1479F(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CAGCGGGCAACACTCGCTGAA	0.527									Kartagener syndrome				C|||	1	0.000199681	0.0008	0.0	5008	,	,		18121	0.0		0.0	False		,,,				2504	0.0						uc003jfd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(4435-4437)TGT>TTT		dynein, axonemal, heavy chain 5		C	PHE/CYS	1,4405	2.1+/-5.4	0,1,2202	57.0	56.0	56.0		4436	5.3	1.0	5		56	0,8600		0,0,4300	no	missense	DNAH5	NM_001369.2	205	0,1,6502	AA,AC,CC		0.0,0.0227,0.0077	benign	1479/4625	13864666	1,13005	2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13864666C>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4436G>T	5.37:g.13864666C>A	ENSP00000265104:p.Cys1479Phe						p.C1479F	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN			28	4478	-	Lung NSC(4;0.00476)		1479			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.4436G>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	19.41	3.821523	0.71028	2.27E-4	0.0	ENSG00000039139	ENST00000265104	T	0.60548	0.18	5.32	5.32	0.75619	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	T	0.63640	0.2528	L	0.46741	1.465	0.80722	D	1	B	0.33919	0.432	P	0.44422	0.449	T	0.65647	-0.6117	10	0.66056	D	0.02	.	19.0581	0.93074	0.0:1.0:0.0:0.0	.	1479	Q8TE73	DYH5_HUMAN	F	1479	ENSP00000265104:C1479F	ENSP00000265104:C1479F	C	-	2	0	DNAH5	13917666	1.000000	0.71417	0.978000	0.43139	0.962000	0.63368	4.791000	0.62460	2.488000	0.83962	0.632000	0.83419	TGT		0.527	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		28	60	1	0	1.77063e-15	0.005443	3.3803e-15	28	60				
MYO10	4651	broad.mit.edu	37	5	16672820	16672820	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:16672820C>A	ENST00000513610.1	-	37	5741	c.5287G>T	c.(5287-5289)Gat>Tat	p.D1763Y	MYO10_ENST00000515803.1_Missense_Mutation_p.D1102Y|MYO10_ENST00000274203.9_Missense_Mutation_p.D1120Y|MYO10_ENST00000505695.1_Missense_Mutation_p.D1102Y|MYO10_ENST00000427430.2_Missense_Mutation_p.D1120Y	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1763	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.D1763Y(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						GCTAAGACATCAGCTACGACG	0.478																																							uc003jft.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(5287-5289)GAT>TAT		myosin X							150.0	147.0	148.0					5																	16672820		1998	4164	6162	SO:0001583	missense	4651				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity	g.chr5:16672820C>A	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.5287G>T	5.37:g.16672820C>A	ENSP00000421280:p.Asp1763Tyr					MYO10_uc011cnb.1_Missense_Mutation_p.D392Y|MYO10_uc011cnc.1_Missense_Mutation_p.D642Y|MYO10_uc011cnd.1_Missense_Mutation_p.D1120Y|MYO10_uc011cne.1_Missense_Mutation_p.D1120Y|MYO10_uc010itx.2_Missense_Mutation_p.D1385Y	p.D1763Y	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN			37	5755	-			1763			FERM.		A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	37	c.5287G>T	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.763657	0.69878	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	D;D;D;D;D	0.98164	-4.24;-4.76;-4.68;-4.76;-4.68	5.54	5.54	0.83059	Band 4.1 domain (1);FERM domain (1);	.	.	.	.	D	0.99102	0.9691	M	0.86953	2.85	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.99709	1.1006	9	0.87932	D	0	.	19.4819	0.95013	0.0:1.0:0.0:0.0	.	642;1403;1763	B4DIJ5;Q69YP8;Q9HD67	.;.;MYO10_HUMAN	Y	1763;1102;1120;1102;1120	ENSP00000421280:D1763Y;ENSP00000425051:D1102Y;ENSP00000274203:D1120Y;ENSP00000421170:D1102Y;ENSP00000391106:D1120Y	ENSP00000274203:D1120Y	D	-	1	0	MYO10	16725820	1.000000	0.71417	0.134000	0.22075	0.381000	0.30169	7.818000	0.86416	2.595000	0.87683	0.655000	0.94253	GAT		0.478	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334		21	63	1	0	1.2644e-06	0.001523	1.78049e-06	21	63				
MYO10	4651	broad.mit.edu	37	5	16701144	16701144	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:16701144G>C	ENST00000513610.1	-	25	3814	c.3360C>G	c.(3358-3360)gaC>gaG	p.D1120E	MYO10_ENST00000515803.1_Missense_Mutation_p.D459E|MYO10_ENST00000274203.9_Missense_Mutation_p.D477E|MYO10_ENST00000505695.1_Missense_Mutation_p.D459E|MYO10_ENST00000427430.2_Missense_Mutation_p.D477E|MYO10_ENST00000512061.1_5'Flank	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1120					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.D1120E(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						AGCAGCGGTAGTCGGGGGACC	0.627																																							uc003jft.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(3358-3360)GAC>GAG		myosin X							13.0	15.0	15.0					5																	16701144		2138	4226	6364	SO:0001583	missense	4651				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity	g.chr5:16701144G>C	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.3360C>G	5.37:g.16701144G>C	ENSP00000421280:p.Asp1120Glu					MYO10_uc011cnc.1_5'Flank|MYO10_uc011cnd.1_Missense_Mutation_p.D477E|MYO10_uc011cne.1_Missense_Mutation_p.D477E|MYO10_uc010itx.2_Missense_Mutation_p.D743E	p.D1120E	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN			25	3828	-			1120					A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	37	c.3360C>G	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537058	0.27475	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	D;D;D;D;D	0.87103	-2.13;-2.21;-2.13;-2.21;-2.13	4.84	2.07	0.26955	.	.	.	.	.	T	0.65154	0.2664	N	0.03050	-0.425	0.44985	D	0.998006	B;B	0.18610	0.006;0.029	B;B	0.15052	0.007;0.012	T	0.53718	-0.8399	9	0.07644	T	0.81	.	7.8479	0.29437	0.3218:0.0:0.6782:0.0	.	761;1120	Q69YP8;Q9HD67	.;MYO10_HUMAN	E	1120;459;477;459;477	ENSP00000421280:D1120E;ENSP00000425051:D459E;ENSP00000274203:D477E;ENSP00000421170:D459E;ENSP00000391106:D477E	ENSP00000274203:D477E	D	-	3	2	MYO10	16754144	1.000000	0.71417	0.995000	0.50966	0.839000	0.47603	1.016000	0.29976	0.463000	0.27118	0.462000	0.41574	GAC		0.627	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334		4	6	0	0	0	0.000248	0	4	6				
CDH18	1016	broad.mit.edu	37	5	19520859	19520859	+	Silent	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:19520859T>A	ENST00000507958.1	-	12	2409	c.1419A>T	c.(1417-1419)acA>acT	p.T473T	CDH18_ENST00000382275.1_Silent_p.T473T|CDH18_ENST00000511273.1_Silent_p.T473T|CDH18_ENST00000502796.1_Silent_p.T473T|CDH18_ENST00000274170.4_Silent_p.T473T|CDH18_ENST00000506372.1_Silent_p.T473T			Q13634	CAD18_HUMAN	cadherin 18, type 2	473	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T473T(2)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TAATACCCACTGTGACATGGC	0.388																																							uc003jgc.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|large_intestine(1)|skin(1)	7						c.(1417-1419)ACA>ACT		cadherin 18, type 2 preproprotein							154.0	152.0	152.0					5																	19520859		2203	4300	6503	SO:0001819	synonymous_variant	1016				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:19520859T>A	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1419A>T	5.37:g.19520859T>A						CDH18_uc003jgd.2_Silent_p.T473T|CDH18_uc011cnm.1_Silent_p.T473T	p.T473T	NM_004934	NP_004925	Q13634	CAD18_HUMAN			9	1796	-	Lung NSC(1;0.00734)|all_lung(1;0.0197)		473			Extracellular (Potential).|Cadherin 4.		A8K0I2|B4DHG6|Q8N5Z2	Silent	SNP	ENST00000507958.1	37	c.1419A>T	CCDS3889.1																																																																																				0.388	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		48	93	0	0	0	0.00361	0	48	93				
SLC1A3	6507	broad.mit.edu	37	5	36608599	36608599	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:36608599G>A	ENST00000265113.4	+	2	550	c.74G>A	c.(73-75)cGc>cAc	p.R25H	SLC1A3_ENST00000381918.3_Missense_Mutation_p.R25H|SLC1A3_ENST00000506725.1_3'UTR	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	25					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.R25H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GTCCGTAAACGCACACTTTTG	0.463																																							uc003jkj.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(73-75)CGC>CAC		solute carrier family 1 (glial high affinity	L-Glutamic Acid(DB00142)						163.0	158.0	160.0					5																	36608599		2203	4300	6503	SO:0001583	missense	6507				D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity	g.chr5:36608599G>A		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.74G>A	5.37:g.36608599G>A	ENSP00000265113:p.Arg25His					SLC1A3_uc011cox.1_5'UTR|SLC1A3_uc010iuy.2_Missense_Mutation_p.R25H	p.R25H	NM_004172	NP_004163	P43003	EAA1_HUMAN	Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		2	550	+	all_lung(31;0.000245)		25			Cytoplasmic (Potential).		B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	37	c.74G>A	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387793	0.82902	.	.	ENSG00000079215	ENST00000265113;ENST00000513903;ENST00000427100;ENST00000416645;ENST00000505202;ENST00000513646;ENST00000381918	T;T;T;T;T	0.59906	0.24;1.63;1.65;1.65;0.23	5.69	5.69	0.88448	.	0.099675	0.64402	D	0.000003	T	0.52256	0.1723	N	0.19112	0.55	0.80722	D	1	D;B	0.60160	0.987;0.221	P;B	0.48488	0.579;0.055	T	0.48055	-0.9068	10	0.28530	T	0.3	-10.0692	19.812	0.96551	0.0:0.0:1.0:0.0	.	25;25	Q4JCQ8;P43003	.;EAA1_HUMAN	H	25	ENSP00000265113:R25H;ENSP00000427203:R25H;ENSP00000424986:R25H;ENSP00000420992:R25H;ENSP00000371343:R25H	ENSP00000265113:R25H	R	+	2	0	SLC1A3	36644356	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.790000	0.91844	2.685000	0.91497	0.655000	0.94253	CGC		0.463	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172		11	939	0	0	0	0.001855	0	11	939				
WDR70	55100	broad.mit.edu	37	5	37703125	37703125	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:37703125G>A	ENST00000265107.4	+	13	1508	c.1352G>A	c.(1351-1353)gGc>gAc	p.G451D	RNU6-484P_ENST00000384016.1_RNA	NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	451							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGTGGCAGCGGCAAACTTGTT	0.413																																							uc003jkv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1351-1353)GGC>GAC		WD repeat domain 70							119.0	109.0	112.0					5																	37703125		2203	4300	6503	SO:0001583	missense	55100							g.chr5:37703125G>A	BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.1352G>A	5.37:g.37703125G>A	ENSP00000265107:p.Gly451Asp						p.G451D	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		13	1410	+	all_lung(31;0.000285)		451			WD 6.		Q9H053	Missense_Mutation	SNP	ENST00000265107.4	37	c.1352G>A	CCDS34147.1	.	.	.	.	.	.	.	.	.	.	G	33	5.254750	0.95336	.	.	ENSG00000082068	ENST00000265107	T	0.02369	4.32	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.19604	0.0471	M	0.89414	3.03	0.80722	D	1	D	0.76494	0.999	D	0.64595	0.927	T	0.00351	-1.1796	10	0.59425	D	0.04	-20.8732	19.6155	0.95632	0.0:0.0:1.0:0.0	.	451	Q9NW82	WDR70_HUMAN	D	451	ENSP00000265107:G451D	ENSP00000265107:G451D	G	+	2	0	WDR70	37738882	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	8.891000	0.92485	2.801000	0.96364	0.650000	0.86243	GGC		0.413	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368294.1	NM_018034		8	806	0	0	0	0.00308	0	8	806				
PARP8	79668	broad.mit.edu	37	5	50124151	50124151	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:50124151C>T	ENST00000281631.5	+	21	2254	c.2096C>T	c.(2095-2097)tCa>tTa	p.S699L	PARP8_ENST00000514067.2_Missense_Mutation_p.S657L|PARP8_ENST00000503750.2_Missense_Mutation_p.S657L|PARP8_ENST00000505697.2_Missense_Mutation_p.S699L|PARP8_ENST00000505554.1_Missense_Mutation_p.S678L|PARP8_ENST00000514342.2_Missense_Mutation_p.S410L|PARP8_ENST00000511363.2_3'UTR	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	699	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.S699L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				TTTAGTGGCTCACACATTGAA	0.378																																							uc003jon.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|large_intestine(1)|ovary(1)	5						c.(2095-2097)TCA>TTA		poly (ADP-ribose) polymerase family, member 8							203.0	198.0	199.0					5																	50124151		2203	4300	6503	SO:0001583	missense	79668					intracellular	NAD+ ADP-ribosyltransferase activity	g.chr5:50124151C>T	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.2096C>T	5.37:g.50124151C>T	ENSP00000281631:p.Ser699Leu					PARP8_uc011cpz.1_Missense_Mutation_p.S591L|PARP8_uc003joo.2_Missense_Mutation_p.S699L|PARP8_uc003jop.2_Missense_Mutation_p.S657L	p.S699L	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN			22	2278	+		Lung NSC(810;0.0305)|Breast(144;0.222)	699			PARP catalytic.		Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	ENST00000281631.5	37	c.2096C>T	CCDS3954.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.239821	0.79912	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000514342;ENST00000281631;ENST00000514067;ENST00000505554;ENST00000503561;ENST00000423185	T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78	5.77	5.77	0.91146	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.111808	0.47093	D	0.000241	T	0.60792	0.2296	M	0.90145	3.09	0.80722	D	1	B;D;B	0.57899	0.005;0.981;0.005	B;D;B	0.69142	0.016;0.962;0.016	T	0.66089	-0.6010	9	.	.	.	-11.9201	19.9981	0.97395	0.0:1.0:0.0:0.0	.	591;657;699	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	L	699;657;410;699;657;678;410;410	ENSP00000422217:S699L;ENSP00000440851:S657L;ENSP00000439022:S410L;ENSP00000281631:S699L;ENSP00000424814:S657L;ENSP00000423946:S678L	.	S	+	2	0	PARP8	50159908	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.807000	0.86032	2.729000	0.93468	0.655000	0.94253	TCA		0.378	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615		10	107	0	0	0	0.006214	0	10	107				
CCDC112	153733	broad.mit.edu	37	5	114607173	114607173	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:114607173C>A	ENST00000512261.1	-	8	1236	c.820G>T	c.(820-822)Gca>Tca	p.A274S	CCDC112_ENST00000506442.1_Missense_Mutation_p.A274S|CCDC112_ENST00000379611.5_Missense_Mutation_p.A357S|CCDC112_ENST00000395557.4_Missense_Mutation_p.A274S			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	274								p.A357S(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		GCTTCAACTGCCAAtttctgt	0.333																																							uc003kqy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(820-822)GCA>TCA		coiled-coil domain containing 112 isoform 2							177.0	166.0	170.0					5																	114607173		2201	4300	6501	SO:0001583	missense	153733							g.chr5:114607173C>A	BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.820G>T	5.37:g.114607173C>A	ENSP00000423712:p.Ala274Ser					CCDC112_uc003kqz.2_Missense_Mutation_p.A357S|CCDC112_uc003kra.2_Missense_Mutation_p.A357S	p.A274S	NM_152549	NP_689762	Q8NEF3	CC112_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)	7	1333	-		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)	274			Potential.		Q6A334	Missense_Mutation	SNP	ENST00000512261.1	37	c.820G>T	CCDS4117.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346240	0.82022	.	.	ENSG00000164221	ENST00000379611;ENST00000512261;ENST00000506442;ENST00000395557	T;T;T;T	0.21734	1.99;2.14;2.23;2.14	6.03	6.03	0.97812	.	0.269175	0.41605	D	0.000843	T	0.40423	0.1116	L	0.56769	1.78	0.33374	D	0.573917	D;D;D	0.65815	0.995;0.995;0.99	D;D;P	0.63957	0.92;0.92;0.819	T	0.27739	-1.0065	10	0.10111	T	0.7	-16.2036	20.1519	0.98089	0.0:1.0:0.0:0.0	.	274;357;274	D6RF76;Q8NEF3-2;Q8NEF3	.;.;CC112_HUMAN	S	357;274;274;274	ENSP00000368931:A357S;ENSP00000423712:A274S;ENSP00000424876:A274S;ENSP00000378925:A274S	ENSP00000368931:A357S	A	-	1	0	CCDC112	114635072	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	3.744000	0.55112	2.861000	0.98227	0.655000	0.94253	GCA		0.333	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370999.1	NM_152549		15	87	1	0	1.49906e-05	0.00245	2.01124e-05	15	87				
FBN2	2201	broad.mit.edu	37	5	127666379	127666379	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:127666379C>G	ENST00000508053.1	-	39	5205	c.4231G>C	c.(4231-4233)Gaa>Caa	p.E1411Q	FBN2_ENST00000507835.1_Missense_Mutation_p.E261Q|FBN2_ENST00000262464.4_Missense_Mutation_p.E1411Q|FBN2_ENST00000508989.1_Missense_Mutation_p.E1378Q			P35556	FBN2_HUMAN	fibrillin 2	1411	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.E1411Q(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TTAGAACATTCGTCCAGATCT	0.428																																							uc003kuu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(4231-4233)GAA>CAA		fibrillin 2 precursor							107.0	101.0	103.0					5																	127666379		2203	4300	6503	SO:0001583	missense	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127666379C>G	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4231G>C	5.37:g.127666379C>G	ENSP00000424571:p.Glu1411Gln					FBN2_uc003kuv.2_Missense_Mutation_p.E1378Q	p.E1411Q	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	33	4670	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	1411			EGF-like 23; calcium-binding.		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	c.4231G>C	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.000286	0.93227	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.98862	-5.19;-5.19;-5.19;-5.19	5.14	5.14	0.70334	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000008	D	0.99510	0.9825	H	0.97291	3.975	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.997	D	0.98096	1.0412	10	0.87932	D	0	.	19.1483	0.93477	0.0:1.0:0.0:0.0	.	1378;1411	D6RJI3;P35556	.;FBN2_HUMAN	Q	1411;1411;261;1378	ENSP00000262464:E1411Q;ENSP00000424571:E1411Q;ENSP00000426839:E261Q;ENSP00000425596:E1378Q	ENSP00000262464:E1411Q	E	-	1	0	FBN2	127694278	1.000000	0.71417	0.947000	0.38551	0.977000	0.68977	7.585000	0.82584	2.835000	0.97688	0.591000	0.81541	GAA		0.428	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		7	30	0	0	0	0.001984	0	7	30				
C5orf24	134553	broad.mit.edu	37	5	134190862	134190862	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:134190862G>T	ENST00000394976.3	+	2	500	c.272G>T	c.(271-273)gGc>gTc	p.G91V	C5orf24_ENST00000504727.1_Missense_Mutation_p.G91V|C5orf24_ENST00000435259.2_Missense_Mutation_p.G91V|C5orf24_ENST00000338051.4_Missense_Mutation_p.G91V	NM_001135586.1	NP_001129058.1	Q7Z6I8	CE024_HUMAN	chromosome 5 open reading frame 24	91								p.G91V(1)		breast(2)|endometrium(2)|lung(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGTAAGCGTGGCCGGCCTTCG	0.478																																							uc003kzx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(271-273)GGC>GTC		hypothetical protein LOC134553							72.0	81.0	78.0					5																	134190862		2203	4300	6503	SO:0001583	missense	134553							g.chr5:134190862G>T	BC053677	CCDS4179.1, CCDS75307.1	5q31.1	2008-02-05			ENSG00000181904	ENSG00000181904			26746	protein-coding gene	gene with protein product						12477932	Standard	NM_152409		Approved	FLJ37562	uc003kzz.3	Q7Z6I8	OTTHUMG00000129121	ENST00000394976.3:c.272G>T	5.37:g.134190862G>T	ENSP00000378427:p.Gly91Val					C5orf24_uc003kzy.3_Missense_Mutation_p.G91V|C5orf24_uc003kzz.2_Missense_Mutation_p.G91V	p.G91V	NM_152409	NP_689622	Q7Z6I8	CE024_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		2	333	+			91					D3DQA7|Q86Y53|Q8N1T9	Missense_Mutation	SNP	ENST00000394976.3	37	c.272G>T	CCDS4179.1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880907	0.72294	.	.	ENSG00000181904	ENST00000338051;ENST00000394976;ENST00000504727;ENST00000435259	.	.	.	5.98	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.65365	0.2684	L	0.34521	1.04	0.80722	D	1	D;D	0.71674	0.989;0.998	P;D	0.64776	0.884;0.929	T	0.69499	-0.5129	9	0.87932	D	0	-5.7197	15.219	0.73296	0.0673:0.0:0.9327:0.0	.	91;91	Q7Z6I8-2;Q7Z6I8	.;CE024_HUMAN	V	91	.	ENSP00000337044:G91V	G	+	2	0	C5orf24	134218761	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	1.538000	0.49270	0.655000	0.94253	GGC		0.478	C5orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251167.1	NM_152409		17	80	1	0	8.28177e-16	0.007413	1.60646e-15	17	80				
PCDHB7	56129	broad.mit.edu	37	5	140553068	140553068	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:140553068G>T	ENST00000231137.3	+	1	826	c.652G>T	c.(652-654)Ggc>Tgc	p.G218C		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	218	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G218S(1)|p.G218C(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTAGACGGCGGCTCTCCTCC	0.537																																							uc003lit.2		NA																	2	Substitution - Missense(2)		upper_aerodigestive_tract(1)|lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(652-654)GGC>TGC		protocadherin beta 7 precursor							64.0	64.0	64.0					5																	140553068		2203	4300	6503	SO:0001583	missense	56129				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140553068G>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.652G>T	5.37:g.140553068G>T	ENSP00000231137:p.Gly218Cys						p.G218C	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	826	+			218			Extracellular (Potential).|Cadherin 2.		A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	c.652G>T	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657757	0.47467	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.01804	4.63	4.61	4.61	0.57282	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.26955	0.0660	H	0.99890	4.9	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	T	0.63111	-0.6710	9	0.87932	D	0	.	17.4139	0.87494	0.0:0.0:1.0:0.0	.	218	Q9Y5E2	PCDB7_HUMAN	C	218;1	ENSP00000231137:G218C	ENSP00000231137:G218C	G	+	1	0	PCDHB7	140533252	1.000000	0.71417	0.988000	0.46212	0.034000	0.12701	9.787000	0.99055	2.248000	0.74166	0.655000	0.94253	GGC		0.537	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940		11	58	1	0	2.27111e-07	0.001368	3.35458e-07	11	58				
PCDHGA5	56110	broad.mit.edu	37	5	140744069	140744069	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:140744069G>T	ENST00000518069.1	+	1	172	c.172G>T	c.(172-174)Gag>Tag	p.E58*	PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	58	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E58*(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCCCCAGGAGCTGGCGGA	0.647																																							uc003lju.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)	4						c.(172-174)GAG>TAG		protocadherin gamma subfamily A, 5 isoform 1							46.0	56.0	52.0					5																	140744069		2202	4299	6501	SO:0001587	stop_gained	56110				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140744069G>T	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.172G>T	5.37:g.140744069G>T	ENSP00000429834:p.Glu58*					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Nonsense_Mutation_p.E58*	p.E58*	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	172	+			58			Cadherin 1.|Extracellular (Potential).		Q2M3F5|Q9Y5D2	Nonsense_Mutation	SNP	ENST00000518069.1	37	c.172G>T	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	14.25	2.478101	0.44044	.	.	ENSG00000253485	ENST00000518069	.	.	.	5.38	3.55	0.40652	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	10.8005	0.46485	0.0746:0.3037:0.6217:0.0	.	.	.	.	X	58	.	ENSP00000429834:E58X	E	+	1	0	PCDHGA5	140724253	0.000000	0.05858	0.926000	0.36857	0.277000	0.26821	0.406000	0.21032	1.404000	0.46819	0.558000	0.71614	GAG		0.647	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918		9	99	1	0	0.000978159	0.000978	0.00120216	9	99				
IL17B	27190	broad.mit.edu	37	5	148753957	148753957	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:148753957G>T	ENST00000261796.3	-	3	568	c.518C>A	c.(517-519)gCt>gAt	p.A173D	IL17B_ENST00000505432.1_5'UTR|RP11-394O4.3_ENST00000521756.1_RNA	NM_014443.2	NP_055258.1	Q9UHF5	IL17B_HUMAN	interleukin 17B	173					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)	p.A173D(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|urinary_tract(1)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCCCACAGCGATGGTCTC	0.657																																							uc003lqo.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(517-519)GCT>GAT		interleukin 17B precursor							25.0	27.0	27.0					5																	148753957		2202	4296	6498	SO:0001583	missense	27190				cell-cell signaling|immune response|inflammatory response	extracellular space	cytokine activity|signal transducer activity	g.chr5:148753957G>T	AF184969	CCDS4297.1	5q33.1	2011-07-14			ENSG00000127743	ENSG00000127743		"""Interleukins and interleukin receptors"""	5982	protein-coding gene	gene with protein product	"""neuronal interleukin-17-related factor"""	604627				10639155	Standard	NM_014443		Approved	IL-17B, ZCYTO7, IL-20, MGC138900, MGC138901, NIRF	uc003lqo.3	Q9UHF5	OTTHUMG00000130051	ENST00000261796.3:c.518C>A	5.37:g.148753957G>T	ENSP00000261796:p.Ala173Asp						p.A173D	NM_014443	NP_055258	Q9UHF5	IL17B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		3	568	-			173					Q14CE5	Missense_Mutation	SNP	ENST00000261796.3	37	c.518C>A	CCDS4297.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.430813	0.83776	.	.	ENSG00000127743	ENST00000261796	T	0.57107	0.42	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000002	T	0.74504	0.3725	M	0.76838	2.35	0.53005	D	0.99996	D	0.89917	1.0	D	0.91635	0.999	T	0.77498	-0.2565	10	0.62326	D	0.03	-13.5702	18.7722	0.91896	0.0:0.0:1.0:0.0	.	173	Q9UHF5	IL17B_HUMAN	D	173	ENSP00000261796:A173D	ENSP00000261796:A173D	A	-	2	0	IL17B	148734150	1.000000	0.71417	0.925000	0.36789	0.809000	0.45718	7.459000	0.80802	2.423000	0.82170	0.561000	0.74099	GCT		0.657	IL17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252330.1	NM_014443		11	36	1	0	1.36491e-13	0.001855	2.54537e-13	11	36				
ARSI	340075	broad.mit.edu	37	5	149676935	149676935	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:149676935C>A	ENST00000328668.7	-	2	2131	c.1552G>T	c.(1552-1554)Ggt>Tgt	p.G518C		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	518					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.G518C(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCCAAGCACCCCCATTAAAG	0.607																																							uc003lrv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1552-1554)GGT>TGT		arylsulfatase family, member I precursor							79.0	94.0	89.0					5																	149676935		2203	4300	6503	SO:0001583	missense	340075					endoplasmic reticulum|extracellular region	arylsulfatase activity|metal ion binding	g.chr5:149676935C>A	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1552G>T	5.37:g.149676935C>A	ENSP00000333395:p.Gly518Cys						p.G518C	NM_001012301	NP_001012301	Q5FYB1	ARSI_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		2	2141	-			518					A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	37	c.1552G>T	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859141	0.71834	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.96232	-3.95;-3.95	4.56	4.56	0.56223	Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98242	0.9418	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98753	1.0721	10	0.52906	T	0.07	.	17.5297	0.87810	0.0:1.0:0.0:0.0	.	518	Q5FYB1	ARSI_HUMAN	C	518;375	ENSP00000333395:G518C;ENSP00000426879:G375C	ENSP00000333395:G518C	G	-	1	0	ARSI	149657128	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.313000	0.78978	2.356000	0.79943	0.643000	0.83706	GGT		0.607	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301		17	120	1	0	3.32936e-07	0.006122	4.87297e-07	17	120				
SIMC1	375484	broad.mit.edu	37	5	175716950	175716950	+	Silent	SNP	A	A	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:175716950A>G	ENST00000443967.1	+	4	773	c.366A>G	c.(364-366)gtA>gtG	p.V122V	SIMC1_ENST00000503595.1_3'UTR|SIMC1_ENST00000430704.2_Intron|SIMC1_ENST00000341199.6_Intron|SIMC1_ENST00000429602.2_Silent_p.V141V			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	122							SUMO polymer binding (GO:0032184)	p.V122V(1)									ACACCTTTGTAGGTCCCCCAC	0.493																																							uc003mds.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(364-366)GTA>GTG		RecName: Full=Uncharacterized protein C5orf25;							59.0	58.0	59.0					5																	175716950		2203	4297	6500	SO:0001819	synonymous_variant	375484							g.chr5:175716950A>G	BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.366A>G	5.37:g.175716950A>G						C5orf25_uc003mdt.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Silent_p.V141V|uc003mdu.1_Silent_p.V33V	p.V122V			Q8NDZ2	CE025_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)	4	773	+	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	122					J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Silent	SNP	ENST00000443967.1	37	c.366A>G																																																																																					0.493	SIMC1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000253155.2	NM_198567		3	106	0	0	0	0.004672	0	3	106				
ELOVL2	54898	broad.mit.edu	37	6	10995243	10995243	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:10995243G>T	ENST00000354666.3	-	5	585	c.502C>A	c.(502-504)Caa>Aaa	p.Q168K		NM_017770.3	NP_060240.3	Q9NXB9	ELOV2_HUMAN	ELOVL fatty acid elongase 2	168					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	fatty acid elongase activity (GO:0009922)	p.Q168K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(2)	14	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			AACTTACTTTGTCCACAAGGT	0.383																																							uc003mzp.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(502-504)CAA>AAA		elongation of very long chain fatty acids-like							142.0	141.0	141.0					6																	10995243		2203	4300	6503	SO:0001583	missense	54898				fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding	g.chr6:10995243G>T	AK000341	CCDS4518.1	6p24.1	2011-05-25	2011-05-25		ENSG00000197977	ENSG00000197977			14416	protein-coding gene	gene with protein product		611814	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2"""			12371743, 16564093	Standard	NM_017770		Approved	Ssc2	uc003mzp.4	Q9NXB9	OTTHUMG00000014252	ENST00000354666.3:c.502C>A	6.37:g.10995243G>T	ENSP00000346693:p.Gln168Lys						p.Q168K	NM_017770	NP_060240	Q9NXB9	ELOV2_HUMAN	Epithelial(50;0.176)		5	663	-	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	168					Q6P9E1|Q86W94	Missense_Mutation	SNP	ENST00000354666.3	37	c.502C>A	CCDS4518.1	.	.	.	.	.	.	.	.	.	.	G	31	5.092513	0.94149	.	.	ENSG00000197977	ENST00000354666	T	0.21543	2.0	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	M	0.92268	3.29	0.80722	D	1	P	0.46142	0.873	P	0.49192	0.602	T	0.53809	-0.8386	10	0.66056	D	0.02	.	19.9598	0.97242	0.0:0.0:1.0:0.0	.	168	Q9NXB9	ELOV2_HUMAN	K	168	ENSP00000346693:Q168K	ENSP00000346693:Q168K	Q	-	1	0	ELOVL2	11103229	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	9.640000	0.98453	2.716000	0.92895	0.655000	0.94253	CAA		0.383	ELOVL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039849.1			25	151	1	0	6.32553e-13	0.004656	1.15728e-12	25	151				
MBOAT1	154141	broad.mit.edu	37	6	20152873	20152873	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:20152873A>T	ENST00000324607.7	-	2	391	c.227T>A	c.(226-228)gTc>gAc	p.V76D	MBOAT1_ENST00000536798.1_Missense_Mutation_p.V76D|MBOAT1_ENST00000541730.1_5'UTR	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	76					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)	p.V76D(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			ACAAAAGATGACAAAATAGAT	0.438																																							uc003ncx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(226-228)GTC>GAC		membrane bound O-acyltransferase domain							78.0	70.0	73.0					6																	20152873		2203	4300	6503	SO:0001583	missense	154141				phospholipid biosynthetic process	integral to membrane	acyltransferase activity	g.chr6:20152873A>T	AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.227T>A	6.37:g.20152873A>T	ENSP00000324944:p.Val76Asp					MBOAT1_uc011dji.1_Intron	p.V76D	NM_001080480	NP_001073949	Q6ZNC8	MBOA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)		2	432	-	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		76			Helical; (Potential).		A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Missense_Mutation	SNP	ENST00000324607.7	37	c.227T>A	CCDS34346.1	.	.	.	.	.	.	.	.	.	.	A	14.12	2.441709	0.43326	.	.	ENSG00000172197	ENST00000324607;ENST00000536798	T;T	0.24723	2.62;1.84	5.37	2.97	0.34412	.	0.503297	0.21544	N	0.072858	T	0.08714	0.0216	L	0.60455	1.87	0.58432	D	0.999999	P	0.39216	0.664	B	0.27500	0.08	T	0.08106	-1.0738	10	0.41790	T	0.15	-14.2188	7.2074	0.25915	0.6298:0.0:0.3702:0.0	.	76	Q6ZNC8	MBOA1_HUMAN	D	76	ENSP00000324944:V76D;ENSP00000439814:V76D	ENSP00000324944:V76D	V	-	2	0	MBOAT1	20260852	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	1.827000	0.39102	0.434000	0.26340	0.533000	0.62120	GTC		0.438	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039980.1			5	8	0	0	0	0.001168	0	5	8				
SLC17A4	10050	broad.mit.edu	37	6	25773866	25773866	+	Silent	SNP	G	G	C	rs146741384		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:25773866G>C	ENST00000377905.4	+	8	1070	c.951G>C	c.(949-951)acG>acC	p.T317T	SLC17A4_ENST00000397076.2_Silent_p.T87T|SLC17A4_ENST00000439485.2_Intron	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	317					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.T317T(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						ACACACCAACGTACATCAGCT	0.388																																							uc003nfe.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(949-951)ACG>ACC		solute carrier family 17 (sodium phosphate),							128.0	114.0	119.0					6																	25773866		2203	4300	6503	SO:0001819	synonymous_variant	10050				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity	g.chr6:25773866G>C	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.951G>C	6.37:g.25773866G>C						SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Silent_p.T78T|SLC17A4_uc003nfg.2_Silent_p.T254T|SLC17A4_uc010jqa.2_Silent_p.T30T	p.T317T	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN			8	1070	+			317					B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Silent	SNP	ENST00000377905.4	37	c.951G>C	CCDS4564.1																																																																																				0.388	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1			46	64	0	0	0	0.00361	0	46	64				
OR2B2	81697	broad.mit.edu	37	6	27879562	27879562	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:27879562C>G	ENST00000303324.2	-	1	612	c.536G>C	c.(535-537)tGt>tCt	p.C179S		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C179S(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						AGGGACTTCACAGAAGAAGTG	0.453																																							uc011dkw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(535-537)TGT>TCT		olfactory receptor, family 2, subfamily B,							99.0	92.0	94.0					6																	27879562		2203	4300	6503	SO:0001583	missense	81697				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:27879562C>G	Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.536G>C	6.37:g.27879562C>G	ENSP00000304419:p.Cys179Ser						p.C179S	NM_033057	NP_149046	Q9GZK3	OR2B2_HUMAN			1	536	-			179			Extracellular (Potential).		B2RNH2|Q9GZL2|Q9Y299	Missense_Mutation	SNP	ENST00000303324.2	37	c.536G>C	CCDS4641.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055525	0.75960	.	.	ENSG00000168131	ENST00000303324	T	0.62364	0.03	4.42	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42964	U	0.000633	D	0.86239	0.5885	H	0.99312	4.51	0.38882	D	0.956922	D	0.89917	1.0	D	0.91635	0.999	D	0.91926	0.5551	10	0.87932	D	0	.	15.3246	0.74150	0.0:1.0:0.0:0.0	.	179	Q9GZK3	OR2B2_HUMAN	S	179	ENSP00000304419:C179S	ENSP00000304419:C179S	C	-	2	0	OR2B2	27987541	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.123000	0.77176	2.371000	0.80710	0.563000	0.77884	TGT		0.453	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040163.1			25	128	0	0	0	0.00632	0	25	128				
TNXB	7148	broad.mit.edu	37	6	32035686	32035686	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:32035686C>A	ENST00000375244.3	-	18	6497	c.6296G>T	c.(6295-6297)gGg>gTg	p.G2099V	TNXB_ENST00000375247.2_Missense_Mutation_p.G2099V			P22105	TENX_HUMAN	tenascin XB	2171	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.G2099V(1)|p.G2186V(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TGTTAGCTCCCCCAGGAGCGG	0.647																																							uc003nzl.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(6295-6297)GGG>GTG		tenascin XB isoform 1 precursor							34.0	38.0	37.0					6																	32035686		1779	3943	5722	SO:0001583	missense	7148				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding	g.chr6:32035686C>A	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.6296G>T	6.37:g.32035686C>A	ENSP00000364393:p.Gly2099Val						p.G2099V	NM_019105	NP_061978	P22105	TENX_HUMAN			18	6498	-			2171			Fibronectin type-III 14.		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37	c.6296G>T		.	.	.	.	.	.	.	.	.	.	C	19.16	3.773571	0.69992	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.04454	3.62;3.62	4.72	4.72	0.59763	.	0.000000	0.42053	D	0.000776	T	0.16685	0.0401	M	0.90425	3.115	0.53688	D	0.999974	D	0.76494	0.999	D	0.71414	0.973	T	0.03728	-1.1009	10	0.33940	T	0.23	.	14.6628	0.68885	0.0:1.0:0.0:0.0	.	2099	P22105-3	.	V	2099	ENSP00000364393:G2099V;ENSP00000364396:G2099V	ENSP00000364393:G2099V	G	-	2	0	TNXB	32143664	0.936000	0.31750	1.000000	0.80357	0.903000	0.53119	1.707000	0.37888	2.177000	0.69029	0.456000	0.33151	GGG		0.647	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		45	87	1	0	6.21074e-16	0.002852	1.21943e-15	45	87				
IP6K3	117283	broad.mit.edu	37	6	33690860	33690860	+	Silent	SNP	A	A	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:33690860A>G	ENST00000293756.4	-	6	1196	c.870T>C	c.(868-870)aaT>aaC	p.N290N	IP6K3_ENST00000451316.1_Silent_p.N290N	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	290					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.N290N(1)		skin(1)	1						GGTGGCTTCCATTATGTAGGA	0.502																																							uc010jvf.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(868-870)AAT>AAC		inositol hexakisphosphate kinase 3							48.0	54.0	52.0					6																	33690860		2203	4300	6503	SO:0001819	synonymous_variant	117283				inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|protein phosphorylation	cytoplasm	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol hexakisphosphate 6-kinase activity|inositol trisphosphate 3-kinase activity	g.chr6:33690860A>G	AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.870T>C	6.37:g.33690860A>G						IP6K3_uc003ofb.2_Silent_p.N290N	p.N290N	NM_001142883	NP_001136355	Q96PC2	IP6K3_HUMAN			7	1406	-			290					Q96MQ9	Silent	SNP	ENST00000293756.4	37	c.870T>C	CCDS34435.1																																																																																				0.502	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111		22	54	0	0	0	0.002299	0	22	54				
BRPF3	27154	broad.mit.edu	37	6	36196766	36196766	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:36196766G>T	ENST00000357641.6	+	12	3620	c.3367G>T	c.(3367-3369)Gag>Tag	p.E1123*	BRPF3_ENST00000443324.2_Nonsense_Mutation_p.E789*|BRPF3_ENST00000534694.1_Nonsense_Mutation_p.E789*|BRPF3_ENST00000534400.1_Missense_Mutation_p.R1090I|BRPF3_ENST00000339717.7_Nonsense_Mutation_p.E853*|BRPF3_ENST00000543502.1_Nonsense_Mutation_p.E853*	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	1123	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.E1123*(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						GAAGCTGGGAGAGCAGAAACA	0.602																																							uc003olv.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(3367-3369)GAG>TAG		bromodomain and PHD finger containing, 3							88.0	82.0	84.0					6																	36196766		2203	4300	6503	SO:0001587	stop_gained	27154				histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding	g.chr6:36196766G>T	AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.3367G>T	6.37:g.36196766G>T	ENSP00000350267:p.Glu1123*					BRPF3_uc010jwb.2_Nonsense_Mutation_p.E853*|BRPF3_uc011dtj.1_RNA|BRPF3_uc010jwc.2_Intron|BRPF3_uc011dtk.1_Nonsense_Mutation_p.E789*|BRPF3_uc010jwd.2_Nonsense_Mutation_p.E25*	p.E1123*	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN			12	3591	+			1123			PWWP.		A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Nonsense_Mutation	SNP	ENST00000357641.6	37	c.3367G>T	CCDS34437.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.358785|7.358785	0.98235|0.98235	.|.	.|.	ENSG00000096070|ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324|ENST00000534400	.|T	.|0.19394	.|2.15	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.35422	.|0.0931	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.06127	.|-1.0844	.|5	0.66056|0.52906	D|T	0.02|0.07	.|.	19.1126|19.1126	0.93323|0.93323	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1123;853;789;853;789|1090	.|ENSP00000436504:R1090I	ENSP00000345419:E853X|ENSP00000436504:R1090I	E|R	+|+	1|2	0|0	BRPF3|BRPF3	36304744|36304744	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.950000|7.950000	0.87804|0.87804	2.591000|2.591000	0.87537|0.87537	0.655000|0.655000	0.94253|0.94253	GAG|AGA		0.602	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695		27	63	1	0	2.79863e-10	0.004656	4.6773e-10	27	63				
PI16	221476	broad.mit.edu	37	6	36930861	36930861	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:36930861T>A	ENST00000373674.3	+	5	1071	c.743T>A	c.(742-744)gTc>gAc	p.V248D	PI16_ENST00000491324.1_Intron	NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	248					negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)	p.V248D(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTAACAGAGGTCTCAGGCTCC	0.577																																							uc003ona.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(742-744)GTC>GAC		protease inhibitor 16 precursor							111.0	104.0	106.0					6																	36930861		2203	4300	6503	SO:0001583	missense	221476					extracellular region|integral to membrane	peptidase inhibitor activity	g.chr6:36930861T>A		CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.743T>A	6.37:g.36930861T>A	ENSP00000362778:p.Val248Asp					PI16_uc003omz.1_Intron|PI16_uc003onb.2_Intron|PI16_uc011dts.1_Missense_Mutation_p.V19D	p.V248D	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN			5	1071	+			248			Extracellular (Potential).		Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	ENST00000373674.3	37	c.743T>A	CCDS34440.1	.	.	.	.	.	.	.	.	.	.	T	13.27	2.186530	0.38609	.	.	ENSG00000164530	ENST00000373674;ENST00000539035	T	0.08720	3.06	4.56	-6.09	0.02145	.	1.378020	0.04830	N	0.438595	T	0.03477	0.0100	L	0.51422	1.61	0.29236	N	0.87293	P	0.44578	0.838	B	0.44315	0.446	T	0.15809	-1.0424	10	0.42905	T	0.14	.	8.4176	0.32681	0.0:0.3381:0.4839:0.178	.	248	Q6UXB8	PI16_HUMAN	D	248;100	ENSP00000362778:V248D	ENSP00000362778:V248D	V	+	2	0	PI16	37038839	0.002000	0.14202	0.003000	0.11579	0.735000	0.41995	-0.374000	0.07484	-1.138000	0.02884	-0.250000	0.11733	GTC		0.577	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040380.1	NM_153370		22	131	0	0	0	0.002299	0	22	131				
DNAH8	1769	broad.mit.edu	37	6	38905924	38905924	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:38905924C>T	ENST00000359357.3	+	76	11341	c.11087C>T	c.(11086-11088)aCa>aTa	p.T3696I	DNAH8_ENST00000449981.2_Missense_Mutation_p.T3913I|DNAH8_ENST00000441566.1_Missense_Mutation_p.T3660I|RP1-207H1.3_ENST00000416948.1_RNA			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3696					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T3696I(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTCCTCATCACAGAGATGAGC	0.522																																							uc003ooe.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(11086-11088)ACA>ATA		dynein, axonemal, heavy polypeptide 8							125.0	103.0	110.0					6																	38905924		2203	4300	6503	SO:0001583	missense	1769							g.chr6:38905924C>T	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11087C>T	6.37:g.38905924C>T	ENSP00000352312:p.Thr3696Ile					DNAH8_uc003oog.1_Missense_Mutation_p.T145I|uc003oof.1_Intron	p.T3696I	NM_001371	NP_001362					76	11687	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37	c.11087C>T		.	.	.	.	.	.	.	.	.	.	C	21.7	4.185540	0.78677	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.54866	0.55;0.55;0.55	5.61	5.61	0.85477	.	0.226096	0.46442	D	0.000294	T	0.52025	0.1709	M	0.73962	2.25	0.46356	D	0.999009	P;P	0.50943	0.94;0.901	P;B	0.44811	0.461;0.271	T	0.57075	-0.7873	10	0.46703	T	0.11	.	20.0016	0.97412	0.0:1.0:0.0:0.0	.	3660;3696	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	I	3901;3901;3696;3660	ENSP00000333363:T3901I;ENSP00000352312:T3696I;ENSP00000402294:T3660I	ENSP00000333363:T3901I	T	+	2	0	DNAH8	39013902	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	4.923000	0.63412	2.802000	0.96397	0.655000	0.94253	ACA		0.522	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		37	69	0	0	0	0.004878	0	37	69				
GLP1R	2740	broad.mit.edu	37	6	39047364	39047364	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:39047364C>A	ENST00000373256.4	+	11	1111	c.1068C>A	c.(1066-1068)ctC>ctA	p.L356L		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	356					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)	p.L356L(1)		breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	CGCTGACACTCATCCCCCTGC	0.577																																							uc003ooj.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|breast(1)|pancreas(1)	5						c.(1066-1068)CTC>CTA		glucagon-like peptide 1 receptor precursor	Exenatide(DB01276)|Glucagon recombinant(DB00040)						87.0	82.0	83.0					6																	39047364		2203	4300	6503	SO:0001819	synonymous_variant	2740				activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled	g.chr6:39047364C>A		CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.1068C>A	6.37:g.39047364C>A						GLP1R_uc003ooh.2_RNA|GLP1R_uc003ooi.2_RNA	p.L356L	NM_002062	NP_002053	P43220	GLP1R_HUMAN			11	1128	+			356			Helical; Name=6; (Potential).		Q2M229|Q99669	Silent	SNP	ENST00000373256.4	37	c.1068C>A	CCDS4839.1																																																																																				0.577	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1			9	71	1	0	0.000978159	0.000978	0.00120216	9	71				
TFAP2D	83741	broad.mit.edu	37	6	50696930	50696931	+	Missense_Mutation	DNP	GC	GC	CA	rs373051413		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:50696930_50696931GC>CA	ENST00000008391.3	+	5	1016_1017	c.788_789GC>CA	c.(787-789)cGC>cCA	p.R263P	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.R263P(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					AATGGGGGCCGCTGCCTGAGAG	0.416																																							uc003paf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(1)	7						c.(787-789)CGC>CCA		transcription factor AP-2 beta-like 1																																				SO:0001583	missense	83741						DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:50696930_50696931GC>CA	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		Exception_encountered	6.37:g.50696930_50696931delinsCA	ENSP00000008391:p.Arg263Pro					TFAP2D_uc011dwt.1_RNA	p.R263P	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN			5	1300_1301	+	Lung NSC(77;0.0334)		263						Missense_Mutation	DNP	ENST00000008391.3	37	c.788_789GC>CA	CCDS4933.1																																																																																				0.416	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		22	149	0	0	0	0.004672	0	22	149				
HCRTR2	3062	broad.mit.edu	37	6	55113436	55113436	+	Splice_Site	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:55113436G>A	ENST00000370862.3	+	2	559		c.e2-1			NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2						circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)	p.?(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTTCAAATTAGTTTGTGTGGC	0.393																																							uc003pcl.2		NA																	1	Unknown(1)		lung(1)	ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6						c.e2-1		orexin receptor 2							134.0	120.0	125.0					6																	55113436		2203	4299	6502	SO:0001630	splice_region_variant	3062				feeding behavior	integral to plasma membrane	neuropeptide receptor activity	g.chr6:55113436G>A	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.224-1G>A	6.37:g.55113436G>A						HCRTR2_uc010jzv.2_Splice_Site|HCRTR2_uc010jzw.1_Splice_Site_p.V10_splice	p.V75_splice	NM_001526	NP_001517	O43614	OX2R_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		2	539	+	Lung NSC(77;0.107)|Renal(3;0.122)							Q5VTM0	Splice_Site	SNP	ENST00000370862.3	37	c.224_splice	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382440	0.82792	.	.	ENSG00000137252	ENST00000370862	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8648	0.92287	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HCRTR2	55221395	1.000000	0.71417	0.951000	0.38953	0.954000	0.61252	9.476000	0.97823	2.461000	0.83175	0.650000	0.86243	.		0.393	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		Intron	18	95	0	0	0	0.007413	0	18	95				
COL9A1	1297	broad.mit.edu	37	6	70970395	70970395	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:70970395C>A	ENST00000357250.6	-	20	1572	c.1414G>T	c.(1414-1416)Ggc>Tgc	p.G472C	COL9A1_ENST00000320755.7_Missense_Mutation_p.G229C|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Missense_Mutation_p.G229C	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	472	Collagen-like 4.|Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.G472C(1)|p.G229C(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CCGGTGATGCCTCGCAAACCC	0.353																																							uc003pfg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(1414-1416)GGC>TGC		alpha 1 type IX collagen isoform 1 precursor							60.0	60.0	60.0					6																	70970395		2203	4300	6503	SO:0001583	missense	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:70970395C>A		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1414G>T	6.37:g.70970395C>A	ENSP00000349790:p.Gly472Cys					COL9A1_uc003pfe.3_Missense_Mutation_p.G45C|COL9A1_uc003pff.3_Missense_Mutation_p.G229C	p.G472C	NM_001851	NP_001842	P20849	CO9A1_HUMAN			20	1573	-			472			Triple-helical region (COL2).		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	c.1414G>T	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888455	0.52014	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.99637	-6.29;-6.29;-5.78	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	H	0.99847	4.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96356	0.9262	10	0.87932	D	0	.	17.1033	0.86655	0.0:1.0:0.0:0.0	.	472;229;45	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	C	472;229;229	ENSP00000349790:G472C;ENSP00000315252:G229C;ENSP00000359530:G229C	ENSP00000315252:G229C	G	-	1	0	COL9A1	71027116	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.054000	0.64275	2.775000	0.95449	0.655000	0.94253	GGC		0.353	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			5	22	1	0	0.000157383	0.00308	0.00020057	5	22				
MDN1	23195	broad.mit.edu	37	6	90428642	90428642	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:90428642A>T	ENST00000369393.3	-	42	6280	c.6165T>A	c.(6163-6165)tgT>tgA	p.C2055*	MDN1_ENST00000428876.1_Nonsense_Mutation_p.C2055*			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2055					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.C2055*(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCATCTGCACACACTTCATGA	0.577																																							uc003pnn.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(8)|skin(2)	10						c.(6163-6165)TGT>TGA		MDN1, midasin homolog							83.0	80.0	81.0					6																	90428642		2203	4300	6503	SO:0001587	stop_gained	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90428642A>T	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.6165T>A	6.37:g.90428642A>T	ENSP00000358400:p.Cys2055*						p.C2055*	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	42	6281	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	2055					O15019|Q5T794	Nonsense_Mutation	SNP	ENST00000369393.3	37	c.6165T>A	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	A	47	13.300496	0.99733	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	.	.	.	5.63	3.29	0.37713	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3486	0.32288	0.716:0.0:0.284:0.0	.	.	.	.	X	2055	.	ENSP00000358400:C2055X	C	-	3	2	MDN1	90485363	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.836000	0.39191	0.965000	0.38133	0.528000	0.53228	TGT		0.577	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			22	74	0	0	0	0.001882	0	22	74				
GPRC6A	222545	broad.mit.edu	37	6	117130516	117130516	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:117130516C>A	ENST00000310357.3	-	2	480	c.459G>T	c.(457-459)atG>atT	p.M153I	GPRC6A_ENST00000368549.3_Missense_Mutation_p.M153I|GPRC6A_ENST00000530250.1_Missense_Mutation_p.M153I	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	153					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.M153I(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TGGAGACAGCCATAGTTATTT	0.413																																							uc003pxj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)	6						c.(457-459)ATG>ATT		G protein-coupled receptor, family C, group 6,							84.0	82.0	82.0					6																	117130516		2203	4300	6503	SO:0001583	missense	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117130516C>A	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.459G>T	6.37:g.117130516C>A	ENSP00000309493:p.Met153Ile					GPRC6A_uc003pxk.1_Missense_Mutation_p.M153I|GPRC6A_uc003pxl.1_Missense_Mutation_p.M153I	p.M153I	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	2	481	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	153			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	c.459G>T	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	C	1.377	-0.584361	0.03827	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	T;T;T	0.80994	-1.44;-1.44;-1.44	4.86	-3.31	0.04988	Extracellular ligand-binding receptor (1);	0.355062	0.28748	N	0.014263	T	0.15825	0.0381	N	0.01529	-0.815	0.19775	N	0.999952	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.001;0.002	T	0.42015	-0.9476	10	0.02654	T	1	.	0.9469	0.01367	0.2235:0.3448:0.1091:0.3226	.	153;153;153	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	I	153	ENSP00000309493:M153I;ENSP00000357537:M153I;ENSP00000433465:M153I	ENSP00000309493:M153I	M	-	3	0	GPRC6A	117237209	0.728000	0.28080	0.967000	0.41034	0.938000	0.57974	-0.270000	0.08584	-0.519000	0.06444	0.585000	0.79938	ATG		0.413	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			18	122	1	0	6.44725e-10	0.002299	1.06281e-09	18	122				
ALDH8A1	64577	broad.mit.edu	37	6	135239767	135239767	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:135239767T>C	ENST00000265605.2	-	7	1318	c.1250A>G	c.(1249-1251)tAt>tGt	p.Y417C	ALDH8A1_ENST00000367847.2_Missense_Mutation_p.Y367C|ALDH8A1_ENST00000367845.2_Missense_Mutation_p.Y363C	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	417					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)	p.Y417C(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CGCCAGCCCATACTTAACGTT	0.552																																							uc003qew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)|skin(1)	4						c.(1249-1251)TAT>TGT		aldehyde dehydrogenase 8A1 isoform 1							152.0	101.0	118.0					6																	135239767		2203	4300	6503	SO:0001583	missense	64577				retinal metabolic process	cytoplasm	retinal dehydrogenase activity	g.chr6:135239767T>C	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.1250A>G	6.37:g.135239767T>C	ENSP00000265605:p.Tyr417Cys					ALDH8A1_uc003qex.2_Missense_Mutation_p.Y363C|ALDH8A1_uc010kgh.2_Missense_Mutation_p.Y195C|ALDH8A1_uc011ecx.1_Missense_Mutation_p.Y367C	p.Y417C	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)	7	1303	-	Colorectal(23;0.221)		417					B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	c.1250A>G	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	T	16.41	3.115083	0.56505	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847;ENST00000460753	D;T;D;D	0.81739	-1.53;1.25;-1.53;-1.53	5.83	5.83	0.93111	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.92831	0.7720	H	0.97240	3.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95254	0.8362	10	0.87932	D	0	.	16.2009	0.82078	0.0:0.0:0.0:1.0	.	367;363;417	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	C	417;363;367;102	ENSP00000265605:Y417C;ENSP00000356819:Y363C;ENSP00000356821:Y367C;ENSP00000437161:Y102C	ENSP00000265605:Y417C	Y	-	2	0	ALDH8A1	135281460	1.000000	0.71417	0.833000	0.33012	0.095000	0.18619	6.058000	0.71126	2.235000	0.73313	0.533000	0.62120	TAT		0.552	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2			13	70	0	0	0	0.001368	0	13	70				
AKAP12	9590	broad.mit.edu	37	6	151673210	151673210	+	Silent	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:151673210G>C	ENST00000253332.1	+	3	3873	c.3684G>C	c.(3682-3684)gtG>gtC	p.V1228V	AKAP12_ENST00000359755.5_Silent_p.V1123V|AKAP12_ENST00000402676.2_Silent_p.V1228V|AKAP12_ENST00000354675.6_Silent_p.V1130V			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1228					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.V1228V(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CCAGTTTTGTGTTCCAGGAAG	0.473																																					Melanoma(141;1616 1805 10049 24534 51979)	Melanoma(141;1616 1805 10049 24534 51979)	uc011eep.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8						c.(3682-3684)GTG>GTC		A kinase (PRKA) anchor protein 12 isoform 1							51.0	53.0	52.0					6																	151673210		2203	4300	6503	SO:0001819	synonymous_variant	9590				G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding	g.chr6:151673210G>C	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.3684G>C	6.37:g.151673210G>C						AKAP12_uc003qoe.2_Silent_p.V1228V|AKAP12_uc003qof.2_Silent_p.V1130V|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Silent_p.V1123V	p.V1228V	NM_005100	NP_005091	Q02952	AKA12_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)	4	3924	+		Ovarian(120;0.125)	1228					O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	37	c.3684G>C	CCDS5229.1																																																																																				0.473	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1			16	59	0	0	0	0.00499	0	16	59				
ZBTB2	57621	broad.mit.edu	37	6	151687533	151687533	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr6:151687533T>C	ENST00000325144.4	-	3	808	c.668A>G	c.(667-669)gAa>gGa	p.E223G		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E223G(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		GGAAGATGCTTCCAGATTGGT	0.552																																							uc003qoh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(667-669)GAA>GGA		zinc finger and BTB domain containing 2							111.0	97.0	102.0					6																	151687533		2203	4300	6503	SO:0001583	missense	57621				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:151687533T>C	BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.668A>G	6.37:g.151687533T>C	ENSP00000323183:p.Glu223Gly						p.E223G	NM_020861	NP_065912	Q8N680	ZBTB2_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)	3	803	-			223					A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	ENST00000325144.4	37	c.668A>G	CCDS5231.1	.	.	.	.	.	.	.	.	.	.	T	17.08	3.297780	0.60086	.	.	ENSG00000181472	ENST00000325144	T	0.05855	3.38	5.76	4.58	0.56647	.	0.343429	0.34178	N	0.004186	T	0.02012	0.0063	L	0.29908	0.895	0.51012	D	0.999904	P	0.38504	0.634	B	0.27608	0.081	T	0.49570	-0.8926	10	0.87932	D	0	-24.9457	13.105	0.59241	0.0:0.0:0.1339:0.8661	.	223	Q8N680	ZBTB2_HUMAN	G	223	ENSP00000323183:E223G	ENSP00000323183:E223G	E	-	2	0	ZBTB2	151729226	0.999000	0.42202	0.774000	0.31636	0.904000	0.53231	2.840000	0.48215	0.986000	0.38683	0.533000	0.62120	GAA		0.552	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042715.1	NM_020861		16	78	0	0	0	0.004007	0	16	78				
INMT	11185	broad.mit.edu	37	7	30793517	30793517	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:30793517C>A	ENST00000013222.5	+	2	341	c.325C>A	c.(325-327)Cca>Aca	p.P109T	INMT-FAM188B_ENST00000458257.1_Missense_Mutation_p.P108T|INMT_ENST00000484180.1_3'UTR|INMT_ENST00000409539.1_Missense_Mutation_p.P108T	NM_001199219.1|NM_006774.4	NP_001186148.1|NP_006765.4	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	109					amine metabolic process (GO:0009308)|methylation (GO:0032259)|response to toxic substance (GO:0009636)	cytosol (GO:0005829)	amine N-methyltransferase activity (GO:0030748)|thioether S-methyltransferase activity (GO:0004790)	p.P109T(1)		kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|stomach(1)	23						TGACTGGACCCCAGCGGTGAA	0.572																																							uc003tbs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(325-327)CCA>ACA		indolethylamine N-methyltransferase							70.0	79.0	76.0					7																	30793517		2203	4300	6503	SO:0001583	missense	11185					cytoplasm	amine N-methyltransferase activity	g.chr7:30793517C>A		CCDS5430.1, CCDS56479.1	7p14.3	2011-08-30			ENSG00000241644	ENSG00000241644	2.1.1.49		6069	protein-coding gene	gene with protein product		604854				10552930	Standard	NM_001199219		Approved		uc003tbs.1	O95050	OTTHUMG00000167163	ENST00000013222.5:c.325C>A	7.37:g.30793517C>A	ENSP00000013222:p.Pro109Thr					FAM188B_uc010kwe.2_5'UTR|INMT_uc010kwc.1_RNA|INMT_uc010kwd.1_Missense_Mutation_p.P108T	p.P109T	NM_006774	NP_006765	O95050	INMT_HUMAN			2	341	+			109					B8ZZ69|Q3KP49|Q9P1Y2|Q9UBY4|Q9UHQ0	Missense_Mutation	SNP	ENST00000013222.5	37	c.325C>A	CCDS5430.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303178	0.40795	.	.	ENSG00000241644	ENST00000013222;ENST00000409539	T;T	0.10192	2.9;2.9	3.69	0.796	0.18648	.	0.377377	0.19434	N	0.114356	T	0.14399	0.0348	L	0.55743	1.74	0.09310	N	1	D;D	0.61080	0.989;0.989	P;P	0.54815	0.761;0.761	T	0.10730	-1.0617	10	0.32370	T	0.25	-6.4565	3.3794	0.07249	0.0:0.4362:0.2059:0.3579	.	108;109	B8ZZ69;O95050	.;INMT_HUMAN	T	109;108	ENSP00000013222:P109T;ENSP00000386961:P108T	ENSP00000013222:P109T	P	+	1	0	INMT	30760042	0.000000	0.05858	0.013000	0.15412	0.218000	0.24690	0.302000	0.19192	0.328000	0.23435	0.561000	0.74099	CCA		0.572	INMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214993.3	NM_006774		37	130	1	0	1.06647e-15	0.003755	2.06043e-15	37	130				
INHBA	3624	broad.mit.edu	37	7	41730102	41730103	+	Missense_Mutation	DNP	CC	CC	TA	rs151132792		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:41730102_41730103CC>TA	ENST00000242208.4	-	3	672_673	c.426_427GG>TA	c.(424-429)aaGGaa>aaTAaa	p.142_143KE>NK	INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_Missense_Mutation_p.142_143KE>NK	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	142					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.K142_E143>NK(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TCACTGCCTTCCTTGGAAATCT	0.5										TSP Lung(11;0.080)																													uc003thq.2		NA																	1	Complex - compound substitution(1)		lung(1)	lung(5)|ovary(1)	6						c.(424-429)AAGGAA>AATAAA		inhibin beta A precursor																																				SO:0001583	missense	3624				cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity	g.chr7:41730102_41730103CC>TA		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.426_427delinsTA	7.37:g.41730102_41730103delinsTA	ENSP00000242208:p.K142_E143delinsNK	TSP Lung(11;0.080)				INHBA_uc003thr.2_Missense_Mutation_p.142_143KE>NK	p.142_143KE>NK	NM_002192	NP_002183	P08476	INHBA_HUMAN			2	661_662	-			142_143					Q14599	Missense_Mutation	DNP	ENST00000242208.4	37	c.426_427GG>TA	CCDS5464.1																																																																																				0.500	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1			15	47	0	0	0	0.004672	0	15	47				
POM121L12	285877	broad.mit.edu	37	7	53103500	53103500	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:53103500C>A	ENST00000408890.4	+	1	152	c.136C>A	c.(136-138)Ccc>Acc	p.P46T		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	46								p.P46T(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CACGCCATCTCCCCAGGGTCG	0.677																																							uc003tpz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(136-138)CCC>ACC		POM121 membrane glycoprotein-like 12							26.0	33.0	31.0					7																	53103500		2025	4180	6205	SO:0001583	missense	285877							g.chr7:53103500C>A		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.136C>A	7.37:g.53103500C>A	ENSP00000386133:p.Pro46Thr						p.P46T	NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN			1	152	+			46					Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	c.136C>A	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.494649	0.26774	.	.	ENSG00000221900	ENST00000408890	T	0.26373	1.74	1.62	0.685	0.18009	.	.	.	.	.	T	0.13927	0.0337	N	0.22421	0.69	0.09310	N	1	P	0.34977	0.478	B	0.28916	0.096	T	0.17258	-1.0375	9	0.72032	D	0.01	.	5.6666	0.17698	0.0:0.3836:0.6164:0.0	.	46	Q8N7R1	P1L12_HUMAN	T	46	ENSP00000386133:P46T	ENSP00000386133:P46T	P	+	1	0	POM121L12	53070994	0.001000	0.12720	0.008000	0.14137	0.005000	0.04900	0.173000	0.16724	0.255000	0.21593	0.313000	0.20887	CCC		0.677	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		10	39	1	0	1.08611e-07	0.000978	1.62412e-07	10	39				
DTX2	113878	broad.mit.edu	37	7	76112318	76112318	+	Silent	SNP	G	G	T	rs146537218	byFrequency	TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:76112318G>T	ENST00000324432.5	+	5	1272	c.762G>T	c.(760-762)ggG>ggT	p.G254G	DTX2_ENST00000446820.2_Silent_p.G254G|DTX2_ENST00000446600.1_Silent_p.G163G|DTX2_ENST00000430490.2_Silent_p.G254G|DTX2_ENST00000413936.2_Silent_p.G254G|DTX2_ENST00000307569.8_Silent_p.G254G	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	254					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.G254G(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						CACTCTCCGGGGCCCGGTCTG	0.677																																							uc003uff.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(760-762)GGG>GGT		deltex 2 isoform a							115.0	127.0	123.0					7																	76112318		2203	4300	6503	SO:0001819	synonymous_variant	113878				Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding	g.chr7:76112318G>T		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.762G>T	7.37:g.76112318G>T						DTX2_uc011kgk.1_Silent_p.G163G|DTX2_uc003ufg.3_Silent_p.G254G|DTX2_uc003ufh.3_Silent_p.G254G|DTX2_uc003ufj.3_Silent_p.G254G	p.G254G	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN			5	1318	+			254					Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	ENST00000324432.5	37	c.762G>T	CCDS5587.1																																																																																				0.677	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2			24	230	1	0	4.43304e-23	0.00632	9.77697e-23	24	230				
PDK4	5166	broad.mit.edu	37	7	95216781	95216781	+	Silent	SNP	T	T	C	rs148379762		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:95216781T>C	ENST00000005178.5	-	9	1127	c.930A>G	c.(928-930)acA>acG	p.T310T		NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	310	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)	p.T310T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			CAGTGGAGTATGTATAACTAA	0.393													T|||	1	0.000199681	0.0008	0.0	5008	,	,		18257	0.0		0.0	False		,,,				2504	0.0						uc003uoa.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(928-930)ACA>ACG		pyruvate dehydrogenase kinase 4 precursor		T		2,4404	4.2+/-10.8	0,2,2201	95.0	97.0	96.0		930	-11.5	0.4	7	dbSNP_134	96	0,8600		0,0,4300	no	coding-synonymous	PDK4	NM_002612.3		0,2,6501	CC,CT,TT		0.0,0.0454,0.0154		310/412	95216781	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	5166				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity	g.chr7:95216781T>C	U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.930A>G	7.37:g.95216781T>C						PDK4_uc003unz.2_Silent_p.T98T	p.T310T	NM_002612	NP_002603	Q16654	PDK4_HUMAN	STAD - Stomach adenocarcinoma(171;0.0151)		9	1250	-	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		310			Histidine kinase.			Silent	SNP	ENST00000005178.5	37	c.930A>G	CCDS5643.1																																																																																				0.393	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333298.1	NM_002612		23	83	0	0	0	0.00333	0	23	83				
LMTK2	22853	broad.mit.edu	37	7	97822738	97822738	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:97822738C>G	ENST00000297293.5	+	11	3254	c.2961C>G	c.(2959-2961)ttC>ttG	p.F987L		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	987					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)	p.F987L(2)		NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CAGCACCCTTCCCAGCCTCTG	0.567																																							uc003upd.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16						c.(2959-2961)TTC>TTG		lemur tyrosine kinase 2 precursor							92.0	101.0	98.0					7																	97822738		2203	4300	6503	SO:0001583	missense	22853				early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr7:97822738C>G	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.2961C>G	7.37:g.97822738C>G	ENSP00000297293:p.Phe987Leu						p.F987L	NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN			11	3254	+	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)		987					A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	ENST00000297293.5	37	c.2961C>G	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	C	1.473	-0.559204	0.03967	.	.	ENSG00000164715	ENST00000297293	T	0.76448	-1.02	5.12	-10.2	0.00374	.	1.012530	0.07890	N	0.970952	T	0.45236	0.1332	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43877	-0.9364	10	0.02654	T	1	.	3.0948	0.06305	0.1072:0.5626:0.1373:0.1928	.	987	Q8IWU2	LMTK2_HUMAN	L	987	ENSP00000297293:F987L	ENSP00000297293:F987L	F	+	3	2	LMTK2	97660674	0.000000	0.05858	0.000000	0.03702	0.325000	0.28411	-2.875000	0.00718	-1.815000	0.01222	-0.300000	0.09419	TTC		0.567	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916		12	177	0	0	0	0.001855	0	12	177				
ORAI2	80228	broad.mit.edu	37	7	102079390	102079390	+	Splice_Site	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:102079390G>T	ENST00000356387.2	+	3	222		c.e3-1		ORAI2_ENST00000478730.2_Splice_Site|ORAI2_ENST00000473939.1_Splice_Site|ORAI2_ENST00000403646.3_Splice_Site|ORAI2_ENST00000488996.1_Intron	NM_001126340.1|NM_001271818.1|NM_001271819.1|NM_032831.3	NP_001119812.1|NP_001258747.1|NP_001258748.1|NP_116220.1	Q96SN7	ORAI2_HUMAN	ORAI calcium release-activated calcium modulator 2							growth cone (GO:0030426)|integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15						CCCACCCTTAGCCTGGCTCCC	0.582																																							uc010lhz.1		NA																	0				ovary(1)|kidney(1)	2						c.e3-1		ORAI calcium release-activated calcium modulator							112.0	104.0	107.0					7																	102079390		2203	4300	6503	SO:0001630	splice_region_variant	80228					integral to membrane	protein binding	g.chr7:102079390G>T	AF258552	CCDS5722.1	7q22.1	2007-08-14	2007-08-14	2007-08-14	ENSG00000160991	ENSG00000160991		"""ORAI calcium release-activated calcium modulators"""	21667	protein-coding gene	gene with protein product	"""CAP-binding protein complex interacting protein 2"""	610929	"""chromosome 7 open reading frame 19"", ""transmembrane protein 142B"""	C7orf19, TMEM142B		16582901	Standard	NM_001126340		Approved	CBCIP2, FLJ12474, FLJ14733, H_NH0514P08.8	uc003uzj.3	Q96SN7	OTTHUMG00000157722	ENST00000356387.2:c.-13-1G>T	7.37:g.102079390G>T						ORAI2_uc003uzj.2_Splice_Site|ORAI2_uc003uzk.2_Splice_Site|ORAI2_uc011kks.1_Intron		NM_001126340	NP_001119812	Q96SN7	ORAI2_HUMAN			3	223	+								Q6IA68|Q8WY94|Q9H9Y3	Splice_Site	SNP	ENST00000356387.2	37	c.-12_splice	CCDS5722.1																																																																																				0.582	ORAI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349509.2	NM_032831	Intron	23	106	1	0	1.5548e-18	0.005443	3.23693e-18	23	106				
FBXL13	222235	broad.mit.edu	37	7	102517943	102517943	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:102517943C>A	ENST00000313221.4	-	16	2032	c.1606G>T	c.(1606-1608)Gat>Tat	p.D536Y	FBXL13_ENST00000379305.3_Missense_Mutation_p.D536Y|FBXL13_ENST00000393772.2_Missense_Mutation_p.D536Y|FBXL13_ENST00000379308.3_Missense_Mutation_p.D536Y|FBXL13_ENST00000379306.3_Intron|FBXL13_ENST00000455112.2_Missense_Mutation_p.D536Y|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000436908.1_Missense_Mutation_p.D536Y	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	536								p.D536Y(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						CCAGAGAGATCTATTGATACC	0.294																																							uc003vaq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1606-1608)GAT>TAT		F-box and leucine-rich repeat protein 13 isoform							62.0	64.0	63.0					7																	102517943		2202	4294	6496	SO:0001583	missense	222235							g.chr7:102517943C>A	BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.1606G>T	7.37:g.102517943C>A	ENSP00000321927:p.Asp536Tyr					FBXL13_uc010liq.1_Intron|FBXL13_uc010lir.1_Missense_Mutation_p.D536Y|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Missense_Mutation_p.D536Y	p.D536Y	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN			16	2033	-			536			LRR 12.		C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Missense_Mutation	SNP	ENST00000313221.4	37	c.1606G>T	CCDS5726.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993272	0.74703	.	.	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000349747;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000455112	T;T;T;T;T;T	0.55588	0.51;2.64;0.51;2.64;2.64;2.64	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.994;0.999	T	0.75947	-0.3138	10	0.87932	D	0	.	18.4069	0.90539	0.0:1.0:0.0:0.0	.	536;536;536	Q8NEE6-3;Q8NEE6-2;Q8NEE6	.;.;FXL13_HUMAN	Y	536;536;257;536;536;536;536	ENSP00000377367:D536Y;ENSP00000368610:D536Y;ENSP00000368607:D536Y;ENSP00000388608:D536Y;ENSP00000321927:D536Y;ENSP00000391550:D536Y	ENSP00000321927:D536Y	D	-	1	0	FBXL13	102305179	0.987000	0.35691	0.981000	0.43875	0.905000	0.53344	4.494000	0.60347	2.761000	0.94854	0.557000	0.71058	GAT		0.294	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348001.1	NM_145032		15	69	1	0	1.02788e-11	0.00499	1.78586e-11	15	69				
CPED1	79974	broad.mit.edu	37	7	120782149	120782149	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:120782149C>A	ENST00000310396.5	+	16	2476	c.2009C>A	c.(2008-2010)cCa>cAa	p.P670Q	CPED1_ENST00000423795.1_Missense_Mutation_p.P450Q|CPED1_ENST00000450913.2_Missense_Mutation_p.P670Q	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	670						endoplasmic reticulum (GO:0005783)		p.P670Q(1)									GAAGACCGCCCAAGTCTGCCC	0.433																																							uc003vjq.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9						c.(2008-2010)CCA>CAA		hypothetical protein LOC79974 isoform 1							190.0	170.0	177.0					7																	120782149		2203	4299	6502	SO:0001583	missense	79974					endoplasmic reticulum		g.chr7:120782149C>A		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2009C>A	7.37:g.120782149C>A	ENSP00000309772:p.Pro670Gln					C7orf58_uc003vjs.3_Missense_Mutation_p.P670Q|C7orf58_uc003vjt.3_Missense_Mutation_p.P450Q	p.P670Q	NM_024913	NP_079189	A4D0V7	CG058_HUMAN			16	2456	+	all_neural(327;0.117)		670					A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	ENST00000310396.5	37	c.2009C>A	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707984	0.89018	.	.	ENSG00000106034	ENST00000310396;ENST00000450913;ENST00000423795	T;T;T	0.25749	2.11;1.78;1.79	5.77	5.77	0.91146	.	0.056277	0.64402	D	0.000001	T	0.53029	0.1771	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.982	T	0.48636	-0.9018	10	0.62326	D	0.03	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	450;670;670	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	Q	670;670;450	ENSP00000309772:P670Q;ENSP00000406122:P670Q;ENSP00000415573:P450Q	ENSP00000309772:P670Q	P	+	2	0	C7orf58	120569385	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.634000	0.67833	2.885000	0.99019	0.655000	0.94253	CCA		0.433	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913		31	156	1	0	4.15321e-07	0.001786	6.06043e-07	31	156				
POT1	25913	broad.mit.edu	37	7	124475445	124475445	+	Nonsense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:124475445T>A	ENST00000357628.3	-	15	1991	c.1393A>T	c.(1393-1395)Aaa>Taa	p.K465*	POT1_ENST00000393329.1_Nonsense_Mutation_p.K334*	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	465					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)	p.K465*(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						TTCGAGAGTTTGCAAATTTCA	0.363																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	uc003vlm.2		NA																	2	Substitution - Nonsense(2)		lung(2)	central_nervous_system(1)	1						c.(1393-1395)AAA>TAA		protection of telomeres 1 isoform 1							134.0	135.0	135.0					7																	124475445		2203	4300	6503	SO:0001587	stop_gained	25913				DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity	g.chr7:124475445T>A	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.1393A>T	7.37:g.124475445T>A	ENSP00000350249:p.Lys465*					POT1_uc011koe.1_RNA|POT1_uc003vlk.2_RNA|POT1_uc003vll.2_RNA|POT1_uc003vlo.2_Nonsense_Mutation_p.K334*|POT1_uc003vln.2_RNA	p.K465*	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN			15	1994	-			465					O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Nonsense_Mutation	SNP	ENST00000357628.3	37	c.1393A>T	CCDS5793.1	.	.	.	.	.	.	.	.	.	.	T	45	11.518113	0.99571	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000265391	.	.	.	5.33	4.1	0.47936	.	0.328118	0.36444	N	0.002585	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7323	11.8414	0.52357	0.0:0.0:0.1451:0.8549	.	.	.	.	X	465;334;465;464	.	ENSP00000265391:K464X	K	-	1	0	POT1	124262681	0.997000	0.39634	0.536000	0.28039	0.988000	0.76386	3.105000	0.50314	2.139000	0.66308	0.482000	0.46254	AAA		0.363	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1			21	74	0	0	0	0.002299	0	21	74				
ZNF800	168850	broad.mit.edu	37	7	127014765	127014765	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:127014765C>A	ENST00000393313.1	-	5	1216	c.625G>T	c.(625-627)Gaa>Taa	p.E209*	ZNF800_ENST00000393312.1_Nonsense_Mutation_p.E209*|ZNF800_ENST00000265827.3_Nonsense_Mutation_p.E209*|ZNF800_ENST00000485577.1_5'Flank			Q2TB10	ZN800_HUMAN	zinc finger protein 800	209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E209*(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						TGAGGTTGTTCATCAGATGTA	0.418																																							uc003vlx.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(625-627)GAA>TAA		zinc finger protein 800							114.0	112.0	113.0					7																	127014765		2203	4300	6503	SO:0001587	stop_gained	168850				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:127014765C>A	AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.625G>T	7.37:g.127014765C>A	ENSP00000376989:p.Glu209*					ZNF800_uc003vlw.1_Nonsense_Mutation_p.E112*|ZNF800_uc003vly.1_Nonsense_Mutation_p.E209*|ZNF800_uc010lla.2_Nonsense_Mutation_p.E209*	p.E209*	NM_176814	NP_789784	Q2TB10	ZN800_HUMAN			5	888	-			209					Q9HBN0	Nonsense_Mutation	SNP	ENST00000393313.1	37	c.625G>T	CCDS5795.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.451570	0.63290	.	.	ENSG00000048405	ENST00000393313;ENST00000265827;ENST00000393312;ENST00000434602	.	.	.	5.68	5.68	0.88126	.	0.045294	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-1.1293	18.7799	0.91928	0.0:1.0:0.0:0.0	.	.	.	.	X	209	.	ENSP00000265827:E209X	E	-	1	0	ZNF800	126802001	1.000000	0.71417	0.988000	0.46212	0.749000	0.42624	3.535000	0.53575	2.685000	0.91497	0.650000	0.86243	GAA		0.418	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141823.1	NM_176814		32	109	1	0	3.57733e-08	0.001786	5.43349e-08	32	109				
HIPK2	28996	broad.mit.edu	37	7	139416353	139416353	+	Missense_Mutation	SNP	C	C	A	rs577031287		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:139416353C>A	ENST00000406875.3	-	2	575	c.481G>T	c.(481-483)Gcc>Tcc	p.A161S	HIPK2_ENST00000342645.6_Missense_Mutation_p.A161S|HIPK2_ENST00000428878.2_Missense_Mutation_p.A161S	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	161	Transcriptional corepression. {ECO:0000250}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)	p.A161S(2)		breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					GCGACAGTGGCCCCGCTTGCA	0.557																																							uc003vvf.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|central_nervous_system(3)|skin(1)	7						c.(481-483)GCC>TCC		homeodomain interacting protein kinase 2 isoform							139.0	121.0	127.0					7																	139416353		1568	3582	5150	SO:0001583	missense	28996				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding	g.chr7:139416353C>A	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.481G>T	7.37:g.139416353C>A	ENSP00000385571:p.Ala161Ser					HIPK2_uc003vvd.3_Missense_Mutation_p.A161S	p.A161S	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN			2	655	-	Melanoma(164;0.205)		161			Transcriptional corepression (By similarity).		Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37	c.481G>T		.	.	.	.	.	.	.	.	.	.	C	13.41	2.228237	0.39399	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.52983	0.64;0.68;0.68	5.41	5.41	0.78517	.	.	.	.	.	T	0.42585	0.1209	.	.	.	0.58432	D	0.999997	B;P	0.48162	0.278;0.906	B;B	0.43536	0.079;0.423	T	0.17592	-1.0364	8	0.15499	T	0.54	.	19.2039	0.93722	0.0:1.0:0.0:0.0	.	161;161	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	S	161	ENSP00000385571:A161S;ENSP00000413724:A161S;ENSP00000343108:A161S	ENSP00000343108:A161S	A	-	1	0	HIPK2	139062839	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	6.026000	0.70873	2.523000	0.85059	0.655000	0.94253	GCC		0.557	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740		26	113	1	0	5.61819e-17	0.005443	1.13066e-16	26	113				
BRAF	673	broad.mit.edu	37	7	140453193	140453193	+	Splice_Site	SNP	T	T	C	rs121913370		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:140453193T>C	ENST00000288602.6	-	15	1802	c.1742A>G	c.(1741-1743)aAt>aGt	p.N581S		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	581	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> D (in CFC1). {ECO:0000269|PubMed:16439621, ECO:0000269|PubMed:16474404, ECO:0000269|PubMed:18042262}.|N -> S (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N581S(9)|p.N581I(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	AAGAAATATATCTGAGGTGTA	0.358		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3		61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	10	Substitution - Missense(10)	p.N581S(7)|p.N581Y(1)|p.N581I(1)	large_intestine(3)|lung(3)|skin(2)|ovary(1)|soft_tissue(1)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.(1741-1743)AAT>AGT		B-Raf	Sorafenib(DB00398)						86.0	83.0	84.0					7																	140453193		2203	4298	6501	SO:0001630	splice_region_variant	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140453193T>C	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1742-1A>G	7.37:g.140453193T>C							p.N581S	NM_004333	NP_004324	P15056	BRAF_HUMAN			15	1803	-	Melanoma(164;0.00956)		581		N -> D (in CFC syndrome).|N -> S (in a colorectal adenocarcinoma sample; somatic mutation).	Protein kinase.		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	c.1742A>G	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.68|17.68	3.450518|3.450518	0.63290|0.63290	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000496384|ENST00000288602	.|D	.|0.99803	.|-6.82	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99864|0.99864	0.9936|0.9936	H|H	0.96970|0.96970	3.915|3.915	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.96655|0.96655	0.9484|0.9484	5|10	.|0.59425	.|D	.|0.04	.|.	15.9326|15.9326	0.79675|0.79675	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|581	.|P15056	.|BRAF_HUMAN	V|S	189|581	.|ENSP00000288602:N581S	.|ENSP00000288602:N581S	I|N	-|-	1|2	0|0	BRAF|BRAF	140099662|140099662	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.921000|7.921000	0.87530|0.87530	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	ATA|AAT		0.358	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	Missense_Mutation	8	76	0	0	0	0.006214	0	8	76				
TAS2R60	338398	broad.mit.edu	37	7	143140666	143140666	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:143140666G>T	ENST00000332690.1	+	1	121	c.121G>T	c.(121-123)Gct>Tct	p.A41S	EPHA1-AS1_ENST00000429289.1_RNA	NM_177437.1	NP_803186.1	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	41					sensory perception of bitter taste (GO:0050913)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A41S(1)		breast(1)|kidney(1)|large_intestine(2)|lung(17)|prostate(1)|skin(7)|urinary_tract(2)	31	Melanoma(164;0.172)					CATCACTGCTGCTCTGGGCGT	0.493																																							uc011ktg.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(6)	6						c.(121-123)GCT>TCT		taste receptor, type 2, member 60							242.0	218.0	226.0					7																	143140666		2203	4300	6503	SO:0001583	missense	338398				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity	g.chr7:143140666G>T	AY114094	CCDS5885.1	7q35	2014-07-10			ENSG00000185899	ENSG00000185899		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	20639	protein-coding gene	gene with protein product		613968				12584440	Standard	NM_177437		Approved	T2R60	uc011ktg.2	P59551	OTTHUMG00000154891	ENST00000332690.1:c.121G>T	7.37:g.143140666G>T	ENSP00000327724:p.Ala41Ser					uc003wda.2_Intron	p.A41S	NM_177437	NP_803186	P59551	T2R60_HUMAN			1	121	+	Melanoma(164;0.172)		41			Helical; Name=2; (Potential).		A4D2G8|Q645W8|Q7RTR7	Missense_Mutation	SNP	ENST00000332690.1	37	c.121G>T	CCDS5885.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059330	0.36373	.	.	ENSG00000185899	ENST00000332690	T	0.38887	1.11	5.68	0.108	0.14548	.	1.093040	0.07163	U	0.851052	T	0.51058	0.1652	L	0.50333	1.59	0.09310	N	1	D	0.58970	0.984	P	0.60173	0.87	T	0.40942	-0.9536	10	0.72032	D	0.01	.	6.1633	0.20376	0.1845:0.4512:0.3643:0.0	.	41	P59551	T2R60_HUMAN	S	41	ENSP00000327724:A41S	ENSP00000327724:A41S	A	+	1	0	TAS2R60	142850788	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.112000	0.10791	0.007000	0.14760	-0.150000	0.13652	GCT		0.493	TAS2R60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337541.1			42	124	1	0	1.62957e-23	0.00874	3.61047e-23	42	124				
KCNH2	3757	broad.mit.edu	37	7	150644045	150644045	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:150644045G>T	ENST00000262186.5	-	14	3651	c.3250C>A	c.(3250-3252)Ccg>Acg	p.P1084T	KCNH2_ENST00000392968.2_Missense_Mutation_p.P988T|KCNH2_ENST00000330883.4_Missense_Mutation_p.P744T	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1084					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.P1084T(1)		NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CCAGGCCCCGGGGTGGTCACA	0.662																																					GBM(137;110 1844 13671 20123 45161)	GBM(137;110 1844 13671 20123 45161)	uc003wic.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(3250-3252)CCG>ACG		voltage-gated potassium channel, subfamily H,	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)						55.0	57.0	56.0					7																	150644045		2203	4300	6503	SO:0001583	missense	3757				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity	g.chr7:150644045G>T	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3250C>A	7.37:g.150644045G>T	ENSP00000262186:p.Pro1084Thr					KCNH2_uc003wib.2_Missense_Mutation_p.P744T|KCNH2_uc011kux.1_Missense_Mutation_p.P988T	p.P1084T	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	14	3263	-	all_neural(206;0.219)		1084			Cytoplasmic (Potential).		A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	c.3250C>A	CCDS5910.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.88|14.88	2.668718|2.668718	0.47677|0.47677	.|.	.|.	ENSG00000055118|ENSG00000055118	ENST00000350328|ENST00000330883;ENST00000392968;ENST00000262186	.|D;D;D	.|0.85339	.|-1.97;-1.97;-1.97	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	0.144412|0.144412	0.46145|0.46145	D|D	0.000311|0.000311	T|T	0.81847|0.81847	0.4909|0.4909	N|N	0.12746|0.12746	0.255|0.255	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.54964	.|0.948;0.948;0.969	.|P;P;P	.|0.54431	.|0.57;0.57;0.752	D|D	0.84223|0.84223	0.0462|0.0462	7|10	0.87932|0.48119	D|T	0|0.1	.|.	15.9235|15.9235	0.79592|0.79592	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|988;1084;744	.|C4PFH9;Q12809;Q12809-2	.|.;KCNH2_HUMAN;.	H|T	360|744;988;1084	.|ENSP00000328531:P744T;ENSP00000376695:P988T;ENSP00000262186:P1084T	ENSP00000309393:P360H|ENSP00000262186:P1084T	P|P	-|-	2|1	0|0	KCNH2|KCNH2	150274978|150274978	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.753000|0.753000	0.42808|0.42808	2.485000|2.485000	0.45250|0.45250	2.426000|2.426000	0.82243|0.82243	0.484000|0.484000	0.47621|0.47621	CCC|CCG		0.662	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238		18	97	1	0	8.34094e-07	0.008871	1.17797e-06	18	97				
PTPRN2	5799	broad.mit.edu	37	7	157959945	157959945	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr7:157959945C>A	ENST00000389418.4	-	6	597	c.588G>T	c.(586-588)gtG>gtT	p.V196V	PTPRN2_ENST00000389416.4_Silent_p.V179V|PTPRN2_ENST00000404321.2_Silent_p.V219V|PTPRN2_ENST00000389413.3_Silent_p.V196V|PTPRN2_ENST00000409483.1_Silent_p.V158V	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	196					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.V196V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ACGTGTGGGCCACATAGGTCA	0.627																																							uc003wno.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7						c.(586-588)GTG>GTT		protein tyrosine phosphatase, receptor type, N							67.0	66.0	66.0					7																	157959945		2203	4300	6503	SO:0001819	synonymous_variant	5799					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:157959945C>A	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.588G>T	7.37:g.157959945C>A						PTPRN2_uc003wnp.2_Silent_p.V179V|PTPRN2_uc003wnq.2_Silent_p.V196V|PTPRN2_uc003wnr.2_Silent_p.V158V|PTPRN2_uc011kwa.1_Silent_p.V219V	p.V196V	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)	6	709	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	196			Extracellular (Potential).		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	ENST00000389418.4	37	c.588G>T	CCDS5947.1																																																																																				0.627	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1			10	78	1	0	0.000442599	0.006214	0.000556707	10	78				
CSMD1	64478	broad.mit.edu	37	8	3076867	3076867	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr8:3076867C>G	ENST00000520002.1	-	30	5140	c.4585G>C	c.(4585-4587)Gaa>Caa	p.E1529Q	CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602723.1_Missense_Mutation_p.E1529Q|CSMD1_ENST00000539096.1_Missense_Mutation_p.E1528Q|CSMD1_ENST00000542608.1_Missense_Mutation_p.E1528Q|CSMD1_ENST00000400186.3_Missense_Mutation_p.E1529Q|CSMD1_ENST00000602557.1_Missense_Mutation_p.E1529Q|CSMD1_ENST00000537824.1_Missense_Mutation_p.E1528Q			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1529	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.E1528Q(1)|p.E1257Q(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCTATTCTTTCTGGGGCCTGA	0.498																																							uc011kwk.1		NA																	2	Substitution - Missense(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(4585-4587)GAA>CAA		CUB and Sushi multiple domains 1 precursor							38.0	42.0	41.0					8																	3076867		1825	4088	5913	SO:0001583	missense	64478					integral to membrane		g.chr8:3076867C>G			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4585G>C	8.37:g.3076867C>G	ENSP00000430733:p.Glu1529Gln					CSMD1_uc011kwj.1_Missense_Mutation_p.E921Q|CSMD1_uc003wqe.2_Missense_Mutation_p.E685Q	p.E1529Q	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	29	4975	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	1529			Extracellular (Potential).|CUB 9.		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.4585G>C		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.25|15.25	2.776344|2.776344	0.49786|0.49786	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.19105|.	2.17;2.17;2.17;2.17;2.17|.	5.48|5.48	5.48|5.48	0.80851|0.80851	CUB (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60728|0.60728	0.2291|0.2291	L|L	0.33710|0.33710	1.025|1.025	0.80722|0.80722	D|D	1|1	B;P;D|.	0.58268|.	0.25;0.849;0.982|.	B;P;D|.	0.65987|.	0.138;0.704;0.94|.	T|T	0.53913|0.53913	-0.8371|-0.8371	10|5	0.33940|.	T|.	0.23|.	.|.	19.7147|19.7147	0.96110|0.96110	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1529;1529;1529|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	Q|T	1529;1529;1391;1528;1528;1528|1008	ENSP00000383047:E1529Q;ENSP00000430733:E1529Q;ENSP00000441462:E1528Q;ENSP00000446243:E1528Q;ENSP00000441675:E1528Q|.	ENSP00000320445:E1391Q|.	E|R	-|-	1|2	0|0	CSMD1|CSMD1	3064274|3064274	1.000000|1.000000	0.71417|0.71417	0.152000|0.152000	0.22495|0.22495	0.211000|0.211000	0.24417|0.24417	7.564000|7.564000	0.82326|0.82326	2.724000|2.724000	0.93272|0.93272	0.555000|0.555000	0.69702|0.69702	GAA|AGA		0.498	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		2	3	0	0	0	0.004672	0	2	3				
BLK	640	broad.mit.edu	37	8	11414294	11414294	+	Silent	SNP	C	C	T	rs139994406	byFrequency	TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr8:11414294C>T	ENST00000259089.4	+	9	1492	c.900C>T	c.(898-900)taC>taT	p.Y300Y	RP11-148O21.4_ENST00000528629.1_RNA|BLK_ENST00000529894.1_Silent_p.Y229Y|RP11-148O21.2_ENST00000533322.1_RNA|RP11-148O21.3_ENST00000527922.1_RNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	300	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.Y300Y(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		TCCGACTCTACGCAGTGGTCA	0.617													C|||	2	0.000399361	0.0	0.0	5008	,	,		16603	0.001		0.0	False		,,,				2504	0.001						uc003wty.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|stomach(1)|ovary(1)	3						c.(898-900)TAC>TAT		B lymphoid tyrosine kinase		C		0,4406		0,0,2203	82.0	67.0	72.0		900	-1.4	1.0	8	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BLK	NM_001715.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		300/506	11414294	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	640				intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr8:11414294C>T	BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.900C>T	8.37:g.11414294C>T						BLK_uc003wtz.2_Silent_p.Y229Y	p.Y300Y	NM_001715	NP_001706	P51451	BLK_HUMAN	STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)	9	1481	+			300			Protein kinase.		Q16291|Q96IN1	Silent	SNP	ENST00000259089.4	37	c.900C>T	CCDS5982.1																																																																																				0.617	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207460.1			8	35	0	0	0	0.00308	0	8	35				
NEFL	4747	broad.mit.edu	37	8	24811218	24811218	+	RNA	SNP	G	G	A	rs191346286		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr8:24811218G>A	ENST00000221169.5	-	0	1855				CTD-2168K21.2_ENST00000607735.1_RNA			P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)	p.R421*(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TAGGCAGATCGGCCAAAGACC	0.572																																							uc003xee.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1261-1263)CGA>TGA		neurofilament, light polypeptide 68kDa							53.0	61.0	58.0					8																	24811218		1960	4163	6123			4747				anterograde axon cargo transport|axon transport of mitochondrion|neurofilament bundle assembly|retrograde axon cargo transport|synaptic transmission	cytosol|neurofilament	identical protein binding|protein C-terminus binding|structural constituent of cytoskeleton	g.chr8:24811218G>A		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24811218G>A							p.R421*	NM_006158	NP_006149	P07196	NFL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)	3	1363	-		Ovarian(32;0.00965)|Prostate(55;0.157)	421			Tail.|Tail, subdomain A.		B9ZVN2|Q16154|Q8IU72	Nonsense_Mutation	SNP	ENST00000221169.5	37	c.1261C>T																																																																																					0.572	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158		13	78	0	0	0	0.00245	0	13	78				
ADAM9	8754	broad.mit.edu	37	8	38948862	38948862	+	Silent	SNP	A	A	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr8:38948862A>G	ENST00000487273.2	+	20	2373	c.2295A>G	c.(2293-2295)gaA>gaG	p.E765E		NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	765				Missing (in Ref. 2; no nucleotide entry). {ECO:0000305}.	activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.E765E(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			CTCCCAGAGAAGTTGTAAGTA	0.348																																							uc003xmr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2293-2295)GAA>GAG		ADAM metallopeptidase domain 9 isoform 1							78.0	84.0	82.0					8																	38948862		2203	4300	6503	SO:0001819	synonymous_variant	8754				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding	g.chr8:38948862A>G	U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.2295A>G	8.37:g.38948862A>G						ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA|ADAM9_uc003xms.2_RNA	p.E765E	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	LUSC - Lung squamous cell carcinoma(45;2.74e-07)		20	2373	+		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	765	Missing (in Ref. 2; no nucleotide entry).		Cytoplasmic (Potential).		B7ZLN7|Q10718|Q8NFM6	Silent	SNP	ENST00000487273.2	37	c.2295A>G	CCDS6112.1																																																																																				0.348	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2			19	153	0	0	0	0.006122	0	19	153				
HOOK3	84376	broad.mit.edu	37	8	42823213	42823213	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr8:42823213G>T	ENST00000307602.4	+	11	1178	c.978G>T	c.(976-978)aaG>aaT	p.K326N		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	326					cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)	p.K326N(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			ATAAAAAGAAGCTAGAAGACC	0.338			T	RET	papillary thyroid																																		uc003xpr.2		NA		Dom	yes		8	8p11.21	84376	T	hook homolog 3			E	RET		papillary thyroid		1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(976-978)AAG>AAT		golgi-associated microtubule-binding protein							70.0	73.0	72.0					8																	42823213		2203	4300	6503	SO:0001583	missense	84376				cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding	g.chr8:42823213G>T	AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.978G>T	8.37:g.42823213G>T	ENSP00000305699:p.Lys326Asn					HOOK3_uc010lxq.1_Missense_Mutation_p.K326N	p.K326N	NM_032410	NP_115786	Q86VS8	HOOK3_HUMAN	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)		11	1220	+	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	326			Potential.		D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	ENST00000307602.4	37	c.978G>T	CCDS6139.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419630	0.62622	.	.	ENSG00000168172	ENST00000307602	T	0.27256	1.68	5.37	3.55	0.40652	.	0.000000	0.85682	D	0.000000	T	0.50086	0.1595	M	0.83312	2.635	0.42936	D	0.994339	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.55153	-0.8185	10	0.87932	D	0	-27.757	9.0869	0.36587	0.2867:0.0:0.7133:0.0	.	326;326	Q2VJ45;Q86VS8	.;HOOK3_HUMAN	N	326	ENSP00000305699:K326N	ENSP00000305699:K326N	K	+	3	2	HOOK3	42942370	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.262000	0.32992	1.383000	0.46405	0.655000	0.94253	AAG		0.338	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383172.2	NM_032410		28	57	1	0	2.65835e-16	0.007291	5.26222e-16	28	57				
OPRK1	4986	broad.mit.edu	37	8	54142028	54142028	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr8:54142028G>T	ENST00000265572.3	-	4	1269	c.972C>A	c.(970-972)agC>agA	p.S324R	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000524278.1_Missense_Mutation_p.S235R|OPRK1_ENST00000520287.1_Missense_Mutation_p.S324R	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	324					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)	p.S324R(1)		NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TGGGATTCAGGCTACTGTTGG	0.512																																							uc003xrh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(970-972)AGC>AGA		opioid receptor, kappa 1	Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)						78.0	71.0	73.0					8																	54142028		2203	4300	6503	SO:0001583	missense	4986				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding	g.chr8:54142028G>T		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.972C>A	8.37:g.54142028G>T	ENSP00000265572:p.Ser324Arg					OPRK1_uc003xri.1_Missense_Mutation_p.S324R|OPRK1_uc010lyc.1_Missense_Mutation_p.S235R	p.S324R	NM_000912	NP_000903	P41145	OPRK_HUMAN			3	1347	-		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)	324			Helical; Name=7; (Potential).		E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	37	c.972C>A	CCDS6152.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419620	0.83559	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.38560	1.13;1.13;1.13	5.8	4.92	0.64577	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.73345	0.3575	H	0.94345	3.525	0.80722	D	1	D	0.71674	0.998	D	0.75020	0.985	T	0.82210	-0.0570	10	0.87932	D	0	.	15.0098	0.71542	0.0683:0.0:0.9317:0.0	.	324	P41145	OPRK_HUMAN	R	324;235;324;310	ENSP00000265572:S324R;ENSP00000430923:S235R;ENSP00000429706:S324R	ENSP00000265572:S324R	S	-	3	2	OPRK1	54304581	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.912000	0.63335	1.454000	0.47793	0.650000	0.86243	AGC		0.512	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1			8	65	1	0	0.00307968	0.00308	0.00370021	8	65				
EYA1	2138	broad.mit.edu	37	8	72246386	72246386	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr8:72246386T>A	ENST00000340726.3	-	4	787	c.148A>T	c.(148-150)Agt>Tgt	p.S50C	EYA1_ENST00000388742.4_Missense_Mutation_p.S50C|EYA1_ENST00000303824.7_Missense_Mutation_p.S50C|EYA1_ENST00000388741.2_Missense_Mutation_p.S17C|EYA1_ENST00000388743.2_Missense_Mutation_p.S50C|EYA1_ENST00000388740.3_Missense_Mutation_p.S17C|EYA1_ENST00000419131.1_Missense_Mutation_p.S50C	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	50					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)	p.S50C(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			GCTGTTTCACTGCTGCTCATT	0.328																																							uc003xys.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5						c.(148-150)AGT>TGT		eyes absent 1 isoform b							128.0	123.0	125.0					8																	72246386		2203	4300	6503	SO:0001583	missense	2138				double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr8:72246386T>A	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.148A>T	8.37:g.72246386T>A	ENSP00000342626:p.Ser50Cys					EYA1_uc003xyr.3_Missense_Mutation_p.S50C|EYA1_uc003xyt.3_Missense_Mutation_p.S17C|EYA1_uc010lzf.2_5'UTR|EYA1_uc003xyu.2_Missense_Mutation_p.S50C|EYA1_uc011lfe.1_Missense_Mutation_p.S50C|EYA1_uc003xyv.2_5'UTR	p.S50C	NM_172058	NP_742055	Q99502	EYA1_HUMAN	Epithelial(68;0.0837)|all cancers(69;0.247)		3	435	-	Breast(64;0.046)		50					A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	c.148A>T	CCDS34906.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.385933	0.82902	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	T;T;T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54	5.65	5.65	0.86999	.	0.037898	0.85682	D	0.000000	T	0.77605	0.4155	L	0.50333	1.59	0.58432	D	0.999993	D;D;D;D	0.67145	0.965;0.996;0.986;0.972	P;P;P;P	0.59948	0.759;0.866;0.776;0.866	T	0.79718	-0.1686	10	0.72032	D	0.01	-18.3797	13.6809	0.62484	0.0:0.0:0.0:1.0	.	50;17;50;50	A6NCB9;Q99502-2;Q99502;G5E9R4	.;.;EYA1_HUMAN;.	C	50;50;18;17;50;17;50;50	ENSP00000373394:S50C;ENSP00000342626:S50C;ENSP00000373392:S17C;ENSP00000303221:S50C;ENSP00000373393:S17C;ENSP00000373395:S50C;ENSP00000410176:S50C	ENSP00000303221:S50C	S	-	1	0	EYA1	72408940	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.053000	0.64269	2.272000	0.75746	0.460000	0.39030	AGT		0.328	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060		32	62	0	0	0	0.002836	0	32	62				
CSMD3	114788	broad.mit.edu	37	8	114186001	114186001	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr8:114186001G>T	ENST00000297405.5	-	4	903	c.659C>A	c.(658-660)gCc>gAc	p.A220D	CSMD3_ENST00000352409.3_Missense_Mutation_p.A220D|CSMD3_ENST00000343508.3_Missense_Mutation_p.A180D|CSMD3_ENST00000519485.1_5'UTR|CSMD3_ENST00000455883.2_Missense_Mutation_p.A220D	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	220	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A220D(1)|p.A180D(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AACTGAATTGGCTATGCAGGT	0.428										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(658-660)GCC>GAC		CUB and Sushi multiple domains 3 isoform 1							134.0	124.0	128.0					8																	114186001		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:114186001G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.659C>A	8.37:g.114186001G>T	ENSP00000297405:p.Ala220Asp	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003ynt.2_Missense_Mutation_p.A180D|CSMD3_uc011lhx.1_Missense_Mutation_p.A220D|CSMD3_uc010mcx.1_Missense_Mutation_p.A220D	p.A220D	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			4	818	-			220			Extracellular (Potential).|Sushi 1.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.659C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524186	0.85600	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	5.09	5.09	0.68999	Complement control module (2);Sushi/SCR/CCP (3);	0.297839	0.26400	N	0.024590	T	0.39759	0.1090	L	0.51422	1.61	0.34129	D	0.665001	B;P;P;D	0.65815	0.275;0.557;0.837;0.995	B;B;P;D	0.66979	0.206;0.277;0.493;0.948	T	0.43212	-0.9405	10	0.23891	T	0.37	.	11.3621	0.49648	0.083:0.0:0.917:0.0	.	220;220;220;180	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	D	180;220;220;220	ENSP00000345799:A180D;ENSP00000297405:A220D;ENSP00000412263:A220D;ENSP00000343124:A220D	ENSP00000297405:A220D	A	-	2	0	CSMD3	114255177	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.161000	0.58170	2.533000	0.85409	0.650000	0.86243	GCC		0.428	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		20	99	1	0	1.10513e-12	0.002299	1.99917e-12	20	99				
COL14A1	7373	broad.mit.edu	37	8	121381596	121381596	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr8:121381596G>T	ENST00000297848.3	+	47	5453	c.5183G>T	c.(5182-5184)aGc>aTc	p.S1728I	COL14A1_ENST00000247781.3_Missense_Mutation_p.S1633I|COL14A1_ENST00000309791.4_Missense_Mutation_p.S1728I	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.S1728I(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CGGCCTGGCAGCCCTGGGCCC	0.582																																							uc003yox.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(5182-5184)AGC>ATC		collagen, type XIV, alpha 1 precursor							49.0	54.0	52.0					8																	121381596		2203	4300	6503	SO:0001583	missense	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121381596G>T		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.5183G>T	8.37:g.121381596G>T	ENSP00000297848:p.Ser1728Ile					COL14A1_uc003yoz.2_Missense_Mutation_p.S693I	p.S1728I	NM_021110	NP_066933	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		47	5448	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		1728			Triple-helical region 2 (COL1).			Missense_Mutation	SNP	ENST00000297848.3	37	c.5183G>T	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.790326	0.70337	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000440844	D;D;D;D	0.94376	-2.17;-2.18;-3.27;-3.41	4.84	3.03	0.35002	.	0.169491	0.64402	D	0.000006	D	0.90587	0.7049	L	0.28649	0.875	0.80722	D	1	D	0.56521	0.976	P	0.53450	0.726	D	0.86178	0.1604	10	0.16896	T	0.51	.	11.3741	0.49717	0.1508:0.0:0.8492:0.0	.	1728	Q05707	COEA1_HUMAN	I	1728;1728;1633;75	ENSP00000311809:S1728I;ENSP00000297848:S1728I;ENSP00000247781:S1633I;ENSP00000403640:S75I	ENSP00000247781:S1633I	S	+	2	0	COL14A1	121450777	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	4.807000	0.62576	0.718000	0.32166	0.561000	0.74099	AGC		0.582	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		16	95	1	0	2.23348e-06	0.004007	3.09992e-06	16	95				
SPATA6L	55064	broad.mit.edu	37	9	4625390	4625390	+	Missense_Mutation	SNP	C	C	A	rs535794399		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr9:4625390C>A	ENST00000454239.2	-	7	851	c.606G>T	c.(604-606)caG>caT	p.Q202H	SPATA6L_ENST00000381890.5_Missense_Mutation_p.Q216H|SPATA6L_ENST00000381895.5_Missense_Mutation_p.Q79H|SPATA6L_ENST00000223517.5_5'Flank|SPATA6L_ENST00000475086.1_Missense_Mutation_p.Q144H			Q8N4H0	SPA6L_HUMAN	spermatogenesis associated 6-like	202								p.Q202H(1)									CAAGGTTCAACTGAGCTGGCT	0.428																																							uc011llz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(430-432)CAG>CAT		hypothetical protein LOC55064							72.0	71.0	71.0					9																	4625390		1841	4095	5936	SO:0001583	missense	55064							g.chr9:4625390C>A	AK000920	CCDS43785.1, CCDS43785.2	9p24.2	2012-03-15	2012-03-15	2012-03-15	ENSG00000106686	ENSG00000106686			25472	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 68"""	C9orf68			Standard	NM_001039395		Approved	FLJ10058	uc011llz.2	Q8N4H0	OTTHUMG00000019469	ENST00000454239.2:c.606G>T	9.37:g.4625390C>A	ENSP00000404277:p.Gln202His					C9orf68_uc003zik.2_RNA|C9orf68_uc003zil.2_RNA|C9orf68_uc010mhj.2_Missense_Mutation_p.Q202H|C9orf68_uc011lly.1_Missense_Mutation_p.Q79H	p.Q144H	NM_001039395	NP_001034484	B4DIY4	B4DIY4_HUMAN		GBM - Glioblastoma multiforme(50;0.0222)	5	670	-		Breast(48;0.0456)	144					B4DIY4|Q5JVJ5|Q8IY90	Missense_Mutation	SNP	ENST00000454239.2	37	c.432G>T		.	.	.	.	.	.	.	.	.	.	C	0.069	-1.207301	0.01568	.	.	ENSG00000106686	ENST00000454239;ENST00000381890;ENST00000475086;ENST00000381895	T;T;T;T	0.38560	2.2;1.13;2.25;1.93	5.22	-10.4	0.00318	.	0.847270	0.10467	N	0.671308	T	0.14399	0.0348	N	0.25647	0.755	0.09310	N	1	B;B;B	0.12630	0.004;0.002;0.006	B;B;B	0.11329	0.004;0.004;0.006	T	0.39643	-0.9604	10	0.05351	T	0.99	-14.5518	0.3167	0.00297	0.2586:0.2747:0.2242:0.2425	.	144;79;202	B4DIY4;E7ENB5;Q8N4H0	.;.;CI068_HUMAN	H	202;216;144;79	ENSP00000404277:Q202H;ENSP00000371314:Q216H;ENSP00000417063:Q144H;ENSP00000371319:Q79H	ENSP00000371314:Q216H	Q	-	3	2	C9orf68	4615390	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.884000	0.00174	-2.568000	0.00469	-0.182000	0.12963	CAG		0.428	SPATA6L-202	KNOWN	basic	protein_coding	protein_coding		NM_017985		20	68	1	0	1.96292e-10	0.001523	3.30345e-10	20	68				
SPATA6L	55064	broad.mit.edu	37	9	4625413	4625413	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr9:4625413A>C	ENST00000454239.2	-	7	828	c.583T>G	c.(583-585)Ttc>Gtc	p.F195V	SPATA6L_ENST00000381890.5_Missense_Mutation_p.F209V|SPATA6L_ENST00000381895.5_Missense_Mutation_p.F72V|SPATA6L_ENST00000223517.5_5'UTR|SPATA6L_ENST00000475086.1_Missense_Mutation_p.F137V			Q8N4H0	SPA6L_HUMAN	spermatogenesis associated 6-like	195								p.F195V(1)									TCCTGGAAGAAATGCCTGGTA	0.433																																							uc011llz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(409-411)TTC>GTC		hypothetical protein LOC55064							68.0	69.0	69.0					9																	4625413		1841	4089	5930	SO:0001583	missense	55064							g.chr9:4625413A>C	AK000920	CCDS43785.1, CCDS43785.2	9p24.2	2012-03-15	2012-03-15	2012-03-15	ENSG00000106686	ENSG00000106686			25472	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 68"""	C9orf68			Standard	NM_001039395		Approved	FLJ10058	uc011llz.2	Q8N4H0	OTTHUMG00000019469	ENST00000454239.2:c.583T>G	9.37:g.4625413A>C	ENSP00000404277:p.Phe195Val					C9orf68_uc003zik.2_RNA|C9orf68_uc003zil.2_RNA|C9orf68_uc010mhj.2_Missense_Mutation_p.F195V|C9orf68_uc011lly.1_Missense_Mutation_p.F72V	p.F137V	NM_001039395	NP_001034484	B4DIY4	B4DIY4_HUMAN		GBM - Glioblastoma multiforme(50;0.0222)	5	647	-		Breast(48;0.0456)	137					B4DIY4|Q5JVJ5|Q8IY90	Missense_Mutation	SNP	ENST00000454239.2	37	c.409T>G		.	.	.	.	.	.	.	.	.	.	A	10.13	1.264662	0.23136	.	.	ENSG00000106686	ENST00000454239;ENST00000381890;ENST00000475086;ENST00000381895	T;T;T;T	0.39787	2.07;1.06;2.07;2.06	5.22	1.43	0.22495	.	0.829223	0.10642	N	0.650904	T	0.26268	0.0641	L	0.34521	1.04	0.09310	N	1	B;B;B	0.28291	0.038;0.206;0.043	B;B;B	0.24269	0.052;0.052;0.032	T	0.20571	-1.0271	10	0.34782	T	0.22	-12.9179	2.8624	0.05591	0.3826:0.0:0.4037:0.2137	.	137;72;195	B4DIY4;E7ENB5;Q8N4H0	.;.;CI068_HUMAN	V	195;209;137;72	ENSP00000404277:F195V;ENSP00000371314:F209V;ENSP00000417063:F137V;ENSP00000371319:F72V	ENSP00000371314:F209V	F	-	1	0	C9orf68	4615413	0.001000	0.12720	0.000000	0.03702	0.115000	0.19883	0.693000	0.25497	0.100000	0.17581	0.528000	0.53228	TTC		0.433	SPATA6L-202	KNOWN	basic	protein_coding	protein_coding		NM_017985		19	71	0	0	0	0.007413	0	19	71				
KIAA2026	158358	broad.mit.edu	37	9	5920027	5920027	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr9:5920027G>C	ENST00000399933.3	-	8	5968	c.5969C>G	c.(5968-5970)gCt>gGt	p.A1990G	KIAA2026_ENST00000381461.2_Missense_Mutation_p.A1960G	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1990								p.A1165G(1)|p.A1990G(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		AGGAACCTTAGCAGTTGTGTT	0.398																																							uc003zjq.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(5968-5970)GCT>GGT		hypothetical protein LOC158358							166.0	159.0	161.0					9																	5920027		1930	4147	6077	SO:0001583	missense	158358							g.chr9:5920027G>C	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.5969C>G	9.37:g.5920027G>C	ENSP00000382815:p.Ala1990Gly					KIAA2026_uc010mht.2_Missense_Mutation_p.A1165G	p.A1990G	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)	8	6185	-		Acute lymphoblastic leukemia(23;0.158)	1990					A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37	c.5969C>G		.	.	.	.	.	.	.	.	.	.	G	1.514	-0.548719	0.04024	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.69	4.79	0.61399	.	0.359620	0.22692	N	0.056818	T	0.51907	0.1702	M	0.63428	1.95	0.23421	N	0.997711	B	0.17268	0.021	B	0.15484	0.013	T	0.46541	-0.9184	9	0.52906	T	0.07	-3.4866	14.4545	0.67407	0.0632:0.1078:0.8289:0.0	.	1990	Q5HYC2	K2026_HUMAN	G	1990;1960	.	ENSP00000370870:A1960G	A	-	2	0	KIAA2026	5910027	0.915000	0.31059	0.910000	0.35882	0.028000	0.11728	1.721000	0.38032	0.775000	0.33450	-0.797000	0.03246	GCT		0.398	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		35	193	0	0	0	0.004878	0	35	193				
KIAA2026	158358	broad.mit.edu	37	9	5920648	5920648	+	Missense_Mutation	SNP	C	C	A	rs369163099		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr9:5920648C>A	ENST00000399933.3	-	8	5347	c.5348G>T	c.(5347-5349)cGg>cTg	p.R1783L	KIAA2026_ENST00000381461.2_Missense_Mutation_p.R1753L	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1783								p.R1783L(1)|p.R958L(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GAGTGAAGTCCGAGATTGTCT	0.418																																							uc003zjq.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(5347-5349)CGG>CTG		hypothetical protein LOC158358							353.0	347.0	349.0					9																	5920648		1950	4134	6084	SO:0001583	missense	158358							g.chr9:5920648C>A	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.5348G>T	9.37:g.5920648C>A	ENSP00000382815:p.Arg1783Leu					KIAA2026_uc010mht.2_Missense_Mutation_p.R958L	p.R1783L	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)	8	5564	-		Acute lymphoblastic leukemia(23;0.158)	1783					A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37	c.5348G>T		.	.	.	.	.	.	.	.	.	.	C	9.678	1.148447	0.21288	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	6.1	1.69	0.24217	.	1.011600	0.07926	N	0.976739	T	0.33847	0.0877	L	0.54323	1.7	0.20821	N	0.999848	B	0.32071	0.355	B	0.28849	0.095	T	0.24870	-1.0148	9	0.27082	T	0.32	0.5065	4.929	0.13907	0.0:0.4099:0.1985:0.3916	.	1783	Q5HYC2	K2026_HUMAN	L	1783;1753	.	ENSP00000370870:R1753L	R	-	2	0	KIAA2026	5910648	0.015000	0.18098	0.975000	0.42487	0.988000	0.76386	-0.263000	0.08670	0.442000	0.26555	0.650000	0.86243	CGG		0.418	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		116	487	1	0	3.35115e-56	0.00361	7.81934e-56	116	487				
FOCAD	54914	broad.mit.edu	37	9	20946798	20946798	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr9:20946798G>T	ENST00000380249.1	+	32	4018	c.3654G>T	c.(3652-3654)ctG>ctT	p.L1218L	FOCAD_ENST00000605086.1_Silent_p.L654L|FOCAD_ENST00000338382.6_Silent_p.L1218L	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1218						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.L1218L(1)									AGCTTCGACTGTTAGTGGAGA	0.453																																							uc003zog.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|breast(1)|kidney(1)	10						c.(3652-3654)CTG>CTT		hypothetical protein LOC54914							221.0	192.0	202.0					9																	20946798		2203	4300	6503	SO:0001819	synonymous_variant	54914					integral to membrane	binding	g.chr9:20946798G>T	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3654G>T	9.37:g.20946798G>T						KIAA1797_uc003zoh.1_Silent_p.L654L	p.L1218L	NM_017794	NP_060264	Q5VW36	K1797_HUMAN		GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)	32	4017	+			1218					D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Silent	SNP	ENST00000380249.1	37	c.3654G>T	CCDS34993.1																																																																																				0.453	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794		21	90	1	0	8.10497e-08	0.001523	1.22718e-07	21	90				
SHOX	6473	broad.mit.edu	37	X	591669	591669	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:591669G>T	ENST00000554971.1	+	1	128	c.37G>T	c.(37-39)Gac>Tac	p.D13Y	SHOX_ENST00000334060.3_Missense_Mutation_p.D13Y|SHOX_ENST00000381578.1_Missense_Mutation_p.D13Y|SHOX_ENST00000381575.1_Missense_Mutation_p.D13Y			O15266	SHOX_HUMAN	short stature homeobox	13					skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D13Y(1)		endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAAGTCTTTTGACCAGAAAAG	0.637																																					Ovarian(95;18 1419 12424 14056 28266)	Ovarian(95;18 1419 12424 14056 28266)	uc004cph.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(37-39)GAC>TAC		short stature homeobox isoform SHOXa							120.0	143.0	135.0					X																	591669		2203	4296	6499	SO:0001583	missense	6473				skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:591669G>T	U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.37G>T	X.37:g.591669G>T	ENSP00000452016:p.Asp13Tyr					SHOX_uc004cpi.2_Missense_Mutation_p.D13Y	p.D13Y	NM_000451	NP_000442	O15266	SHOX_HUMAN			2	728	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	13					O00412|O00413|O15267	Missense_Mutation	SNP	ENST00000554971.1	37	c.37G>T	CCDS14107.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007106	0.54361	.	.	ENSG00000185960	ENST00000334060;ENST00000381578;ENST00000554971;ENST00000381575	D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99	2.38	2.38	0.29361	.	0.145699	0.42821	U	0.000642	D	0.98476	0.9492	M	0.71581	2.175	0.09310	N	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.995	D	0.94881	0.8039	10	0.72032	D	0.01	.	12.494	0.55916	0.0:0.0:1.0:0.0	.	13;13	O15266-2;O15266	.;SHOX_HUMAN	Y	13	ENSP00000335505:D13Y;ENSP00000370990:D13Y;ENSP00000452016:D13Y;ENSP00000370987:D13Y	ENSP00000335505:D13Y	D	+	1	0	SHOX	511669	1.000000	0.71417	0.921000	0.36526	0.695000	0.40330	7.251000	0.78297	0.833000	0.34828	0.422000	0.28245	GAC		0.637	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411999.3	NM_000451		32	262	1	0	1.61788e-16	0.002445	3.21578e-16	32	262				
ARSF	416	broad.mit.edu	37	X	3002590	3002590	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:3002590C>A	ENST00000381127.1	+	6	934	c.713C>A	c.(712-714)aCg>aAg	p.T238K	ARSF_ENST00000537104.1_Missense_Mutation_p.T238K|ARSF_ENST00000359361.2_Missense_Mutation_p.T238K	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	238					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.T238K(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCCAGCCACACGTCCCCTTTA	0.547																																							uc004cre.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(712-714)ACG>AAG		arylsulfatase F precursor							111.0	95.0	100.0					X																	3002590		2203	4300	6503	SO:0001583	missense	416					extracellular region	arylsulfatase activity|metal ion binding	g.chrX:3002590C>A	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.713C>A	X.37:g.3002590C>A	ENSP00000370519:p.Thr238Lys					ARSF_uc004crf.1_Missense_Mutation_p.T238K	p.T238K	NM_004042	NP_004033	P54793	ARSF_HUMAN			6	934	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	238					Q8TCC5	Missense_Mutation	SNP	ENST00000381127.1	37	c.713C>A	CCDS14123.1	.	.	.	.	.	.	.	.	.	.	c	1.046	-0.677458	0.03378	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	D;D;D	0.93247	-3.19;-3.19;-3.19	3.3	-6.59	0.01830	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	2.837000	0.01749	N	0.029831	D	0.82793	0.5114	N	0.11756	0.17	0.09310	N	1	B	0.02656	0.0	B	0.14023	0.01	T	0.76578	-0.2908	10	0.17832	T	0.49	.	3.9405	0.09325	0.5074:0.1956:0.2143:0.0826	.	238	P54793	ARSF_HUMAN	K	238	ENSP00000370519:T238K;ENSP00000445594:T238K;ENSP00000352319:T238K	ENSP00000352319:T238K	T	+	2	0	ARSF	3012590	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.308000	0.02730	-2.787000	0.00358	-1.612000	0.00800	ACG		0.547	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1			14	129	1	0	3.41278e-10	0.00499	5.68405e-10	14	129				
NLGN4X	57502	broad.mit.edu	37	X	5821398	5821398	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:5821398C>A	ENST00000381095.3	-	5	1948	c.1321G>T	c.(1321-1323)Gtg>Ttg	p.V441L	NLGN4X_ENST00000381092.1_Missense_Mutation_p.V441L|NLGN4X_ENST00000538097.1_Missense_Mutation_p.V441L|NLGN4X_ENST00000275857.6_Missense_Mutation_p.V441L|NLGN4X_ENST00000381093.2_Missense_Mutation_p.V461L	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	441					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.V441L(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						AAGAGAGCCACCAGGGTTTTC	0.597																																							uc010ndh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(1321-1323)GTG>TTG		X-linked neuroligin 4 precursor							25.0	27.0	26.0					X																	5821398		2202	4297	6499	SO:0001583	missense	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5821398C>A	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1321G>T	X.37:g.5821398C>A	ENSP00000370485:p.Val441Leu					NLGN4X_uc004crp.2_Missense_Mutation_p.V461L|NLGN4X_uc004crq.2_Missense_Mutation_p.V441L|NLGN4X_uc010ndi.2_Missense_Mutation_p.V478L|NLGN4X_uc004crr.2_Missense_Mutation_p.V441L|NLGN4X_uc010ndj.2_Missense_Mutation_p.V441L	p.V441L	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN			5	1822	-			441			Extracellular (Potential).		Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	c.1321G>T	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	5.642	0.303113	0.10678	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24	3.8	3.8	0.43715	Carboxylesterase, type B (1);	.	.	.	.	T	0.48223	0.1488	N	0.11756	0.17	0.58432	D	0.999999	B;B;B	0.18610	0.029;0.011;0.008	B;B;B	0.25140	0.02;0.052;0.058	T	0.36890	-0.9729	8	.	.	.	.	14.2389	0.65945	0.0:1.0:0.0:0.0	.	498;441;461	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	L	441;461;441;441;441	ENSP00000370485:V441L;ENSP00000370483:V461L;ENSP00000275857:V441L;ENSP00000370482:V441L;ENSP00000439203:V441L	.	V	-	1	0	NLGN4X	5831398	1.000000	0.71417	0.782000	0.31804	0.106000	0.19336	5.037000	0.64170	1.512000	0.48834	0.513000	0.50165	GTG		0.597	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		16	57	1	0	6.49762e-13	0.006122	1.17983e-12	16	57				
ATXN3L	92552	broad.mit.edu	37	X	13337046	13337046	+	Silent	SNP	G	G	T	rs376950658		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:13337046G>T	ENST00000380622.2	-	1	1472	c.1008C>A	c.(1006-1008)gcC>gcA	p.A336A	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	336					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)	p.A336A(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						TGTCGACAGCGGCCTGTACTG	0.393																																							uc010ned.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(1006-1008)GCC>GCA		ataxin 3-like							177.0	152.0	159.0					X																	13337046		1568	3582	5150	SO:0001819	synonymous_variant	92552				protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity	g.chrX:13337046G>T		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.1008C>A	X.37:g.13337046G>T							p.A336A	NM_001135995	NP_001129467	Q9H3M9	ATX3L_HUMAN			1	1473	-			336					B2RNY8	Silent	SNP	ENST00000380622.2	37	c.1008C>A	CCDS48080.1																																																																																				0.393	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995		63	210	1	0	2.23399e-28	0.00361	5.04215e-28	63	210				
EGFL6	25975	broad.mit.edu	37	X	13624574	13624574	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:13624574C>A	ENST00000361306.1	+	6	854	c.597C>A	c.(595-597)taC>taA	p.Y199*	EGFL6_ENST00000380602.3_Nonsense_Mutation_p.Y199*	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	199	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.Y199*(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						GAAGCTACTACTGCAAATGTC	0.413																																							uc004cvi.2		NA																	2	Substitution - Nonsense(2)		lung(2)	breast(2)	2						c.(595-597)TAC>TAA		epidermal growth factor-like protein 6							218.0	183.0	195.0					X																	13624574		2203	4300	6503	SO:0001587	stop_gained	25975				cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding	g.chrX:13624574C>A	AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.597C>A	X.37:g.13624574C>A	ENSP00000355126:p.Tyr199*					EGFL6_uc004cvj.2_Nonsense_Mutation_p.Y199*|EGFL6_uc011mik.1_Nonsense_Mutation_p.Y100*	p.Y199*	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN			6	837	+			199			EGF-like 4; calcium-binding (Potential).		B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Nonsense_Mutation	SNP	ENST00000361306.1	37	c.597C>A	CCDS14155.1	.	.	.	.	.	.	.	.	.	.	C	38	6.685774	0.97764	.	.	ENSG00000198759	ENST00000361306;ENST00000380602	.	.	.	5.14	1.42	0.22433	.	0.123460	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2914	0.37789	0.0:0.6905:0.0:0.3095	.	.	.	.	X	199	.	ENSP00000355126:Y199X	Y	+	3	2	EGFL6	13534495	0.999000	0.42202	0.997000	0.53966	0.976000	0.68499	0.718000	0.25866	-0.133000	0.11537	0.532000	0.56150	TAC		0.413	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055800.1	NM_015507		41	134	1	0	2.87052e-16	0.005524	5.65902e-16	41	134				
FANCB	2187	broad.mit.edu	37	X	14882911	14882911	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:14882911T>A	ENST00000324138.3	-	2	875	c.722A>T	c.(721-723)cAt>cTt	p.H241L	FANCB_ENST00000398334.1_Missense_Mutation_p.H241L	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	241					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)		p.H241L(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					TGCACAAATATGTACATAAGT	0.338								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc004cwg.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(721-723)CAT>CTT	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia complementation group B							83.0	80.0	81.0					X																	14882911		2203	4300	6503	SO:0001583	missense	2187	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	nucleoplasm		g.chrX:14882911T>A	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.722A>T	X.37:g.14882911T>A	ENSP00000326819:p.His241Leu					FANCB_uc004cwh.1_Missense_Mutation_p.H241L	p.H241L	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN			3	990	-	Hepatocellular(33;0.183)		241					B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	ENST00000324138.3	37	c.722A>T	CCDS14161.1	.	.	.	.	.	.	.	.	.	.	T	10.02	1.235112	0.22626	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	T;T;T	0.03152	4.03;4.03;4.03	5.43	1.64	0.23874	.	0.574549	0.19337	N	0.116750	T	0.07503	0.0189	L	0.55103	1.725	0.09310	N	1	D	0.58620	0.983	P	0.54544	0.755	T	0.21245	-1.0251	10	0.54805	T	0.06	-1.674	4.9723	0.14123	0.1276:0.2206:0.0:0.6518	.	241	Q8NB91	FANCB_HUMAN	L	241	ENSP00000326819:H241L;ENSP00000381378:H241L;ENSP00000397849:H241L	ENSP00000326819:H241L	H	-	2	0	FANCB	14792832	0.000000	0.05858	0.018000	0.16275	0.003000	0.03518	0.130000	0.15850	-0.002000	0.14469	0.417000	0.27973	CAT		0.338	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633		20	94	0	0	0	0.007413	0	20	94				
MOSPD2	158747	broad.mit.edu	37	X	14915215	14915215	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:14915215G>T	ENST00000380492.3	+	5	420	c.332G>T	c.(331-333)aGg>aTg	p.R111M	MOSPD2_ENST00000482354.1_Missense_Mutation_p.R111M|MOSPD2_ENST00000495110.1_3'UTR	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	111	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)	p.R111M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					GTCTGGATCAGGGTGAAGTAT	0.328																																							uc004cwi.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(331-333)AGG>ATG		motile sperm domain containing 2							89.0	85.0	86.0					X																	14915215		2203	4300	6503	SO:0001583	missense	158747					integral to membrane	structural molecule activity	g.chrX:14915215G>T	AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.332G>T	X.37:g.14915215G>T	ENSP00000369860:p.Arg111Met					MOSPD2_uc004cwj.2_Missense_Mutation_p.R48M	p.R111M	NM_152581	NP_689794	Q8NHP6	MSPD2_HUMAN			5	420	+	Hepatocellular(33;0.183)		111			CRAL-TRIO.		Q8N3H2|Q8NA83	Missense_Mutation	SNP	ENST00000380492.3	37	c.332G>T	CCDS14162.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.226259	0.58668	.	.	ENSG00000130150	ENST00000380492	T	0.78816	-1.21	5.23	4.37	0.52481	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.089646	0.64402	D	0.000001	T	0.80844	0.4701	L	0.43152	1.355	0.34695	D	0.726181	D	0.76494	0.999	D	0.70227	0.968	D	0.83888	0.0283	10	0.48119	T	0.1	.	7.8957	0.29704	0.2749:0.0:0.7251:0.0	.	111	Q8NHP6	MSPD2_HUMAN	M	111	ENSP00000369860:R111M	ENSP00000369860:R111M	R	+	2	0	MOSPD2	14825136	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	2.523000	0.45580	1.108000	0.41662	0.529000	0.55759	AGG		0.328	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055837.1	NM_152581		15	97	1	0	1.05317e-09	0.00245	1.70698e-09	15	97				
ASB11	140456	broad.mit.edu	37	X	15306059	15306059	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:15306059G>T	ENST00000480796.1	-	6	841	c.791C>A	c.(790-792)gCg>gAg	p.A264E	ASB11_ENST00000537676.1_Missense_Mutation_p.A243E|ASB11_ENST00000344384.4_Missense_Mutation_p.A243E|ASB11_ENST00000380470.3_Missense_Mutation_p.A247E			Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box containing 11, E3 ubiquitin protein ligase	264					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.A264E(2)|p.A243E(1)		breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(1)	16	Hepatocellular(33;0.183)					CAGATCAAGCGCACTTTTGCC	0.542																																							uc004cwp.1		NA																	3	Substitution - Missense(3)		lung(2)|ovary(1)	breast(2)|skin(1)	3						c.(790-792)GCG>GAG		ankyrin repeat and SOCS box-containing protein							124.0	97.0	106.0					X																	15306059		2203	4300	6503	SO:0001583	missense	140456				intracellular signal transduction			g.chrX:15306059G>T	AF425642	CCDS14164.1, CCDS35209.1, CCDS56596.1	Xp22.31	2014-02-10	2014-02-10		ENSG00000165192	ENSG00000165192		"""Ankyrin repeat domain containing"""	17186	protein-coding gene	gene with protein product		300626	"""ankyrin repeat and SOCS box-containing 11"", ""ankyrin repeat and SOCS box containing 11"""			24337577	Standard	NM_080873		Approved	DKFZp779E2460	uc004cwp.2	Q8WXH4	OTTHUMG00000021173	ENST00000480796.1:c.791C>A	X.37:g.15306059G>T	ENSP00000417914:p.Ala264Glu					ASB11_uc004cwo.1_Missense_Mutation_p.A243E|ASB11_uc010nes.1_RNA|ASB11_uc010net.1_Missense_Mutation_p.A247E	p.A264E	NM_080873	NP_543149	Q8WXH4	ASB11_HUMAN			6	791	-	Hepatocellular(33;0.183)		264					E9PEN1|Q3SYC4|Q7Z667	Missense_Mutation	SNP	ENST00000480796.1	37	c.791C>A	CCDS14164.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179073	0.78564	.	.	ENSG00000165192	ENST00000537676;ENST00000380470;ENST00000344384;ENST00000480796	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	5.44	5.44	0.79542	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000003	D	0.82683	0.5090	H	0.94503	3.545	0.23620	N	0.997276	D;D;D	0.89917	0.981;0.999;1.0	P;D;D	0.72982	0.9;0.966;0.979	T	0.79325	-0.1850	10	0.87932	D	0	-4.8556	17.2286	0.86978	0.0:0.0:1.0:0.0	.	247;264;243	Q7Z667;Q8WXH4;E9PEN1	.;ASB11_HUMAN;.	E	243;247;243;264	ENSP00000445465:A243E;ENSP00000369837:A247E;ENSP00000343408:A243E;ENSP00000417914:A264E	ENSP00000343408:A243E	A	-	2	0	ASB11	15215980	1.000000	0.71417	0.020000	0.16555	0.980000	0.70556	8.393000	0.90182	2.279000	0.76181	0.523000	0.50628	GCG		0.542	ASB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055852.2			18	68	1	0	7.07596e-05	0.006122	9.18733e-05	18	68				
GPR64	10149	broad.mit.edu	37	X	19027777	19027777	+	Silent	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:19027777A>T	ENST00000379869.3	-	18	1552	c.1389T>A	c.(1387-1389)acT>acA	p.T463T	GPR64_ENST00000357991.3_Silent_p.T460T|GPR64_ENST00000379876.1_Silent_p.T439T|GPR64_ENST00000360279.4_Silent_p.T441T|GPR64_ENST00000379878.3_Silent_p.T447T|GPR64_ENST00000357544.3_Silent_p.T433T|GPR64_ENST00000356606.4_Silent_p.T449T|GPR64_ENST00000379873.2_Silent_p.T463T|GPR64_ENST00000354791.3_Silent_p.T447T|GPR64_ENST00000340581.3_Silent_p.T433T	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	463					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.T460T(1)		breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					CCACAAAGGTAGTTGTGTTGA	0.423																																							uc004cyx.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1387-1389)ACT>ACA		G protein-coupled receptor 64 isoform 1							159.0	131.0	140.0					X																	19027777		2203	4300	6503	SO:0001819	synonymous_variant	10149				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity	g.chrX:19027777A>T	X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.1389T>A	X.37:g.19027777A>T						GPR64_uc004cyy.2_Silent_p.T460T|GPR64_uc004cyz.2_Silent_p.T449T|GPR64_uc004czb.2_Silent_p.T463T|GPR64_uc004czc.2_Silent_p.T447T|GPR64_uc004czd.2_Silent_p.T439T|GPR64_uc004cze.2_Silent_p.T433T|GPR64_uc004czf.2_Silent_p.T425T|GPR64_uc004cza.2_Silent_p.T441T|GPR64_uc004cyw.2_Silent_p.T447T|GPR64_uc010nfj.2_Silent_p.T433T	p.T463T	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN			18	1553	-	Hepatocellular(33;0.183)		463			Extracellular (Potential).		B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Silent	SNP	ENST00000379869.3	37	c.1389T>A	CCDS43923.1																																																																																				0.423	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2			16	104	0	0	0	0.006122	0	16	104				
MAGEB18	286514	broad.mit.edu	37	X	26157298	26157298	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:26157298G>T	ENST00000325250.1	+	2	383	c.196G>T	c.(196-198)Gga>Tga	p.G66*		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	66						cytoplasm (GO:0005737)		p.G66*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						AGCGCTTCAGGGAGCCCCATC	0.532																																							uc004dbq.1		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(196-198)GGA>TGA		melanoma antigen family B, 18							44.0	39.0	41.0					X																	26157298		2202	4300	6502	SO:0001587	stop_gained	286514						protein binding	g.chrX:26157298G>T	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.196G>T	X.37:g.26157298G>T	ENSP00000314543:p.Gly66*						p.G66*	NM_173699	NP_775970	Q96M61	MAGBI_HUMAN			2	383	+			66						Nonsense_Mutation	SNP	ENST00000325250.1	37	c.196G>T	CCDS14216.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787185	0.70337	.	.	ENSG00000176774	ENST00000325250	.	.	.	4.4	0.514	0.17007	.	3.782720	0.00559	N	0.000275	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	6.3431	0.21335	0.4902:0.0:0.5098:0.0	.	.	.	.	X	66	.	ENSP00000314543:G66X	G	+	1	0	MAGEB18	26067219	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.097000	0.15168	-0.036000	0.13669	0.600000	0.82982	GGA		0.532	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699		12	46	1	0	1.61879e-10	0.001368	2.74343e-10	12	46				
IL1RAPL1	11141	broad.mit.edu	37	X	29938182	29938182	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:29938182G>T	ENST00000378993.1	+	8	1701	c.1028G>T	c.(1027-1029)cGa>cTa	p.R343L	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.R343L	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	343	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.R343Q(2)|p.R343L(2)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						AATGGACGTCGACACGCCAGC	0.438																																							uc004dby.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|lung(1)|pancreas(1)	5						c.(1027-1029)CGA>CTA		interleukin 1 receptor accessory protein-like 1							141.0	114.0	123.0					X																	29938182		2202	4300	6502	SO:0001583	missense	11141				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity	g.chrX:29938182G>T	AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1028G>T	X.37:g.29938182G>T	ENSP00000368278:p.Arg343Leu						p.R343L	NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN			8	1536	+			343			Extracellular (Potential).|Ig-like C2-type 3.		A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	c.1028G>T	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937582	0.73557	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.66995	-0.24;-0.24	6.03	6.03	0.97812	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.74489	0.3723	L	0.51422	1.61	0.27512	N	0.951654	D	0.61080	0.989	D	0.63283	0.913	T	0.69371	-0.5163	9	.	.	.	.	12.8299	0.57740	0.0758:0.0:0.9242:0.0	.	343	Q9NZN1	IRPL1_HUMAN	L	343	ENSP00000368278:R343L;ENSP00000305200:R343L	.	R	+	2	0	IL1RAPL1	29848103	1.000000	0.71417	0.903000	0.35520	0.950000	0.60333	9.476000	0.97823	2.561000	0.86390	0.523000	0.50628	CGA		0.438	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271		32	95	1	0	1.08312e-15	0.001786	2.08425e-15	32	95				
MAGEB2	4113	broad.mit.edu	37	X	30237292	30237292	+	Missense_Mutation	SNP	C	C	A	rs45513291		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:30237292C>A	ENST00000378988.4	+	2	696	c.595C>A	c.(595-597)Ccc>Acc	p.P199T		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	199	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.P199T(2)		breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						CTGGGACTTTCCCAGGAGAAA	0.488													C|||	1	0.000264901	0.0	0.0	3775	,	,		14370	0.0		0.001	False		,,,				2504	0.0						uc004dbz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(595-597)CCC>ACC		melanoma antigen family B, 2							60.0	48.0	52.0					X																	30237292		2202	4300	6502	SO:0001583	missense	4113						protein binding	g.chrX:30237292C>A	AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.595C>A	X.37:g.30237292C>A	ENSP00000368273:p.Pro199Thr						p.P199T	NM_002364	NP_002355	O15479	MAGB2_HUMAN			2	698	+			199			MAGE.		O75860	Missense_Mutation	SNP	ENST00000378988.4	37	c.595C>A	CCDS14219.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	12.78	2.041299	0.35989	.	.	ENSG00000099399	ENST00000378988	T	0.07567	3.18	3.27	2.35	0.29111	.	0.445939	0.23985	N	0.042622	T	0.37376	0.1001	H	0.97611	4.04	0.09310	N	1	D	0.76494	0.999	D	0.81914	0.995	T	0.29912	-0.9996	10	0.87932	D	0	.	6.7686	0.23581	0.2778:0.7222:0.0:0.0	rs45513291	199	O15479	MAGB2_HUMAN	T	199	ENSP00000368273:P199T	ENSP00000368273:P199T	P	+	1	0	MAGEB2	30147213	0.039000	0.19947	0.002000	0.10522	0.028000	0.11728	1.761000	0.38440	0.722000	0.32252	0.436000	0.28706	CCC		0.488	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	NM_002364		10	33	1	0	2.17888e-05	0.006214	2.89917e-05	10	33				
FAM47A	158724	broad.mit.edu	37	X	34148514	34148514	+	Silent	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:34148514G>A	ENST00000346193.3	-	1	1933	c.1882C>T	c.(1882-1884)Ctg>Ttg	p.L628L		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	628								p.L628L(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AAGTCAAACAGATTCCTGATG	0.443																																							uc004ddg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(1)	5						c.(1882-1884)CTG>TTG		hypothetical protein LOC158724							90.0	83.0	85.0					X																	34148514		2120	4240	6360	SO:0001819	synonymous_variant	158724							g.chrX:34148514G>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1882C>T	X.37:g.34148514G>A							p.L628L	NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN			1	1915	-			628					A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	c.1882C>T	CCDS43926.1																																																																																				0.443	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		21	85	0	0	0	0.008871	0	21	85				
CYBB	1536	broad.mit.edu	37	X	37655268	37655268	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:37655268C>A	ENST00000378588.4	+	6	615	c.548C>A	c.(547-549)aCg>aAg	p.T183K	CYBB_ENST00000536160.1_Intron|TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Missense_Mutation_p.T151K	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	183	Ferric oxidoreductase.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)	p.T183K(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	GTTGTCATCACGCTGTGCCTC	0.453																																							uc004ddr.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(547-549)ACG>AAG		cytochrome b-245 beta polypeptide							171.0	128.0	143.0					X																	37655268		2202	4300	6502	SO:0001583	missense	1536				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity	g.chrX:37655268C>A	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.548C>A	X.37:g.37655268C>A	ENSP00000367851:p.Thr183Lys					CYBB_uc011mke.1_RNA|CYBB_uc011mkf.1_Missense_Mutation_p.T151K|CYBB_uc011mkg.1_Intron	p.T183K	NM_000397	NP_000388	P04839	CY24B_HUMAN			6	609	+			183			Helical; (Potential).|Ferric oxidoreductase.		A8K138|Q2PP16	Missense_Mutation	SNP	ENST00000378588.4	37	c.548C>A	CCDS14242.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552645	0.86127	.	.	ENSG00000165168	ENST00000378588;ENST00000545017	D;D	0.91407	-2.84;-2.84	5.4	5.4	0.78164	Flavoprotein transmembrane component (1);	0.000000	0.85682	D	0.000000	D	0.95996	0.8696	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96264	0.9193	10	0.56958	D	0.05	.	18.3094	0.90194	0.0:1.0:0.0:0.0	.	151;183	F5GWD2;P04839	.;CY24B_HUMAN	K	183;151	ENSP00000367851:T183K;ENSP00000441896:T151K	ENSP00000367851:T183K	T	+	2	0	CYBB	37540208	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	7.487000	0.81328	2.263000	0.75096	0.538000	0.68166	ACG		0.453	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080881.1			13	71	1	0	9.31168e-06	0.001855	1.27049e-05	13	71				
BCOR	54880	broad.mit.edu	37	X	39933626	39933626	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:39933626G>T	ENST00000378444.4	-	4	1201	c.973C>A	c.(973-975)Ctg>Atg	p.L325M	BCOR_ENST00000378455.4_Missense_Mutation_p.L325M|BCOR_ENST00000342274.4_Missense_Mutation_p.L325M|BCOR_ENST00000397354.3_Missense_Mutation_p.L325M	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	325					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.L325M(1)		breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TCCCCCGGCAGGCCACTGGTG	0.647			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																uc004den.3		NA		Rec	yes		X	Xp11.4	54880		BCL6 corepressor	yes							1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|central_nervous_system(1)	4						c.(973-975)CTG>ATG		BCL-6 interacting corepressor isoform c							28.0	26.0	27.0					X																	39933626		2202	4299	6501	SO:0001583	missense	54880				heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chrX:39933626G>T	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.973C>A	X.37:g.39933626G>T	ENSP00000367705:p.Leu325Met					BCOR_uc004dep.3_Missense_Mutation_p.L325M|BCOR_uc004deo.3_Missense_Mutation_p.L325M|BCOR_uc004dem.3_Missense_Mutation_p.L325M|BCOR_uc004deq.3_Missense_Mutation_p.L325M	p.L325M	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN			4	1265	-			325					D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	ENST00000378444.4	37	c.973C>A	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536148	0.27475	.	.	ENSG00000183337	ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000406200	T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63	5.56	5.56	0.83823	.	.	.	.	.	T	0.22666	0.0547	L	0.27053	0.805	0.31905	N	0.615488	P;P;P;P	0.52170	0.951;0.951;0.919;0.951	B;B;B;B	0.43052	0.406;0.406;0.23;0.406	T	0.21690	-1.0238	9	0.52906	T	0.07	-14.9009	7.6793	0.28505	0.0795:0.0:0.6421:0.2784	.	325;325;325;325	Q6W2J9-3;Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;.;BCOR_HUMAN;.	M	325	ENSP00000367716:L325M;ENSP00000380512:L325M;ENSP00000367705:L325M;ENSP00000345923:L325M;ENSP00000384485:L325M	ENSP00000345923:L325M	L	-	1	2	BCOR	39818570	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	1.124000	0.31320	2.331000	0.79229	0.600000	0.82982	CTG		0.647	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745		5	37	1	0	0.00116845	0.001168	0.00142876	5	37				
SLC35A2	7355	broad.mit.edu	37	X	48762073	48762073	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:48762073C>A	ENST00000247138.5	-	4	1116	c.1113G>T	c.(1111-1113)ccG>ccT	p.P371P	SLC35A2_ENST00000376515.3_Missense_Mutation_p.A151S|SLC35A2_ENST00000413561.2_Silent_p.P310P|SLC35A2_ENST00000452555.2_Silent_p.P399P|SLC35A2_ENST00000376529.3_Missense_Mutation_p.A175S|SLC35A2_ENST00000445167.2_Missense_Mutation_p.A175S|SLC35A2_ENST00000376521.1_Silent_p.P371P	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	371					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)	p.A175S(1)|p.P371P(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						AAGACAGCTGCGGTGGTGGTG	0.652																																							uc004dlo.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	breast(1)	1						c.(1111-1113)CCG>CCT		solute carrier family 35, member A2 isoform a							41.0	34.0	36.0					X																	48762073		2203	4300	6503	SO:0001819	synonymous_variant	7355				galactose metabolic process	Golgi membrane|integral to membrane|nucleus	sugar:hydrogen symporter activity|UDP-galactose transmembrane transporter activity	g.chrX:48762073C>A	D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.1113G>T	X.37:g.48762073C>A						SLC35A2_uc011mml.1_Silent_p.P384P|SLC35A2_uc004dlp.1_Silent_p.P371P|SLC35A2_uc011mmm.1_Silent_p.P399P|SLC35A2_uc011mmn.1_Silent_p.P310P|SLC35A2_uc004dlr.1_3'UTR|SLC35A2_uc004dlq.2_Missense_Mutation_p.A175S	p.P371P	NM_005660	NP_005651	P78381	S35A2_HUMAN			4	1117	-			371					A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Silent	SNP	ENST00000247138.5	37	c.1113G>T	CCDS14311.1	.	.	.	.	.	.	.	.	.	.	C	9.682	1.149580	0.21288	.	.	ENSG00000102100	ENST00000376529;ENST00000445167;ENST00000376515	.	.	.	3.67	-4.91	0.03085	.	.	.	.	.	T	0.28830	0.0715	.	.	.	0.28009	N	0.93498	B	0.30870	0.298	B	0.28553	0.091	T	0.14364	-1.0475	7	0.87932	D	0	-0.5438	7.9325	0.29909	0.0:0.301:0.1161:0.5829	.	175	P78381-3	.	S	175;175;151	.	ENSP00000365698:A151S	A	-	1	0	SLC35A2	48647017	0.000000	0.05858	0.005000	0.12908	0.401000	0.30781	-3.776000	0.00369	-1.821000	0.01213	-0.190000	0.12839	GCA		0.652	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060790.1	NM_005660		10	35	1	0	3.07112e-06	0.000978	4.25029e-06	10	35				
TSR2	90121	broad.mit.edu	37	X	54466893	54466893	+	Silent	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:54466893G>T	ENST00000375151.4	+	1	60	c.39G>T	c.(37-39)cgG>cgT	p.R13R		NM_058163.1	NP_477511.1	Q969E8	TSR2_HUMAN	TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)	13					rRNA processing (GO:0006364)			p.R13R(1)		breast(1)|endometrium(3)|lung(2)	6						CTCTTTTCCGGGCTGGGGTCT	0.697																																							uc004dte.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(37-39)CGG>CGT		TSR2, 20S rRNA accumulation, homolog							7.0	9.0	8.0					X																	54466893		2165	4222	6387	SO:0001819	synonymous_variant	90121				rRNA processing		protein binding	g.chrX:54466893G>T	BC007699	CCDS14358.1	Xp11.22	2008-10-01			ENSG00000158526	ENSG00000158526			25455	protein-coding gene	gene with protein product	"""WGG motif containing 1"""					9417904	Standard	NM_058163		Approved	DT1P1A10, RP1-112K5.2, WGG1	uc004dte.3	Q969E8	OTTHUMG00000021628	ENST00000375151.4:c.39G>T	X.37:g.54466893G>T						TSR2_uc004dtf.2_5'UTR	p.R13R	NM_058163	NP_477511	Q969E8	TSR2_HUMAN			1	41	+			13						Silent	SNP	ENST00000375151.4	37	c.39G>T	CCDS14358.1																																																																																				0.697	TSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056802.1	NM_058163		4	16	1	0	0.00024832	0.000248	0.000313975	4	16				
FGD1	2245	broad.mit.edu	37	X	54497808	54497808	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:54497808C>A	ENST00000375135.3	-	2	1153	c.420G>T	c.(418-420)ccG>ccT	p.P140P		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	140	Pro-rich.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.P140P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GGGTTTCAGTCGGGGGACCTG	0.607																																							uc004dtg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(418-420)CCG>CCT		faciogenital dysplasia protein							52.0	54.0	54.0					X																	54497808		2203	4300	6503	SO:0001819	synonymous_variant	2245				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chrX:54497808C>A	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.420G>T	X.37:g.54497808C>A						FGD1_uc011moi.1_5'Flank	p.P140P	NM_004463	NP_004454	P98174	FGD1_HUMAN			2	1154	-			140			Pro-rich.		Q5H999|Q8N4D9	Silent	SNP	ENST00000375135.3	37	c.420G>T	CCDS14359.1																																																																																				0.607	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463		32	79	1	0	8.88839e-20	0.002096	1.90804e-19	32	79				
USP51	158880	broad.mit.edu	37	X	55513306	55513306	+	Silent	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:55513306G>A	ENST00000500968.3	-	2	2149	c.2067C>T	c.(2065-2067)acC>acT	p.T689T	USP51_ENST00000586165.1_5'UTR	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	689	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.T689T(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						AGTCCTCAATGGTAGCCTTGG	0.433																																							uc004dun.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|breast(1)	3						c.(2065-2067)ACC>ACT		ubiquitin specific protease 51							96.0	81.0	86.0					X																	55513306		2203	4300	6503	SO:0001819	synonymous_variant	158880				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding	g.chrX:55513306G>A	BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.2067C>T	X.37:g.55513306G>A						USP51_uc011moo.1_Silent_p.T393T	p.T689T	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN			2	2146	-			689					Q8IWJ8	Silent	SNP	ENST00000500968.3	37	c.2067C>T	CCDS14370.1																																																																																				0.433	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056871.2	NM_201286		16	81	0	0	0	0.003163	0	16	81				
UBQLN2	29978	broad.mit.edu	37	X	56591074	56591074	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:56591074C>G	ENST00000338222.5	+	1	1049	c.768C>G	c.(766-768)agC>agG	p.S256R		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	256					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S256R(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						TGGCTCTTAGCAATCTAGAAA	0.483																																					Esophageal Squamous(104;218 1492 6022 10838 28884)	Esophageal Squamous(104;218 1492 6022 10838 28884)	uc004dus.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(766-768)AGC>AGG		ubiquilin 2							63.0	63.0	63.0					X																	56591074		2203	4300	6503	SO:0001583	missense	29978					cytoplasm|nucleus|plasma membrane	binding	g.chrX:56591074C>G	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.768C>G	X.37:g.56591074C>G	ENSP00000345195:p.Ser256Arg					UBQLN2_uc011moq.1_Missense_Mutation_p.S256R	p.S256R	NM_013444	NP_038472	Q9UHD9	UBQL2_HUMAN			1	1003	+			256					O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	ENST00000338222.5	37	c.768C>G	CCDS14374.1	.	.	.	.	.	.	.	.	.	.	C	6.349	0.432430	0.12045	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	T	0.79940	-1.32	5.05	1.28	0.21552	.	0.000000	0.85682	D	0.000000	T	0.80417	0.4619	M	0.73753	2.245	0.48236	D	0.999611	B;P	0.41131	0.23;0.739	B;P	0.48304	0.168;0.573	T	0.74922	-0.3499	10	0.48119	T	0.1	-11.2908	4.5639	0.12173	0.1606:0.5605:0.0:0.2789	.	256;256	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	R	256	ENSP00000345195:S256R	ENSP00000345195:S256R	S	+	3	2	UBQLN2	56607799	1.000000	0.71417	1.000000	0.80357	0.234000	0.25298	1.789000	0.38724	0.245000	0.21373	-0.222000	0.12452	AGC		0.483	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056891.1	NM_013444		14	71	0	0	0	0.00245	0	14	71				
AMER1	139285	broad.mit.edu	37	X	63410828	63410828	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:63410828C>A	ENST00000330258.3	-	2	2611	c.2339G>T	c.(2338-2340)gGg>gTg	p.G780V	AMER1_ENST00000403336.1_Missense_Mutation_p.G780V|AMER1_ENST00000374869.3_Missense_Mutation_p.G780V	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	780					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.G780V(2)									AAAGAGGTTCCCATTGCTGGT	0.512																																							uc004dvo.2		NA																	69	Whole gene deletion(67)|Substitution - Missense(2)	p.0?(40)	kidney(65)|lung(2)|ovary(1)|large_intestine(1)	kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						c.(2338-2340)GGG>GTG		family with sequence similarity 123B							47.0	38.0	41.0					X																	63410828		2203	4300	6503	SO:0001583	missense	139285				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		g.chrX:63410828C>A	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2339G>T	X.37:g.63410828C>A	ENSP00000329117:p.Gly780Val						p.G780V	NM_152424	NP_689637	Q5JTC6	F123B_HUMAN			2	2612	-			780					A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	c.2339G>T	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913147	0.33815	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.57907	0.37;0.54;0.37	5.18	4.32	0.51571	.	0.110909	0.41001	N	0.000974	T	0.30916	0.0780	N	0.14661	0.345	0.46609	D	0.99912	B	0.19200	0.034	B	0.16722	0.016	T	0.18147	-1.0346	10	0.66056	D	0.02	-10.8372	3.5446	0.07824	0.1765:0.5654:0.1667:0.0915	.	780	Q5JTC6	F123B_HUMAN	V	780	ENSP00000364003:G780V;ENSP00000329117:G780V;ENSP00000384722:G780V	ENSP00000329117:G780V	G	-	2	0	FAM123B	63327553	0.997000	0.39634	0.957000	0.39632	0.928000	0.56348	3.420000	0.52735	1.293000	0.44690	0.529000	0.55759	GGG		0.512	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		11	35	1	0	2.80697e-09	0.000978	4.45977e-09	11	35				
TEX11	56159	broad.mit.edu	37	X	69902602	69902602	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:69902602G>T	ENST00000395889.2	-	15	1278	c.1123C>A	c.(1123-1125)Ctg>Atg	p.L375M	TEX11_ENST00000344304.3_Missense_Mutation_p.L375M|TEX11_ENST00000374320.2_Missense_Mutation_p.L50M|TEX11_ENST00000374333.2_Missense_Mutation_p.L360M	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	375					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.L360M(1)		breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TGGAGTATCAGAACTTTTCCA	0.358																																							uc004dyl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|skin(1)	5						c.(1123-1125)CTG>ATG		testis expressed sequence 11 isoform 1							82.0	69.0	73.0					X																	69902602		2203	4300	6503	SO:0001583	missense	56159						protein binding	g.chrX:69902602G>T	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1123C>A	X.37:g.69902602G>T	ENSP00000379226:p.Leu375Met					TEX11_uc004dyk.2_Missense_Mutation_p.L50M|TEX11_uc004dym.2_Missense_Mutation_p.L360M	p.L375M	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN			15	1285	-	Renal(35;0.156)		375					A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	37	c.1123C>A	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	G	7.712	0.695345	0.15106	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.55052	1.02;1.05;0.54;1.05	4.56	-1.47	0.08772	.	0.605324	0.15213	N	0.274387	T	0.53045	0.1772	M	0.61703	1.905	0.09310	N	1	P;P	0.50369	0.919;0.934	P;P	0.56474	0.697;0.799	T	0.45614	-0.9249	9	.	.	.	0.9105	0.6248	0.00784	0.3868:0.1699:0.2678:0.1755	.	360;375	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	M	360;375;50;375	ENSP00000363453:L360M;ENSP00000379226:L375M;ENSP00000363440:L50M;ENSP00000340995:L375M	.	L	-	1	2	TEX11	69819327	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.257000	0.08745	-0.292000	0.08999	0.415000	0.27848	CTG		0.358	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			14	45	1	0	9.31168e-06	0.001855	1.27049e-05	14	45				
ACRC	93953	broad.mit.edu	37	X	70824043	70824043	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:70824043G>T	ENST00000373695.1	+	7	1453	c.916G>T	c.(916-918)Gac>Tac	p.D306Y	ACRC_ENST00000373696.3_Missense_Mutation_p.D306Y			Q96QF7	ACRC_HUMAN	acidic repeat containing	306	Asp/Ser-rich.					nucleus (GO:0005634)		p.D306Y(1)		autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					GGAAGCTCCCGACGACAAGAG	0.512																																							uc004eae.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(916-918)GAC>TAC		ACRC protein							182.0	159.0	167.0					X																	70824043		2203	4300	6503	SO:0001583	missense	93953					nucleus		g.chrX:70824043G>T	AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.916G>T	X.37:g.70824043G>T	ENSP00000362799:p.Asp306Tyr					BCYRN1_uc011mpt.1_Intron	p.D306Y	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN			8	1417	+	Renal(35;0.156)		306			Asp/Ser-rich.		B9EG62	Missense_Mutation	SNP	ENST00000373695.1	37	c.916G>T	CCDS35326.1	.	.	.	.	.	.	.	.	.	.	G	10.58	1.389928	0.25118	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.35421	1.31;1.31	0.14	0.14	0.14804	.	.	.	.	.	T	0.33818	0.0876	N	0.19112	0.55	0.35071	D	0.762514	D	0.64830	0.994	P	0.59643	0.861	T	0.46679	-0.9174	9	0.87932	D	0	.	5.9727	0.19361	6.0E-4:0.0:0.9994:0.0	.	306	Q96QF7	ACRC_HUMAN	Y	306	ENSP00000362800:D306Y;ENSP00000362799:D306Y	ENSP00000362799:D306Y	D	+	1	0	ACRC	70740768	0.000000	0.05858	0.018000	0.16275	0.019000	0.09904	-0.028000	0.12350	0.168000	0.19655	0.169000	0.16792	GAC		0.512	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1			46	264	1	0	2.77807e-22	0.003214	6.09913e-22	46	264				
FAM46D	169966	broad.mit.edu	37	X	79699123	79699123	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:79699123C>A	ENST00000308293.5	+	3	1324	c.1085C>A	c.(1084-1086)cCt>cAt	p.P362H	FAM46D_ENST00000538312.1_Missense_Mutation_p.P362H	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	362								p.P362H(1)		kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						GCAAGGTACCCTATTTATGTA	0.428																																							uc004edl.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(1084-1086)CCT>CAT		hypothetical protein LOC169966							60.0	54.0	56.0					X																	79699123		2202	4298	6500	SO:0001583	missense	169966							g.chrX:79699123C>A	BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.1085C>A	X.37:g.79699123C>A	ENSP00000308575:p.Pro362His					FAM46D_uc004edm.1_Missense_Mutation_p.P362H	p.P362H	NM_152630	NP_689843	Q8NEK8	FA46D_HUMAN			5	1419	+			362					B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	37	c.1085C>A	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	C	0.782	-0.761916	0.02996	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.22134	1.97;1.97	4.69	2.77	0.32553	.	0.285662	0.31041	U	0.008371	T	0.15132	0.0365	L	0.51422	1.61	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.21861	-1.0233	10	0.45353	T	0.12	-3.1962	1.6014	0.02675	0.1811:0.4669:0.1725:0.1794	.	362	Q8NEK8	FA46D_HUMAN	H	362	ENSP00000443410:P362H;ENSP00000308575:P362H	ENSP00000308575:P362H	P	+	2	0	FAM46D	79585779	0.000000	0.05858	0.018000	0.16275	0.051000	0.14879	0.000000	0.12993	0.741000	0.32674	0.594000	0.82650	CCT		0.428	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630		8	49	1	0	0.00448238	0.004482	0.00534565	8	49				
PABPC5	140886	broad.mit.edu	37	X	90690795	90690795	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:90690795G>C	ENST00000312600.3	+	2	433	c.219G>C	c.(217-219)gaG>gaC	p.E73D	PABPC5_ENST00000373105.1_Intron|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	73	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.E73D(1)		central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						CGGATGCAGAGTGGGCCTTGA	0.532																																							uc004efg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|pancreas(1)	3						c.(217-219)GAG>GAC		poly(A) binding protein, cytoplasmic 5							40.0	33.0	35.0					X																	90690795		2203	4300	6503	SO:0001583	missense	140886					cytoplasm	nucleotide binding|RNA binding	g.chrX:90690795G>C	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.219G>C	X.37:g.90690795G>C	ENSP00000308012:p.Glu73Asp					PABPC5_uc004eff.1_Intron	p.E73D	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN			2	659	+			73			RRM 1.		A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	ENST00000312600.3	37	c.219G>C	CCDS14460.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692720	0.30052	.	.	ENSG00000174740	ENST00000312600;ENST00000402906	T	0.17691	2.26	4.43	-0.0337	0.13900	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.14960	0.0361	L	0.52011	1.625	0.38927	D	0.957853	B	0.23249	0.082	B	0.25987	0.065	T	0.06716	-1.0811	10	0.66056	D	0.02	.	8.0302	0.30461	0.6245:0.0:0.3755:0.0	.	73	Q96DU9	PABP5_HUMAN	D	73;41	ENSP00000308012:E73D	ENSP00000308012:E73D	E	+	3	2	PABPC5	90577451	0.999000	0.42202	0.997000	0.53966	0.893000	0.52053	1.421000	0.34815	-0.125000	0.11703	-0.380000	0.06706	GAG		0.532	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832		7	37	0	0	0	0.001984	0	7	37				
XKRX	402415	broad.mit.edu	37	X	100178004	100178004	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:100178004C>A	ENST00000372956.2	-	2	986	c.382G>T	c.(382-384)Gag>Tag	p.E128*	XKRX_ENST00000328526.5_Nonsense_Mutation_p.E141*|XKRX_ENST00000468904.1_Intron			Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related, X-linked	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E141*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(3)	22						TCCTCCTGCTCCTCTTTCTTC	0.512																																							uc004egn.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(1)	1						c.(382-384)GAG>TAG		XK, Kell blood group complex subunit-related,							148.0	129.0	136.0					X																	100178004		2203	4300	6503	SO:0001587	stop_gained	402415					integral to membrane|plasma membrane		g.chrX:100178004C>A	AY589511	CCDS14476.1, CCDS14476.2	Xq22	2008-02-05	2006-01-12		ENSG00000182489	ENSG00000182489			29845	protein-coding gene	gene with protein product		300684	"""X Kell blood group precursor-related, X-linked"""				Standard	NM_212559		Approved	XPLAC, XKR2	uc004egn.2	Q6PP77	OTTHUMG00000022010	ENST00000372956.2:c.382G>T	X.37:g.100178004C>A	ENSP00000362047:p.Glu128*					XKRX_uc011mre.1_Intron	p.E128*	NM_212559	NP_997724	Q6PP77	XKR2_HUMAN			2	987	-			128					B2RNN6|B4DKU2|Q5H9J6	Nonsense_Mutation	SNP	ENST00000372956.2	37	c.382G>T	CCDS14476.2	.	.	.	.	.	.	.	.	.	.	C	42	9.562520	0.99205	.	.	ENSG00000182489	ENST00000328526;ENST00000372956	.	.	.	5.73	5.73	0.89815	.	0.345604	0.34628	N	0.003814	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9958	14.1563	0.65419	0.0:1.0:0.0:0.0	.	.	.	.	X	141;128	.	ENSP00000327570:E141X	E	-	1	0	XKRX	100064660	0.086000	0.21541	1.000000	0.80357	0.994000	0.84299	1.593000	0.36686	2.417000	0.82017	0.544000	0.68410	GAG		0.512	XKRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057501.3	NM_212559		32	140	1	0	2.46105e-21	0.002096	5.33044e-21	32	140				
IRS4	8471	broad.mit.edu	37	X	107977841	107977841	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:107977841A>T	ENST00000372129.2	-	1	1810	c.1734T>A	c.(1732-1734)gaT>gaA	p.D578E	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	578					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.D578E(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AGCCATGGCCATCTCCAGGTC	0.612																																							uc004eoc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1732-1734)GAT>GAA		insulin receptor substrate 4							144.0	148.0	147.0					X																	107977841		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107977841A>T	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1734T>A	X.37:g.107977841A>T	ENSP00000361202:p.Asp578Glu						p.D578E	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1767	-			578						Missense_Mutation	SNP	ENST00000372129.2	37	c.1734T>A	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	A	7.588	0.670200	0.14776	.	.	ENSG00000133124	ENST00000372129	T	0.35421	1.31	4.48	4.48	0.54585	.	1.042350	0.07514	N	0.909465	T	0.34106	0.0886	L	0.60455	1.87	0.24435	N	0.99456	P	0.37525	0.598	B	0.32211	0.142	T	0.20739	-1.0266	10	0.36615	T	0.2	-6.0846	9.3287	0.38008	1.0:0.0:0.0:0.0	.	578	O14654	IRS4_HUMAN	E	578	ENSP00000361202:D578E	ENSP00000361202:D578E	D	-	3	2	IRS4	107864497	0.223000	0.23663	0.765000	0.31456	0.390000	0.30446	2.128000	0.42045	1.802000	0.52723	0.479000	0.44913	GAT		0.612	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		61	277	0	0	0	0.00361	0	61	277				
GUCY2F	2986	broad.mit.edu	37	X	108708604	108708604	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:108708604G>C	ENST00000218006.2	-	3	1090	c.799C>G	c.(799-801)Cat>Gat	p.H267D		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	267					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.H267D(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TTCAGATCATGAGCACATTCC	0.443																																							uc004eod.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|breast(3)|central_nervous_system(1)	8						c.(799-801)CAT>GAT		guanylate cyclase 2F precursor							169.0	137.0	148.0					X																	108708604		2203	4300	6503	SO:0001583	missense	2986				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity	g.chrX:108708604G>C	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.799C>G	X.37:g.108708604G>C	ENSP00000218006:p.His267Asp					GUCY2F_uc011msq.1_RNA	p.H267D	NM_001522	NP_001513	P51841	GUC2F_HUMAN			3	1075	-			267			Extracellular (Potential).		Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	c.799C>G	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.115423	0.37339	.	.	ENSG00000101890	ENST00000218006	D	0.82893	-1.66	4.11	3.25	0.37280	Extracellular ligand-binding receptor (1);	0.168108	0.52532	D	0.000071	T	0.78641	0.4315	L	0.59436	1.845	0.47153	D	0.999336	B	0.33777	0.425	B	0.36608	0.229	T	0.74441	-0.3664	10	0.35671	T	0.21	.	8.9066	0.35528	0.114:0.0:0.886:0.0	.	267	P51841	GUC2F_HUMAN	D	267	ENSP00000218006:H267D	ENSP00000218006:H267D	H	-	1	0	GUCY2F	108595260	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.304000	0.33482	1.080000	0.41073	0.600000	0.82982	CAT		0.443	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522		32	177	0	0	0	0.003271	0	32	177				
TRPC5	7224	broad.mit.edu	37	X	111195529	111195529	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:111195529C>A	ENST00000262839.2	-	2	1038	c.120G>T	c.(118-120)gtG>gtT	p.V40V		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	40					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.V40V(1)		biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CCCCCTTCTCCACAGCATTGA	0.542																																							uc004epl.1		NA																	1	Substitution - coding silent(1)		lung(1)	urinary_tract(1)	1						c.(118-120)GTG>GTT		transient receptor potential cation channel,							102.0	81.0	88.0					X																	111195529		2203	4300	6503	SO:0001819	synonymous_variant	7224				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chrX:111195529C>A	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.120G>T	X.37:g.111195529C>A						TRPC5_uc004epm.1_Silent_p.V40V	p.V40V	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN			2	1039	-			40			Cytoplasmic (Potential).|ANK 1.		B2RP53|O75233|Q5JXY8|Q9Y514	Silent	SNP	ENST00000262839.2	37	c.120G>T	CCDS14561.1																																																																																				0.542	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471		19	77	1	0	2.4624e-09	0.008871	3.92521e-09	19	77				
LONRF3	79836	broad.mit.edu	37	X	118108865	118108865	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:118108865T>C	ENST00000371628.3	+	1	153	c.122T>C	c.(121-123)gTg>gCg	p.V41A	LONRF3_ENST00000304778.7_Missense_Mutation_p.V41A|LONRF3_ENST00000422289.2_5'Flank	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	41							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.V41A(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						CACCCAAAGGTGGCTGCAGAG	0.662																																							uc004eqw.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(121-123)GTG>GCG		LON peptidase N-terminal domain and ring finger							16.0	16.0	16.0					X																	118108865		2188	4289	6477	SO:0001583	missense	79836				proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding	g.chrX:118108865T>C	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.122T>C	X.37:g.118108865T>C	ENSP00000360690:p.Val41Ala					LONRF3_uc004eqx.2_Missense_Mutation_p.V41A|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_5'Flank	p.V41A	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN			1	153	+			41					Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	c.122T>C	CCDS35374.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.417838	0.00188	.	.	ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628	T;T;T	0.80566	-1.39;-1.39;-1.13	4.58	-4.18	0.03846	.	1.374150	0.05390	N	0.538815	T	0.47893	0.1470	N	0.02539	-0.55	0.09310	N	0.999996	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43228	-0.9404	10	0.08837	T	0.75	-11.701	1.2132	0.01909	0.2347:0.1367:0.3617:0.2669	.	41;41	Q496Y0-2;Q496Y0	.;LONF3_HUMAN	A	41	ENSP00000360691:V41A;ENSP00000307732:V41A;ENSP00000360690:V41A	ENSP00000307732:V41A	V	+	2	0	LONRF3	117992893	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.135000	0.03225	-0.630000	0.05567	-0.269000	0.10298	GTG		0.662	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778		3	10	0	0	0	0.004672	0	3	10				
KIAA1210	57481	broad.mit.edu	37	X	118220782	118220782	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:118220782C>T	ENST00000402510.2	-	11	4410	c.4411G>A	c.(4411-4413)Gat>Aat	p.D1471N		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1471								p.D1295N(1)|p.D1471N(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TTTTCAACATCATCCTGATTG	0.438																																							uc004era.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(4411-4413)GAT>AAT		hypothetical protein LOC57481							78.0	74.0	75.0					X																	118220782		1880	4099	5979	SO:0001583	missense	57481							g.chrX:118220782C>T	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4411G>A	X.37:g.118220782C>T	ENSP00000384670:p.Asp1471Asn						p.D1471N	NM_020721	NP_065772	Q9ULL0	K1210_HUMAN			11	4411	-			1471					B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	c.4411G>A	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972621	0.34848	.	.	ENSG00000250423	ENST00000402510	T	0.14766	2.48	5.0	-0.00908	0.14002	.	.	.	.	.	T	0.09862	0.0242	L	0.43152	1.355	0.09310	N	1	P	0.48016	0.904	B	0.40066	0.318	T	0.23904	-1.0175	9	0.31617	T	0.26	.	4.6846	0.12752	0.0:0.4311:0.2933:0.2756	.	1471	Q9ULL0	K1210_HUMAN	N	1471	ENSP00000384670:D1471N	ENSP00000384670:D1471N	D	-	1	0	RP13-347D8.6	118104810	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.228000	0.09114	-0.262000	0.09392	-0.511000	0.04467	GAT		0.438	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721		4	79	0	0	0	0.000248	0	4	79				
CXorf56	63932	broad.mit.edu	37	X	118675326	118675326	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:118675326G>C	ENST00000371594.4	-	6	649	c.571C>G	c.(571-573)Cgc>Ggc	p.R191G	CXorf56_ENST00000469448.1_5'UTR|CXorf56_ENST00000536133.1_Missense_Mutation_p.R177G|CXorf56_ENST00000320339.4_Missense_Mutation_p.R142G	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	191								p.R191G(1)		cervix(1)|endometrium(2)|lung(7)	10						ATGCCTTTGCGCTCCAGCTGT	0.493																																							uc004erk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(571-573)CGC>GGC		hypothetical protein LOC63932							158.0	131.0	140.0					X																	118675326		2203	4300	6503	SO:0001583	missense	63932						protein binding	g.chrX:118675326G>C	AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.571C>G	X.37:g.118675326G>C	ENSP00000360652:p.Arg191Gly					uc004eri.2_5'Flank|CXorf56_uc004erj.1_Missense_Mutation_p.R142G|CXorf56_uc011mtu.1_Missense_Mutation_p.R177G	p.R191G	NM_022101	NP_071384	Q9H5V9	CX056_HUMAN			6	617	-			191			Potential.		A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Missense_Mutation	SNP	ENST00000371594.4	37	c.571C>G	CCDS14579.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772317	0.49680	.	.	ENSG00000018610	ENST00000486230;ENST00000320339;ENST00000371594;ENST00000536133;ENST00000476164	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7	5.59	5.59	0.84812	.	0.045927	0.85682	D	0.000000	T	0.31104	0.0786	M	0.78049	2.395	0.58432	D	0.999999	B;B	0.28400	0.21;0.21	B;B	0.22880	0.042;0.042	T	0.13818	-1.0495	10	0.66056	D	0.02	-13.1368	12.233	0.54499	0.0:0.0:0.8302:0.1698	.	177;191	F5GWL7;Q9H5V9	.;CX056_HUMAN	G	191;142;191;177;191	ENSP00000420787:R191G;ENSP00000320345:R142G;ENSP00000360652:R191G;ENSP00000441786:R177G;ENSP00000420635:R191G	ENSP00000320345:R142G	R	-	1	0	CXorf56	118559354	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.285000	0.65633	2.352000	0.79861	0.597000	0.82753	CGC		0.493	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022101		57	216	0	0	0	0.00361	0	57	216				
ZBTB33	10009	broad.mit.edu	37	X	119387450	119387450	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:119387450C>A	ENST00000326624.2	+	2	408	c.180C>A	c.(178-180)ctC>ctA	p.L60L	ZBTB33_ENST00000557385.1_Silent_p.L60L	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	60	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.|Interaction with NCOR1.|Self-association. {ECO:0000250}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)	p.L60L(1)		breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						TCCATCAGCTCTTCTCTGTTG	0.393																																							uc004esn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(178-180)CTC>CTA		kaiso							135.0	139.0	138.0					X																	119387450		2203	4300	6503	SO:0001819	synonymous_variant	10009				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|nucleolus|plasma membrane	DNA binding|protein binding|zinc ion binding	g.chrX:119387450C>A	BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.180C>A	X.37:g.119387450C>A						ZBTB33_uc010nqm.1_Silent_p.L60L	p.L60L	NM_006777	NP_006768	Q86T24	KAISO_HUMAN			2	408	+			60			BTB.|Self-association (By similarity).|Interaction with NCOR1.		B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Silent	SNP	ENST00000326624.2	37	c.180C>A	CCDS14596.1																																																																																				0.393	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058085.2	NM_006777		53	303	1	0	4.88506e-25	0.00361	1.09235e-24	53	303				
TENM1	10178	broad.mit.edu	37	X	123839006	123839006	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:123839006G>A	ENST00000371130.3	-	5	935	c.872C>T	c.(871-873)cCt>cTt	p.P291L	TENM1_ENST00000422452.2_Missense_Mutation_p.P291L	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	291	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.P293L(1)									AGGCCTGGGAGGGGGCGAGTA	0.527																																							uc004euj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(871-873)CCT>CTT		odz, odd Oz/ten-m homolog 1 isoform 3							139.0	128.0	132.0					X																	123839006		2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123839006G>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.872C>T	X.37:g.123839006G>A	ENSP00000360171:p.Pro291Leu					ODZ1_uc011muj.1_Missense_Mutation_p.P291L|ODZ1_uc010nqy.2_Missense_Mutation_p.P291L	p.P291L	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN			5	936	-			291			Teneurin N-terminal.|Cytoplasmic (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.872C>T	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.728553	0.89390	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.50813	0.73;0.73	5.49	5.49	0.81192	Teneurin intracellular, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.68595	0.3018	M	0.69358	2.11	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.977;0.99	T	0.70421	-0.4876	10	0.56958	D	0.05	.	18.4256	0.90608	0.0:0.0:1.0:0.0	.	291;291;291	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	L	291	ENSP00000360171:P291L;ENSP00000403954:P291L	ENSP00000360171:P291L	P	-	2	0	ODZ1	123666687	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	9.823000	0.99369	2.292000	0.77174	0.523000	0.50628	CCT		0.527	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		38	218	0	0	0	0.007835	0	38	218				
SMARCA1	6594	broad.mit.edu	37	X	128657272	128657272	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:128657272C>A	ENST00000371122.4	-	1	205	c.76G>T	c.(76-78)Gac>Tac	p.D26Y	SMARCA1_ENST00000371123.1_Missense_Mutation_p.D26Y|SMARCA1_ENST00000478420.1_5'Flank|SMARCA1_ENST00000371121.3_Missense_Mutation_p.D26Y	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	26					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.D26Y(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						GGCTGCTCGTCCTCTATGACC	0.697																																							uc004eun.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(76-78)GAC>TAC		SWI/SNF-related matrix-associated							92.0	79.0	83.0					X																	128657272		2200	4298	6498	SO:0001583	missense	6594				ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding	g.chrX:128657272C>A	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.76G>T	X.37:g.128657272C>A	ENSP00000360163:p.Asp26Tyr					SMARCA1_uc004eup.3_Missense_Mutation_p.D26Y|SMARCA1_uc011muk.1_Missense_Mutation_p.D26Y|SMARCA1_uc011mul.1_Missense_Mutation_p.D26Y	p.D26Y	NM_003069	NP_003060	P28370	SMCA1_HUMAN			1	189	-			26					Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	37	c.76G>T	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	c	12.63	1.994617	0.35226	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.92446	-2.85;-2.85;-2.84;-3.04	3.15	3.15	0.36227	.	.	.	.	.	T	0.80539	0.4642	N	0.08118	0	0.35499	D	0.799658	P;P;P;P	0.41041	0.704;0.617;0.736;0.617	B;B;B;B	0.34346	0.032;0.087;0.18;0.087	D	0.84637	0.0693	9	0.87932	D	0	-9.3677	9.0977	0.36649	0.0:1.0:0.0:0.0	.	26;26;26;26	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	Y	26	ENSP00000360162:D26Y;ENSP00000360164:D26Y;ENSP00000360163:D26Y;ENSP00000404275:D26Y	ENSP00000360162:D26Y	D	-	1	0	SMARCA1	128484953	1.000000	0.71417	0.998000	0.56505	0.797000	0.45037	2.929000	0.48916	1.577000	0.49804	0.472000	0.43445	GAC		0.697	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069		14	61	1	0	2.31682e-05	0.003163	3.07425e-05	14	61				
AIFM1	9131	broad.mit.edu	37	X	129271088	129271088	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:129271088T>A	ENST00000287295.3	-	10	1270	c.1040A>T	c.(1039-1041)tAc>tTc	p.Y347F	AIFM1_ENST00000319908.3_Missense_Mutation_p.Y343F|AIFM1_ENST00000346424.2_Missense_Mutation_p.Y60F|AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000440263.1_5'UTR|AIFM1_ENST00000460436.2_Missense_Mutation_p.Y8F	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	347	FAD-dependent oxidoreductase. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.Y347F(1)|p.Y343F(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	GTTGCTGAGGTATTCGGGGAG	0.468																																							uc004evg.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|central_nervous_system(1)	5						c.(1039-1041)TAC>TTC		programmed cell death 8 isoform 1							193.0	158.0	170.0					X																	129271088		2203	4300	6503	SO:0001583	missense	9131				activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding	g.chrX:129271088T>A	AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1040A>T	X.37:g.129271088T>A	ENSP00000287295:p.Tyr347Phe					AIFM1_uc011mur.1_5'UTR|AIFM1_uc011mus.1_3'UTR|AIFM1_uc004evh.2_Missense_Mutation_p.Y343F|AIFM1_uc004evi.2_Missense_Mutation_p.Y60F|AIFM1_uc004evk.2_RNA	p.Y347F	NM_004208	NP_004199	O95831	AIFM1_HUMAN			10	1218	-			347			FAD-dependent oxidoreductase (By similarity).		A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	ENST00000287295.3	37	c.1040A>T	CCDS14618.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.912807	0.92178	.	.	ENSG00000156709	ENST00000460436;ENST00000346424;ENST00000319908;ENST00000287295	T;T;T;T	0.57436	0.76;0.8;0.4;0.4	5.17	5.17	0.71159	Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain (1);Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.60418	0.2267	M	0.69248	2.105	0.80722	D	1	P;P;P	0.43352	0.454;0.804;0.649	B;P;P	0.49421	0.312;0.61;0.595	T	0.59010	-0.7534	10	0.30078	T	0.28	-6.5292	14.14	0.65313	0.0:0.0:0.0:1.0	.	60;343;347	O95831-2;O95831-3;O95831	.;.;AIFM1_HUMAN	F	8;60;343;347	ENSP00000431222:Y8F;ENSP00000316320:Y60F;ENSP00000315122:Y343F;ENSP00000287295:Y347F	ENSP00000287295:Y347F	Y	-	2	0	AIFM1	129098769	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.501000	0.81600	1.914000	0.55421	0.486000	0.48141	TAC		0.468	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2			32	150	0	0	0	0.004878	0	32	150				
FRMD7	90167	broad.mit.edu	37	X	131212510	131212510	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:131212510C>A	ENST00000298542.4	-	12	1710	c.1535G>T	c.(1534-1536)aGa>aTa	p.R512I	FRMD7_ENST00000370879.1_Missense_Mutation_p.R392I|FRMD7_ENST00000464296.1_Missense_Mutation_p.R497I	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	512					regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.R512I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					TTCCTCTGCTCTAATTGGGGA	0.483																																							uc004ewn.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1534-1536)AGA>ATA		FERM domain containing 7							142.0	140.0	140.0					X																	131212510		2203	4300	6503	SO:0001583	missense	90167				regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding	g.chrX:131212510C>A	AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.1535G>T	X.37:g.131212510C>A	ENSP00000298542:p.Arg512Ile					FRMD7_uc011muy.1_Missense_Mutation_p.R497I	p.R512I	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN			12	1713	-	Acute lymphoblastic leukemia(192;0.000127)		512					C0LLJ3|Q5JX99	Missense_Mutation	SNP	ENST00000298542.4	37	c.1535G>T	CCDS35397.1	.	.	.	.	.	.	.	.	.	.	C	0.998	-0.691873	0.03303	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	D;D;D	0.85258	-1.96;-1.62;-1.73	5.16	2.77	0.32553	.	0.603585	0.17125	N	0.186076	T	0.62417	0.2426	N	0.03608	-0.345	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.49143	-0.8970	10	0.23302	T	0.38	.	3.8017	0.08761	0.599:0.2022:0.1988:0.0	.	497;512	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	I	392;512;497	ENSP00000359916:R392I;ENSP00000298542:R512I;ENSP00000417996:R497I	ENSP00000298542:R512I	R	-	2	0	FRMD7	131040191	0.001000	0.12720	0.804000	0.32291	0.026000	0.11368	1.352000	0.34033	0.623000	0.30267	-0.328000	0.08392	AGA		0.483	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1	NM_194277		58	239	1	0	2.14255e-21	0.00361	4.66149e-21	58	239				
USP26	83844	broad.mit.edu	37	X	132160953	132160953	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:132160953G>T	ENST00000511190.1	-	6	1765	c.1296C>A	c.(1294-1296)tgC>tgA	p.C432*	USP26_ENST00000406273.1_Nonsense_Mutation_p.C432*|USP26_ENST00000370832.1_Nonsense_Mutation_p.C432*	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	432	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.C432*(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					TAATGACAGGGCAAGAAAACC	0.378																																					NSCLC(104;342 1621 36940 47097 52632)	NSCLC(104;342 1621 36940 47097 52632)	uc010nrm.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8						c.(1294-1296)TGC>TGA		ubiquitin-specific protease 26							84.0	78.0	80.0					X																	132160953		2202	4300	6502	SO:0001587	stop_gained	83844				protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chrX:132160953G>T	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.1296C>A	X.37:g.132160953G>T	ENSP00000423390:p.Cys432*					USP26_uc011mvf.1_Nonsense_Mutation_p.C432*	p.C432*	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN			6	1766	-	Acute lymphoblastic leukemia(192;0.000127)		432					B9WRT6|Q5H9H4	Nonsense_Mutation	SNP	ENST00000511190.1	37	c.1296C>A	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	g	28.9	4.962901	0.92791	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	.	.	.	3.62	1.22	0.21188	.	0.000000	0.56097	D	0.000037	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.7884	6.0372	0.19714	0.7496:0.0:0.2504:0.0	.	.	.	.	X	432	.	ENSP00000359869:C432X	C	-	3	2	USP26	131988619	1.000000	0.71417	0.975000	0.42487	0.020000	0.10135	1.796000	0.38794	0.151000	0.19162	-0.415000	0.06103	TGC		0.378	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		22	109	1	0	1.9806e-07	0.002299	2.94347e-07	22	109				
SAGE1	55511	broad.mit.edu	37	X	134983834	134983834	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:134983834G>A	ENST00000370709.3	+	2	204	c.204G>A	c.(202-204)tgG>tgA	p.W68*	SAGE1_ENST00000535938.1_Nonsense_Mutation_p.W68*|SAGE1_ENST00000324447.3_Nonsense_Mutation_p.W68*|SAGE1_ENST00000537770.1_Nonsense_Mutation_p.W68*			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	68						nucleus (GO:0005634)		p.W68*(1)		breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					TGTCCTCGTGGTTAGACAAAC	0.428																																							uc004ezh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(1)	3						c.(202-204)TGG>TGA		sarcoma antigen 1							176.0	167.0	170.0					X																	134983834		2203	4300	6503	SO:0001587	stop_gained	55511							g.chrX:134983834G>A	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.204G>A	X.37:g.134983834G>A	ENSP00000359743:p.Trp68*					SAGE1_uc010nry.1_Nonsense_Mutation_p.W68*|SAGE1_uc011mvv.1_Nonsense_Mutation_p.W68*	p.W68*	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN			3	371	+	Acute lymphoblastic leukemia(192;0.000127)		68					Q5JNW0	Nonsense_Mutation	SNP	ENST00000370709.3	37	c.204G>A	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929920	0.34096	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	.	.	.	1.33	1.33	0.21861	.	0.216192	0.38720	U	0.001582	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	5.6128	0.17414	0.0:0.0:1.0:0.0	.	.	.	.	X	68	.	ENSP00000323191:W68X	W	+	3	0	SAGE1	134811500	0.000000	0.05858	0.003000	0.11579	0.207000	0.24258	0.026000	0.13599	0.950000	0.37743	0.181000	0.17075	TGG		0.428	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666		65	298	0	0	0	0.00361	0	65	298				
MAGEA8	4107	broad.mit.edu	37	X	149013289	149013289	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:149013289C>G	ENST00000542674.1	+	3	764	c.243C>G	c.(241-243)agC>agG	p.S81R	MAGEA8_ENST00000535454.1_Missense_Mutation_p.S81R|MAGEA8_ENST00000286482.1_Missense_Mutation_p.S81R|MAGEA8_ENST00000493910.1_3'UTR	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	81								p.S81R(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					CTCTGTGGAGCCAATCCGATG	0.597																																							uc004fdw.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(241-243)AGC>AGG		melanoma antigen family A, 8							68.0	62.0	64.0					X																	149013289		2203	4298	6501	SO:0001583	missense	4107							g.chrX:149013289C>G		CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.243C>G	X.37:g.149013289C>G	ENSP00000443776:p.Ser81Arg						p.S81R	NM_005364	NP_005355	P43361	MAGA8_HUMAN			3	458	+	Acute lymphoblastic leukemia(192;6.56e-05)		81					Q9BUN9	Missense_Mutation	SNP	ENST00000542674.1	37	c.243C>G	CCDS14692.1	.	.	.	.	.	.	.	.	.	.	.	3.534	-0.095127	0.07010	.	.	ENSG00000156009	ENST00000535454;ENST00000542674;ENST00000286482	T;T;T	0.05025	3.51;3.51;3.51	0.805	0.805	0.18703	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.05318	0.0141	L	0.28649	0.875	0.09310	N	1	B	0.13594	0.008	B	0.23419	0.046	T	0.40175	-0.9577	8	0.36615	T	0.2	.	.	.	.	.	81	P43361	MAGA8_HUMAN	R	81	ENSP00000438293:S81R;ENSP00000443776:S81R;ENSP00000286482:S81R	ENSP00000286482:S81R	S	+	3	2	MAGEA8	148773947	0.001000	0.12720	0.043000	0.18650	0.028000	0.11728	-0.704000	0.05058	0.659000	0.30945	0.190000	0.17370	AGC		0.597	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364		20	91	0	0	0	0.007413	0	20	91				
GPR50	9248	broad.mit.edu	37	X	150349618	150349618	+	Silent	SNP	C	C	A	rs377123063		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:150349618C>A	ENST00000218316.3	+	2	1632	c.1563C>A	c.(1561-1563)ccC>ccA	p.P521P	AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	521	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)	p.P521P(1)		breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CTGACTATCCCAAGCCTGCCA	0.612																																							uc010ntg.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(1561-1563)CCC>CCA		G protein-coupled receptor 50							60.0	74.0	70.0					X																	150349618		2170	4248	6418	SO:0001819	synonymous_variant	9248				cell-cell signaling	integral to plasma membrane	melatonin receptor activity	g.chrX:150349618C>A	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1563C>A	X.37:g.150349618C>A							p.P521P	NM_004224	NP_004215	Q13585	MTR1L_HUMAN			2	1698	+	Acute lymphoblastic leukemia(192;6.56e-05)		521			Cytoplasmic (Potential).|Pro-rich.		Q0VGG3|Q3ZAR0	Silent	SNP	ENST00000218316.3	37	c.1563C>A	CCDS44012.1																																																																																				0.612	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224		28	80	1	0	2.40579e-17	0.00623	4.88234e-17	28	80				
MAGEA4	4103	broad.mit.edu	37	X	151092221	151092221	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:151092221C>A	ENST00000360243.2	+	3	352	c.85C>A	c.(85-87)Cag>Aag	p.Q29K	MAGEA4_ENST00000276344.2_Missense_Mutation_p.Q29K|MAGEA4_ENST00000370335.1_Missense_Mutation_p.Q29K|MAGEA4_ENST00000370340.3_Missense_Mutation_p.Q29K|MAGEA4_ENST00000393921.1_Missense_Mutation_p.Q29K|MAGEA4_ENST00000393920.1_Missense_Mutation_p.Q29K|MAGEA4_ENST00000370337.4_Missense_Mutation_p.Q29K	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	29								p.Q29K(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					GGTGGGTGCACAGGCTCCTAC	0.612																																							uc004fez.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|central_nervous_system(1)	3						c.(85-87)CAG>AAG		melanoma antigen family A, 4							47.0	45.0	45.0					X																	151092221		2203	4300	6503	SO:0001583	missense	4103						protein binding	g.chrX:151092221C>A		CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.85C>A	X.37:g.151092221C>A	ENSP00000353379:p.Gln29Lys					MAGEA4_uc004ffa.2_Missense_Mutation_p.Q29K|MAGEA4_uc004ffb.2_Missense_Mutation_p.Q29K|MAGEA4_uc004ffc.2_Missense_Mutation_p.Q29K|MAGEA4_uc004ffd.2_Missense_Mutation_p.Q29K	p.Q29K	NM_002362	NP_002353	P43358	MAGA4_HUMAN			3	241	+	Acute lymphoblastic leukemia(192;6.56e-05)		29					Q14798	Missense_Mutation	SNP	ENST00000360243.2	37	c.85C>A	CCDS14702.1	.	.	.	.	.	.	.	.	.	.	C	12.18	1.859540	0.32884	.	.	ENSG00000147381	ENST00000431963;ENST00000276344;ENST00000448295;ENST00000393921;ENST00000430273;ENST00000370337;ENST00000441865;ENST00000393920;ENST00000370340;ENST00000416020;ENST00000425182;ENST00000457310;ENST00000370335;ENST00000360243;ENST00000431971	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1;3.1;3.1;3.1;3.1;3.1;3.1;3.1;3.1;3.1;3.1	2.4	-2.4	0.06583	Melanoma associated antigen, MAGE, N-terminal (1);	4.543870	0.00166	N	0.000003	T	0.35248	0.0925	M	0.93462	3.42	0.09310	N	1	D	0.71674	0.998	D	0.65443	0.935	T	0.41627	-0.9498	10	0.72032	D	0.01	.	6.7982	0.23736	0.1858:0.2676:0.5466:0.0	.	29	P43358	MAGA4_HUMAN	K	29	ENSP00000387777:Q29K;ENSP00000276344:Q29K;ENSP00000391904:Q29K;ENSP00000377498:Q29K;ENSP00000394149:Q29K;ENSP00000359362:Q29K;ENSP00000402624:Q29K;ENSP00000377497:Q29K;ENSP00000359365:Q29K;ENSP00000394073:Q29K;ENSP00000400900:Q29K;ENSP00000402186:Q29K;ENSP00000359360:Q29K;ENSP00000353379:Q29K;ENSP00000390096:Q29K	ENSP00000276344:Q29K	Q	+	1	0	MAGEA4	150842877	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.646000	0.05403	-0.816000	0.04340	0.436000	0.28706	CAG		0.612	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060898.1	NM_002362		23	80	1	0	2.89027e-11	0.002299	4.96797e-11	23	80				
HCFC1	3054	broad.mit.edu	37	X	153219071	153219071	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:153219071C>A	ENST00000310441.7	-	18	5450	c.4484G>T	c.(4483-4485)gGc>gTc	p.G1495V	HCFC1_ENST00000354233.3_Missense_Mutation_p.G1426V|HCFC1_ENST00000369984.4_Missense_Mutation_p.G1495V	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1495					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.G1495V(1)|p.G1398V(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACAGAGGGGCCCGGGACCGG	0.652																																							uc004fjp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(4483-4485)GGC>GTC		host cell factor 1							46.0	47.0	47.0					X																	153219071		2089	4197	6286	SO:0001583	missense	3054				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chrX:153219071C>A		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.4484G>T	X.37:g.153219071C>A	ENSP00000309555:p.Gly1495Val						p.G1495V	NM_005334	NP_005325	P51610	HCFC1_HUMAN			18	5012	-	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		1495					Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	37	c.4484G>T	CCDS44020.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210925	0.79240	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.24538	3.33;1.85;3.32	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.46151	0.1378	L	0.43923	1.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.36432	-0.9748	10	0.87932	D	0	.	17.9311	0.88998	0.0:1.0:0.0:0.0	.	1495	P51610	HCFC1_HUMAN	V	1495;1495;1426	ENSP00000309555:G1495V;ENSP00000359001:G1495V;ENSP00000346174:G1426V	ENSP00000309555:G1495V	G	-	2	0	HCFC1	152872265	1.000000	0.71417	0.978000	0.43139	0.262000	0.26303	6.917000	0.75782	2.509000	0.84616	0.529000	0.55759	GGC		0.652	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334		13	62	1	0	0.00185496	0.001855	0.00224548	13	62				
PLXNA3	55558	broad.mit.edu	37	X	153694526	153694526	+	Silent	SNP	C	C	A			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chrX:153694526C>A	ENST00000369682.3	+	15	2887	c.2712C>A	c.(2710-2712)ccC>ccA	p.P904P		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	904	IPT/TIG 1.				axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.P904P(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGCTGGTGCCCAGCCCGCCGC	0.682																																							uc004flm.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(2710-2712)CCC>CCA		plexin A3 precursor							61.0	67.0	65.0					X																	153694526		2201	4298	6499	SO:0001819	synonymous_variant	55558				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity	g.chrX:153694526C>A	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.2712C>A	X.37:g.153694526C>A							p.P904P	NM_017514	NP_059984	P51805	PLXA3_HUMAN			15	2885	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		904			IPT/TIG 1.|Extracellular (Potential).		Q5HY36	Silent	SNP	ENST00000369682.3	37	c.2712C>A	CCDS14752.1																																																																																				0.682	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514		14	77	1	0	1.37285e-15	0.004007	2.6313e-15	14	77				
JUN	3725	broad.mit.edu	37	1	59247873	59247873	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:59247873delC	ENST00000371222.2	-	1	1912	c.870delG	c.(868-870)cagfs	p.Q290fs	RP4-794H19.2_ENST00000419531.2_lincRNA	NM_002228.3	NP_002219.1	P05412	JUN_HUMAN	jun proto-oncogene	290	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				aging (GO:0007568)|angiogenesis (GO:0001525)|axon regeneration (GO:0031103)|cellular response to calcium ion (GO:0071277)|cellular response to potassium ion starvation (GO:0051365)|circadian rhythm (GO:0007623)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leading edge cell differentiation (GO:0035026)|learning (GO:0007612)|liver development (GO:0001889)|membrane depolarization (GO:0051899)|microglial cell activation (GO:0001774)|monocyte differentiation (GO:0030224)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA binding (GO:0043392)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990441)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|SMAD protein import into nucleus (GO:0007184)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nuclear chromosome (GO:0000228)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|R-SMAD binding (GO:0070412)|Rho GTPase activator activity (GO:0005100)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|kidney(2)|lung(5)|skin(1)	10	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Pseudoephedrine(DB00852)|Vinblastine(DB00570)	GCTCCGAGTTCTGAGCTTTCA	0.542			A		sarcoma						OREG0013518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001cze.2		NA		Dom	yes		1	1p32-p31	3725	A	jun oncogene			M			sarcoma		0					0						c.(868-870)CAGfs		jun oncogene	Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Vinblastine(DB00570)						129.0	127.0	128.0					1																	59247873		2203	4300	6503	SO:0001589	frameshift_variant	3725				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation by host of viral transcription|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein import into nucleus|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway		R-SMAD binding|Rho GTPase activator activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity|transcription factor binding|transcription regulatory region DNA binding	g.chr1:59247873delC	AY217548	CCDS610.1	1p32-p31	2013-01-10	2010-08-27		ENSG00000177606	ENSG00000177606		"""basic leucine zipper proteins"""	6204	protein-coding gene	gene with protein product		165160	"""v-jun avian sarcoma virus 17 oncogene homolog"", ""v-jun sarcoma virus 17 oncogene homolog (avian)"", ""jun oncogene"""			3194415	Standard	NM_002228		Approved	c-Jun, AP-1	uc001cze.3	P05412	OTTHUMG00000008376	ENST00000371222.2:c.870delG	1.37:g.59247873delC	ENSP00000360266:p.Gln290fs		OREG0013518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1037	uc001czf.2_5'Flank|uc010oop.1_5'Flank	p.Q290fs	NM_002228	NP_002219	P05412	JUN_HUMAN			1	1913	-	all_cancers(7;8.55e-07)		290			Leucine-zipper.		Q6FHM7|Q96G93	Frame_Shift_Del	DEL	ENST00000371222.2	37	c.870delG	CCDS610.1																																																																																				0.542	JUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023042.1	NM_002228		49	173	NA	NA	NA	NA	NA	49	173	---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103355036	103355036	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr1:103355036delC	ENST00000370096.3	-	59	4751	c.4439delG	c.(4438-4440)ggafs	p.G1480fs	COL11A1_ENST00000353414.4_Frame_Shift_Del_p.G1441fs|COL11A1_ENST00000358392.2_Frame_Shift_Del_p.G1492fs|COL11A1_ENST00000512756.1_Frame_Shift_Del_p.G1364fs	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1480	Collagen-like 7.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TCCTGGAGATCCTTGAGTTCC	0.458																																							uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(4438-4440)GGAfs		alpha 1 type XI collagen isoform A							85.0	83.0	84.0					1																	103355036		2203	4300	6503	SO:0001589	frameshift_variant	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103355036delC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4439delG	1.37:g.103355036delC	ENSP00000359114:p.Gly1480fs					COL11A1_uc001duk.2_Frame_Shift_Del_p.G676fs|COL11A1_uc001dum.2_Frame_Shift_Del_p.G1492fs|COL11A1_uc001dun.2_Frame_Shift_Del_p.G1441fs|COL11A1_uc009weh.2_Frame_Shift_Del_p.G1364fs	p.G1480fs	NM_001854	NP_001845	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	59	4757	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	1480			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Frame_Shift_Del	DEL	ENST00000370096.3	37	c.4439delG	CCDS778.1																																																																																				0.458	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		19	98	NA	NA	NA	NA	NA	19	98	---	---	---	---
SWAP70	23075	broad.mit.edu	37	11	9759806	9759806	+	Frame_Shift_Del	DEL	G	G	-	rs200743817		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr11:9759806delG	ENST00000318950.6	+	8	1230	c.1127delG	c.(1126-1128)cgcfs	p.R376fs	SWAP70_ENST00000447399.2_Frame_Shift_Del_p.R318fs	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	376					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		GAAAAGAAACGCCTTCAGACT	0.478																																							uc001mhw.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1126-1128)CGCfs		SWAP-70 protein							70.0	67.0	68.0					11																	9759806		2201	4294	6495	SO:0001589	frameshift_variant	23075					cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding	g.chr11:9759806delG	AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.1127delG	11.37:g.9759806delG	ENSP00000315630:p.Arg376fs					SWAP70_uc001mhv.2_Frame_Shift_Del_p.R376fs|SWAP70_uc001mhx.2_Frame_Shift_Del_p.R318fs	p.R376fs	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN		all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)	8	1226	+			376			Potential.		D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Frame_Shift_Del	DEL	ENST00000318950.6	37	c.1127delG	CCDS31426.1																																																																																				0.478	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055		16	76	NA	NA	NA	NA	NA	16	76	---	---	---	---
ZIC2	7546	broad.mit.edu	37	13	100635008	100635010	+	In_Frame_Del	DEL	CCA	CCA	-	rs375069774		TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	CCA	CCA	-	-	CCA	CCA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr13:100635008_100635010delCCA	ENST00000376335.3	+	1	983_985	c.690_692delCCA	c.(688-693)gcccac>gcc	p.H239del		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	239	Necessary for interaction with MDFIC and transcriptional activation or repression. {ECO:0000250}.|Poly-His.		H -> HH. {ECO:0000269|PubMed:15221788}.|Missing. {ECO:0000269|PubMed:15221788}.		brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CAGCCGCGGCccaccaccaccac	0.621																																					Pancreas(97;119 1522 31925 44771 48764)	Pancreas(97;119 1522 31925 44771 48764)	uc001von.2		NA																	0					0						c.(688-693)GCCCAC>GCC		zinc finger protein of the cerebellum 2																																				SO:0001651	inframe_deletion	7546				brain development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|visual perception	cytoplasm|nucleus	chromatin DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr13:100635008_100635010delCCA	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.690_692delCCA	13.37:g.100635017_100635019delCCA	ENSP00000365514:p.His239del						p.H239del	NM_007129	NP_009060	O95409	ZIC2_HUMAN			1	690_692	+	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		239		Missing.|H -> HH.	Necessary for interaction with MDFIC and transcriptional activation or repression (By similarity).|Poly-His.		Q5VYA9|Q9H309	In_Frame_Del	DEL	ENST00000376335.3	37	c.690_692delCCA	CCDS9495.1																																																																																				0.621	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045618.2	NM_007129		7	82	NA	NA	NA	NA	NA	7	82	---	---	---	---
FANCM	57697	broad.mit.edu	37	14	45639873	45639873	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:45639873delG	ENST00000267430.5	+	12	2169	c.2084delG	c.(2083-2085)aggfs	p.R695fs	FANCM_ENST00000542564.2_Frame_Shift_Del_p.R669fs	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	695					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TATAGATTAAGGGACAGTGAT	0.294								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc001wwd.3		NA																	0				ovary(3)|lung(2)|breast(2)	7						c.(2083-2085)AGGfs	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group M							62.0	69.0	66.0					14																	45639873		2202	4294	6496	SO:0001589	frameshift_variant	57697	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding	g.chr14:45639873delG	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.2084delG	14.37:g.45639873delG	ENSP00000267430:p.Arg695fs					FANCM_uc010anf.2_Frame_Shift_Del_p.R669fs|FANCM_uc001wwe.3_Frame_Shift_Del_p.R231fs	p.R695fs	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN			12	2183	+			695					B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Frame_Shift_Del	DEL	ENST00000267430.5	37	c.2084delG	CCDS32070.1																																																																																				0.294	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		12	66	NA	NA	NA	NA	NA	12	66	---	---	---	---
FRMD6	122786	broad.mit.edu	37	14	52178252	52178252	+	Frame_Shift_Del	DEL	A	A	-			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr14:52178252delA	ENST00000344768.5	+	8	914	c.718delA	c.(718-720)aaafs	p.K240fs	FRMD6_ENST00000395718.2_Frame_Shift_Del_p.K232fs|FRMD6_ENST00000554167.1_Frame_Shift_Del_p.K163fs|FRMD6_ENST00000356218.4_Frame_Shift_Del_p.K232fs			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	240	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					CCTACAGGATAAAAGGGAAAT	0.328																																							uc001wzd.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(718-720)AAAfs		FERM domain containing 6							71.0	69.0	70.0					14																	52178252		2203	4300	6503	SO:0001589	frameshift_variant	122786					cytoskeleton|mitochondrion|plasma membrane	binding	g.chr14:52178252delA	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.718delA	14.37:g.52178252delA	ENSP00000343899:p.Lys240fs					FRMD6_uc001wzb.2_Frame_Shift_Del_p.K232fs|FRMD6_uc001wzc.2_Frame_Shift_Del_p.K232fs|FRMD6_uc001wze.2_Frame_Shift_Del_p.K163fs|FRMD6_uc001wzf.2_5'Flank	p.K240fs	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN			8	1003	+	all_epithelial(31;0.0163)|Breast(41;0.089)		240			FERM.		D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Frame_Shift_Del	DEL	ENST00000344768.5	37	c.718delA	CCDS58318.1																																																																																				0.328	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330		8	53	NA	NA	NA	NA	NA	8	53	---	---	---	---
ATP8B3	148229	broad.mit.edu	37	19	1796145	1796145	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr19:1796145delC	ENST00000310127.6	-	17	2111	c.1873delG	c.(1873-1875)gagfs	p.E626fs	ATP8B3_ENST00000539485.1_Frame_Shift_Del_p.E626fs|ATP8B3_ENST00000525591.1_Frame_Shift_Del_p.E579fs	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	626					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCCGTTCCTCCCCCAGCTCC	0.677											OREG0025127	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002ltw.2		NA																	0					0						c.(1873-1875)GAGfs		ATPase, class I, type 8B, member 3							55.0	60.0	58.0					19																	1796145		2033	4174	6207	SO:0001589	frameshift_variant	148229				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr19:1796145delC	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1873delG	19.37:g.1796145delC	ENSP00000311336:p.Glu626fs		OREG0025127	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	598	ATP8B3_uc002ltv.2_Frame_Shift_Del_p.E578fs|ATP8B3_uc002ltx.2_RNA	p.E625fs	NM_138813	NP_620168	O60423	AT8B3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	17	2107	-		Hepatocellular(1079;0.137)	625			Cytoplasmic (Potential).		Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Frame_Shift_Del	DEL	ENST00000310127.6	37	c.1873delG	CCDS45901.1																																																																																				0.677	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813		20	63	NA	NA	NA	NA	NA	20	63	---	---	---	---
LOC401010	401010	broad.mit.edu	37	2	132200298	132200299	+	IGR	INS	-	-	G			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr2:132200298_132200299insG								AC073869.19 (33676 upstream) : RP11-109E12.1 (19094 downstream)																							GGGCCAGCCCCGCCTCTGCGTC	0.663																																							uc002tst.2		NA																	0					0						c.(1702-1704)GCGfs		SubName: Full=cDNA FLJ12694 fis, clone NT2RP1000358, highly similar to Homo sapiens mRNA; cDNA DKFZp564C186 (from clone DKFZp564C186);																																				SO:0001628	intergenic_variant	401010							g.chr2:132200298_132200299insG																													2.37:g.132200299_132200299dupG							p.A568fs	NR_002826						1	2169_2170	-									Frame_Shift_Ins	INS		37	c.1703_1704insC																																																																																				0	0.663									9	23	NA	NA	NA	NA	NA	9	23	---	---	---	---
NIPBL	25836	broad.mit.edu	37	5	37049317	37049317	+	Frame_Shift_Del	DEL	T	T	-			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr5:37049317delT	ENST00000282516.8	+	40	7367	c.6868delT	c.(6868-6870)tttfs	p.F2291fs	NIPBL_ENST00000448238.2_Frame_Shift_Del_p.F2291fs	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2291					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GCTTGAGGCATTTTTTCACAC	0.403																																							uc003jkl.3		NA																	0				ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9						c.(6868-6870)TTTfs		delangin isoform A							221.0	210.0	214.0					5																	37049317		2203	4300	6503	SO:0001589	frameshift_variant	25836				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding	g.chr5:37049317delT	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6868delT	5.37:g.37049317delT	ENSP00000282516:p.Phe2291fs					NIPBL_uc003jkk.3_Frame_Shift_Del_p.F2290fs|NIPBL_uc003jkn.2_5'Flank	p.F2290fs	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)		40	7367	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		2290					Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Frame_Shift_Del	DEL	ENST00000282516.8	37	c.6868delT	CCDS3920.1																																																																																				0.403	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384		7	2137	NA	NA	NA	NA	NA	7	2137	---	---	---	---
IFNA7	3444	broad.mit.edu	37	9	21202041	21202041	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6774-01A-21D-1855-08	TCGA-44-6774-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	f9cc1d71-bece-4693-b953-3e73d1b6c11c	7d906a56-6db5-4619-948c-30a21f5c40c9	g.chr9:21202041delC	ENST00000239347.3	-	1	163	c.124delG	c.(124-126)gcafs	p.A42fs		NM_021057.2	NP_066401.2	P01567	IFNA7_HUMAN	interferon, alpha 7	42					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(6)	12				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CCCATTTGTGCCAGGAGTATC	0.512																																							uc003zop.1		NA																	0					0						c.(124-126)GCAfs		interferon, alpha 7 precursor							115.0	114.0	114.0					9																	21202041		2203	4300	6503	SO:0001589	frameshift_variant	3444				blood coagulation|cell-cell signaling|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding	g.chr9:21202041delC		CCDS34995.1	9p22	2010-12-10			ENSG00000214042	ENSG00000214042		"""Interferons"""	5428	protein-coding gene	gene with protein product		147567				1385305	Standard	NM_021057		Approved	IFNA-J, IFN-alphaJ	uc003zop.1	P01567	OTTHUMG00000019662	ENST00000239347.3:c.124delG	9.37:g.21202041delC	ENSP00000239347:p.Ala42fs					IFNA14_uc003zoo.1_Intron	p.A42fs	NM_021057	NP_066401	P01567	IFNA7_HUMAN		GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)	1	164	-			42					Q14607|Q5VV14	Frame_Shift_Del	DEL	ENST00000239347.3	37	c.124delG	CCDS34995.1																																																																																				0.512	IFNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051891.1	NM_021057		49	223	NA	NA	NA	NA	NA	49	223	---	---	---	---
