#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TNFRSF18	8784	broad.mit.edu	37	1	1139804	1139804	+	Missense_Mutation	SNP	C	C	T	rs531486834		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:1139804C>T	ENST00000379268.2	-	3	492	c.373G>A	c.(373-375)Gaa>Aaa	p.E125K	TNFRSF18_ENST00000486728.1_Missense_Mutation_p.E53K|TNFRSF18_ENST00000379265.5_Missense_Mutation_p.E125K|TNFRSF18_ENST00000328596.6_Missense_Mutation_p.E125K	NM_004195.2|NM_148902.1	NP_004186.1|NP_683700.1	Q9Y5U5	TNR18_HUMAN	tumor necrosis factor receptor superfamily, member 18	125					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)	p.E125K(2)		lung(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CAGTGGCCTTCGTGGCCCCCG	0.647													c|||	1	0.000199681	0.0008	0.0	5008	,	,		13889	0.0		0.0	False		,,,				2504	0.0				GBM(157;472 1934 13810 14591 35952)	GBM(157;472 1934 13810 14591 35952)	uc001adc.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(373-375)GAA>AAA		tumor necrosis factor receptor superfamily,							34.0	38.0	37.0					1																	1139804		2197	4294	6491	SO:0001583	missense	8784				anti-apoptosis|apoptosis	extracellular region|integral to plasma membrane	tumor necrosis factor receptor activity	g.chr1:1139804C>T	AF125304	CCDS9.1, CCDS10.1, CCDS30552.1	1p36.3	2011-08-11			ENSG00000186891	ENSG00000186891		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11914	protein-coding gene	gene with protein product		603905				9177197, 10037686	Standard	NM_004195		Approved	AITR, GITR, CD357	uc001add.3	Q9Y5U5	OTTHUMG00000001414	ENST00000379268.2:c.373G>A	1.37:g.1139804C>T	ENSP00000368570:p.Glu125Lys					TNFRSF18_uc001ada.2_Missense_Mutation_p.E53K|TNFRSF18_uc001adb.2_Missense_Mutation_p.E125K|TNFRSF18_uc001add.2_Missense_Mutation_p.E125K	p.E125K	NM_004195	NP_004186	Q9Y5U5	TNR18_HUMAN		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	3	511	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	125			TNFR-Cys 3.|Extracellular (Potential).		B1AME1|O95851|Q5U0I4|Q9NYJ9	Missense_Mutation	SNP	ENST00000379268.2	37	c.373G>A	CCDS10.1	.	.	.	.	.	.	.	.	.	.	C	9.851	1.193643	0.22037	.	.	ENSG00000186891	ENST00000328596;ENST00000379268;ENST00000379265	T;T;T	0.61040	1.82;0.14;0.14	3.55	2.6	0.31112	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.678176	0.13361	N	0.393645	T	0.47637	0.1456	L	0.44542	1.39	0.09310	N	1	P;P;P	0.50710	0.792;0.938;0.938	B;B;B	0.39840	0.128;0.241;0.311	T	0.39522	-0.9610	10	0.66056	D	0.02	-9.6217	10.9468	0.47306	0.0:0.8076:0.1924:0.0	.	125;125;125	Q9Y5U5-2;Q9Y5U5;B1AME3	.;TNR18_HUMAN;.	K	125	ENSP00000328207:E125K;ENSP00000368570:E125K;ENSP00000368567:E125K	ENSP00000328207:E125K	E	-	1	0	TNFRSF18	1129667	0.001000	0.12720	0.099000	0.21106	0.009000	0.06853	1.116000	0.31221	1.035000	0.39972	0.655000	0.94253	GAA		0.647	TNFRSF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004083.2	NM_004195		10	31	0	0	0	0.006214	0	10	31				
EPHB2	2048	broad.mit.edu	37	1	23111087	23111087	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:23111087C>A	ENST00000400191.3	+	3	347	c.329C>A	c.(328-330)aCc>aAc	p.T110N	EPHB2_ENST00000374632.3_Missense_Mutation_p.T110N|EPHB2_ENST00000374627.1_Missense_Mutation_p.T104N|EPHB2_ENST00000374630.3_Missense_Mutation_p.T110N|EPHB2_ENST00000544305.1_Missense_Mutation_p.T110N	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	110	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.T110N(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		TGCAAGGAGACCTTCAACCTC	0.572																																							uc009vqj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|pancreas(1)	5						c.(328-330)ACC>AAC		ephrin receptor EphB2 isoform 1 precursor							53.0	48.0	50.0					1																	23111087		2203	4300	6503	SO:0001583	missense	2048	Hereditary_Prostate_Cancer			axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity	g.chr1:23111087C>A	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.329C>A	1.37:g.23111087C>A	ENSP00000383053:p.Thr110Asn					EPHB2_uc001bge.2_Missense_Mutation_p.T110N|EPHB2_uc001bgf.2_Missense_Mutation_p.T110N|EPHB2_uc010odu.1_Missense_Mutation_p.T110N	p.T110N	NM_017449	NP_059145	P29323	EPHB2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)	3	474	+		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)	110			Extracellular (Potential).		O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	37	c.329C>A		.	.	.	.	.	.	.	.	.	.	C	24.1	4.498059	0.85069	.	.	ENSG00000133216	ENST00000374625;ENST00000544305;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T;T	0.19394	2.15;2.15;2.15;2.15;2.15	5.43	5.43	0.79202	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.60077	0.2241	H	0.94306	3.52	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.71094	-0.4692	10	0.87932	D	0	.	17.9703	0.89111	0.0:1.0:0.0:0.0	.	110;110;128;110	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	N	110;110;110;110;110;104	ENSP00000444174:T110N;ENSP00000363761:T110N;ENSP00000383053:T110N;ENSP00000363763:T110N;ENSP00000363758:T104N	ENSP00000363755:T110N	T	+	2	0	EPHB2	22983674	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.590000	0.82653	2.830000	0.97506	0.585000	0.79938	ACC		0.572	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449		12	21	1	0	1.08611e-07	0.010729	1.39711e-07	12	21				
C8B	732	broad.mit.edu	37	1	57411544	57411544	+	Missense_Mutation	SNP	C	C	A	rs202077631		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:57411544C>A	ENST00000371237.4	-	7	1121	c.1055G>T	c.(1054-1056)gGc>gTc	p.G352V	C8B_ENST00000535057.1_Missense_Mutation_p.G290V|C8B_ENST00000543257.1_Missense_Mutation_p.G300V	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	352	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.G352V(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						TTCATAAATGCCCCCAAGCAC	0.517																																							uc001cyp.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|large_intestine(1)|ovary(1)	4						c.(1054-1056)GGC>GTC		complement component 8, beta polypeptide							83.0	80.0	81.0					1																	57411544		2203	4300	6503	SO:0001583	missense	732				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex		g.chr1:57411544C>A	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.1055G>T	1.37:g.57411544C>A	ENSP00000360281:p.Gly352Val					C8B_uc010oon.1_Missense_Mutation_p.G290V|C8B_uc010ooo.1_Missense_Mutation_p.G300V	p.G352V	NM_000066	NP_000057	P07358	CO8B_HUMAN			7	1122	-			352			MACPF.		A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	c.1055G>T	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062847	0.76187	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	D;D;D	0.94650	-3.48;-3.48;-3.48	4.71	3.77	0.43336	Membrane attack complex component/perforin (MACPF) domain (3);	0.099213	0.64402	D	0.000001	D	0.97185	0.9080	M	0.86651	2.83	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97415	1.0005	10	0.87932	D	0	-22.7853	13.3994	0.60874	0.0:0.9218:0.0:0.0782	.	300;290;352	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	V	352;300;290	ENSP00000360281:G352V;ENSP00000442548:G300V;ENSP00000440113:G290V	ENSP00000360281:G352V	G	-	2	0	C8B	57184132	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.445000	0.60007	2.438000	0.82558	0.655000	0.94253	GGC		0.517	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2			32	56	1	0	9.65021e-13	0.010818	1.44506e-12	32	56				
IL12RB2	3595	broad.mit.edu	37	1	67795397	67795397	+	Silent	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:67795397C>T	ENST00000262345.1	+	6	1432	c.792C>T	c.(790-792)agC>agT	p.S264S	IL12RB2_ENST00000541374.1_Silent_p.S264S|IL12RB2_ENST00000544434.1_Silent_p.S264S|IL12RB2_ENST00000371000.1_Silent_p.S264S	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	264	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)	p.S264S(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						CCAGTAACAGCAGGCTCTGGA	0.403																																							uc001ddu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(790-792)AGC>AGT		interleukin 12 receptor, beta 2 precursor							110.0	105.0	107.0					1																	67795397		2203	4300	6503	SO:0001819	synonymous_variant	3595				positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity	g.chr1:67795397C>T	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.792C>T	1.37:g.67795397C>T						IL12RB2_uc010oqi.1_Silent_p.S264S|IL12RB2_uc010oqj.1_Silent_p.S264S|IL12RB2_uc010oqk.1_RNA|IL12RB2_uc010oql.1_Silent_p.S264S|IL12RB2_uc010oqm.1_Silent_p.S264S|IL12RB2_uc010oqn.1_RNA	p.S264S	NM_001559	NP_001550	Q99665	I12R2_HUMAN			6	1432	+			264			Extracellular (Potential).|Fibronectin type-III 2.		B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Silent	SNP	ENST00000262345.1	37	c.792C>T	CCDS638.1	.	.	.	.	.	.	.	.	.	.	C	0.037	-1.301723	0.01353	.	.	ENSG00000081985	ENST00000441640	.	.	.	5.2	3.21	0.36854	.	.	.	.	.	.	.	.	.	.	.	0.29926	N	0.822317	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.3427	7.5917	0.28025	0.0:0.7381:0.1675:0.0944	.	.	.	.	X	132	.	.	Q	+	1	0	IL12RB2	67567985	0.000000	0.05858	0.388000	0.26195	0.064000	0.16182	0.084000	0.14891	1.327000	0.45338	0.561000	0.74099	CAG		0.403	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559		15	41	0	0	0	0.00499	0	15	41				
ERICH3	127254	broad.mit.edu	37	1	75097536	75097536	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:75097536A>C	ENST00000326665.5	-	7	898	c.680T>G	c.(679-681)aTt>aGt	p.I227S	C1orf173_ENST00000420661.2_Missense_Mutation_p.I30S	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		227								p.I227S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GTAACTGTTAATGTTTGGAAG	0.398																																							uc001dgg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(679-681)ATT>AGT		hypothetical protein LOC127254							220.0	190.0	200.0					1																	75097536		2203	4300	6503	SO:0001583	missense	127254							g.chr1:75097536A>C																												ENST00000326665.5:c.680T>G	1.37:g.75097536A>C	ENSP00000322609:p.Ile227Ser					C1orf173_uc001dgi.3_Missense_Mutation_p.I21S	p.I227S	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN			7	899	-			227					Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	c.680T>G	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.928290	0.34002	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.35421	1.73;1.31	5.39	4.23	0.50019	.	.	.	.	.	T	0.39545	0.1082	M	0.72118	2.19	0.41767	D	0.989746	D;D	0.76494	0.989;0.999	P;D	0.68039	0.787;0.955	T	0.34378	-0.9831	9	0.17832	T	0.49	-3.6671	11.1543	0.48478	0.8617:0.0:0.0:0.1383	.	30;227	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	S	227;30	ENSP00000322609:I227S;ENSP00000398581:I30S	ENSP00000322609:I227S	I	-	2	0	C1orf173	74870124	1.000000	0.71417	0.036000	0.18154	0.005000	0.04900	3.898000	0.56281	0.850000	0.35239	0.528000	0.53228	ATT		0.398	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			38	63	0	0	0	0.004289	0	38	63				
PKN2	5586	broad.mit.edu	37	1	89270578	89270578	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:89270578A>G	ENST00000370521.3	+	10	1834	c.1475A>G	c.(1474-1476)cAa>cGa	p.Q492R	PKN2_ENST00000316005.7_Missense_Mutation_p.Q492R|PKN2_ENST00000370513.5_Missense_Mutation_p.Q444R|PKN2_ENST00000370505.3_Missense_Mutation_p.Q335R|PKN2_ENST00000544045.1_Missense_Mutation_p.Q166R	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	492					apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.Q492R(2)		breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		CTTCAAAGACAAAAGAAAATT	0.264																																							uc001dmn.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|lung(1)|skin(1)	3						c.(1474-1476)CAA>CGA		protein kinase N2							36.0	34.0	35.0					1																	89270578		1791	4039	5830	SO:0001583	missense	5586				signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity	g.chr1:89270578A>G	U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.1475A>G	1.37:g.89270578A>G	ENSP00000359552:p.Gln492Arg					PKN2_uc001dmm.1_Missense_Mutation_p.Q492R|PKN2_uc010osp.1_Missense_Mutation_p.Q476R|PKN2_uc010osq.1_Missense_Mutation_p.Q335R|PKN2_uc009wcv.2_Missense_Mutation_p.Q444R|PKN2_uc010osr.1_Missense_Mutation_p.Q157R	p.Q492R	NM_006256	NP_006247	Q16513	PKN2_HUMAN		all cancers(265;0.0136)|Epithelial(280;0.0301)	10	1817	+		Lung NSC(277;0.123)	492					B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	ENST00000370521.3	37	c.1475A>G	CCDS714.1	.	.	.	.	.	.	.	.	.	.	A	18.00	3.525174	0.64747	.	.	ENSG00000065243	ENST00000370521;ENST00000316005;ENST00000370505;ENST00000370513;ENST00000544045	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.62	5.62	0.85841	.	0.000000	0.43416	U	0.000580	T	0.53899	0.1825	M	0.83603	2.65	0.58432	D	0.999999	D;P;B;B	0.55172	0.97;0.945;0.191;0.178	P;P;B;B	0.55087	0.768;0.768;0.056;0.026	T	0.63585	-0.6604	10	0.87932	D	0	.	15.8333	0.78778	1.0:0.0:0.0:0.0	.	476;444;492;492	B4DTP5;E7ESL7;Q16513;B1AL79	.;.;PKN2_HUMAN;.	R	492;492;335;444;166	ENSP00000359552:Q492R;ENSP00000317851:Q492R;ENSP00000359536:Q335R;ENSP00000359544:Q444R;ENSP00000439643:Q166R	ENSP00000317851:Q492R	Q	+	2	0	PKN2	89043166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.935000	0.92923	2.153000	0.67306	0.477000	0.44152	CAA		0.264	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3	NM_006256		13	35	0	0	0	0.013537	0	13	35				
COL11A1	1301	broad.mit.edu	37	1	103364517	103364517	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:103364517G>A	ENST00000370096.3	-	55	4432	c.4120C>T	c.(4120-4122)Caa>Taa	p.Q1374*	COL11A1_ENST00000512756.1_Nonsense_Mutation_p.Q1258*|COL11A1_ENST00000358392.2_Nonsense_Mutation_p.Q1386*|COL11A1_ENST00000353414.4_Nonsense_Mutation_p.Q1335*	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1374	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.Q1374*(1)|p.Q1386*(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTTCACCTTGTCTTCCCTCT	0.269																																							uc001dul.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(4120-4122)CAA>TAA		alpha 1 type XI collagen isoform A							41.0	41.0	41.0					1																	103364517		2201	4298	6499	SO:0001587	stop_gained	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103364517G>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4120C>T	1.37:g.103364517G>A	ENSP00000359114:p.Gln1374*					COL11A1_uc001duk.2_Nonsense_Mutation_p.Q570*|COL11A1_uc001dum.2_Nonsense_Mutation_p.Q1386*|COL11A1_uc001dun.2_Nonsense_Mutation_p.Q1335*|COL11A1_uc009weh.2_Nonsense_Mutation_p.Q1258*	p.Q1374*	NM_001854	NP_001845	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	55	4438	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	1374			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Nonsense_Mutation	SNP	ENST00000370096.3	37	c.4120C>T	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	43	10.500606	0.99416	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.6279	0.95687	0.0:0.0:1.0:0.0	.	.	.	.	X	1374;1386;1335;594;1258	.	ENSP00000302551:Q1335X	Q	-	1	0	COL11A1	103137105	1.000000	0.71417	1.000000	0.80357	0.633000	0.38033	9.558000	0.98132	2.880000	0.98712	0.650000	0.86243	CAA		0.269	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		8	35	0	0	0	0.00308	0	8	35				
RPRD2	23248	broad.mit.edu	37	1	150337348	150337348	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:150337348A>G	ENST00000369068.4	+	1	162	c.158A>G	c.(157-159)aAa>aGa	p.K53R	RPRD2_ENST00000539519.1_Missense_Mutation_p.K53R|RPRD2_ENST00000492220.1_Intron|RPRD2_ENST00000369067.3_Missense_Mutation_p.K53R|RPRD2_ENST00000401000.4_Missense_Mutation_p.K53R	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	53	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)		p.K53R(2)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						GAGAACAAAAAACACCACAGT	0.498																																							uc009wlr.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(157-159)AAA>AGA		Regulation of nuclear pre-mRNA domain containing							125.0	123.0	124.0					1																	150337348		1975	4157	6132	SO:0001583	missense	23248						protein binding	g.chr1:150337348A>G	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.158A>G	1.37:g.150337348A>G	ENSP00000358064:p.Lys53Arg					RPRD2_uc010pcc.1_Missense_Mutation_p.K53R|RPRD2_uc001eup.3_Missense_Mutation_p.K53R	p.K53R	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN			1	359	+			53			CID.		A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	c.158A>G	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.696786	0.48202	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369067;ENST00000369068	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	4.42	4.42	0.53409	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);	0.053408	0.64402	D	0.000001	T	0.17152	0.0412	L	0.45698	1.435	0.36466	D	0.866964	B;B;B	0.16166	0.013;0.016;0.015	B;B;B	0.16722	0.009;0.005;0.016	T	0.07252	-1.0782	10	0.25106	T	0.35	-11.4214	7.283	0.26322	0.8631:0.0:0.1369:0.0	.	53;53;53	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	R	53	ENSP00000383785:K53R;ENSP00000445482:K53R;ENSP00000358063:K53R;ENSP00000358064:K53R	ENSP00000358063:K53R	K	+	2	0	RPRD2	148603972	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.651000	0.61447	1.984000	0.57885	0.533000	0.62120	AAA		0.498	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203		12	52	0	0	0	0.001855	0	12	52				
HRNR	388697	broad.mit.edu	37	1	152188100	152188100	+	Missense_Mutation	SNP	C	C	G	rs368547266		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:152188100C>G	ENST00000368801.2	-	3	6080	c.6005G>C	c.(6004-6006)gGc>gCc	p.G2002A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2002					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G2002A(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGACCGTAGCCAGAGGACTG	0.567																																							uc001ezt.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(6004-6006)GGC>GCC		hornerin							173.0	242.0	219.0					1																	152188100		1587	3304	4891	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152188100C>G	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6005G>C	1.37:g.152188100C>G	ENSP00000357791:p.Gly2002Ala						p.G2002A	NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6081	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2002			22.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.6005G>C	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	8.682	0.905307	0.17760	.	.	ENSG00000197915	ENST00000368801	T	0.02103	4.45	4.4	4.4	0.53042	.	.	.	.	.	T	0.00875	0.0029	L	0.43152	1.355	0.09310	N	1	P	0.47034	0.889	B	0.44224	0.444	T	0.35201	-0.9798	9	0.06625	T	0.88	.	8.2196	0.31532	0.0:0.8932:0.0:0.1068	.	2002	Q86YZ3	HORN_HUMAN	A	2002	ENSP00000357791:G2002A	ENSP00000357791:G2002A	G	-	2	0	HRNR	150454724	0.001000	0.12720	0.003000	0.11579	0.005000	0.04900	1.053000	0.30442	2.298000	0.77334	0.505000	0.49811	GGC		0.567	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		41	470	0	0	0	0.007835	0	41	470				
S100A7	6278	broad.mit.edu	37	1	153430323	153430323	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:153430323G>A	ENST00000368723.3	-	3	375	c.265C>T	c.(265-267)Cag>Tag	p.Q89*	S100A7_ENST00000368722.1_Nonsense_Mutation_p.Q89*	NM_002963.3	NP_002954.2	P31151	S10A7_HUMAN	S100 calcium binding protein A7	89					angiogenesis (GO:0001525)|defense response to Gram-negative bacterium (GO:0050829)|epidermis development (GO:0008544)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of granulocyte chemotaxis (GO:0071624)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of T cell chemotaxis (GO:0010820)|response to lipopolysaccharide (GO:0032496)|response to reactive oxygen species (GO:0000302)|sequestering of metal ion (GO:0051238)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)	p.Q89*(1)		breast(1)|large_intestine(2)|lung(5)|skin(2)	10	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCATGGCTCTGCTTGTGGTAG	0.527																																							uc001fbv.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(265-267)CAG>TAG		S100 calcium binding protein A7							90.0	82.0	85.0					1																	153430323		2203	4300	6503	SO:0001587	stop_gained	6278				angiogenesis|defense response to Gram-negative bacterium|innate immune response|keratinocyte differentiation|positive regulation of ERK1 and ERK2 cascade|positive regulation of granulocyte chemotaxis|positive regulation of monocyte chemotaxis|positive regulation of T cell chemotaxis|response to lipopolysaccharide|response to reactive oxygen species|sequestering of metal ion	cytosol|endoplasmic reticulum|extracellular region|focal adhesion|nucleus	calcium ion binding|RAGE receptor binding|zinc ion binding	g.chr1:153430323G>A	BC034687	CCDS1039.1	1q21	2013-01-10	2006-09-11		ENSG00000143556	ENSG00000143556		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10497	protein-coding gene	gene with protein product		600353	"""S100 calcium-binding protein A7 (psoriasin 1)"", ""S100 calcium binding protein A7 (psoriasin 1)"""	PSOR1		1940442	Standard	NM_002963		Approved	S100A7c	uc001fbv.1	P31151	OTTHUMG00000013123	ENST00000368723.3:c.265C>T	1.37:g.153430323G>A	ENSP00000357712:p.Gln89*						p.Q89*	NM_002963	NP_002954	P31151	S10A7_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		3	336	-	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		89					Q5SY67|Q6FGE3|Q9H1E2	Nonsense_Mutation	SNP	ENST00000368723.3	37	c.265C>T	CCDS1039.1	.	.	.	.	.	.	.	.	.	.	.	9.385	1.073922	0.20147	.	.	ENSG00000143556	ENST00000368723;ENST00000368722	.	.	.	2.15	-0.755	0.11061	.	.	.	.	.	.	.	.	.	.	.	0.35225	D	0.776426	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	2.6462	0.04985	0.308:0.2684:0.4236:0.0	.	.	.	.	X	89	.	ENSP00000357711:Q89X	Q	-	1	0	S100A7	151696947	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	0.210000	0.17455	-0.177000	0.10690	0.194000	0.17425	CAG		0.527	S100A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036789.1	NM_002963		12	116	0	0	0	0.00245	0	12	116				
RRNAD1	51093	broad.mit.edu	37	1	156703953	156703953	+	Silent	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:156703953G>T	ENST00000368216.4	+	6	1419	c.789G>T	c.(787-789)ctG>ctT	p.L263L	RRNAD1_ENST00000368218.4_Intron|RRNAD1_ENST00000476229.1_Intron	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	263						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)	p.L263L(1)		NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						GTGGGGATCTGAGTGTTGCCT	0.632																																							uc001fpu.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(787-789)CTG>CTT		hypothetical protein LOC51093 isoform 1							94.0	81.0	85.0					1																	156703953		2203	4300	6503	SO:0001819	synonymous_variant	51093					integral to membrane	rRNA (adenine-N6,N6-)-dimethyltransferase activity	g.chr1:156703953G>T	BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.789G>T	1.37:g.156703953G>T						C1orf66_uc001fpv.2_Intron	p.L263L	NM_015997	NP_057081	Q96FB5	RRNAD_HUMAN			6	1423	+	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		263					D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Silent	SNP	ENST00000368216.4	37	c.789G>T	CCDS1154.1																																																																																				0.632	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098973.1	NM_015997		17	40	1	0	4.14922e-12	0.004007	5.99788e-12	17	40				
OR6N1	128372	broad.mit.edu	37	1	158736422	158736422	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:158736422G>T	ENST00000335094.2	-	1	70	c.51C>A	c.(49-51)ttC>ttA	p.F17L		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F17L(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					GGAGATGGGGGAAGCCCAAGA	0.483																																							uc010piq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(49-51)TTC>TTA		olfactory receptor, family 6, subfamily N,							57.0	54.0	55.0					1																	158736422		2203	4300	6503	SO:0001583	missense	128372				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158736422G>T	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.51C>A	1.37:g.158736422G>T	ENSP00000335535:p.Phe17Leu						p.F17L	NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN			1	51	-	all_hematologic(112;0.0378)		17			Extracellular (Potential).		Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	c.51C>A	CCDS30905.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.991385	0.54041	.	.	ENSG00000197403	ENST00000335094	T	0.06068	3.35	4.83	0.122	0.14702	.	0.000000	0.47093	D	0.000254	T	0.03053	0.0090	N	0.21508	0.67	0.32994	D	0.525362	D	0.69078	0.997	D	0.75020	0.985	T	0.14952	-1.0454	10	0.07482	T	0.82	-25.5719	8.361	0.32359	0.4994:0.0:0.5006:0.0	.	17	Q8NGY5	OR6N1_HUMAN	L	17	ENSP00000335535:F17L	ENSP00000335535:F17L	F	-	3	2	OR6N1	157003046	0.002000	0.14202	0.988000	0.46212	0.927000	0.56198	-0.172000	0.09868	0.137000	0.18759	-0.140000	0.14226	TTC		0.483	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185		14	43	1	0	1.52009e-12	0.003163	2.24175e-12	14	43				
MNDA	4332	broad.mit.edu	37	1	158813853	158813853	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:158813853G>T	ENST00000368141.4	+	4	772	c.511G>T	c.(511-513)Gat>Tat	p.D171Y		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	171					B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D171Y(1)		NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					TGCAGCTGTGGATCATCCCCC	0.493																																							uc001fsz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)	4						c.(511-513)GAT>TAT		myeloid cell nuclear differentiation antigen							263.0	216.0	232.0					1																	158813853		2203	4300	6503	SO:0001583	missense	4332				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr1:158813853G>T	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.511G>T	1.37:g.158813853G>T	ENSP00000357123:p.Asp171Tyr						p.D171Y	NM_002432	NP_002423	P41218	MNDA_HUMAN			4	711	+	all_hematologic(112;0.0378)		171						Missense_Mutation	SNP	ENST00000368141.4	37	c.511G>T	CCDS1177.1	.	.	.	.	.	.	.	.	.	.	G	8.029	0.761243	0.15914	.	.	ENSG00000163563	ENST00000368141	T	0.05258	3.47	2.94	0.915	0.19366	.	.	.	.	.	T	0.00998	0.0033	N	0.22421	0.69	0.09310	N	1	P	0.46277	0.875	B	0.31614	0.133	T	0.47898	-0.9081	9	0.62326	D	0.03	-0.1	3.2178	0.06705	0.1491:0.0:0.5771:0.2738	.	171	P41218	MNDA_HUMAN	Y	171	ENSP00000357123:D171Y	ENSP00000357123:D171Y	D	+	1	0	MNDA	157080477	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.279000	0.08479	0.229000	0.21039	0.563000	0.77884	GAT		0.493	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432		39	166	1	0	7.53189e-24	0.007835	1.32489e-23	39	166				
ASTN1	460	broad.mit.edu	37	1	176863861	176863861	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:176863861G>A	ENST00000367654.3	-	17	3012	c.2801C>T	c.(2800-2802)gCg>gTg	p.A934V	ASTN1_ENST00000424564.2_Missense_Mutation_p.A926V|ASTN1_ENST00000367657.3_Missense_Mutation_p.A926V|ASTN1_ENST00000361833.2_Missense_Mutation_p.A926V	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	934					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.A926V(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GACTCCAGCCGCCATGTGCTT	0.602																																							uc001glc.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						c.(2776-2778)GCG>GTG		astrotactin isoform 1							99.0	97.0	98.0					1																	176863861		2203	4300	6503	SO:0001583	missense	460				cell migration|neuron cell-cell adhesion	integral to membrane		g.chr1:176863861G>A	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2801C>T	1.37:g.176863861G>A	ENSP00000356626:p.Ala934Val					ASTN1_uc001glb.1_Missense_Mutation_p.A926V|ASTN1_uc001gld.1_Missense_Mutation_p.A926V	p.A926V	NM_004319	NP_004310	O14525	ASTN1_HUMAN			17	2989	-			934					A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37	c.2777C>T		.	.	.	.	.	.	.	.	.	.	G	15.19	2.760974	0.49468	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	5.26	5.26	0.73747	.	0.046610	0.85682	D	0.000000	T	0.14830	0.0358	N	0.21373	0.66	0.80722	D	1	P;P	0.46706	0.883;0.883	B;B	0.35655	0.207;0.207	T	0.07790	-1.0754	10	0.02654	T	1	-19.0179	18.8334	0.92150	0.0:0.0:1.0:0.0	.	926;926	O14525-2;B1AJS1	.;.	V	926;926;934;926;926	ENSP00000356629:A926V;ENSP00000354536:A926V;ENSP00000356626:A934V;ENSP00000395041:A926V	ENSP00000354536:A926V	A	-	2	0	ASTN1	175130484	1.000000	0.71417	0.994000	0.49952	0.971000	0.66376	8.868000	0.92320	2.640000	0.89533	0.655000	0.94253	GCG		0.602	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		25	83	0	0	0	0.00874	0	25	83				
TATDN3	128387	broad.mit.edu	37	1	212976082	212976082	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:212976082G>A	ENST00000366974.4	+	5	392	c.298G>A	c.(298-300)Gat>Aat	p.D100N	TATDN3_ENST00000531963.1_Missense_Mutation_p.D100N|TATDN3_ENST00000526641.1_Intron|TATDN3_ENST00000366973.4_Missense_Mutation_p.D100N|TATDN3_ENST00000525569.1_3'UTR|TATDN3_ENST00000532324.1_Missense_Mutation_p.D100N|TATDN3_ENST00000526997.1_Missense_Mutation_p.D100N|TATDN3_ENST00000530441.1_3'UTR	NM_001042552.2|NM_001042553.2|NM_001146169.1|NM_001146171.1	NP_001036017.1|NP_001036018.1|NP_001139641.1|NP_001139643.1	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3	100					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)	p.D100N(1)		endometrium(1)|large_intestine(2)|lung(6)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		GAATTATAAGGATCGGTTGTT	0.343																																							uc001hjo.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(298-300)GAT>AAT		TatD DNase domain containing 3 isoform 1							125.0	124.0	125.0					1																	212976082		2203	4300	6503	SO:0001583	missense	128387					nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding	g.chr1:212976082G>A	AL832248	CCDS31019.1, CCDS41465.1, CCDS53475.1, CCDS53476.1, CCDS53477.1	1q32.3	2008-02-05			ENSG00000203705	ENSG00000203705			27010	protein-coding gene	gene with protein product							Standard	NM_001042552		Approved		uc001hjo.2	Q17R31	OTTHUMG00000036805	ENST00000366974.4:c.298G>A	1.37:g.212976082G>A	ENSP00000355941:p.Asp100Asn					TATDN3_uc010ptj.1_Missense_Mutation_p.D100N|TATDN3_uc010ptk.1_Missense_Mutation_p.D100N|TATDN3_uc001hjp.2_Missense_Mutation_p.D100N|TATDN3_uc010ptl.1_Intron|TATDN3_uc010ptm.1_Missense_Mutation_p.D48N	p.D100N	NM_001042552	NP_001036017	Q17R31	TATD3_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)	5	392	+			100					A6NGS3|B7Z1C1|B7Z978|B7ZLQ6|E9PJE5|E9PNH3|G3V151|Q4G0L1	Missense_Mutation	SNP	ENST00000366974.4	37	c.298G>A	CCDS31019.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.41|16.41	3.116668|3.116668	0.56505|0.56505	.|.	.|.	ENSG00000203705|ENSG00000203705	ENST00000532324;ENST00000366974;ENST00000531963;ENST00000366973;ENST00000526997;ENST00000530399|ENST00000488246	.|.	.|.	.|.	5.58|5.58	4.66|4.66	0.58398|0.58398	.|.	0.146866|.	0.64402|.	D|.	0.000012|.	T|T	0.62344|0.62344	0.2420|0.2420	L|L	0.51914|0.51914	1.62|1.62	0.58432|0.58432	D|D	0.999999|0.999999	B;B;B;B;B|.	0.12013|.	0.001;0.001;0.001;0.002;0.005|.	B;B;B;B;B|.	0.17433|.	0.008;0.007;0.008;0.008;0.018|.	T|T	0.59080|0.59080	-0.7521|-0.7521	9|5	0.56958|.	D|.	0.05|.	-26.5683|-26.5683	13.5546|13.5546	0.61751|0.61751	0.0756:0.0:0.9244:0.0|0.0756:0.0:0.9244:0.0	.|.	48;100;100;100;100|.	B7Z2Z9;G3V151;E9PJE5;Q17R31-2;Q17R31|.	.;.;.;.;TATD3_HUMAN|.	N|E	100;100;100;100;100;99|99	.|.	ENSP00000355940:D100N|.	D|G	+|+	1|2	0|0	TATDN3|TATDN3	211042705|211042705	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.819000|0.819000	0.46315|0.46315	6.612000|6.612000	0.74187|0.74187	2.616000|2.616000	0.88540|0.88540	0.557000|0.557000	0.71058|0.71058	GAT|GGA		0.343	TATDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089396.2	XM_375838		4	54	0	0	0	0.009096	0	4	54				
ZNF678	339500	broad.mit.edu	37	1	227843491	227843491	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:227843491G>T	ENST00000343776.5	+	4	1885	c.1540G>T	c.(1540-1542)Gag>Tag	p.E514*	ZNF678_ENST00000397097.3_Nonsense_Mutation_p.E569*|ZNF678_ENST00000608949.1_Intron	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E514*(1)|p.E569*(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				TTATACTGGAGAGGAACCTGA	0.323																																							uc001hqw.1		NA																	2	Substitution - Nonsense(2)		lung(2)	pancreas(1)	1						c.(1540-1542)GAG>TAG		zinc finger protein 678							42.0	47.0	45.0					1																	227843491		2202	4295	6497	SO:0001587	stop_gained	339500				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr1:227843491G>T	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.1540G>T	1.37:g.227843491G>T	ENSP00000344828:p.Glu514*					ZNF678_uc009xet.1_Intron|ZNF678_uc009xeu.1_Intron	p.E514*	NM_178549	NP_848644	F5GXA7	F5GXA7_HUMAN			4	1885	+		Prostate(94;0.0885)	569					Q8IVQ9	Nonsense_Mutation	SNP	ENST00000343776.5	37	c.1540G>T		.	.	.	.	.	.	.	.	.	.	G	13.98	2.400056	0.42613	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	.	.	.	1.08	1.08	0.20341	.	.	.	.	.	.	.	.	.	.	.	0.33119	D	0.541528	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	7.9567	0.30047	0.0:0.0:1.0:0.0	.	.	.	.	X	514;569	.	ENSP00000344828:E514X	E	+	1	0	ZNF678	225910114	0.272000	0.24172	0.005000	0.12908	0.005000	0.04900	1.784000	0.38674	0.399000	0.25367	0.400000	0.26472	GAG		0.323	ZNF678-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000091976.2	NM_178549		15	65	1	0	6.31663e-08	0.003163	8.16131e-08	15	65				
HEATR1	55127	broad.mit.edu	37	1	236734657	236734657	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:236734657T>C	ENST00000366582.3	-	28	4056	c.3942A>G	c.(3940-3942)atA>atG	p.I1314M	HEATR1_ENST00000366581.2_Missense_Mutation_p.I1233M	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1314					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.I1314M(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TTACCGGAAATATTCCAGCAA	0.398																																							uc001hyd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(3940-3942)ATA>ATG		protein BAP28							52.0	53.0	53.0					1																	236734657		2203	4300	6503	SO:0001583	missense	55127				rRNA processing	nucleolus|ribonucleoprotein complex	protein binding	g.chr1:236734657T>C	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.3942A>G	1.37:g.236734657T>C	ENSP00000355541:p.Ile1314Met					HEATR1_uc009xgh.1_Missense_Mutation_p.I476M	p.I1314M	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00117)		28	4067	-	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	1314					Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	c.3942A>G	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	T	17.16	3.318867	0.60524	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.70516	-0.49;0.9	5.36	1.29	0.21616	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47040	0.1424	L	0.39085	1.19	0.80722	D	1	B;P	0.36733	0.23;0.567	B;B	0.27500	0.053;0.08	T	0.29427	-1.0012	10	0.29301	T	0.29	.	2.4688	0.04559	0.1429:0.1009:0.4236:0.3327	.	1233;1314	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	M	1314;1233	ENSP00000355541:I1314M;ENSP00000355540:I1233M	ENSP00000355540:I1233M	I	-	3	3	HEATR1	234801280	0.998000	0.40836	1.000000	0.80357	0.972000	0.66771	0.354000	0.20146	0.831000	0.34780	0.477000	0.44152	ATA		0.398	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853		16	40	0	0	0	0.00499	0	16	40				
OR2C3	81472	broad.mit.edu	37	1	247695027	247695027	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:247695027G>T	ENST00000366487.3	-	2	1148	c.787C>A	c.(787-789)Cca>Aca	p.P263T	GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366489.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P262T(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CTCTTGGCTGGCTGGAGATAC	0.527																																							uc009xgy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(787-789)CCA>ACA		olfactory receptor, family 2, subfamily C,							115.0	102.0	106.0					1																	247695027		2203	4300	6503	SO:0001583	missense	81472				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247695027G>T	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.787C>A	1.37:g.247695027G>T	ENSP00000355443:p.Pro263Thr					C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	p.P263T	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0241)		2	1149	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	263			Extracellular (Potential).		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	ENST00000366487.3	37	c.787C>A	CCDS1634.2	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066660	0.36470	.	.	ENSG00000196242	ENST00000366487	T	0.00274	8.35	3.91	3.91	0.45181	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35585	U	0.003116	T	0.00695	0.0023	H	0.94582	3.555	0.23735	N	0.996983	P	0.52170	0.951	P	0.57425	0.82	T	0.17531	-1.0366	10	0.87932	D	0	.	7.5982	0.28061	0.1153:0.0:0.8847:0.0	.	263	Q8N628	OR2C3_HUMAN	T	263	ENSP00000355443:P263T	ENSP00000355443:P263T	P	-	1	0	OR2C3	245761650	0.635000	0.27199	1.000000	0.80357	0.288000	0.27193	3.308000	0.51896	2.157000	0.67596	0.655000	0.94253	CCA		0.527	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074		27	103	1	0	1.66031e-10	0.003954	2.28684e-10	27	103				
OR2C3	81472	broad.mit.edu	37	1	247695038	247695038	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:247695038A>T	ENST00000366487.3	-	2	1137	c.776T>A	c.(775-777)aTg>aAg	p.M259K	GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366489.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M258K(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CTGGAGATACATGAAGATGAT	0.517																																							uc009xgy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(775-777)ATG>AAG		olfactory receptor, family 2, subfamily C,							118.0	104.0	109.0					1																	247695038		2203	4300	6503	SO:0001583	missense	81472				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247695038A>T	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.776T>A	1.37:g.247695038A>T	ENSP00000355443:p.Met259Lys					C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	p.M259K	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0241)		2	1138	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	259			Helical; Name=6; (Potential).		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	ENST00000366487.3	37	c.776T>A	CCDS1634.2	.	.	.	.	.	.	.	.	.	.	A	12.01	1.809344	0.31961	.	.	ENSG00000196242	ENST00000366487	T	0.00198	8.57	3.91	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	U	0.000594	T	0.00300	0.0009	M	0.88181	2.935	0.25400	N	0.988459	B	0.31413	0.322	B	0.32211	0.142	T	0.26189	-1.0110	10	0.87932	D	0	.	7.6975	0.28602	0.8959:0.0:0.1041:0.0	.	259	Q8N628	OR2C3_HUMAN	K	259	ENSP00000355443:M259K	ENSP00000355443:M259K	M	-	2	0	OR2C3	245761661	0.029000	0.19370	1.000000	0.80357	0.056000	0.15407	1.584000	0.36589	0.651000	0.30788	-0.274000	0.10170	ATG		0.517	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074		28	99	0	0	0	0.004656	0	28	99				
TUBB8	347688	broad.mit.edu	37	10	93939	93939	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:93939C>G	ENST00000309812.4	-	4	455	c.393G>C	c.(391-393)caG>caC	p.Q131H	TUBB8_ENST00000447903.2_Missense_Mutation_p.Q59H|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000332708.5_3'UTR	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	131					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.Q131H(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GCTGGAAACCCTGCAGGCAGT	0.582																																					Pancreas(192;2041 3010 9013 18103)	Pancreas(192;2041 3010 9013 18103)	uc001ifi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(391-393)CAG>CAC		tubulin, beta 8 isoform 1							33.0	32.0	33.0					10																	93939		2187	4266	6453	SO:0001583	missense	347688				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr10:93939C>G	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.393G>C	10.37:g.93939C>G	ENSP00000311042:p.Gln131His					TUBB8_uc009xhe.2_Missense_Mutation_p.Q94H|TUBB8_uc010pzs.1_Missense_Mutation_p.Q59H	p.Q131H	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)	4	393	-		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)	131					Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	c.393G>C	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	C	12.93	2.086150	0.36855	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.72725	-0.68	.	.	.	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.64402	U	0.000014	D	0.87748	0.6255	H	0.98738	4.315	0.37055	D	0.897791	D;D	0.89917	0.973;1.0	D;D	0.97110	0.986;1.0	D	0.85524	0.1205	9	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	94;131	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	H	59;97;94;131	ENSP00000403895:Q59H	ENSP00000272035:Q97H	Q	-	3	2	RP11-631M21.2	83939	1.000000	0.71417	0.463000	0.27130	0.468000	0.32798	5.268000	0.65536	0.119000	0.18210	0.121000	0.15741	CAG		0.582	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987		14	69	0	0	0	0.006122	0	14	69				
FAM208B	54906	broad.mit.edu	37	10	5782228	5782228	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:5782228C>T	ENST00000328090.5	+	13	2720	c.2095C>T	c.(2095-2097)Cgg>Tgg	p.R699W	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	699								p.R699W(1)									CATGCCATTTCGGCATCAGCC	0.532																																							uc001iij.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2095-2097)CGG>TGG		hypothetical protein LOC54906							83.0	84.0	84.0					10																	5782228		1867	4097	5964	SO:0001583	missense	54906							g.chr10:5782228C>T	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.2095C>T	10.37:g.5782228C>T	ENSP00000328426:p.Arg699Trp					C10orf18_uc001iik.2_Intron	p.R699W	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN			13	2720	+			699					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	c.2095C>T	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	c	16.49	3.138700	0.56936	.	.	ENSG00000108021	ENST00000328090	T	0.47869	0.83	5.64	3.79	0.43588	.	0.229512	0.31082	N	0.008299	T	0.64193	0.2576	M	0.72118	2.19	0.27420	N	0.954318	D	0.89917	1.0	D	0.91635	0.999	T	0.58451	-0.7634	10	0.87932	D	0	.	9.2396	0.37489	0.1441:0.782:0.0:0.0739	.	699	Q5VWN6	F208B_HUMAN	W	699	ENSP00000328426:R699W	ENSP00000328426:R699W	R	+	1	2	C10orf18	5822234	0.995000	0.38212	0.997000	0.53966	0.386000	0.30323	0.525000	0.22956	0.732000	0.32470	-0.185000	0.12909	CGG		0.532	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		6	76	0	0	0	0.00308	0	6	76				
GRID1	2894	broad.mit.edu	37	10	87482866	87482866	+	Missense_Mutation	SNP	G	G	T	rs138984541		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:87482866G>T	ENST00000327946.7	-	12	1976	c.1891C>A	c.(1891-1893)Cgc>Agc	p.R631S	GRID1_ENST00000536331.1_Missense_Mutation_p.R202S	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	631					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.R631S(1)|p.R631C(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						ATCACGATGCGCATGGCCATG	0.587										Multiple Myeloma(13;0.14)																													uc001kdl.1		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.(1891-1893)CGC>AGC		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)	G	SER/ARG	0,4406		0,0,2203	118.0	86.0	97.0		1891	5.0	1.0	10	dbSNP_134	97	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRID1	NM_017551.2	110	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging	631/1010	87482866	1,13005	2203	4300	6503	SO:0001583	missense	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87482866G>T	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1891C>A	10.37:g.87482866G>T	ENSP00000330148:p.Arg631Ser	Multiple Myeloma(13;0.14)				GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.R202S	p.R631S	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN			12	1992	-			631			Cytoplasmic (Potential).		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	c.1891C>A	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300290	0.81136	0.0	1.16E-4	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.74421	-0.84;-0.84	5.95	5.04	0.67666	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.047867	0.85682	D	0.000000	D	0.90511	0.7027	H	0.95850	3.73	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.93530	0.6869	10	0.87932	D	0	.	15.6309	0.76908	0.0:0.0:0.8616:0.1384	.	631	Q9ULK0	GRID1_HUMAN	S	631;202	ENSP00000330148:R631S;ENSP00000444455:R202S	ENSP00000330148:R631S	R	-	1	0	GRID1	87472846	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.149000	0.42244	1.507000	0.48752	0.561000	0.74099	CGC		0.587	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		7	26	1	0	0.00198382	0.001984	0.00221097	7	26				
CYP2C9	1559	broad.mit.edu	37	10	96740969	96740969	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:96740969A>T	ENST00000260682.6	+	7	1003	c.991A>T	c.(991-993)Att>Ttt	p.I331F		NM_000771.3	NP_000762.2	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 9	331					arachidonic acid metabolic process (GO:0019369)|cellular amide metabolic process (GO:0043603)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|urea metabolic process (GO:0019627)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|caffeine oxidase activity (GO:0034875)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|steroid hydroxylase activity (GO:0008395)	p.I331F(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TGAACGTGTGATTGGCAGAAA	0.478																																					Ovarian(54;1266 1406 16072 35076)	Ovarian(54;1266 1406 16072 35076)	uc001kka.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(2)	6						c.(991-993)ATT>TTT		cytochrome P450, family 2, subfamily C,	Acenocoumarol(DB01418)|Alosetron(DB00969)|Amiodarone(DB01118)|Antihemophilic Factor(DB00025)|Aprepitant(DB00673)|Bosentan(DB00559)|Carprofen(DB00821)|Carvedilol(DB01136)|Celecoxib(DB00482)|Clomipramine(DB01242)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Desogestrel(DB00304)|Diclofenac(DB00586)|Esomeprazole(DB00736)|Etodolac(DB00749)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Glibenclamide(DB01016)|Glimepiride(DB00222)|Glipizide(DB01067)|Guanfacine(DB01018)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Imipramine(DB00458)|Irbesartan(DB01029)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Losartan(DB00678)|Lumiracoxib(DB01283)|Marinol(DB00470)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mephenytoin(DB00532)|Metronidazole(DB00916)|Miconazole(DB01110)|Midazolam(DB00683)|Montelukast(DB00471)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Oxymorphone(DB01192)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pravastatin(DB00175)|Quinidine(DB00908)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Sertraline(DB01104)|Sildenafil(DB00203)|Sulfamethoxazole(DB01015)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tenoxicam(DB00469)|Terfenadine(DB00342)|Tolbutamide(DB01124)|Torasemide(DB00214)|Troleandomycin(DB01361)|Valdecoxib(DB00580)|Valsartan(DB00177)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)						160.0	144.0	149.0					10																	96740969		2203	4300	6503	SO:0001583	missense	1559				exogenous drug catabolic process|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative demethylation|steroid metabolic process|urea metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|caffeine oxidase activity|drug binding|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity	g.chr10:96740969A>T	M61855	CCDS7437.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138109	ENSG00000138109		"""Cytochrome P450s"""	2623	protein-coding gene	gene with protein product		601130	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9"""	CYP2C10		2009263, 7841444	Standard	NM_000771		Approved	P450IIC9	uc001kka.4	P11712	OTTHUMG00000018805	ENST00000260682.6:c.991A>T	10.37:g.96740969A>T	ENSP00000260682:p.Ile331Phe					CYP2C9_uc009xut.2_Missense_Mutation_p.I329F	p.I331F	NM_000771	NP_000762	P11712	CP2C9_HUMAN		all cancers(201;6.93e-05)	7	1016	+		Colorectal(252;0.0902)	331					P11713|Q16756|Q16872|Q5VX92|Q6IRV8|Q8WW80	Missense_Mutation	SNP	ENST00000260682.6	37	c.991A>T	CCDS7437.1	.	.	.	.	.	.	.	.	.	.	.	9.344	1.063860	0.20067	.	.	ENSG00000138109	ENST00000545448;ENST00000260682	T	0.71341	-0.56	3.78	-3.68	0.04463	.	0.166448	0.36854	U	0.002367	T	0.51669	0.1688	L	0.39514	1.22	0.30518	N	0.768691	P;P	0.44044	0.825;0.825	B;B	0.39152	0.292;0.292	T	0.54990	-0.8210	10	0.87932	D	0	.	5.3931	0.16255	0.3942:0.0:0.4545:0.1513	.	331;331	Q5VX92;P11712	.;CP2C9_HUMAN	F	331	ENSP00000260682:I331F	ENSP00000260682:I331F	I	+	1	0	CYP2C9	96730959	0.181000	0.23161	0.589000	0.28718	0.064000	0.16182	-0.253000	0.08794	-0.820000	0.04318	-0.756000	0.03474	ATT		0.478	CYP2C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049501.1	NM_000771		58	97	0	0	0	0.01441	0	58	97				
NPM3	10360	broad.mit.edu	37	10	103542607	103542607	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:103542607C>A	ENST00000370110.5	-	2	215	c.193G>T	c.(193-195)Gca>Tca	p.A65S	NPM3_ENST00000474993.1_Intron	NM_006993.2	NP_008924.1	O75607	NPM3_HUMAN	nucleophosmin/nucleoplasmin 3	65					rRNA processing (GO:0006364)|rRNA transcription (GO:0009303)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.A65S(1)		large_intestine(3)|lung(1)|skin(1)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		ATGGTTAGTGCCAGCACGTGC	0.542																																							uc001ktt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(193-195)GCA>TCA		nucleophosmin/nucleoplasmin 3							67.0	64.0	65.0					10																	103542607		2203	4300	6503	SO:0001583	missense	10360						nucleic acid binding	g.chr10:103542607C>A	AY049737	CCDS7519.1	10q24.31	2009-08-27	2009-08-27		ENSG00000107833	ENSG00000107833			7931	protein-coding gene	gene with protein product		606456				11722795	Standard	NM_006993		Approved		uc001ktt.3	O75607	OTTHUMG00000018942	ENST00000370110.5:c.193G>T	10.37:g.103542607C>A	ENSP00000359128:p.Ala65Ser						p.A65S	NM_006993	NP_008924	O75607	NPM3_HUMAN		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)	2	216	-		Colorectal(252;0.122)	65					Q9UNY6	Missense_Mutation	SNP	ENST00000370110.5	37	c.193G>T	CCDS7519.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761982	0.49468	.	.	ENSG00000107833	ENST00000370110	T	0.40756	1.02	4.51	4.51	0.55191	Nucleoplasmin core (2);	0.245199	0.41500	D	0.000870	T	0.33411	0.0862	N	0.11255	0.115	0.42866	D	0.994124	D	0.57257	0.979	P	0.54759	0.76	T	0.06391	-1.0829	10	0.06494	T	0.89	-15.1947	15.6149	0.76756	0.0:1.0:0.0:0.0	.	65	O75607	NPM3_HUMAN	S	65	ENSP00000359128:A65S	ENSP00000359128:A65S	A	-	1	0	NPM3	103532597	1.000000	0.71417	0.983000	0.44433	0.876000	0.50452	2.870000	0.48451	2.340000	0.79590	0.650000	0.86243	GCA		0.542	NPM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050003.2	NM_006993		15	32	1	0	1.15088e-07	0.004007	1.46111e-07	15	32				
ACTR1A	10121	broad.mit.edu	37	10	104244124	104244124	+	Silent	SNP	T	T	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:104244124T>A	ENST00000369905.4	-	6	513	c.450A>T	c.(448-450)acA>acT	p.T150T	ACTR1A_ENST00000470322.1_5'Flank|ACTR1A_ENST00000487599.1_Silent_p.T150T|RP11-18I14.11_ENST00000608017.1_RNA|ACTR1A_ENST00000545684.1_Silent_p.T76T|ACTR1A_ENST00000446605.2_Silent_p.T103T	NM_005736.3	NP_005727.1	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)	150					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|microtubule associated complex (GO:0005875)	ATP binding (GO:0005524)	p.T150T(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	13		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		TGGTCCTGCCTGTAGCGTAAC	0.537																																							uc001kvv.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(448-450)ACA>ACT		ARP1 actin-related protein 1 homolog A,							47.0	38.0	41.0					10																	104244124		2203	4299	6502	SO:0001819	synonymous_variant	10121				G2/M transition of mitotic cell cycle|vesicle-mediated transport	centrosome|cytosol|dynactin complex	ATP binding	g.chr10:104244124T>A	X82206	CCDS7536.1	10q24	2008-07-08	2001-11-28		ENSG00000138107	ENSG00000138107			167	protein-coding gene	gene with protein product		605143	"""ARP1 (actin-related protein 1, yeast) homolog A (centractin alpha)"""			1528266	Standard	NM_005736		Approved	ARP1	uc001kvv.3	P61163	OTTHUMG00000018956	ENST00000369905.4:c.450A>T	10.37:g.104244124T>A						ACTR1A_uc010qqn.1_Silent_p.T76T|ACTR1A_uc010qqo.1_Silent_p.T103T	p.T150T	NM_005736	NP_005727	P61163	ACTZ_HUMAN		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)	6	558	-		Colorectal(252;0.122)	150					B2R6B0|P42024	Silent	SNP	ENST00000369905.4	37	c.450A>T	CCDS7536.1																																																																																				0.537	ACTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050053.1			9	20	0	0	0	0.006214	0	9	20				
NRAP	4892	broad.mit.edu	37	10	115356917	115356917	+	Silent	SNP	A	A	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:115356917A>G	ENST00000359988.3	-	37	4603	c.4359T>C	c.(4357-4359)agT>agC	p.S1453S	NRAP_ENST00000369360.3_Silent_p.S1426S|NRAP_ENST00000360478.3_Silent_p.S1418S|NRAP_ENST00000369358.4_Silent_p.S1461S	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.S1453S(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGAACTTGATACTGTCTGGTT	0.453																																							uc001laj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10						c.(4357-4359)AGT>AGC		nebulin-related anchoring protein isoform S							317.0	285.0	296.0					10																	115356917		2203	4300	6503	SO:0001819	synonymous_variant	4892					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding	g.chr10:115356917A>G		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.4359T>C	10.37:g.115356917A>G						NRAP_uc009xyb.2_Silent_p.S242S|NRAP_uc001lak.2_Silent_p.S1418S|NRAP_uc001lal.3_Silent_p.S1453S	p.S1453S	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN		Epithelial(162;0.00392)|all cancers(201;0.00569)	37	4523	-		Colorectal(252;0.0233)|Breast(234;0.188)	1453						Silent	SNP	ENST00000359988.3	37	c.4359T>C	CCDS7579.1																																																																																				0.453	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175		44	125	0	0	0	0.013114	0	44	125				
GFRA1	2674	broad.mit.edu	37	10	118029077	118029077	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:118029077G>T	ENST00000355422.6	-	4	906	c.356C>A	c.(355-357)tCc>tAc	p.S119Y	GFRA1_ENST00000369236.1_Missense_Mutation_p.S119Y|GFRA1_ENST00000490345.1_5'Flank|GFRA1_ENST00000439649.3_Missense_Mutation_p.S119Y	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	119					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.S119Y(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		TTCATATGGGGAATCCTCCAG	0.393																																					Ovarian(128;329 1725 45498 46808 50759)	Ovarian(128;329 1725 45498 46808 50759)	uc001lcj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(355-357)TCC>TAC		GDNF family receptor alpha 1 isoform a							131.0	119.0	123.0					10																	118029077		2203	4300	6503	SO:0001583	missense	2674				axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity	g.chr10:118029077G>T	AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.356C>A	10.37:g.118029077G>T	ENSP00000347591:p.Ser119Tyr					GFRA1_uc001lci.2_Missense_Mutation_p.S119Y|GFRA1_uc009xyr.2_Missense_Mutation_p.S119Y	p.S119Y	NM_005264	NP_005255	P56159	GFRA1_HUMAN		all cancers(201;0.0337)	4	1054	-		Lung NSC(174;0.21)	119					A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	c.356C>A	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206172	0.79127	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000369234	T;T;T;T	0.42900	1.17;1.17;0.96;0.96	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.64249	0.2581	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.60520	-0.7247	10	0.42905	T	0.14	-25.3635	19.8101	0.96543	0.0:0.0:1.0:0.0	.	119;119	P56159;P56159-2	GFRA1_HUMAN;.	Y	119	ENSP00000393725:S119Y;ENSP00000358239:S119Y;ENSP00000347591:S119Y;ENSP00000358237:S119Y	ENSP00000347591:S119Y	S	-	2	0	GFRA1	118019067	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.981000	0.93465	2.696000	0.92011	0.655000	0.94253	TCC		0.393	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793		9	29	1	0	7.48243e-07	0.006214	9.33705e-07	9	29				
GPR26	2849	broad.mit.edu	37	10	125426536	125426536	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:125426536C>A	ENST00000284674.1	+	1	666	c.613C>A	c.(613-615)Cgc>Agc	p.R205S		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	205					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R205S(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				CCATTGCAAGCGCATCGACGT	0.632																																							uc001lhh.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(613-615)CGC>AGC		G protein-coupled receptor 26							29.0	21.0	24.0					10																	125426536		2203	4300	6503	SO:0001583	missense	2849				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:125426536C>A		CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.613C>A	10.37:g.125426536C>A	ENSP00000284674:p.Arg205Ser						p.R205S	NM_153442	NP_703143	Q8NDV2	GPR26_HUMAN			1	666	+		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)	205			Cytoplasmic (Potential).		Q2M2E2	Missense_Mutation	SNP	ENST00000284674.1	37	c.613C>A	CCDS7636.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.840928	0.71488	.	.	ENSG00000154478	ENST00000284674	T	0.71934	-0.61	4.02	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.071404	0.52532	D	0.000074	D	0.83857	0.5345	M	0.88979	2.995	0.58432	D	0.999995	D	0.69078	0.997	D	0.67103	0.949	D	0.86276	0.1664	10	0.72032	D	0.01	-20.6647	10.6801	0.45809	0.3298:0.6702:0.0:0.0	.	205	Q8NDV2	GPR26_HUMAN	S	205	ENSP00000284674:R205S	ENSP00000284674:R205S	R	+	1	0	GPR26	125416526	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.248000	0.32827	2.067000	0.61834	0.655000	0.94253	CGC		0.632	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050850.1			6	9	1	0	3.59834e-05	0.001168	4.2712e-05	6	9				
CFAP46	54777	broad.mit.edu	37	10	134628239	134628239	+	Silent	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr10:134628239G>T	ENST00000368586.5	-	52	7300	c.7200C>A	c.(7198-7200)ccC>ccA	p.P2400P	TTC40_ENST00000263170.5_Silent_p.P561P	NM_001200049.2	NP_001186978.2												p.P2400P(1)|p.P561P(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGATGGTCCGGGGGATGCTGC	0.667																																							uc010qux.1		NA																	2	Substitution - coding silent(2)		lung(2)		NA						c.(6376-6378)CCC>CCA		Homo sapiens cDNA, FLJ17989.							44.0	42.0	43.0					10																	134628239		2203	4300	6503	SO:0001819	synonymous_variant	0							g.chr10:134628239G>T																												ENST00000368586.5:c.7200C>A	10.37:g.134628239G>T							p.P2126P	NM_017609	NP_060079					44	6378	-									Silent	SNP	ENST00000368586.5	37	c.6378C>A	CCDS58101.1																																																																																				0.667	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3			16	34	1	0	1.5739e-10	0.004007	2.17809e-10	16	34				
OR52M1	119772	broad.mit.edu	37	11	4566472	4566472	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:4566472G>T	ENST00000360213.1	+	1	52	c.52G>T	c.(52-54)Ggc>Tgc	p.G18C		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G18C(1)		endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTGGCTCACTGGCATCCCAGG	0.532																																							uc010qyf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(52-54)GGC>TGC		olfactory receptor, family 52, subfamily M,							100.0	91.0	94.0					11																	4566472		2201	4298	6499	SO:0001583	missense	119772				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4566472G>T	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.52G>T	11.37:g.4566472G>T	ENSP00000353343:p.Gly18Cys						p.G18C	NM_001004137	NP_001004137	Q8NGK5	O52M1_HUMAN		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	52	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	18			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000360213.1	37	c.52G>T	CCDS31353.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972697	0.53614	.	.	ENSG00000197790	ENST00000360213	T	0.00662	5.93	4.72	4.72	0.59763	.	0.000000	0.48286	D	0.000189	T	0.08133	0.0203	H	0.96239	3.79	0.23287	N	0.997978	D	0.89917	1.0	D	0.97110	1.0	T	0.07252	-1.0782	10	0.87932	D	0	.	15.558	0.76216	0.0:0.0:1.0:0.0	.	18	Q8NGK5	O52M1_HUMAN	C	18	ENSP00000353343:G18C	ENSP00000353343:G18C	G	+	1	0	OR52M1	4523048	0.994000	0.37717	0.946000	0.38457	0.959000	0.62525	2.918000	0.48829	2.600000	0.87896	0.655000	0.94253	GGC		0.532	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	NM_001004137		25	60	1	0	2.21704e-12	0.00278	3.25314e-12	25	60				
CCKBR	887	broad.mit.edu	37	11	6292734	6292734	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:6292734G>C	ENST00000334619.2	+	5	1498	c.1305G>C	c.(1303-1305)agG>agC	p.R435S	CCKBR_ENST00000532715.1_Missense_Mutation_p.R351S|CCKBR_ENST00000525462.1_Missense_Mutation_p.R504S	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	435					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.R435S(1)|p.R504S(1)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	CGCTGTCCAGGCTTAGCTACA	0.637																																							uc001mcp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|ovary(2)|breast(1)	8						c.(1303-1305)AGG>AGC		cholecystokinin B receptor	Pentagastrin(DB00183)						39.0	37.0	38.0					11																	6292734		2201	4294	6495	SO:0001583	missense	887				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding	g.chr11:6292734G>C	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.1305G>C	11.37:g.6292734G>C	ENSP00000335544:p.Arg435Ser					CCKBR_uc001mcq.2_Missense_Mutation_p.R363S|CCKBR_uc001mcr.2_Missense_Mutation_p.R418S|CCKBR_uc001mcs.2_Missense_Mutation_p.R504S	p.R435S	NM_176875	NP_795344	P32239	GASR_HUMAN		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	5	1498	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	435			Cytoplasmic (Potential).		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	c.1305G>C	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.303753	0.60305	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.78003	0.18;-1.14;0.02	5.39	2.12	0.27331	.	0.050767	0.64402	D	0.000001	T	0.79499	0.4456	L	0.42245	1.32	0.31128	N	0.708098	D;P;D	0.61697	0.99;0.944;0.972	D;P;P	0.66716	0.946;0.81;0.901	T	0.76719	-0.2856	10	0.72032	D	0.01	.	6.6446	0.22929	0.2328:0.0:0.6312:0.136	.	504;369;435	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	S	435;351;504	ENSP00000335544:R435S;ENSP00000432079:R351S;ENSP00000435534:R504S	ENSP00000335544:R435S	R	+	3	2	CCKBR	6249310	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	1.471000	0.35365	0.641000	0.30601	0.563000	0.77884	AGG		0.637	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875		13	35	0	0	0	0.003163	0	13	35				
OR10A2	341276	broad.mit.edu	37	11	6891249	6891249	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:6891249G>A	ENST00000307322.4	+	1	326	c.264G>A	c.(262-264)atG>atA	p.M88I		NM_001004460.1	NP_001004460.1	Q9H208	O10A2_HUMAN	olfactory receptor, family 10, subfamily A, member 2	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M88I(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(12)|urinary_tract(1)	24		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CCACTCAGATGTATTTCTTCT	0.522																																							uc001meu.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(262-264)ATG>ATA		olfactory receptor, family 10, subfamily A,							107.0	107.0	107.0					11																	6891249		2201	4296	6497	SO:0001583	missense	341276				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6891249G>A	BK004293	CCDS31415.1	11p15.4	2012-08-09		2004-03-10	ENSG00000170790	ENSG00000170790		"""GPCR / Class A : Olfactory receptors"""	8161	protein-coding gene	gene with protein product				OR10A2P			Standard	NM_001004460		Approved	OST363	uc001meu.1	Q9H208	OTTHUMG00000165739	ENST00000307322.4:c.264G>A	11.37:g.6891249G>A	ENSP00000303862:p.Met88Ile						p.M88I	NM_001004460	NP_001004460	Q9H208	O10A2_HUMAN		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)	1	264	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	88			Helical; Name=3; (Potential).		B2RNL9|Q6IFG9	Missense_Mutation	SNP	ENST00000307322.4	37	c.264G>A	CCDS31415.1	.	.	.	.	.	.	.	.	.	.	g	10.13	1.265908	0.23136	.	.	ENSG00000170790	ENST00000307322	T	0.02015	4.5	4.51	2.64	0.31445	GPCR, rhodopsin-like superfamily (1);	0.089165	0.50627	D	0.000109	T	0.01976	0.0062	L	0.42487	1.325	0.33628	D	0.605712	P	0.43542	0.81	B	0.35859	0.212	T	0.48758	-0.9007	10	0.87932	D	0	.	4.2893	0.10870	0.1909:0.0:0.6294:0.1797	.	88	Q9H208	O10A2_HUMAN	I	88	ENSP00000303862:M88I	ENSP00000303862:M88I	M	+	3	0	OR10A2	6847825	0.821000	0.29204	1.000000	0.80357	0.255000	0.26057	0.257000	0.18369	0.655000	0.30866	-0.141000	0.14075	ATG		0.522	OR10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385984.1	NM_001004460		46	123	0	0	0	0.01441	0	46	123				
KCNC1	3746	broad.mit.edu	37	11	17757877	17757877	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:17757877C>A	ENST00000379472.3	+	1	358	c.328C>A	c.(328-330)Cgc>Agc	p.R110S	KCNC1_ENST00000265969.6_Missense_Mutation_p.R110S	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	110					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.R110S(2)		breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	GATGACGTACCGCCAGCACCG	0.716																																							uc001mnk.3		NA																	2	Substitution - Missense(2)		lung(2)	upper_aerodigestive_tract(1)	1						c.(328-330)CGC>AGC		Shaw-related voltage-gated potassium channel							31.0	33.0	32.0					11																	17757877		2200	4292	6492	SO:0001583	missense	3746					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr11:17757877C>A	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.328C>A	11.37:g.17757877C>A	ENSP00000368785:p.Arg110Ser					KCNC1_uc009yhc.1_Missense_Mutation_p.R110S	p.R110S	NM_004976	NP_004967	P48547	KCNC1_HUMAN			1	383	+			110			Cytoplasmic (Potential).		K4DI87	Missense_Mutation	SNP	ENST00000379472.3	37	c.328C>A	CCDS7827.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.868247	0.72065	.	.	ENSG00000129159	ENST00000265969;ENST00000379472	D;D	0.97161	-4.27;-4.25	5.09	4.08	0.47627	BTB/POZ-like (1);BTB/POZ fold (2);	0.054008	0.64402	D	0.000001	D	0.97673	0.9237	L	0.55213	1.73	0.58432	D	0.999997	B;D	0.89917	0.129;1.0	B;D	0.87578	0.045;0.998	D	0.97734	1.0204	10	0.49607	T	0.09	.	16.1821	0.81915	0.1425:0.8575:0.0:0.0	.	110;110	Q3KNS8;P48547	.;KCNC1_HUMAN	S	110	ENSP00000265969:R110S;ENSP00000368785:R110S	ENSP00000265969:R110S	R	+	1	0	KCNC1	17714453	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.800000	0.55537	2.368000	0.80403	0.491000	0.48974	CGC		0.716	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976		13	30	1	0	3.27435e-08	0.00245	4.28749e-08	13	30				
LDLRAD3	143458	broad.mit.edu	37	11	36103274	36103274	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:36103274T>A	ENST00000315571.5	+	3	286	c.265T>A	c.(265-267)Ttc>Atc	p.F89I	LDLRAD3_ENST00000524419.1_Missense_Mutation_p.F40I|LDLRAD3_ENST00000528989.1_Missense_Mutation_p.F40I	NM_174902.2	NP_777562.1	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain containing 3	89	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				receptor-mediated endocytosis (GO:0006898)|regulation of protein processing (GO:0070613)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.F89I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(7)|skin(1)	28	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				CATTGGTCGCTTCCGGTGCAA	0.527																																							uc001mwk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(265-267)TTC>ATC		low density lipoprotein receptor class A domain							160.0	132.0	141.0					11																	36103274		2202	4298	6500	SO:0001583	missense	143458					integral to membrane	receptor activity	g.chr11:36103274T>A	AK075546	CCDS31462.1	11p13	2014-06-05			ENSG00000179241	ENSG00000179241			27046	protein-coding gene	gene with protein product						21795536	Standard	NM_174902		Approved	LRAD3	uc001mwk.1	Q86YD5	OTTHUMG00000166313	ENST00000315571.5:c.265T>A	11.37:g.36103274T>A	ENSP00000318607:p.Phe89Ile					LDLRAD3_uc010rey.1_Missense_Mutation_p.F40I|LDLRAD3_uc010rez.1_5'UTR	p.F89I	NM_174902	NP_777562	Q86YD5	LRAD3_HUMAN			3	302	+	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)	89			Extracellular (Potential).|LDL-receptor class A 2.		B7Z1U3|B9EG81|Q8NBJ0	Missense_Mutation	SNP	ENST00000315571.5	37	c.265T>A	CCDS31462.1	.	.	.	.	.	.	.	.	.	.	T	35	5.588323	0.96590	.	.	ENSG00000179241	ENST00000528989;ENST00000524419;ENST00000545142;ENST00000315571	D;D;D	0.95412	-3.7;-3.7;-3.7	5.95	5.95	0.96441	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97794	0.9276	M	0.85777	2.775	0.80722	D	1	D;D	0.69078	0.985;0.997	D;D	0.80764	0.933;0.994	D	0.98423	1.0578	10	0.66056	D	0.02	.	15.6134	0.76744	0.0:0.0:0.0:1.0	.	40;89	B7Z1U3;Q86YD5	.;LRAD3_HUMAN	I	40;40;89;89	ENSP00000433954:F40I;ENSP00000434313:F40I;ENSP00000318607:F89I	ENSP00000318607:F89I	F	+	1	0	LDLRAD3	36059850	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.698000	0.84413	2.281000	0.76405	0.528000	0.53228	TTC		0.527	LDLRAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389085.1	NM_174902		37	76	0	0	0	0.004878	0	37	76				
OR8I2	120586	broad.mit.edu	37	11	55861219	55861219	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:55861219G>T	ENST00000302124.2	+	1	467	c.436G>T	c.(436-438)Gta>Tta	p.V146L		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V146L(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					CTGGCTGGGAGTAATGCCATA	0.433																																							uc010rix.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(436-438)GTA>TTA		olfactory receptor, family 8, subfamily I,							148.0	136.0	140.0					11																	55861219		2201	4296	6497	SO:0001583	missense	120586				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55861219G>T	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.436G>T	11.37:g.55861219G>T	ENSP00000303864:p.Val146Leu						p.V146L	NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN			1	436	+	Esophageal squamous(21;0.00693)		146			Helical; Name=4; (Potential).		B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	ENST00000302124.2	37	c.436G>T	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	g	1.067	-0.671023	0.03403	.	.	ENSG00000172154	ENST00000302124	T	0.35421	1.31	4.33	-0.0421	0.13865	GPCR, rhodopsin-like superfamily (1);	1.346490	0.05611	U	0.578171	T	0.17534	0.0421	N	0.13327	0.33	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.20773	-1.0265	10	0.09084	T	0.74	-0.1618	2.9749	0.05934	0.2336:0.1205:0.523:0.123	.	146	Q8N0Y5	OR8I2_HUMAN	L	146	ENSP00000303864:V146L	ENSP00000303864:V146L	V	+	1	0	OR8I2	55617795	0.000000	0.05858	0.000000	0.03702	0.177000	0.22998	-0.201000	0.09464	0.042000	0.15717	-0.431000	0.05894	GTA		0.433	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750		30	97	1	0	1.55811e-20	0.008361	2.64516e-20	30	97				
OR8H1	219469	broad.mit.edu	37	11	56057871	56057871	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:56057871G>T	ENST00000313022.2	-	1	695	c.668C>A	c.(667-669)aCc>aAc	p.T223N		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T223N(1)		NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					TTTCAGGATGGTAGAGAGAAT	0.398																																							uc010rje.1		NA																	1	Substitution - Missense(1)	p.T223T(1)	lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(667-669)ACC>AAC		olfactory receptor, family 8, subfamily H,							137.0	126.0	130.0					11																	56057871		2201	4294	6495	SO:0001583	missense	219469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56057871G>T	AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.668C>A	11.37:g.56057871G>T	ENSP00000323595:p.Thr223Asn						p.T223N	NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN			1	668	-	Esophageal squamous(21;0.00448)		223			Cytoplasmic (Potential).		B2RNI7|Q6IFC5	Missense_Mutation	SNP	ENST00000313022.2	37	c.668C>A	CCDS31526.1	.	.	.	.	.	.	.	.	.	.	G	4.237	0.042977	0.08196	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.00193	8.58	3.81	3.81	0.43845	GPCR, rhodopsin-like superfamily (1);	0.117893	0.39020	N	0.001497	T	0.00271	0.0008	M	0.69523	2.12	0.09310	N	1	B	0.18013	0.025	B	0.29077	0.098	T	0.41556	-0.9502	10	0.39692	T	0.17	.	16.1701	0.81808	0.0:0.0:1.0:0.0	.	223	Q8NGG4	OR8H1_HUMAN	N	223;219	ENSP00000323595:T223N	ENSP00000323595:T223N	T	-	2	0	OR8H1	55814447	0.002000	0.14202	0.016000	0.15963	0.006000	0.05464	0.800000	0.27042	2.059000	0.61396	0.573000	0.79308	ACC		0.398	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370019.1	NM_001005199		33	52	1	0	5.91797e-21	0.012213	1.0165e-20	33	52				
RIN1	9610	broad.mit.edu	37	11	66099844	66099844	+	Missense_Mutation	SNP	G	G	A	rs3181770		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:66099844G>A	ENST00000311320.4	-	10	2381	c.2255C>T	c.(2254-2256)tCt>tTt	p.S752F	RP11-867G23.12_ENST00000526655.1_RNA|RIN1_ENST00000424433.2_Intron|RIN1_ENST00000530056.1_Missense_Mutation_p.S586F|RIN1_ENST00000524804.1_5'Flank	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	752					associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.S752F(1)		breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						AGTTGTCTCAGACTGTTCCCG	0.632																																							uc001ohn.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|breast(1)	3						c.(2254-2256)TCT>TTT		ras inhibitor RIN1							137.0	133.0	135.0					11																	66099844		2200	4295	6495	SO:0001583	missense	9610				endocytosis|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase activator activity|protein binding	g.chr11:66099844G>A	L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.2255C>T	11.37:g.66099844G>A	ENSP00000310406:p.Ser752Phe					RIN1_uc010roy.1_Missense_Mutation_p.S383F|RIN1_uc009yrd.1_Missense_Mutation_p.S445F|RIN1_uc010roz.1_Missense_Mutation_p.S647F|RIN1_uc010rpa.1_Missense_Mutation_p.S586F	p.S752F	NM_004292	NP_004283	Q13671	RIN1_HUMAN			10	2382	-			752					O15010|Q00427|Q96CC8	Missense_Mutation	SNP	ENST00000311320.4	37	c.2255C>T	CCDS31614.1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677279	0.29783	.	.	ENSG00000174791	ENST00000311320;ENST00000530056	T;T	0.15139	3.04;2.45	4.39	2.24	0.28232	.	9.351080	0.00166	N	0.000001	T	0.17109	0.0411	L	0.32530	0.975	0.09310	N	1	B;B;B	0.33379	0.07;0.07;0.41	B;B;B	0.35550	0.058;0.058;0.205	T	0.27971	-1.0058	10	0.72032	D	0.01	-2.7055	6.5388	0.22369	0.0:0.2024:0.589:0.2086	rs3181770	586;383;752	E9PNR2;B4DW96;Q13671	.;.;RIN1_HUMAN	F	752;586	ENSP00000310406:S752F;ENSP00000432798:S586F	ENSP00000310406:S752F	S	-	2	0	RIN1	65856420	0.000000	0.05858	0.001000	0.08648	0.071000	0.16799	0.304000	0.19228	1.093000	0.41377	0.462000	0.41574	TCT		0.632	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392980.2	NM_004292		58	100	0	0	0	0.01441	0	58	100				
SYT12	91683	broad.mit.edu	37	11	66807645	66807645	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:66807645C>T	ENST00000393946.2	+	7	1754	c.592C>T	c.(592-594)Ccg>Tcg	p.P198S	SYT12_ENST00000527043.1_Missense_Mutation_p.P198S|SYT12_ENST00000525457.1_Missense_Mutation_p.P198S|SYT12_ENST00000526281.1_3'UTR			Q8IV01	SYT12_HUMAN	synaptotagmin XII	198	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)		p.P198S(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						CAGCCTGCTGCCGGACGAGCA	0.662																																					Ovarian(65;2862 3307)	Ovarian(65;2862 3307)	uc009yrl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(592-594)CCG>TCG		synaptotagmin XII							45.0	49.0	48.0					11																	66807645		2198	4295	6493	SO:0001583	missense	91683					cell junction|integral to membrane|synaptic vesicle membrane		g.chr11:66807645C>T	AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.592C>T	11.37:g.66807645C>T	ENSP00000377520:p.Pro198Ser					SYT12_uc001oju.2_Missense_Mutation_p.P198S	p.P198S	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN			4	822	+			198			C2 1.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000393946.2	37	c.592C>T	CCDS8154.1	.	.	.	.	.	.	.	.	.	.	C	33	5.219162	0.95104	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043	T;T;T	0.72505	-0.66;-0.66;-0.66	5.63	5.63	0.86233	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.78278	0.4258	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80153	-0.1501	10	0.87932	D	0	.	17.1708	0.86830	0.0:1.0:0.0:0.0	.	198	Q8IV01	SYT12_HUMAN	S	198	ENSP00000377520:P198S;ENSP00000431400:P198S;ENSP00000435316:P198S	ENSP00000377520:P198S	P	+	1	0	SYT12	66564221	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	6.007000	0.70731	2.655000	0.90218	0.462000	0.41574	CCG		0.662	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393129.1	NM_177963		3	44	0	0	0	0.009096	0	3	44				
NXPE2	120406	broad.mit.edu	37	11	114569375	114569375	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:114569375C>A	ENST00000389586.4	+	3	931	c.741C>A	c.(739-741)gaC>gaA	p.D247E	NXPE2_ENST00000375475.5_Missense_Mutation_p.D247E	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	247						integral component of membrane (GO:0016021)		p.D247E(2)									ACATGGATGACAGAGACCAAG	0.473																																							uc009yyy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(739-741)GAC>GAA		hypothetical protein LOC120406							91.0	77.0	81.0					11																	114569375		692	1591	2283	SO:0001583	missense	120406					integral to membrane		g.chr11:114569375C>A	AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.741C>A	11.37:g.114569375C>A	ENSP00000374237:p.Asp247Glu						p.D247E	NM_182495	NP_872301	Q96DL1	FA55B_HUMAN			3	839	+			247					Q2NKI8	Missense_Mutation	SNP	ENST00000389586.4	37	c.741C>A	CCDS44738.1	.	.	.	.	.	.	.	.	.	.	C	8.368	0.834592	0.16820	.	.	ENSG00000204361	ENST00000389586;ENST00000375475;ENST00000505358	T;T	0.15718	2.9;2.4	4.41	-6.24	0.02046	.	2.317170	0.01763	N	0.030695	T	0.07458	0.0188	N	0.20530	0.585	0.09310	N	1	B	0.15473	0.013	B	0.15052	0.012	T	0.30268	-0.9984	10	0.05436	T	0.98	.	3.2127	0.06689	0.1257:0.4335:0.2556:0.1852	.	247	Q96DL1	FA55B_HUMAN	E	247	ENSP00000374237:D247E;ENSP00000364624:D247E	ENSP00000364624:D247E	D	+	3	2	FAM55B	114074585	0.000000	0.05858	0.002000	0.10522	0.532000	0.34746	-1.394000	0.02518	-0.717000	0.04955	-0.218000	0.12543	GAC		0.473	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399181.1	NM_182495		15	40	1	0	6.72482e-11	0.003163	9.39545e-11	15	40				
BCL9L	283149	broad.mit.edu	37	11	118772195	118772195	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:118772195T>A	ENST00000334801.3	-	6	3221	c.2257A>T	c.(2257-2259)Atg>Ttg	p.M753L	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	753	Met-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.M753L(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GACTGCCCCATGGGAGGGCTC	0.612																																							uc001pug.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(2257-2259)ATG>TTG		B-cell CLL/lymphoma 9-like							103.0	74.0	84.0					11																	118772195		2200	4295	6495	SO:0001583	missense	283149				negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		transcription coactivator activity	g.chr11:118772195T>A	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2257A>T	11.37:g.118772195T>A	ENSP00000335320:p.Met753Leu					BCL9L_uc009zal.2_Missense_Mutation_p.M748L	p.M753L	NM_182557	NP_872363	Q86UU0	BCL9L_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)	6	3222	-	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)	753			Met-rich.		A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	c.2257A>T	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	T	6.134	0.392920	0.11638	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	T	0.76709	-1.04	4.44	4.44	0.53790	.	0.000000	0.56097	D	0.000025	T	0.62696	0.2449	N	0.25647	0.755	0.31856	N	0.621642	B;B	0.12630	0.006;0.003	B;B	0.10450	0.005;0.002	T	0.61322	-0.7086	10	0.23891	T	0.37	-11.8278	9.0772	0.36529	0.0:0.0:0.1852:0.8148	.	748;753	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	L	753;716;46;753;753	ENSP00000335320:M753L	ENSP00000335320:M753L	M	-	1	0	BCL9L	118277405	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.552000	0.53705	1.858000	0.53909	0.260000	0.18958	ATG		0.612	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557		22	48	0	0	0	0.00278	0	22	48				
UBASH3B	84959	broad.mit.edu	37	11	122666894	122666894	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:122666894C>A	ENST00000284273.5	+	8	1519	c.1144C>A	c.(1144-1146)Cag>Aag	p.Q382K		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	382	Protein tyrosine phosphatase. {ECO:0000250}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.Q382K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		GCCCGGCCCCCAGAAGCGATG	0.542											OREG0021442	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001pyi.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1144-1146)CAG>AAG		ubiquitin associated and SH3 domain containing,							154.0	137.0	143.0					11																	122666894		2202	4299	6501	SO:0001583	missense	84959					cytoplasm|nucleus	protein tyrosine phosphatase activity	g.chr11:122666894C>A	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.1144C>A	11.37:g.122666894C>A	ENSP00000284273:p.Gln382Lys		OREG0021442	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1520		p.Q382K	NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)	8	1504	+		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)	382			Protein tyrosine phosphatase (By similarity).		Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	37	c.1144C>A	CCDS31694.1	.	.	.	.	.	.	.	.	.	.	C	5.759	0.324371	0.10900	.	.	ENSG00000154127	ENST00000284273	T	0.05139	3.49	5.54	5.54	0.83059	.	0.178314	0.50627	D	0.000119	T	0.03608	0.0103	N	0.08118	0	0.34245	D	0.678123	B	0.02656	0.0	B	0.04013	0.001	T	0.29458	-1.0011	10	0.08179	T	0.78	-4.52	14.3422	0.66636	0.1482:0.8518:0.0:0.0	.	382	Q8TF42	UBS3B_HUMAN	K	382	ENSP00000284273:Q382K	ENSP00000284273:Q382K	Q	+	1	0	UBASH3B	122172104	1.000000	0.71417	0.988000	0.46212	0.974000	0.67602	3.611000	0.54132	2.609000	0.88269	0.655000	0.94253	CAG		0.542	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	NM_032873		27	83	1	0	3.73988e-18	0.00632	6.16975e-18	27	83				
OR4D5	219875	broad.mit.edu	37	11	123810710	123810710	+	Silent	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:123810710C>A	ENST00000307033.2	+	1	461	c.387C>A	c.(385-387)ccC>ccA	p.P129P		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P129P(1)		autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TTTCCCAGCCCCTGCACTACA	0.507																																							uc001pzk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(385-387)CCC>CCA		olfactory receptor, family 4, subfamily D,							128.0	109.0	116.0					11																	123810710		2202	4299	6501	SO:0001819	synonymous_variant	219875				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123810710C>A	BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.387C>A	11.37:g.123810710C>A							p.P129P	NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)	1	387	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	129			Cytoplasmic (Potential).		B9EGZ4|Q6IFE6	Silent	SNP	ENST00000307033.2	37	c.387C>A	CCDS31699.1																																																																																				0.507	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387263.1	NM_001001965		33	103	1	0	5.43694e-19	0.005524	9.14099e-19	33	103				
CHEK1	1111	broad.mit.edu	37	11	125499295	125499295	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr11:125499295C>T	ENST00000534070.1	+	5	619	c.364C>T	c.(364-366)Cat>Tat	p.H122Y	CHEK1_ENST00000532449.1_3'UTR|CHEK1_ENST00000524737.1_Missense_Mutation_p.H122Y|CHEK1_ENST00000427383.2_Missense_Mutation_p.H138Y|CHEK1_ENST00000428830.2_Missense_Mutation_p.H122Y|CHEK1_ENST00000544373.1_Missense_Mutation_p.H122Y|CHEK1_ENST00000278916.3_Missense_Mutation_p.H122Y|CHEK1_ENST00000438015.1_Missense_Mutation_p.H122Y	NM_001274.5	NP_001265.2	O14757	CHK1_HUMAN	checkpoint kinase 1	122	Interaction with CLSPN. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to caffeine (GO:0071313)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to mechanical stimulus (GO:0071260)|chromatin-mediated maintenance of transcription (GO:0048096)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of mitosis (GO:0045839)|peptidyl-threonine phosphorylation (GO:0018107)|regulation of cell proliferation (GO:0042127)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of histone H3-K9 acetylation (GO:2000615)|regulation of mitotic centrosome separation (GO:0046602)|regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010767)|replicative senescence (GO:0090399)	centrosome (GO:0005813)|chromatin (GO:0000785)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	ATP binding (GO:0005524)|histone kinase activity (H3-T11 specific) (GO:0035402)|protein serine/threonine kinase activity (GO:0004674)	p.H122Y(1)		central_nervous_system(3)|endometrium(3)|large_intestine(2)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	26	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		GGTTTATCTGCATGGTATTGG	0.318								Other conserved DNA damage response genes																															uc009zbo.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(3)|lung(2)|skin(1)	6						c.(364-366)CAT>TAT	Other_conserved_DNA_damage_response_genes	checkpoint kinase 1							97.0	102.0	100.0					11																	125499295		2201	4299	6500	SO:0001583	missense	1111				cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr11:125499295C>T	AF016582, BC017575	CCDS8459.1, CCDS58191.1	11q24.2	2011-11-11	2011-11-11		ENSG00000149554	ENSG00000149554			1925	protein-coding gene	gene with protein product		603078	"""CHK1 (checkpoint, S.pombe) homolog"", ""CHK1 checkpoint homolog (S. pombe)"""			9278511, 9382850	Standard	NM_001114121		Approved	CHK1	uc001qcg.4	O14757	OTTHUMG00000165853	ENST00000534070.1:c.364C>T	11.37:g.125499295C>T	ENSP00000435371:p.His122Tyr					CHEK1_uc010sbh.1_Missense_Mutation_p.H138Y|CHEK1_uc010sbi.1_Missense_Mutation_p.H122Y|CHEK1_uc001qcf.3_Missense_Mutation_p.H122Y|CHEK1_uc009zbp.2_Missense_Mutation_p.H122Y|CHEK1_uc001qcg.3_Missense_Mutation_p.H122Y|CHEK1_uc009zbq.2_Missense_Mutation_p.H122Y|CHEK1_uc001qci.1_RNA	p.H122Y	NM_001114122	NP_001107594	O14757	CHK1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)	5	1256	+	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	122			Protein kinase.		A8K934|B4DDD0|B4DSK3|B5BTY6|F5H7S4|H2BI51	Missense_Mutation	SNP	ENST00000534070.1	37	c.364C>T	CCDS8459.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.441572	0.83993	.	.	ENSG00000149554	ENST00000438015;ENST00000525396;ENST00000427383;ENST00000428830;ENST00000544373;ENST00000527013;ENST00000526937;ENST00000534685;ENST00000534070;ENST00000524737;ENST00000532669;ENST00000278916	D;D;D;D;D;D;D;D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76	5.32	4.41	0.53225	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93262	0.7853	H	0.95611	3.695	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.94698	0.7880	10	0.87932	D	0	-19.7966	13.0727	0.59070	0.0:0.921:0.0:0.079	.	122;138;122;122	F5H7S4;E7EPP6;B5BTY6;O14757	.;.;.;CHK1_HUMAN	Y	122;122;138;122;122;122;122;122;122;122;43;122	ENSP00000388648:H122Y;ENSP00000434141:H122Y;ENSP00000391090:H138Y;ENSP00000412504:H122Y;ENSP00000442317:H122Y;ENSP00000431525:H122Y;ENSP00000431815:H122Y;ENSP00000432470:H122Y;ENSP00000435371:H122Y;ENSP00000432890:H122Y;ENSP00000434646:H43Y;ENSP00000278916:H122Y	ENSP00000278916:H122Y	H	+	1	0	CHEK1	125004505	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.447000	0.80620	1.394000	0.46624	0.591000	0.81541	CAT		0.318	CHEK1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386714.1	NM_001274		22	54	0	0	0	0.014323	0	22	54				
CACNA1C	775	broad.mit.edu	37	12	2797830	2797830	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:2797830G>A	ENST00000347598.4	+	48	6146	c.6146G>A	c.(6145-6147)gGt>gAt	p.G2049D	CACNA1C_ENST00000399649.1_Missense_Mutation_p.G2007D|CACNA1C_ENST00000399606.1_Missense_Mutation_p.G2021D|CACNA1C_ENST00000399655.1_Missense_Mutation_p.G2001D|CACNA1C_ENST00000402845.3_Missense_Mutation_p.G2020D|CACNA1C_ENST00000399601.1_Missense_Mutation_p.G2001D|CACNA1C_ENST00000327702.7_Missense_Mutation_p.G2036D|CACNA1C_ENST00000399621.1_Missense_Mutation_p.G2020D|CACNA1C-AS1_ENST00000544517.1_RNA|CACNA1C_ENST00000399629.1_Missense_Mutation_p.G2018D|CACNA1C_ENST00000344100.3_Missense_Mutation_p.G2042D|CACNA1C_ENST00000399644.1_Missense_Mutation_p.G2001D|CACNA1C_ENST00000399641.1_Missense_Mutation_p.G2001D|CACNA1C_ENST00000399638.1_Missense_Mutation_p.G2029D|CACNA1C_ENST00000399597.1_Missense_Mutation_p.G2001D|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399637.1_Missense_Mutation_p.G2020D|CACNA1C-AS1_ENST00000541673.1_RNA|CACNA1C_ENST00000399617.1_Missense_Mutation_p.G2036D|CACNA1C_ENST00000399591.1_Missense_Mutation_p.G2009D|CACNA1C_ENST00000399603.1_Missense_Mutation_p.G2001D|CACNA1C_ENST00000399634.1_Missense_Mutation_p.G2072D|CACNA1C_ENST00000335762.5_Missense_Mutation_p.G2026D|CACNA1C_ENST00000399595.1_Missense_Mutation_p.G2009D|CACNA1C_ENST00000406454.3_Missense_Mutation_p.G2072D	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	2084					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.G2036D(1)|p.G1536D(1)|p.G2049D(1)|p.G2114D(1)|p.G2042D(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACCACCCCCGGTGGCGGGGGC	0.711																																							uc009zdu.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(10)|central_nervous_system(1)	11						c.(6250-6252)GGT>GAT		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						26.0	31.0	29.0					12																	2797830		1905	4106	6011	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2797830G>A	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.6146G>A	12.37:g.2797830G>A	ENSP00000266376:p.Gly2049Asp					CACNA1C_uc009zdv.1_Missense_Mutation_p.G1998D|CACNA1C_uc001qkb.2_Missense_Mutation_p.G2001D|CACNA1C_uc001qkc.2_Missense_Mutation_p.G2020D|CACNA1C_uc001qke.2_Missense_Mutation_p.G1990D|CACNA1C_uc001qkf.2_Missense_Mutation_p.G2009D|CACNA1C_uc001qjz.2_Missense_Mutation_p.G2001D|CACNA1C_uc001qkd.2_Missense_Mutation_p.G2020D|CACNA1C_uc001qkg.2_Missense_Mutation_p.G2007D|CACNA1C_uc009zdw.1_Missense_Mutation_p.G2042D|CACNA1C_uc001qkh.2_Missense_Mutation_p.G2009D|CACNA1C_uc001qkl.2_Missense_Mutation_p.G2049D|CACNA1C_uc001qkn.2_Missense_Mutation_p.G2001D|CACNA1C_uc001qko.2_Missense_Mutation_p.G2021D|CACNA1C_uc001qkp.2_Missense_Mutation_p.G2001D|CACNA1C_uc001qkr.2_Missense_Mutation_p.G2018D|CACNA1C_uc001qku.2_Missense_Mutation_p.G2036D|CACNA1C_uc001qkq.2_Missense_Mutation_p.G2029D|CACNA1C_uc001qks.2_Missense_Mutation_p.G2001D|CACNA1C_uc001qkt.2_Missense_Mutation_p.G2020D|CACNA1C_uc001qki.1_Missense_Mutation_p.G1808D|CACNA1C_uc001qkj.1_Missense_Mutation_p.G1772D|CACNA1C_uc001qkk.1_Missense_Mutation_p.G1737D|CACNA1C_uc001qkm.1_Missense_Mutation_p.G1797D|CACNA1C_uc010sea.1_Missense_Mutation_p.G692D|uc001qkx.1_Intron|CACNA1C_uc001qky.1_Missense_Mutation_p.G319D	p.G2084D	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	49	6564	+			2084			Poly-Gly.|Cytoplasmic (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.6251G>A	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	4.986	0.183145	0.09495	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.95885	-3.77;-3.77;-3.77;-3.76;-3.77;-3.79;-3.68;-3.72;-3.77;-3.71;-3.69;-3.77;-3.84;-3.69;-3.65;-3.83;-3.78;-3.77;-3.84;-3.74;-3.83;-3.83	4.69	3.8	0.43715	.	0.540142	0.18284	N	0.145938	D	0.89722	0.6797	N	0.08118	0	0.09310	N	1	B;P;B;B;P;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.38745	0.002;0.454;0.0;0.019;0.645;0.128;0.0;0.001;0.0;0.001;0.0;0.0;0.036;0.076;0.0;0.046;0.036;0.0;0.001;0.0;0.0;0.128;0.0;0.0;0.0	B;B;B;B;P;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.45474	0.017;0.398;0.0;0.017;0.482;0.1;0.0;0.001;0.002;0.001;0.0;0.0;0.085;0.1;0.0;0.046;0.085;0.001;0.0;0.001;0.0;0.054;0.0;0.0;0.0	T	0.82188	-0.0581	10	0.22706	T	0.39	.	8.899	0.35484	0.1014:0.0:0.8986:0.0	.	692;2042;1998;2084;2036;2020;2001;2018;2029;2001;2021;2001;2032;2049;2001;2036;2072;2009;2007;2009;1990;2020;2020;2001;2001	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	D	2026;2001;2001;2029;2001;2020;2020;2009;2001;2049;2021;2001;2042;2018;2036;2007;2020;2001;2072;2036;2072;2009;1902	ENSP00000336982:G2026D;ENSP00000382563:G2001D;ENSP00000382552:G2001D;ENSP00000382547:G2029D;ENSP00000382506:G2001D;ENSP00000382530:G2020D;ENSP00000382546:G2020D;ENSP00000382500:G2009D;ENSP00000382549:G2001D;ENSP00000266376:G2049D;ENSP00000382515:G2021D;ENSP00000382510:G2001D;ENSP00000341092:G2042D;ENSP00000382537:G2018D;ENSP00000329877:G2036D;ENSP00000382557:G2007D;ENSP00000385724:G2020D;ENSP00000382512:G2001D;ENSP00000382542:G2072D;ENSP00000382526:G2036D;ENSP00000385896:G2072D;ENSP00000382504:G2009D	ENSP00000323129:G1902D	G	+	2	0	CACNA1C	2668091	0.003000	0.15002	0.004000	0.12327	0.003000	0.03518	1.300000	0.33436	1.204000	0.43247	-0.369000	0.07265	GGT		0.711	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		11	25	0	0	0	0.010729	0	11	25				
RAD51AP1	10635	broad.mit.edu	37	12	4657319	4657319	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:4657319T>G	ENST00000544927.1	+	5	391	c.381T>G	c.(379-381)aaT>aaG	p.N127K	RAD51AP1_ENST00000228843.9_Missense_Mutation_p.N144K|RAD51AP1_ENST00000543041.1_Missense_Mutation_p.N9K|RAD51AP1_ENST00000321524.7_Missense_Mutation_p.N144K|RAD51AP1_ENST00000352618.4_Missense_Mutation_p.N127K					RAD51 associated protein 1									p.N127K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00306)|COAD - Colon adenocarcinoma(12;0.0389)			ATATCTCTAATTGCAGTGTAG	0.274																																							uc001qmw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(430-432)AAT>AAG		RAD51 associated protein 1 isoform a							75.0	84.0	81.0					12																	4657319		2201	4299	6500	SO:0001583	missense	10635				double-strand break repair via homologous recombination		double-stranded DNA binding|protein binding|protein binding|RNA binding|single-stranded DNA binding	g.chr12:4657319T>G	AF006259	CCDS8529.1, CCDS44805.1	12p13.2-p13.1	2004-09-16			ENSG00000111247	ENSG00000111247			16956	protein-coding gene	gene with protein product		603070				9396801	Standard	NM_001130862		Approved	PIR51	uc001qmw.3	Q96B01	OTTHUMG00000168125	ENST00000544927.1:c.381T>G	12.37:g.4657319T>G	ENSP00000446296:p.Asn127Lys					RAD51AP1_uc001qmu.2_Missense_Mutation_p.N127K|RAD51AP1_uc001qmv.2_Missense_Mutation_p.N90K|RAD51AP1_uc010sep.1_Missense_Mutation_p.N9K|RAD51AP1_uc010seq.1_Missense_Mutation_p.N9K|RAD51AP1_uc009zeg.2_5'Flank	p.N144K	NM_001130862	NP_001124334	Q96B01	R51A1_HUMAN	Colorectal(7;0.00306)|COAD - Colon adenocarcinoma(12;0.0389)		6	588	+			144						Missense_Mutation	SNP	ENST00000544927.1	37	c.432T>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.93|18.93	3.726901|3.726901	0.69074|0.69074	.|.	.|.	ENSG00000111247|ENSG00000111247	ENST00000536117|ENST00000321524;ENST00000543041;ENST00000228843;ENST00000352618;ENST00000544927	.|T;T;T;T;T	.|0.34275	.|1.37;1.37;1.37;1.37;1.37	4.86|4.86	-1.39|-1.39	0.08997|0.08997	.|.	.|0.700825	.|0.14469	.|N	.|0.317712	T|T	0.47875|0.47875	0.1469|0.1469	L|L	0.52011|0.52011	1.625|1.625	0.39669|0.39669	D|D	0.970734|0.970734	.|D;D;D;D	.|0.89917	.|0.998;0.998;0.992;1.0	.|D;D;P;D	.|0.87578	.|0.994;0.948;0.876;0.998	T|T	0.46596|0.46596	-0.9180|-0.9180	5|10	.|0.56958	.|D	.|0.05	-23.7428|-23.7428	9.0134|9.0134	0.36155|0.36155	0.0:0.5494:0.0:0.4506|0.0:0.5494:0.0:0.4506	.|.	.|9;144;144;127	.|B4DUS5;Q96B01;A8K313;Q96B01-2	.|.;R51A1_HUMAN;.;.	V|K	122|144;9;144;127;127	.|ENSP00000323750:N144K;ENSP00000439960:N9K;ENSP00000228843:N144K;ENSP00000309479:N127K;ENSP00000446296:N127K	.|ENSP00000228843:N144K	L|N	+|+	1|3	2|2	RAD51AP1|RAD51AP1	4527580|4527580	0.722000|0.722000	0.28017|0.28017	0.979000|0.979000	0.43373|0.43373	0.998000|0.998000	0.95712|0.95712	-0.838000|-0.838000	0.04372|0.04372	-0.420000|-0.420000	0.07427|0.07427	0.482000|0.482000	0.46254|0.46254	TTG|AAT		0.274	RAD51AP1-012	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000399208.1	NM_006479		8	126	0	0	0	0.00308	0	8	126				
RERGL	79785	broad.mit.edu	37	12	18237478	18237478	+	Missense_Mutation	SNP	C	C	T	rs61757396	byFrequency	TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:18237478C>T	ENST00000229002.2	-	5	514	c.308G>A	c.(307-309)cGg>cAg	p.R103Q	RERGL_ENST00000538724.1_Missense_Mutation_p.R102Q|RERGL_ENST00000536890.1_3'UTR|RERGL_ENST00000541632.1_5'UTR	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	103	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.R103Q(2)		endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						TTGTGGCTCCCGGATTCTGTA	0.383													C|||	7	0.00139776	0.0053	0.0	5008	,	,		17166	0.0		0.0	False		,,,				2504	0.0						uc001rdq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(307-309)CGG>CAG		RERG/RAS-like		C	GLN/ARG	19,4387	27.2+/-55.0	0,19,2184	136.0	137.0	137.0		308	4.9	1.0	12	dbSNP_129	137	0,8600		0,0,4300	yes	missense	RERGL	NM_024730.2	43	0,19,6484	TT,TC,CC		0.0,0.4312,0.1461	possibly-damaging	103/206	18237478	19,12987	2203	4300	6503	SO:0001583	missense	79785				signal transduction	membrane	GTP binding|GTPase activity	g.chr12:18237478C>T	AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.308G>A	12.37:g.18237478C>T	ENSP00000229002:p.Arg103Gln					RERGL_uc001rdr.2_Missense_Mutation_p.R102Q	p.R103Q	NM_024730	NP_079006	Q9H628	RERGL_HUMAN			5	502	-			103			Small GTPase-like.			Missense_Mutation	SNP	ENST00000229002.2	37	c.308G>A	CCDS8679.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	10.61	1.397490	0.25205	0.004312	0.0	ENSG00000111404	ENST00000229002;ENST00000538724	T;T	0.80214	-1.35;-1.35	4.91	4.91	0.64330	.	0.132040	0.52532	D	0.000066	T	0.65964	0.2742	L	0.35249	1.045	0.80722	D	1	B;P	0.37573	0.076;0.6	B;B	0.30316	0.021;0.114	T	0.64097	-0.6487	10	0.12766	T	0.61	.	12.6956	0.57001	0.0:0.9189:0.0:0.0811	rs61757396	102;103	F5H686;Q9H628	.;RERGL_HUMAN	Q	103;102	ENSP00000229002:R103Q;ENSP00000437814:R102Q	ENSP00000229002:R103Q	R	-	2	0	RERGL	18128745	1.000000	0.71417	1.000000	0.80357	0.252000	0.25951	2.464000	0.45067	2.660000	0.90430	0.467000	0.42956	CGG		0.383	RERGL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401198.1	NM_024730		12	95	0	0	0	0.001855	0	12	95				
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052						c.(34-36)GGT>GAT		c-K-ras2 protein isoform a precursor							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12D|KRAS_uc001rgr.2_RNA	p.G12D	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	216	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.35G>A	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		10	11	0	0	0	0.010729	0	10	11				
OR8S1	341568	broad.mit.edu	37	12	48921695	48921695	+	Splice_Site	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:48921695G>A	ENST00000310194.1	+	2	889	c.889G>A	c.(889-891)Ggg>Agg	p.G297R	OR8S1_ENST00000551654.1_3'UTR	NM_001005203.2	NP_001005203.2	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S, member 1	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G297R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|skin(4)	22						CTGTTACAAGGGGGAAAGAAG	0.468																																							uc010slu.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(889-891)GGG>AGG		olfactory receptor, family 8, subfamily S,							26.0	31.0	30.0					12																	48921695		2203	4300	6503	SO:0001630	splice_region_variant	341568				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:48921695G>A		CCDS31789.1	12q13.2	2012-08-09				ENSG00000197376		"""GPCR / Class A : Olfactory receptors"""	19628	protein-coding gene	gene with protein product							Standard	NM_001005203		Approved		uc010slu.2	Q8NH09		ENST00000310194.1:c.889-1G>A	12.37:g.48921695G>A							p.G297R	NM_001005203	NP_001005203	Q8NH09	OR8S1_HUMAN			2	889	+			297			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000310194.1	37	c.889G>A	CCDS31789.1	.	.	.	.	.	.	.	.	.	.	G	7.308	0.614507	0.14129	.	.	ENSG00000197376	ENST00000310194	T	0.03181	4.02	0.158	0.158	0.14942	.	.	.	.	.	T	0.02047	0.0064	N	0.08118	0	0.09310	N	1	B	0.30179	0.271	B	0.33846	0.171	T	0.50759	-0.8790	8	0.17832	T	0.49	0.6067	.	.	.	.	297	Q8NH09	OR8S1_HUMAN	R	297	ENSP00000310632:G297R	ENSP00000310632:G297R	G	+	1	0	OR8S1	47207962	0.705000	0.27846	0.213000	0.23690	0.172000	0.22775	0.228000	0.17814	0.202000	0.20498	0.205000	0.17691	GGG		0.468	OR8S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406881.1		Missense_Mutation	19	45	0	0	0	0.008871	0	19	45				
MCRS1	10445	broad.mit.edu	37	12	49954103	49954103	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:49954103C>G	ENST00000550165.1	-	10	1122	c.856G>C	c.(856-858)Gac>Cac	p.D286H	MCRS1_ENST00000546244.1_Missense_Mutation_p.D95H|MCRS1_ENST00000547182.1_5'UTR|MCRS1_ENST00000343810.4_Missense_Mutation_p.D286H|MCRS1_ENST00000357123.4_Missense_Mutation_p.D299H			Q96EZ8	MCRS1_HUMAN	microspherule protein 1	286					cellular protein modification process (GO:0006464)|chromatin organization (GO:0006325)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.D299H(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)	23						TCAATCAGGTCCTCTGCATCA	0.577																																							uc001ruk.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(856-858)GAC>CAC		microspherule protein 1 isoform 1							291.0	268.0	276.0					12																	49954103		2203	4300	6503	SO:0001583	missense	10445				DNA recombination|DNA repair|protein modification process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|MLL1 complex|nucleolus	protein binding	g.chr12:49954103C>G	BC011794	CCDS8787.1, CCDS31795.1, CCDS61118.1	12q13.12	2011-07-06				ENSG00000187778		"""INO80 complex subunits"""	6960	protein-coding gene	gene with protein product	"""INO80 complex subunit Q"""	609504				9765390, 9654073	Standard	NM_006337		Approved	ICP22BP, MSP58, P78, MCRS2, INO80Q	uc001rui.1	Q96EZ8		ENST00000550165.1:c.856G>C	12.37:g.49954103C>G	ENSP00000448056:p.Asp286His					MCRS1_uc001rui.1_Missense_Mutation_p.D299H|MCRS1_uc001ruj.1_Missense_Mutation_p.D273H|MCRS1_uc001rul.1_Missense_Mutation_p.D286H|MCRS1_uc009zlj.1_Missense_Mutation_p.D95H|MCRS1_uc001rum.1_Missense_Mutation_p.D273H	p.D286H	NM_006337	NP_006328	Q96EZ8	MCRS1_HUMAN			9	1047	-			286					O14742|O75497|Q6VN53|Q7Z372	Missense_Mutation	SNP	ENST00000550165.1	37	c.856G>C	CCDS8787.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416763	0.83449	.	.	ENSG00000187778	ENST00000546244;ENST00000343810;ENST00000550165;ENST00000357123;ENST00000553173	.	.	.	6.06	6.06	0.98353	.	0.094194	0.64402	D	0.000001	T	0.68430	0.3000	M	0.65975	2.015	0.54753	D	0.999982	P;P	0.39003	0.602;0.654	B;P	0.44518	0.283;0.452	T	0.65117	-0.6246	8	.	.	.	-20.499	18.1068	0.89523	0.0:1.0:0.0:0.0	.	286;299	Q96EZ8;Q96EZ8-2	MCRS1_HUMAN;.	H	95;286;286;299;273	.	.	D	-	1	0	MCRS1	48240370	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.372000	0.66156	2.876000	0.98609	0.655000	0.94253	GAC		0.577	MCRS1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405102.1	NM_006337		107	291	0	0	0	0.01441	0	107	291				
NAB2	4665	broad.mit.edu	37	12	57485446	57485446	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:57485446T>C	ENST00000300131.3	+	2	1000	c.622T>C	c.(622-624)Ttc>Ctc	p.F208L	NAB2_ENST00000342556.6_Missense_Mutation_p.F208L|NAB2_ENST00000357680.4_Missense_Mutation_p.F208L|NAB2_ENST00000554718.1_3'UTR	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	208					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.F208L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CTCGCCCCCCTTCTCCCCCCC	0.716																																							uc001smz.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(622-624)TTC>CTC		NGFI-A binding protein 2							12.0	17.0	15.0					12																	57485446		2196	4277	6473	SO:0001583	missense	4665				cell proliferation|negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	transcription corepressor activity	g.chr12:57485446T>C	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.622T>C	12.37:g.57485446T>C	ENSP00000300131:p.Phe208Leu						p.F208L	NM_005967	NP_005958	Q15742	NAB2_HUMAN			2	1000	+			208					B2RAK3|O76006|Q14797	Missense_Mutation	SNP	ENST00000300131.3	37	c.622T>C	CCDS8930.1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.473597	0.26423	.	.	ENSG00000166886	ENST00000300131;ENST00000342556;ENST00000357680	.	.	.	4.15	4.15	0.48705	NAB co-repressor, domain (1);	0.441905	0.22768	N	0.055868	T	0.21801	0.0525	N	0.11427	0.14	0.33270	D	0.560932	P	0.43826	0.818	B	0.41466	0.358	T	0.14392	-1.0474	9	0.10902	T	0.67	-12.462	9.5058	0.39046	0.0:0.0:0.0:1.0	.	208	Q15742	NAB2_HUMAN	L	208	.	ENSP00000300131:F208L	F	+	1	0	NAB2	55771713	0.994000	0.37717	0.852000	0.33557	0.975000	0.68041	0.652000	0.24888	1.732000	0.51606	0.379000	0.24179	TTC		0.716	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967		5	30	0	0	0	0.001984	0	5	30				
ARHGEF25	115557	broad.mit.edu	37	12	58007844	58007844	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:58007844C>T	ENST00000286494.4	+	6	1058	c.598C>T	c.(598-600)Cga>Tga	p.R200*	AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000593846.1_RNA|AC025165.8_ENST00000356672.3_RNA|AC025165.8_ENST00000444467.1_RNA|ARHGEF25_ENST00000333972.7_Nonsense_Mutation_p.R239*	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	200	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R200*(1)|p.R239*(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						CGAGAGTCTTCGAGGCCGTGA	0.567																																							uc001spb.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(598-600)CGA>TGA		RhoA/RAC/CDC42 exchange factor isoform 1							98.0	96.0	96.0					12																	58007844		2203	4300	6503	SO:0001587	stop_gained	115557				regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity	g.chr12:58007844C>T		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.598C>T	12.37:g.58007844C>T	ENSP00000286494:p.Arg200*					GEFT_uc009zpy.2_Nonsense_Mutation_p.R239*|GEFT_uc001soz.1_Nonsense_Mutation_p.R74*|GEFT_uc001spa.2_Nonsense_Mutation_p.R94*|uc001spc.2_Intron|GEFT_uc001spd.2_5'UTR	p.R200*	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN			6	1058	+	Melanoma(17;0.122)		200			DH.		A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Nonsense_Mutation	SNP	ENST00000286494.4	37	c.598C>T	CCDS8947.1	.	.	.	.	.	.	.	.	.	.	c	42	9.307504	0.99132	.	.	ENSG00000240771	ENST00000333972;ENST00000300189;ENST00000286494	.	.	.	4.83	4.83	0.62350	.	0.000000	0.31847	N	0.006968	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9722	0.47446	0.3003:0.6997:0.0:0.0	.	.	.	.	X	239;74;200	.	ENSP00000286494:R200X	R	+	1	2	ARHGEF25	56294111	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.624000	0.46444	2.410000	0.81850	0.563000	0.77884	CGA		0.567	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483		11	101	0	0	0	0.010729	0	11	101				
TPH2	121278	broad.mit.edu	37	12	72335413	72335413	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:72335413G>A	ENST00000333850.3	+	2	296	c.155G>A	c.(154-156)aGc>aAc	p.S52N	TPH2_ENST00000546576.1_3'UTR	NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	52					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.S52N(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	AACAAGGGAAGCAGCAAACGT	0.413																																							uc009zrw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(154-156)AGC>AAC		tryptophan hydroxylase 2	L-Tryptophan(DB00150)						97.0	93.0	94.0					12																	72335413		2203	4300	6503	SO:0001583	missense	121278				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity	g.chr12:72335413G>A	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.155G>A	12.37:g.72335413G>A	ENSP00000329093:p.Ser52Asn					TPH2_uc001swy.2_5'UTR	p.S52N	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN			2	296	+			52					A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	c.155G>A	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	G	6.725	0.502490	0.12822	.	.	ENSG00000139287	ENST00000333850;ENST00000266669	D	0.99466	-5.95	5.82	0.815	0.18763	.	0.589854	0.17994	N	0.155122	D	0.96150	0.8745	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.92853	0.6299	10	0.30078	T	0.28	-2.1418	5.0803	0.14653	0.3819:0.2594:0.3586:0.0	.	52	Q8IWU9	TPH2_HUMAN	N	52	ENSP00000329093:S52N	ENSP00000266669:S52N	S	+	2	0	TPH2	70621680	0.001000	0.12720	0.037000	0.18230	0.731000	0.41821	-0.020000	0.12525	-0.109000	0.12044	0.650000	0.86243	AGC		0.413	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353		13	43	0	0	0	0.001855	0	13	43				
LIN7A	8825	broad.mit.edu	37	12	81239642	81239642	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:81239642C>A	ENST00000552864.1	-	4	552	c.350G>T	c.(349-351)gGc>gTc	p.G117V		NM_004664.2	NP_004655.1	O14910	LIN7A_HUMAN	lin-7 homolog A (C. elegans)	117	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				exocytosis (GO:0006887)|inner ear development (GO:0048839)|neurotransmitter secretion (GO:0007269)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|synaptic vesicle transport (GO:0048489)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	L27 domain binding (GO:0097016)	p.G117V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(2)	15						AAAACCAAGGCCTTCATCAGT	0.458																																							uc001szj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(349-351)GGC>GTC		lin-7 homolog A							65.0	63.0	64.0					12																	81239642		2203	4300	6503	SO:0001583	missense	8825				exocytosis|protein complex assembly|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	L27 domain binding	g.chr12:81239642C>A	AF028826	CCDS9021.1	12q21.31	2014-09-04			ENSG00000111052	ENSG00000111052			17787	protein-coding gene	gene with protein product	"""mammalian LIN-7 1"""	603380				10341223, 17237226	Standard	NM_004664		Approved	MALS-1, TIP-33, LIN-7A, VELI1	uc001szj.1	O14910	OTTHUMG00000170168	ENST00000552864.1:c.350G>T	12.37:g.81239642C>A	ENSP00000447488:p.Gly117Val					LIN7A_uc001szk.1_RNA	p.G117V	NM_004664	NP_004655	O14910	LIN7A_HUMAN			4	543	-			117			PDZ.		A4FTY3|Q147W1|Q6LES3|Q7LDS4	Missense_Mutation	SNP	ENST00000552864.1	37	c.350G>T	CCDS9021.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.30|17.30	3.353707|3.353707	0.61293|0.61293	.|.	.|.	ENSG00000111052|ENSG00000111052	ENST00000552093|ENST00000552864;ENST00000549417	.|T;T	.|0.59224	.|0.28;0.5	5.27|5.27	5.27|5.27	0.74061|0.74061	.|PDZ/DHR/GLGF (4);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83022|0.83022	0.5164|0.5164	M|M	0.93420|0.93420	3.415|3.415	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.87412|0.87412	0.2376|0.2376	5|10	.|0.87932	.|D	.|0	-8.3573|-8.3573	19.2615|19.2615	0.93970|0.93970	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|117	.|O14910	.|LIN7A_HUMAN	S|V	83|117;111	.|ENSP00000447488:G117V;ENSP00000448975:G111V	.|ENSP00000448975:G111V	A|G	-|-	1|2	0|0	LIN7A|LIN7A	79763773|79763773	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.075000|0.075000	0.17131|0.17131	7.776000|7.776000	0.85560|0.85560	2.614000|2.614000	0.88457|0.88457	0.655000|0.655000	0.94253|0.94253	GCC|GGC		0.458	LIN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407760.1			18	64	1	0	3.52763e-06	0.00499	4.34628e-06	18	64				
DDX54	79039	broad.mit.edu	37	12	113600946	113600946	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:113600946C>T	ENST00000306014.5	-	16	2099	c.2072G>A	c.(2071-2073)aGc>aAc	p.S691N	DDX54_ENST00000549271.1_5'Flank|DDX54_ENST00000314045.7_Missense_Mutation_p.S691N	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	691					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)	p.S691N(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCCCCGCTCGCTGTCAAAGTC	0.647																																							uc001tup.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(2071-2073)AGC>AAC		DEAD (Asp-Glu-Ala-Asp) box polypeptide 54							51.0	59.0	56.0					12																	113600946		2203	4300	6503	SO:0001583	missense	79039				estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nucleolus	ATP binding|ATP-dependent RNA helicase activity|estrogen receptor binding|RNA binding|transcription corepressor activity	g.chr12:113600946C>T	AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.2072G>A	12.37:g.113600946C>T	ENSP00000304072:p.Ser691Asn					DDX54_uc001tuq.3_Missense_Mutation_p.S691N	p.S691N	NM_024072	NP_076977	Q8TDD1	DDX54_HUMAN			16	2100	-			691					Q86YT8|Q9BRZ1	Missense_Mutation	SNP	ENST00000306014.5	37	c.2072G>A	CCDS31907.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807537	0.90623	.	.	ENSG00000123064	ENST00000314045;ENST00000306014	T;T	0.10288	2.89;2.89	5.24	5.24	0.73138	.	0.201410	0.52532	D	0.000070	T	0.30634	0.0771	M	0.78801	2.425	0.48901	D	0.999722	D;D	0.62365	0.991;0.985	D;P	0.64237	0.923;0.84	T	0.01805	-1.1270	10	0.28530	T	0.3	.	14.9188	0.70818	0.0:0.8563:0.1437:0.0	.	691;691	Q8TDD1-2;Q8TDD1	.;DDX54_HUMAN	N	691	ENSP00000323858:S691N;ENSP00000304072:S691N	ENSP00000304072:S691N	S	-	2	0	DDX54	112085329	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	4.572000	0.60886	2.456000	0.83038	0.643000	0.83706	AGC		0.647	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405435.1	NM_024072		4	22	0	0	0	0.001168	0	4	22				
PABPC3	5042	broad.mit.edu	37	13	25671157	25671157	+	Missense_Mutation	SNP	C	C	A	rs532491618|rs371971190		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr13:25671157C>A	ENST00000281589.3	+	1	858	c.821C>A	c.(820-822)aCg>aAg	p.T274K		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	274					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.T274K(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GAACGGCAGACGGAACTTAAG	0.393																																							uc001upy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(820-822)ACG>AAG		poly(A) binding protein, cytoplasmic 3							162.0	151.0	155.0					13																	25671157		2203	4300	6503	SO:0001583	missense	5042				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding	g.chr13:25671157C>A	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.821C>A	13.37:g.25671157C>A	ENSP00000281589:p.Thr274Lys						p.T274K	NM_030979	NP_112241	Q9H361	PABP3_HUMAN		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)	1	882	+		Lung SC(185;0.0225)|Breast(139;0.0602)	274					Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	c.821C>A	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	8.580	0.882006	0.17467	.	.	ENSG00000151846	ENST00000281589	T	0.05382	3.45	0.875	0.875	0.19130	.	0.000000	0.48286	U	0.000185	T	0.04998	0.0134	L	0.45137	1.4	0.39258	D	0.964168	B	0.22276	0.067	B	0.15484	0.013	T	0.37731	-0.9693	10	0.20519	T	0.43	.	7.5489	0.27783	0.0:1.0:0.0:0.0	.	274	Q9H361	PABP3_HUMAN	K	274	ENSP00000281589:T274K	ENSP00000281589:T274K	T	+	2	0	PABPC3	24569157	1.000000	0.71417	0.995000	0.50966	0.934000	0.57294	2.723000	0.47277	0.759000	0.33084	0.313000	0.20887	ACG		0.393	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979		37	89	1	0	2.09667e-21	0.003755	3.62264e-21	37	89				
ENOX1	55068	broad.mit.edu	37	13	43930271	43930271	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr13:43930271C>A	ENST00000261488.6	-	8	1184	c.607G>T	c.(607-609)Ggg>Tgg	p.G203W	ENOX1_ENST00000540032.1_Missense_Mutation_p.G16W|ENOX1_ENST00000412891.1_Missense_Mutation_p.G203W	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	203	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)	p.G203W(2)		breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		GTGCTAGACCCTAATCGCATC	0.502																																							uc001uza.3		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)|skin(1)	2						c.(607-609)GGG>TGG		ecto-NOX disulfide-thiol exchanger 1							54.0	50.0	51.0					13																	43930271		2203	4300	6503	SO:0001583	missense	55068				electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity	g.chr13:43930271C>A	EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.607G>T	13.37:g.43930271C>A	ENSP00000261488:p.Gly203Trp					ENOX1_uc001uzb.3_Missense_Mutation_p.G203W|ENOX1_uc001uzc.3_Missense_Mutation_p.G203W|ENOX1_uc001uyz.3_Translation_Start_Site|ENOX1_uc010tfm.1_Missense_Mutation_p.G16W	p.G203W	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)	8	907	-		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)	203			RRM.		A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	ENST00000261488.6	37	c.607G>T	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304336	0.81136	.	.	ENSG00000120658	ENST00000261488;ENST00000412891;ENST00000540032	T;T	0.54866	0.55;0.55	5.43	5.43	0.79202	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.73458	0.3589	M	0.72353	2.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75994	-0.3121	10	0.87932	D	0	4.3859	19.2593	0.93961	0.0:1.0:0.0:0.0	.	16;203	B7Z5K1;Q8TC92	.;ENOX1_HUMAN	W	203;203;16	ENSP00000261488:G203W;ENSP00000415054:G203W	ENSP00000261488:G203W	G	-	1	0	ENOX1	42828271	1.000000	0.71417	0.990000	0.47175	0.990000	0.78478	7.487000	0.81328	2.557000	0.86248	0.655000	0.94253	GGG		0.502	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993		10	33	1	0	0.000673444	0.008291	0.000756329	10	33				
SLITRK1	114798	broad.mit.edu	37	13	84454347	84454347	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr13:84454347G>T	ENST00000377084.2	-	1	2181	c.1296C>A	c.(1294-1296)agC>agA	p.S432R		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	432					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.S432R(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CCAGGTAATTGCTATCCATGT	0.498																																							uc001vlk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(1294-1296)AGC>AGA		slit and trk like 1 protein precursor							156.0	149.0	151.0					13																	84454347		2203	4300	6503	SO:0001583	missense	114798					integral to membrane		g.chr13:84454347G>T	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1296C>A	13.37:g.84454347G>T	ENSP00000366288:p.Ser432Arg						p.S432R	NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	2182	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	432			LRR 9.|Extracellular (Potential).		Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	c.1296C>A	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	9.741	1.164802	0.21538	.	.	ENSG00000178235	ENST00000377084	T	0.57595	0.39	5.07	1.35	0.21983	.	0.110513	0.64402	D	0.000002	T	0.32615	0.0835	N	0.20574	0.59	0.42385	D	0.992502	B	0.21225	0.053	B	0.23275	0.045	T	0.06499	-1.0823	10	0.54805	T	0.06	-16.7779	5.8416	0.18637	0.2798:0.1332:0.587:0.0	.	432	Q96PX8	SLIK1_HUMAN	R	432	ENSP00000366288:S432R	ENSP00000366288:S432R	S	-	3	2	SLITRK1	83352348	0.999000	0.42202	0.998000	0.56505	0.997000	0.91878	0.577000	0.23758	0.011000	0.14865	0.655000	0.94253	AGC		0.498	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		39	112	1	0	3.78316e-11	0.00623	5.36253e-11	39	112				
TMTC4	84899	broad.mit.edu	37	13	101308647	101308647	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr13:101308647C>A	ENST00000376234.3	-	5	760	c.571G>T	c.(571-573)Gca>Tca	p.A191S	TMTC4_ENST00000342624.5_Missense_Mutation_p.A210S|TMTC4_ENST00000328767.5_Missense_Mutation_p.A80S	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	191						integral component of membrane (GO:0016021)		p.A210S(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TCTCTAAATGCTTTACAGTAG	0.418																																							uc001vou.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(571-573)GCA>TCA		transmembrane and tetratricopeptide repeat							93.0	98.0	96.0					13																	101308647		1928	4137	6065	SO:0001583	missense	84899					integral to membrane	binding	g.chr13:101308647C>A		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.571G>T	13.37:g.101308647C>A	ENSP00000365408:p.Ala191Ser					TMTC4_uc001vot.2_Missense_Mutation_p.A210S|TMTC4_uc010tja.1_Missense_Mutation_p.A80S	p.A191S	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN			5	731	-	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		191					A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	ENST00000376234.3	37	c.571G>T	CCDS41904.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.742154	0.30865	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	D;D;T	0.93953	-3.32;-3.32;1.24	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.85952	0.5817	N	0.19112	0.55	0.58432	D	0.999999	B;B;B	0.16166	0.016;0.001;0.004	B;B;B	0.13407	0.007;0.002;0.009	T	0.79945	-0.1589	10	0.02654	T	1	.	15.4946	0.75641	0.1389:0.8611:0.0:0.0	.	80;191;210	B7Z666;Q5T4D3;Q5T4D3-3	.;TMTC4_HUMAN;.	S	191;210;80	ENSP00000365408:A191S;ENSP00000343871:A210S;ENSP00000365409:A80S	ENSP00000365409:A80S	A	-	1	0	TMTC4	100106648	1.000000	0.71417	0.975000	0.42487	0.792000	0.44763	5.574000	0.67424	2.691000	0.91804	0.655000	0.94253	GCA		0.418	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813		20	29	1	0	1.28384e-07	0.012319	1.62286e-07	20	29				
COL4A1	1282	broad.mit.edu	37	13	110817329	110817329	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr13:110817329C>A	ENST00000375820.4	-	46	4151	c.4030G>T	c.(4030-4032)Ggt>Tgt	p.G1344C	COL4A1_ENST00000467182.1_5'Flank	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1344	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.G1344C(1)|p.G987C(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCAGGAGGACCCGGGAGACCT	0.592																																							uc001vqw.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6						c.(4030-4032)GGT>TGT		alpha 1 type IV collagen preproprotein							13.0	15.0	14.0					13																	110817329		2202	4298	6500	SO:0001583	missense	1282				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding	g.chr13:110817329C>A	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.4030G>T	13.37:g.110817329C>A	ENSP00000364979:p.Gly1344Cys					COL4A1_uc010agl.2_Intron	p.G1344C	NM_001845	NP_001836	P02462	CO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)		46	4152	-	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	1344			Triple-helical region.		A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	c.4030G>T	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923979	0.52653	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.93712	-3.27	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.98324	0.9444	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99852	1.1073	10	0.87932	D	0	.	18.6358	0.91378	0.0:1.0:0.0:0.0	.	1344	P02462	CO4A1_HUMAN	C	987;1344;993	ENSP00000364979:G1344C	ENSP00000364973:G987C	G	-	1	0	COL4A1	109615330	1.000000	0.71417	0.066000	0.19879	0.248000	0.25809	7.145000	0.77365	2.391000	0.81399	0.655000	0.94253	GGT		0.592	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3			6	24	1	0	4.096e-09	0.001168	5.46133e-09	6	24				
ADCY4	196883	broad.mit.edu	37	14	24800251	24800251	+	Silent	SNP	G	G	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr14:24800251G>C	ENST00000310677.4	-	7	1016	c.903C>G	c.(901-903)ctC>ctG	p.L301L	ADCY4_ENST00000554068.2_Silent_p.L301L|ADCY4_ENST00000418030.2_Silent_p.L301L|ADCY4_ENST00000558563.1_5'Flank|ADCY4_ENST00000396747.3_Missense_Mutation_p.S37C	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	301					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.L301L(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		ACTTGCCAAAGAGCTCATTGA	0.577																																							uc001wov.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|pancreas(1)	3						c.(901-903)CTC>CTG		adenylate cyclase 4							90.0	69.0	76.0					14																	24800251		2203	4300	6503	SO:0001819	synonymous_variant	196883				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding	g.chr14:24800251G>C	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.903C>G	14.37:g.24800251G>C						ADCY4_uc001wow.2_Silent_p.L301L|ADCY4_uc010toh.1_5'UTR|ADCY4_uc001wox.2_Silent_p.L301L|ADCY4_uc001woy.2_Silent_p.L301L	p.L301L	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN		GBM - Glioblastoma multiforme(265;0.0192)	6	909	-			301			Cytoplasmic (Potential).		B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Silent	SNP	ENST00000310677.4	37	c.903C>G	CCDS9627.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.385697	0.42308	.	.	ENSG00000129467	ENST00000396747	T	0.78816	-1.21	4.44	2.62	0.31277	.	.	.	.	.	T	0.76047	0.3933	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.66131	-0.6000	6	0.56958	D	0.05	.	8.8187	0.35011	0.1867:0.0:0.8133:0.0	.	.	.	.	C	37	ENSP00000379971:S37C	ENSP00000379971:S37C	S	-	2	0	ADCY4	23870091	0.798000	0.28890	1.000000	0.80357	0.926000	0.56050	-0.175000	0.09825	0.619000	0.30197	-0.254000	0.11334	TCT		0.577	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4			16	25	0	0	0	0.004007	0	16	25				
NYNRIN	57523	broad.mit.edu	37	14	24885566	24885566	+	Silent	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr14:24885566G>A	ENST00000382554.3	+	9	4929	c.4611G>A	c.(4609-4611)ccG>ccA	p.P1537P		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1537					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)	p.P1537P(1)|p.P66P(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GGGTAGTCCCGACGCAACTCC	0.547																																							uc001wpf.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(4609-4611)CCG>CCA		hypothetical protein LOC57523							36.0	41.0	39.0					14																	24885566		1943	4163	6106	SO:0001819	synonymous_variant	57523				DNA integration	integral to membrane	DNA binding	g.chr14:24885566G>A	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.4611G>A	14.37:g.24885566G>A							p.P1537P	NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN			9	4929	+			1537					Q6P153|Q86TR3|Q9HAC4	Silent	SNP	ENST00000382554.3	37	c.4611G>A	CCDS45090.1																																																																																				0.547	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1			8	17	0	0	0	0.00308	0	8	17				
VRTN	55237	broad.mit.edu	37	14	74825221	74825221	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr14:74825221G>T	ENST00000256362.4	+	2	1976	c.1735G>T	c.(1735-1737)Gag>Tag	p.E579*		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	579					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)	p.E579*(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						GCAGGAGAAGGAGGCTGGCAG	0.642																																							uc001xpw.3		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(1735-1737)GAG>TAG		hypothetical protein LOC55237							38.0	46.0	44.0					14																	74825221		2203	4300	6503	SO:0001587	stop_gained	55237				transposition, DNA-mediated		DNA binding|transposase activity	g.chr14:74825221G>T	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.1735G>T	14.37:g.74825221G>T	ENSP00000256362:p.Glu579*						p.E579*	NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00147)	2	1926	+			579					Q9NVC7	Nonsense_Mutation	SNP	ENST00000256362.4	37	c.1735G>T	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	G	37	5.994638	0.97184	.	.	ENSG00000133980	ENST00000256362	.	.	.	4.29	4.29	0.51040	.	0.824980	0.10458	U	0.672328	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-5.3931	12.1049	0.53807	0.0:0.0:1.0:0.0	.	.	.	.	X	579	.	ENSP00000256362:E579X	E	+	1	0	VRTN	73894974	.	.	0.133000	0.22050	0.030000	0.12068	.	.	2.211000	0.71520	0.491000	0.48974	GAG		0.642	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228		23	63	1	0	1.17739e-12	0.005443	1.75408e-12	23	63				
DIO2	1734	broad.mit.edu	37	14	80677806	80677807	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr14:80677806_80677807GG>TT	ENST00000557010.1	-	3	394_395	c.9_10CC>AA	c.(7-12)atCCtc>atAAtc	p.L4I	DIO2_ENST00000422005.3_Missense_Mutation_p.L4I|DIO2_ENST00000557125.1_Missense_Mutation_p.L4I|DIO2_ENST00000555750.1_Missense_Mutation_p.L4I|DIO2_ENST00000438257.4_Missense_Mutation_p.L4I|DIO2-AS1_ENST00000553979.1_RNA	NM_000793.5|NM_001242502.1|NM_001242503.1	NP_000784.2|NP_001229431.1|NP_001229432.1	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	4					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)	p.L4I(2)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		TCTACGCTGAGGATGCCCATCT	0.52																																							uc010tvq.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(7-12)ATCCTC>ATAATC		deiodinase, iodothyronine, type II isoform a																																				SO:0001583	missense	1734				hormone biosynthetic process|selenocysteine incorporation|thyroid hormone generation	integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|ubiquitin protein ligase binding	g.chr14:80677806_80677807GG>TT	AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557010.1:c.9_10delinsTT	14.37:g.80677806_80677807delinsTT	ENSP00000451419:p.Leu4Ile					uc001xuw.1_RNA|DIO2_uc010tvp.1_Missense_Mutation_p.L4I|DIO2_uc001xut.2_RNA|DIO2_uc010asx.2_Missense_Mutation_p.L4I|DIO2_uc010tvr.1_Missense_Mutation_p.L4I|DIO2_uc010asy.2_Missense_Mutation_p.L4I	p.L4I	NM_000793	NP_000784	Q92813	IOD2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0281)	2	411_412	-			4					B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Missense_Mutation	DNP	ENST00000557010.1	37	c.9_10CC>AA	CCDS45146.1																																																																																				0.520	DIO2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000413428.2			6	12	0	0	0	0.004672	0	6	12				
OR4M2	390538	broad.mit.edu	37	15	22369024	22369024	+	Missense_Mutation	SNP	G	G	T	rs570771230	byFrequency	TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr15:22369024G>T	ENST00000332663.2	+	1	547	c.449G>T	c.(448-450)aGg>aTg	p.R150M	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R150M(2)		NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTCTCCTGGAGGGGGGGCTTC	0.502																																							uc010tzu.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(448-450)AGG>ATG		olfactory receptor, family 4, subfamily M,							308.0	265.0	280.0					15																	22369024		2203	4300	6503	SO:0001583	missense	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22369024G>T	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.449G>T	15.37:g.22369024G>T	ENSP00000329467:p.Arg150Met					LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.R150M	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	449	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	150			Helical; Name=4; (Potential).		B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	37	c.449G>T	CCDS32172.1	.	.	.	.	.	.	.	.	.	.	.	0.036	-1.305068	0.01353	.	.	ENSG00000182974	ENST00000332663	T	0.36340	1.26	2.5	1.34	0.21922	GPCR, rhodopsin-like superfamily (1);	1.194180	0.05949	N	0.638345	T	0.10852	0.0265	N	0.00566	-1.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18493	-1.0335	10	0.29301	T	0.29	0.3727	3.5572	0.07869	0.0:0.1461:0.2289:0.625	.	150	Q8NGB6	OR4M2_HUMAN	M	150	ENSP00000329467:R150M	ENSP00000329467:R150M	R	+	2	0	OR4M2	19870388	0.000000	0.05858	0.923000	0.36655	0.215000	0.24574	0.156000	0.16382	-0.122000	0.11766	-0.598000	0.04106	AGG		0.502	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			54	493	1	0	4.13886e-29	0.01441	7.36919e-29	54	493				
OR4M2	390538	broad.mit.edu	37	15	22369051	22369051	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr15:22369051A>G	ENST00000332663.2	+	1	574	c.476A>G	c.(475-477)cAg>cGg	p.Q159R	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q159R(1)		NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCTATCATACAGGTGGCTCTC	0.512																																							uc010tzu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(475-477)CAG>CGG		olfactory receptor, family 4, subfamily M,							356.0	296.0	316.0					15																	22369051		2203	4300	6503	SO:0001583	missense	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22369051A>G	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.476A>G	15.37:g.22369051A>G	ENSP00000329467:p.Gln159Arg					LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.Q159R	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	476	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	159			Extracellular (Potential).		B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	37	c.476A>G	CCDS32172.1	.	.	.	.	.	.	.	.	.	.	.	14.92	2.680533	0.47886	.	.	ENSG00000182974	ENST00000332663	T	0.00115	8.71	2.5	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000262	T	0.00468	0.0015	M	0.87269	2.87	0.28167	N	0.92874	D	0.89917	1.0	D	0.79108	0.992	T	0.17228	-1.0376	10	0.87932	D	0	-7.1773	8.5824	0.33637	1.0:0.0:0.0:0.0	.	159	Q8NGB6	OR4M2_HUMAN	R	159	ENSP00000329467:Q159R	ENSP00000329467:Q159R	Q	+	2	0	OR4M2	19870415	0.085000	0.21516	1.000000	0.80357	0.942000	0.58702	2.308000	0.43690	1.167000	0.42706	0.368000	0.22195	CAG		0.512	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			70	517	0	0	0	0.01441	0	70	517				
BAHD1	22893	broad.mit.edu	37	15	40751953	40751953	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr15:40751953C>A	ENST00000416165.1	+	2	1361	c.1290C>A	c.(1288-1290)caC>caA	p.H430Q	BAHD1_ENST00000560846.1_Missense_Mutation_p.H430Q|BAHD1_ENST00000561234.1_Missense_Mutation_p.H430Q	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	430					heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)	p.P431fs*16(1)|p.H430Q(1)		NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CTTTCCAGCACCCTCCCTGGG	0.627																																							uc001zlu.2		NA																	2	Substitution - Missense(1)|Deletion - Frameshift(1)		large_intestine(1)|lung(1)		0						c.(1288-1290)CAC>CAA		bromo adjacent homology domain containing 1							51.0	49.0	50.0					15																	40751953		2203	4300	6503	SO:0001583	missense	22893				heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding	g.chr15:40751953C>A	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.1290C>A	15.37:g.40751953C>A	ENSP00000396976:p.His430Gln					BAHD1_uc001zlt.2_Missense_Mutation_p.H430Q|BAHD1_uc010bbp.1_Missense_Mutation_p.H430Q|BAHD1_uc001zlv.2_Missense_Mutation_p.H430Q	p.H430Q	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)	2	1361	+		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	430					Q8NDF7|Q9Y2F4	Missense_Mutation	SNP	ENST00000416165.1	37	c.1290C>A	CCDS10058.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.171161	0.57584	.	.	ENSG00000140320	ENST00000416165	T	0.56776	0.44	6.08	0.556	0.17253	.	0.229298	0.43260	N	0.000589	T	0.30166	0.0756	L	0.27053	0.805	0.38682	D	0.952554	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.003	T	0.07139	-1.0788	10	0.36615	T	0.2	-20.5999	2.1049	0.03688	0.1105:0.4245:0.2154:0.2496	.	430;430;430	Q8TBE0-3;Q8TBE0;Q8TBE0-2	.;BAHD1_HUMAN;.	Q	430	ENSP00000396976:H430Q	ENSP00000396976:H430Q	H	+	3	2	BAHD1	38539245	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-2.527000	0.00946	0.433000	0.26313	0.655000	0.94253	CAC		0.627	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252248.1	NM_014952		3	50	1	0	0.004672	0.004672	0.00507146	3	50				
HDC	3067	broad.mit.edu	37	15	50546389	50546389	+	Silent	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr15:50546389G>T	ENST00000267845.3	-	6	1060	c.658C>A	c.(658-660)Cga>Aga	p.R220R	HDC_ENST00000543581.1_Silent_p.R220R	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)		p.R220R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		GCTTCCCCTCGGAGTGAGAAG	0.488																																					GBM(95;1627 1936 6910 9570)	GBM(95;1627 1936 6910 9570)	uc001zxz.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6						c.(658-660)CGA>AGA		histidine decarboxylase	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)						67.0	66.0	66.0					15																	50546389		2196	4295	6491	SO:0001819	synonymous_variant	3067				catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity	g.chr15:50546389G>T		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.658C>A	15.37:g.50546389G>T						HDC_uc001zxy.2_5'Flank|HDC_uc010uff.1_Silent_p.R220R|HDC_uc010bet.1_Silent_p.R141R|HDC_uc010beu.1_Silent_p.R220R	p.R220R	NM_002112	NP_002103	P19113	DCHS_HUMAN		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	6	764	-		all_lung(180;0.0138)	220						Silent	SNP	ENST00000267845.3	37	c.658C>A	CCDS10134.1																																																																																				0.488	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1			26	56	1	0	1.55469e-16	0.00333	2.5504e-16	26	56				
DENND4A	10260	broad.mit.edu	37	15	65989642	65989642	+	Silent	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr15:65989642T>C	ENST00000431932.2	-	20	2989	c.2781A>G	c.(2779-2781)caA>caG	p.Q927Q	DENND4A_ENST00000443035.3_Silent_p.Q970Q|snoU13_ENST00000459325.1_RNA	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	927					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.Q970Q(1)|p.Q927Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						CTTTTTCTTCTTGAATGTCTT	0.308																																							uc002aph.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(2779-2781)CAA>CAG		DENN/MADD domain containing 4A isoform 2							121.0	119.0	120.0					15																	65989642		1812	4062	5874	SO:0001819	synonymous_variant	10260				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding	g.chr15:65989642T>C	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.2781A>G	15.37:g.65989642T>C						DENND4A_uc002api.2_Silent_p.Q970Q|DENND4A_uc002apj.3_Silent_p.Q927Q	p.Q927Q	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN			20	3159	-			927			Bipartite nuclear localization signal (Potential).		E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	37	c.2781A>G	CCDS45285.1																																																																																				0.308	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848		48	96	0	0	0	0.01441	0	48	96				
CEMIP	57214	broad.mit.edu	37	15	81201518	81201518	+	Silent	SNP	G	G	A	rs377174220		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr15:81201518G>A	ENST00000394685.3	+	14	2087	c.1668G>A	c.(1666-1668)ccG>ccA	p.P556P	RP11-351M8.1_ENST00000560560.1_Intron|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Silent_p.P556P|KIAA1199_ENST00000356249.5_Silent_p.P556P			Q8WUJ3	CEMIP_HUMAN		556	Necessary for its endoplasmic reticulum (ER) retention and interaction with HSPA5.				hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.P556P(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GTCAGTACCCGATTCACTTCC	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		19806	0.001		0.0	False		,,,				2504	0.0						uc002bfw.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1666-1668)CCG>CCA		KIAA1199 precursor		G		0,4406		0,0,2203	158.0	113.0	128.0		1668	-8.3	0.0	15		128	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KIAA1199	NM_018689.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		556/1362	81201518	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57214							g.chr15:81201518G>A																												ENST00000394685.3:c.1668G>A	15.37:g.81201518G>A						KIAA1199_uc010unn.1_Silent_p.P556P	p.P556P	NM_018689	NP_061159	Q8WUJ3	K1199_HUMAN			13	1928	+			556					Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	37	c.1668G>A	CCDS10315.1																																																																																				0.547	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1			13	63	0	0	0	0.00245	0	13	63				
SLC28A1	9154	broad.mit.edu	37	15	85438235	85438235	+	Silent	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr15:85438235C>A	ENST00000286749.3	+	5	432	c.342C>A	c.(340-342)gtC>gtA	p.V114V	SLC28A1_ENST00000394573.1_Silent_p.V114V|SLC28A1_ENST00000537703.1_Silent_p.V36V|SLC28A1_ENST00000537624.1_Silent_p.V114V|SLC28A1_ENST00000338602.2_Silent_p.V114V|SLC28A1_ENST00000538177.1_Silent_p.V114V|SLC28A1_ENST00000537216.1_Silent_p.V114V			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	114					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)	p.V114V(2)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	CTCTGTTTGTCCTCACCTGTG	0.637																																							uc002blg.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)|ovary(1)	3						c.(340-342)GTC>GTA		solute carrier family 28, member 1 isoform 1							78.0	80.0	79.0					15																	85438235		2203	4299	6502	SO:0001819	synonymous_variant	9154				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding	g.chr15:85438235C>A	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.342C>A	15.37:g.85438235C>A						SLC28A1_uc010upd.1_Silent_p.V36V|SLC28A1_uc010bnb.2_Silent_p.V114V|SLC28A1_uc010upe.1_Silent_p.V114V|SLC28A1_uc010upf.1_Silent_p.V114V|SLC28A1_uc010upg.1_Silent_p.V114V|SLC28A1_uc002blf.2_Silent_p.V114V	p.V114V	NM_004213	NP_004204	O00337	S28A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		6	544	+			114			Helical; (Potential).		A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Silent	SNP	ENST00000286749.3	37	c.342C>A	CCDS10334.1																																																																																				0.637	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2			25	95	1	0	1.64293e-13	0.00333	2.53829e-13	25	95				
ZNF263	10127	broad.mit.edu	37	16	3334041	3334041	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr16:3334041C>T	ENST00000219069.5	+	1	1099	c.223C>T	c.(223-225)Cgc>Tgc	p.R75C	ZNF263_ENST00000574253.1_Missense_Mutation_p.R75C|ZNF263_ENST00000538765.1_Intron|ZNF263_ENST00000573578.1_Missense_Mutation_p.R75C	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	75	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R75C(1)		NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						GCCTGAGATGCGCACGAAGGA	0.622																																							uc002cuq.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(223-225)CGC>TGC		zinc finger protein 263							67.0	70.0	69.0					16																	3334041		2197	4300	6497	SO:0001583	missense	10127				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:3334041C>T	AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.223C>T	16.37:g.3334041C>T	ENSP00000219069:p.Arg75Cys					ZNF263_uc010uww.1_Intron|ZNF263_uc002cup.2_Missense_Mutation_p.R75C	p.R75C	NM_005741	NP_005732	O14978	ZN263_HUMAN			1	555	+			75			SCAN box.		B2R634|O43387|Q96H95	Missense_Mutation	SNP	ENST00000219069.5	37	c.223C>T	CCDS10499.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997596	0.54147	.	.	ENSG00000006194	ENST00000219069	T	0.04654	3.58	5.06	5.06	0.68205	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.362885	0.24150	N	0.041098	T	0.13329	0.0323	L	0.57536	1.79	0.50632	D	0.999881	D;D	0.65815	0.995;0.959	P;B	0.54965	0.765;0.439	T	0.00041	-1.2232	10	0.87932	D	0	.	14.1192	0.65175	0.0:1.0:0.0:0.0	.	75;75	O14978;D3DUC1	ZN263_HUMAN;.	C	75	ENSP00000219069:R75C	ENSP00000219069:R75C	R	+	1	0	ZNF263	3274042	0.191000	0.23288	0.997000	0.53966	0.556000	0.35491	1.220000	0.32491	2.790000	0.95986	0.655000	0.94253	CGC		0.622	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251463.2			4	102	0	0	0	0.000602	0	4	102				
SYT17	51760	broad.mit.edu	37	16	19236108	19236108	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr16:19236108C>G	ENST00000355377.2	+	7	1574	c.1176C>G	c.(1174-1176)ttC>ttG	p.F392L	SYT17_ENST00000562034.1_Missense_Mutation_p.F331L|SYT17_ENST00000568433.1_Missense_Mutation_p.F86L|SYT17_ENST00000568115.1_Missense_Mutation_p.F331L|SYT17_ENST00000562711.2_Missense_Mutation_p.F388L	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII	392	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)	p.F392L(1)		NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						ATGAATCCTTCAGCTTCAAAG	0.448																																							uc002dfw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1174-1176)TTC>TTG		B/K protein							118.0	117.0	118.0					16																	19236108		2197	4300	6497	SO:0001583	missense	51760					membrane|synaptic vesicle	transporter activity	g.chr16:19236108C>G		CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.1176C>G	16.37:g.19236108C>G	ENSP00000347538:p.Phe392Leu					SYT17_uc002dfx.2_Missense_Mutation_p.F331L|SYT17_uc002dfy.2_Missense_Mutation_p.F388L|SYT17_uc002dfv.1_Missense_Mutation_p.F331L	p.F392L	NM_016524	NP_057608	Q9BSW7	SYT17_HUMAN			7	1507	+			392			C2 2.		O43330|Q9NZ18	Missense_Mutation	SNP	ENST00000355377.2	37	c.1176C>G	CCDS10575.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.492336	0.84962	.	.	ENSG00000103528	ENST00000355377	T	0.76060	-0.99	5.05	5.05	0.67936	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000003	T	0.79009	0.4374	L	0.46567	1.45	0.58432	D	0.999999	P;P	0.41366	0.747;0.747	P;P	0.51806	0.68;0.68	T	0.77991	-0.2379	10	0.40728	T	0.16	.	18.405	0.90532	0.0:1.0:0.0:0.0	.	392;331	Q9BSW7;B4DJB2	SYT17_HUMAN;.	L	392	ENSP00000347538:F392L	ENSP00000347538:F392L	F	+	3	2	SYT17	19143609	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.463000	0.45058	2.355000	0.79922	0.561000	0.74099	TTC		0.448	SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254286.2	NM_016524		39	93	0	0	0	0.01441	0	39	93				
ACSM5	54988	broad.mit.edu	37	16	20435240	20435240	+	Missense_Mutation	SNP	G	G	T	rs374421448		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr16:20435240G>T	ENST00000331849.4	+	6	917	c.770G>T	c.(769-771)cGg>cTg	p.R257L		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	257					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.R257L(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						TTTGGCAGACGGTGGGTGGCC	0.483																																							uc002dhe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(769-771)CGG>CTG		acyl-CoA synthetase medium-chain family member 5							192.0	183.0	186.0					16																	20435240		2203	4300	6503	SO:0001583	missense	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20435240G>T		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.770G>T	16.37:g.20435240G>T	ENSP00000327916:p.Arg257Leu						p.R257L	NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN			6	917	+			257					Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	c.770G>T	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	G	7.151	0.583698	0.13749	.	.	ENSG00000183549	ENST00000331849	T	0.41065	1.01	4.56	-5.61	0.02489	AMP-dependent synthetase/ligase (1);	1.264370	0.05660	N	0.586652	T	0.25975	0.0633	N	0.16368	0.405	0.25142	N	0.990491	B	0.02656	0.0	B	0.08055	0.003	T	0.26815	-1.0092	10	0.20046	T	0.44	0.112	14.4033	0.67065	0.8519:0.0:0.1481:0.0	.	257	Q6NUN0	ACSM5_HUMAN	L	257	ENSP00000327916:R257L	ENSP00000327916:R257L	R	+	2	0	ACSM5	20342741	0.011000	0.17503	0.438000	0.26821	0.738000	0.42128	0.191000	0.17076	-1.035000	0.03291	-0.136000	0.14681	CGG		0.483	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		44	160	1	0	4.53413e-08	0.013114	5.91056e-08	44	160				
ZNF423	23090	broad.mit.edu	37	16	49672667	49672667	+	Silent	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr16:49672667C>A	ENST00000561648.1	-	4	449	c.396G>T	c.(394-396)ggG>ggT	p.G132G	ZNF423_ENST00000562520.1_Silent_p.G72G|ZNF423_ENST00000262383.2_Silent_p.G132G|ZNF423_ENST00000563137.2_Silent_p.G72G|ZNF423_ENST00000535559.1_Silent_p.G15G|ZNF423_ENST00000562871.1_Silent_p.G72G|ZNF423_ENST00000567169.1_Silent_p.G15G	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	132					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G132G(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGCCCGTGCCCCCTTCCTCCT	0.607																																							uc002efs.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(394-396)GGG>GGT		zinc finger protein 423							59.0	56.0	57.0					16																	49672667		2198	4300	6498	SO:0001819	synonymous_variant	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49672667C>A	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.396G>T	16.37:g.49672667C>A						ZNF423_uc010vgn.1_Silent_p.G15G	p.G132G	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN			5	694	-		all_cancers(37;0.0155)	132					O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	c.396G>T	CCDS32445.1																																																																																				0.607	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		14	42	1	0	4.3838e-07	0.001855	5.49386e-07	14	42				
TOX3	27324	broad.mit.edu	37	16	52502441	52502441	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr16:52502441C>A	ENST00000219746.9	-	2	417	c.133G>T	c.(133-135)Gcg>Tcg	p.A45S	TOX3_ENST00000407228.3_Missense_Mutation_p.A41S	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	45					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)	p.A45S(1)|p.A41S(1)		NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						GCGAAGAACGCATTGTTCGCC	0.353																																							uc002egw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(133-135)GCG>TCG		TOX high mobility group box family member 3							138.0	140.0	140.0					16																	52502441		1882	4101	5983	SO:0001583	missense	27324				apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity	g.chr16:52502441C>A	U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.133G>T	16.37:g.52502441C>A	ENSP00000219746:p.Ala45Ser					TOX3_uc010vgt.1_Missense_Mutation_p.A41S|TOX3_uc010vgu.1_Missense_Mutation_p.A45S	p.A45S	NM_001080430	NP_001073899	O15405	TOX3_HUMAN			2	304	-			45					B4DRD0|B5MCW4	Missense_Mutation	SNP	ENST00000219746.9	37	c.133G>T	CCDS54009.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.384128	0.42308	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.09073	3.02;3.02	5.87	3.75	0.43078	.	0.121890	0.53938	D	0.000055	T	0.10508	0.0257	L	0.57536	1.79	0.51767	D	0.999937	B;B	0.30851	0.297;0.297	B;B	0.28385	0.089;0.055	T	0.04140	-1.0974	10	0.54805	T	0.06	.	12.3166	0.54960	0.0:0.8545:0.0:0.1455	.	41;45	B4DRD0;O15405	.;TOX3_HUMAN	S	45;41	ENSP00000219746:A45S;ENSP00000385705:A41S	ENSP00000219746:A45S	A	-	1	0	TOX3	51059942	1.000000	0.71417	0.800000	0.32199	0.554000	0.35429	2.540000	0.45727	0.708000	0.31955	0.650000	0.86243	GCG		0.353	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000422534.1	XM_049037		37	83	1	0	4.90274e-10	0.00623	6.65861e-10	37	83				
DUS2	54920	broad.mit.edu	37	16	68109324	68109324	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr16:68109324G>T	ENST00000565263.1	+	14	1493	c.999G>T	c.(997-999)agG>agT	p.R333S	DUS2_ENST00000432752.1_Missense_Mutation_p.R298S|DUS2_ENST00000358896.6_Missense_Mutation_p.R333S|RP11-67A1.2_ENST00000548144.1_RNA	NM_017803.3	NP_060273.1	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2	333					negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)|flavin adenine dinucleotide binding (GO:0050660)|protein kinase inhibitor activity (GO:0004860)|tRNA dihydrouridine synthase activity (GO:0017150)	p.R333S(1)									AGCAGGCCAGGCTCTCAGCCA	0.547																																							uc002evi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(997-999)AGG>AGT		dihydrouridine synthase 2-like, SMM1 homolog							65.0	60.0	61.0					16																	68109324		2198	4300	6498	SO:0001583	missense	54920				tRNA processing	endoplasmic reticulum	double-stranded RNA binding|flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity	g.chr16:68109324G>T		CCDS10859.1, CCDS61970.1	16q22.1	2013-07-23	2013-07-23	2013-07-23	ENSG00000167264	ENSG00000167264			26014	protein-coding gene	gene with protein product	"""SMM1 homolog (S. cerevisiae)"""	609707	"""dihydrouridine synthase 2-like (SMM1, S. cerevisiae)"", ""dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)"", ""dihydrouridine synthase 2-like"""	DUS2L		15994936, 22741570	Standard	NM_017803		Approved	FLJ20399, SMM1	uc002evj.4	Q9NX74	OTTHUMG00000137538	ENST00000565263.1:c.999G>T	16.37:g.68109324G>T	ENSP00000455229:p.Arg333Ser					DUS2L_uc002evj.2_Missense_Mutation_p.R333S|DUS2L_uc010vkk.1_Missense_Mutation_p.R298S|DUS2L_uc010cez.2_Missense_Mutation_p.R246S	p.R333S	NM_017803	NP_060273	Q9NX74	DUS2L_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0131)|Epithelial(162;0.0564)	14	1148	+		Ovarian(137;0.192)	333					A8K3G3|Q4H4D9	Missense_Mutation	SNP	ENST00000565263.1	37	c.999G>T	CCDS10859.1	.	.	.	.	.	.	.	.	.	.	G	0.019	-1.459725	0.01062	.	.	ENSG00000167264	ENST00000358896;ENST00000432752	T;T	0.31247	1.52;1.5	5.44	1.97	0.26223	.	11.078600	0.00166	N	0.000000	T	0.13072	0.0317	N	0.03324	-0.35	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26643	-1.0097	10	0.10111	T	0.7	-15.6116	3.0058	0.06028	0.1703:0.3126:0.3974:0.1197	.	298;333	E7EUN9;Q9NX74	.;DUS2L_HUMAN	S	333;298	ENSP00000351769:R333S;ENSP00000409498:R298S	ENSP00000351769:R333S	R	+	3	2	DUS2L	66666825	0.000000	0.05858	0.020000	0.16555	0.008000	0.06430	-0.571000	0.05889	0.717000	0.32145	0.650000	0.86243	AGG		0.547	DUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268869.2	NM_017803		10	28	1	0	2.17888e-05	0.006214	2.60751e-05	10	28				
ABR	29	broad.mit.edu	37	17	1003898	1003898	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr17:1003898G>C	ENST00000302538.5	-	3	470	c.324C>G	c.(322-324)aaC>aaG	p.N108K	ABR_ENST00000544583.2_Missense_Mutation_p.N62K|ABR_ENST00000574437.1_Missense_Mutation_p.N62K|ABR_ENST00000291107.2_Missense_Mutation_p.N71K	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	108	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N108K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CTTCCAGCTGGTTAATGTAGA	0.582																																					Esophageal Squamous(197;2016 2115 4129 29033 46447)	Esophageal Squamous(197;2016 2115 4129 29033 46447)	uc002fsd.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(322-324)AAC>AAG		active breakpoint cluster region-related							147.0	134.0	138.0					17																	1003898		2203	4300	6503	SO:0001583	missense	29				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr17:1003898G>C	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.324C>G	17.37:g.1003898G>C	ENSP00000303909:p.Asn108Lys					ABR_uc002fse.2_Missense_Mutation_p.N62K|ABR_uc002fsg.2_Missense_Mutation_p.N71K|ABR_uc010cjq.1_Missense_Mutation_p.N120K	p.N108K	NM_021962	NP_068781	Q12979	ABR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)	3	434	-			108			DH.		B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	ENST00000302538.5	37	c.324C>G	CCDS10999.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.589010	0.46110	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107	T;T;T	0.27402	1.67;1.67;1.67	4.27	2.24	0.28232	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.33235	0.0856	N	0.21194	0.64	0.80722	D	1	D;D;B	0.67145	0.976;0.996;0.201	D;D;B	0.75484	0.95;0.986;0.141	T	0.04650	-1.0936	10	0.24483	T	0.36	.	7.635	0.28261	0.2729:0.0:0.7271:0.0	.	62;71;108	B3KW89;Q12979-2;Q12979	.;.;ABR_HUMAN	K	108;62;71	ENSP00000303909:N108K;ENSP00000442048:N62K;ENSP00000291107:N71K	ENSP00000291107:N71K	N	-	3	2	ABR	950648	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.464000	0.53057	0.929000	0.37192	-0.224000	0.12420	AAC		0.582	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4			11	108	0	0	0	0.010729	0	11	108				
GPATCH8	23131	broad.mit.edu	37	17	42483385	42483385	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr17:42483385C>T	ENST00000591680.1	-	7	557	c.527G>A	c.(526-528)cGa>cAa	p.R176Q	GPATCH8_ENST00000434000.1_Missense_Mutation_p.R98Q	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	176							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R176Q(1)		breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		AGAGACATTTCGAGCAAACTC	0.423																																							uc002igw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|kidney(1)|skin(1)	4						c.(526-528)CGA>CAA		G patch domain containing 8							73.0	76.0	75.0					17																	42483385		2203	4300	6503	SO:0001583	missense	23131					intracellular	nucleic acid binding|zinc ion binding	g.chr17:42483385C>T	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.527G>A	17.37:g.42483385C>T	ENSP00000467556:p.Arg176Gln					GPATCH8_uc002igv.1_Missense_Mutation_p.R98Q|GPATCH8_uc010wiz.1_Missense_Mutation_p.R98Q	p.R176Q	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.206)	7	591	-		Prostate(33;0.0181)	176					B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	37	c.527G>A	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.271781	0.80469	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.18960	2.18	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.49847	0.1581	M	0.74467	2.265	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.49418	-0.8942	10	0.66056	D	0.02	-8.2175	19.597	0.95544	0.0:1.0:0.0:0.0	.	176	Q9UKJ3	GPTC8_HUMAN	Q	176;98	ENSP00000395016:R98Q	ENSP00000335486:R176Q	R	-	2	0	GPATCH8	39838911	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.639000	0.89480	0.655000	0.94253	CGA		0.423	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909		4	112	0	0	0	0.009096	0	4	112				
CACNG5	27091	broad.mit.edu	37	17	64876776	64876776	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr17:64876776T>G	ENST00000533854.1	+	4	623	c.386T>G	c.(385-387)aTa>aGa	p.I129R	CACNG5_ENST00000307139.3_Missense_Mutation_p.I129R|CACNG5_ENST00000169565.3_Missense_Mutation_p.I129R			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5	129					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)	p.I129R(2)		NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			CACCGGACGATACTGGCCTTT	0.438																																							uc010wqi.1		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)|skin(1)	2						c.(385-387)ATA>AGA		voltage-dependent calcium channel gamma-5							266.0	227.0	240.0					17																	64876776		2203	4300	6503	SO:0001583	missense	27091				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|postsynaptic density|postsynaptic membrane	voltage-gated calcium channel activity	g.chr17:64876776T>G	AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.386T>G	17.37:g.64876776T>G	ENSP00000436836:p.Ile129Arg					CACNG5_uc002jfr.2_Missense_Mutation_p.I129R|CACNG5_uc010wqj.1_Missense_Mutation_p.I129R	p.I129R	NM_145811	NP_665810	Q9UF02	CCG5_HUMAN	BRCA - Breast invasive adenocarcinoma(6;1.61e-08)		4	623	+			129			Helical; (Potential).		A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Missense_Mutation	SNP	ENST00000533854.1	37	c.386T>G	CCDS11665.1	.	.	.	.	.	.	.	.	.	.	T	15.76	2.928079	0.52759	.	.	ENSG00000075429	ENST00000533854;ENST00000307139;ENST00000169565	D;D;D	0.88277	-2.36;-2.36;-2.36	3.67	3.67	0.42095	.	0.069901	0.56097	D	0.000036	D	0.89656	0.6778	L	0.60845	1.875	0.80722	D	1	P	0.41131	0.739	P	0.51266	0.664	D	0.87102	0.2179	10	0.26408	T	0.33	-12.9822	12.1726	0.54167	0.0:0.0:0.0:1.0	.	129	Q9UF02	CCG5_HUMAN	R	129	ENSP00000436836:I129R;ENSP00000303092:I129R;ENSP00000169565:I129R	ENSP00000169565:I129R	I	+	2	0	CACNG5	62307238	1.000000	0.71417	0.317000	0.25265	0.928000	0.56348	7.602000	0.82796	1.599000	0.50093	0.482000	0.46254	ATA		0.438	CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389882.1	NM_014404, NM_145811		65	153	0	0	0	0.01441	0	65	153				
POTEC	388468	broad.mit.edu	37	18	14542880	14542880	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr18:14542880G>T	ENST00000358970.5	-	1	265	c.266C>A	c.(265-267)tCc>tAc	p.S89Y	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	89								p.S89Y(1)		NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CTTCATAAAGGAGTTGTCATG	0.607																																							uc010dln.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(265-267)TCC>TAC		ANKRD26-like family B, member 2							53.0	58.0	56.0					18																	14542880		692	1591	2283	SO:0001583	missense	388468							g.chr18:14542880G>T	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.266C>A	18.37:g.14542880G>T	ENSP00000351856:p.Ser89Tyr					POTEC_uc010xaj.1_RNA	p.S89Y	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN			1	720	-			89						Missense_Mutation	SNP	ENST00000358970.5	37	c.266C>A	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	G	9.061	0.994452	0.19043	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.37584	1.19	.	.	.	.	.	.	.	.	T	0.46502	0.1396	L	0.46157	1.445	0.09310	N	1	D	0.67145	0.996	D	0.74023	0.982	T	0.27806	-1.0063	7	0.51188	T	0.08	.	.	.	.	.	89	B2RU33	POTEC_HUMAN	Y	89	ENSP00000351856:S89Y	ENSP00000351856:S89Y	S	-	2	0	POTEC	14532880	0.002000	0.14202	0.006000	0.13384	0.006000	0.05464	0.060000	0.14342	0.172000	0.19760	0.175000	0.17021	TCC		0.607	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269		55	285	1	0	6.56871e-35	0.01441	1.21396e-34	55	285				
ANKRD30B	374860	broad.mit.edu	37	18	14784490	14784490	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr18:14784490C>G	ENST00000358984.4	+	14	1808	c.1628C>G	c.(1627-1629)cCa>cGa	p.P543R	ANKRD30B_ENST00000447268.2_Missense_Mutation_p.P543R|ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	543								p.P543R(2)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AAGACTGTTCCAAATAAAGCC	0.303																																							uc010dlo.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(1627-1629)CCA>CGA		ankyrin repeat domain 30B							145.0	109.0	120.0					18																	14784490		692	1588	2280	SO:0001583	missense	374860							g.chr18:14784490C>G	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1628C>G	18.37:g.14784490C>G	ENSP00000351875:p.Pro543Arg					ANKRD30B_uc010xak.1_RNA	p.P543R	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN			14	1808	+			543					B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	c.1628C>G	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	10.21	1.287880	0.23478	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.06371	3.31;3.31	1.47	1.47	0.22746	.	.	.	.	.	T	0.13670	0.0331	L	0.40543	1.245	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.12477	-1.0546	9	0.66056	D	0.02	.	6.3569	0.21406	0.0:1.0:0.0:0.0	.	543	F8WAG3	.	R	543	ENSP00000351875:P543R;ENSP00000399031:P543R	ENSP00000351875:P543R	P	+	2	0	ANKRD30B	14774490	0.004000	0.15560	0.027000	0.17364	0.021000	0.10359	0.561000	0.23515	1.116000	0.41820	0.185000	0.17295	CCA		0.303	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029		12	34	0	0	0	0.013537	0	12	34				
DSG4	147409	broad.mit.edu	37	18	28986162	28986162	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr18:28986162T>A	ENST00000308128.4	+	12	1894	c.1759T>A	c.(1759-1761)Tgt>Agt	p.C587S	RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.C587S|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	587					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.C587S(2)		NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GTTATATGCCTGTGATTGCGA	0.478																																							uc002kwq.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(3)	8						c.(1759-1761)TGT>AGT		desmoglein 4 isoform 2 preproprotein							110.0	106.0	107.0					18																	28986162		2203	4300	6503	SO:0001583	missense	147409				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding	g.chr18:28986162T>A	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.1759T>A	18.37:g.28986162T>A	ENSP00000311859:p.Cys587Ser					DSG4_uc002kwr.2_Missense_Mutation_p.C587S	p.C587S	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		12	1894	+			587			Extracellular (Potential).		A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	37	c.1759T>A	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962710	0.53507	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.61274	0.12;0.12	5.99	5.99	0.97316	Cadherin-like (1);	0.000000	0.37715	N	0.001976	T	0.70885	0.3275	M	0.72118	2.19	0.43036	D	0.994613	P;D	0.61080	0.48;0.989	B;P	0.57911	0.132;0.829	T	0.75175	-0.3410	10	0.87932	D	0	.	14.0124	0.64505	0.0:0.0:0.0:1.0	.	587;587	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	S	587	ENSP00000311859:C587S;ENSP00000352785:C587S	ENSP00000311859:C587S	C	+	1	0	DSG4	27240160	1.000000	0.71417	0.995000	0.50966	0.016000	0.09150	1.381000	0.34362	2.296000	0.77279	0.533000	0.62120	TGT		0.478	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986		25	64	0	0	0	0.003954	0	25	64				
DTNA	1837	broad.mit.edu	37	18	32400802	32400802	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr18:32400802C>A	ENST00000399113.3	+	8	924	c.924C>A	c.(922-924)agC>agA	p.S308R	DTNA_ENST00000269192.7_5'UTR|DTNA_ENST00000348997.5_Missense_Mutation_p.S308R|DTNA_ENST00000601125.1_5'UTR|DTNA_ENST00000444659.1_Missense_Mutation_p.S308R|DTNA_ENST00000598334.1_Missense_Mutation_p.S308R|DTNA_ENST00000283365.9_Missense_Mutation_p.S308R|AC068506.1_ENST00000408482.1_RNA|DTNA_ENST00000599844.1_5'UTR|DTNA_ENST00000269190.7_Missense_Mutation_p.S308R|DTNA_ENST00000598774.1_Missense_Mutation_p.S308R|DTNA_ENST00000591182.1_5'UTR|DTNA_ENST00000597599.1_Missense_Mutation_p.S308R|DTNA_ENST00000554864.3_Missense_Mutation_p.S308R|DTNA_ENST00000399121.5_Missense_Mutation_p.S308R|DTNA_ENST00000315456.6_Missense_Mutation_p.S308R|DTNA_ENST00000269191.6_Missense_Mutation_p.S308R|DTNA_ENST00000595022.1_Missense_Mutation_p.S308R|DTNA_ENST00000556414.3_5'UTR|DTNA_ENST00000399097.3_5'UTR|DTNA_ENST00000597674.1_5'UTR|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000598142.1_Missense_Mutation_p.S308R			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	308					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.S308R(5)		endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						AGTCCCTGAGCTGTGCTTCCA	0.468																																							uc010dmn.1		NA																	5	Substitution - Missense(5)		lung(5)		0						c.(922-924)AGC>AGA		dystrobrevin alpha isoform 1							98.0	84.0	89.0					18																	32400802		2203	4300	6503	SO:0001583	missense	1837				neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding	g.chr18:32400802C>A	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.924C>A	18.37:g.32400802C>A	ENSP00000382064:p.Ser308Arg					DTNA_uc002kxu.2_Missense_Mutation_p.S308R|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Missense_Mutation_p.S308R|DTNA_uc002kxw.2_Missense_Mutation_p.S308R|DTNA_uc002kxx.2_Missense_Mutation_p.S308R|DTNA_uc010dmj.2_Missense_Mutation_p.S308R|DTNA_uc002kxz.2_Missense_Mutation_p.S308R|DTNA_uc002kxy.2_Missense_Mutation_p.S308R|DTNA_uc010dmk.1_RNA|DTNA_uc010dml.2_Missense_Mutation_p.S308R|DTNA_uc002kyb.3_Missense_Mutation_p.S308R|DTNA_uc010dmm.2_Missense_Mutation_p.S308R|DTNA_uc010xby.1_Missense_Mutation_p.S58R|DTNA_uc010dmo.2_Translation_Start_Site|DTNA_uc002kyd.3_Translation_Start_Site|DTNA_uc010xbz.1_Translation_Start_Site|DTNA_uc010xca.1_Translation_Start_Site|DTNA_uc002kye.2_Translation_Start_Site	p.S308R	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN			8	925	+			308					A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	37	c.924C>A	CCDS59311.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528023	0.27299	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000315456;ENST00000556176;ENST00000399114;ENST00000269190;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113	T;T;T;T;T;T;T;T	0.17528	2.37;2.3;2.28;2.29;2.34;2.27;2.28;2.27	5.66	2.88	0.33553	.	0.039077	0.85682	D	0.000000	T	0.21468	0.0517	N	0.25332	0.735	0.80722	D	1	D;D;D;B;B;D;B;B;B;B;P;B	0.76494	0.998;0.998;0.999;0.0;0.081;0.999;0.002;0.048;0.004;0.036;0.899;0.007	D;D;D;B;B;D;B;B;B;B;P;B	0.85130	0.93;0.968;0.997;0.002;0.03;0.981;0.002;0.023;0.013;0.02;0.469;0.03	T	0.03981	-1.0987	10	0.02654	T	1	-18.2773	11.7415	0.51796	0.0:0.805:0.0:0.195	.	58;308;308;308;308;308;308;319;308;308;308;308	B7Z3X3;Q9Y4J8;Q9Y4J8-3;A8K541;F5H5C1;Q9Y4J8-4;E9PEH8;Q59GK7;Q9BS59;Q9Y4J8-2;Q9Y4J8-5;Q9Y4J8-7	.;DTNA_HUMAN;.;.;.;.;.;.;.;.;.;.	R	308	ENSP00000283365:S308R;ENSP00000322519:S308R;ENSP00000269190:S308R;ENSP00000336682:S308R;ENSP00000382072:S308R;ENSP00000405819:S308R;ENSP00000269191:S308R;ENSP00000382064:S308R	ENSP00000269190:S308R	S	+	3	2	DTNA	30654800	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.660000	0.46749	0.857000	0.35407	0.585000	0.79938	AGC		0.468	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390		26	56	1	0	3.6726e-16	0.003954	5.95778e-16	26	56				
MYO5B	4645	broad.mit.edu	37	18	47566513	47566513	+	Splice_Site	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr18:47566513C>A	ENST00000285039.7	-	3	609	c.310G>T	c.(310-312)Ggt>Tgt	p.G104C		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	104	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.G104C(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CCCCACTTACCACAGTAAGTG	0.458																																							uc002leb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|central_nervous_system(1)	5						c.(310-312)GGT>TGT		myosin VB							126.0	124.0	125.0					18																	47566513		1926	4138	6064	SO:0001630	splice_region_variant	4645				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr18:47566513C>A	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.310+1G>T	18.37:g.47566513C>A						MYO5B_uc002lec.1_Missense_Mutation_p.G103C	p.G104C	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN		READ - Rectum adenocarcinoma(32;0.103)	3	598	-			104			Myosin head-like.		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	c.310G>T	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615049	0.87359	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.98437	-4.93	5.94	5.94	0.96194	Myosin head, motor domain (3);	0.105519	0.64402	D	0.000005	D	0.99551	0.9839	H	0.99619	4.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97725	1.0199	9	.	.	.	.	18.9372	0.92590	0.0:1.0:0.0:0.0	.	103;104	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	C	104;103	ENSP00000285039:G104C	.	G	-	1	0	MYO5B	45820511	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.776000	0.85560	2.816000	0.96949	0.561000	0.74099	GGT		0.458	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		Missense_Mutation	55	95	1	0	1.54043e-34	0.01441	2.82897e-34	55	95				
CPLX4	339302	broad.mit.edu	37	18	56963966	56963966	+	Silent	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr18:56963966G>T	ENST00000299721.3	-	3	633	c.447C>A	c.(445-447)atC>atA	p.I149I	CPLX4_ENST00000587244.1_Intron	NM_181654.3	NP_857637.1	Q7Z7G2	CPLX4_HUMAN	complexin 4	149					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter secretion (GO:0046928)	cell junction (GO:0030054)|membrane (GO:0016020)|synapse (GO:0045202)		p.I149I(1)		autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	16		Colorectal(73;0.175)				CTGTCTGCTTGATTTCAGTGA	0.498																																							uc002lhy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(445-447)ATC>ATA		complexin 4 precursor							101.0	93.0	95.0					18																	56963966		2203	4300	6503	SO:0001819	synonymous_variant	339302				exocytosis|neurotransmitter transport	cell junction|synapse	syntaxin binding	g.chr18:56963966G>T	AY286502	CCDS11973.1	18q21.32	2005-08-02			ENSG00000166569	ENSG00000166569			24330	protein-coding gene	gene with protein product		609586				15911881	Standard	NM_181654		Approved	CPX-IV	uc002lhy.3	Q7Z7G2	OTTHUMG00000132756	ENST00000299721.3:c.447C>A	18.37:g.56963966G>T							p.I149I	NM_181654	NP_857637	Q7Z7G2	CPLX4_HUMAN			3	634	-		Colorectal(73;0.175)	149					F1T0L6	Silent	SNP	ENST00000299721.3	37	c.447C>A	CCDS11973.1																																																																																				0.498	CPLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256127.1	NM_181654		13	44	1	0	1.5739e-10	0.004007	2.17809e-10	13	44				
SERPINB4	6318	broad.mit.edu	37	18	61310721	61310721	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr18:61310721G>T	ENST00000341074.5	-	2	206	c.91C>A	c.(91-93)Cct>Act	p.P31T	SERPINB4_ENST00000356424.6_Missense_Mutation_p.P31T	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	31					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.P31T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						ATGCTGATAGGGGAATAGAAG	0.423																																							uc002ljf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)	3						c.(91-93)CCT>ACT		serine (or cysteine) proteinase inhibitor, clade							237.0	207.0	217.0					18																	61310721		2203	4298	6501	SO:0001583	missense	6318				immune response|regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity	g.chr18:61310721G>T	X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.91C>A	18.37:g.61310721G>T	ENSP00000343445:p.Pro31Thr					SERPINB4_uc002lje.2_Missense_Mutation_p.P31T|SERPINB4_uc002ljg.2_Intron	p.P31T	NM_002974	NP_002965	P48594	SPB4_HUMAN			2	177	-			31					A8K847	Missense_Mutation	SNP	ENST00000341074.5	37	c.91C>A	CCDS11986.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.958203	0.73902	.	.	ENSG00000206073	ENST00000341074;ENST00000356424;ENST00000436264	D;D;D	0.97209	-4.29;-4.29;-4.29	3.76	3.76	0.43208	Serpin domain (3);	0.000000	0.39475	N	0.001354	D	0.99187	0.9718	H	0.99516	4.605	0.43673	D	0.996101	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98336	1.0536	10	0.87932	D	0	.	15.1599	0.72775	0.0:0.0:1.0:0.0	.	31;31	P48594;Q9BYF7	SPB4_HUMAN;.	T	31	ENSP00000343445:P31T;ENSP00000348795:P31T;ENSP00000399796:P31T	ENSP00000343445:P31T	P	-	1	0	SERPINB4	59461701	1.000000	0.71417	0.128000	0.21923	0.305000	0.27757	5.377000	0.66184	2.092000	0.63282	0.508000	0.49915	CCT		0.423	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2	NM_175041		41	107	1	0	2.2871e-25	0.007835	4.04747e-25	41	107				
STK11	6794	broad.mit.edu	37	19	1220640	1220640	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:1220640C>T	ENST00000326873.7	+	5	1831	c.658C>T	c.(658-660)Cag>Tag	p.Q220*		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	220	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.Q220*(4)|p.?(2)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGGCTTTCCAGCCGCCCGA	0.711		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		26	Whole gene deletion(20)|Substitution - Nonsense(4)|Unknown(2)	p.0?(19)|p.Q220*(3)|p.?(2)	cervix(14)|lung(8)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CM991157	STK11	M		c.(658-660)CAG>TAG		serine/threonine protein kinase 11							13.0	18.0	17.0					19																	1220640		1947	4128	6075	SO:0001587	stop_gained	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220640C>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.658C>T	19.37:g.1220640C>T	ENSP00000324856:p.Gln220*	TSP Lung(3;<1E-08)					p.Q220*	NM_000455	NP_000446	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1773	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	220			Protein kinase.		B2RBX7|E7EW76	Nonsense_Mutation	SNP	ENST00000326873.7	37	c.658C>T	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	C	48	14.216541	0.99785	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-51.9112	18.5988	0.91240	0.0:1.0:0.0:0.0	.	.	.	.	X	220	.	ENSP00000324856:Q220X	Q	+	1	0	STK11	1171640	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	7.712000	0.84684	2.644000	0.89710	0.561000	0.74099	CAG		0.711	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455		13	10	0	0	0	0.001855	0	13	10				
MUC16	94025	broad.mit.edu	37	19	9091467	9091467	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:9091467G>T	ENST00000397910.4	-	1	551	c.348C>A	c.(346-348)aaC>aaA	p.N116K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	116	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.N116K(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TAGCAGGGTAGTTCCTAGAGG	0.502																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(346-348)AAC>AAA		mucin 16							122.0	120.0	120.0					19																	9091467		1964	4155	6119	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9091467G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.348C>A	19.37:g.9091467G>T	ENSP00000381008:p.Asn116Lys						p.N116K	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			1	552	-			116			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.348C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.352	-0.348739	0.05208	.	.	ENSG00000181143	ENST00000397910	T	0.02446	4.29	0.907	0.907	0.19321	.	.	.	.	.	T	0.01592	0.0051	N	0.08118	0	.	.	.	D	0.55172	0.97	B	0.40444	0.329	T	0.47484	-0.9114	8	0.87932	D	0	.	5.1325	0.14917	0.0:0.0:1.0:0.0	.	116	B5ME49	.	K	116	ENSP00000381008:N116K	ENSP00000381008:N116K	N	-	3	2	MUC16	8952467	0.003000	0.15002	0.006000	0.13384	0.013000	0.08279	0.100000	0.15231	0.799000	0.34018	0.313000	0.20887	AAC		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		73	54	1	0	3.12118e-38	0.01441	5.805e-38	73	54				
KEAP1	9817	broad.mit.edu	37	19	10610246	10610246	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:10610246A>G	ENST00000171111.5	-	2	1011	c.464T>C	c.(463-465)gTc>gCc	p.V155A	KEAP1_ENST00000393623.2_Missense_Mutation_p.V155A|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	155					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.V155A(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	ACCGTTCATGACGTGGAGGAC	0.587																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(463-465)GTC>GCC		kelch-like ECH-associated protein 1							185.0	145.0	159.0					19																	10610246		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10610246A>G	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.464T>C	19.37:g.10610246A>G	ENSP00000171111:p.Val155Ala					KEAP1_uc002mor.1_Missense_Mutation_p.V155A	p.V155A	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		2	620	-			155					B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.464T>C	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.939271	0.73557	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.72725	-0.68;-0.68	4.81	4.81	0.61882	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.060118	0.64402	D	0.000003	T	0.81992	0.4940	M	0.88241	2.94	0.51767	D	0.999933	D	0.61697	0.99	P	0.54759	0.76	D	0.85787	0.1365	10	0.87932	D	0	.	12.3271	0.55018	1.0:0.0:0.0:0.0	.	155	Q14145	KEAP1_HUMAN	A	155	ENSP00000171111:V155A;ENSP00000377245:V155A	ENSP00000171111:V155A	V	-	2	0	KEAP1	10471246	1.000000	0.71417	0.999000	0.59377	0.411000	0.31082	7.288000	0.78691	1.811000	0.52892	0.459000	0.35465	GTC		0.587	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		37	22	0	0	0	0.004289	0	37	22				
SLC25A42	284439	broad.mit.edu	37	19	19215725	19215725	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:19215725C>T	ENST00000318596.7	+	4	342	c.191C>T	c.(190-192)tCt>tTt	p.S64F	SLC25A42_ENST00000600275.1_Intron	NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	64					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)	p.S64F(1)		cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			TTTCCAGTGTCTTCAAAAAGA	0.557																																							uc002nlf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(190-192)TCT>TTT		solute carrier family 25, member 42							110.0	97.0	101.0					19																	19215725		2203	4300	6503	SO:0001583	missense	284439				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding	g.chr19:19215725C>T		CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.191C>T	19.37:g.19215725C>T	ENSP00000326693:p.Ser64Phe					SLC25A42_uc010xqn.1_Missense_Mutation_p.S116F	p.S64F	NM_178526	NP_848621	Q86VD7	S2542_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)		4	342	+			64			Solcar 1.		D2T2J5|O14553|O43378	Missense_Mutation	SNP	ENST00000318596.7	37	c.191C>T	CCDS32966.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235311	0.79800	.	.	ENSG00000181035	ENST00000318596	T	0.79247	-1.25	4.16	4.16	0.48862	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.88100	0.6346	M	0.83312	2.635	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.77557	0.968;0.99	D	0.89327	0.3644	10	0.49607	T	0.09	-4.6993	15.4633	0.75377	0.0:1.0:0.0:0.0	.	116;64	B7Z8R5;Q86VD7	.;S2542_HUMAN	F	64	ENSP00000326693:S64F	ENSP00000326693:S64F	S	+	2	0	SLC25A42	19076725	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.461000	0.73522	1.883000	0.54544	0.462000	0.41574	TCT		0.557	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465931.1	NM_178526		12	11	0	0	0	0.00245	0	12	11				
CHST8	64377	broad.mit.edu	37	19	34263296	34263296	+	Silent	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:34263296C>A	ENST00000262622.4	+	4	1361	c.603C>A	c.(601-603)ggC>ggA	p.G201G	CHST8_ENST00000434302.1_Silent_p.G201G|CHST8_ENST00000438847.3_Silent_p.G201G	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	201					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)	p.G201G(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					CCAAGGCCGGCTGCTCCAATT	0.687																																							uc002nus.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(601-603)GGC>GGA		carbohydrate (N-acetylgalactosamine 4-0)							41.0	42.0	41.0					19																	34263296		2200	4298	6498	SO:0001819	synonymous_variant	64377				carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity	g.chr19:34263296C>A	AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.603C>A	19.37:g.34263296C>A						CHST8_uc002nut.3_Silent_p.G201G|CHST8_uc002nuu.2_Silent_p.G201G	p.G201G	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN			5	1108	+	Esophageal squamous(110;0.162)		201			PAPS (By similarity).|Lumenal (Potential).		Q9H3N2	Silent	SNP	ENST00000262622.4	37	c.603C>A	CCDS12433.1																																																																																				0.687	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451453.1	NM_022467		6	94	1	0	5.18039e-06	0.00308	6.35577e-06	6	94				
GAPDHS	26330	broad.mit.edu	37	19	36034719	36034719	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:36034719C>A	ENST00000222286.4	+	9	1162	c.1046C>A	c.(1045-1047)aCc>aAc	p.T349N	TMEM147_ENST00000392204.2_5'Flank|AD000090.2_ENST00000590125.1_RNA|AD000090.2_ENST00000444728.1_RNA|AD000090.2_ENST00000590717.1_RNA|AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000588286.1_RNA|TMEM147_ENST00000392205.1_5'Flank|TMEM147_ENST00000222284.5_5'Flank	NM_014364.4	NP_055179.1	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase, spermatogenic	349					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	cytosol (GO:0005829)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|NAD binding (GO:0051287)|NADP binding (GO:0050661)	p.T349N(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(8)	11	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CTTGCCTACACCGAGGATGAG	0.622																																							uc002oaf.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1045-1047)ACC>AAC		glyceraldehyde-3-phosphate dehydrogenase,	NADH(DB00157)						20.0	20.0	20.0					19																	36034719		2203	4300	6503	SO:0001583	missense	26330				gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding	g.chr19:36034719C>A	AJ005371	CCDS12465.1	19q13.1	2008-02-05		2005-05-06		ENSG00000105679			24864	protein-coding gene	gene with protein product		609169		GAPDS		10714828	Standard	NM_014364		Approved	GAPDH-2, GAPD2	uc002oaf.1	O14556		ENST00000222286.4:c.1046C>A	19.37:g.36034719C>A	ENSP00000222286:p.Thr349Asn					uc010eec.1_RNA|uc002oag.2_Intron|TMEM147_uc002oai.1_5'Flank|TMEM147_uc002oaj.1_5'Flank|TMEM147_uc002oak.1_5'Flank	p.T349N	NM_014364	NP_055179	O14556	G3PT_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		9	1162	+	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		349					B2RC82|O60823|Q6JTT9|Q9HCU6	Missense_Mutation	SNP	ENST00000222286.4	37	c.1046C>A	CCDS12465.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097875	0.76870	.	.	ENSG00000105679	ENST00000222286	T	0.50277	0.75	5.23	4.18	0.49190	Glyceraldehyde 3-phosphate dehydrogenase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70587	0.3241	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76313	-0.3005	10	0.87932	D	0	-23.696	13.2797	0.60208	0.1599:0.8401:0.0:0.0	.	349	O14556	G3PT_HUMAN	N	349	ENSP00000222286:T349N	ENSP00000222286:T349N	T	+	2	0	GAPDHS	40726559	1.000000	0.71417	0.793000	0.32043	0.935000	0.57460	7.722000	0.84778	1.317000	0.45149	0.485000	0.47835	ACC		0.622	GAPDHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460423.1	NM_014364		18	16	1	0	5.3912e-06	0.006122	6.58674e-06	18	16				
NFKBID	84807	broad.mit.edu	37	19	36387872	36387872	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:36387872G>A	ENST00000396901.1	-	5	668	c.95C>T	c.(94-96)gCt>gTt	p.A32V	NFKBID_ENST00000585544.1_5'Flank|NFKBID_ENST00000606253.1_Missense_Mutation_p.A32V|NFKBID_ENST00000352614.2_Missense_Mutation_p.A184V	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta	32					inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)		p.A32V(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						CAGCATGTGAGCTCGGGCCAC	0.622																																							uc002oci.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(94-96)GCT>GTT		nuclear factor of kappa light polypeptide gene							47.0	52.0	51.0					19																	36387872		1950	4145	6095	SO:0001583	missense	84807				inflammatory response	nucleus		g.chr19:36387872G>A	AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.95C>T	19.37:g.36387872G>A	ENSP00000380109:p.Ala32Val					NFKBID_uc002och.1_5'Flank|NFKBID_uc002ocj.1_Missense_Mutation_p.A47V	p.A32V	NM_139239	NP_640332	Q8NI38	IKBD_HUMAN			5	669	-			32					Q8NI39|Q9BRG9	Missense_Mutation	SNP	ENST00000396901.1	37	c.95C>T	CCDS42552.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613440	0.46631	.	.	ENSG00000167604	ENST00000352614;ENST00000396901	T;T	0.57436	0.4;1.13	5.18	4.15	0.48705	.	0.348745	0.30565	N	0.009360	T	0.35624	0.0938	N	0.17082	0.46	0.80722	D	1	B;B	0.13594	0.008;0.001	B;B	0.12156	0.007;0.002	T	0.11767	-1.0574	10	0.37606	T	0.19	.	11.5441	0.50683	0.0884:0.0:0.9116:0.0	.	184;32	Q8NI38-2;Q8NI38	.;IKBD_HUMAN	V	184;32	ENSP00000252985:A184V;ENSP00000380109:A32V	ENSP00000252985:A184V	A	-	2	0	NFKBID	41079712	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.321000	0.51999	1.197000	0.43143	0.491000	0.48974	GCT		0.622	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452927.3	NM_032721		24	86	0	0	0	0.014323	0	24	86				
FCGBP	8857	broad.mit.edu	37	19	40433188	40433188	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:40433188C>T	ENST00000221347.6	-	2	1088	c.1081G>A	c.(1081-1083)Gtg>Atg	p.V361M		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	361	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)		p.V361M(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GTCTGTGCCACTACCAGGGCC	0.607																																							uc002omp.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(4)|central_nervous_system(1)	9						c.(1081-1083)GTG>ATG		Fc fragment of IgG binding protein precursor							98.0	74.0	82.0					19																	40433188		2203	4300	6503	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40433188C>T	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.1081G>A	19.37:g.40433188C>T	ENSP00000221347:p.Val361Met						p.V361M	NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		2	1089	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		361			IgGFc-binding.		O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.1081G>A	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.933055	0.52866	.	.	ENSG00000090920	ENST00000221347	T	0.21031	2.03	4.36	2.23	0.28157	.	0.196964	0.30193	N	0.010189	T	0.11410	0.0278	L	0.29908	0.895	0.23381	N	0.997796	P	0.43287	0.802	B	0.31614	0.133	T	0.18147	-1.0346	10	0.72032	D	0.01	.	8.2783	0.31885	0.0:0.7335:0.0:0.2665	.	361	Q9Y6R7	FCGBP_HUMAN	M	361	ENSP00000221347:V361M	ENSP00000221347:V361M	V	-	1	0	FCGBP	45125028	0.002000	0.14202	0.701000	0.30321	0.772000	0.43724	-0.046000	0.11983	0.778000	0.33520	0.655000	0.94253	GTG		0.607	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		9	46	0	0	0	0.006214	0	9	46				
SNRPA	6626	broad.mit.edu	37	19	41263354	41263354	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:41263354G>T	ENST00000243563.3	+	2	741	c.191G>T	c.(190-192)aGc>aTc	p.S64I	SNRPA_ENST00000599570.1_3'UTR	NM_004596.4	NP_004587.1	P09012	SNRPA_HUMAN	small nuclear ribonucleoprotein polypeptide A	64	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snRNA binding (GO:0017069)	p.S64I(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GAGGTCAGCAGCGCCACCAAC	0.542																																							uc002ooz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)|central_nervous_system(1)	4						c.(190-192)AGC>ATC		small nuclear ribonucleoprotein polypeptide A							88.0	82.0	84.0					19																	41263354		2203	4300	6503	SO:0001583	missense	6626					nucleoplasm|spliceosomal complex	nucleotide binding|protein binding|RNA binding	g.chr19:41263354G>T	X06347	CCDS12565.1	19q13.1	2013-02-12				ENSG00000077312		"""RNA binding motif (RRM) containing"""	11151	protein-coding gene	gene with protein product		182285				1701111	Standard	NM_004596		Approved	U1A, U1-A, Mud1	uc002ooz.3	P09012		ENST00000243563.3:c.191G>T	19.37:g.41263354G>T	ENSP00000243563:p.Ser64Ile					SNRPA_uc002opa.2_Missense_Mutation_p.S14I	p.S64I	NM_004596	NP_004587	P09012	SNRPA_HUMAN	LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		2	726	+			64			RRM 1.			Missense_Mutation	SNP	ENST00000243563.3	37	c.191G>T	CCDS12565.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998082	0.74818	.	.	ENSG00000077312	ENST00000243563	T	0.18657	2.2	5.82	4.79	0.61399	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.039240	0.85682	D	0.000000	T	0.40171	0.1106	M	0.84219	2.685	0.53688	D	0.999975	B	0.19706	0.038	B	0.43360	0.417	T	0.40942	-0.9536	10	0.66056	D	0.02	-37.2283	9.3314	0.38023	0.0772:0.1454:0.7774:0.0	.	64	P09012	SNRPA_HUMAN	I	64	ENSP00000243563:S64I	ENSP00000243563:S64I	S	+	2	0	SNRPA	45955194	1.000000	0.71417	0.988000	0.46212	0.887000	0.51463	7.797000	0.85911	1.462000	0.47948	0.655000	0.94253	AGC		0.542	SNRPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463118.2	NM_004596		41	46	1	0	6.1207e-33	0.013114	1.11009e-32	41	46				
SMG9	56006	broad.mit.edu	37	19	44251904	44251904	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:44251904G>A	ENST00000270066.6	-	4	713	c.371C>T	c.(370-372)cCa>cTa	p.P124L	SMG9_ENST00000601170.1_Missense_Mutation_p.P124L	NM_019108.2	NP_061981.2	Q9H0W8	SMG9_HUMAN	SMG9 nonsense mediated mRNA decay factor	124	Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|intracellular (GO:0005622)	identical protein binding (GO:0042802)	p.P124L(1)		kidney(1)|large_intestine(5)|liver(1)|lung(7)|pancreas(1)|prostate(2)|urinary_tract(2)	19						AGGGGGTGGTGGGGCGGTGCC	0.682																																							uc002oxj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(370-372)CCA>CTA		SMG9 protein							17.0	20.0	19.0					19																	44251904		2195	4296	6491	SO:0001583	missense	56006				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	intracellular	protein binding	g.chr19:44251904G>A	BC008869	CCDS33043.2	19q13.31	2013-07-02	2013-07-02	2011-06-21	ENSG00000105771	ENSG00000105771			25763	protein-coding gene	gene with protein product		613176	"""chromosome 19 open reading frame 61"", ""smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C19orf61		11230166, 19417104	Standard	NM_019108		Approved	FLJ12886	uc002oxj.2	Q9H0W8	OTTHUMG00000150337	ENST00000270066.6:c.371C>T	19.37:g.44251904G>A	ENSP00000270066:p.Pro124Leu					C19orf61_uc002oxk.2_Missense_Mutation_p.P124L|C19orf61_uc010eiy.1_Missense_Mutation_p.P124L	p.P124L	NM_019108	NP_061981	Q9H0W8	SMG9_HUMAN			4	714	-		Prostate(69;0.0352)	124			Pro-rich.		O60429|Q9H9A9	Missense_Mutation	SNP	ENST00000270066.6	37	c.371C>T	CCDS33043.2	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689346	0.68271	.	.	ENSG00000105771	ENST00000270066	.	.	.	5.3	5.3	0.74995	.	0.209725	0.40222	N	0.001152	T	0.44095	0.1277	N	0.19112	0.55	0.58432	D	0.999998	P;P	0.44139	0.827;0.734	B;B	0.44044	0.439;0.185	T	0.40384	-0.9566	9	0.40728	T	0.16	0.6015	16.4556	0.84011	0.0:0.0:1.0:0.0	.	124;124	Q9H0W8-2;Q9H0W8	.;SMG9_HUMAN	L	124	.	ENSP00000270066:P124L	P	-	2	0	SMG9	48943744	1.000000	0.71417	0.730000	0.30809	0.994000	0.84299	5.134000	0.64770	2.499000	0.84300	0.655000	0.94253	CCA		0.682	SMG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317668.1	NM_019108		28	16	0	0	0	0.00632	0	28	16				
LRRC4B	94030	broad.mit.edu	37	19	51021872	51021872	+	Missense_Mutation	SNP	G	G	C	rs550149281		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:51021872G>C	ENST00000599957.1	-	3	1295	c.1098C>G	c.(1096-1098)atC>atG	p.I366M	LRRC4B_ENST00000389201.3_Missense_Mutation_p.I366M			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	366	Ig-like C2-type.				positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.I366M(1)|p.I366I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GCGGCTCCACGATGACGGGCG	0.667																																							uc002pss.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		large_intestine(1)|lung(1)	central_nervous_system(1)|skin(1)	2						c.(1096-1098)ATC>ATG		leucine rich repeat containing 4B precursor							49.0	55.0	53.0					19																	51021872		2110	4233	6343	SO:0001583	missense	94030					cell junction|integral to membrane|presynaptic membrane		g.chr19:51021872G>C	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1098C>G	19.37:g.51021872G>C	ENSP00000471502:p.Ile366Met						p.I366M	NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)	3	1235	-		all_neural(266;0.131)	366			Extracellular (Potential).|Ig-like C2-type.		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	c.1098C>G	CCDS42595.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.403871	0.42613	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	T	0.70749	-0.51	3.9	1.75	0.24633	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.80849	0.4702	M	0.84948	2.725	0.43292	D	0.995276	D	0.89917	1.0	D	0.83275	0.996	T	0.77365	-0.2615	10	0.72032	D	0.01	.	3.4573	0.07521	0.2177:0.0:0.5822:0.2	.	366	Q9NT99	LRC4B_HUMAN	M	366	ENSP00000373853:I366M	ENSP00000373853:I366M	I	-	3	3	LRRC4B	55713684	0.969000	0.33509	1.000000	0.80357	0.970000	0.65996	0.098000	0.15189	0.443000	0.26582	-0.258000	0.10820	ATC		0.667	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457		7	30	0	0	0	0.00308	0	7	30				
SIGLEC9	27180	broad.mit.edu	37	19	51630545	51630545	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:51630545C>A	ENST00000250360.3	+	4	1074	c.1007C>A	c.(1006-1008)tCc>tAc	p.S336Y	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.S336Y	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	336	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.S336Y(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CTGAACGTCTCCCTGCAGAGT	0.597																																							uc002pvu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1006-1008)TCC>TAC		sialic acid binding Ig-like lectin 9 precursor							21.0	20.0	20.0					19																	51630545		2203	4300	6503	SO:0001583	missense	27180				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding	g.chr19:51630545C>A	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1007C>A	19.37:g.51630545C>A	ENSP00000250360:p.Ser336Tyr					SIGLEC9_uc010yct.1_Missense_Mutation_p.S336Y	p.S336Y	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)	4	1074	+		all_neural(266;0.0529)	336			Extracellular (Potential).|Ig-like C2-type 2.		Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	c.1007C>A	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	13.06	2.123300	0.37436	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.15487	2.42;2.42	2.19	1.12	0.20585	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.759984	0.10857	N	0.626535	T	0.44829	0.1312	M	0.93854	3.465	0.09310	N	1	D	0.63880	0.993	D	0.68943	0.961	T	0.19451	-1.0305	10	0.51188	T	0.08	.	4.5562	0.12138	0.0:0.7965:0.0:0.2035	.	336	Q9Y336	SIGL9_HUMAN	Y	336	ENSP00000413861:S336Y;ENSP00000250360:S336Y	ENSP00000250360:S336Y	S	+	2	0	SIGLEC9	56322357	0.000000	0.05858	0.011000	0.14972	0.259000	0.26198	-1.211000	0.02997	0.139000	0.18822	0.400000	0.26472	TCC		0.597	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441		4	9	1	0	0.00909568	0.009096	0.00972871	4	9				
LILRA2	11027	broad.mit.edu	37	19	55086241	55086241	+	Silent	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:55086241G>A	ENST00000251377.3	+	5	529	c.396G>A	c.(394-396)gtG>gtA	p.V132V	LILRA2_ENST00000495786.1_3'UTR|LILRA2_ENST00000391738.3_Silent_p.V132V|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391737.1_Silent_p.V120V|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000251376.3_Silent_p.V132V			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	132	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.V132V(2)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CCAGCCCTGTGGTGACCTTAG	0.562																																							uc002qgg.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(394-396)GTG>GTA		leukocyte immunoglobulin-like receptor,							143.0	133.0	136.0					19																	55086241		2203	4300	6503	SO:0001819	synonymous_variant	11027				defense response	integral to membrane	antigen binding|receptor activity	g.chr19:55086241G>A	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.396G>A	19.37:g.55086241G>A						LILRA2_uc010ern.2_Silent_p.V132V|LILRA2_uc002qgf.2_Silent_p.V132V|LILRA2_uc010yfe.1_Silent_p.V132V|LILRA2_uc010yff.1_Silent_p.V120V|LILRA2_uc010ero.2_Silent_p.V120V|LILRA2_uc010yfg.1_Silent_p.V132V	p.V132V	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN		GBM - Glioblastoma multiforme(193;0.0963)	4	485	+			132			Extracellular (Potential).|Ig-like C2-type 2.		O75020	Silent	SNP	ENST00000251377.3	37	c.396G>A	CCDS46179.1																																																																																				0.562	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2			47	171	0	0	0	0.01441	0	47	171				
NLRP13	126204	broad.mit.edu	37	19	56423822	56423822	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:56423822C>A	ENST00000342929.3	-	5	1360	c.1361G>T	c.(1360-1362)aGt>aTt	p.S454I	NLRP13_ENST00000588751.1_Missense_Mutation_p.S454I	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	454	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)	p.S454I(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GGCATACAGACTGGTGGTAGT	0.527																																							uc010ygg.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|ovary(3)|pancreas(1)|lung(1)	9						c.(1360-1362)AGT>ATT		NACHT, leucine rich repeat and PYD containing							93.0	94.0	94.0					19																	56423822		2203	4300	6503	SO:0001583	missense	126204						ATP binding	g.chr19:56423822C>A	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1361G>T	19.37:g.56423822C>A	ENSP00000343891:p.Ser454Ile						p.S454I	NM_176810	NP_789780	Q86W25	NAL13_HUMAN		GBM - Glioblastoma multiforme(193;0.0642)	5	1386	-		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)	454			NACHT.		Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	37	c.1361G>T	CCDS33119.1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.357250	0.41801	.	.	ENSG00000173572	ENST00000342929	T	0.73897	-0.79	2.48	1.21	0.21127	.	.	.	.	.	T	0.76335	0.3973	M	0.82823	2.61	0.09310	N	1	P	0.49447	0.924	P	0.46825	0.528	T	0.67369	-0.5688	9	0.66056	D	0.02	.	6.2423	0.20797	0.0:0.6811:0.3189:0.0	.	454	Q86W25	NAL13_HUMAN	I	454	ENSP00000343891:S454I	ENSP00000343891:S454I	S	-	2	0	NLRP13	61115634	0.000000	0.05858	0.006000	0.13384	0.313000	0.28021	-0.697000	0.05098	1.363000	0.46019	0.543000	0.68304	AGT		0.527	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	NM_176810		43	125	1	0	6.21074e-16	0.011902	1.00195e-15	43	125				
CAD	790	broad.mit.edu	37	2	27459689	27459689	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:27459689C>T	ENST00000403525.1	+	26	4342	c.4198C>T	c.(4198-4200)Cga>Tga	p.R1400*	CAD_ENST00000264705.4_Nonsense_Mutation_p.R1463*			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.R1463*(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAGCTTGTGCGACTGCCGGG	0.572																																							uc002rji.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10						c.(4387-4389)CGA>TGA		carbamoylphosphate synthetase 2/aspartate	L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)						116.0	112.0	113.0					2																	27459689		2203	4300	6503	SO:0001587	stop_gained	790				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity	g.chr2:27459689C>T	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4198C>T	2.37:g.27459689C>T	ENSP00000384510:p.Arg1400*					CAD_uc010eyw.2_Nonsense_Mutation_p.R1400*	p.R1463*	NM_004341	NP_004332	P27708	PYR1_HUMAN			27	4549	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1463			DHOase (dihydroorotase).		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Nonsense_Mutation	SNP	ENST00000403525.1	37	c.4387C>T		.	.	.	.	.	.	.	.	.	.	C	26.2	4.714658	0.89112	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-6.8307	13.1411	0.59436	0.16:0.84:0.0:0.0	.	.	.	.	X	1463;1400	.	ENSP00000264705:R1463X	R	+	1	2	CAD	27313193	1.000000	0.71417	0.997000	0.53966	0.944000	0.59088	5.268000	0.65536	2.622000	0.88805	0.561000	0.74099	CGA		0.572	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1			4	111	0	0	0	0.001168	0	4	111				
ALK	238	broad.mit.edu	37	2	29455189	29455189	+	Missense_Mutation	SNP	G	G	T	rs150557024		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:29455189G>T	ENST00000389048.3	-	15	3519	c.2613C>A	c.(2611-2613)aaC>aaA	p.N871K	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	871	Gly-rich.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N871K(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CGGAATTGCCGTTTAGCCCTA	0.617			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														uc002rmy.2		NA	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	T|Mis|A	anaplastic lymphoma kinase (Ki-1)			"""L, E, M"""	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	neuroblastoma	ALCL|NSCLC|Neuroblastoma	NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218						c.(2611-2613)AAC>AAA		anaplastic lymphoma kinase precursor	Adenosine triphosphate(DB00171)						108.0	100.0	103.0					2																	29455189		2203	4300	6503	SO:0001583	missense	238	Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	g.chr2:29455189G>T	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2613C>A	2.37:g.29455189G>T	ENSP00000373700:p.Asn871Lys						p.N871K	NM_004304	NP_004295	Q9UM73	ALK_HUMAN			15	3520	-	Acute lymphoblastic leukemia(172;0.155)		871			Gly-rich.|Extracellular (Potential).		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	c.2613C>A	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067697	0.55539	.	.	ENSG00000171094	ENST00000389048	T	0.40756	1.02	5.41	-0.168	0.13343	.	0.000000	0.51477	D	0.000085	T	0.51007	0.1649	L	0.52206	1.635	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.40869	-0.9540	9	.	.	.	.	9.4543	0.38745	0.5992:0.0:0.4008:0.0	.	871	Q9UM73	ALK_HUMAN	K	871	ENSP00000373700:N871K	.	N	-	3	2	ALK	29308693	0.847000	0.29606	0.985000	0.45067	0.785000	0.44390	-0.010000	0.12743	0.020000	0.15106	-0.266000	0.10368	AAC		0.617	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304		26	49	1	0	9.39395e-14	0.00632	1.45906e-13	26	49				
NLRC4	58484	broad.mit.edu	37	2	32476218	32476218	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:32476218G>T	ENST00000404025.2	-	5	1203	c.715C>A	c.(715-717)Ctg>Atg	p.L239M	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000402280.1_Missense_Mutation_p.L239M|NLRC4_ENST00000360906.5_Missense_Mutation_p.L239M			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	239	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.|Nucleotide-binding domain (NBD). {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.L239M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CTCTGCCGCAGCTTCAGCAGC	0.502																																							uc002roi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|lung(1)|skin(1)	6						c.(715-717)CTG>ATG		caspase recruitment domain protein 12							81.0	85.0	84.0					2																	32476218		2203	4300	6503	SO:0001583	missense	58484				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity	g.chr2:32476218G>T	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.715C>A	2.37:g.32476218G>T	ENSP00000385090:p.Leu239Met					NLRC4_uc002roj.1_Missense_Mutation_p.L239M|NLRC4_uc010ezt.1_Intron	p.L239M	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN			4	961	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)		239			NACHT.		A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	37	c.715C>A	CCDS33174.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.321967	0.23994	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.80123	-1.34;-1.34;-1.34	3.27	1.37	0.22104	NACHT nucleoside triphosphatase (1);	0.000000	0.37761	N	0.001951	D	0.83815	0.5336	L	0.59436	1.845	0.30395	N	0.7805960000000001	D	0.76494	0.999	D	0.91635	0.999	T	0.82833	-0.0262	9	0.35671	T	0.21	-4.6858	6.776	0.23621	0.3281:0.0:0.6719:0.0	.	239	Q9NPP4	NLRC4_HUMAN	M	239	ENSP00000354159:L239M;ENSP00000385428:L239M;ENSP00000385090:L239M	ENSP00000354159:L239M	L	-	1	2	NLRC4	32329722	0.043000	0.20138	0.862000	0.33874	0.387000	0.30353	1.081000	0.30791	0.203000	0.20529	0.543000	0.68304	CTG		0.502	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209		40	93	1	0	8.69298e-16	0.006999	1.3947e-15	40	93				
VIT	5212	broad.mit.edu	37	2	37035875	37035875	+	Silent	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:37035875G>T	ENST00000389975.3	+	14	1907	c.1605G>T	c.(1603-1605)ggG>ggT	p.G535G	VIT_ENST00000379241.3_Silent_p.G513G|VIT_ENST00000497382.1_Silent_p.G204G|VIT_ENST00000379242.3_Silent_p.G550G|VIT_ENST00000404084.1_Silent_p.G487G|VIT_ENST00000401530.1_Silent_p.G514G	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	535	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)	p.G550G(1)		autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				CGCGCATCGGGGCCGTGCAGT	0.582																																							uc002rpl.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1648-1650)GGG>GGT		vitrin							80.0	78.0	79.0					2																	37035875		2203	4300	6503	SO:0001819	synonymous_variant	5212					proteinaceous extracellular matrix		g.chr2:37035875G>T	AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.1605G>T	2.37:g.37035875G>T						VIT_uc002rpm.2_Silent_p.G528G|VIT_uc010ezv.2_Silent_p.G506G|VIT_uc010ezw.2_Silent_p.G507G	p.G550G	NM_053276	NP_444506	Q6UXI7	VITRN_HUMAN			15	1871	+		all_hematologic(82;0.248)	535			VWFA 2.		A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Silent	SNP	ENST00000389975.3	37	c.1650G>T	CCDS54347.1																																																																																				0.582	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				14	46	1	0	4.93089e-13	0.00245	7.49906e-13	14	46				
HEATR5B	54497	broad.mit.edu	37	2	37302722	37302722	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:37302722C>T	ENST00000233099.5	-	5	598	c.503G>A	c.(502-504)gGt>gAt	p.G168D	HEATR5B_ENST00000354531.2_Missense_Mutation_p.G168D	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	168						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.G168D(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TGCTGCACCACCCAGTCCACT	0.413																																							uc002rpp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)|breast(1)	8						c.(502-504)GGT>GAT		HEAT repeat containing 5B							158.0	144.0	149.0					2																	37302722		2203	4300	6503	SO:0001583	missense	54497						binding	g.chr2:37302722C>T	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.503G>A	2.37:g.37302722C>T	ENSP00000233099:p.Gly168Asp						p.G168D	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN			5	599	-		all_hematologic(82;0.21)	168					B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	c.503G>A	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.740284	0.89573	.	.	ENSG00000008869	ENST00000233099;ENST00000354531;ENST00000424416	T;T	0.67698	-0.28;-0.28	5.16	4.28	0.50868	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82972	0.5153	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85452	0.1161	10	0.52906	T	0.07	-13.0421	15.4787	0.75508	0.1395:0.8605:0.0:0.0	.	168	Q9P2D3	HTR5B_HUMAN	D	168	ENSP00000233099:G168D;ENSP00000346531:G168D	ENSP00000233099:G168D	G	-	2	0	HEATR5B	37156226	1.000000	0.71417	0.987000	0.45799	0.985000	0.73830	5.866000	0.69590	1.301000	0.44836	0.591000	0.81541	GGT		0.413	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024		27	105	0	0	0	0.004656	0	27	105				
RPLP0P6	220717	broad.mit.edu	37	2	38709705	38709705	+	lincRNA	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:38709705C>A	ENST00000417039.1	-	0	696																											GCATCAGTACCCCATTCTATC	0.502																																							uc002rqu.1		NA																	0					NA						c.(526-528)ACC>ACA		SubName: Full=RPLP0 protein;																																						0							g.chr2:38709705C>A																													2.37:g.38709705C>A							p.T176T							2	595	+									Silent	SNP	ENST00000417039.1	37	c.528C>A																																																																																					0.502	AC016995.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000331173.1			29	44	1	0	5.60225e-13	0.009535	8.47594e-13	29	44				
MSH2	4436	broad.mit.edu	37	2	47630474	47630474	+	Silent	SNP	G	G	A	rs63750334|rs63750089|rs63750644|rs63751482		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:47630474G>A	ENST00000233146.2	+	1	367	c.144G>A	c.(142-144)gaG>gaA	p.E48E	MSH2_ENST00000406134.1_Silent_p.E48E|MSH2_ENST00000543555.1_Intron	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	48					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.E48E(1)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CGCACGGCGAGGACGCGCTGC	0.687			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc002rvy.1		NA	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	D|Mis|N|F|S	mutS homolog 2 (E. coli)			E		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		4	Whole gene deletion(2)|Substitution - coding silent(1)|Unknown(1)		haematopoietic_and_lymphoid_tissue(3)|lung(1)	large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55						c.(142-144)GAG>GAA	MMR	mutS homolog 2							12.0	14.0	13.0					2																	47630474		2193	4288	6481	SO:0001819	synonymous_variant	4436	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding	g.chr2:47630474G>A	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.144G>A	2.37:g.47630474G>A						MSH2_uc010yoh.1_Intron|MSH2_uc002rvz.2_Silent_p.E48E|MSH2_uc010fbf.1_Silent_p.E48E	p.E48E	NM_000251	NP_000242	P43246	MSH2_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		1	212	+		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	48					B4E2Z2|O75488	Silent	SNP	ENST00000233146.2	37	c.144G>A	CCDS1834.1																																																																																				0.687	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3			8	25	0	0	0	0.006214	0	8	25				
ADD2	119	broad.mit.edu	37	2	70906010	70906010	+	Silent	SNP	C	C	G	rs556635447		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:70906010C>G	ENST00000264436.4	-	11	1653	c.1209G>C	c.(1207-1209)acG>acC	p.T403T	ADD2_ENST00000413157.2_Silent_p.T403T|ADD2_ENST00000407644.2_Silent_p.T403T|ADD2_ENST00000430656.1_Silent_p.T419T|ADD2_ENST00000355733.3_Silent_p.T403T	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	403					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.T403T(2)|p.T419T(1)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						AGGCTGTGACCGTGGCTGGAA	0.542																																							uc002sgz.2		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(2)|pancreas(1)	3						c.(1207-1209)ACG>ACC		adducin 2 isoform a							165.0	161.0	162.0					2																	70906010		2203	4300	6503	SO:0001819	synonymous_variant	119				actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding	g.chr2:70906010C>G	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1209G>C	2.37:g.70906010C>G						ADD2_uc010fds.1_RNA|ADD2_uc002sgy.2_Silent_p.T403T|ADD2_uc002sha.2_Intron|ADD2_uc002sgx.2_Silent_p.T403T|ADD2_uc010fdt.1_Silent_p.T403T|ADD2_uc002shc.1_Silent_p.T403T|ADD2_uc002shd.1_Intron|ADD2_uc010fdu.1_Silent_p.T419T	p.T403T	NM_001617	NP_001608	P35612	ADDB_HUMAN			11	1674	-			403					A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	ENST00000264436.4	37	c.1209G>C	CCDS1906.1																																																																																				0.542	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617		17	121	0	0	0	0.004007	0	17	121				
POLR1A	25885	broad.mit.edu	37	2	86305001	86305001	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:86305001T>A	ENST00000263857.6	-	11	1739	c.1361A>T	c.(1360-1362)aAc>aTc	p.N454I	POLR1A_ENST00000409681.1_Missense_Mutation_p.N454I			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	454					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.N454I(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						TCCAATTTCGTTGGTGTTGAT	0.542																																							uc002sqs.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1360-1362)AAC>ATC		DNA-directed RNA polymerase I A							127.0	129.0	128.0					2																	86305001		2011	4154	6165	SO:0001583	missense	25885				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding	g.chr2:86305001T>A	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.1361A>T	2.37:g.86305001T>A	ENSP00000263857:p.Asn454Ile						p.N454I	NM_015425	NP_056240	O95602	RPA1_HUMAN			11	1740	-			454					B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	c.1361A>T	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	T	19.48	3.835831	0.71373	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.70631	-0.5;-0.5	5.62	5.62	0.85841	RNA polymerase, alpha subunit (1);RNA polymerase, N-terminal (1);	0.206138	0.51477	D	0.000098	D	0.84633	0.5515	M	0.86502	2.82	0.58432	D	0.999991	D	0.54964	0.969	P	0.60682	0.878	D	0.87519	0.2445	10	0.87932	D	0	-17.6938	15.7908	0.78364	0.0:0.0:0.0:1.0	.	454	O95602	RPA1_HUMAN	I	454	ENSP00000263857:N454I;ENSP00000386300:N454I	ENSP00000263857:N454I	N	-	2	0	POLR1A	86158512	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	7.541000	0.82084	2.270000	0.75569	0.459000	0.35465	AAC		0.542	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425		53	138	0	0	0	0.01441	0	53	138				
PTPN4	5775	broad.mit.edu	37	2	120714600	120714600	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:120714600A>T	ENST00000263708.2	+	22	2851	c.2080A>T	c.(2080-2082)Aca>Tca	p.T694S	PTPN4_ENST00000544261.1_Missense_Mutation_p.T327S	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	694	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.T694S(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	AGATGATGCCACACGGGTCAT	0.274																																							uc002tmf.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2080-2082)ACA>TCA		protein tyrosine phosphatase, non-receptor type	Alendronate(DB00630)						41.0	44.0	43.0					2																	120714600		2202	4294	6496	SO:0001583	missense	5775					cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity	g.chr2:120714600A>T		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.2080A>T	2.37:g.120714600A>T	ENSP00000263708:p.Thr694Ser					PTPN4_uc010flj.1_Missense_Mutation_p.T407S|PTPN4_uc010yyr.1_Missense_Mutation_p.T327S	p.T694S	NM_002830	NP_002821	P29074	PTN4_HUMAN			22	2851	+			694			Tyrosine-protein phosphatase.		B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	c.2080A>T	CCDS2129.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.756045	0.89843	.	.	ENSG00000088179	ENST00000263708;ENST00000544261	T;T	0.13420	2.59;2.59	5.28	5.28	0.74379	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.31796	0.0808	L	0.49699	1.58	0.80722	D	1	D	0.61697	0.99	D	0.71414	0.973	T	0.02567	-1.1140	10	0.87932	D	0	.	15.2057	0.73177	1.0:0.0:0.0:0.0	.	694	P29074	PTN4_HUMAN	S	694;327	ENSP00000263708:T694S;ENSP00000445841:T327S	ENSP00000263708:T694S	T	+	1	0	PTPN4	120431070	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.237000	0.95368	1.982000	0.57802	0.533000	0.62120	ACA		0.274	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2			16	32	0	0	0	0.00499	0	16	32				
XIRP2	129446	broad.mit.edu	37	2	168107287	168107287	+	Missense_Mutation	SNP	A	A	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:168107287A>C	ENST00000409195.1	+	9	9474	c.9385A>C	c.(9385-9387)Act>Cct	p.T3129P	XIRP2_ENST00000409273.1_Missense_Mutation_p.T2907P|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.T3129P|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2954					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.T3129P(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AATAGAATCTACTGCCCGACG	0.443																																							uc002udx.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(9385-9387)ACT>CCT		xin actin-binding repeat containing 2 isoform 1							83.0	79.0	80.0					2																	168107287		1859	4091	5950	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168107287A>C	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9385A>C	2.37:g.168107287A>C	ENSP00000386840:p.Thr3129Pro					XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.T2954P|XIRP2_uc010fpq.2_Missense_Mutation_p.T2907P|XIRP2_uc010fpr.2_Intron	p.T3129P	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	9403	+			2954					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.9385A>C	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.980327	0.34942	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.03524	3.91;3.91;3.9	5.88	4.7	0.59300	.	0.161074	0.53938	D	0.000041	T	0.13415	0.0325	M	0.66939	2.045	0.38200	D	0.940173	D;D;D	0.67145	0.981;0.989;0.996	P;P;D	0.64410	0.77;0.885;0.925	T	0.01084	-1.1457	10	0.62326	D	0.03	-5.9212	10.5046	0.44826	0.8546:0.0:0.0:0.1454	.	2954;2954;2907	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	P	3129;3129;2907;543	ENSP00000386840:T3129P;ENSP00000295237:T3129P;ENSP00000387255:T2907P	ENSP00000295237:T3129P	T	+	1	0	XIRP2	167815533	0.934000	0.31675	0.629000	0.29254	0.087000	0.18053	3.837000	0.55820	1.017000	0.39495	0.455000	0.32223	ACT		0.443	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		26	58	0	0	0	0.005443	0	26	58				
TTN	7273	broad.mit.edu	37	2	179648491	179648491	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:179648491G>T	ENST00000591111.1	-	17	3021	c.2797C>A	c.(2797-2799)Cca>Aca	p.P933T	TTN_ENST00000359218.5_Missense_Mutation_p.P887T|TTN_ENST00000460472.2_Missense_Mutation_p.P887T|TTN_ENST00000342992.6_Missense_Mutation_p.P933T|TTN_ENST00000342175.6_Missense_Mutation_p.P887T|TTN_ENST00000589042.1_Missense_Mutation_p.P933T|TTN_ENST00000360870.5_Missense_Mutation_p.P933T			Q8WZ42	TITIN_HUMAN	titin	33630					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P887T(3)|p.P933T(3)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAGGTGCTGGTACTCTTGCT	0.348																																							uc010zfg.1		NA																	6	Substitution - Missense(6)		lung(6)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(2797-2799)CCA>ACA		titin isoform N2-A							88.0	90.0	89.0					2																	179648491		2203	4300	6503	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179648491G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2797C>A	2.37:g.179648491G>T	ENSP00000465570:p.Pro933Thr					TTN_uc010zfh.1_Missense_Mutation_p.P887T|TTN_uc010zfi.1_Missense_Mutation_p.P887T|TTN_uc010zfj.1_Missense_Mutation_p.P887T|TTN_uc002unb.2_Missense_Mutation_p.P933T	p.P933T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		17	3021	-			933					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.2797C>A		.	.	.	.	.	.	.	.	.	.	G	15.43	2.830714	0.50845	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.66280	-0.2;0.06;0.05;0.03;0.18	5.93	5.93	0.95920	Ribonuclease H-like (1);	.	.	.	.	T	0.73361	0.3577	L	0.34521	1.04	0.36733	D	0.881817	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.996;0.996;0.996;0.999	T	0.77354	-0.2619	9	0.87932	D	0	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	887;887;887;933;933	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	T	933;887;887;887;887;933	ENSP00000343764:P933T;ENSP00000434586:P887T;ENSP00000340554:P887T;ENSP00000352154:P887T;ENSP00000354117:P933T	ENSP00000340554:P887T	P	-	1	0	TTN	179356736	1.000000	0.71417	0.990000	0.47175	0.974000	0.67602	5.975000	0.70475	2.826000	0.97356	0.655000	0.94253	CCA		0.348	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		22	83	1	0	7.92952e-12	0.003954	1.1406e-11	22	83				
ABCA12	26154	broad.mit.edu	37	2	215821447	215821447	+	Nonsense_Mutation	SNP	A	A	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:215821447A>T	ENST00000272895.7	-	42	6392	c.6173T>A	c.(6172-6174)tTa>tAa	p.L2058*	ABCA12_ENST00000389661.4_Nonsense_Mutation_p.L1740*|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2058					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.L2058*(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GAATGCAGGTAATTTGAAAAT	0.358																																					Ovarian(66;664 1488 5121 34295)	Ovarian(66;664 1488 5121 34295)	uc002vew.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11						c.(6172-6174)TTA>TAA		ATP-binding cassette, sub-family A, member 12							113.0	111.0	112.0					2																	215821447		2203	4300	6503	SO:0001587	stop_gained	26154				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity	g.chr2:215821447A>T	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6173T>A	2.37:g.215821447A>T	ENSP00000272895:p.Leu2058*					ABCA12_uc002vev.2_Nonsense_Mutation_p.L1740*|ABCA12_uc010zjn.1_Nonsense_Mutation_p.L985*	p.L2058*	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)	42	6393	-		Renal(323;0.127)	2058					Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Nonsense_Mutation	SNP	ENST00000272895.7	37	c.6173T>A	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	A	46	12.368456	0.99661	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	.	.	.	5.69	5.69	0.88448	.	0.136270	0.31438	N	0.007647	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6101	0.76710	1.0:0.0:0.0:0.0	.	.	.	.	X	2058;1740	.	ENSP00000272895:L2058X	L	-	2	0	ABCA12	215529692	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	6.552000	0.73914	2.173000	0.68751	0.533000	0.62120	TTA		0.358	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		22	84	0	0	0	0.00333	0	22	84				
MARCH4	57574	broad.mit.edu	37	2	217142428	217142428	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:217142428C>A	ENST00000273067.4	-	3	2598	c.832G>T	c.(832-834)Ggg>Tgg	p.G278W		NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	278						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G278W(1)		breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		CCATACATCCCGTAGCAGATC	0.557																																							uc002vgb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(832-834)GGG>TGG		membrane-associated ring finger (C3HC4) 4							208.0	175.0	186.0					2																	217142428		2203	4300	6503	SO:0001583	missense	57574					Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding	g.chr2:217142428C>A	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.832G>T	2.37:g.217142428C>A	ENSP00000273067:p.Gly278Trp						p.G278W	NM_020814	NP_065865	Q9P2E8	MARH4_HUMAN		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)	3	2599	-		Renal(323;0.0854)	278			Helical; (Potential).		Q4KMN7|Q86WR8	Missense_Mutation	SNP	ENST00000273067.4	37	c.832G>T	CCDS33376.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.921132	0.92249	.	.	ENSG00000144583	ENST00000273067	T	0.19669	2.13	5.4	5.4	0.78164	.	0.049506	0.85682	D	0.000000	T	0.47266	0.1436	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.43114	-0.9411	10	0.66056	D	0.02	-6.6461	18.1705	0.89744	0.0:1.0:0.0:0.0	.	278	Q9P2E8	MARH4_HUMAN	W	278	ENSP00000273067:G278W	ENSP00000273067:G278W	G	-	1	0	MARCH4	216850673	1.000000	0.71417	0.960000	0.40013	0.964000	0.63967	7.818000	0.86416	2.543000	0.85770	0.655000	0.94253	GGG		0.557	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814		39	105	1	0	2.66277e-13	0.006999	4.07082e-13	39	105				
PAK7	57144	broad.mit.edu	37	20	9546928	9546928	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr20:9546928C>A	ENST00000378429.3	-	6	1640	c.1094G>T	c.(1093-1095)gGc>gTc	p.G365V	PAK7_ENST00000353224.5_Missense_Mutation_p.G365V|PAK7_ENST00000378423.1_Missense_Mutation_p.G365V	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	365	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G365V(1)		NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			TGAGGAATAGCCCGATTTGCT	0.562																																							uc002wnl.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23						c.(1093-1095)GGC>GTC		p21-activated kinase 7							174.0	171.0	172.0					20																	9546928		2203	4300	6503	SO:0001583	missense	57144						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr20:9546928C>A	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1094G>T	20.37:g.9546928C>A	ENSP00000367686:p.Gly365Val					PAK7_uc002wnk.2_Missense_Mutation_p.G365V|PAK7_uc002wnj.2_Missense_Mutation_p.G365V|PAK7_uc010gby.1_Missense_Mutation_p.G365V	p.G365V	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	COAD - Colon adenocarcinoma(9;0.194)		6	1639	-			365			Linker.		A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	c.1094G>T	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.090626	0.36855	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.27256	1.68;1.68;1.68	5.94	4.91	0.64330	.	0.341025	0.37669	N	0.002000	T	0.10895	0.0266	N	0.08118	0	0.80722	D	1	P;B	0.35383	0.498;0.001	B;B	0.30572	0.117;0.003	T	0.16719	-1.0393	9	.	.	.	.	9.0805	0.36550	0.0:0.7495:0.1505:0.1	.	365;365	B0AZM9;Q9P286	.;PAK7_HUMAN	V	365;365;365;313	ENSP00000367686:G365V;ENSP00000322957:G365V;ENSP00000367679:G365V	.	G	-	2	0	PAK7	9494928	0.987000	0.35691	0.987000	0.45799	0.969000	0.65631	1.503000	0.35715	2.807000	0.96579	0.591000	0.81541	GGC		0.562	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1			45	145	1	0	2.81731e-22	0.01441	4.92607e-22	45	145				
FOXS1	2307	broad.mit.edu	37	20	30433325	30433325	+	Silent	SNP	G	G	A	rs564111331		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr20:30433325G>A	ENST00000375978.3	-	1	95	c.21C>T	c.(19-21)ccC>ccT	p.P7P		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	7					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P7P(1)		kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						CGCCAGGCCCGGGCAGAGGCT	0.682													G|||	0	0.0	0.0	0.0	5008	,	,		15329	0.0		0.0	False		,,,				2504	0.0						uc002wwt.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(19-21)CCC>CCT		forkhead box S1							27.0	32.0	30.0					20																	30433325		2194	4277	6471	SO:0001819	synonymous_variant	2307				anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|insulin receptor signaling pathway|lymphangiogenesis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|neural crest cell fate commitment|neuromuscular process controlling balance|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of multicellular organism growth|positive regulation of transcription from RNA polymerase II promoter|regulation of blood vessel size|regulation of organ growth|somitogenesis|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr20:30433325G>A	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.21C>T	20.37:g.30433325G>A							p.P7P	NM_004118	NP_004109	O43638	FOXS1_HUMAN			1	96	-			7					Q96D28	Silent	SNP	ENST00000375978.3	37	c.21C>T	CCDS13192.1																																																																																				0.682	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2	NM_004118		26	44	0	0	0	0.00632	0	26	44				
CHD6	84181	broad.mit.edu	37	20	40050551	40050551	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr20:40050551C>A	ENST00000373233.3	-	31	4901	c.4724G>T	c.(4723-4725)tGg>tTg	p.W1575L		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1575					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.W1575L(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CCCACACTCCCACCAGACTGG	0.567																																							uc002xka.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14						c.(4723-4725)TGG>TTG		chromodomain helicase DNA binding protein 6							87.0	59.0	69.0					20																	40050551		2203	4300	6503	SO:0001583	missense	84181				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding	g.chr20:40050551C>A	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4724G>T	20.37:g.40050551C>A	ENSP00000362330:p.Trp1575Leu						p.W1575L	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN			31	4902	-		Myeloproliferative disorder(115;0.00425)	1575					Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	c.4724G>T	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.919825	0.92249	.	.	ENSG00000124177	ENST00000373233	T	0.80738	-1.41	5.89	5.89	0.94794	.	0.000000	0.56097	D	0.000021	D	0.91670	0.7367	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92093	0.5682	10	0.87932	D	0	-9.2834	20.3051	0.98623	0.0:1.0:0.0:0.0	.	1575	Q8TD26	CHD6_HUMAN	L	1575	ENSP00000362330:W1575L	ENSP00000362330:W1575L	W	-	2	0	CHD6	39483965	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.814000	0.96858	0.650000	0.86243	TGG		0.567	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			11	35	1	0	3.86212e-05	0.008291	4.54733e-05	11	35				
ZSWIM3	140831	broad.mit.edu	37	20	44505453	44505453	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr20:44505453G>A	ENST00000255152.2	+	2	465	c.256G>A	c.(256-258)Gag>Aag	p.E86K	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.E80K	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	86							zinc ion binding (GO:0008270)	p.E86K(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				AAGGTACAACGAGAGACTAGA	0.473																																							uc002xqd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(256-258)GAG>AAG		zinc finger, SWIM domain containing 3							130.0	115.0	120.0					20																	44505453		2203	4300	6503	SO:0001583	missense	140831						zinc ion binding	g.chr20:44505453G>A	AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.256G>A	20.37:g.44505453G>A	ENSP00000255152:p.Glu86Lys					ZSWIM3_uc010zxg.1_Missense_Mutation_p.E80K	p.E86K	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN			2	459	+		Myeloproliferative disorder(115;0.0122)	86					Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	c.256G>A	CCDS13381.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216533	0.79352	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.32753	1.7;1.44	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000002	T	0.40094	0.1103	L	0.34521	1.04	0.45284	D	0.998282	D;D	0.69078	0.997;0.993	P;P	0.57720	0.826;0.762	T	0.02378	-1.1168	10	0.22706	T	0.39	-26.8924	18.868	0.92301	0.0:0.0:1.0:0.0	.	80;86	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	K	86;80	ENSP00000255152:E86K;ENSP00000406313:E80K	ENSP00000255152:E86K	E	+	1	0	ZSWIM3	43938860	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	4.169000	0.58223	2.797000	0.96272	0.561000	0.74099	GAG		0.473	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752		19	101	0	0	0	0.008871	0	19	101				
PREX1	57580	broad.mit.edu	37	20	47276591	47276591	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr20:47276591T>G	ENST00000371941.3	-	16	1769	c.1747A>C	c.(1747-1749)Aag>Cag	p.K583Q	PREX1_ENST00000396220.1_Missense_Mutation_p.K583Q	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	583	DEP 2. {ECO:0000255|PROSITE- ProRule:PRU00066}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K583Q(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AACTCGCTCTTCTCCAGCACT	0.532																																							uc002xtw.1		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|ovary(2)|pancreas(1)	6						c.(1747-1749)AAG>CAG		phosphatidylinositol-3,4,							132.0	108.0	116.0					20																	47276591		2203	4300	6503	SO:0001583	missense	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47276591T>G	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1747A>C	20.37:g.47276591T>G	ENSP00000361009:p.Lys583Gln						p.K583Q	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		16	1770	-			583			DEP 2.		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	c.1747A>C	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	T	29.5	5.014433	0.93404	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.16457	2.34;2.34	5.62	5.62	0.85841	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.56097	U	0.000024	T	0.32882	0.0844	L	0.52759	1.655	0.80722	D	1	P	0.44478	0.836	P	0.56216	0.794	T	0.02064	-1.1220	10	0.87932	D	0	.	15.5272	0.75919	0.0:0.0:0.0:1.0	.	583	Q8TCU6	PREX1_HUMAN	Q	583	ENSP00000361009:K583Q;ENSP00000379522:K583Q	ENSP00000361009:K583Q	K	-	1	0	PREX1	46709998	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.959000	0.87885	2.141000	0.66446	0.528000	0.53228	AAG		0.532	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		3	90	0	0	0	0.004672	0	3	90				
KRTAP11-1	337880	broad.mit.edu	37	21	32253450	32253450	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr21:32253450G>T	ENST00000332378.4	-	1	424	c.394C>A	c.(394-396)Caa>Aaa	p.Q132K		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	132	4 X 10 AA approximate repeats.					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.Q132K(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						CCCACTGGTTGGCAGACAGTA	0.597																																							uc002yov.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(394-396)CAA>AAA		keratin associated protein 11-1							57.0	59.0	58.0					21																	32253450		2203	4300	6503	SO:0001583	missense	337880					keratin filament	structural molecule activity	g.chr21:32253450G>T	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.394C>A	21.37:g.32253450G>T	ENSP00000330720:p.Gln132Lys						p.Q132K	NM_175858	NP_787054	Q8IUC1	KR111_HUMAN			1	425	-			132			3.|4 X 10 AA approximate repeats.		A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	37	c.394C>A	CCDS13608.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.712514	0.30322	.	.	ENSG00000182591	ENST00000332378	T	0.03094	4.05	4.59	4.59	0.56863	.	0.229906	0.36591	N	0.002516	T	0.16557	0.0398	M	0.78049	2.395	0.29915	N	0.823253	D	0.53885	0.963	D	0.68621	0.959	T	0.01972	-1.1237	10	0.27082	T	0.32	-1.05	15.3268	0.74172	0.0:0.0:1.0:0.0	.	132	Q8IUC1	KR111_HUMAN	K	132	ENSP00000330720:Q132K	ENSP00000330720:Q132K	Q	-	1	0	KRTAP11-1	31175321	1.000000	0.71417	0.926000	0.36857	0.288000	0.27193	3.450000	0.52957	2.267000	0.75376	0.650000	0.86243	CAA		0.597	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1			12	75	1	0	3.07112e-06	0.010729	3.79986e-06	12	75				
IL17RA	23765	broad.mit.edu	37	22	17589773	17589773	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr22:17589773G>T	ENST00000319363.6	+	13	1797	c.1664G>T	c.(1663-1665)gGg>gTg	p.G555V		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	555					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)	p.G555V(1)		endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GAGCTGTCGGGGGACAACTAC	0.677																																							uc002zly.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(1663-1665)GGG>GTG		interleukin 17A receptor precursor							19.0	18.0	18.0					22																	17589773		2195	4298	6493	SO:0001583	missense	23765				fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity	g.chr22:17589773G>T	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.1664G>T	22.37:g.17589773G>T	ENSP00000320936:p.Gly555Val					IL17RA_uc010gqt.2_Missense_Mutation_p.G503V	p.G555V	NM_014339	NP_055154	Q96F46	I17RA_HUMAN		Colorectal(9;0.241)	13	1797	+		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)	555			Cytoplasmic (Potential).		O43844|Q20WK1	Missense_Mutation	SNP	ENST00000319363.6	37	c.1664G>T	CCDS13739.1	.	.	.	.	.	.	.	.	.	.	G	6.746	0.506516	0.12883	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.05649	3.41	4.97	-4.13	0.03904	.	0.639545	0.16147	N	0.227427	T	0.04048	0.0113	L	0.50919	1.6	0.19575	N	0.999965	P;P	0.43094	0.799;0.651	B;B	0.35859	0.212;0.084	T	0.34925	-0.9809	10	0.32370	T	0.25	-11.6175	4.0329	0.09717	0.2474:0.4816:0.1769:0.0942	.	503;555	D3YTB4;Q96F46	.;I17RA_HUMAN	V	503;555	ENSP00000320936:G555V	ENSP00000320936:G555V	G	+	2	0	IL17RA	15969773	0.002000	0.14202	0.000000	0.03702	0.010000	0.07245	0.461000	0.21940	-0.260000	0.09418	0.462000	0.41574	GGG		0.677	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339		4	12	1	0	0.00909568	0.009096	0.00972871	4	12				
CECR1	51816	broad.mit.edu	37	22	17688152	17688152	+	Silent	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr22:17688152G>A	ENST00000399839.1	-	3	621	c.351C>T	c.(349-351)ggC>ggT	p.G117G	CECR1_ENST00000399837.2_Silent_p.G117G|CECR1_ENST00000262607.3_Silent_p.G117G|CECR1_ENST00000449907.2_Silent_p.G75G	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	117					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)	p.G117G(1)		endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				TAGTCACGATGCCAATGTCAT	0.552																																							uc002zmk.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(349-351)GGC>GGT		cat eye syndrome critical region protein 1							100.0	94.0	96.0					22																	17688152		2203	4300	6503	SO:0001819	synonymous_variant	51816				adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding	g.chr22:17688152G>A	AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.351C>T	22.37:g.17688152G>A						CECR1_uc010gqu.1_Silent_p.G117G|CECR1_uc011agi.1_Silent_p.G75G|CECR1_uc011agj.1_Silent_p.G75G	p.G117G	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN			2	563	-		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)	117					A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Silent	SNP	ENST00000399839.1	37	c.351C>T	CCDS13742.1																																																																																				0.552	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1			5	79	0	0	0	0.000602	0	5	79				
EFCAB6	64800	broad.mit.edu	37	22	43986047	43986047	+	Missense_Mutation	SNP	T	T	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr22:43986047T>G	ENST00000262726.7	-	24	3192	c.2939A>C	c.(2938-2940)aAa>aCa	p.K980T	EFCAB6_ENST00000396231.2_Missense_Mutation_p.K828T	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	980	EF-hand 11. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.K980T(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				GTAGTTGGTTTTGGATTGATC	0.428																																							uc003bdy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7						c.(2938-2940)AAA>ACA		CAP-binding protein complex interacting protein							296.0	253.0	268.0					22																	43986047		2203	4300	6503	SO:0001583	missense	64800				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding	g.chr22:43986047T>G	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2939A>C	22.37:g.43986047T>G	ENSP00000262726:p.Lys980Thr					EFCAB6_uc003bdz.1_Missense_Mutation_p.K828T|EFCAB6_uc010gzi.1_Missense_Mutation_p.K828T|EFCAB6_uc010gzj.1_Missense_Mutation_p.K206T	p.K980T	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN			24	3154	-		Ovarian(80;0.0247)|all_neural(38;0.025)	980			EF-hand 11.		A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	c.2939A>C	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	T	12.44	1.939456	0.34189	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	D;D	0.83755	-1.76;-1.76	4.58	-1.97	0.07503	EF-hand-like domain (1);	0.844217	0.10097	N	0.716464	D	0.82346	0.5017	M	0.66939	2.045	0.09310	N	1	P;P	0.49358	0.873;0.923	P;P	0.52424	0.544;0.698	T	0.70092	-0.4967	10	0.11794	T	0.64	-2.5378	7.9887	0.30226	0.0:0.4569:0.1237:0.4194	.	828;980	Q5THR3-2;Q5THR3	.;EFCB6_HUMAN	T	828;980	ENSP00000379533:K828T;ENSP00000262726:K980T	ENSP00000262726:K980T	K	-	2	0	EFCAB6	42317380	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-1.184000	0.03076	-0.755000	0.04709	0.454000	0.30748	AAA		0.428	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785		3	97	0	0	0	0.009096	0	3	97				
MOV10L1	54456	broad.mit.edu	37	22	50547205	50547205	+	Silent	SNP	A	A	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr22:50547205A>T	ENST00000262794.5	+	5	758	c.675A>T	c.(673-675)gcA>gcT	p.A225A	MOV10L1_ENST00000540615.1_Silent_p.A205A|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000545383.1_Silent_p.A225A|MOV10L1_ENST00000395858.3_Silent_p.A225A	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	225					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.A225A(1)|p.A205A(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TGGTCAATGCAGTGGTGGTGG	0.532																																							uc003bjj.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(1)	3						c.(673-675)GCA>GCT		MOV10-like 1 isoform 1							123.0	107.0	112.0					22																	50547205		2203	4300	6503	SO:0001819	synonymous_variant	54456				germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding	g.chr22:50547205A>T	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.675A>T	22.37:g.50547205A>T						MOV10L1_uc003bjk.3_Silent_p.A225A|MOV10L1_uc011arp.1_Silent_p.A205A	p.A225A	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)	5	758	+		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)	225					A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	37	c.675A>T	CCDS14084.1																																																																																				0.532	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995		25	67	0	0	0	0.003954	0	25	67				
PBRM1	55193	broad.mit.edu	37	3	52643704	52643704	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr3:52643704A>T	ENST00000296302.7	-	16	2193	c.2192T>A	c.(2191-2193)aTg>aAg	p.M731K	PBRM1_ENST00000410007.1_Missense_Mutation_p.M731K|PBRM1_ENST00000409767.1_Missense_Mutation_p.M746K|PBRM1_ENST00000409057.1_Missense_Mutation_p.M731K|PBRM1_ENST00000409114.3_Missense_Mutation_p.M746K|PBRM1_ENST00000356770.4_Missense_Mutation_p.M699K|PBRM1_ENST00000337303.4_Missense_Mutation_p.M731K|PBRM1_ENST00000394830.3_Missense_Mutation_p.M731K			Q86U86	PB1_HUMAN	polybromo 1	731	Bromo 5. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.M731K(2)|p.M699K(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATTATTAAACATCATGACAAA	0.408			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																		uc003des.2		NA		Rec	yes		3	3p21	55193	Mis|N|F|S|D|O	polybromo 1			E			clear cell renal carcinoma|breast		3	Substitution - Missense(3)		lung(3)	kidney(136)|breast(4)	140						c.(2191-2193)ATG>AAG		polybromo 1 isoform 4							153.0	147.0	149.0					3																	52643704		2203	4300	6503	SO:0001583	missense	55193				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	g.chr3:52643704A>T	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2192T>A	3.37:g.52643704A>T	ENSP00000296302:p.Met731Lys					PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.M731K|PBRM1_uc003der.2_Missense_Mutation_p.M699K|PBRM1_uc003det.2_Missense_Mutation_p.M746K|PBRM1_uc003deu.2_Missense_Mutation_p.M746K|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.M731K|PBRM1_uc010hmk.1_Missense_Mutation_p.M731K|PBRM1_uc003dey.2_Missense_Mutation_p.M731K|PBRM1_uc003dez.1_Missense_Mutation_p.M731K|PBRM1_uc003dfb.1_Missense_Mutation_p.M644K|PBRM1_uc003dfa.1_Missense_Mutation_p.M77K|PBRM1_uc003dfc.2_Missense_Mutation_p.M98K	p.M731K	NM_181042	NP_060635	Q86U86	PB1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	16	2204	-			731			Bromo 5.		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37	c.2192T>A		.	.	.	.	.	.	.	.	.	.	A	24.2	4.502442	0.85176	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81	6.17	6.17	0.99709	Bromodomain (5);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.65217	0.2670	H	0.95645	3.7	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.998;0.995;0.999;0.998;0.998;0.998;0.999;1.0;0.998;0.998	T	0.76408	-0.2970	10	0.87932	D	0	-6.9025	16.8222	0.85835	1.0:0.0:0.0:0.0	.	731;106;731;731;731;731;746;746;731;699;731	Q86U86-9;Q6IRX1;Q86U86-6;E7EVG2;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;.;.;PB1_HUMAN;.;.	K	699;731;731;731;731;731;746;746;731;690	ENSP00000349213:M699K;ENSP00000378307:M731K;ENSP00000296302:M731K;ENSP00000338302:M731K;ENSP00000386593:M731K;ENSP00000386529:M731K;ENSP00000386643:M746K;ENSP00000386601:M746K;ENSP00000387775:M731K;ENSP00000397662:M690K	ENSP00000296302:M731K	M	-	2	0	PBRM1	52618744	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.307000	0.96226	2.371000	0.80710	0.533000	0.62120	ATG		0.408	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165		6	89	0	0	0	0.001984	0	6	89				
CNTN3	5067	broad.mit.edu	37	3	74414733	74414733	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr3:74414733G>C	ENST00000263665.6	-	8	1094	c.1067C>G	c.(1066-1068)gCa>gGa	p.A356G		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	356	Ig-like C2-type 4.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.A356G(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CACCAGGGCTGCTCCATTTTT	0.483																																							uc003dpm.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)|skin(1)	5						c.(1066-1068)GCA>GGA		contactin 3 precursor							214.0	207.0	210.0					3																	74414733		2203	4300	6503	SO:0001583	missense	5067				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr3:74414733G>C	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1067C>G	3.37:g.74414733G>C	ENSP00000263665:p.Ala356Gly						p.A356G	NM_020872	NP_065923	Q9P232	CNTN3_HUMAN		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)	8	1147	-		Lung NSC(201;0.138)|Lung SC(41;0.21)	356			Ig-like C2-type 4.		B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	c.1067C>G	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	G	7.213	0.595796	0.13875	.	.	ENSG00000113805	ENST00000263665	T	0.68025	-0.3	5.37	-0.427	0.12310	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.291251	0.37304	N	0.002158	T	0.44138	0.1279	N	0.12502	0.225	0.22940	N	0.998531	B	0.09022	0.002	B	0.22601	0.04	T	0.36359	-0.9751	10	0.45353	T	0.12	.	9.2595	0.37603	0.1116:0.0:0.411:0.4774	.	356	Q9P232	CNTN3_HUMAN	G	356	ENSP00000263665:A356G	ENSP00000263665:A356G	A	-	2	0	CNTN3	74497423	0.999000	0.42202	0.188000	0.23233	0.151000	0.21798	3.137000	0.50562	-0.010000	0.14271	-0.293000	0.09583	GCA		0.483	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872		123	145	0	0	0	0.01441	0	123	145				
MYH15	22989	broad.mit.edu	37	3	108117506	108117506	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr3:108117506C>G	ENST00000273353.3	-	36	5227	c.5171G>C	c.(5170-5172)aGa>aCa	p.R1724T		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1724						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R1724T(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						AAGATTGATTCTTTCTGTTGC	0.527																																							uc003dxa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(2)	7						c.(5170-5172)AGA>ACA		myosin, heavy polypeptide 15							172.0	171.0	172.0					3																	108117506		1906	4117	6023	SO:0001583	missense	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108117506C>G	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5171G>C	3.37:g.108117506C>G	ENSP00000273353:p.Arg1724Thr						p.R1724T	NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN			36	5228	-			1724			Potential.			Missense_Mutation	SNP	ENST00000273353.3	37	c.5171G>C	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900985	0.72754	.	.	ENSG00000144821	ENST00000273353	T	0.80824	-1.42	5.5	-2.14	0.07123	Myosin tail (1);	.	.	.	.	T	0.80226	0.4584	M	0.76838	2.35	0.31910	N	0.614787	P	0.35944	0.529	B	0.42692	0.395	T	0.78537	-0.2166	9	0.66056	D	0.02	.	6.8731	0.24131	0.0:0.4775:0.1107:0.4118	.	1724	Q9Y2K3	MYH15_HUMAN	T	1724	ENSP00000273353:R1724T	ENSP00000273353:R1724T	R	-	2	0	MYH15	109600196	1.000000	0.71417	0.000000	0.03702	0.440000	0.31957	1.951000	0.40333	-0.223000	0.09943	-0.140000	0.14226	AGA		0.527	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		79	84	0	0	0	0.01441	0	79	84				
LRRC58	116064	broad.mit.edu	37	3	120054769	120054769	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr3:120054769T>C	ENST00000295628.3	-	2	627	c.532A>G	c.(532-534)Att>Gtt	p.I178V		NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	178								p.I178V(1)		large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		ATTTCTTTAATGAAATTTCCT	0.318																																							uc003edr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(532-534)ATT>GTT		leucine rich repeat containing 58							76.0	71.0	72.0					3																	120054769		1799	4061	5860	SO:0001583	missense	116064							g.chr3:120054769T>C	BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.532A>G	3.37:g.120054769T>C	ENSP00000295628:p.Ile178Val						p.I178V	NM_001099678	NP_001093148	Q96CX6	LRC58_HUMAN		GBM - Glioblastoma multiforme(114;0.147)	2	628	-			178			LRR 6.			Missense_Mutation	SNP	ENST00000295628.3	37	c.532A>G	CCDS46892.1	.	.	.	.	.	.	.	.	.	.	T	19.95	3.921716	0.73213	.	.	ENSG00000163428	ENST00000295628	T	0.60920	0.15	5.32	5.32	0.75619	.	0.100715	0.64402	D	0.000002	T	0.59252	0.2180	M	0.66439	2.03	0.58432	D	0.999999	P	0.38148	0.62	B	0.40444	0.329	T	0.63743	-0.6568	10	0.56958	D	0.05	-12.5967	13.0115	0.58733	0.0:0.0:0.0:1.0	.	178	Q96CX6	LRC58_HUMAN	V	178	ENSP00000295628:I178V	ENSP00000295628:I178V	I	-	1	0	LRRC58	121537459	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.111000	0.77077	2.003000	0.58678	0.528000	0.53228	ATT		0.318	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355142.1	XM_057296		28	27	0	0	0	0.005443	0	28	27				
SIAH2	6478	broad.mit.edu	37	3	150460021	150460021	+	Silent	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr3:150460021G>A	ENST00000312960.3	-	2	1409	c.882C>T	c.(880-882)agC>agT	p.S294S		NM_005067.5	NP_005058.3	O43255	SIAH2_HUMAN	siah E3 ubiquitin protein ligase 2	294	SBD.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|cellular protein catabolic process (GO:0044257)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|regulation of protein ubiquitination (GO:0031396)|regulation of RNA biosynthetic process (GO:2001141)|small GTPase mediated signal transduction (GO:0007264)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S294S(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)	16			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CAAGGCAGTCGCTGTTCATGA	0.498																																							uc003eyi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)	2						c.(880-882)AGC>AGT		seven in absentia homolog 2							91.0	78.0	83.0					3																	150460021		2203	4300	6503	SO:0001819	synonymous_variant	6478				apoptosis|axon guidance|cell cycle|negative regulation of canonical Wnt receptor signaling pathway|small GTPase mediated signal transduction|ubiquitin-dependent protein catabolic process	cytosol|nucleus	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr3:150460021G>A	U76248	CCDS3152.1	3q25	2012-02-23	2012-02-23		ENSG00000181788	ENSG00000181788	6.3.2.1		10858	protein-coding gene	gene with protein product		602213	"""seven in absentia (Drosophila) homolog 2"", ""seven in absentia homolog 2 (Drosophila)"""			9334332	Standard	NM_005067		Approved		uc003eyi.3	O43255	OTTHUMG00000159847	ENST00000312960.3:c.882C>T	3.37:g.150460021G>A							p.S294S	NM_005067	NP_005058	O43255	SIAH2_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)		2	1509	-			294			SBD.		O43270	Silent	SNP	ENST00000312960.3	37	c.882C>T	CCDS3152.1																																																																																				0.498	SIAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357697.1	NM_005067		25	20	0	0	0	0.00333	0	25	20				
CRIPAK	285464	broad.mit.edu	37	4	1389175	1389175	+	Silent	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:1389175C>T	ENST00000324803.4	+	1	3836	c.876C>T	c.(874-876)ctC>ctT	p.L292L		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	292					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L292L(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CCCGCCTGCTCACACGTGCCC	0.687																																							uc003gdf.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(874-876)CTC>CTT		cysteine-rich PAK1 inhibitor							125.0	130.0	128.0					4																	1389175		2200	4299	6499	SO:0001819	synonymous_variant	285464				ER-nucleus signaling pathway|negative regulation of protein kinase activity|regulation of cytoskeleton organization|response to estrogen stimulus	endoplasmic reticulum|nucleus|plasma membrane	protein binding	g.chr4:1389175C>T	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.876C>T	4.37:g.1389175C>T							p.L292L	NM_175918	NP_787114	Q8N1N5	CRPAK_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0106)		1	3836	+			292					Q8NB03	Silent	SNP	ENST00000324803.4	37	c.876C>T	CCDS3349.1																																																																																				0.687	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918		100	232	0	0	0	0.01441	0	100	232				
WHSC1	7468	broad.mit.edu	37	4	1952804	1952804	+	Silent	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:1952804G>T	ENST00000382895.3	+	12	2318	c.1887G>T	c.(1885-1887)tcG>tcT	p.S629S	WHSC1_ENST00000382892.2_Silent_p.S629S|WHSC1_ENST00000508803.1_Silent_p.S629S|WHSC1_ENST00000382888.3_5'Flank|WHSC1_ENST00000382891.5_Silent_p.S629S|WHSC1_ENST00000482415.2_3'UTR	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	629					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.S629S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TCTAGGTCTCGGACAGCCCGG	0.587			T	IGH@	MM																																		uc003gdz.3		NA		Dom	yes		4	4p16.3	7468	T	Wolf-Hirschhorn syndrome candidate 1(MMSET)			L	IGH@		MM		1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.(1885-1887)TCG>TCT		Wolf-Hirschhorn syndrome candidate 1 protein							66.0	63.0	64.0					4																	1952804		2203	4300	6503	SO:0001819	synonymous_variant	7468				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr4:1952804G>T	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.1887G>T	4.37:g.1952804G>T						WHSC1_uc003geb.3_Silent_p.S629S|WHSC1_uc003gec.3_Silent_p.S629S|WHSC1_uc003ged.3_Silent_p.S629S|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_5'UTR|WHSC1_uc011bvh.1_5'UTR|WHSC1_uc010icf.2_5'Flank	p.S629S	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)	10	2063	+		all_epithelial(65;1.34e-05)	629					A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	ENST00000382895.3	37	c.1887G>T	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	G	7.581	0.668739	0.14776	.	.	ENSG00000109685	ENST00000514329	.	.	.	5.77	-7.8	0.01214	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8058	0.40792	0.7031:0.0718:0.0916:0.1335	.	.	.	.	X	42	.	.	G	+	1	0	WHSC1	1922602	0.019000	0.18553	0.238000	0.24106	0.844000	0.47949	-1.448000	0.02394	-1.770000	0.01295	-0.793000	0.03317	GGA		0.587	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330		17	53	1	0	1.15088e-07	0.004007	1.46111e-07	17	53				
SLC2A9	56606	broad.mit.edu	37	4	9998467	9998467	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:9998467T>C	ENST00000264784.3	-	3	401	c.348A>G	c.(346-348)atA>atG	p.I116M	SLC2A9_ENST00000506583.1_Missense_Mutation_p.I87M|SLC2A9_ENST00000309065.3_Missense_Mutation_p.I87M	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	116					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)	p.I116M(1)|p.I87M(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	CGATGGCGAATATGGACACAG	0.498																																							uc003gmc.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(346-348)ATA>ATG		solute carrier family 2, member 9 protein							136.0	116.0	123.0					4																	9998467		2203	4300	6503	SO:0001583	missense	56606				glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity	g.chr4:9998467T>C	AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.348A>G	4.37:g.9998467T>C	ENSP00000264784:p.Ile116Met					SLC2A9_uc003gmd.2_Missense_Mutation_p.I87M	p.I116M	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN			3	409	-			116			Helical; Name=2; (Potential).		Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Missense_Mutation	SNP	ENST00000264784.3	37	c.348A>G	CCDS3407.1	.	.	.	.	.	.	.	.	.	.	T	9.729	1.161757	0.21538	.	.	ENSG00000109667	ENST00000506583;ENST00000264784;ENST00000309065;ENST00000513129	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	5.21	2.34	0.29019	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.103821	0.64402	D	0.000006	T	0.75339	0.3836	L	0.42487	1.325	0.30257	N	0.793543	D;P	0.58620	0.983;0.933	D;D	0.68943	0.959;0.961	T	0.68895	-0.5288	9	.	.	.	.	4.6709	0.12689	0.2282:0.0:0.1838:0.5881	.	87;116	Q9NRM0-2;Q9NRM0	.;GTR9_HUMAN	M	87;116;87;87	ENSP00000422209:I87M;ENSP00000264784:I116M;ENSP00000311383:I87M;ENSP00000426800:I87M	.	I	-	3	3	SLC2A9	9607565	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	0.838000	0.27572	0.958000	0.37956	0.524000	0.50904	ATA		0.498	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207055.1			14	43	0	0	0	0.006122	0	14	43				
LAP3	51056	broad.mit.edu	37	4	17590484	17590484	+	Silent	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:17590484C>T	ENST00000226299.4	+	7	1021	c.747C>T	c.(745-747)ctC>ctT	p.L249L	AC006160.5_ENST00000511010.1_RNA|LAP3_ENST00000503467.1_3'UTR|LAP3_ENST00000606142.1_Silent_p.L218L	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	249					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)	p.L249L(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						GATCATTCCTCAGTGTGGCCA	0.443																																							uc003gph.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(745-747)CTC>CTT		leucine aminopeptidase 3							107.0	106.0	106.0					4																	17590484		2203	4300	6503	SO:0001819	synonymous_variant	51056				proteolysis	nucleus	aminopeptidase activity|magnesium ion binding|manganese ion binding|metalloexopeptidase activity|zinc ion binding	g.chr4:17590484C>T	AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.747C>T	4.37:g.17590484C>T							p.L249L	NM_015907	NP_056991	P28838	AMPL_HUMAN			7	909	+			249					B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Silent	SNP	ENST00000226299.4	37	c.747C>T	CCDS3422.1																																																																																				0.443	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1			30	80	0	0	0	0.010818	0	30	80				
YIPF7	285525	broad.mit.edu	37	4	44638039	44638039	+	Silent	SNP	C	C	A	rs375403982		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:44638039C>A	ENST00000332990.5	-	3	268	c.252G>T	c.(250-252)tcG>tcT	p.S84S	YIPF7_ENST00000415895.4_Silent_p.S60S	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	84						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.S84S(2)		breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						CTGCGTAACCCGATGACATGA	0.413																																							uc010ifx.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(250-252)TCG>TCT		Yip1 domain family, member 7							90.0	89.0	89.0					4																	44638039		1916	4144	6060	SO:0001819	synonymous_variant	285525					endoplasmic reticulum membrane|integral to membrane		g.chr4:44638039C>A	AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.252G>T	4.37:g.44638039C>A						YIPF7_uc010ify.1_Silent_p.S84S	p.S84S	NM_182592	NP_872398	Q8N8F6	YIPF7_HUMAN			3	269	-			84					Q3SY21|Q3SY22	Silent	SNP	ENST00000332990.5	37	c.252G>T	CCDS54766.1	.	.	.	.	.	.	.	.	.	.	T	4.695	0.129224	0.08981	.	.	ENSG00000177752	ENST00000415895	.	.	.	5.02	-3.84	0.04256	.	.	.	.	.	T	0.28599	0.0708	.	.	.	0.18873	N	0.999981	.	.	.	.	.	.	T	0.33624	-0.9861	4	.	.	.	-9.5458	7.8378	0.29380	0.0:0.4105:0.3563:0.2333	.	.	.	.	W	61	.	.	G	-	1	0	YIPF7	44332796	0.000000	0.05858	0.001000	0.08648	0.045000	0.14185	-0.573000	0.05874	-0.843000	0.04189	-0.260000	0.10688	GGG		0.413	YIPF7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_182592		12	41	1	0	0.000151284	0.001855	0.0001767	12	41				
CWH43	80157	broad.mit.edu	37	4	49005982	49005982	+	Missense_Mutation	SNP	G	G	T	rs139364544		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:49005982G>T	ENST00000226432.4	+	7	1216	c.1033G>T	c.(1033-1035)Gct>Tct	p.A345S	CWH43_ENST00000513409.1_Missense_Mutation_p.A318S	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	345					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)		p.A345S(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						AGGTGTCTACGCTAGAGAAAG	0.393																																							uc003gyv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1033-1035)GCT>TCT		cell wall biogenesis 43 C-terminal homolog							56.0	55.0	56.0					4																	49005982		2203	4300	6503	SO:0001583	missense	80157				GPI anchor biosynthetic process	integral to membrane		g.chr4:49005982G>T		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1033G>T	4.37:g.49005982G>T	ENSP00000226432:p.Ala345Ser					CWH43_uc011bzl.1_Missense_Mutation_p.A318S	p.A345S	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN			7	1215	+			345					B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	37	c.1033G>T	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123444	0.37436	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.44482	1.5;0.92	4.72	3.88	0.44766	.	0.000000	0.56097	D	0.000037	T	0.41236	0.1150	M	0.65975	2.015	0.33392	D	0.576217	B	0.25105	0.118	B	0.30572	0.117	T	0.51911	-0.8645	9	.	.	.	.	10.1053	0.42530	0.1618:0.0:0.8382:0.0	.	345	Q9H720	PG2IP_HUMAN	S	345;318	ENSP00000226432:A345S;ENSP00000422802:A318S	.	A	+	1	0	CWH43	48700739	0.762000	0.28451	0.995000	0.50966	0.658000	0.38924	1.422000	0.34826	1.367000	0.46095	-0.137000	0.14449	GCT		0.393	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087		9	23	1	0	0.000442599	0.006214	0.000500926	9	23				
KDR	3791	broad.mit.edu	37	4	55981449	55981449	+	Splice_Site	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:55981449G>T	ENST00000263923.4	-	4	783	c.488C>A	c.(487-489)gCa>gAa	p.A163E		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	163	Ig-like C2-type 2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.A163E(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCAACTTACTGCACAAAGTGA	0.358			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																													uc003has.2		NA		Dom	yes		4	4q11-q12	3791	Mis	vascular endothelial growth factor receptor 2			E			NSCLC|angiosarcoma		1	Substitution - Missense(1)		lung(1)	lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33						c.(487-489)GCA>GAA		kinase insert domain receptor precursor	Sorafenib(DB00398)|Sunitinib(DB01268)						119.0	112.0	114.0					4																	55981449		2203	4300	6503	SO:0001630	splice_region_variant	3791	Familial_Infantile_Hemangioma			angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity	g.chr4:55981449G>T	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.489+1C>A	4.37:g.55981449G>T		TSP Lung(20;0.16)				KDR_uc003hat.1_Missense_Mutation_p.A163E|KDR_uc011bzx.1_Missense_Mutation_p.A163E	p.A163E	NM_002253	NP_002244	P35968	VGFR2_HUMAN	Epithelial(7;0.189)		4	790	-	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		163			Ig-like C2-type 2.|Extracellular (Potential).		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	c.488C>A	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985289	0.93044	.	.	ENSG00000128052	ENST00000263923	T	0.45668	0.89	5.75	5.75	0.90469	Immunoglobulin-like fold (1);	0.052413	0.85682	D	0.000000	T	0.55513	0.1925	L	0.38838	1.175	0.52501	D	0.999957	D;D	0.89917	1.0;0.975	D;P	0.91635	0.999;0.698	T	0.44513	-0.9323	10	0.28530	T	0.3	.	18.121	0.89571	0.0:0.0:1.0:0.0	.	163;163	P35968-2;P35968	.;VGFR2_HUMAN	E	163	ENSP00000263923:A163E	ENSP00000263923:A163E	A	-	2	0	KDR	55676206	1.000000	0.71417	0.983000	0.44433	0.946000	0.59487	6.022000	0.70839	2.708000	0.92522	0.655000	0.94253	GCA		0.358	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		Missense_Mutation	11	27	1	0	6.40141e-05	0.010729	7.50688e-05	11	27				
NPFFR2	10886	broad.mit.edu	37	4	73012884	73012884	+	Nonsense_Mutation	SNP	C	C	A	rs370050336		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:73012884C>A	ENST00000308744.6	+	4	1022	c.924C>A	c.(922-924)tgC>tgA	p.C308*	NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000358749.3_Nonsense_Mutation_p.C206*|NPFFR2_ENST00000395999.1_Nonsense_Mutation_p.C209*|NPFFR2_ENST00000344413.5_3'UTR	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	308					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)	p.C308*(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TCTACTGGTGCCGGGAAGACT	0.458																																							uc003hgg.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(922-924)TGC>TGA		neuropeptide FF receptor 2 isoform 1							105.0	95.0	99.0					4																	73012884		2203	4300	6503	SO:0001587	stop_gained	10886				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity	g.chr4:73012884C>A	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.924C>A	4.37:g.73012884C>A	ENSP00000307822:p.Cys308*					NPFFR2_uc010iig.1_Nonsense_Mutation_p.C90*|NPFFR2_uc003hgi.2_Nonsense_Mutation_p.C209*|NPFFR2_uc003hgh.2_Nonsense_Mutation_p.C206*|NPFFR2_uc003hgj.2_RNA	p.C308*	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)		4	1022	+			308			Extracellular (Potential).		Q96RV1|Q9NR49	Nonsense_Mutation	SNP	ENST00000308744.6	37	c.924C>A	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265014	0.59431	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	.	.	.	5.91	2.29	0.28610	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.7339	0.23399	0.0:0.6128:0.1178:0.2693	.	.	.	.	X	308;209;206	.	ENSP00000307822:C308X	C	+	3	2	NPFFR2	73231748	0.608000	0.26966	0.994000	0.49952	0.052000	0.14988	0.956000	0.29202	0.113000	0.18004	-0.777000	0.03380	TGC		0.458	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885		20	64	1	0	8.00594e-06	0.007413	9.74056e-06	20	64				
FRAS1	80144	broad.mit.edu	37	4	79432632	79432632	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:79432632G>T	ENST00000264895.6	+	64	10425	c.9985G>T	c.(9985-9987)Gat>Tat	p.D3329Y		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3325					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.D3330Y(1)|p.D3329Y(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GAAATACCTGGATGTCAAACA	0.512																																							uc003hlb.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(5)	5						c.(9985-9987)GAT>TAT		Fraser syndrome 1							49.0	48.0	48.0					4																	79432632		1969	4156	6125	SO:0001583	missense	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79432632G>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.9985G>T	4.37:g.79432632G>T	ENSP00000264895:p.Asp3329Tyr					FRAS1_uc003hlc.1_Missense_Mutation_p.D331Y	p.D3329Y	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN			64	10425	+			3324			Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	c.9985G>T	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.733974|4.733974	0.89482|0.89482	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.14144|.	2.53|.	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75874|0.75874	0.3909|0.3909	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.83275|.	0.996;0.996|.	T|T	0.72381|0.72381	-0.4311|-0.4311	10|5	0.66056|.	D|.	0.02|.	.|.	20.1882|20.1882	0.98224|0.98224	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3328;3329|.	Q86XX4-2;E9PHH6|.	.;.|.	Y|V	3329|1557	ENSP00000264895:D3329Y|.	ENSP00000264895:D3329Y|.	D|G	+|+	1|2	0|0	FRAS1|FRAS1	79651656|79651656	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.893000|0.893000	0.52053|0.52053	9.657000|9.657000	0.98554|0.98554	2.783000|2.783000	0.95769|0.95769	0.591000|0.591000	0.81541|0.81541	GAT|GGA		0.512	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				10	20	1	0	2.17888e-05	0.006214	2.60751e-05	10	20				
USP38	84640	broad.mit.edu	37	4	144124648	144124648	+	Silent	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:144124648T>C	ENST00000307017.4	+	5	1644	c.1138T>C	c.(1138-1140)Ttg>Ctg	p.L380L	USP38_ENST00000510377.1_Silent_p.L380L	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	380					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.L380L(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					ATTAACAGAATTGATACACTG	0.333																																							uc003ijb.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|ovary(1)|breast(1)|pancreas(1)	5						c.(1138-1140)TTG>CTG		ubiquitin specific peptidase 38							151.0	140.0	144.0					4																	144124648		2203	4299	6502	SO:0001819	synonymous_variant	84640				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr4:144124648T>C	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.1138T>C	4.37:g.144124648T>C						USP38_uc003ija.3_Silent_p.L380L|USP38_uc003ijc.2_RNA	p.L380L	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN			5	1672	+	all_hematologic(180;0.158)		380					B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Silent	SNP	ENST00000307017.4	37	c.1138T>C	CCDS3758.1																																																																																				0.333	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557		32	63	0	0	0	0.013726	0	32	63				
RXFP1	59350	broad.mit.edu	37	4	159573154	159573154	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:159573154C>A	ENST00000307765.5	+	18	2472	c.2221C>A	c.(2221-2223)Ccc>Acc	p.P741T	RXFP1_ENST00000470033.1_Missense_Mutation_p.P708T|RXFP1_ENST00000343542.5_Missense_Mutation_p.P693T|RXFP1_ENST00000460056.2_Missense_Mutation_p.P660T|RXFP1_ENST00000448688.2_Missense_Mutation_p.P636T	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	741					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)	p.P741T(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		TTTCACATACCCCTGTGAAAT	0.443																																							uc003ipz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2221-2223)CCC>ACC		relaxin/insulin-like family peptide receptor 1							114.0	107.0	109.0					4																	159573154		1871	4115	5986	SO:0001583	missense	59350					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding	g.chr4:159573154C>A	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.2221C>A	4.37:g.159573154C>A	ENSP00000303248:p.Pro741Thr					RXFP1_uc011cja.1_Missense_Mutation_p.P636T|RXFP1_uc010iqo.2_Missense_Mutation_p.P693T|RXFP1_uc011cjb.1_Missense_Mutation_p.P639T|RXFP1_uc010iqk.2_Missense_Mutation_p.P609T|RXFP1_uc011cjc.1_Missense_Mutation_p.P660T|RXFP1_uc011cjd.1_Missense_Mutation_p.P660T|RXFP1_uc010iql.2_Missense_Mutation_p.P585T|RXFP1_uc011cje.1_Missense_Mutation_p.P768T|RXFP1_uc010iqm.2_Missense_Mutation_p.P708T|RXFP1_uc011cjf.1_Missense_Mutation_p.P610T|RXFP1_uc010iqn.2_Missense_Mutation_p.P686T	p.P741T	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN		COAD - Colon adenocarcinoma(41;0.0219)	18	2303	+	all_hematologic(180;0.24)	Renal(120;0.0854)	741			Cytoplasmic (Potential).		B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	37	c.2221C>A	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507787	0.27036	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	T;T;T;T;T	0.69175	-0.23;-0.33;-0.19;-0.38;-0.33	5.75	0.132	0.14762	.	0.635184	0.16337	N	0.218868	T	0.47284	0.1437	L	0.29908	0.895	0.27593	N	0.949224	B;B;B;B;B;B;B;B	0.25441	0.062;0.126;0.025;0.102;0.043;0.032;0.025;0.025	B;B;B;B;B;B;B;B	0.24701	0.036;0.055;0.015;0.054;0.054;0.021;0.024;0.024	T	0.34153	-0.9840	10	0.45353	T	0.12	.	4.1765	0.10355	0.1968:0.2285:0.0:0.5747	.	752;768;636;693;708;660;611;741	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q9HBX9	.;.;.;.;.;.;.;RXFP1_HUMAN	T	660;741;636;693;708;611	ENSP00000423306:P660T;ENSP00000303248:P741T;ENSP00000414885:P636T;ENSP00000345889:P693T;ENSP00000420712:P708T	ENSP00000303248:P741T	P	+	1	0	RXFP1	159792604	0.985000	0.35326	0.998000	0.56505	0.440000	0.31957	0.367000	0.20382	0.049000	0.15920	0.655000	0.94253	CCC		0.443	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634		15	55	1	0	1.3612e-06	0.003163	1.69137e-06	15	55				
DDX60	55601	broad.mit.edu	37	4	169190053	169190053	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:169190053G>A	ENST00000393743.3	-	20	3029	c.2738C>T	c.(2737-2739)cCc>cTc	p.P913L		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	913	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.P913L(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		AGCCAAAAAGGGACATCGGAT	0.358																																							uc003irp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2737-2739)CCC>CTC		DEAD (Asp-Glu-Ala-Asp) box polypeptide 60							104.0	102.0	102.0					4																	169190053		2203	4300	6503	SO:0001583	missense	55601						ATP binding|ATP-dependent helicase activity|RNA binding	g.chr4:169190053G>A	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.2738C>T	4.37:g.169190053G>A	ENSP00000377344:p.Pro913Leu						p.P913L	NM_017631	NP_060101	Q8IY21	DDX60_HUMAN		GBM - Glioblastoma multiforme(119;0.0485)	20	3030	-		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)	913			Helicase ATP-binding.		Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	c.2738C>T	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310108	0.81358	.	.	ENSG00000137628	ENST00000393743;ENST00000537338	T	0.15603	2.41	5.56	5.56	0.83823	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.64402	D	0.000004	T	0.54447	0.1859	M	0.93106	3.38	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.65586	-0.6132	10	0.87932	D	0	.	19.1245	0.93376	0.0:0.0:1.0:0.0	.	913	Q8IY21	DDX60_HUMAN	L	913;5	ENSP00000377344:P913L	ENSP00000377344:P913L	P	-	2	0	DDX60	169426628	1.000000	0.71417	0.999000	0.59377	0.848000	0.48234	6.230000	0.72301	2.628000	0.89032	0.455000	0.32223	CCC		0.358	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631		29	81	0	0	0	0.003755	0	29	81				
PALLD	23022	broad.mit.edu	37	4	169611777	169611777	+	Silent	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:169611777G>A	ENST00000505667.1	+	7	1532	c.1359G>A	c.(1357-1359)gcG>gcA	p.A453A	PALLD_ENST00000333488.4_Silent_p.A330A|PALLD_ENST00000335742.7_Silent_p.A71A|PALLD_ENST00000261509.6_Silent_p.A453A|PALLD_ENST00000512127.1_Silent_p.A71A			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	453	Ig-like C2-type 2.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)	p.A453A(1)|p.A71A(1)		breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CAGCCGTGGCGGAAGGCCAGG	0.502									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)	Esophageal Squamous(109;1482 1532 18347 40239 51172)	uc011cjx.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1357-1359)GCG>GCA		palladin isoform 2							83.0	96.0	92.0					4																	169611777		2203	4300	6503	SO:0001819	synonymous_variant	23022	Pancreatic_Cancer_Familial_Clustering_of	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding	g.chr4:169611777G>A	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1359G>A	4.37:g.169611777G>A						PALLD_uc003iru.2_Silent_p.A453A|PALLD_uc003irv.2_Silent_p.A71A	p.A453A	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN		GBM - Glioblastoma multiforme(119;0.204)	7	1570	+		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)	453			Ig-like C2-type 2.		B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Silent	SNP	ENST00000505667.1	37	c.1359G>A	CCDS54818.1																																																																																				0.502	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081		56	146	0	0	0	0.01441	0	56	146				
FAT1	2195	broad.mit.edu	37	4	187628565	187628565	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr4:187628565C>T	ENST00000441802.2	-	2	2626	c.2417G>A	c.(2416-2418)cGt>cAt	p.R806H		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	806	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R806H(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ATGTAGAAGACGCCACGCAGC	0.443										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(2416-2418)CGT>CAT		FAT tumor suppressor 1 precursor							191.0	190.0	190.0					4																	187628565		1979	4157	6136	SO:0001583	missense	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187628565C>T	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.2417G>A	4.37:g.187628565C>T	ENSP00000406229:p.Arg806His	HNSCC(5;0.00058)				FAT1_uc010iso.1_Missense_Mutation_p.R806H	p.R806H	NM_005245	NP_005236	Q14517	FAT1_HUMAN			2	2605	-			806			Extracellular (Potential).|Cadherin 6.			Missense_Mutation	SNP	ENST00000441802.2	37	c.2417G>A	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	6.722	0.501952	0.12822	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.51325	0.71	4.81	-2.09	0.07232	Cadherin (4);Cadherin-like (1);	0.389091	0.31797	N	0.007054	T	0.28267	0.0698	L	0.35288	1.05	0.45607	D	0.998549	B	0.15473	0.013	B	0.13407	0.009	T	0.14420	-1.0473	10	0.14252	T	0.57	.	8.5936	0.33701	0.0:0.3877:0.1011:0.5112	.	806	Q14517	FAT1_HUMAN	H	806	ENSP00000406229:R806H	ENSP00000260147:R806H	R	-	2	0	FAT1	187865559	0.012000	0.17670	0.359000	0.25824	0.132000	0.20833	0.007000	0.13174	-0.830000	0.04262	-0.339000	0.08088	CGT		0.443	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		55	153	0	0	0	0.01441	0	55	153				
FBXL7	23194	broad.mit.edu	37	5	15928306	15928306	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:15928306C>A	ENST00000504595.1	+	3	916	c.435C>A	c.(433-435)taC>taA	p.Y145*	FBXL7_ENST00000510662.1_Nonsense_Mutation_p.Y98*|FBXL7_ENST00000329673.7_Nonsense_Mutation_p.Y133*	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	145	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.Y145*(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						GCCGCTGGTACAACCTGGCCT	0.672																																							uc003jfn.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|lung(1)	3						c.(433-435)TAC>TAA		F-box and leucine-rich repeat protein 7							15.0	18.0	17.0					5																	15928306		2066	4213	6279	SO:0001587	stop_gained	23194				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:15928306C>A	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.435C>A	5.37:g.15928306C>A	ENSP00000423630:p.Tyr145*						p.Y145*	NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN			3	916	+			145			F-box.		B9EGF1|D6RDY7|O94926	Nonsense_Mutation	SNP	ENST00000504595.1	37	c.435C>A	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851082	0.91277	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	.	.	.	5.46	5.46	0.80206	.	0.054964	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8978	0.41329	0.0:0.8486:0.0:0.1514	.	.	.	.	X	145;98;133	.	ENSP00000329632:Y133X	Y	+	3	2	FBXL7	15981306	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.178000	0.50879	2.576000	0.86940	0.561000	0.74099	TAC		0.672	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304		5	11	1	0	0.00116845	0.001168	0.00130723	5	11				
UGT3A1	133688	broad.mit.edu	37	5	35957471	35957471	+	Silent	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:35957471C>A	ENST00000274278.3	-	5	1251	c.894G>T	c.(892-894)gtG>gtT	p.V298V	UGT3A1_ENST00000503189.1_Silent_p.V298V|UGT3A1_ENST00000507113.1_Silent_p.V264V|UGT3A1_ENST00000513233.1_5'UTR	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	298						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.V298V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGCCAAAGGCCACAAGGACAA	0.488																																							uc003jjv.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(892-894)GTG>GTT		UDP glycosyltransferase 3 family, polypeptide A1							100.0	87.0	91.0					5																	35957471		2203	4300	6503	SO:0001819	synonymous_variant	133688					integral to membrane	glucuronosyltransferase activity	g.chr5:35957471C>A		CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.894G>T	5.37:g.35957471C>A						UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Silent_p.V298V|UGT3A1_uc011cor.1_Silent_p.V264V	p.V298V	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		5	1051	-	all_lung(31;0.000197)		298			Extracellular (Potential).		G5E961|Q8IYS9|Q8NAW4|Q96DM6	Silent	SNP	ENST00000274278.3	37	c.894G>T	CCDS3913.1																																																																																				0.488	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253770.2	NM_152404		16	40	1	0	6.94344e-10	0.006122	9.38651e-10	16	40				
MAST4	375449	broad.mit.edu	37	5	66460901	66460901	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:66460901G>T	ENST00000403625.2	+	29	6189	c.5894G>T	c.(5893-5895)aGg>aTg	p.R1965M	MAST4_ENST00000405643.1_Missense_Mutation_p.R1786M|MAST4_ENST00000403666.1_Missense_Mutation_p.R1776M|MAST4_ENST00000261569.7_Missense_Mutation_p.R1771M|MAST4_ENST00000404260.3_Missense_Mutation_p.R1968M	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1968						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.R1968M(1)		breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCCCCCTCAAGGGAGAAGCCA	0.647																																							uc003jut.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13						c.(5326-5328)AGG>ATG		microtubule associated serine/threonine kinase							20.0	25.0	23.0					5																	66460901		1960	4149	6109	SO:0001583	missense	375449					cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr5:66460901G>T	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.5894G>T	5.37:g.66460901G>T	ENSP00000385727:p.Arg1965Met					MAST4_uc003juw.2_Missense_Mutation_p.R1704M|MAST4_uc003jux.2_5'Flank	p.R1776M	NM_015183	NP_055998	O15021	MAST4_HUMAN		Lung(70;0.011)	28	5395	+		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)	1968					A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	c.5327G>T	CCDS54861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.49|18.49	3.635314|3.635314	0.67130|0.67130	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000443808|ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569	.|T;T;T;T;T	.|0.69806	.|-0.41;-0.41;-0.43;-0.43;-0.41	4.99|4.99	-0.0531|-0.0531	0.13819|0.13819	.|.	.|8.422420	.|0.00166	.|N	.|0.000003	T|T	0.70885|0.70885	0.3275|0.3275	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	.|D;D	.|0.69078	.|0.994;0.997	.|P;P	.|0.58873	.|0.707;0.847	T|T	0.58836|0.58836	-0.7566|-0.7566	5|10	.|0.72032	.|D	.|0.01	-13.56|-13.56	8.8749|8.8749	0.35339|0.35339	0.6053:0.0:0.3947:0.0|0.6053:0.0:0.3947:0.0	.|.	.|1968;1776	.|O15021;O15021-3	.|MAST4_HUMAN;.	N|M	1021|1968;1965;1776;1786;1786;1771	.|ENSP00000385048:R1968M;ENSP00000385727:R1965M;ENSP00000384313:R1776M;ENSP00000384099:R1786M;ENSP00000261569:R1771M	.|ENSP00000261569:R1771M	K|R	+|+	3|2	2|0	MAST4|MAST4	66496657|66496657	0.988000|0.988000	0.35896|0.35896	0.066000|0.066000	0.19879|0.19879	0.314000|0.314000	0.28054|0.28054	1.422000|1.422000	0.34826|0.34826	0.020000|0.020000	0.15106|0.15106	0.563000|0.563000	0.77884|0.77884	AAG|AGG		0.647	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2			3	10	1	0	0.004672	0.004672	0.00507146	3	10				
PIK3R1	5295	broad.mit.edu	37	5	67589621	67589621	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:67589621G>T	ENST00000521381.1	+	11	2000	c.1384G>T	c.(1384-1386)Gaa>Taa	p.E462*	PIK3R1_ENST00000523872.1_Nonsense_Mutation_p.E99*|PIK3R1_ENST00000521657.1_Nonsense_Mutation_p.E462*|PIK3R1_ENST00000320694.8_Nonsense_Mutation_p.E162*|PIK3R1_ENST00000274335.5_Nonsense_Mutation_p.E462*|PIK3R1_ENST00000336483.5_Nonsense_Mutation_p.E192*|PIK3R1_ENST00000396611.1_Nonsense_Mutation_p.E462*	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	462					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.E162*(1)|p.E192*(1)|p.0?(1)|p.?(1)|p.E462*(1)|p.E462_R465delEYDR(1)|p.T454_D464del(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	AAAAAGTCGAGAATATGATAG	0.284			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																													uc003jva.2		NA		Rec	yes		5	5q13.1	5295	Mis|F|O	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""			"""E, O"""			gliobastoma|ovarian|colorectal		7	Substitution - Nonsense(3)|Deletion - In frame(2)|Whole gene deletion(1)|Unknown(1)	p.D434_Q475del(2)|p.T454_D464del(1)|p.?(1)	lung(5)|large_intestine(1)|endometrium(1)	endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101						c.(1384-1386)GAA>TAA		phosphoinositide-3-kinase, regulatory subunit 1	Isoproterenol(DB01064)						45.0	48.0	47.0					5																	67589621		2183	4267	6450	SO:0001587	stop_gained	5295				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	g.chr5:67589621G>T	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1384G>T	5.37:g.67589621G>T	ENSP00000428056:p.Glu462*	TCGA GBM(4;<1E-08)				PIK3R1_uc003jvb.2_Nonsense_Mutation_p.E462*|PIK3R1_uc003jvc.2_Nonsense_Mutation_p.E162*|PIK3R1_uc003jvd.2_Nonsense_Mutation_p.E192*|PIK3R1_uc003jve.2_Nonsense_Mutation_p.E141*|PIK3R1_uc011crb.1_Nonsense_Mutation_p.E132*	p.E462*	NM_181523	NP_852664	P27986	P85A_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	11	1944	+		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)	462					B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Nonsense_Mutation	SNP	ENST00000521381.1	37	c.1384G>T	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	G	37	6.502411	0.97620	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000521409;ENST00000336483;ENST00000519025;ENST00000523872	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-27.0775	19.0691	0.93125	0.0:0.0:1.0:0.0	.	.	.	.	X	462;462;462;462;162;99;192;135;99	.	ENSP00000274335:E462X	E	+	1	0	PIK3R1	67625377	1.000000	0.71417	0.994000	0.49952	0.883000	0.51084	9.208000	0.95075	2.822000	0.97130	0.650000	0.86243	GAA		0.284	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504		26	58	1	0	3.6726e-16	0.003954	5.95778e-16	26	58				
MAP1B	4131	broad.mit.edu	37	5	71490202	71490202	+	Silent	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:71490202C>T	ENST00000296755.7	+	5	1318	c.1020C>T	c.(1018-1020)acC>acT	p.T340T		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	340					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.T340T(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AGGGCTCCACCACAAATAGTG	0.448																																					Melanoma(17;367 822 11631 31730 47712)	Melanoma(17;367 822 11631 31730 47712)	uc003kbw.3		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5						c.(1018-1020)ACC>ACT		microtubule-associated protein 1B							56.0	49.0	51.0					5																	71490202		2203	4300	6503	SO:0001819	synonymous_variant	4131					microtubule|microtubule associated complex	structural molecule activity	g.chr5:71490202C>T	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.1020C>T	5.37:g.71490202C>T						MAP1B_uc010iyw.1_Silent_p.T357T|MAP1B_uc010iyx.1_Silent_p.T214T|MAP1B_uc010iyy.1_Silent_p.T214T	p.T340T	NM_005909	NP_005900	P46821	MAP1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)	5	1261	+		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)	340					A2BDK5	Silent	SNP	ENST00000296755.7	37	c.1020C>T	CCDS4012.1																																																																																				0.448	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909		20	45	0	0	0	0.008871	0	20	45				
TMEM171	134285	broad.mit.edu	37	5	72419665	72419665	+	Silent	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:72419665C>T	ENST00000454765.2	+	2	938	c.465C>T	c.(463-465)ccC>ccT	p.P155P	TMEM171_ENST00000287773.5_Silent_p.P155P			Q8WVE6	TM171_HUMAN	transmembrane protein 171	155						integral component of membrane (GO:0016021)		p.P155P(1)		endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)	15		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		ACTCAGAGCCCCGGATGTGTG	0.562																																					NSCLC(112;638 2280 27369 30736)	NSCLC(112;638 2280 27369 30736)	uc003kcm.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(463-465)CCC>CCT		transmembrane protein 171 isoform 1							128.0	132.0	131.0					5																	72419665		2203	4300	6503	SO:0001819	synonymous_variant	134285					integral to membrane		g.chr5:72419665C>T	BC018083	CCDS4017.1, CCDS54869.1	5q13.2	2008-02-05			ENSG00000157111	ENSG00000157111			27031	protein-coding gene	gene with protein product						12477932	Standard	NM_173490		Approved	PRP2	uc003kcm.2	Q8WVE6	OTTHUMG00000131269	ENST00000454765.2:c.465C>T	5.37:g.72419665C>T						TMEM171_uc003kcn.3_Silent_p.P155P	p.P155P	NM_173490	NP_775761	Q8WVE6	TM171_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)	2	669	+		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)	155					Q8N0S1|Q8TDT7	Silent	SNP	ENST00000454765.2	37	c.465C>T	CCDS4017.1																																																																																				0.562	TMEM171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254037.2	NM_173490		46	119	0	0	0	0.01441	0	46	119				
PCDHB2	56133	broad.mit.edu	37	5	140475340	140475340	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:140475340G>T	ENST00000194155.4	+	1	1114	c.966G>T	c.(964-966)caG>caT	p.Q322H		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	322	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.Q322H(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAAATATTCAGGCGACAGATG	0.418																																							uc003lil.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(964-966)CAG>CAT		protocadherin beta 2 precursor							95.0	97.0	96.0					5																	140475340		2203	4300	6503	SO:0001583	missense	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140475340G>T	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.966G>T	5.37:g.140475340G>T	ENSP00000194155:p.Gln322His					PCDHB2_uc003lim.1_Translation_Start_Site	p.Q322H	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1104	+			322			Extracellular (Potential).|Cadherin 3.		Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	c.966G>T	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283412	0.40394	.	.	ENSG00000112852	ENST00000194155	T	0.61040	0.14	5.38	3.57	0.40892	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.72684	0.3491	M	0.88906	2.99	0.35427	D	0.793701	D	0.54772	0.968	P	0.59115	0.852	T	0.80427	-0.1387	9	0.87932	D	0	.	6.9767	0.24679	0.3441:0.0:0.6559:0.0	.	322	Q9Y5E7	PCDB2_HUMAN	H	322	ENSP00000194155:Q322H	ENSP00000194155:Q322H	Q	+	3	2	PCDHB2	140455524	0.004000	0.15560	1.000000	0.80357	0.735000	0.41995	0.087000	0.14958	1.418000	0.47098	-0.145000	0.13849	CAG		0.418	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		33	67	1	0	4.74835e-14	0.010818	7.4947e-14	33	67				
PCDHB17	54661	broad.mit.edu	37	5	140537229	140537229	+	Silent	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:140537229G>T	ENST00000539533.1	+	1	1653	c.1653G>T	c.(1651-1653)ctG>ctT	p.L551L						protocadherin beta 17 pseudogene									p.L551L(2)									TGCGCGTGCTGGTGTGCTGGA	0.711																																							uc003lis.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(1648-1650)CTG>CTT		SubName: Full=Protocadherin-psi1;																																				SO:0001819	synonymous_variant	54661							g.chr5:140537229G>T	AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.1653G>T	5.37:g.140537229G>T							p.L550L	NR_001280						1	1650	+									Silent	SNP	ENST00000539533.1	37	c.1650G>T																																																																																					0.711	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				35	47	1	0	2.09667e-21	0.003755	3.62264e-21	35	47				
PCDHB12	56124	broad.mit.edu	37	5	140589383	140589383	+	Missense_Mutation	SNP	A	A	T	rs147813756		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:140589383A>T	ENST00000239450.2	+	1	1093	c.904A>T	c.(904-906)Act>Tct	p.T302S	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	302	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T302S(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTGACATTACTTTAACAGC	0.368																																							uc003liz.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(904-906)ACT>TCT		protocadherin beta 12 precursor							72.0	76.0	75.0					5																	140589383		2203	4300	6503	SO:0001583	missense	56124				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140589383A>T	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.904A>T	5.37:g.140589383A>T	ENSP00000239450:p.Thr302Ser					PCDHB12_uc011dak.1_Intron	p.T302S	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1093	+			302			Extracellular (Potential).|Cadherin 3.		B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	c.904A>T	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	A	1.988	-0.432542	0.04669	.	.	ENSG00000120328	ENST00000239450	T	0.01152	5.26	4.06	-1.26	0.09376	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01061	0.0035	L	0.37697	1.125	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.46582	-0.9181	9	0.15952	T	0.53	.	7.1521	0.25616	0.3593:0.521:0.1196:0.0	.	302	Q9Y5F1	PCDBC_HUMAN	S	302	ENSP00000239450:T302S	ENSP00000239450:T302S	T	+	1	0	PCDHB12	140569567	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-3.202000	0.00560	0.047000	0.15862	0.402000	0.26972	ACT		0.368	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932		38	83	0	0	0	0.003755	0	38	83				
PCDHGA4	56111	broad.mit.edu	37	5	140736276	140736276	+	Silent	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:140736276C>G	ENST00000571252.1	+	1	1509	c.1509C>G	c.(1507-1509)tcC>tcG	p.S503S	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	503	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTGTCCTCCTATGTCTCCA	0.507																																							uc003ljq.1		NA																	0					0						c.(1507-1509)TCC>TCG		protocadherin gamma subfamily A, 4 isoform 1							128.0	135.0	132.0					5																	140736276		2092	4250	6342	SO:0001819	synonymous_variant	56111				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140736276C>G	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1509C>G	5.37:g.140736276C>G						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Silent_p.S503S	p.S503S	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1509	+			503			Extracellular (Potential).|Cadherin 5.		Q9Y5D3	Silent	SNP	ENST00000571252.1	37	c.1509C>G	CCDS58979.1																																																																																				0.507	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917		56	128	0	0	0	0.01441	0	56	128				
DCTN4	51164	broad.mit.edu	37	5	150121678	150121678	+	Silent	SNP	G	G	T	rs200338052		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:150121678G>T	ENST00000447998.2	-	4	542	c.427C>A	c.(427-429)Cgg>Agg	p.R143R	DCTN4_ENST00000424236.1_Silent_p.R86R|DCTN4_ENST00000521093.1_Intron|DCTN4_ENST00000446090.2_Silent_p.R143R	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	143					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)	p.R143R(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTACTTACCCGTTGTGTGTGA	0.338																																							uc003lsv.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(427-429)CGG>AGG		dynactin 4 (p62) isoform b							157.0	174.0	168.0					5																	150121678		2203	4300	6503	SO:0001819	synonymous_variant	51164					centrosome|nucleus	protein N-terminus binding	g.chr5:150121678G>T	AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.427C>A	5.37:g.150121678G>T						DCTN4_uc003lsu.2_Silent_p.R86R|DCTN4_uc010jhi.2_Silent_p.R143R|DCTN4_uc010jhj.2_Intron|DCTN4_uc011dck.1_Silent_p.R86R	p.R143R	NM_016221	NP_057305	Q9UJW0	DCTN4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		4	529	-		Medulloblastoma(196;0.167)	143					B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Silent	SNP	ENST00000447998.2	37	c.427C>A	CCDS4310.1																																																																																				0.338	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252372.1			107	207	1	0	2.38168e-41	0.01441	4.51592e-41	107	207				
FAM71B	153745	broad.mit.edu	37	5	156592744	156592744	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr5:156592744T>C	ENST00000302938.4	-	1	531	c.436A>G	c.(436-438)Act>Gct	p.T146A		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	146						nucleus (GO:0005634)		p.T146A(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTACGGCCAGTGGCGAGTTTC	0.493																																							uc003lwn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|skin(1)	6						c.(436-438)ACT>GCT		family with sequence similarity 71, member B							96.0	101.0	99.0					5																	156592744		2203	4300	6503	SO:0001583	missense	153745					nucleus		g.chr5:156592744T>C		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.436A>G	5.37:g.156592744T>C	ENSP00000305596:p.Thr146Ala						p.T146A	NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		1	536	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	146					Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	c.436A>G	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	T	14.73	2.623476	0.46840	.	.	ENSG00000170613	ENST00000302938	T	0.19394	2.15	4.56	4.56	0.56223	.	0.206543	0.33364	N	0.004994	T	0.43322	0.1242	M	0.73962	2.25	0.35498	D	0.799524	D	0.76494	0.999	D	0.71656	0.974	T	0.57854	-0.7739	10	0.62326	D	0.03	-22.3022	10.8845	0.46960	0.0:0.0:0.0:1.0	.	146	Q8TC56	FA71B_HUMAN	A	146	ENSP00000305596:T146A	ENSP00000305596:T146A	T	-	1	0	FAM71B	156525322	1.000000	0.71417	1.000000	0.80357	0.261000	0.26267	4.052000	0.57420	1.999000	0.58509	0.533000	0.62120	ACT		0.493	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		37	74	0	0	0	0.003755	0	37	74				
BLOC1S5-TXNDC5	100526836	broad.mit.edu	37	6	7988040	7988040	+	Intron	SNP	T	T	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr6:7988040T>A	ENST00000439343.2	-	4	372				TXNDC5_ENST00000539054.1_Intron					BLOC1S5-TXNDC5 readthrough (NMD candidate)									p.F424Y(1)									CGCCCAGGCTTCTACGCTGAA	0.473																																							uc003mxx.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1270-1272)TTC>TAC		RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;																																				SO:0001627	intron_variant	206426							g.chr6:7988040T>A			6p24.3	2013-05-09	2013-05-09	2012-08-01	ENSG00000259040	ENSG00000259040			42001	other	readthrough			"""MUTED-TXNDC5 readthrough (non-protein coding)"""	MUTED-TXNDC5			Standard	NR_037616		Approved				OTTHUMG00000171453	ENST00000439343.2:c.372+38559A>T	6.37:g.7988040T>A						TXNDC5_uc003mxw.2_Intron	p.F424Y	NR_027712						1	1706	+									Missense_Mutation	SNP	ENST00000439343.2	37	c.1271T>A																																																																																					0.473	BLOC1S5-TXNDC5-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding	OTTHUMT00000413472.1	NR_037616.1		28	111	0	0	0	0.007291	0	28	111				
JARID2	3720	broad.mit.edu	37	6	15452366	15452366	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr6:15452366G>T	ENST00000341776.2	+	4	697	c.453G>T	c.(451-453)aaG>aaT	p.K151N	JARID2_ENST00000397311.3_5'UTR|JARID2_ENST00000541660.1_Missense_Mutation_p.K113N	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	151					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.K151N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CTAAAAGGAAGCCTAAGACAG	0.483																																							uc003nbj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|pancreas(1)	4						c.(451-453)AAG>AAT		jumonji, AT rich interactive domain 2 protein							100.0	94.0	96.0					6																	15452366		2203	4300	6503	SO:0001583	missense	3720				central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding	g.chr6:15452366G>T	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.453G>T	6.37:g.15452366G>T	ENSP00000341280:p.Lys151Asn					JARID2_uc011diu.1_Intron|JARID2_uc011div.1_5'UTR|JARID2_uc011diw.1_Missense_Mutation_p.K113N	p.K151N	NM_004973	NP_004964	Q92833	JARD2_HUMAN			4	697	+	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)	151					A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	c.453G>T	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.335170	0.81801	.	.	ENSG00000008083	ENST00000341776;ENST00000541660	T;T	0.37058	1.22;1.22	5.4	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.44726	0.1307	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.983	T	0.47420	-0.9119	10	0.56958	D	0.05	-19.242	14.0803	0.64917	0.0724:0.0:0.9276:0.0	.	113;151	F5H590;Q92833	.;JARD2_HUMAN	N	151;113	ENSP00000341280:K151N;ENSP00000444623:K113N	ENSP00000341280:K151N	K	+	3	2	JARID2	15560345	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.370000	0.79589	1.268000	0.44264	0.655000	0.94253	AAG		0.483	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973		37	85	1	0	1.04594e-18	0.00623	1.73531e-18	37	85				
FAM65B	9750	broad.mit.edu	37	6	24848310	24848310	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr6:24848310C>T	ENST00000259698.4	-	12	1195	c.1020G>A	c.(1018-1020)atG>atA	p.M340I	FAM65B_ENST00000538035.1_Missense_Mutation_p.M369I|FAM65B_ENST00000540914.1_Missense_Mutation_p.M340I|FAM65B_ENST00000378023.4_Missense_Mutation_p.M340I|FAM65B_ENST00000510784.2_Missense_Mutation_p.M374I	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	340					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)		p.M340I(2)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						TGTACATGGACATTCTCCTCT	0.527																																							uc003neo.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1018-1020)ATG>ATA		hypothetical protein LOC9750 isoform 1							95.0	95.0	95.0					6																	24848310		1983	4158	6141	SO:0001583	missense	9750				cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding	g.chr6:24848310C>T	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1020G>A	6.37:g.24848310C>T	ENSP00000259698:p.Met340Ile					FAM65B_uc011djs.1_Missense_Mutation_p.M369I|FAM65B_uc011dju.1_Missense_Mutation_p.M374I|FAM65B_uc003nep.2_Missense_Mutation_p.M340I|FAM65B_uc011djt.1_Missense_Mutation_p.M340I	p.M340I	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN			12	1196	-			340					A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	c.1020G>A	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446383	0.43429	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.01933	4.55;4.55;4.55;4.55;4.55	5.48	5.48	0.80851	.	0.044581	0.85682	D	0.000000	T	0.01156	0.0038	L	0.40543	1.245	0.42019	D	0.990976	P;P;B;P	0.41420	0.565;0.698;0.313;0.749	B;B;B;B	0.35770	0.158;0.158;0.097;0.21	T	0.69716	-0.5070	10	0.26408	T	0.33	-33.023	14.9111	0.70758	0.0:0.8572:0.1428:0.0	.	374;369;340;340	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	I	340;369;340;340;374	ENSP00000259698:M340I;ENSP00000441138:M369I;ENSP00000367262:M340I;ENSP00000438425:M340I;ENSP00000441305:M374I	ENSP00000259698:M340I	M	-	3	0	FAM65B	24956289	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.306000	0.43673	2.551000	0.86045	0.563000	0.77884	ATG		0.527	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2			16	47	0	0	0	0.003163	0	16	47				
IBTK	25998	broad.mit.edu	37	6	82936912	82936912	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr6:82936912G>T	ENST00000306270.7	-	5	1200	c.651C>A	c.(649-651)tgC>tgA	p.C217*	IBTK_ENST00000510291.1_Nonsense_Mutation_p.C217*|IBTK_ENST00000503631.1_Nonsense_Mutation_p.C217*	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	217					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)	p.C217*(1)		central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		CAATTACCAAGCATGTCTGTT	0.358																																							uc003pjl.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|central_nervous_system(2)	4						c.(649-651)TGC>TGA		inhibitor of Bruton's tyrosine kinase							108.0	106.0	106.0					6																	82936912		2203	4300	6503	SO:0001587	stop_gained	25998				negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity	g.chr6:82936912G>T	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.651C>A	6.37:g.82936912G>T	ENSP00000305721:p.Cys217*					IBTK_uc011dyv.1_Nonsense_Mutation_p.C217*|IBTK_uc011dyw.1_Nonsense_Mutation_p.C217*|IBTK_uc010kbi.1_5'UTR|IBTK_uc003pjm.2_Nonsense_Mutation_p.C217*	p.C217*	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0901)	5	1178	-		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)	217			RCC1 2.		Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Nonsense_Mutation	SNP	ENST00000306270.7	37	c.651C>A	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	G	37	5.979358	0.97168	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	.	.	.	5.54	3.74	0.42951	.	0.046469	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-7.2197	12.2854	0.54789	0.1401:0.0:0.8599:0.0	.	.	.	.	X	217	.	ENSP00000305721:C217X	C	-	3	2	IBTK	82993631	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.870000	0.39529	0.667000	0.31107	0.591000	0.81541	TGC		0.358	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525		22	62	1	0	7.87624e-14	0.00278	1.22987e-13	22	62				
CGA	1081	broad.mit.edu	37	6	87795485	87795485	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr6:87795485G>T	ENST00000369582.2	-	4	440	c.340C>A	c.(340-342)Cac>Aac	p.H114N	RN7SKP209_ENST00000516888.1_RNA	NM_000735.3	NP_000726.1	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide	114					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|cellular response to hormone stimulus (GO:0032870)|developmental growth (GO:0048589)|follicle-stimulating hormone secretion (GO:0046884)|gonad development (GO:0008406)|luteinizing hormone secretion (GO:0032275)|negative regulation of organ growth (GO:0046621)|peptide hormone processing (GO:0016486)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.H114N(1)		NS(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)	15		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		TAAGATTTGTGATAATAACAA	0.368																																							uc003plj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(340-342)CAC>AAC		glycoprotein hormones, alpha polypeptide							81.0	77.0	78.0					6																	87795485		2203	4300	6503	SO:0001583	missense	1081				hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity	g.chr6:87795485G>T	V00518	CCDS5007.1, CCDS75492.1	6q14-q21	2013-02-26			ENSG00000135346	ENSG00000135346		"""Endogenous ligands"""	1885	protein-coding gene	gene with protein product	"""follicle-stimulating hormone alpha subunit"", ""chorionic gonadotropin, alpha polypeptide"", ""luteinizing hormone alpha chain"", ""lutropin alpha chain"", ""thyroid-stimulating hormone alpha chain"", ""glycoprotein hormones alpha chain"""	118850				6286817	Standard	NM_000735		Approved	HCG, GPHa, GPHA1, FSHA, LHA, TSHA	uc021zci.1	P01215	OTTHUMG00000015161	ENST00000369582.2:c.340C>A	6.37:g.87795485G>T	ENSP00000358595:p.His114Asn						p.H114N	NM_000735	NP_000726	P01215	GLHA_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0484)	4	441	-		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)	114						Missense_Mutation	SNP	ENST00000369582.2	37	c.340C>A	CCDS5007.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.675649	0.67928	.	.	ENSG00000135346	ENST00000369582	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.76730	0.4028	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.78089	-0.2340	9	0.87932	D	0	-0.9765	19.9155	0.97058	0.0:0.0:1.0:0.0	.	114	P01215	GLHA_HUMAN	N	114	.	ENSP00000358595:H114N	H	-	1	0	CGA	87852204	1.000000	0.71417	1.000000	0.80357	0.197000	0.23852	9.097000	0.94193	2.699000	0.92147	0.650000	0.86243	CAC		0.368	CGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041425.1	NM_000735		9	14	1	0	2.17888e-05	0.006214	2.60751e-05	9	14				
MAP3K4	4216	broad.mit.edu	37	6	161491814	161491814	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr6:161491814C>T	ENST00000392142.4	+	4	2030	c.1882C>T	c.(1882-1884)Cat>Tat	p.H628Y	MAP3K4_ENST00000366920.2_Missense_Mutation_p.H628Y|MAP3K4_ENST00000348824.7_Missense_Mutation_p.H628Y|MAP3K4_ENST00000366919.2_Missense_Mutation_p.H628Y	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	628					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.H628Y(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GAATGTCATACATGAGTGTCT	0.448																																							uc003qtn.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(3)|skin(2)|stomach(1)	9						c.(1882-1884)CAT>TAT		mitogen-activated protein kinase kinase kinase 4							123.0	107.0	113.0					6																	161491814		2203	4300	6503	SO:0001583	missense	4216				activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding	g.chr6:161491814C>T	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.1882C>T	6.37:g.161491814C>T	ENSP00000375986:p.His628Tyr					MAP3K4_uc010kkc.1_Missense_Mutation_p.H628Y|MAP3K4_uc003qto.2_Missense_Mutation_p.H628Y|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.H81Y	p.H628Y	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)	4	2024	+		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)	628					A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	c.1882C>T	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686162	0.88639	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.39332	0.1074	M	0.77103	2.36	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.997;0.995;0.993	T	0.29488	-1.0010	10	0.72032	D	0.01	-32.8919	19.512	0.95146	0.0:1.0:0.0:0.0	.	628;628;628	F5H538;Q9Y6R4-2;Q9Y6R4	.;.;M3K4_HUMAN	Y	628	ENSP00000355886:H628Y;ENSP00000375986:H628Y;ENSP00000355887:H628Y;ENSP00000297332:H628Y	ENSP00000297332:H628Y	H	+	1	0	MAP3K4	161411804	1.000000	0.71417	0.383000	0.26132	0.904000	0.53231	7.461000	0.80834	2.624000	0.88883	0.467000	0.42956	CAT		0.448	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3			10	23	0	0	0	0.008291	0	10	23				
SNX10	29887	broad.mit.edu	37	7	26400636	26400636	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:26400636G>T	ENST00000338523.4	+	3	253	c.66G>T	c.(64-66)aaG>aaT	p.K22N	SNX10_ENST00000409367.1_5'UTR|SNX10_ENST00000396376.1_Missense_Mutation_p.K22N|SNX10_ENST00000446848.2_Missense_Mutation_p.K48N	NM_001199835.1|NM_013322.2	NP_001186764.1|NP_037454.2	Q9Y5X0	SNX10_HUMAN	sorting nexin 10	22	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.|Required for the interaction with ATP6V1D.				cilium assembly (GO:0042384)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|osteoclast differentiation (GO:0030316)|protein localization to centrosome (GO:0071539)|protein localization to cilium (GO:0061512)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extrinsic component of endosome membrane (GO:0031313)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|ATPase binding (GO:0051117)	p.K22N(1)		endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	6						GGATTCAGAAGGAGGACTTCT	0.358																																							uc003sxx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(64-66)AAG>AAT		sorting nexin 10							156.0	146.0	149.0					7																	26400636		2203	4300	6503	SO:0001583	missense	29887				cell communication|endosome organization|protein transport	extrinsic to endosome membrane	1-phosphatidylinositol binding	g.chr7:26400636G>T	AF121860	CCDS5399.1, CCDS56470.1	7p15.2	2008-05-22			ENSG00000086300	ENSG00000086300		"""Sorting nexins"""	14974	protein-coding gene	gene with protein product		614780				17012226	Standard	NM_013322		Approved		uc010kuu.3	Q9Y5X0	OTTHUMG00000023650	ENST00000338523.4:c.66G>T	7.37:g.26400636G>T	ENSP00000343709:p.Lys22Asn					SNX10_uc011jzg.1_Missense_Mutation_p.K45N|SNX10_uc010kuu.2_Missense_Mutation_p.K22N|SNX10_uc010kuv.2_Missense_Mutation_p.K18N	p.K22N	NM_013322	NP_037454	Q9Y5X0	SNX10_HUMAN			3	281	+			22			PX.		E9PFH5|Q8IYT5	Missense_Mutation	SNP	ENST00000338523.4	37	c.66G>T	CCDS5399.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807009	0.50421	.	.	ENSG00000086300	ENST00000416246;ENST00000338523;ENST00000412416;ENST00000446848;ENST00000396376	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	4.93	3.12	0.35913	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.34803	0.0910	N	0.15975	0.35	0.48288	D	0.999624	D;D	0.67145	0.996;0.992	D;P	0.67382	0.951;0.834	T	0.09796	-1.0658	10	0.37606	T	0.19	.	6.8321	0.23915	0.4034:0.0:0.5966:0.0	.	48;22	B4DJM0;Q9Y5X0	.;SNX10_HUMAN	N	48;22;48;48;22	ENSP00000408164:K48N;ENSP00000343709:K22N;ENSP00000395474:K48N;ENSP00000379661:K22N	ENSP00000343709:K22N	K	+	3	2	SNX10	26367161	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.382000	0.34374	0.607000	0.29982	0.650000	0.86243	AAG		0.358	SNX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214120.1			13	65	1	0	2.32078e-09	0.003163	3.10857e-09	13	65				
DPY19L2P1	554236	broad.mit.edu	37	7	35144364	35144364	+	RNA	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:35144364G>T	ENST00000436258.1	-	0	1702							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ACTGCAATGTGTGAAAAGCCA	0.303																																							uc003teq.1		NA																	0					0						c.(742-744)CAC>CAA		RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;																																						554236							g.chr7:35144364G>T	BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35144364G>T						DPY19L2P1_uc003tep.1_RNA|DPY19L2P1_uc010kwz.1_RNA	p.H248Q							18	1851	-								B4E2E3	Missense_Mutation	SNP	ENST00000436258.1	37	c.744C>A																																																																																					0.303	DPY19L2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000338113.1			12	22	1	0	5.16669e-11	0.010729	7.28827e-11	12	22				
POU6F2	11281	broad.mit.edu	37	7	39379533	39379533	+	Silent	SNP	G	G	A	rs200308619		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:39379533G>A	ENST00000403058.1	+	6	958	c.804G>A	c.(802-804)caG>caA	p.Q268Q	POU6F2_ENST00000518318.2_Silent_p.Q268Q|POU6F2_ENST00000517348.1_3'UTR|POU6F2_ENST00000559001.1_Silent_p.Q260Q	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	268	Gln-rich.|Pro-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q268Q(1)		NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						caacccagcagagctccagcc	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		15023	0.001		0.0	False		,,,				2504	0.0						uc003thb.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(802-804)CAG>CAA		POU class 6 homeobox 2 isoform 1							121.0	136.0	131.0					7																	39379533		2203	4300	6503	SO:0001819	synonymous_variant	11281				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:39379533G>A	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.804G>A	7.37:g.39379533G>A						POU6F2_uc010kxo.2_Silent_p.Q260Q	p.Q268Q	NM_007252	NP_009183	P78424	PO6F2_HUMAN			5	846	+			268			Pro-rich.|Gln-rich.		A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	ENST00000403058.1	37	c.804G>A	CCDS34620.2																																																																																				0.622	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252		14	35	0	0	0	0.00245	0	14	35				
ZNF716	441234	broad.mit.edu	37	7	57528793	57528793	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:57528793G>T	ENST00000420713.1	+	4	738	c.626G>T	c.(625-627)aGg>aTg	p.R209M		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R209M(2)		breast(1)|kidney(1)|lung(20)|ovary(2)	24						ATTCATACTAGGGAGAAGTCT	0.353																																							uc011kdi.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(625-627)AGG>ATG		zinc finger protein 716							47.0	43.0	44.0					7																	57528793		692	1591	2283	SO:0001583	missense	441234							g.chr7:57528793G>T	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.626G>T	7.37:g.57528793G>T	ENSP00000394248:p.Arg209Met						p.R209M	NM_001159279	NP_001152751					4	738	+									Missense_Mutation	SNP	ENST00000420713.1	37	c.626G>T	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	G	9.674	1.147550	0.21288	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.40476	1.03	0.195	0.195	0.15151	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33556	0.0867	L	0.45698	1.435	0.27154	N	0.961335	B	0.27192	0.171	B	0.28385	0.089	T	0.37079	-0.9721	9	0.87932	D	0	.	6.2336	0.20750	3.0E-4:0.0:0.9997:0.0	.	197	A6NP11	ZN716_HUMAN	M	209;197	ENSP00000394248:R209M	ENSP00000387687:R197M	R	+	2	0	ZNF716	57532735	0.027000	0.19231	0.008000	0.14137	0.007000	0.05969	1.862000	0.39448	0.300000	0.22699	0.306000	0.20318	AGG		0.353	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279		4	17	1	0	0.00024832	0.009096	0.000284351	4	17				
ZNF107	51427	broad.mit.edu	37	7	64167704	64167704	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:64167704C>T	ENST00000395391.1	+	4	2397	c.1022C>T	c.(1021-1023)tCa>tTa	p.S341L	ZNF107_ENST00000344930.3_Missense_Mutation_p.S341L|ZNF107_ENST00000423627.1_Missense_Mutation_p.S341L			Q9UII5	ZN107_HUMAN	zinc finger protein 107	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S341L(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				AACCAGTTCTCAACTCTTACT	0.343																																							uc003ttd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1021-1023)TCA>TTA		zinc finger protein 107							29.0	32.0	31.0					7																	64167704		2148	4275	6423	SO:0001583	missense	51427				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:64167704C>T	AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.1022C>T	7.37:g.64167704C>T	ENSP00000378789:p.Ser341Leu					ZNF107_uc003tte.2_Missense_Mutation_p.S341L	p.S341L	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN			7	1808	+		Lung NSC(55;0.00948)|all_lung(88;0.0249)	341			C2H2-type 10.			Missense_Mutation	SNP	ENST00000395391.1	37	c.1022C>T	CCDS5527.1	.	.	.	.	.	.	.	.	.	.	.	12.06	1.823766	0.32237	.	.	ENSG00000196247	ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.07444	3.19;3.19;3.19	1.27	1.27	0.21489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23133	0.0559	M	0.78456	2.415	0.09310	N	1	D	0.76494	0.999	D	0.70935	0.971	T	0.04467	-1.0949	8	.	.	.	.	5.2825	0.15682	0.0:0.6307:0.3693:0.0	.	341	Q9UII5	ZN107_HUMAN	L	341	ENSP00000343443:S341L;ENSP00000400037:S341L;ENSP00000378789:S341L	.	S	+	2	0	ZNF107	63805139	0.000000	0.05858	0.009000	0.14445	0.097000	0.18754	-0.253000	0.08794	0.635000	0.30488	0.313000	0.20887	TCA		0.343	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220		17	24	0	0	0	0.00499	0	17	24				
SEMA3D	223117	broad.mit.edu	37	7	84666213	84666213	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:84666213G>C	ENST00000284136.6	-	10	1226	c.1183C>G	c.(1183-1185)Cct>Gct	p.P395A	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	395	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.P395A(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						ACTGTACCAGGCCGTGGATAA	0.363																																					Ovarian(63;442 1191 17318 29975 31528)	Ovarian(63;442 1191 17318 29975 31528)	uc003uic.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(2)	5						c.(1183-1185)CCT>GCT		semaphorin 3D precursor							120.0	107.0	112.0					7																	84666213		2203	4300	6503	SO:0001583	missense	223117				cell differentiation|nervous system development	extracellular region|membrane	receptor activity	g.chr7:84666213G>C	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1183C>G	7.37:g.84666213G>C	ENSP00000284136:p.Pro395Ala					SEMA3D_uc010led.2_Missense_Mutation_p.P395A|SEMA3D_uc003uib.2_Missense_Mutation_p.P34A	p.P395A	NM_152754	NP_689967	O95025	SEM3D_HUMAN			10	1223	-			395			Sema.		A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	c.1183C>G	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.786915	0.90367	.	.	ENSG00000153993	ENST00000284136	T	0.24151	1.87	5.89	5.89	0.94794	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.68100	0.2964	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.78809	-0.2058	10	0.87932	D	0	.	20.2508	0.98407	0.0:0.0:1.0:0.0	.	395	O95025	SEM3D_HUMAN	A	395	ENSP00000284136:P395A	ENSP00000284136:P395A	P	-	1	0	SEMA3D	84504149	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.773000	0.98989	2.788000	0.95919	0.585000	0.79938	CCT		0.363	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754		16	51	0	0	0	0.004007	0	16	51				
DYNC1I1	1780	broad.mit.edu	37	7	95657604	95657604	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:95657604C>G	ENST00000324972.6	+	11	1331	c.1138C>G	c.(1138-1140)Cgg>Ggg	p.R380G	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.R360G|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.R363G|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.R343G|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.R343G|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.R363G	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	380					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.R380G(1)|p.R380W(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TCCAGTGCAGCGGACACCCTT	0.517																																							uc003uoc.3		NA																	2	Substitution - Missense(2)		lung(1)|skin(1)	ovary(3)|kidney(1)	4						c.(1138-1140)CGG>GGG		dynein, cytoplasmic 1, intermediate chain 1							145.0	122.0	130.0					7																	95657604		2203	4300	6503	SO:0001583	missense	1780				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity	g.chr7:95657604C>G	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1138C>G	7.37:g.95657604C>G	ENSP00000320130:p.Arg380Gly					DYNC1I1_uc003uod.3_Missense_Mutation_p.R363G|DYNC1I1_uc003uob.2_Missense_Mutation_p.R343G|DYNC1I1_uc003uoe.3_Missense_Mutation_p.R360G|DYNC1I1_uc010lfl.2_Missense_Mutation_p.R369G	p.R380G	NM_004411	NP_004402	O14576	DC1I1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0957)		11	1415	+	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		380					B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	c.1138C>G	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.248703	0.39797	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.07114	3.22;3.22;3.22;3.22;3.22;3.22	5.03	-2.26	0.06867	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.054003	0.64402	D	0.000001	T	0.28566	0.0707	M	0.89478	3.035	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.87578	0.995;0.998;0.998;0.995;0.983	T	0.20739	-1.0266	10	0.72032	D	0.01	-4.514	11.6192	0.51108	0.6453:0.286:0.0:0.0687	.	363;360;363;380;343	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	G	363;380;343;360;343;363	ENSP00000392337:R363G;ENSP00000320130:R380G;ENSP00000438377:R343G;ENSP00000398118:R360G;ENSP00000352348:R343G;ENSP00000412444:R363G	ENSP00000320130:R380G	R	+	1	2	DYNC1I1	95495540	0.993000	0.37304	0.984000	0.44739	0.002000	0.02628	0.408000	0.21065	-0.187000	0.10516	-0.157000	0.13467	CGG		0.517	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411		45	82	0	0	0	0.013114	0	45	82				
LAMB1	3912	broad.mit.edu	37	7	107600230	107600230	+	Missense_Mutation	SNP	G	G	T	rs371396695		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:107600230G>T	ENST00000222399.6	-	19	2594	c.2364C>A	c.(2362-2364)aaC>aaA	p.N788K	LAMB1_ENST00000393561.1_Missense_Mutation_p.N812K|LAMB1_ENST00000393560.1_Missense_Mutation_p.N788K	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	788	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.N788N(1)|p.N788K(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						ACTGGCCTCCGTTGGGATCAC	0.562																																							uc003vew.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(2362-2364)AAC>AAA		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						54.0	47.0	49.0					7																	107600230		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107600230G>T	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2364C>A	7.37:g.107600230G>T	ENSP00000222399:p.Asn788Lys					LAMB1_uc003vev.2_Missense_Mutation_p.N812K|LAMB1_uc003vex.2_Missense_Mutation_p.N788K	p.N788K	NM_002291	NP_002282	P07942	LAMB1_HUMAN			19	2699	-			788			Laminin EGF-like 6.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.2364C>A	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	1.484	-0.556505	0.03967	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.61040	0.14;0.14;0.14	5.31	-0.893	0.10567	EGF-like, laminin (3);	.	.	.	.	T	0.39989	0.1099	N	0.13327	0.33	0.31208	N	0.698978	B;P;D	0.53151	0.125;0.468;0.958	B;B;P	0.44647	0.04;0.258;0.456	T	0.47433	-0.9118	9	0.26408	T	0.33	.	12.2825	0.54771	0.6033:0.0:0.3967:0.0	.	788;788;812	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	K	812;788;788	ENSP00000377191:N812K;ENSP00000222399:N788K;ENSP00000377190:N788K	ENSP00000222399:N788K	N	-	3	2	LAMB1	107387466	0.000000	0.05858	0.671000	0.29857	0.798000	0.45092	-1.133000	0.03232	-0.104000	0.12154	-0.251000	0.11542	AAC		0.562	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		11	20	1	0	1.05317e-09	0.00245	1.41717e-09	11	20				
EPHB6	2051	broad.mit.edu	37	7	142562228	142562228	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:142562228G>A	ENST00000392957.2	+	7	1457	c.670G>A	c.(670-672)Gct>Act	p.A224T	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Missense_Mutation_p.A224T	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	224	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)	p.A209T(1)		NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					GGCCCTGGTCGCTGTCAGGCT	0.652																																							uc011kst.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(670-672)GCT>ACT		ephrin receptor EphB6 precursor							71.0	79.0	76.0					7																	142562228		2202	4299	6501	SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142562228G>A	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.670G>A	7.37:g.142562228G>A	ENSP00000376684:p.Ala224Thr					EPHB6_uc011ksu.1_Missense_Mutation_p.A224T|EPHB6_uc003wbs.2_5'UTR|EPHB6_uc003wbt.2_Intron|EPHB6_uc003wbu.2_5'UTR|EPHB6_uc003wbv.2_5'Flank	p.A224T	NM_004445	NP_004436	O15197	EPHB6_HUMAN			7	1457	+	Melanoma(164;0.059)		224			Extracellular (Potential).|Cys-rich.		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	c.670G>A	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835540	0.32421	.	.	ENSG00000106123	ENST00000392957;ENST00000442129	T;T	0.03860	3.78;3.78	5.55	3.72	0.42706	Tyrosine-protein kinase, receptor class V, conserved site (1);Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.490245	0.17164	N	0.184522	T	0.08088	0.0202	L	0.58510	1.815	0.20975	N	0.999814	D	0.58970	0.984	P	0.47162	0.54	T	0.20207	-1.0282	10	0.87932	D	0	.	6.902	0.24288	0.1475:0.0:0.7125:0.14	.	224	O15197	EPHB6_HUMAN	T	224	ENSP00000376684:A224T;ENSP00000410789:A224T	ENSP00000376684:A224T	A	+	1	0	EPHB6	142272350	0.220000	0.23631	0.055000	0.19348	0.024000	0.10985	0.967000	0.29344	1.591000	0.50007	-0.140000	0.14226	GCT		0.652	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			6	142	0	0	0	0.001984	0	6	142				
ARHGEF5	7984	broad.mit.edu	37	7	144062360	144062360	+	Silent	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:144062360G>T	ENST00000056217.5	+	2	2772	c.2598G>T	c.(2596-2598)cgG>cgT	p.R866R	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	866					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R866R(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GGAGCACTCGGGGAGGACATA	0.612																																							uc003wel.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(2596-2598)CGG>CGT		rho guanine nucleotide exchange factor 5							77.0	89.0	85.0					7																	144062360		2202	4298	6500	SO:0001819	synonymous_variant	7984				intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr7:144062360G>T	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.2598G>T	7.37:g.144062360G>T						ARHGEF5_uc003wek.2_Silent_p.R866R|ARHGEF5_uc003wem.2_5'Flank	p.R866R	NM_005435	NP_005426	Q12774	ARHG5_HUMAN			2	2716	+	Melanoma(164;0.14)		866					A6NNJ2|Q6ZML7	Silent	SNP	ENST00000056217.5	37	c.2598G>T	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	G	0.038	-1.295381	0.01375	.	.	ENSG00000050327	ENST00000474817	.	.	.	4.27	-0.0336	0.13900	.	.	.	.	.	T	0.19208	0.0461	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	T	0.22312	-1.0220	4	.	.	.	-2.6284	0.6352	0.00801	0.2258:0.1767:0.3813:0.2163	.	.	.	.	V	120	.	.	G	+	2	0	ARHGEF5	143693293	0.329000	0.24696	0.268000	0.24571	0.023000	0.10783	-0.017000	0.12590	0.399000	0.25367	0.555000	0.69702	GGG		0.612	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435		13	122	1	0	6.72482e-11	0.003163	9.39545e-11	13	122				
KCNH2	3757	broad.mit.edu	37	7	150644119	150644119	+	Missense_Mutation	SNP	T	T	C	rs553337493		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:150644119T>C	ENST00000262186.5	-	14	3577	c.3176A>G	c.(3175-3177)gAc>gGc	p.D1059G	KCNH2_ENST00000330883.4_Missense_Mutation_p.D719G|KCNH2_ENST00000392968.2_Missense_Mutation_p.D963G	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1059					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.D1059G(1)		NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	AGTGGCCATGTCTGCACTCAG	0.662																																					GBM(137;110 1844 13671 20123 45161)	GBM(137;110 1844 13671 20123 45161)	uc003wic.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(3175-3177)GAC>GGC		voltage-gated potassium channel, subfamily H,	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)						39.0	42.0	41.0					7																	150644119		2203	4300	6503	SO:0001583	missense	3757				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity	g.chr7:150644119T>C	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3176A>G	7.37:g.150644119T>C	ENSP00000262186:p.Asp1059Gly					KCNH2_uc003wib.2_Missense_Mutation_p.D719G|KCNH2_uc011kux.1_Missense_Mutation_p.D963G	p.D1059G	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	14	3189	-	all_neural(206;0.219)		1059			Cytoplasmic (Potential).		A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	c.3176A>G	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	T	18.75	3.690970	0.68271	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186	D;D;D	0.92348	-3.02;-3.02;-3.02	4.68	4.68	0.58851	.	0.000000	0.64402	D	0.000001	D	0.94268	0.8159	L	0.55103	1.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.80764	0.994;0.994;0.99	D	0.94561	0.7762	10	0.72032	D	0.01	.	12.3915	0.55360	0.0:0.0:0.0:1.0	.	963;1059;719	C4PFH9;Q12809;Q12809-2	.;KCNH2_HUMAN;.	G	719;963;1059	ENSP00000328531:D719G;ENSP00000376695:D963G;ENSP00000262186:D1059G	ENSP00000262186:D1059G	D	-	2	0	KCNH2	150275052	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	3.207000	0.51106	1.877000	0.54381	0.397000	0.26171	GAC		0.662	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238		27	47	0	0	0	0.003954	0	27	47				
MYOM2	9172	broad.mit.edu	37	8	2021510	2021510	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:2021510G>T	ENST00000262113.4	+	10	1191	c.1050G>T	c.(1048-1050)gaG>gaT	p.E350D	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	350	Ig-like C2-type 2.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.E350D(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGGACGACGAGGGCCTGTACA	0.602																																							uc003wpx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(1048-1050)GAG>GAT		myomesin 2							78.0	66.0	70.0					8																	2021510		2203	4300	6503	SO:0001583	missense	9172				muscle contraction	myosin filament	structural constituent of muscle	g.chr8:2021510G>T		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1050G>T	8.37:g.2021510G>T	ENSP00000262113:p.Glu350Asp					MYOM2_uc011kwi.1_Intron	p.E350D	NM_003970	NP_003961	P54296	MYOM2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)	10	1188	+		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)	350			Ig-like C2-type 2.		Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	c.1050G>T	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934597	0.73442	.	.	ENSG00000036448	ENST00000262113	T	0.68903	-0.36	4.9	-1.06	0.10002	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73156	0.3551	M	0.86268	2.805	0.80722	D	1	P	0.46952	0.887	P	0.51516	0.672	T	0.74595	-0.3613	10	0.72032	D	0.01	.	9.6284	0.39765	0.778:0.0:0.222:0.0	.	350	P54296	MYOM2_HUMAN	D	350	ENSP00000262113:E350D	ENSP00000262113:E350D	E	+	3	2	MYOM2	2008917	1.000000	0.71417	0.963000	0.40424	0.786000	0.44442	1.092000	0.30927	-0.124000	0.11724	-0.126000	0.14955	GAG		0.602	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970		19	61	1	0	3.32936e-07	0.006122	4.1904e-07	19	61				
MYOM2	9172	broad.mit.edu	37	8	2044147	2044147	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:2044147T>A	ENST00000262113.4	+	18	2327	c.2186T>A	c.(2185-2187)cTc>cAc	p.L729H	MYOM2_ENST00000523438.1_Missense_Mutation_p.L154H	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	729	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.L729H(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TCCATGACCCTCGGCTGGAAG	0.572																																							uc003wpx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|central_nervous_system(1)|skin(1)	6						c.(2185-2187)CTC>CAC		myomesin 2							125.0	111.0	116.0					8																	2044147		2203	4300	6503	SO:0001583	missense	9172				muscle contraction	myosin filament	structural constituent of muscle	g.chr8:2044147T>A		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2186T>A	8.37:g.2044147T>A	ENSP00000262113:p.Leu729His					MYOM2_uc011kwi.1_Missense_Mutation_p.L154H	p.L729H	NM_003970	NP_003961	P54296	MYOM2_HUMAN		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)	18	2324	+		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)	729			Fibronectin type-III 4.		Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	c.2186T>A	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.373784	0.82573	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.66995	-0.24;-0.24	5.47	5.47	0.80525	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	D	0.88153	0.6360	H	0.97707	4.06	0.47476	D	0.999433	D	0.89917	1.0	D	0.79108	0.992	D	0.92367	0.5902	10	0.87932	D	0	.	15.5476	0.76118	0.0:0.0:0.0:1.0	.	729	P54296	MYOM2_HUMAN	H	729;154	ENSP00000262113:L729H;ENSP00000428396:L154H	ENSP00000262113:L729H	L	+	2	0	MYOM2	2031554	1.000000	0.71417	0.954000	0.39281	0.738000	0.42128	7.355000	0.79434	2.071000	0.62044	0.459000	0.35465	CTC		0.572	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970		25	76	0	0	0	0.003954	0	25	76				
CSMD1	64478	broad.mit.edu	37	8	4851865	4851865	+	Missense_Mutation	SNP	G	G	A	rs372511285		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:4851865G>A	ENST00000520002.1	-	1	629	c.74C>T	c.(73-75)aCt>aTt	p.T25I	CSMD1_ENST00000602723.1_Missense_Mutation_p.T25I|CSMD1_ENST00000539096.1_Missense_Mutation_p.T25I|CSMD1_ENST00000400186.3_Missense_Mutation_p.T25I|CSMD1_ENST00000537824.1_Missense_Mutation_p.T25I|CSMD1_ENST00000542608.1_Missense_Mutation_p.T25I|CSMD1_ENST00000602557.1_Missense_Mutation_p.T25I			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	25						integral component of membrane (GO:0016021)		p.T25I(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTTCGCTGCAGTGAGGAGCCT	0.657																																							uc011kwk.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(20)|large_intestine(5)	25						c.(73-75)ACT>ATT		CUB and Sushi multiple domains 1 precursor							46.0	57.0	53.0					8																	4851865		2181	4287	6468	SO:0001583	missense	64478					integral to membrane		g.chr8:4851865G>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.74C>T	8.37:g.4851865G>A	ENSP00000430733:p.Thr25Ile						p.T25I	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	1	464	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	25					Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37	c.74C>T		.	.	.	.	.	.	.	.	.	.	G	5.633	0.301514	0.10678	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.25912	1.77;1.88;1.91;1.77;2.21	4.11	4.11	0.48088	.	.	.	.	.	T	0.13670	0.0331	N	0.08118	0	0.24954	N	0.991775	B	0.17667	0.023	B	0.18263	0.021	T	0.14282	-1.0478	9	0.36615	T	0.2	.	9.3104	0.37900	0.0:0.0:0.7851:0.2149	.	25	E5RIG2	.	I	25	ENSP00000383047:T25I;ENSP00000430733:T25I;ENSP00000441462:T25I;ENSP00000446243:T25I;ENSP00000441675:T25I	ENSP00000383047:T25I	T	-	2	0	CSMD1	4839273	1.000000	0.71417	1.000000	0.80357	0.377000	0.30045	3.963000	0.56773	1.790000	0.52503	0.563000	0.77884	ACT		0.657	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		10	33	0	0	0	0.008291	0	10	33				
POLR3D	661	broad.mit.edu	37	8	22107690	22107690	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:22107690G>T	ENST00000397802.4	+	7	1239	c.1024G>T	c.(1024-1026)Ggc>Tgc	p.G342C	POLR3D_ENST00000306433.4_Missense_Mutation_p.G342C			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	342					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.G342C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		ACTCCTCTTGGGCAAGGTGAC	0.567																																							uc003xbl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1024-1026)GGC>TGC		polymerase (RNA) III (DNA directed) polypeptide							85.0	77.0	80.0					8																	22107690		2203	4300	6503	SO:0001583	missense	661				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity	g.chr8:22107690G>T	M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.1024G>T	8.37:g.22107690G>T	ENSP00000380904:p.Gly342Cys					POLR3D_uc003xbm.2_Missense_Mutation_p.G342C|POLR3D_uc011kze.1_RNA	p.G342C	NM_001722	NP_001713	P05423	RPC4_HUMAN		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)	8	1107	+			342					Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Missense_Mutation	SNP	ENST00000397802.4	37	c.1024G>T	CCDS34858.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006628	0.93287	.	.	ENSG00000168495	ENST00000306433;ENST00000397802	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.84977	0.5592	M	0.88842	2.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87324	0.2320	9	0.62326	D	0.03	-16.3934	17.9601	0.89083	0.0:0.0:1.0:0.0	.	342	P05423	RPC4_HUMAN	C	342	.	ENSP00000303088:G342C	G	+	1	0	POLR3D	22163635	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.725000	0.98778	2.520000	0.84964	0.561000	0.74099	GGC		0.567	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375434.2	NM_001722		13	40	1	0	3.27435e-08	0.00245	4.28749e-08	13	40				
KCNU1	157855	broad.mit.edu	37	8	36703176	36703176	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:36703176G>T	ENST00000399881.3	+	17	1819	c.1782G>T	c.(1780-1782)aaG>aaT	p.K594N		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	594					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.K594N(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AAACTCCAAAGGACGTCAGAA	0.408																																							uc010lvw.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1780-1782)AAG>AAT		potassium channel, subfamily U, member 1							116.0	106.0	109.0					8																	36703176		1856	4102	5958	SO:0001583	missense	157855					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr8:36703176G>T	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1782G>T	8.37:g.36703176G>T	ENSP00000382770:p.Lys594Asn					KCNU1_uc003xjw.2_RNA	p.K594N	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)	17	1869	+			594			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000399881.3	37	c.1782G>T	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	G	5.526	0.282048	0.10458	.	.	ENSG00000215262	ENST00000399881	T	0.34472	1.36	5.53	-2.07	0.07276	.	0.797448	0.10147	U	0.710167	T	0.30947	0.0781	M	0.77103	2.36	0.42707	D	0.993632	B	0.23990	0.095	B	0.15870	0.014	T	0.46133	-0.9213	10	0.72032	D	0.01	-5.178	0.5251	0.00619	0.2915:0.1161:0.2429:0.3496	.	594	A8MYU2	KCNU1_HUMAN	N	594	ENSP00000382770:K594N	ENSP00000382770:K594N	K	+	3	2	KCNU1	36822334	0.368000	0.25031	0.024000	0.17045	0.005000	0.04900	0.169000	0.16641	-0.016000	0.14127	-0.169000	0.13324	AAG		0.408	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836		10	45	1	0	2.52707e-12	0.006214	3.68952e-12	10	45				
POMK	84197	broad.mit.edu	37	8	42977285	42977285	+	Silent	SNP	A	A	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:42977285A>G	ENST00000331373.5	+	5	573	c.318A>G	c.(316-318)gcA>gcG	p.A106A		NM_001277971.1|NM_032237.3	NP_001264900.1|NP_115613.1	Q9H5K3	SG196_HUMAN	protein-O-mannose kinase	106	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|carbohydrate phosphorylation (GO:0046835)|learning or memory (GO:0007611)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|protein O-linked glycosylation (GO:0006493)|sensory perception of pain (GO:0019233)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|carbohydrate kinase activity (GO:0019200)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|protein kinase activity (GO:0004672)	p.A106A(2)									ACAAAGTTGCACTCTCACAGC	0.483																																							uc003xpw.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(316-318)GCA>GCG		protein kinase-like protein SgK196							121.0	112.0	115.0					8																	42977285		2203	4300	6503	SO:0001819	synonymous_variant	84197					integral to membrane	ATP binding|protein kinase activity	g.chr8:42977285A>G		CCDS6141.1	8p11.21	2013-08-22			ENSG00000185900	ENSG00000185900			26267	protein-coding gene	gene with protein product		615247				16879967, 23519211	Standard	NM_001277971		Approved	FLJ23356, SgK196		Q9H5K3	OTTHUMG00000164100	ENST00000331373.5:c.318A>G	8.37:g.42977285A>G							p.A106A	NM_032237	NP_115613	Q9H5K3	SG196_HUMAN			5	577	+			106			Protein kinase.			Silent	SNP	ENST00000331373.5	37	c.318A>G	CCDS6141.1																																																																																				0.483	POMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377291.2	NM_032237		51	94	0	0	0	0.01441	0	51	94				
PRKDC	5591	broad.mit.edu	37	8	48767902	48767902	+	Silent	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:48767902T>C	ENST00000314191.2	-	51	6695	c.6639A>G	c.(6637-6639)cgA>cgG	p.R2213R	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Silent_p.R2213R	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2214					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.R2214R(1)|p.R2213R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	AATTAAGCAATCGATTTGCTA	0.368								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	Esophageal Squamous(79;1091 1253 12329 31680 40677)	uc003xqi.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34						c.(6640-6642)CGA>CGG	NHEJ	protein kinase, DNA-activated, catalytic							65.0	58.0	60.0					8																	48767902		1825	4088	5913	SO:0001819	synonymous_variant	5591				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding	g.chr8:48767902T>C		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.6639A>G	8.37:g.48767902T>C						PRKDC_uc003xqj.2_Silent_p.R2214R|PRKDC_uc011ldh.1_Intron	p.R2214R	NM_006904	NP_008835	P78527	PRKDC_HUMAN			51	6699	-		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)	2214					P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	ENST00000314191.2	37	c.6642A>G																																																																																					0.368	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		7	10	0	0	0	0.00308	0	7	10				
SNTG1	54212	broad.mit.edu	37	8	51664632	51664632	+	Missense_Mutation	SNP	T	T	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:51664632T>A	ENST00000522124.1	+	18	2017	c.1356T>A	c.(1354-1356)ttT>ttA	p.F452L	SNTG1_ENST00000518864.1_Missense_Mutation_p.F452L|SNTG1_ENST00000276467.5_Intron|SNTG1_ENST00000517473.1_Intron	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	452					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.F452L(2)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				AAATCAAATTTTTGTTTCAGA	0.348																																							uc010lxy.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)	5						c.(1354-1356)TTT>TTA		syntrophin, gamma 1							115.0	118.0	117.0					8																	51664632		2203	4300	6503	SO:0001583	missense	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51664632T>A	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1356T>A	8.37:g.51664632T>A	ENSP00000429842:p.Phe452Leu					SNTG1_uc003xqs.1_Missense_Mutation_p.F452L|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_RNA	p.F452L	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN			19	1727	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)	452					Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	c.1356T>A	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	T	7.351	0.622853	0.14193	.	.	ENSG00000147481	ENST00000518864;ENST00000522124	T;T	0.75704	-0.96;-0.96	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.49813	0.1579	N	0.10945	0.07	0.80722	D	1	B	0.17667	0.023	B	0.12156	0.007	T	0.48603	-0.9021	10	0.02654	T	1	.	10.4737	0.44652	0.0:0.0797:0.0:0.9203	.	452	Q9NSN8	SNTG1_HUMAN	L	452	ENSP00000429276:F452L;ENSP00000429842:F452L	ENSP00000429276:F452L	F	+	3	2	SNTG1	51827185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.746000	0.26275	2.031000	0.59945	0.467000	0.42956	TTT		0.348	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			47	123	0	0	0	0.01441	0	47	123				
CRISPLD1	83690	broad.mit.edu	37	8	75932314	75932314	+	Splice_Site	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:75932314G>T	ENST00000262207.4	+	12	1712	c.1244G>T	c.(1243-1245)aGa>aTa	p.R415I	CRISPLD1_ENST00000517786.1_Splice_Site_p.R229I|CRISPLD1_ENST00000523524.1_Splice_Site_p.R227I	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	415	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.R415I(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CATTGCCCAAGGTAAACCAGT	0.408																																							uc003yan.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1243-1245)AGA>ATA		cysteine-rich secretory protein LCCL domain							104.0	95.0	98.0					8																	75932314		2203	4300	6503	SO:0001630	splice_region_variant	83690					extracellular region		g.chr8:75932314G>T	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.1244+1G>T	8.37:g.75932314G>T						CRISPLD1_uc011lfk.1_Missense_Mutation_p.R227I|CRISPLD1_uc011lfl.1_Missense_Mutation_p.R227I	p.R415I	NM_031461	NP_113649	Q9H336	CRLD1_HUMAN	Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)		12	1619	+	Breast(64;0.0799)		415			LCCL 2.		B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	37	c.1244G>T	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	G	32	5.170631	0.94807	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	D;D;D	0.89050	-2.46;-2.46;-2.46	5.44	5.44	0.79542	LCCL (5);	0.000000	0.85682	D	0.000000	D	0.95586	0.8565	M	0.89030	3	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.993;0.999	D	0.95783	0.8818	10	0.87932	D	0	.	19.4586	0.94906	0.0:0.0:1.0:0.0	.	229;415	B7Z929;Q9H336	.;CRLD1_HUMAN	I	415;227;229	ENSP00000262207:R415I;ENSP00000430105:R227I;ENSP00000429746:R229I	ENSP00000262207:R415I	R	+	2	0	CRISPLD1	76094869	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.222000	0.95196	2.834000	0.97654	0.650000	0.86243	AGA		0.408	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	Missense_Mutation	12	37	1	0	2.61681e-11	0.00245	3.72737e-11	12	37				
POP1	10940	broad.mit.edu	37	8	99142345	99142345	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:99142345C>T	ENST00000401707.2	+	5	707	c.626C>T	c.(625-627)gCc>gTc	p.A209V	POP1_ENST00000349693.3_Missense_Mutation_p.A209V	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	209					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)	p.A209V(1)		autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			ATCTGGCACGCCAAGCGGTTT	0.488																																							uc003yij.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(625-627)GCC>GTC		processing of precursor 1							75.0	72.0	73.0					8																	99142345		2203	4300	6503	SO:0001583	missense	10940				tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity	g.chr8:99142345C>T	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.626C>T	8.37:g.99142345C>T	ENSP00000385787:p.Ala209Val					POP1_uc011lgv.1_Missense_Mutation_p.A209V|POP1_uc003yik.2_Missense_Mutation_p.A209V	p.A209V	NM_001145860	NP_001139332	Q99575	POP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.145)		5	726	+	Breast(36;1.78e-06)		209					A8K5W9|Q15037	Missense_Mutation	SNP	ENST00000401707.2	37	c.626C>T	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	C	36	5.647996	0.96714	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.61980	0.06;0.06	5.81	5.81	0.92471	Ribonuclease P/MRP, subunit POP1 (1);	0.139825	0.47093	D	0.000247	T	0.76905	0.4053	M	0.66378	2.025	0.80722	D	1	D	0.56287	0.975	D	0.65323	0.934	T	0.75004	-0.3470	9	.	.	.	-3.0517	17.8794	0.88835	0.0:1.0:0.0:0.0	.	209	Q99575	POP1_HUMAN	V	209	ENSP00000385787:A209V;ENSP00000339529:A209V	.	A	+	2	0	POP1	99211521	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.731000	0.84895	2.746000	0.94184	0.591000	0.81541	GCC		0.488	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029		17	53	0	0	0	0.007413	0	17	53				
RGS22	26166	broad.mit.edu	37	8	101065202	101065202	+	Missense_Mutation	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:101065202G>A	ENST00000360863.6	-	10	1711	c.1517C>T	c.(1516-1518)gCa>gTa	p.A506V	RGS22_ENST00000523287.1_Missense_Mutation_p.A325V|RGS22_ENST00000523437.1_Missense_Mutation_p.A494V	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	506					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.A506V(2)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			GAATCTTGGTGCCCTGTTTAT	0.368																																							uc003yjb.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(1516-1518)GCA>GTA		regulator of G-protein signaling 22							140.0	133.0	135.0					8																	101065202		1860	4096	5956	SO:0001583	missense	26166				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr8:101065202G>A	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.1517C>T	8.37:g.101065202G>A	ENSP00000354109:p.Ala506Val					RGS22_uc003yja.1_Missense_Mutation_p.A325V|RGS22_uc003yjc.1_Missense_Mutation_p.A494V|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	p.A506V	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)		10	1712	-			506					A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	c.1517C>T	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.195443	0.78902	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.62232	0.04;0.04;0.04	5.13	3.14	0.36123	Regulator of G protein signalling superfamily (1);	0.299613	0.31301	N	0.007899	T	0.71417	0.3337	M	0.62723	1.935	0.31751	N	0.634539	D;D;D	0.61080	0.986;0.986;0.989	P;P;P	0.58266	0.7;0.7;0.836	T	0.77672	-0.2500	10	0.56958	D	0.05	.	14.1162	0.65154	0.0:0.5858:0.4142:0.0	.	494;506;325	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	V	506;494;325;494	ENSP00000354109:A506V;ENSP00000429382:A325V;ENSP00000428212:A494V	ENSP00000354109:A506V	A	-	2	0	RGS22	101134378	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.839000	0.39220	1.259000	0.44117	-0.182000	0.12963	GCA		0.368	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668		7	160	0	0	0	0.001984	0	7	160				
RIMS2	9699	broad.mit.edu	37	8	104930687	104930687	+	Silent	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:104930687T>C	ENST00000436393.2	+	7	1630	c.1389T>C	c.(1387-1389)ccT>ccC	p.P463P	RIMS2_ENST00000262231.10_Silent_p.P540P|RIMS2_ENST00000507740.1_Silent_p.P493P|RIMS2_ENST00000406091.3_Silent_p.P685P			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	763					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.P493P(2)|p.P685P(1)|p.P768P(1)|p.P463P(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CGCGAATACCTGATAGCACAC	0.294										HNSCC(12;0.0054)																													uc003yls.2		NA																	5	Substitution - coding silent(5)		lung(5)	ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(1387-1389)CCT>CCC		regulating synaptic membrane exocytosis 2							103.0	101.0	102.0					8																	104930687		1814	4088	5902	SO:0001819	synonymous_variant	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:104930687T>C	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1389T>C	8.37:g.104930687T>C		HNSCC(12;0.0054)				RIMS2_uc003ylp.2_Silent_p.P685P|RIMS2_uc003ylw.2_Silent_p.P493P|RIMS2_uc003ylq.2_Silent_p.P493P|RIMS2_uc003ylr.2_Silent_p.P540P|RIMS2_uc003ylt.2_Silent_p.P86P|RIMS2_uc003ylu.1_Silent_p.P76P|RIMS2_uc003ylv.1_Silent_p.P76P	p.P463P	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		7	1630	+			763					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	37	c.1389T>C																																																																																					0.294	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		3	87	0	0	0	0.009096	0	3	87				
KCNV1	27012	broad.mit.edu	37	8	110986332	110986332	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:110986332G>T	ENST00000524391.1	-	2	1318	c.286C>A	c.(286-288)Ccc>Acc	p.P96T	KCNV1_ENST00000297404.1_Missense_Mutation_p.P96T|RP11-696P8.2_ENST00000530667.1_RNA			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	96					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)	p.P96T(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			TTGTCCACGGGGTTGGCATCG	0.672																																							uc003ynr.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|kidney(1)	2						c.(286-288)CCC>ACC		potassium channel, subfamily V, member 1							39.0	33.0	35.0					8																	110986332		2203	4299	6502	SO:0001583	missense	27012					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity	g.chr8:110986332G>T	AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.286C>A	8.37:g.110986332G>T	ENSP00000435954:p.Pro96Thr					KCNV1_uc010mcw.2_Missense_Mutation_p.P96T	p.P96T	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)		1	628	-	all_neural(195;0.219)		96			Cytoplasmic (Potential).		Q9UHJ4	Missense_Mutation	SNP	ENST00000524391.1	37	c.286C>A	CCDS6314.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.604567	0.28623	.	.	ENSG00000164794	ENST00000524391;ENST00000297404	T;T	0.76316	-1.01;-1.01	4.95	4.08	0.47627	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.221260	0.40064	N	0.001198	T	0.69214	0.3086	L	0.41961	1.31	0.29733	N	0.837691	B	0.11235	0.004	B	0.14578	0.011	T	0.61845	-0.6979	10	0.27082	T	0.32	.	12.6847	0.56942	0.0794:0.0:0.9206:0.0	.	96	Q6PIU1	KCNV1_HUMAN	T	96	ENSP00000435954:P96T;ENSP00000297404:P96T	ENSP00000297404:P96T	P	-	1	0	KCNV1	111055508	1.000000	0.71417	0.973000	0.42090	0.877000	0.50540	1.895000	0.39778	1.297000	0.44761	0.655000	0.94253	CCC		0.672	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385525.1	NM_014379		6	21	1	0	0.000157383	0.00308	0.000181644	6	21				
FER1L6	654463	broad.mit.edu	37	8	125094556	125094556	+	Silent	SNP	A	A	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:125094556A>T	ENST00000522917.1	+	33	4454	c.4248A>T	c.(4246-4248)ccA>ccT	p.P1416P	FER1L6_ENST00000399018.1_Silent_p.P1416P|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1416	C2 5. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)		p.P1416P(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CCACATTCCCAAAAGAGTCCC	0.478																																							uc003yqw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|skin(5)|central_nervous_system(1)	11						c.(4246-4248)CCA>CCT		fer-1-like 6							140.0	146.0	144.0					8																	125094556		2202	4300	6502	SO:0001819	synonymous_variant	654463					integral to membrane		g.chr8:125094556A>T	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4248A>T	8.37:g.125094556A>T						uc003yqy.1_Intron	p.P1416P	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		33	4454	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		1416			C2 5.|Cytoplasmic (Potential).			Silent	SNP	ENST00000522917.1	37	c.4248A>T	CCDS43767.1																																																																																				0.478	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		53	107	0	0	0	0.01441	0	53	107				
FAM135B	51059	broad.mit.edu	37	8	139263221	139263221	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:139263221G>T	ENST00000395297.1	-	6	575	c.405C>A	c.(403-405)agC>agA	p.S135R		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	135								p.S135R(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CAAGCGTTCGGCTGCTGACCA	0.592										HNSCC(54;0.14)																													uc003yuy.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(2)	9						c.(403-405)AGC>AGA		hypothetical protein LOC51059							100.0	113.0	108.0					8																	139263221		2156	4245	6401	SO:0001583	missense	51059							g.chr8:139263221G>T	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.405C>A	8.37:g.139263221G>T	ENSP00000378710:p.Ser135Arg	HNSCC(54;0.14)				FAM135B_uc003yux.2_Missense_Mutation_p.S36R|FAM135B_uc003yuz.2_RNA	p.S135R	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		6	576	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		135					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.405C>A	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064987	0.55432	.	.	ENSG00000147724	ENST00000395297;ENST00000160713	T	0.17054	2.3	5.61	1.13	0.20643	.	0.049693	0.85682	D	0.000000	T	0.36635	0.0974	M	0.80746	2.51	0.44330	D	0.997218	D	0.69078	0.997	D	0.68039	0.955	T	0.04229	-1.0967	10	0.48119	T	0.1	-20.5224	9.0504	0.36372	0.3954:0.0:0.6046:0.0	.	135	Q49AJ0	F135B_HUMAN	R	135	ENSP00000378710:S135R	ENSP00000160713:S135R	S	-	3	2	FAM135B	139332403	1.000000	0.71417	0.986000	0.45419	0.349000	0.29174	1.111000	0.31159	-0.069000	0.12931	-0.136000	0.14681	AGC		0.592	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		39	113	1	0	6.2361e-21	0.007835	1.06488e-20	39	113				
MROH5	389690	broad.mit.edu	37	8	142505489	142505490	+	RNA	DNP	GG	GG	TT			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:142505489_142505490GG>TT	ENST00000430863.1	-	0	436_437					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5									p.S119*(1)									CCAGCTTGGGGGAGCCATGAGC	0.559																																							uc003ywi.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(355-357)TCC>TAA		hypothetical protein LOC389690																																						389690						binding	g.chr8:142505489_142505490GG>TT			8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944	ENST00000430863.1:c.356_357delinsTT	8.37:g.142505489_142505490delinsTT						FLJ43860_uc011ljs.1_5'Flank|FLJ43860_uc010meu.1_5'Flank	p.S119*	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0493)		3	437_438	-	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		119						Nonsense_Mutation	DNP	ENST00000430863.1	37	c.356_357CC>AA																																																																																					0.559	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000342412.4	NM_207414		28	71	0	0	0	0.004672	0	28	71				
ARC	23237	broad.mit.edu	37	8	143695607	143695608	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:143695607_143695608CC>AA	ENST00000356613.2	-	1	1225_1226	c.25_26GG>TT	c.(25-27)GGc>TTc	p.G9F	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)	p.G9F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				GTGGAGCCCGCCGCTGGTCCGG	0.738																																							uc003ywn.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(25-27)GGC>TTC		activity-regulated cytoskeleton-associated																																				SO:0001583	missense	23237				endocytosis	acrosomal vesicle|cell junction|dendritic spine|endosome|postsynaptic density|postsynaptic membrane		g.chr8:143695607_143695608CC>AA	AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.25_26delinsAA	8.37:g.143695607_143695608delinsAA	ENSP00000349022:p.Gly9Phe						p.G9F	NM_015193	NP_056008	Q7LC44	ARC_HUMAN			1	226_227	-	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)	9					B4DFL0|O60937	Missense_Mutation	DNP	ENST00000356613.2	37	c.25_26GG>TT	CCDS34950.1																																																																																				0.738	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259274.2			7	14	0	0	0	0.004672	0	7	14				
SLURP1	57152	broad.mit.edu	37	8	143822670	143822670	+	Missense_Mutation	SNP	A	A	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:143822670A>G	ENST00000246515.1	-	3	228	c.203T>C	c.(202-204)gTg>gCg	p.V68A		NM_020427.2	NP_065160.1	P55000	SLUR1_HUMAN	secreted LY6/PLAUR domain containing 1	68	UPAR/Ly6.				cell activation (GO:0001775)|cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)	p.V68A(1)		breast(1)|lung(7)|ovary(1)	9	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GCGGGTCACCACGGGGCTCTG	0.672																																							uc003ywy.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(202-204)GTG>GCG		ARS component B precursor							56.0	52.0	54.0					8																	143822670		2202	4294	6496	SO:0001583	missense	57152				cell activation|cell adhesion	extracellular space	cytokine activity	g.chr8:143822670A>G	AY579080	CCDS6387.1	8q24.3	2004-11-16			ENSG00000126233	ENSG00000126233			18746	protein-coding gene	gene with protein product	"""lymphocyte antigen 6-like secreted"", ""ARS component B"""	606119				11285253, 10211827	Standard	NM_020427		Approved	ARS, ANUP, MDM, ArsB, LY6LS	uc003ywy.3	P55000	OTTHUMG00000164685	ENST00000246515.1:c.203T>C	8.37:g.143822670A>G	ENSP00000246515:p.Val68Ala						p.V68A	NM_020427	NP_065160	P55000	SLUR1_HUMAN			3	229	-	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		68			UPAR/Ly6.		Q53YJ6|Q6PUA6|Q92483	Missense_Mutation	SNP	ENST00000246515.1	37	c.203T>C	CCDS6387.1	.	.	.	.	.	.	.	.	.	.	A	11.39	1.624187	0.28889	.	.	ENSG00000126233	ENST00000246515	T	0.70869	-0.52	3.58	1.03	0.20045	Ly-6 antigen / uPA receptor -like (1);CD59 antigen (1);	0.854493	0.10062	N	0.720807	T	0.57373	0.2049	L	0.44542	1.39	0.22918	N	0.998565	B	0.24823	0.112	B	0.22753	0.041	T	0.45673	-0.9245	10	0.38643	T	0.18	.	3.8877	0.09105	0.6632:0.216:0.1208:0.0	.	68	P55000	SLUR1_HUMAN	A	68	ENSP00000246515:V68A	ENSP00000246515:V68A	V	-	2	0	SLURP1	143819672	0.624000	0.27102	0.420000	0.26596	0.647000	0.38526	0.973000	0.29422	0.089000	0.17243	0.368000	0.22195	GTG		0.672	SLURP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379741.1	NM_020427		11	15	0	0	0	0.010729	0	11	15				
CYP11B2	1585	broad.mit.edu	37	8	143996498	143996498	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr8:143996498C>T	ENST00000323110.2	-	3	561	c.559G>A	c.(559-561)Gac>Aac	p.D187N		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	187					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.D187N(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	GGCTGGACGTCCAGGGTCAGG	0.642									Familial Hyperaldosteronism type I																														uc003yxk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(559-561)GAC>AAC		cytochrome P450, family 11, subfamily B,	Candesartan(DB00796)|Metyrapone(DB01011)						48.0	45.0	46.0					8																	143996498		2203	4297	6500	SO:0001583	missense	1585	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143996498C>T	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.559G>A	8.37:g.143996498C>T	ENSP00000325822:p.Asp187Asn						p.D187N	NM_000498	NP_000489	P19099	C11B2_HUMAN			3	562	-	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		187					B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	c.559G>A	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	12.53	1.966102	0.34659	.	.	ENSG00000179142	ENST00000323110	T	0.73575	-0.76	3.44	1.56	0.23342	.	0.373853	0.23051	N	0.052494	T	0.63780	0.2540	L	0.51422	1.61	0.34342	D	0.688881	B	0.27316	0.175	B	0.29785	0.107	T	0.62978	-0.6739	10	0.32370	T	0.25	.	6.2556	0.20872	0.0:0.6886:0.1955:0.1159	.	187	P19099	C11B2_HUMAN	N	187	ENSP00000325822:D187N	ENSP00000325822:D187N	D	-	1	0	CYP11B2	143993500	1.000000	0.71417	0.729000	0.30791	0.663000	0.39108	1.983000	0.40648	0.753000	0.32945	0.561000	0.74099	GAC		0.642	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1			6	23	0	0	0	0.001168	0	6	23				
IFNA6	3443	broad.mit.edu	37	9	21350395	21350396	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr9:21350395_21350396CC>AA	ENST00000380210.1	-	1	981_982	c.491_492GG>TT	c.(490-492)tGG>tTT	p.W164F		NM_021002.2	NP_066282.1	P05013	IFNA6_HUMAN	interferon, alpha 6	164					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.W164F(1)		large_intestine(3)|lung(7)|skin(1)	11				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		TGACAACCTCCCAGGCACAAGG	0.455																																							uc011lni.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(490-492)TGG>TTT		interferon, alpha 6 precursor																																				SO:0001583	missense	3443				blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding	g.chr9:21350395_21350396CC>AA		CCDS6504.1	9p22	2010-12-10			ENSG00000120235	ENSG00000120235		"""Interferons"""	5427	protein-coding gene	gene with protein product		147566				1385305	Standard	NM_021002		Approved	IFN-alphaK	uc011lni.2	P05013	OTTHUMG00000019676	ENST00000380210.1:c.491_492delinsAA	9.37:g.21350395_21350396delinsAA	ENSP00000369558:p.Trp164Phe						p.W164F	NM_021002	NP_066282	P05013	IFNA6_HUMAN		Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)	1	491_492	-			164					Q5VYQ1	Missense_Mutation	DNP	ENST00000380210.1	37	c.491_492GG>TT	CCDS6504.1																																																																																				0.455	IFNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051905.1	NM_021002		95	292	0	0	0	0.004672	0	95	292				
SPATA31A6	389730	broad.mit.edu	37	9	43627205	43627205	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr9:43627205C>A	ENST00000332857.6	-	4	1510	c.1482G>T	c.(1480-1482)gaG>gaT	p.E494D	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	494					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.E494D(1)									GGGCCTGAGCCTCGGCCTGAG	0.542																																							uc011lrb.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1480-1482)GAG>GAT		hypothetical protein LOC389730							68.0	74.0	72.0					9																	43627205		612	1534	2146	SO:0001583	missense	389730					integral to membrane		g.chr9:43627205C>A		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1482G>T	9.37:g.43627205C>A	ENSP00000329825:p.Glu494Asp						p.E494D	NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN			4	1511	-			494						Missense_Mutation	SNP	ENST00000332857.6	37	c.1482G>T	CCDS47973.1	.	.	.	.	.	.	.	.	.	.	C	3.656	-0.070525	0.07228	.	.	ENSG00000185775	ENST00000332857	T	0.07444	3.19	2.33	-4.65	0.03339	.	1.475580	0.04348	N	0.355130	T	0.07279	0.0184	L	0.53249	1.67	0.09310	N	1	B	0.14805	0.011	B	0.17979	0.02	T	0.38415	-0.9662	10	0.21540	T	0.41	0.0643	1.4547	0.02383	0.3297:0.221:0.3264:0.1229	.	494	Q5VVP1	F75A6_HUMAN	D	494	ENSP00000329825:E494D	ENSP00000329825:E494D	E	-	3	2	FAM75A6	43567201	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.292000	0.19011	-1.225000	0.02578	-2.210000	0.00300	GAG		0.542	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		199	502	1	0	3.81497e-87	0.01441	7.32875e-87	199	502				
XPA	7507	broad.mit.edu	37	9	100455996	100455996	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr9:100455996C>T	ENST00000375128.4	-	2	282	c.218G>A	c.(217-219)gGa>gAa	p.G73E		NM_000380.3	NP_000371.1	P23025	XPA_HUMAN	xeroderma pigmentosum, complementation group A	73	Interaction with CEP164 and required for UV resistance.				DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)	p.G73E(1)		breast(1)|endometrium(4)|large_intestine(1)|lung(4)|prostate(1)	11		Acute lymphoblastic leukemia(62;0.158)				AATGAAGCCTCCTCCTGTGTC	0.353			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc004axr.3		NA	yes	Rec		Xeroderma pigmentosum (A)	9	9q22.3	7507	Mis|N|F|S	"""xeroderma pigmentosum, complementation group A"""			E		skin basal cell|skin squamous cell|melanoma			1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(217-219)GGA>GAA	NER	xeroderma pigmentosum, complementation group A							93.0	94.0	94.0					9																	100455996		2203	4299	6502	SO:0001583	missense	7507	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	nucleotide-excision repair, DNA damage removal	nucleoplasm	damaged DNA binding|metal ion binding|nucleotide binding|protein domain specific binding|protein homodimerization activity	g.chr9:100455996C>T	D14533	CCDS6729.1	9q22.3	2014-09-17			ENSG00000136936	ENSG00000136936			12814	protein-coding gene	gene with protein product		611153					Standard	NM_000380		Approved	XPAC, XP1	uc004axr.4	P23025	OTTHUMG00000020330	ENST00000375128.4:c.218G>A	9.37:g.100455996C>T	ENSP00000364270:p.Gly73Glu					XPA_uc004axs.3_RNA	p.G73E	NM_000380	NP_000371	P23025	XPA_HUMAN			2	335	-		Acute lymphoblastic leukemia(62;0.158)	73			Interaction with CEP164 and required for UV resistance.		Q5T1U9|Q6LCW7|Q6LD02	Missense_Mutation	SNP	ENST00000375128.4	37	c.218G>A	CCDS6729.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789971	0.70337	.	.	ENSG00000136936	ENST00000375128	T	0.66460	-0.21	5.45	4.55	0.56014	.	0.054275	0.64402	D	0.000001	T	0.78362	0.4271	M	0.80422	2.495	0.58432	D	0.999999	D	0.64830	0.994	P	0.57911	0.829	T	0.81743	-0.0793	10	0.87932	D	0	.	12.3474	0.55128	0.0:0.9174:0.0:0.0826	.	73	P23025	XPA_HUMAN	E	73	ENSP00000364270:G73E	ENSP00000364270:G73E	G	-	2	0	XPA	99495817	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	3.816000	0.55658	1.453000	0.47775	0.591000	0.81541	GGA		0.353	XPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053332.1	NM_000380		15	57	0	0	0	0.003163	0	15	57				
SVEP1	79987	broad.mit.edu	37	9	113173762	113173762	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr9:113173762G>T	ENST00000401783.2	-	37	6565	c.6229C>A	c.(6229-6231)Cgt>Agt	p.R2077S	SVEP1_ENST00000374469.1_Missense_Mutation_p.R2054S|SVEP1_ENST00000297826.5_Missense_Mutation_p.R3S	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2077	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.R2080S(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GCTATACAACGGGGCATGTCT	0.478																																							uc010mtz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)	7						c.(6229-6231)CGT>AGT		polydom							45.0	46.0	45.0					9																	113173762		1882	4099	5981	SO:0001583	missense	79987				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding	g.chr9:113173762G>T	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6229C>A	9.37:g.113173762G>T	ENSP00000384917:p.Arg2077Ser					SVEP1_uc010mty.2_Missense_Mutation_p.R3S	p.R2077S	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN			37	6566	-			2077			Sushi 11.		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	c.6229C>A	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	G	13.10	2.135168	0.37728	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.70749	-0.09;-0.09;-0.51	5.98	5.98	0.97165	Complement control module (2);Sushi/SCR/CCP (3);	0.370853	0.33272	N	0.005092	T	0.49695	0.1572	N	0.19112	0.55	0.80722	D	1	B	0.32283	0.362	B	0.32864	0.154	T	0.48258	-0.9051	10	0.10636	T	0.68	.	6.8082	0.23788	0.0692:0.1277:0.671:0.1321	.	2077	Q4LDE5	SVEP1_HUMAN	S	2077;2054;3	ENSP00000384917:R2077S;ENSP00000363593:R2054S;ENSP00000297826:R3S	ENSP00000297826:R3S	R	-	1	0	SVEP1	112213583	0.893000	0.30496	0.974000	0.42286	0.997000	0.91878	4.498000	0.60373	2.847000	0.97988	0.591000	0.81541	CGT		0.478	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				15	22	1	0	0.000308642	0.003163	0.000350675	15	22				
KIF12	113220	broad.mit.edu	37	9	116859704	116859704	+	Silent	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr9:116859704G>A	ENST00000374118.3	-	4	346	c.109C>T	c.(109-111)Ctg>Ttg	p.L37L	KIF12_ENST00000473174.1_Intron	NM_138424.1	NP_612433.1	Q96FN5	KIF12_HUMAN	kinesin family member 12	170	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L37L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	17						CCCAGGCTCAGCAAGTCCCGA	0.627																																							uc004bif.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(109-111)CTG>TTG		kinesin family member 12							24.0	28.0	26.0					9																	116859704		2202	4300	6502	SO:0001819	synonymous_variant	113220				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr9:116859704G>A	BC010626	CCDS6801.1	9q33.1	2008-02-05			ENSG00000136883	ENSG00000136883		"""Kinesins"""	21495	protein-coding gene	gene with protein product		611278					Standard	NM_138424		Approved		uc004bif.3	Q96FN5	OTTHUMG00000020533	ENST00000374118.3:c.109C>T	9.37:g.116859704G>A						KIF12_uc004big.2_RNA	p.L37L	NM_138424	NP_612433	Q96FN5	KIF12_HUMAN			4	347	-			170			Kinesin-motor.		Q5TBE0	Silent	SNP	ENST00000374118.3	37	c.109C>T	CCDS6801.1																																																																																				0.627	KIF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053751.1	NM_138424		12	40	0	0	0	0.001855	0	12	40				
TNC	3371	broad.mit.edu	37	9	117810558	117810558	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr9:117810558C>G	ENST00000350763.4	-	16	5244	c.4833G>C	c.(4831-4833)ttG>ttC	p.L1611F	TNC_ENST00000542877.1_Intron|TNC_ENST00000535648.1_Intron|TNC_ENST00000537320.1_Intron|TNC_ENST00000340094.3_Missense_Mutation_p.L1247F|TNC_ENST00000345230.3_Intron|TNC_ENST00000423613.2_Intron|TNC_ENST00000346706.3_Intron|TNC_ENST00000341037.4_Intron|TNC_ENST00000481475.1_5'UTR	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1611	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.L1611F(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TCTCAGCCCTCAAGGGCTTGG	0.493																																							uc004bjj.3		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						c.(4831-4833)TTG>TTC		tenascin C precursor							151.0	151.0	151.0					9																	117810558		2203	4300	6503	SO:0001583	missense	3371				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding	g.chr9:117810558C>G		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.4833G>C	9.37:g.117810558C>G	ENSP00000265131:p.Leu1611Phe					TNC_uc010mvf.2_Intron	p.L1611F	NM_002160	NP_002151	P24821	TENA_HUMAN			16	5195	-			1611			Fibronectin type-III 11.		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	c.4833G>C	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957492	0.53400	.	.	ENSG00000041982	ENST00000340094;ENST00000350763	T;T	0.05081	3.5;3.5	5.7	5.7	0.88788	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.50627	D	0.000119	T	0.18964	0.0455	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.00273	-1.1858	10	0.33940	T	0.23	.	10.9432	0.47285	0.0:0.8725:0.0:0.1275	.	1611	P24821	TENA_HUMAN	F	1247;1611	ENSP00000344400:L1247F;ENSP00000265131:L1611F	ENSP00000344400:L1247F	L	-	3	2	TNC	116850379	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.043000	0.41231	2.688000	0.91661	0.655000	0.94253	TTG		0.493	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160		5	194	0	0	0	0.001168	0	5	194				
C5	727	broad.mit.edu	37	9	123783854	123783854	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr9:123783854C>A	ENST00000223642.1	-	11	1264	c.1235G>T	c.(1234-1236)cGt>cTt	p.R412L		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	412					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.R412L(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	ATCATCAACACGTGTTACACT	0.433																																							uc004bkv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1234-1236)CGT>CTT		complement component 5 preproprotein	Eculizumab(DB01257)						197.0	166.0	176.0					9																	123783854		2203	4300	6503	SO:0001583	missense	727				activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity	g.chr9:123783854C>A	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.1235G>T	9.37:g.123783854C>A	ENSP00000223642:p.Arg412Leu					C5_uc010mvm.1_Missense_Mutation_p.R412L|C5_uc010mvn.1_Missense_Mutation_p.R412L	p.R412L	NM_001735	NP_001726	P01031	CO5_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	11	1265	-			412					Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	c.1235G>T	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	C	8.657	0.899611	0.17686	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.32515	1.45	5.97	-1.03	0.10102	.	1.416890	0.04259	N	0.339991	T	0.27384	0.0672	L	0.54323	1.7	0.09310	N	1	P;B	0.41041	0.736;0.215	B;B	0.30855	0.121;0.042	T	0.42982	-0.9419	10	0.54805	T	0.06	.	10.9131	0.47120	0.0:0.4473:0.0:0.5527	.	483;412	Q59GS8;P01031	.;CO5_HUMAN	L	412;483	ENSP00000223642:R412L	ENSP00000223642:R412L	R	-	2	0	C5	122823675	0.000000	0.05858	0.000000	0.03702	0.221000	0.24807	0.200000	0.17257	-0.361000	0.08125	0.655000	0.94253	CGT		0.433	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735		19	59	1	0	1.96292e-10	0.010504	2.69095e-10	19	59				
ST6GALNAC6	30815	broad.mit.edu	37	9	130649020	130649020	+	Missense_Mutation	SNP	T	T	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr9:130649020T>C	ENST00000373146.1	-	7	1039	c.860A>G	c.(859-861)aAg>aGg	p.K287R	ST6GALNAC6_ENST00000373144.3_Missense_Mutation_p.K253R|ST6GALNAC6_ENST00000373141.1_Missense_Mutation_p.K253R|ST6GALNAC6_ENST00000542456.1_Missense_Mutation_p.K87R|ST6GALNAC6_ENST00000485320.1_5'UTR|RP11-203J24.9_ENST00000476274.2_RNA|ST6GALNAC6_ENST00000291839.5_Missense_Mutation_p.K287R|ST6GALNAC6_ENST00000373142.1_Missense_Mutation_p.R286G			Q969X2	SIA7F_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6	287					cell-cell recognition (GO:0009988)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)	p.K287R(1)		endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GTCCGGCCCCTTGGGCTCGTA	0.632																																							uc004bso.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(859-861)AAG>AGG		sialytransferase 7F							164.0	134.0	144.0					9																	130649020		2203	4300	6503	SO:0001583	missense	30815				protein glycosylation	integral to Golgi membrane|plasma membrane		g.chr9:130649020T>C	BC006564	CCDS6882.1, CCDS69668.1, CCDS69669.1, CCDS75908.1	9q34.13	2013-03-01		2005-02-07	ENSG00000160408	ENSG00000160408		"""Sialyltransferases"""	23364	protein-coding gene	gene with protein product		610135	"""sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F"""	SIAT7F		12668675	Standard	XM_005251952		Approved	ST6GALNACVI	uc004bso.1	Q969X2	OTTHUMG00000020718	ENST00000373146.1:c.860A>G	9.37:g.130649020T>C	ENSP00000362239:p.Lys287Arg					ST6GALNAC6_uc004bsn.1_Missense_Mutation_p.K253R|ST6GALNAC6_uc011man.1_Missense_Mutation_p.K87R|ST6GALNAC6_uc004bsp.1_Missense_Mutation_p.R286G|ST6GALNAC6_uc004bsq.1_Missense_Mutation_p.K253R|ST6GALNAC6_uc004bsr.2_Missense_Mutation_p.K253R|ST6GALNAC6_uc010mxp.1_RNA	p.K287R	NM_013443	NP_038471	Q969X2	SIA7F_HUMAN			7	979	-			287			Lumenal (Potential).		B3KQ01|Q5T9C4|Q5T9C5|Q9H8A2|Q9ULB8	Missense_Mutation	SNP	ENST00000373146.1	37	c.860A>G	CCDS6882.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.48|18.48	3.632280|3.632280	0.67015|0.67015	.|.	.|.	ENSG00000160408|ENSG00000160408	ENST00000373146;ENST00000373141;ENST00000373144;ENST00000291839;ENST00000542456|ENST00000373142	T;T;T;T;T|T	0.30448|0.35048	1.53;1.53;1.53;1.53;1.53|1.33	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.385931	.|0.33959	.|N	.|0.004382	T|T	0.20047|0.20047	0.0482|0.0482	N|N	0.04746|0.04746	-0.17|-0.17	0.36880|0.36880	D|D	0.889346|0.889346	B;B|.	0.11235|.	0.004;0.0|.	B;B|.	0.12156|.	0.007;0.001|.	T|T	0.31280|0.31280	-0.9949|-0.9949	9|8	0.08179|0.15499	T|T	0.78|0.54	-13.1445|-13.1445	10.1801|10.1801	0.42963|0.42963	0.0:0.0783:0.0:0.9217|0.0:0.0783:0.0:0.9217	.|.	87;287|.	B4DU80;Q969X2|.	.;SIA7F_HUMAN|.	R|G	287;253;253;287;87|286	ENSP00000362239:K287R;ENSP00000362234:K253R;ENSP00000362237:K253R;ENSP00000291839:K287R;ENSP00000438109:K87R|ENSP00000362235:R286G	ENSP00000291839:K287R|ENSP00000362235:R286G	K|R	-|-	2|1	0|2	ST6GALNAC6|ST6GALNAC6	129688841|129688841	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.026000|3.026000	0.49689|0.49689	2.221000|2.221000	0.72209|0.72209	0.533000|0.533000	0.62120|0.62120	AAG|AGG		0.632	ST6GALNAC6-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054278.1	NM_013443		3	74	0	0	0	0.009096	0	3	74				
MXRA5	25878	broad.mit.edu	37	X	3248300	3248300	+	Silent	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:3248300G>T	ENST00000217939.6	-	4	622	c.468C>A	c.(466-468)ctC>ctA	p.L156L		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	156						extracellular vesicular exosome (GO:0070062)		p.L156L(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTTCCAAATGGAGTAGCCTCA	0.478																																							uc004crg.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(466-468)CTC>CTA		adlican precursor							114.0	92.0	99.0					X																	3248300		2203	4300	6503	SO:0001819	synonymous_variant	25878					extracellular region		g.chrX:3248300G>T	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.468C>A	X.37:g.3248300G>T							p.L156L	NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN			4	625	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	156			LRR 5.		Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	37	c.468C>A	CCDS14124.1																																																																																				0.478	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		17	38	1	0	4.14922e-12	0.004007	5.99788e-12	17	38				
WWC3	55841	broad.mit.edu	37	X	10093091	10093091	+	Silent	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:10093091C>A	ENST00000380861.4	+	14	2245	c.1854C>A	c.(1852-1854)ctC>ctA	p.L618L	WWC3_ENST00000454666.1_Silent_p.L618L	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	618	C2.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.L618L(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						AGTGTCTCCTCGTGCACGTGC	0.622																																							uc004csx.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(1852-1854)CTC>CTA		WWC family member 3							37.0	32.0	34.0					X																	10093091		2203	4299	6502	SO:0001819	synonymous_variant	55841							g.chrX:10093091C>A	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.1854C>A	X.37:g.10093091C>A						WWC3_uc010nds.2_Silent_p.L282L|WWC3_uc010ndt.2_RNA	p.L618L	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN			14	2052	+			618			C2.		A8KA96|Q659C1|Q9BTQ1	Silent	SNP	ENST00000380861.4	37	c.1854C>A	CCDS14136.1																																																																																				0.622	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691		8	17	1	0	2.74318e-10	0.006214	3.74303e-10	8	17				
DMD	1756	broad.mit.edu	37	X	31645941	31645941	+	Missense_Mutation	SNP	C	C	G	rs398124060		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:31645941C>G	ENST00000357033.4	-	55	8272	c.8066G>C	c.(8065-8067)aGa>aCa	p.R2689T	DMD_ENST00000378677.2_Missense_Mutation_p.R2685T|DMD_ENST00000378707.3_Missense_Mutation_p.R229T|DMD_ENST00000541735.1_Missense_Mutation_p.R229T|DMD_ENST00000359836.1_Missense_Mutation_p.R229T|DMD_ENST00000474231.1_Missense_Mutation_p.R229T|DMD_ENST00000343523.2_Missense_Mutation_p.R229T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2689					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R1348T(1)|p.R2684T(1)|p.R2685T(1)|p.R229T(1)|p.R2689T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTGCAGTAATCTATGAGTTTC	0.453																																							uc004dda.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(3)|pancreas(2)|large_intestine(1)	6						c.(8065-8067)AGA>ACA		dystrophin Dp427m isoform							57.0	51.0	53.0					X																	31645941		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:31645941C>G	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8066G>C	X.37:g.31645941C>G	ENSP00000354923:p.Arg2689Thr					DMD_uc004dcr.1_Missense_Mutation_p.R229T|DMD_uc004dcs.1_Missense_Mutation_p.R229T|DMD_uc004dct.1_Missense_Mutation_p.R229T|DMD_uc004dcu.1_Missense_Mutation_p.R229T|DMD_uc004dcv.1_Missense_Mutation_p.R229T|DMD_uc004dcw.2_Missense_Mutation_p.R1345T|DMD_uc004dcx.2_Missense_Mutation_p.R1348T|DMD_uc004dcz.2_Missense_Mutation_p.R2566T|DMD_uc004dcy.1_Missense_Mutation_p.R2685T|DMD_uc004ddb.1_Missense_Mutation_p.R2681T	p.R2689T	NM_004006	NP_003997	P11532	DMD_HUMAN			55	8310	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	2689			Spectrin 19.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.8066G>C	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.57|15.57	2.872964|2.872964	0.51695|0.51695	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231|ENST00000465285	T;T;T;T;T;T;T;T|.	0.63096|.	3.94;-0.02;-0.02;3.86;3.87;3.87;3.88;3.91|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	1.002490|.	0.08052|.	U|.	0.996733|.	T|.	0.70448|.	0.3225|.	L|L	0.59436|0.59436	1.845|1.845	0.40990|0.40990	D|D	0.984842|0.984842	P;P;P;P;P;B;B;B;B;B|.	0.47191|.	0.471;0.891;0.891;0.837;0.837;0.032;0.083;0.316;0.117;0.145|.	B;B;B;B;B;B;B;B;B;B|.	0.43225|.	0.25;0.412;0.412;0.397;0.397;0.038;0.143;0.351;0.081;0.033|.	T|.	0.69577|.	-0.5108|.	10|.	0.45353|.	T|.	0.12|.	.|.	15.4698|15.4698	0.75432|0.75432	0.1388:0.8612:0.0:0.0|0.1388:0.8612:0.0:0.0	.|.	2681;2689;2685;1348;1345;229;229;229;229;229|.	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3|.	.;DMD_HUMAN;.;.;.;.;.;.;.;.|.	T|Y	2681;1348;1345;385;2685;2689;229;229;2689;2566;229;229;229|417	ENSP00000350765:R385T;ENSP00000367948:R2685T;ENSP00000354923:R2689T;ENSP00000352894:R229T;ENSP00000340057:R229T;ENSP00000367979:R229T;ENSP00000444119:R229T;ENSP00000417123:R229T|.	ENSP00000340057:R229T|.	R|X	-|-	2|3	0|2	DMD|DMD	31555862|31555862	0.988000|0.988000	0.35896|0.35896	0.976000|0.976000	0.42696|0.42696	0.992000|0.992000	0.81027|0.81027	2.691000|2.691000	0.47010|0.47010	2.461000|2.461000	0.83175|0.83175	0.508000|0.508000	0.49915|0.49915	AGA|TAG		0.453	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		6	24	0	0	0	0.001984	0	6	24				
FAM47C	442444	broad.mit.edu	37	X	37029325	37029325	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:37029325G>T	ENST00000358047.3	+	1	2894	c.2842G>T	c.(2842-2844)Ggg>Tgg	p.G948W		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	948								p.G948W(4)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GCCTAAGTTGGGGAAAAAGCT	0.458																																							uc004ddl.1		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)	3						c.(2842-2844)GGG>TGG		hypothetical protein LOC442444							110.0	106.0	107.0					X																	37029325		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37029325G>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2842G>T	X.37:g.37029325G>T	ENSP00000367913:p.Gly948Trp						p.G948W	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	2856	+			948					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.2842G>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-2.907506	0.00057	.	.	ENSG00000198173	ENST00000358047	T	0.14640	2.49	0.502	-1.0	0.10196	.	.	.	.	.	T	0.03095	0.0091	N	0.02286	-0.61	0.09310	N	1	B	0.17852	0.024	B	0.15870	0.014	T	0.32561	-0.9902	8	0.02654	T	1	.	.	.	.	.	948	Q5HY64	FA47C_HUMAN	W	948	ENSP00000367913:G948W	ENSP00000367913:G948W	G	+	1	0	FAM47C	36939246	0.242000	0.23868	0.004000	0.12327	0.001000	0.01503	0.147000	0.16202	-2.109000	0.00838	-2.215000	0.00298	GGG		0.458	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		60	118	1	0	4.83677e-39	0.01441	9.11186e-39	60	118				
UBQLN2	29978	broad.mit.edu	37	X	56591819	56591819	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:56591819G>T	ENST00000338222.5	+	1	1794	c.1513G>T	c.(1513-1515)Gtc>Ttc	p.V505F		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	505	12 X 3 AA tandem repeats of P-X-X.				cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V505F(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						AGGCCCTATAGTCCCTTTTAC	0.662																																					Esophageal Squamous(104;218 1492 6022 10838 28884)	Esophageal Squamous(104;218 1492 6022 10838 28884)	uc004dus.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1513-1515)GTC>TTC		ubiquilin 2							10.0	11.0	11.0					X																	56591819		2189	4273	6462	SO:0001583	missense	29978					cytoplasm|nucleus|plasma membrane	binding	g.chrX:56591819G>T	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.1513G>T	X.37:g.56591819G>T	ENSP00000345195:p.Val505Phe					UBQLN2_uc011moq.1_Intron	p.V505F	NM_013444	NP_038472	Q9UHD9	UBQL2_HUMAN			1	1748	+			505			5.|12 X 3 AA tandem repeats of P-X-X.		O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	ENST00000338222.5	37	c.1513G>T	CCDS14374.1	.	.	.	.	.	.	.	.	.	.	G	9.739	1.164360	0.21538	.	.	ENSG00000188021	ENST00000338222	D	0.84298	-1.83	4.18	4.18	0.49190	.	0.000000	0.35096	N	0.003460	T	0.69387	0.3105	N	0.08118	0	0.31870	N	0.6199	P	0.34699	0.464	B	0.36134	0.218	T	0.73503	-0.3962	10	0.56958	D	0.05	-8.3788	6.9342	0.24457	0.1235:0.0:0.8765:0.0	.	505	Q9UHD9	UBQL2_HUMAN	F	505	ENSP00000345195:V505F	ENSP00000345195:V505F	V	+	1	0	UBQLN2	56608544	0.721000	0.28007	1.000000	0.80357	0.974000	0.67602	3.221000	0.51215	2.316000	0.78162	0.594000	0.82650	GTC		0.662	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056891.1	NM_013444		3	4	1	0	0.00909568	0.009096	0.00972871	3	4				
SPIN4	139886	broad.mit.edu	37	X	62570685	62570685	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:62570685G>T	ENST00000335144.3	-	1	533	c.14C>A	c.(13-15)aCc>aAc	p.T5N	SPIN4-AS1_ENST00000451979.1_RNA|SPIN4_ENST00000374884.2_5'UTR	NM_001012968.2	NP_001012986.2	Q56A73	SPIN4_HUMAN	spindlin family, member 4	5					gamete generation (GO:0007276)			p.T5N(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	11						CGGAGGCACGGTTGGAGGAGA	0.512																																							uc004dvf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(13-15)ACC>AAC		spindlin family, member 4							46.0	45.0	45.0					X																	62570685		2000	4151	6151	SO:0001583	missense	139886				gamete generation			g.chrX:62570685G>T	AK126931	CCDS43964.1	Xq11.1	2008-02-05			ENSG00000186767	ENSG00000186767			27040	protein-coding gene	gene with protein product						12477932	Standard	NM_001012968		Approved	FLJ44984	uc004dvf.3	Q56A73	OTTHUMG00000021696	ENST00000335144.3:c.14C>A	X.37:g.62570685G>T	ENSP00000334163:p.Thr5Asn						p.T5N	NM_001012968	NP_001012986	Q56A73	SPIN4_HUMAN			1	534	-			5					B3KX90|Q5JUL2	Missense_Mutation	SNP	ENST00000335144.3	37	c.14C>A	CCDS43964.1	.	.	.	.	.	.	.	.	.	.	.	8.409	0.843821	0.16963	.	.	ENSG00000186767	ENST00000335144	T	0.45276	0.9	3.9	3.03	0.35002	.	0.385688	0.19168	N	0.121014	T	0.26919	0.0659	L	0.29908	0.895	0.09310	N	0.999999	B	0.26577	0.153	B	0.12837	0.008	T	0.19128	-1.0315	10	0.66056	D	0.02	-14.9958	6.4827	0.22071	0.1332:0.0:0.8668:0.0	.	5	Q56A73	SPIN4_HUMAN	N	5	ENSP00000334163:T5N	ENSP00000334163:T5N	T	-	2	0	SPIN4	62487410	0.762000	0.28451	0.107000	0.21349	0.161000	0.22273	2.726000	0.47302	1.006000	0.39211	0.422000	0.28245	ACC		0.512	SPIN4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001012968		13	57	1	0	1.49906e-05	0.00245	1.81629e-05	13	57				
EDA	1896	broad.mit.edu	37	X	69255353	69255353	+	Missense_Mutation	SNP	G	G	T	rs61747506		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:69255353G>T	ENST00000374552.4	+	8	1312	c.1070G>T	c.(1069-1071)cGg>cTg	p.R357L	EDA_ENST00000374553.2_Missense_Mutation_p.R355L|EDA_ENST00000524573.1_Missense_Mutation_p.R352L	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	357			R -> P (in XHED).		cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.R357L(2)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						CTCAAGGCCCGGCAGAAGATC	0.582																																							uc004dxs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|large_intestine(1)	3	GRCh37	CM980596	EDA	M	rs61747506	c.(1069-1071)CGG>CTG		ectodysplasin A isoform EDA-A1							92.0	65.0	75.0					X																	69255353		2203	4300	6503	SO:0001583	missense	1896				cell differentiation|ectoderm development|immune response|positive regulation of NF-kappaB transcription factor activity|signal transduction	collagen|cytoskeleton|membrane fraction	tumor necrosis factor receptor binding	g.chrX:69255353G>T	U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.1070G>T	X.37:g.69255353G>T	ENSP00000363680:p.Arg357Leu					EDA_uc004dxr.2_Missense_Mutation_p.R355L|EDA_uc011mpj.1_Missense_Mutation_p.R352L	p.R357L	NM_001399	NP_001390	Q92838	EDA_HUMAN			8	1312	+			357		R -> P (in ED1).	Extracellular (Potential).		A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	ENST00000374552.4	37	c.1070G>T	CCDS14394.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.491402	0.64074	.	.	ENSG00000158813	ENST00000374552;ENST00000374553;ENST00000524573	D;D;D	0.99422	-5.88;-5.88;-5.88	5.42	4.54	0.55810	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.071741	0.56097	D	0.000028	D	0.96852	0.8972	N	0.22421	0.69	0.80722	D	1	P;P;B	0.36974	0.576;0.456;0.402	B;B;B	0.30179	0.068;0.112;0.068	D	0.96509	0.9377	10	0.72032	D	0.01	-9.2184	9.2942	0.37804	0.1694:0.0:0.8306:0.0	.	352;357;355	Q92838-9;Q92838;Q92838-3	.;EDA_HUMAN;.	L	357;355;352	ENSP00000363680:R357L;ENSP00000363681:R355L;ENSP00000432585:R352L	ENSP00000363680:R357L	R	+	2	0	EDA	69172078	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.870000	0.63035	2.261000	0.74972	0.529000	0.55759	CGG		0.582	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057048.2	NM_001399		17	55	1	0	3.45872e-05	0.004007	4.12223e-05	17	55				
KIF4A	24137	broad.mit.edu	37	X	69550032	69550032	+	Silent	SNP	T	T	A	rs200974983		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:69550032T>A	ENST00000374403.3	+	9	1003	c.921T>A	c.(919-921)acT>acA	p.T307T	KIF4A_ENST00000374388.3_Silent_p.T307T	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	307	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.T307T(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						ATAGCCATACTCTTATGATAG	0.378																																							uc004dyg.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)	4						c.(919-921)ACT>ACA		kinesin family member 4							112.0	107.0	109.0					X																	69550032		2203	4299	6502	SO:0001819	synonymous_variant	24137				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding	g.chrX:69550032T>A	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.921T>A	X.37:g.69550032T>A						KIF4A_uc010nkw.2_Silent_p.T307T|KIF4A_uc004dyf.1_Silent_p.T307T	p.T307T	NM_012310	NP_036442	O95239	KIF4A_HUMAN			9	1048	+			307			Kinesin-motor.		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Silent	SNP	ENST00000374403.3	37	c.921T>A	CCDS14401.1																																																																																				0.378	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310		62	156	0	0	0	0.01441	0	62	156				
KIF4A	24137	broad.mit.edu	37	X	69637839	69637839	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:69637839C>A	ENST00000374403.3	+	29	3439	c.3357C>A	c.(3355-3357)aaC>aaA	p.N1119K		NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	1119	Globular.|Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.N1119K(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						AGTGTCGGAACCGCCAGCAAG	0.542																																							uc004dyg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)	4						c.(3355-3357)AAC>AAA		kinesin family member 4							144.0	99.0	114.0					X																	69637839		2203	4300	6503	SO:0001583	missense	24137				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding	g.chrX:69637839C>A	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.3357C>A	X.37:g.69637839C>A	ENSP00000363524:p.Asn1119Lys					KIF4A_uc010nkw.2_Missense_Mutation_p.N1119K	p.N1119K	NM_012310	NP_036442	O95239	KIF4A_HUMAN			29	3484	+			1119			Globular.|Interaction with PRC1.		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	c.3357C>A	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	c	10.51	1.369257	0.24771	.	.	ENSG00000090889	ENST00000374403;ENST00000544650	D	0.93953	-3.32	5.3	2.54	0.30619	.	0.000000	0.64402	D	0.000002	D	0.89815	0.6824	M	0.64997	1.995	0.80722	D	1	B	0.26577	0.153	B	0.22386	0.039	D	0.84135	0.0414	9	.	.	.	.	9.5465	0.39284	0.0:0.7541:0.0:0.2459	.	1119	O95239	KIF4A_HUMAN	K	1119;421	ENSP00000363524:N1119K	.	N	+	3	2	KIF4A	69554564	1.000000	0.71417	1.000000	0.80357	0.418000	0.31294	1.653000	0.37323	0.626000	0.30322	-0.303000	0.09236	AAC		0.542	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310		22	61	1	0	1.55795e-14	0.012319	2.47239e-14	22	61				
DLG3	1741	broad.mit.edu	37	X	69670523	69670523	+	Missense_Mutation	SNP	A	A	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:69670523A>T	ENST00000374360.3	+	6	1108	c.875A>T	c.(874-876)gAg>gTg	p.E292V	DLG3_ENST00000374355.3_5'Flank|DLG3-AS1_ENST00000424211.1_RNA|DLG3-AS1_ENST00000431103.1_RNA|RNU4-81P_ENST00000363561.1_RNA|DLG3_ENST00000194900.4_Missense_Mutation_p.E310V	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	292	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)	p.E292V(1)		endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					GTGAGGCACGAGGAAGCTGTG	0.557																																							uc004dyi.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|pancreas(1)	2						c.(874-876)GAG>GTG		synapse-associated protein 102 isoform a							84.0	58.0	67.0					X																	69670523		2203	4300	6503	SO:0001583	missense	1741				axon guidance|negative regulation of cell proliferation|synaptic transmission	plasma membrane	guanylate kinase activity	g.chrX:69670523A>T	U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.875A>T	X.37:g.69670523A>T	ENSP00000363480:p.Glu292Val					DLG3_uc004dyj.1_5'Flank	p.E292V	NM_021120	NP_066943	Q92796	DLG3_HUMAN			6	1203	+	Renal(35;0.156)		292			PDZ 2.		B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Missense_Mutation	SNP	ENST00000374360.3	37	c.875A>T	CCDS14403.1	.	.	.	.	.	.	.	.	.	.	A	19.86	3.904740	0.72868	.	.	ENSG00000082458	ENST00000194900;ENST00000374360	T;T	0.32272	1.46;1.46	4.38	4.38	0.52667	PDZ/DHR/GLGF (4);	0.000000	0.64402	U	0.000001	T	0.55449	0.1921	M	0.80616	2.505	0.80722	D	1	D	0.69078	0.997	D	0.85130	0.997	T	0.59332	-0.7474	9	.	.	.	.	11.9934	0.53188	1.0:0.0:0.0:0.0	.	292	Q92796	DLG3_HUMAN	V	310;292	ENSP00000194900:E310V;ENSP00000363480:E292V	.	E	+	2	0	DLG3	69587248	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.697000	0.91307	1.618000	0.50286	0.441000	0.28932	GAG		0.557	DLG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057074.2	NM_021120		14	35	0	0	0	0.003163	0	14	35				
ZMYM3	9203	broad.mit.edu	37	X	70464286	70464286	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:70464286G>T	ENST00000353904.2	-	20	3333	c.3146C>A	c.(3145-3147)tCc>tAc	p.S1049Y	ZMYM3_ENST00000373998.1_Missense_Mutation_p.S1037Y|ZMYM3_ENST00000373988.1_Missense_Mutation_p.S1051Y|ZMYM3_ENST00000314425.5_Missense_Mutation_p.S1049Y|ZMYM3_ENST00000373984.3_Missense_Mutation_p.S1051Y|ZMYM3_ENST00000489332.1_5'UTR	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	1049					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S1049Y(1)		breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					GGAGTCCCGGGAGCAGCTTTC	0.537																																							uc004dzh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3145-3147)TCC>TAC		zinc finger protein 261							51.0	41.0	44.0					X																	70464286		2203	4300	6503	SO:0001583	missense	9203				multicellular organismal development	nucleus	DNA binding|zinc ion binding	g.chrX:70464286G>T	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.3146C>A	X.37:g.70464286G>T	ENSP00000343909:p.Ser1049Tyr					BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Missense_Mutation_p.S1049Y|ZMYM3_uc004dzj.1_Missense_Mutation_p.S1037Y	p.S1049Y	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN			20	3233	-	Renal(35;0.156)		1049					D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	ENST00000353904.2	37	c.3146C>A	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	g	21.3	4.123665	0.77436	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988	T;T;T;T;T	0.50277	1.35;0.75;1.35;1.35;1.35	5.09	5.09	0.68999	.	0.174419	0.41605	D	0.000847	T	0.62332	0.2419	L	0.43923	1.385	0.43263	D	0.995201	D;D	0.71674	0.998;0.997	D;D	0.72982	0.979;0.952	T	0.65352	-0.6189	10	0.72032	D	0.01	-18.6949	17.6345	0.88118	0.0:0.0:1.0:0.0	.	1037;1049	Q14202-2;Q14202	.;ZMYM3_HUMAN	Y	1049;1037;1049;1051;1051	ENSP00000322845:S1049Y;ENSP00000363110:S1037Y;ENSP00000343909:S1049Y;ENSP00000363096:S1051Y;ENSP00000363100:S1051Y	ENSP00000322845:S1049Y	S	-	2	0	ZMYM3	70381011	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.564000	0.67359	2.350000	0.79820	0.529000	0.55759	TCC		0.537	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599		16	24	1	0	1.15088e-07	0.004007	1.46111e-07	16	24				
ATP7A	538	broad.mit.edu	37	X	77289241	77289241	+	Missense_Mutation	SNP	G	G	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:77289241G>C	ENST00000341514.6	+	17	3588	c.3433G>C	c.(3433-3435)Gca>Cca	p.A1145P	ATP7A_ENST00000350425.4_Missense_Mutation_p.A148P|ATP7A_ENST00000343533.5_Missense_Mutation_p.A1067P	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1145					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)	p.A1145P(2)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TATTAAAAATGCATCCCTGGT	0.373																																							uc004ecx.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(3433-3435)GCA>CCA		ATPase, Cu++ transporting, alpha polypeptide							126.0	118.0	121.0					X																	77289241		2203	4296	6499	SO:0001583	missense	538				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity	g.chrX:77289241G>C	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.3433G>C	X.37:g.77289241G>C	ENSP00000345728:p.Ala1145Pro						p.A1145P	NM_000052	NP_000043	Q04656	ATP7A_HUMAN			17	3593	+			1145			Cytoplasmic (Potential).		B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	c.3433G>C	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.063403	0.36373	.	.	ENSG00000165240	ENST00000343533;ENST00000350425;ENST00000341514	D;D;D	0.97404	-4.0;-4.37;-4.01	5.16	4.3	0.51218	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.256174	0.39341	N	0.001389	D	0.91078	0.7192	N	0.08118	0	0.39309	D	0.965048	B	0.02656	0.0	B	0.08055	0.003	D	0.86461	0.1779	10	0.22109	T	0.4	-13.9697	13.1758	0.59626	0.0797:0.0:0.9203:0.0	.	1145	Q04656	ATP7A_HUMAN	P	1067;148;1145	ENSP00000343026:A1067P;ENSP00000343678:A148P;ENSP00000345728:A1145P	ENSP00000345728:A1145P	A	+	1	0	ATP7A	77175897	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	3.322000	0.52007	1.068000	0.40764	-0.191000	0.12829	GCA		0.373	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052		44	106	0	0	0	0.009718	0	44	106				
TCEAL5	340543	broad.mit.edu	37	X	102529326	102529326	+	Missense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:102529326C>A	ENST00000372680.1	-	3	460	c.166G>T	c.(166-168)Gat>Tat	p.D56Y		NM_001012979.2	NP_001012997.1	Q5H9L2	TCAL5_HUMAN	transcription elongation factor A (SII)-like 5	56	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.D56Y(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						tctccctcatcctctcgcttt	0.522																																							uc004ejz.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(166-168)GAT>TAT		transcription elongation factor A (SII)-like 5							224.0	150.0	175.0					X																	102529326		2203	4300	6503	SO:0001583	missense	340543				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chrX:102529326C>A		CCDS35356.1	Xq22.2	2014-03-21			ENSG00000204065	ENSG00000204065			22282	protein-coding gene	gene with protein product						16221301	Standard	NM_001012979		Approved	WEX4	uc004ejz.2	Q5H9L2	OTTHUMG00000022092	ENST00000372680.1:c.166G>T	X.37:g.102529326C>A	ENSP00000361765:p.Asp56Tyr						p.D56Y	NM_001012979	NP_001012997	Q5H9L2	TCAL5_HUMAN			3	461	-			56			Glu-rich.		A2RUJ4	Missense_Mutation	SNP	ENST00000372680.1	37	c.166G>T	CCDS35356.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.667726	0.29604	.	.	ENSG00000204065	ENST00000372680	T	0.25579	1.79	3.02	0.802	0.18686	.	1.190930	0.06404	N	0.719439	T	0.21631	0.0521	L	0.41492	1.28	0.09310	N	1	B	0.17038	0.02	B	0.14578	0.011	T	0.33803	-0.9854	10	0.66056	D	0.02	.	6.233	0.20747	0.0:0.8:0.0:0.2	.	56	Q5H9L2	TCAL5_HUMAN	Y	56	ENSP00000361765:D56Y	ENSP00000361765:D56Y	D	-	1	0	TCEAL5	102415982	0.000000	0.05858	0.000000	0.03702	0.670000	0.39368	0.114000	0.15520	0.087000	0.17167	0.292000	0.19580	GAT		0.522	TCEAL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057696.1	XM_291334		26	91	1	0	6.32553e-13	0.004656	9.5209e-13	26	91				
RAB9B	51209	broad.mit.edu	37	X	103080666	103080666	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:103080666C>A	ENST00000243298.2	-	3	333	c.49G>T	c.(49-51)Gga>Tga	p.G17*		NM_016370.2	NP_057454.1	Q9NP90	RAB9B_HUMAN	RAB9B, member RAS oncogene family	17					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)	p.G17*(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(11)	14						TTCCCAACTCCACCATCACCC	0.433																																							uc004ell.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(3)	3						c.(49-51)GGA>TGA		RAB9B, member RAS oncogene family							135.0	126.0	129.0					X																	103080666		2203	4300	6503	SO:0001587	stop_gained	51209				Golgi to endosome transport|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding	g.chrX:103080666C>A	AB036693	CCDS14515.1	Xq22.1-q22.3	2010-04-19			ENSG00000123570	ENSG00000123570		"""RAB, member RAS oncogene"""	14090	protein-coding gene	gene with protein product		300285				11043518	Standard	NM_016370		Approved	RAB9L	uc004ell.2	Q9NP90	OTTHUMG00000022112	ENST00000243298.2:c.49G>T	X.37:g.103080666C>A	ENSP00000243298:p.Gly17*					RAB9B_uc004eli.1_Intron	p.G17*	NM_016370	NP_057454	Q9NP90	RAB9B_HUMAN			3	334	-			17			GTP.		B2R8M0|Q52LX2	Nonsense_Mutation	SNP	ENST00000243298.2	37	c.49G>T	CCDS14515.1	.	.	.	.	.	.	.	.	.	.	C	37	6.558307	0.97663	.	.	ENSG00000123570	ENST00000243298	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.0272	16.5572	0.84488	0.0:1.0:0.0:0.0	.	.	.	.	X	17	.	ENSP00000243298:G17X	G	-	1	0	RAB9B	102967322	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.518000	0.84900	0.600000	0.82982	GGA		0.433	RAB9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057746.1			69	170	1	0	7.577e-32	0.01441	1.36573e-31	69	170				
TEX13A	56157	broad.mit.edu	37	X	104463890	104463890	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:104463890G>T	ENST00000413579.1	-	5	1097	c.986C>A	c.(985-987)cCg>cAg	p.P329Q	TEX13A_ENST00000372575.1_Missense_Mutation_p.R330S|IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372578.3_Missense_Mutation_p.R330S|IL1RAPL2_ENST00000344799.4_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	329							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						CAGCTGAGGCGGAACTGGTGC	0.542																																							uc004ema.2		NA																	0				ovary(2)	2						c.(985-987)CCG>CAG		testis expressed sequence 13A							106.0	101.0	103.0					X																	104463890		2155	4266	6421	SO:0001583	missense	56157					intracellular	zinc ion binding	g.chrX:104463890G>T	AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.986C>A	X.37:g.104463890G>T	ENSP00000399753:p.Pro329Gln					IL1RAPL2_uc004elz.1_Intron|TEX13A_uc004emb.2_Missense_Mutation_p.R330S	p.P329Q	NM_031274	NP_112564	Q9BXU3	TX13A_HUMAN			5	1098	-			329					B1B1G8|Q32NB6	Missense_Mutation	SNP	ENST00000413579.1	37	c.986C>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.69|11.69	1.714043|1.714043	0.30413|0.30413	.|.	.|.	ENSG00000133149|ENSG00000133149	ENST00000413579|ENST00000372578;ENST00000372575	.|.	.|.	.|.	2.68|2.68	0.853|0.853	0.19001|0.19001	.|.	0.451915|.	0.16579|.	N|.	0.208291|.	T|T	0.37679|0.37679	0.1012|0.1012	L|L	0.46157|0.46157	1.445|1.445	0.09310|0.09310	N|N	1|1	D|.	0.76494|.	0.999|.	D|.	0.65010|.	0.931|.	T|T	0.37033|0.37033	-0.9723|-0.9723	9|6	0.87932|0.87932	D|D	0|0	.|.	4.2436|4.2436	0.10660|0.10660	0.3655:0.0:0.6345:0.0|0.3655:0.0:0.6345:0.0	.|.	329|.	Q9BXU3|.	TX13A_HUMAN|.	Q|S	329|330	.|.	ENSP00000399753:P329Q|ENSP00000361656:R330S	P|R	-|-	2|1	0|0	TEX13A|TEX13A	104350546|104350546	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.006000|0.006000	0.05464|0.05464	0.143000|0.143000	0.16115|0.16115	0.109000|0.109000	0.17891|0.17891	0.436000|0.436000	0.28706|0.28706	CCG|CGC		0.542	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_031274		26	60	1	0	6.12954e-19	0.004656	1.02276e-18	26	60				
GUCY2F	2986	broad.mit.edu	37	X	108684589	108684589	+	Silent	SNP	C	C	A	rs371062150		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:108684589C>A	ENST00000218006.2	-	7	1983	c.1692G>T	c.(1690-1692)gcG>gcT	p.A564A		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	564	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)	p.A564A(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						CCTCATAAATCGCTATGTTGG	0.403																																							uc004eod.3		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|breast(3)|central_nervous_system(1)	8						c.(1690-1692)GCG>GCT		guanylate cyclase 2F precursor							157.0	158.0	158.0					X																	108684589		2203	4300	6503	SO:0001819	synonymous_variant	2986				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity	g.chrX:108684589C>A	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.1692G>T	X.37:g.108684589C>A						GUCY2F_uc011msq.1_RNA	p.A564A	NM_001522	NP_001513	P51841	GUC2F_HUMAN			7	1968	-			564			Protein kinase.|Cytoplasmic (Potential).		Q9UJF1	Silent	SNP	ENST00000218006.2	37	c.1692G>T	CCDS14545.1																																																																																				0.403	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522		88	172	1	0	3.7744e-50	0.01441	7.20342e-50	88	172				
LONRF3	79836	broad.mit.edu	37	X	118109401	118109401	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:118109401C>T	ENST00000371628.3	+	1	689	c.658C>T	c.(658-660)Ccg>Tcg	p.P220S	LONRF3_ENST00000304778.7_Missense_Mutation_p.P220S|LONRF3_ENST00000422289.2_5'Flank	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	220							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.P220S(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						GCAGCAGCCGCCGCCGCCGCT	0.736																																							uc004eqw.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(658-660)CCG>TCG		LON peptidase N-terminal domain and ring finger							4.0	4.0	4.0					X																	118109401		1933	3666	5599	SO:0001583	missense	79836				proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding	g.chrX:118109401C>T	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.658C>T	X.37:g.118109401C>T	ENSP00000360690:p.Pro220Ser					LONRF3_uc004eqx.2_Missense_Mutation_p.P220S|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_5'Flank	p.P220S	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN			1	689	+			220					Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	c.658C>T	CCDS35374.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.38|14.38	2.519505|2.519505	0.44866|0.44866	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000439603|ENST00000365713;ENST00000304778;ENST00000371628	.|T;T;T	.|0.81078	.|-1.45;-1.45;-1.22	4.2|4.2	3.32|3.32	0.38043|0.38043	.|.	.|0.438834	.|0.19492	.|N	.|0.112952	T|T	0.75258|0.75258	0.3825|0.3825	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.998;0.999	.|D;D	.|0.68943	.|0.961;0.915	T|T	0.67883|0.67883	-0.5555|-0.5555	5|10	.|0.09338	.|T	.|0.73	-14.2796|-14.2796	8.4623|8.4623	0.32936|0.32936	0.2317:0.7683:0.0:0.0|0.2317:0.7683:0.0:0.0	.|.	.|220;220	.|Q496Y0-2;Q496Y0	.|.;LONF3_HUMAN	V|S	26|220	.|ENSP00000360691:P220S;ENSP00000307732:P220S;ENSP00000360690:P220S	.|ENSP00000307732:P220S	A|P	+|+	2|1	0|0	LONRF3|LONRF3	117993429|117993429	0.032000|0.032000	0.19561|0.19561	0.646000|0.646000	0.29493|0.29493	0.611000|0.611000	0.37282|0.37282	1.548000|1.548000	0.36201|0.36201	0.892000|0.892000	0.36259|0.36259	0.529000|0.529000	0.55759|0.55759	GCC|CCG		0.736	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778		7	12	0	0	0	0.00308	0	7	12				
HTATSF1	27336	broad.mit.edu	37	X	135585093	135585093	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:135585093C>G	ENST00000218364.4	+	5	901	c.727C>G	c.(727-729)Caa>Gaa	p.Q243E	HTATSF1_ENST00000535601.1_Missense_Mutation_p.Q243E	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	243					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q243E(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					GCTGTCTATGCAACAAAAGTT	0.338																																							uc004ezw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(727-729)CAA>GAA		HIV-1 Tat specific factor 1							85.0	90.0	88.0					X																	135585093		2203	4300	6503	SO:0001583	missense	27336				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding	g.chrX:135585093C>G	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.727C>G	X.37:g.135585093C>G	ENSP00000218364:p.Gln243Glu					HTATSF1_uc004ezx.2_Missense_Mutation_p.Q243E	p.Q243E	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN			6	1149	+	Acute lymphoblastic leukemia(192;0.000127)		243					D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	c.727C>G	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631534	0.67015	.	.	ENSG00000102241	ENST00000535601;ENST00000448450;ENST00000218364;ENST00000415377	T;T	0.24723	1.84;1.84	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.49474	0.1559	M	0.65975	2.015	0.80722	D	1	D	0.69078	0.997	D	0.65684	0.937	T	0.43228	-0.9404	10	0.42905	T	0.14	-15.7357	18.4948	0.90861	0.0:1.0:0.0:0.0	.	243	O43719	HTSF1_HUMAN	E	243	ENSP00000442699:Q243E;ENSP00000218364:Q243E	ENSP00000218364:Q243E	Q	+	1	0	HTATSF1	135412759	1.000000	0.71417	0.959000	0.39883	0.949000	0.60115	7.299000	0.78831	2.309000	0.77851	0.468000	0.43344	CAA		0.338	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500		25	67	0	0	0	0.004656	0	25	67				
GPR101	83550	broad.mit.edu	37	X	136112642	136112642	+	Missense_Mutation	SNP	C	C	G			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:136112642C>G	ENST00000298110.1	-	1	1191	c.1192G>C	c.(1192-1194)Gct>Cct	p.A398P		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	398						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.A398P(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					ATCACTTTAGCAGCTTTGCAC	0.552																																							uc011mwh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|skin(1)	5						c.(1192-1194)GCT>CCT		G protein-coupled receptor 101							131.0	118.0	122.0					X																	136112642		2203	4300	6503	SO:0001583	missense	83550					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:136112642C>G	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1192G>C	X.37:g.136112642C>G	ENSP00000298110:p.Ala398Pro						p.A398P	NM_054021	NP_473362	Q96P66	GP101_HUMAN			1	1192	-	Acute lymphoblastic leukemia(192;0.000127)		398			Cytoplasmic (Potential).		Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	c.1192G>C	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.934894	0.73442	.	.	ENSG00000165370	ENST00000298110	T	0.75050	-0.9	5.77	4.91	0.64330	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33610	N	0.004737	D	0.82563	0.5064	L	0.57536	1.79	0.42771	D	0.993832	D	0.89917	1.0	D	0.79784	0.993	D	0.83931	0.0306	10	0.87932	D	0	-13.0282	11.5964	0.50975	0.0:0.9124:0.0:0.0876	.	398	Q96P66	GP101_HUMAN	P	398	ENSP00000298110:A398P	ENSP00000298110:A398P	A	-	1	0	GPR101	135940308	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.790000	0.55461	1.210000	0.43336	0.529000	0.55759	GCT		0.552	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1			35	70	0	0	0	0.013726	0	35	70				
GABRQ	55879	broad.mit.edu	37	X	151818269	151818269	+	Silent	SNP	T	T	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:151818269T>A	ENST00000370306.2	+	6	695	c.675T>A	c.(673-675)acT>acA	p.T225T		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	225					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.T225T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCCACATGACTGAGGAGCTGC	0.478																																							uc004ffp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(673-675)ACT>ACA		gamma-aminobutyric acid (GABA) receptor, theta							199.0	151.0	167.0					X																	151818269		2203	4300	6503	SO:0001819	synonymous_variant	55879					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity	g.chrX:151818269T>A	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.675T>A	X.37:g.151818269T>A							p.T225T	NM_018558	NP_061028	Q9UN88	GBRT_HUMAN			6	695	+	Acute lymphoblastic leukemia(192;6.56e-05)		225			Extracellular (Potential).		A6NFN1|Q32MB4|Q9NZK8	Silent	SNP	ENST00000370306.2	37	c.675T>A	CCDS14707.1																																																																																				0.478	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558		47	116	0	0	0	0.01441	0	47	116				
PNMA3	29944	broad.mit.edu	37	X	152226785	152226785	+	Missense_Mutation	SNP	C	C	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:152226785C>T	ENST00000370264.4	+	1	1399	c.1373C>T	c.(1372-1374)cCc>cTc	p.P458L	PNMA3_ENST00000370265.4_Intron|PNMA3_ENST00000447306.1_Missense_Mutation_p.P458L			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	458					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P458L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					AAGAGCCATCCCAAGTCCAAG	0.532																																							uc004fhc.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)	3						c.(1372-1374)CCC>CTC		paraneoplastic cancer-testis-brain antigen							138.0	121.0	127.0					X																	152226785		2203	4300	6503	SO:0001583	missense	29944				apoptosis	nucleolus	nucleic acid binding|zinc ion binding	g.chrX:152226785C>T	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.1373C>T	X.37:g.152226785C>T	ENSP00000359286:p.Pro458Leu					PNMA5_uc004fha.3_5'Flank|PNMA3_uc004fhd.2_5'Flank	p.P458L	NM_013364	NP_037496	Q9UL41	PNMA3_HUMAN			2	1709	+	Acute lymphoblastic leukemia(192;6.56e-05)		458					D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	37	c.1373C>T	CCDS35435.2	.	.	.	.	.	.	.	.	.	.	c	13.33	2.204199	0.38905	.	.	ENSG00000183837	ENST00000447306;ENST00000370264	T;T	0.25414	1.8;1.8	2.16	2.16	0.27623	.	.	.	.	.	T	0.40094	0.1103	L	0.52573	1.65	0.28116	N	0.930782	D	0.76494	0.999	D	0.76575	0.988	T	0.10730	-1.0617	9	0.72032	D	0.01	.	7.165	0.25685	0.0:1.0:0.0:0.0	.	458	Q9UL41	PNMA3_HUMAN	L	458	ENSP00000407642:P458L;ENSP00000359286:P458L	ENSP00000359286:P458L	P	+	2	0	PNMA3	151977441	0.140000	0.22579	0.444000	0.26895	0.279000	0.26890	0.844000	0.27654	1.378000	0.46305	0.464000	0.42555	CCC		0.532	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364		64	112	0	0	0	0.01441	0	64	112				
SLC6A8	6535	broad.mit.edu	37	X	152958581	152958581	+	Missense_Mutation	SNP	G	G	T			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:152958581G>T	ENST00000253122.5	+	5	1339	c.863G>T	c.(862-864)gGc>gTc	p.G288V	SLC6A8_ENST00000485324.1_3'UTR|SLC6A8_ENST00000430077.2_Missense_Mutation_p.G173V	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	288					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)	p.G288V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	GCCCTGGATGGCATCATTTAC	0.632																																							uc004fib.3		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(862-864)GGC>GTC		solute carrier family 6 member 8 isoform 1	Creatine(DB00148)						67.0	51.0	56.0					X																	152958581		2201	4299	6500	SO:0001583	missense	6535				creatine metabolic process|muscle contraction	integral to plasma membrane	creatine:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chrX:152958581G>T		CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.863G>T	X.37:g.152958581G>T	ENSP00000253122:p.Gly288Val					SLC6A8_uc004fic.3_Missense_Mutation_p.G288V|SLC6A8_uc011myx.1_Missense_Mutation_p.G173V|SLC6A8_uc010nuj.2_RNA	p.G288V	NM_005629	NP_005620	P48029	SC6A8_HUMAN			5	1141	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		288			Helical; (Potential).		B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Missense_Mutation	SNP	ENST00000253122.5	37	c.863G>T	CCDS14726.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	22.9|22.9	4.355199|4.355199	0.82243|0.82243	.|.	.|.	ENSG00000130821|ENSG00000130821	ENST00000413787|ENST00000253122;ENST00000430077;ENST00000328897	T|D;D	0.75477|0.84800	-0.94|-1.9;-1.9	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	.|0.000000	.|0.85682	.|U	.|0.000000	D|D	0.95526|0.95526	0.8546|0.8546	H|H	0.98466|0.98466	4.24|4.24	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.998;1.0	D|D	0.97423|0.97423	1.0010|1.0010	7|10	0.87932|0.87932	D|D	0|0	.|.	15.9109|15.9109	0.79473|0.79473	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|307;288	.|Q59EV7;P48029	.|.;SC6A8_HUMAN	S|V	25|288;173;294	ENSP00000400463:A25S|ENSP00000253122:G288V;ENSP00000403041:G173V	ENSP00000400463:A25S|ENSP00000253122:G288V	A|G	+|+	1|2	0|0	SLC6A8|SLC6A8	152611775|152611775	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.835000|0.835000	0.47333|0.47333	7.577000|7.577000	0.82486|0.82486	2.271000|2.271000	0.75665|0.75665	0.468000|0.468000	0.43344|0.43344	GCA|GGC		0.632	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061003.1			9	18	1	0	0.00448238	0.004482	0.00493908	9	18				
SRPK3	26576	broad.mit.edu	37	X	153048494	153048494	+	Silent	SNP	G	G	A			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:153048494G>A	ENST00000370101.3	+	7	715	c.669G>A	c.(667-669)ggG>ggA	p.G223G	SRPK3_ENST00000489426.1_Silent_p.G290G|SRPK3_ENST00000370100.1_Silent_p.G181G|SRPK3_ENST00000370104.1_Silent_p.G223G|SRPK3_ENST00000370108.3_Silent_p.G223G|SRPK3_ENST00000393786.3_Silent_p.G223G	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	223	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G223G(1)|p.G290G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TGTGTGTGGGGGACGCTTACA	0.647																																					Esophageal Squamous(167;766 3400 32156)	Esophageal Squamous(167;766 3400 32156)	uc004fil.2		NA																	2	Substitution - coding silent(2)		lung(2)	pancreas(2)|lung(1)	3						c.(667-669)GGG>GGA		serine arginine rich protein-specific kinase 3							72.0	59.0	63.0					X																	153048494		2203	4298	6501	SO:0001819	synonymous_variant	26576				cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity	g.chrX:153048494G>A	AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.669G>A	X.37:g.153048494G>A						SRPK3_uc004fik.2_Silent_p.G289G|SRPK3_uc010nul.2_Silent_p.G181G|SRPK3_uc004fin.2_Silent_p.G223G|SRPK3_uc004fim.2_Silent_p.G223G	p.G223G	NM_014370	NP_055185	Q9UPE1	SRPK3_HUMAN			7	701	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		223			Protein kinase.		Q13583|Q4F970|Q562F5|Q9UM62	Silent	SNP	ENST00000370101.3	37	c.669G>A	CCDS35441.1																																																																																				0.647	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354501.1	NM_014370		15	45	0	0	0	0.010504	0	15	45				
CFAP74	85452	broad.mit.edu	37	1	1919959	1919959	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr1:1919959delC	ENST00000434971.2	-	4	320	c.288delG	c.(286-288)gagfs	p.E96fs				Q69YW0	CA222_HUMAN		0										breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)	11	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ACCTCATCTTCTCAGTGAAAA	0.582																																							uc001aim.1		NA																	0				pancreas(1)	1						c.(286-288)GAGfs		hypothetical protein LOC85452							86.0	91.0	90.0					1																	1919959		2082	4223	6305	SO:0001589	frameshift_variant	85452							g.chr1:1919959delC																												ENST00000434971.2:c.288delG	1.37:g.1919959delC	ENSP00000408078:p.Glu96fs					KIAA1751_uc009vkz.1_Frame_Shift_Del_p.E96fs|KIAA1751_uc001ain.1_Frame_Shift_Del_p.E96fs	p.E96fs	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)	4	444	-	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	96						Frame_Shift_Del	DEL	ENST00000434971.2	37	c.288delG																																																																																					0.582	C1orf222-201	KNOWN	basic	protein_coding	protein_coding				20	69	NA	NA	NA	NA	NA	20	69	---	---	---	---
KRT6B	3854	broad.mit.edu	37	12	52845639	52845639	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:52845639delC	ENST00000252252.3	-	1	271	c.224delG	c.(223-225)ggcfs	p.G75fs		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	75	Head.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		GGCACAGCTGCCCCCTCCAAT	0.647																																							uc001sak.2		NA																	0				ovary(2)	2						c.(223-225)GGCfs		keratin 6B							4.0	5.0	4.0					12																	52845639		1793	3662	5455	SO:0001589	frameshift_variant	3854				ectoderm development	keratin filament	structural constituent of cytoskeleton	g.chr12:52845639delC	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.224delG	12.37:g.52845639delC	ENSP00000252252:p.Gly75fs						p.G75fs	NM_005555	NP_005546	P04259	K2C6B_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.083)	1	272	-			75			Head.		P48669	Frame_Shift_Del	DEL	ENST00000252252.3	37	c.224delG	CCDS8828.1																																																																																				0.647	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555		10	33	NA	NA	NA	NA	NA	10	33	---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	86373314	86373314	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr12:86373314delC	ENST00000604798.1	-	8	2394	c.1190delG	c.(1189-1191)ggafs	p.G397fs	MGAT4C_ENST00000332156.1_Frame_Shift_Del_p.G397fs|MGAT4C_ENST00000393205.2_Frame_Shift_Del_p.G426fs|MGAT4C_ENST00000552808.2_Frame_Shift_Del_p.G397fs|MGAT4C_ENST00000548651.1_Frame_Shift_Del_p.G397fs|MGAT4C_ENST00000549405.2_Frame_Shift_Del_p.G397fs			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	397					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						ATCTTCTGTTCCAGTATTTAC	0.343																																							uc001tai.3		NA																	0				ovary(3)	3						c.(1189-1191)GGAfs		alpha-1,3-mannosyl-glycoprotein							57.0	57.0	57.0					12																	86373314		2203	4300	6503	SO:0001589	frameshift_variant	25834				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr12:86373314delC		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.1190delG	12.37:g.86373314delC	ENSP00000474896:p.Gly397fs					MGAT4C_uc001tal.3_Frame_Shift_Del_p.G397fs|MGAT4C_uc001taj.3_Frame_Shift_Del_p.G397fs|MGAT4C_uc001tak.3_Frame_Shift_Del_p.G397fs|MGAT4C_uc010sum.1_Frame_Shift_Del_p.G421fs|MGAT4C_uc001tah.3_Frame_Shift_Del_p.G397fs	p.G397fs	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN			8	2440	-			397			Lumenal (Potential).		B4DRH2|Q4G199|Q9UIU5	Frame_Shift_Del	DEL	ENST00000604798.1	37	c.1190delG	CCDS9030.1																																																																																				0.343	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244		16	43	NA	NA	NA	NA	NA	16	43	---	---	---	---
CD2BP2	10421	broad.mit.edu	37	16	30365550	30365552	+	In_Frame_Del	DEL	CAT	CAT	-	rs202017154		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	CAT	CAT	-	-	CAT	CAT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr16:30365550_30365552delCAT	ENST00000305596.3	-	3	345_347	c.170_172delATG	c.(169-174)gatggg>ggg	p.D57del	CD2BP2_ENST00000569466.1_In_Frame_Del_p.D57del|RP11-347C12.10_ENST00000563252.1_lincRNA	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	57					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)			breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CTGGACCCCCCATCATCATCATC	0.532																																							uc002dxr.2		NA																	0				ovary(1)	1						c.(169-174)GATGGG>GGG		CD2 antigen (cytoplasmic tail) binding protein																																				SO:0001651	inframe_deletion	10421				assembly of spliceosomal tri-snRNP	cytoplasm|nucleoplasm|U5 snRNP	protein binding|ribonucleoprotein binding	g.chr16:30365550_30365552delCAT	AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.170_172delATG	16.37:g.30365559_30365561delCAT	ENSP00000304903:p.Asp57del					CD2BP2_uc002dxs.2_In_Frame_Del_p.D57del	p.D57del	NM_006110	NP_006101	O95400	CD2B2_HUMAN			2	423_425	-			57					B2RDX2|Q9ULP2	In_Frame_Del	DEL	ENST00000305596.3	37	c.170_172delATG	CCDS10675.1																																																																																				0.532	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255528.1	NM_006110		7	360	NA	NA	NA	NA	NA	7	360	---	---	---	---
PIK3R5	23533	broad.mit.edu	37	17	8794155	8794155	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr17:8794155delC	ENST00000447110.1	-	7	681	c.557delG	c.(556-558)ggafs	p.G186fs	PIK3R5_ENST00000581552.1_Frame_Shift_Del_p.G186fs|PIK3R5_ENST00000584803.1_Frame_Shift_Del_p.G186fs	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	186					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						AGGCGAGTGTCCGGGCGTACT	0.642																																					NSCLC(18;589 615 7696 20311 50332)	NSCLC(18;589 615 7696 20311 50332)	uc002glt.2		NA																	0				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(556-558)GGAfs		phosphoinositide-3-kinase, regulatory subunit 5							154.0	119.0	131.0					17																	8794155		2203	4300	6503	SO:0001589	frameshift_variant	23533				platelet activation	cytosol|membrane|nucleus		g.chr17:8794155delC	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.557delG	17.37:g.8794155delC	ENSP00000392812:p.Gly186fs					PIK3R5_uc010vuz.1_Frame_Shift_Del_p.G186fs|PIK3R5_uc002glu.3_Intron|PIK3R5_uc010coa.1_Frame_Shift_Del_p.G186fs|PIK3R5_uc010cob.1_5'UTR	p.G186fs	NM_014308	NP_055123	Q8WYR1	PI3R5_HUMAN			7	624	-			186					B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Frame_Shift_Del	DEL	ENST00000447110.1	37	c.557delG	CCDS11147.1																																																																																				0.642	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	NM_014308		8	28	NA	NA	NA	NA	NA	8	28	---	---	---	---
LYPD3	27076	broad.mit.edu	37	19	43969653	43969655	+	In_Frame_Del	DEL	AGC	AGC	-	rs141441894	byFrequency	TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	AGC	AGC	-	-	AGC	AGC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr19:43969653_43969655delAGC	ENST00000244333.3	-	1	157_159	c.69_71delGCT	c.(67-72)ctgctt>ctt	p.23_24LL>L		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	23					cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				ACCTCCGCGAAGCAGCAGCAGCA	0.675																																							uc002owl.1		NA																	0				pancreas(1)	1						c.(67-72)CTGCTT>CTT		GPI-anchored metastasis-associated protein																																				SO:0001651	inframe_deletion	27076					anchored to plasma membrane		g.chr19:43969653_43969655delAGC	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.69_71delGCT	19.37:g.43969662_43969664delAGC	ENSP00000244333:p.Leu24del					LYPD3_uc002owm.2_In_Frame_Del_p.23_24LL>L	p.23_24LL>L	NM_014400	NP_055215	O95274	LYPD3_HUMAN			1	177_179	-		Prostate(69;0.0153)	23_24					Q9UJ74	In_Frame_Del	DEL	ENST00000244333.3	37	c.69_71delGCT	CCDS12620.1																																																																																				0.675	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400		9	189	NA	NA	NA	NA	NA	9	189	---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80101445	80101446	+	Frame_Shift_Ins	INS	-	-	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr2:80101445_80101446insC	ENST00000402739.4	+	5	834_835	c.829_830insC	c.(829-831)gctfs	p.A277fs	CTNNA2_ENST00000496558.1_Frame_Shift_Ins_p.A277fs|CTNNA2_ENST00000541047.1_Frame_Shift_Ins_p.A277fs|CTNNA2_ENST00000540488.1_Frame_Shift_Ins_p.A277fs|CTNNA2_ENST00000466387.1_Frame_Shift_Ins_p.A277fs|CTNNA2_ENST00000361291.4_Frame_Shift_Ins_p.A311fs	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	277					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CGGCGAGCTGGCTGCGGCTCTT	0.545																																							uc010ysh.1		NA																	0				pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(829-831)GCTfs		catenin, alpha 2 isoform 1																																				SO:0001589	frameshift_variant	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:80101445_80101446insC		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.830dupC	2.37:g.80101446_80101446dupC	ENSP00000384638:p.Ala277fs					CTNNA2_uc010yse.1_Frame_Shift_Ins_p.A277fs|CTNNA2_uc010ysf.1_Frame_Shift_Ins_p.A277fs|CTNNA2_uc010ysg.1_Frame_Shift_Ins_p.A277fs	p.A277fs	NM_004389	NP_004380	P26232	CTNA2_HUMAN			5	834_835	+			277					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Frame_Shift_Ins	INS	ENST00000402739.4	37	c.829_830insC																																																																																					0.545	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		31	69	NA	NA	NA	NA	NA	31	69	---	---	---	---
SLC17A9	63910	broad.mit.edu	37	20	61597059	61597059	+	Frame_Shift_Del	DEL	T	T	-			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr20:61597059delT	ENST00000370351.4	+	10	1174	c.1043delT	c.(1042-1044)ctcfs	p.L348fs	SLC17A9_ENST00000370349.3_Frame_Shift_Del_p.L342fs|SLC17A9_ENST00000488738.1_3'UTR	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	348					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						TCCATCGGCCTCCAGACCTTC	0.642																																							uc002yea.3		NA																	0				ovary(1)|skin(1)	2						c.(1042-1044)CTCfs		vesicular nucleotide transporter SLC17A9							92.0	100.0	98.0					20																	61597059		2056	4203	6259	SO:0001589	frameshift_variant	63910				exocytosis|transmembrane transport	integral to membrane	transporter activity	g.chr20:61597059delT	AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.1043delT	20.37:g.61597059delT	ENSP00000359376:p.Leu348fs					SLC17A9_uc002ydz.3_Frame_Shift_Del_p.L342fs|SLC17A9_uc011aap.1_Frame_Shift_Del_p.L368fs	p.L348fs	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN			10	1227	+			348					B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Frame_Shift_Del	DEL	ENST00000370351.4	37	c.1043delT	CCDS42901.1																																																																																				0.642	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080100.1	NM_022082		48	127	NA	NA	NA	NA	NA	48	127	---	---	---	---
BHLHE40	8553	broad.mit.edu	37	3	5024990	5024991	+	Frame_Shift_Ins	INS	-	-	C			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr3:5024990_5024991insC	ENST00000256495.3	+	5	1455_1456	c.852_853insC	c.(853-855)cccfs	p.P285fs		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	285					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						AGTCCGAAGAACCCCCCACAAA	0.559																																							uc003bqf.2		NA																	0				ovary(1)	1						c.(850-855)GAACCCfs		basic helix-loop-helix family, member e40																																				SO:0001589	frameshift_variant	8553					Golgi apparatus|nucleolus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr3:5024990_5024991insC	AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.858dupC	3.37:g.5024996_5024996dupC	ENSP00000256495:p.Pro285fs					BHLHE40_uc011asw.1_Frame_Shift_Ins_p.E144fs	p.E284fs	NM_003670	NP_003661	O14503	BHE40_HUMAN			5	1159_1160	+			284_285					Q96TD3	Frame_Shift_Ins	INS	ENST00000256495.3	37	c.852_853insC	CCDS2565.1																																																																																				0.559	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670		16	40	NA	NA	NA	NA	NA	16	40	---	---	---	---
AMPH	273	broad.mit.edu	37	7	38502605	38502605	+	Frame_Shift_Del	DEL	G	G	-	rs372756485		TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chr7:38502605delG	ENST00000356264.2	-	10	1073	c.858delC	c.(856-858)cccfs	p.P286fs	AMPH_ENST00000325590.5_Frame_Shift_Del_p.P286fs|AMPH_ENST00000428293.2_Frame_Shift_Del_p.P286fs	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	286					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GTGCTGGTGCGGGAGACGCAG	0.547																																							uc003tgu.2		NA																	0				ovary(3)|liver(1)|skin(1)	5						c.(856-858)CCCfs		amphiphysin isoform 1							162.0	152.0	155.0					7																	38502605		2203	4300	6503	SO:0001589	frameshift_variant	273				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane		g.chr7:38502605delG		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.858delC	7.37:g.38502605delG	ENSP00000348602:p.Pro286fs					AMPH_uc003tgv.2_Frame_Shift_Del_p.P286fs|AMPH_uc003tgt.2_Frame_Shift_Del_p.P39fs	p.P286fs	NM_001635	NP_001626	P49418	AMPH_HUMAN			10	927	-			286					A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Frame_Shift_Del	DEL	ENST00000356264.2	37	c.858delC	CCDS5456.1																																																																																				0.547	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635		34	78	NA	NA	NA	NA	NA	34	78	---	---	---	---
L1CAM	3897	broad.mit.edu	37	X	153135618	153135620	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-44-6776-01A-11D-1855-08	TCGA-44-6776-10A-01D-1855-08	TTG	TTG	-	-	TTG	TTG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	7d3c5101-fae2-4320-a8a2-a93753375368	3588228a-2ade-4230-a5c6-6599dbbbae3e	g.chrX:153135618_153135620delTTG	ENST00000370060.1	-	9	1071_1073	c.882_884delCAA	c.(880-885)aacaag>aag	p.N294del	L1CAM_ENST00000361699.4_In_Frame_Del_p.N294del|L1CAM_ENST00000370055.1_In_Frame_Del_p.N289del|L1CAM_ENST00000361981.3_In_Frame_Del_p.N289del|L1CAM_ENST00000370057.3_In_Frame_Del_p.N294del|L1CAM_ENST00000543994.1_In_Frame_Del_p.N296del|L1CAM_ENST00000538883.1_In_Frame_Del_p.N296del	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	294	Ig-like C2-type 3.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGCAGGGTCTTGTTGTGGTTCT	0.631																																							uc004fjb.2		NA																	0				ovary(8)|central_nervous_system(1)	9						c.(880-885)AACAAG>AAG		L1 cell adhesion molecule isoform 1 precursor																																				SO:0001651	inframe_deletion	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153135618_153135620delTTG	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.882_884delCAA	X.37:g.153135621_153135623delTTG	ENSP00000359077:p.Asn294del					L1CAM_uc004fjc.2_In_Frame_Del_p.N294del|L1CAM_uc010nuo.2_In_Frame_Del_p.N289del|L1CAM_uc004fjd.1_In_Frame_Del_p.N108del|L1CAM_uc004fje.1_In_Frame_Del_p.N289del	p.N294del	NM_000425	NP_000416	P32004	L1CAM_HUMAN			8	990_992	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		294			Extracellular (Potential).|Ig-like C2-type 3.		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	In_Frame_Del	DEL	ENST00000370060.1	37	c.882_884delCAA	CCDS14733.1																																																																																				0.631	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		106	277	NA	NA	NA	NA	NA	106	277	---	---	---	---
