#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CTRC	11330	broad.mit.edu	37	1	15772225	15772225	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:15772225A>G	ENST00000375949.4	+	7	799	c.773A>G	c.(772-774)tAc>tGc	p.Y258C	CTRC_ENST00000375943.2_3'UTR|CTRC_ENST00000483406.1_3'UTR	NM_007272.2	NP_009203.2	Q99895	CTRC_HUMAN	chymotrypsin C (caldecrin)	258	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.Y258C(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	13		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GTGTCCGCCTACATCGACTGG	0.617																																							uc001awi.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(772-774)TAC>TGC		chymotrypsin C preproprotein							84.0	83.0	83.0					1																	15772225		2203	4300	6503	SO:0001583	missense	11330				proteolysis		serine-type endopeptidase activity	g.chr1:15772225A>G	BC015118	CCDS156.1	1p36.21	2009-02-18			ENSG00000162438	ENSG00000162438	3.4.21.2		2523	protein-coding gene	gene with protein product	"""elastase 4"""	601405				8635596	Standard	NM_007272		Approved	CLCR, ELA4	uc001awi.1	Q99895	OTTHUMG00000002255	ENST00000375949.4:c.773A>G	1.37:g.15772225A>G	ENSP00000365116:p.Tyr258Cys					CTRC_uc001awj.1_Silent_p.L209L	p.Y258C	NM_007272	NP_009203	Q99895	CTRC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	7	796	+		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)	258			Peptidase S1.		A8K082|O00765|Q9NUH5	Missense_Mutation	SNP	ENST00000375949.4	37	c.773A>G	CCDS156.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.128133	0.56721	.	.	ENSG00000162438	ENST00000375949	D	0.95001	-3.58	4.68	3.51	0.40186	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.190873	0.47093	D	0.000241	D	0.97876	0.9302	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97475	1.0043	10	0.87932	D	0	-40.5175	9.762	0.40537	0.8452:0.0:0.0:0.1548	.	258	Q99895	CTRC_HUMAN	C	258	ENSP00000365116:Y258C	ENSP00000365116:Y258C	Y	+	2	0	CTRC	15644812	0.997000	0.39634	0.999000	0.59377	0.816000	0.46133	0.699000	0.25586	0.895000	0.36342	0.528000	0.53228	TAC		0.617	CTRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006435.1	NM_007272		18	49	0	0	0	0.012319	0	18	49				
PLA2G2F	64600	broad.mit.edu	37	1	20474875	20474875	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:20474875C>A	ENST00000375102.3	+	5	719	c.617C>A	c.(616-618)gCg>gAg	p.A206E		NM_022819.3	NP_073730.3	Q9BZM2	PA2GF_HUMAN	phospholipase A2, group IIF	163					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.A206E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		CAATCCCCAGCGCCCCCCGCC	0.647																																							uc009vpp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(616-618)GCG>GAG		phospholipase A2, group IIF							46.0	47.0	47.0					1																	20474875		2203	4300	6503	SO:0001583	missense	64600				lipid catabolic process|phospholipid metabolic process	extracellular region	calcium ion binding|phospholipase A2 activity	g.chr1:20474875C>A	AL158172	CCDS204.2	1p35	2008-09-19			ENSG00000158786	ENSG00000158786	3.1.1.4		30040	protein-coding gene	gene with protein product						11112443	Standard	NM_022819		Approved		uc009vpp.1	Q9BZM2	OTTHUMG00000002704	ENST00000375102.3:c.617C>A	1.37:g.20474875C>A	ENSP00000364243:p.Ala206Glu						p.A206E	NM_022819	NP_073730	Q9BZM2	PA2GF_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)	5	715	+		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)	163					Q5R385|Q8N217|Q9H506	Missense_Mutation	SNP	ENST00000375102.3	37	c.617C>A	CCDS204.2	.	.	.	.	.	.	.	.	.	.	C	12.72	2.021222	0.35701	.	.	ENSG00000158786	ENST00000375102	T	0.27890	1.64	4.76	-8.24	0.01029	.	2.127380	0.02283	N	0.069609	T	0.14184	0.0343	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13548	-1.0505	10	0.35671	T	0.21	1.7723	3.6788	0.08302	0.206:0.1705:0.4713:0.1522	.	206	Q9BZM2-2	.	E	206	ENSP00000364243:A206E	ENSP00000364243:A206E	A	+	2	0	PLA2G2F	20347462	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.707000	0.01893	-1.064000	0.03172	-1.228000	0.01579	GCG		0.647	PLA2G2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007687.1	NM_022819		14	19	1	0	7.93312e-07	0.00245	9.33987e-07	14	19				
LDLRAD2	401944	broad.mit.edu	37	1	22141121	22141121	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:22141121C>G	ENST00000344642.2	+	2	503	c.316C>G	c.(316-318)Ccg>Gcg	p.P106A	LDLRAD2_ENST00000543870.1_Missense_Mutation_p.P106A	NM_001013693.2	NP_001013715.2	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain containing 2	106						integral component of membrane (GO:0016021)		p.P106A(1)		endometrium(2)|large_intestine(1)|lung(3)	6		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		CCCGGCCGACCCGTGCGCCCC	0.751																																							uc001bfg.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(316-318)CCG>GCG		low density lipoprotein receptor class A domain							7.0	10.0	9.0					1																	22141121		2089	4087	6176	SO:0001583	missense	401944					integral to membrane	receptor activity	g.chr1:22141121C>G	AL590103	CCDS30624.1	1p36.12	2008-02-05	2005-10-07		ENSG00000187942	ENSG00000187942			32071	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 2"""				Standard	NM_001013693		Approved		uc001bfg.1	Q5SZI1	OTTHUMG00000002675	ENST00000344642.2:c.316C>G	1.37:g.22141121C>G	ENSP00000340988:p.Pro106Ala						p.P106A	NM_001013693	NP_001013715	Q5SZI1	LRAD2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	2	503	+		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)	106			Extracellular (Potential).		B9EJB3|Q6ZSN5	Missense_Mutation	SNP	ENST00000344642.2	37	c.316C>G	CCDS30624.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657182	0.47467	.	.	ENSG00000187942	ENST00000344642;ENST00000543870	T;T	0.46819	0.86;0.86	4.5	2.59	0.31030	CUB (2);	0.200515	0.29362	N	0.012363	T	0.37404	0.1002	L	0.55481	1.735	0.32461	N	0.544132	B	0.21225	0.053	B	0.22152	0.038	T	0.38887	-0.9640	10	0.16896	T	0.51	-10.9034	7.5577	0.27833	0.0:0.7366:0.1682:0.0953	.	106	Q5SZI1	LRAD2_HUMAN	A	106	ENSP00000340988:P106A;ENSP00000444097:P106A	ENSP00000340988:P106A	P	+	1	0	LDLRAD2	22013708	0.928000	0.31464	0.046000	0.18839	0.306000	0.27790	2.826000	0.48104	0.336000	0.23639	0.448000	0.29417	CCG		0.751	LDLRAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007601.1	NM_001013693		6	10	0	0	0	0.001168	0	6	10				
C1orf94	84970	broad.mit.edu	37	1	34666517	34666517	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:34666517A>T	ENST00000488417.1	+	3	1274	c.1154A>T	c.(1153-1155)aAa>aTa	p.K385I	C1orf94_ENST00000373374.3_Missense_Mutation_p.K195I	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	385								p.K385I(1)|p.K195I(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				CCGCCCAAGAAACCTACATGT	0.582																																							uc001bxs.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(583-585)AAA>ATA		hypothetical protein LOC84970 isoform b							56.0	56.0	56.0					1																	34666517		2203	4300	6503	SO:0001583	missense	84970						protein binding	g.chr1:34666517A>T	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.1154A>T	1.37:g.34666517A>T	ENSP00000435634:p.Lys385Ile					C1orf94_uc001bxt.2_Missense_Mutation_p.K385I	p.K195I	NM_032884	NP_116273	Q6P1W5	CA094_HUMAN			3	983	+		Myeloproliferative disorder(586;0.0393)	195					B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	ENST00000488417.1	37	c.584A>T	CCDS44108.1	.	.	.	.	.	.	.	.	.	.	A	16.06	3.016684	0.54468	.	.	ENSG00000142698	ENST00000373374;ENST00000488417	T;T	0.38401	1.14;1.14	5.73	5.73	0.89815	.	0.000000	0.56097	D	0.000021	T	0.55417	0.1919	L	0.59436	1.845	0.38813	D	0.955464	D	0.89917	1.0	D	0.91635	0.999	T	0.60835	-0.7184	10	0.72032	D	0.01	-12.4334	12.3989	0.55402	1.0:0.0:0.0:0.0	.	385	Q6P1W5	CA094_HUMAN	I	195;385	ENSP00000362472:K195I;ENSP00000435634:K385I	ENSP00000362472:K195I	K	+	2	0	C1orf94	34439104	1.000000	0.71417	1.000000	0.80357	0.091000	0.18340	4.593000	0.61034	2.184000	0.69523	0.533000	0.62120	AAA		0.582	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884		8	26	0	0	0	0.004482	0	8	26				
ZMYM4	9202	broad.mit.edu	37	1	35863113	35863113	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:35863113G>T	ENST00000314607.6	+	20	3246	c.3166G>T	c.(3166-3168)Gaa>Taa	p.E1056*	ZMYM4_ENST00000373297.2_Nonsense_Mutation_p.E967*	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	1056					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E1056*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AATGATTGCAGAAGATGAAGA	0.363																																							uc001byt.2		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5						c.(3166-3168)GAA>TAA		zinc finger protein 262							73.0	72.0	72.0					1																	35863113		2203	4300	6503	SO:0001587	stop_gained	9202				multicellular organismal development		DNA binding|zinc ion binding	g.chr1:35863113G>T	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.3166G>T	1.37:g.35863113G>T	ENSP00000322915:p.Glu1056*					ZMYM4_uc009vuu.2_Nonsense_Mutation_p.E1024*|ZMYM4_uc001byu.2_Nonsense_Mutation_p.E732*|ZMYM4_uc009vuv.2_Nonsense_Mutation_p.E795*	p.E1056*	NM_005095	NP_005086	Q5VZL5	ZMYM4_HUMAN			20	3246	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	1056					A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Nonsense_Mutation	SNP	ENST00000314607.6	37	c.3166G>T	CCDS389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.298622|6.298622	0.97453|0.97453	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000314607;ENST00000373297|ENST00000457946	.|.	.|.	.|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.79569	.|0.4468	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77838	.|-0.2439	.|3	0.66056|.	D|.	0.02|.	-17.9801|-17.9801	19.6181|19.6181	0.95643|0.95643	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1056;967|714	.|.	ENSP00000322915:E1056X|.	E|R	+|+	1|2	0|0	ZMYM4|ZMYM4	35635700|35635700	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.121000|8.121000	0.89582|0.89582	2.639000|2.639000	0.89480|0.89480	0.460000|0.460000	0.39030|0.39030	GAA|AGA		0.363	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095		15	15	1	0	1.05317e-09	0.00245	1.33292e-09	15	15				
PLK3	1263	broad.mit.edu	37	1	45268721	45268721	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:45268721A>T	ENST00000372201.4	+	7	1083	c.844A>T	c.(844-846)Agc>Tgc	p.S282C	PLK3_ENST00000465443.1_3'UTR	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	282	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.S243C(1)		endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					GCTGCCTGCCAGCCTCTCACT	0.622																																							uc001cmn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(844-846)AGC>TGC		polo-like kinase 3							48.0	53.0	51.0					1																	45268721		2203	4300	6503	SO:0001583	missense	1263					membrane	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr1:45268721A>T	AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.844A>T	1.37:g.45268721A>T	ENSP00000361275:p.Ser282Cys					PLK3_uc001cmo.2_RNA	p.S282C	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN			7	944	+	Acute lymphoblastic leukemia(166;0.155)		282			Protein kinase.		Q15767|Q5JR99|Q96CV1	Missense_Mutation	SNP	ENST00000372201.4	37	c.844A>T	CCDS515.1	.	.	.	.	.	.	.	.	.	.	A	12.72	2.021330	0.35701	.	.	ENSG00000173846	ENST00000372201;ENST00000543983	T	0.66995	-0.24	5.42	2.96	0.34315	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.56891	0.2016	L	0.53249	1.67	0.37011	D	0.895711	B	0.18863	0.031	B	0.26693	0.072	T	0.60214	-0.7307	9	0.38643	T	0.18	-19.8642	4.2218	0.10561	0.5871:0.0:0.0992:0.3138	.	282	Q9H4B4	PLK3_HUMAN	C	282;257	ENSP00000361275:S282C	ENSP00000361275:S282C	S	+	1	0	PLK3	45041308	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.992000	0.40737	2.062000	0.61559	0.397000	0.26171	AGC		0.622	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023429.1	NM_004073		16	90	0	0	0	0.004007	0	16	90				
NRD1	4898	broad.mit.edu	37	1	52303236	52303236	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:52303236C>A	ENST00000354831.7	-	3	876	c.687G>T	c.(685-687)aaG>aaT	p.K229N	NRD1_ENST00000544028.1_Intron|NRD1_ENST00000539524.1_Missense_Mutation_p.K97N|MIR761_ENST00000390787.1_RNA|NRD1_ENST00000485608.1_Intron|NRD1_ENST00000352171.7_Intron	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.K229N(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						AATAAGTTGACTTAAACCACA	0.373																																							uc001ctc.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(685-687)AAG>AAT		nardilysin isoform a							117.0	115.0	115.0					1																	52303236		2203	4300	6503	SO:0001583	missense	4898				cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding	g.chr1:52303236C>A	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.687G>T	1.37:g.52303236C>A	ENSP00000346890:p.Lys229Asn					NRD1_uc009vzb.2_Intron|NRD1_uc001ctd.3_Intron|NRD1_uc001cte.2_Missense_Mutation_p.K97N|NRD1_uc001ctf.2_Intron|NRD1_uc010ong.1_Intron|NRD1_uc009vzc.1_Intron|MIR761_hsa-mir-761|MI0003941_5'Flank|NRD1_uc001ctg.1_RNA	p.K229N	NM_002525	NP_002516	O43847	NRDC_HUMAN			3	1009	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	37	c.687G>T	CCDS559.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641954	0.29157	.	.	ENSG00000078618	ENST00000354831;ENST00000539524	T;T	0.32023	1.47;1.48	4.88	2.86	0.33363	.	0.418276	0.25386	N	0.031041	T	0.13415	0.0325	N	0.08118	0	0.80722	D	1	B	0.31318	0.319	B	0.29598	0.104	T	0.07385	-1.0775	10	0.42905	T	0.14	-4.024	6.0545	0.19804	0.0:0.7656:0.0:0.2344	.	229	B1AKJ5	.	N	229;97	ENSP00000346890:K229N;ENSP00000444416:K97N	ENSP00000346890:K229N	K	-	3	2	NRD1	52075824	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	1.201000	0.32259	1.275000	0.44379	-0.140000	0.14226	AAG		0.373	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525		29	78	1	0	3.73148e-12	0.007291	5.22923e-12	29	78				
NEGR1	257194	broad.mit.edu	37	1	72076749	72076749	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:72076749C>A	ENST00000357731.5	-	5	987	c.748G>T	c.(748-750)Gtg>Ttg	p.V250L	NEGR1_ENST00000306821.3_Missense_Mutation_p.V122L|NEGR1_ENST00000434200.1_Missense_Mutation_p.V204L	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	250	Ig-like C2-type 3.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.V250L(1)		endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		GGAGGCGGCACACCTGCACCT	0.458																																							uc001dfw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(748-750)GTG>TTG		neuronal growth regulator 1 precursor							107.0	107.0	107.0					1																	72076749		2203	4300	6503	SO:0001583	missense	257194				cell adhesion	anchored to membrane|plasma membrane		g.chr1:72076749C>A	AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.748G>T	1.37:g.72076749C>A	ENSP00000350364:p.Val250Leu					NEGR1_uc001dfv.2_Missense_Mutation_p.V122L|NEGR1_uc010oqs.1_Missense_Mutation_p.V206L	p.V250L	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)	5	848	-		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)	250			Ig-like C2-type 3.		Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	37	c.748G>T	CCDS661.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317021	0.81469	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.67865	-0.29;-0.29;-0.29	5.93	5.93	0.95920	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.71005	0.3289	L	0.48877	1.53	0.58432	D	0.999998	D;D	0.71674	0.998;0.995	D;D	0.73380	0.98;0.955	T	0.63427	-0.6640	10	0.22109	T	0.4	-10.7826	19.1026	0.93279	0.0:1.0:0.0:0.0	.	204;250	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	L	250;122;204	ENSP00000350364:V250L;ENSP00000305938:V122L;ENSP00000413294:V204L	ENSP00000305938:V122L	V	-	1	0	NEGR1	71849337	1.000000	0.71417	1.000000	0.80357	0.563000	0.35712	3.341000	0.52151	2.797000	0.96272	0.655000	0.94253	GTG		0.458	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808		14	69	1	0	1.49906e-05	0.00245	1.69114e-05	14	69				
FPGT	8790	broad.mit.edu	37	1	74670891	74670891	+	Missense_Mutation	SNP	G	G	T	rs185783642		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:74670891G>T	ENST00000609362.1	+	4	1197	c.1160G>T	c.(1159-1161)aGt>aTt	p.S387I	FPGT-TNNI3K_ENST00000370899.3_Intron|FPGT-TNNI3K_ENST00000370893.1_Intron|FPGT-TNNI3K_ENST00000557284.2_Intron|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT_ENST00000370894.5_Splice_Site|TNNI3K_ENST00000370891.2_Intron|FPGT_ENST00000370898.3_Missense_Mutation_p.S400I|FPGT_ENST00000534056.1_Intron|FPGT-TNNI3K_ENST00000533006.1_Intron|FPGT_ENST00000524915.1_Intron	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	387					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)	p.S387I(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						ATAACTTTTAGTATCTTTCCA	0.383																																							uc001dgb.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1159-1161)AGT>ATT		fucose-1-phosphate guanyltransferase							59.0	61.0	60.0					1																	74670891		2203	4299	6502	SO:0001583	missense	8790				fucose metabolic process	cytoplasm	fucose-1-phosphate guanylyltransferase activity|GTP binding	g.chr1:74670891G>T	AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.1160G>T	1.37:g.74670891G>T	ENSP00000476680:p.Ser387Ile					TNNI3K_uc001dgc.1_Intron|TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron|FPGT_uc010oqt.1_Splice_Site_p.C12_splice|FPGT_uc010oqu.1_Intron|FPGT_uc010oqv.1_Intron	p.S387I	NM_003838	NP_003829	O14772	FPGT_HUMAN			4	1197	+			387					A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Missense_Mutation	SNP	ENST00000609362.1	37	c.1160G>T	CCDS663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.40|14.40	2.523470|2.523470	0.44866|0.44866	.|.	.|.	ENSG00000254685|ENSG00000254685	ENST00000370894|ENST00000370898	.|T	.|0.32515	.|1.45	5.91|5.91	5.91|5.91	0.95273|0.95273	.|L-fucokinase (1);	.|.	.|.	.|.	.|.	.|T	.|0.48909	.|0.1526	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	.|D	.|0.64830	.|0.994	.|D	.|0.65773	.|0.938	.|T	.|0.32295	.|-0.9912	.|8	.|.	.|.	.|.	.|.	20.2985|20.2985	0.98592|0.98592	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|387	.|O14772	.|FPGT_HUMAN	.|I	-1|387	.|ENSP00000359935:S387I	.|.	.|S	+|+	.|2	.|0	TNNI3K|TNNI3K	74443479|74443479	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.467000|0.467000	0.32768|0.32768	9.476000|9.476000	0.97823|0.97823	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	.|AGT		0.383	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				10	28	1	0	3.86212e-05	0.008291	4.26201e-05	10	28				
ASB17	127247	broad.mit.edu	37	1	76397599	76397599	+	Missense_Mutation	SNP	A	A	T	rs533619388	byFrequency	TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:76397599A>T	ENST00000284142.6	-	1	517	c.378T>A	c.(376-378)agT>agA	p.S126R		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	126					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.S126R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						CCAGGTTACAACTTCTGTCTT	0.338																																							uc001dhe.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(376-378)AGT>AGA		ankyrin repeat and SOCS box-containing 17							55.0	54.0	54.0					1																	76397599		2203	4299	6502	SO:0001583	missense	127247				intracellular signal transduction			g.chr1:76397599A>T	AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.378T>A	1.37:g.76397599A>T	ENSP00000284142:p.Ser126Arg					ASB17_uc001dhf.1_RNA	p.S126R	NM_080868	NP_543144	Q8WXJ9	ASB17_HUMAN			1	518	-			126					B1APB8|Q8N0X5	Missense_Mutation	SNP	ENST00000284142.6	37	c.378T>A	CCDS671.1	.	.	.	.	.	.	.	.	.	.	A	17.55	3.417874	0.62622	.	.	ENSG00000154007	ENST00000284142	T	0.71579	-0.58	5.97	-3.19	0.05171	Ankyrin repeat-containing domain (1);	0.000000	0.64402	D	0.000005	T	0.44095	0.1277	L	0.27053	0.805	0.30717	N	0.748614	D	0.54397	0.966	P	0.46479	0.518	T	0.57195	-0.7853	10	0.87932	D	0	.	13.7431	0.62860	0.2769:0.0:0.7231:0.0	.	126	Q8WXJ9	ASB17_HUMAN	R	126	ENSP00000284142:S126R	ENSP00000284142:S126R	S	-	3	2	ASB17	76170187	0.985000	0.35326	0.981000	0.43875	0.995000	0.86356	0.050000	0.14120	-0.474000	0.06862	-0.274000	0.10170	AGT		0.338	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868		14	23	0	0	0	0.00245	0	14	23				
PRKACB	5567	broad.mit.edu	37	1	84700881	84700881	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:84700881C>A	ENST00000370689.2	+	10	1213	c.949C>A	c.(949-951)Cca>Aca	p.P317T	PRKACB_ENST00000394839.2_Missense_Mutation_p.P287T|PRKACB_ENST00000370685.3_Missense_Mutation_p.P364T|PRKACB_ENST00000370682.3_Missense_Mutation_p.P321T|PRKACB_ENST00000394838.2_Missense_Mutation_p.P324T	NM_001242862.1|NM_002731.2	NP_001229791.1|NP_002722.1	P22694	KAPCB_HUMAN	protein kinase, cAMP-dependent, catalytic, beta	317	AGC-kinase C-terminal.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of protein processing (GO:0070613)|response to clozapine (GO:0097338)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|magnesium ion binding (GO:0000287)|ubiquitin protein ligase binding (GO:0031625)	p.P324T(1)|p.P317T(1)|p.P364T(1)		breast(1)|endometrium(2)|kidney(1)|lung(11)|ovary(1)	16				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		TCCATTCATACCAAAGTTTAG	0.343																																							uc001djj.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(2)|ovary(1)	3						c.(949-951)CCA>ACA		cAMP-dependent protein kinase catalytic subunit							65.0	68.0	67.0					1																	84700881		2203	4300	6503	SO:0001583	missense	5567				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding	g.chr1:84700881C>A	BC035058	CCDS691.1, CCDS692.1, CCDS693.1, CCDS55610.1, CCDS55611.1, CCDS72812.1, CCDS72813.1, CCDS72814.1, CCDS72815.1, CCDS72816.1	1p36.1	2012-10-02			ENSG00000142875	ENSG00000142875	2.7.11.1		9381	protein-coding gene	gene with protein product		176892					Standard	XM_005271016		Approved	PKACb	uc001djl.3	P22694	OTTHUMG00000009975	ENST00000370689.2:c.949C>A	1.37:g.84700881C>A	ENSP00000359723:p.Pro317Thr					PRKACB_uc001djl.2_Missense_Mutation_p.P364T|PRKACB_uc010ort.1_Missense_Mutation_p.P324T|PRKACB_uc001djn.2_Missense_Mutation_p.P321T|PRKACB_uc010oru.1_Missense_Mutation_p.P305T|PRKACB_uc001djp.2_Missense_Mutation_p.P323T|PRKACB_uc001djq.2_Missense_Mutation_p.P287T|PRKACB_uc010orv.1_Missense_Mutation_p.P304T	p.P317T	NM_002731	NP_002722	P22694	KAPCB_HUMAN		all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)	10	1213	+			317			AGC-kinase C-terminal.		B1APG4|B4DKB0|B4E2Q1|Q14VH1|Q59GC0|Q5BNE9|Q5BNF0|Q5BNF1|Q5BNF2|Q5BNF3|Q5CZ92|Q5T1K3|Q7Z3M1|Q8IYR5|Q8IZQ0|Q96B09	Missense_Mutation	SNP	ENST00000370689.2	37	c.949C>A	CCDS691.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797773	0.90538	.	.	ENSG00000142875	ENST00000370689;ENST00000370685;ENST00000394838;ENST00000370682;ENST00000370679;ENST00000394839;ENST00000370681	T;T;T;T;T	0.08807	3.05;3.05;3.05;3.05;3.05	6.04	6.04	0.98038	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.50326	0.1609	H	0.99842	4.835	0.80722	D	1	D;D;D;D;D;D;D;D	0.71674	0.998;0.997;0.997;0.996;0.998;0.994;0.998;0.998	D;D;D;D;D;D;D;D	0.83275	0.996;0.974;0.96;0.978;0.982;0.995;0.993;0.996	T	0.74615	-0.3606	10	0.87932	D	0	-11.5491	20.5948	0.99439	0.0:1.0:0.0:0.0	.	317;305;324;287;323;321;364;317	B2RB89;P22694-3;B4DKB0;B1APG4;P22694-6;P22694-7;P22694-2;P22694	.;.;.;.;.;.;.;KAPCB_HUMAN	T	317;364;324;321;323;287;279	ENSP00000359723:P317T;ENSP00000359719:P364T;ENSP00000378314:P324T;ENSP00000359716:P321T;ENSP00000378315:P287T	ENSP00000359713:P323T	P	+	1	0	PRKACB	84473469	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.873000	0.98535	0.563000	0.77884	CCA		0.343	PRKACB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027641.1	NM_182948		31	56	1	0	2.1956e-27	0.004289	3.93459e-27	31	56				
NTNG1	22854	broad.mit.edu	37	1	107867366	107867366	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:107867366C>A	ENST00000370068.1	+	3	1555	c.709C>A	c.(709-711)Cta>Ata	p.L237I	NTNG1_ENST00000370065.1_Missense_Mutation_p.L237I|NTNG1_ENST00000370074.4_Missense_Mutation_p.L237I|NTNG1_ENST00000370067.1_Missense_Mutation_p.L237I|NTNG1_ENST00000370073.2_Missense_Mutation_p.L237I|NTNG1_ENST00000370061.3_Missense_Mutation_p.L237I|NTNG1_ENST00000370070.2_Missense_Mutation_p.L237I|NTNG1_ENST00000542803.1_Missense_Mutation_p.L237I|NTNG1_ENST00000370066.1_Missense_Mutation_p.L237I|NTNG1_ENST00000370071.2_Missense_Mutation_p.L237I|NTNG1_ENST00000370072.3_Missense_Mutation_p.L237I|NTNG1_ENST00000477948.1_3'UTR			Q9Y2I2	NTNG1_HUMAN	netrin G1	237	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)		p.L237I(3)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		TGGACCTCGCCTACGCAATAT	0.428																																							uc001dvh.3		NA																	3	Substitution - Missense(3)		lung(3)	large_intestine(2)|ovary(2)|skin(2)	6						c.(709-711)CTA>ATA		netrin G1 isoform 1							86.0	84.0	85.0					1																	107867366		2203	4300	6503	SO:0001583	missense	22854				axonogenesis	anchored to plasma membrane	protein binding	g.chr1:107867366C>A	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.709C>A	1.37:g.107867366C>A	ENSP00000359085:p.Leu237Ile					NTNG1_uc001dvf.3_Missense_Mutation_p.L237I|NTNG1_uc010out.1_Missense_Mutation_p.L237I|NTNG1_uc001dvc.3_Missense_Mutation_p.L237I|NTNG1_uc001dvd.1_Missense_Mutation_p.L237I	p.L237I	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)	3	1427	+		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)	237			Laminin N-terminal.		Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	c.709C>A	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848630	0.71603	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86	6.05	6.05	0.98169	Laminin, N-terminal (3);	0.000000	0.49916	D	0.000136	T	0.80701	0.4673	L	0.56396	1.775	0.58432	D	0.999999	D;D;P;D;D	0.67145	0.968;0.996;0.829;0.966;0.986	D;D;P;D;D	0.83275	0.996;0.996;0.689;0.963;0.939	T	0.81790	-0.0771	10	0.72032	D	0.01	.	13.7598	0.62959	0.0:0.9303:0.0:0.0697	.	237;237;237;237;237	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	I	237	ENSP00000359090:L237I;ENSP00000359088:L237I;ENSP00000440561:L237I;ENSP00000359078:L237I;ENSP00000359089:L237I;ENSP00000359087:L237I;ENSP00000359091:L237I;ENSP00000359085:L237I;ENSP00000359084:L237I;ENSP00000359083:L237I;ENSP00000359082:L237I	ENSP00000294649:L237I	L	+	1	2	NTNG1	107668889	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.106000	0.57804	2.880000	0.98712	0.655000	0.94253	CTA		0.428	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917		15	32	1	0	0.000219431	0.00245	0.000235729	15	32				
TBX15	6913	broad.mit.edu	37	1	119427378	119427378	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:119427378G>A	ENST00000369429.3	-	8	1795	c.1786C>T	c.(1786-1788)Cag>Tag	p.Q596*	TBX15_ENST00000207157.3_Nonsense_Mutation_p.Q490*			Q96SF7	TBX15_HUMAN	T-box 15	596					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.Q490*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		ACGGACATCTGGGAGGAGGAG	0.552																																							uc001ehl.1		NA																	1	Substitution - Nonsense(1)		lung(1)	large_intestine(1)|pancreas(1)	2						c.(1468-1470)CAG>TAG		T-box 15							78.0	74.0	76.0					1																	119427378		2203	4300	6503	SO:0001587	stop_gained	6913					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:119427378G>A	AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.1786C>T	1.37:g.119427378G>A	ENSP00000358437:p.Gln596*					TBX15_uc009whj.1_Nonsense_Mutation_p.Q314*	p.Q490*	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)	8	1783	-	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)	596					Q08E76|Q5JT54|Q5T9S7	Nonsense_Mutation	SNP	ENST00000369429.3	37	c.1468C>T		.	.	.	.	.	.	.	.	.	.	G	36	5.833221	0.97003	.	.	ENSG00000092607	ENST00000344218;ENST00000207157;ENST00000369429;ENST00000449873	.	.	.	5.31	5.31	0.75309	.	0.202376	0.44902	D	0.000405	.	.	.	.	.	.	0.54753	D	0.999983	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.1626	0.93539	0.0:0.0:1.0:0.0	.	.	.	.	X	393;490;596;324	.	ENSP00000207157:Q490X	Q	-	1	0	TBX15	119228901	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.122000	0.94380	2.768000	0.95171	0.561000	0.74099	CAG		0.552	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	NM_152380		22	63	0	0	0	0.012319	0	22	63				
SEMA6C	10500	broad.mit.edu	37	1	151108068	151108068	+	Splice_Site	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:151108068G>A	ENST00000341697.3	-	14	3123	c.1432C>T	c.(1432-1434)Cgg>Tgg	p.R478W	SEMA6C_ENST00000479820.1_5'Flank			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	478	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.R478W(2)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGGCCTCACCGGGCAGGGCTG	0.597																																							uc001ewu.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)|skin(1)	2						c.(1432-1434)CGG>TGG		semaphorin Y precursor							70.0	76.0	74.0					1																	151108068		2203	4299	6502	SO:0001630	splice_region_variant	10500					integral to membrane	receptor activity	g.chr1:151108068G>A	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.1433+1C>T	1.37:g.151108068G>A						SEMA6C_uc001ewv.2_Missense_Mutation_p.R478W|SEMA6C_uc001eww.2_Missense_Mutation_p.R438W|SEMA6C_uc010pcq.1_Missense_Mutation_p.R478W	p.R478W	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		14	1732	-	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		478			Extracellular (Potential).|Sema.		D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	37	c.1432C>T	CCDS984.1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.388909	0.42308	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697	T;T;T;T	0.20332	2.08;2.31;2.11;2.08	4.77	-1.01	0.10169	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (3);	0.000000	0.39210	N	0.001432	T	0.24624	0.0597	M	0.71036	2.16	0.28922	N	0.892079	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.995;0.988;0.998	T	0.06041	-1.0849	10	0.87932	D	0	.	8.4767	0.33018	0.0831:0.0:0.2447:0.6722	.	478;438;478;478	B4DZD4;Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;.;SEM6C_HUMAN	W	478;438;478;478	ENSP00000357910:R478W;ENSP00000357908:R438W;ENSP00000357909:R478W;ENSP00000344148:R478W	ENSP00000344148:R478W	R	-	1	2	SEMA6C	149374692	0.001000	0.12720	0.941000	0.38009	0.204000	0.24138	0.339000	0.19875	-0.152000	0.11156	-1.157000	0.01802	CGG		0.597	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	Missense_Mutation	16	206	0	0	0	0.00499	0	16	206				
TCHHL1	126637	broad.mit.edu	37	1	152058462	152058462	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:152058462C>A	ENST00000368806.1	-	3	1760	c.1696G>T	c.(1696-1698)Gaa>Taa	p.E566*		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	566							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			ACAGGCAGTTCACCTGTCTCT	0.542																																							uc001ezo.1		NA																	0				ovary(1)|skin(1)	2						c.(1696-1698)GAA>TAA		trichohyalin-like 1							140.0	136.0	137.0					1																	152058462		2203	4300	6503	SO:0001587	stop_gained	126637						calcium ion binding	g.chr1:152058462C>A		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.1696G>T	1.37:g.152058462C>A	ENSP00000357796:p.Glu566*						p.E566*	NM_001008536	NP_001008536	Q5QJ38	TCHL1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.246)		3	1761	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		566					B2RPK8|Q5VTJ9	Nonsense_Mutation	SNP	ENST00000368806.1	37	c.1696G>T	CCDS30857.1	.	.	.	.	.	.	.	.	.	.	.	27.4	4.824948	0.90955	.	.	ENSG00000182898	ENST00000368806	.	.	.	5.42	3.54	0.40534	.	0.879875	0.09409	N	0.806094	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-0.0688	8.0486	0.30564	0.0:0.8135:0.0:0.1865	.	.	.	.	X	566	.	ENSP00000357796:E566X	E	-	1	0	TCHHL1	150325086	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.107000	0.15375	0.654000	0.30846	0.655000	0.94253	GAA		0.542	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036638.2	XM_060104		54	182	1	0	4.6707e-30	0.01441	8.55943e-30	54	182				
CD5L	922	broad.mit.edu	37	1	157805682	157805682	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:157805682C>A	ENST00000368174.4	-	3	415	c.319G>T	c.(319-321)Gag>Tag	p.E107*	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	107	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.E107*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCTTCTTGCTCACACTGAGCC	0.483																																							uc001frk.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(319-321)GAG>TAG		CD5 molecule-like precursor							200.0	202.0	201.0					1																	157805682		2203	4300	6503	SO:0001587	stop_gained	922				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity	g.chr1:157805682C>A	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.319G>T	1.37:g.157805682C>A	ENSP00000357156:p.Glu107*						p.E107*	NM_005894	NP_005885	O43866	CD5L_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		3	462	-	all_hematologic(112;0.0378)		107			SRCR 1.		A8K7M5|Q6UX63	Nonsense_Mutation	SNP	ENST00000368174.4	37	c.319G>T	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216713	0.39201	.	.	ENSG00000073754	ENST00000368174	.	.	.	4.68	0.697	0.18081	.	0.895686	0.09313	N	0.819302	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	7.3414	0.26640	0.0:0.5325:0.0:0.4675	.	.	.	.	X	107	.	ENSP00000357156:E107X	E	-	1	0	CD5L	156072306	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-1.619000	0.02048	-0.029000	0.13827	0.563000	0.77884	GAG		0.483	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894		61	368	1	0	1.19403e-26	0.01441	2.12098e-26	61	368				
SPTA1	6708	broad.mit.edu	37	1	158612763	158612763	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:158612763C>T	ENST00000368147.4	-	32	4626	c.4446G>A	c.(4444-4446)tgG>tgA	p.W1482*		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1482					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.W1482*(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGAGAGCCTTCCACCTAGAGG	0.483																																							uc001fst.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(4444-4446)TGG>TGA		spectrin, alpha, erythrocytic 1							92.0	84.0	87.0					1																	158612763		1989	4170	6159	SO:0001587	stop_gained	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158612763C>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4446G>A	1.37:g.158612763C>T	ENSP00000357129:p.Trp1482*						p.W1482*	NM_003126	NP_003117	P02549	SPTA1_HUMAN			32	4645	-	all_hematologic(112;0.0378)		1482			Spectrin 14.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Nonsense_Mutation	SNP	ENST00000368147.4	37	c.4446G>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	44	10.953698	0.99494	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	5.2	5.2	0.72013	.	0.000000	0.30410	N	0.009696	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.4847	0.87684	0.0:1.0:0.0:0.0	.	.	.	.	X	1482	.	ENSP00000357129:W1482X	W	-	3	0	SPTA1	156879387	1.000000	0.71417	0.978000	0.43139	0.385000	0.30292	6.827000	0.75303	2.711000	0.92665	0.655000	0.94253	TGG		0.483	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		31	38	0	0	0	0.010818	0	31	38				
SPTA1	6708	broad.mit.edu	37	1	158648304	158648304	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:158648304G>T	ENST00000368147.4	-	6	879	c.699C>A	c.(697-699)ccC>ccA	p.P233P		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	233					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.P233P(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					ACTGAATTAAGGGTAGGTCAG	0.398																																							uc001fst.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(697-699)CCC>CCA		spectrin, alpha, erythrocytic 1							69.0	65.0	66.0					1																	158648304		1872	4099	5971	SO:0001819	synonymous_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158648304G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.699C>A	1.37:g.158648304G>T							p.P233P	NM_003126	NP_003117	P02549	SPTA1_HUMAN			6	898	-	all_hematologic(112;0.0378)		233			Spectrin 3.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	c.699C>A	CCDS41423.1																																																																																				0.398	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		17	62	1	0	3.41278e-10	0.00499	4.4159e-10	17	62				
ATP1A4	480	broad.mit.edu	37	1	160144384	160144384	+	Missense_Mutation	SNP	G	G	T	rs150078418		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:160144384G>T	ENST00000368081.4	+	15	2629	c.2158G>T	c.(2158-2160)Gtg>Ttg	p.V720L	ATP1A4_ENST00000470705.1_5'Flank|ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	720					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.V720L(1)|p.V720M(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CGTTGTGGCCGTGACAGGTGA	0.542																																							uc001fve.3		NA																	2	Substitution - Missense(2)	p.V720M(1)	ovary(1)|lung(1)	ovary(2)|skin(2)	4						c.(2158-2160)GTG>TTG		Na+/K+ -ATPase alpha 4 subunit isoform 1							102.0	81.0	88.0					1																	160144384		2203	4300	6503	SO:0001583	missense	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160144384G>T	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2158G>T	1.37:g.160144384G>T	ENSP00000357060:p.Val720Leu					ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Missense_Mutation_p.V223L|ATP1A4_uc001fvh.2_5'Flank	p.V720L	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		15	2637	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		720			Cytoplasmic (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	c.2158G>T	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434700	0.83885	.	.	ENSG00000132681	ENST00000368081	D	0.96265	-3.96	4.2	4.2	0.49525	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.061993	0.64402	D	0.000006	D	0.98333	0.9447	H	0.94620	3.56	0.80722	D	1	D	0.56746	0.977	D	0.64877	0.93	D	0.99146	1.0857	10	0.87932	D	0	.	14.4423	0.67325	0.0:0.0:1.0:0.0	.	720	Q13733	AT1A4_HUMAN	L	720	ENSP00000357060:V720L	ENSP00000357060:V720L	V	+	1	0	ATP1A4	158411008	1.000000	0.71417	0.929000	0.37066	0.791000	0.44710	9.619000	0.98369	2.336000	0.79503	0.609000	0.83330	GTG		0.542	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		29	35	1	0	8.16721e-17	0.010818	1.2435e-16	29	35				
FCGR3A	2214	broad.mit.edu	37	1	161594354	161594354	+	Intron	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:161594354A>G	ENST00000540048.1	-	2	94				FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR3B_ENST00000367964.2_Missense_Mutation_p.L218P|FCGR3B_ENST00000294800.3_Missense_Mutation_p.L218P|FCGR3B_ENST00000531221.1_Missense_Mutation_p.L254P			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L218P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CACTGCAAAAAGGAGTACCAT	0.433																																							uc009wul.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(652-654)CTT>CCT		low affinity immunoglobulin gamma Fc region	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						93.0	105.0	101.0					1																	161594354		2190	4297	6487	SO:0001627	intron_variant	2215				immune response	anchored to membrane|extracellular region|plasma membrane	IgG binding|receptor activity	g.chr1:161594354A>G	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+5803T>C	1.37:g.161594354A>G							p.L218P	NM_000570	NP_000561	O75015	FCG3B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)		5	927	-	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		218					A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000540048.1	37	c.653T>C		.	.	.	.	.	.	.	.	.	.	-	12.12	1.841592	0.32513	.	.	ENSG00000162747	ENST00000367964;ENST00000294800;ENST00000531221	T;T;T	0.01947	4.54;4.54;4.55	3.0	3.0	0.34707	.	10.416700	0.00166	N	0.000003	T	0.05640	0.0148	M	0.72479	2.2	0.50171	D	0.999859	D	0.89917	1.0	D	0.69307	0.963	T	0.28650	-1.0037	10	0.49607	T	0.09	.	7.4659	0.27322	1.0:0.0:0.0:0.0	.	218	O75015	FCG3B_HUMAN	P	218;218;254	ENSP00000356941:L218P;ENSP00000294800:L218P;ENSP00000433642:L254P	ENSP00000294800:L218P	L	-	2	0	FCGR3B	159860978	1.000000	0.71417	0.313000	0.25210	0.433000	0.31745	3.594000	0.54008	1.235000	0.43724	0.324000	0.21423	CTT		0.433	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569		31	133	0	0	0	0.010818	0	31	133				
FASLG	356	broad.mit.edu	37	1	172635120	172635120	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:172635120G>A	ENST00000367721.2	+	4	994	c.810G>A	c.(808-810)gaG>gaA	p.E270E	FASLG_ENST00000340030.3_3'UTR	NM_000639.1	NP_000630.1	P48023	TNFL6_HUMAN	Fas ligand (TNF superfamily, member 6)	270					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cellular chloride ion homeostasis (GO:0030644)|endosomal lumen acidification (GO:0048388)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|immune response (GO:0006955)|inflammatory cell apoptotic process (GO:0006925)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of angiogenesis (GO:0016525)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to growth factor (GO:0070848)|response to lipopolysaccharide (GO:0032496)|retinal cell programmed cell death (GO:0046666)|signal transduction (GO:0007165)|T cell apoptotic process (GO:0070231)|transcription, DNA-templated (GO:0006351)	caveola (GO:0005901)|cytoplasmic membrane-bounded vesicle (GO:0016023)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)	p.E270E(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|skin(1)	19						TCAATTTTGAGGAATCTCAGA	0.433																																					Ovarian(28;486 876 30334 44033)	Ovarian(28;486 876 30334 44033)	uc001gis.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|breast(1)	3						c.(808-810)GAG>GAA		fas ligand							73.0	73.0	73.0					1																	172635120		2203	4300	6503	SO:0001819	synonymous_variant	356				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of necroptosis by extracellular signals|induction of necroptosis of activated-T cells|necrotic cell death|negative regulation of angiogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane	cytokine activity	g.chr1:172635120G>A	U11821	CCDS1304.1	1q23	2014-09-17	2005-01-07	2005-01-07	ENSG00000117560	ENSG00000117560		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11936	protein-coding gene	gene with protein product		134638	"""tumor necrosis factor (ligand) superfamily, member 6"""	APT1LG1, TNFSF6		7826947, 9022072	Standard	NM_000639		Approved	FasL, CD178	uc001gis.3	P48023	OTTHUMG00000034841	ENST00000367721.2:c.810G>A	1.37:g.172635120G>A						FASLG_uc001git.2_3'UTR	p.E270E	NM_000639	NP_000630	P48023	TNFL6_HUMAN			4	967	+			270			Extracellular (Potential).		Q9BZP9	Silent	SNP	ENST00000367721.2	37	c.810G>A	CCDS1304.1																																																																																				0.433	FASLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084276.1			41	45	0	0	0	0.009718	0	41	45				
SLC9C2	284525	broad.mit.edu	37	1	173505044	173505044	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:173505044C>T	ENST00000367714.3	-	15	2122	c.1700G>A	c.(1699-1701)aGt>aAt	p.S567N	SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Intron	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	567					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.S567N(1)									TATAAGCCAACTTCTAGTTCT	0.264																																							uc001giz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1699-1701)AGT>AAT		solute carrier family 9, member 11							24.0	28.0	27.0					1																	173505044		2141	4222	6363	SO:0001583	missense	284525				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity	g.chr1:173505044C>T	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1700G>A	1.37:g.173505044C>T	ENSP00000356687:p.Ser567Asn					SLC9A11_uc009wwe.2_Missense_Mutation_p.S125N|SLC9A11_uc010pmq.1_Intron	p.S567N	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN			15	2123	-			567					Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	c.1700G>A	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.442614	0.25987	.	.	ENSG00000162753	ENST00000367714	T	0.21734	1.99	5.81	3.95	0.45737	.	0.161677	0.43579	N	0.000541	T	0.08802	0.0218	L	0.57536	1.79	0.80722	D	1	B	0.30664	0.289	B	0.28784	0.094	T	0.06625	-1.0816	10	0.28530	T	0.3	-14.4978	8.9524	0.35796	0.0:0.8308:0.0:0.1692	.	567	Q5TAH2	S9A11_HUMAN	N	567	ENSP00000356687:S567N	ENSP00000356687:S567N	S	-	2	0	SLC9A11	171771667	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	2.279000	0.43435	0.804000	0.34136	-0.216000	0.12614	AGT		0.264	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		4	36	0	0	0	0.009096	0	4	36				
TNN	63923	broad.mit.edu	37	1	175086339	175086339	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:175086339C>A	ENST00000239462.4	+	10	2497	c.2384C>A	c.(2383-2385)aCa>aAa	p.T795K		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	795	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.T795K(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AAGGCCCAGACAGGTAAGGAG	0.527																																							uc001gkl.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2383-2385)ACA>AAA		tenascin N precursor							79.0	80.0	80.0					1																	175086339		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175086339C>A	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2384C>A	1.37:g.175086339C>A	ENSP00000239462:p.Thr795Lys						p.T795K	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	10	2497	+		Breast(1374;0.000962)	795			Fibronectin type-III 6.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2384C>A	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958954	0.92726	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.65178	-0.14	5.3	5.3	0.74995	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.349613	0.30168	N	0.010241	D	0.83608	0.5291	M	0.93808	3.46	0.80722	D	1	D	0.64830	0.994	D	0.64687	0.928	D	0.87821	0.2638	10	0.87932	D	0	.	17.1036	0.86656	0.0:1.0:0.0:0.0	.	795	Q9UQP3	TENN_HUMAN	K	795;618	ENSP00000239462:T795K	ENSP00000239462:T795K	T	+	2	0	TNN	173352962	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	6.585000	0.74062	2.642000	0.89623	0.655000	0.94253	ACA		0.527	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		25	74	1	0	4.7796e-09	0.004656	5.93785e-09	25	74				
FAM129A	116496	broad.mit.edu	37	1	184764303	184764303	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:184764303C>A	ENST00000367511.3	-	14	2788	c.2595G>T	c.(2593-2595)atG>atT	p.M865I	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	865					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.M865I(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						TTTGCCCTCCCATCTCTTCTT	0.582																																							uc001gra.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2593-2595)ATG>ATT		niban protein isoform 2							121.0	101.0	108.0					1																	184764303		2203	4300	6503	SO:0001583	missense	116496				negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane		g.chr1:184764303C>A	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.2595G>T	1.37:g.184764303C>A	ENSP00000356481:p.Met865Ile					FAM129A_uc001grb.1_Intron	p.M865I	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN			14	2789	-			865					Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	37	c.2595G>T	CCDS1364.1	.	.	.	.	.	.	.	.	.	.	C	8.259	0.810661	0.16537	.	.	ENSG00000135842	ENST00000367511	T	0.09723	2.95	4.22	0.199	0.15175	.	2.535400	0.01380	N	0.012901	T	0.07638	0.0192	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32981	-0.9886	10	0.35671	T	0.21	-0.2298	6.62	0.22798	0.0:0.5835:0.0:0.4165	.	865	Q9BZQ8	NIBAN_HUMAN	I	865	ENSP00000356481:M865I	ENSP00000356481:M865I	M	-	3	0	FAM129A	183030926	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.040000	0.13905	-0.041000	0.13558	0.462000	0.41574	ATG		0.582	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1			59	67	1	0	4.45325e-31	0.01441	8.23547e-31	59	67				
BRINP3	339479	broad.mit.edu	37	1	190203595	190203595	+	Silent	SNP	G	G	T	rs145486539		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:190203595G>T	ENST00000367462.3	-	5	862	c.631C>A	c.(631-633)Cgg>Agg	p.R211R	BRINP3_ENST00000534846.1_Silent_p.R109R	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	211	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GGACCAGTCCGTGTTTCTGTT	0.378																																							uc001gse.1		NA																	0				lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(631-633)CGG>AGG		family with sequence similarity 5, member C							118.0	101.0	107.0					1																	190203595		2203	4300	6503	SO:0001819	synonymous_variant	339479					extracellular region		g.chr1:190203595G>T	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.631C>A	1.37:g.190203595G>T						FAM5C_uc010pot.1_Silent_p.R109R	p.R211R	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN			5	863	-	Prostate(682;0.198)		211					B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	37	c.631C>A	CCDS1373.1																																																																																				0.378	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		24	38	1	0	4.72057e-08	0.003954	5.74124e-08	24	38				
MYOG	4656	broad.mit.edu	37	1	203054889	203054889	+	Silent	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:203054889C>T	ENST00000241651.4	-	1	275	c.201G>A	c.(199-201)ccG>ccA	p.P67P		NM_002479.5	NP_002470.2	P15173	MYOG_HUMAN	myogenin (myogenic factor 4)	67					cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lithium ion (GO:0071285)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|negative regulation of cell proliferation (GO:0008285)|ossification (GO:0001503)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of muscle atrophy (GO:0014737)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myoblast fusion (GO:1901739)|regulation of satellite cell proliferation (GO:0014842)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|striated muscle atrophy (GO:0014891)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P67P(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|urinary_tract(1)	12						TACACGCCCACGGCAGGCACT	0.682																																							uc001gzd.2		NA																	2	Substitution - coding silent(2)		lung(2)	skin(2)	2						c.(199-201)CCG>CCA		myogenin							58.0	64.0	62.0					1																	203054889		2203	4300	6503	SO:0001819	synonymous_variant	4656				muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity	g.chr1:203054889C>T	BC053899	CCDS1433.1	1q31-q41	2013-05-21			ENSG00000122180	ENSG00000122180		"""Basic helix-loop-helix proteins"""	7612	protein-coding gene	gene with protein product		159980		MYF4		10329008	Standard	NM_002479		Approved	bHLHc3	uc001gzd.4	P15173	OTTHUMG00000042127	ENST00000241651.4:c.201G>A	1.37:g.203054889C>T							p.P67P	NM_002479	NP_002470	P15173	MYOG_HUMAN			1	489	-			67					Q53XW6	Silent	SNP	ENST00000241651.4	37	c.201G>A	CCDS1433.1																																																																																				0.682	MYOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100279.1	NM_002479		9	112	0	0	0	0.008291	0	9	112				
BTG2	7832	broad.mit.edu	37	1	203276294	203276294	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:203276294C>G	ENST00000290551.4	+	2	276	c.205C>G	c.(205-207)Cgc>Ggc	p.R69G	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	69					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R69G(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CCGCTGCATTCGCATCAACCA	0.612																																							uc001gzq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|skin(1)	3						c.(205-207)CGC>GGC		B-cell translocation gene 2							47.0	49.0	48.0					1																	203276294		2203	4300	6503	SO:0001583	missense	7832				DNA repair|neuron projection development|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr1:203276294C>G		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.205C>G	1.37:g.203276294C>G	ENSP00000290551:p.Arg69Gly					FMOD_uc010pqi.1_Intron|uc009xao.1_5'Flank|uc001gzp.1_5'Flank|BTG2_uc009xap.1_RNA	p.R69G	NM_006763	NP_006754	P78543	BTG2_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.203)		2	276	+			69					A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	c.205C>G	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.720715	0.68959	.	.	ENSG00000159388	ENST00000290551	T	0.28255	1.62	4.53	3.62	0.41486	Anti-proliferative protein (4);	0.075950	0.51477	D	0.000097	T	0.61173	0.2326	H	0.94503	3.545	0.47584	D	0.999465	D	0.89917	1.0	D	0.97110	1.0	T	0.65459	-0.6163	10	0.87932	D	0	-17.6794	6.666	0.23041	0.1762:0.731:0.0:0.0928	.	69	P78543	BTG2_HUMAN	G	69	ENSP00000290551:R69G	ENSP00000290551:R69G	R	+	1	0	BTG2	201542917	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.455000	0.52993	1.140000	0.42260	0.313000	0.20887	CGC		0.612	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763		13	35	0	0	0	0.013537	0	13	35				
USH2A	7399	broad.mit.edu	37	1	215844561	215844561	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:215844561T>G	ENST00000307340.3	-	64	14272	c.13886A>C	c.(13885-13887)gAg>gCg	p.E4629A	USH2A_ENST00000366943.2_Missense_Mutation_p.E4629A	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4629	Fibronectin type-III 31. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.E4629A(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGTGCAATCTCAGGGGTCTG	0.493										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(13885-13887)GAG>GCG		usherin isoform B							112.0	111.0	111.0					1																	215844561		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215844561T>G	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13886A>C	1.37:g.215844561T>G	ENSP00000305941:p.Glu4629Ala	HNSCC(13;0.011)					p.E4629A	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	64	14273	-			4629			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.13886A>C	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	15.74	2.922288	0.52653	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55052	0.54;0.54	5.21	5.21	0.72293	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.43416	D	0.000570	T	0.72985	0.3529	M	0.83692	2.655	0.58432	D	0.999999	D	0.89917	1.0	D	0.74674	0.984	T	0.73427	-0.3986	10	0.30854	T	0.27	.	15.3969	0.74801	0.0:0.0:0.0:1.0	.	4629	O75445	USH2A_HUMAN	A	4629	ENSP00000305941:E4629A;ENSP00000355910:E4629A	ENSP00000305941:E4629A	E	-	2	0	USH2A	213911184	1.000000	0.71417	0.179000	0.23059	0.063000	0.16089	7.603000	0.82811	2.087000	0.62958	0.528000	0.53228	GAG		0.493	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		15	112	0	0	0	0.003163	0	15	112				
USH2A	7399	broad.mit.edu	37	1	216373371	216373371	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:216373371C>A	ENST00000307340.3	-	17	3795	c.3409G>T	c.(3409-3411)Gta>Tta	p.V1137L	USH2A_ENST00000366942.3_Missense_Mutation_p.V1137L|RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.V1137L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1137	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.V1137L(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTGACAGCTACACTCCTTGTT	0.408										HNSCC(13;0.011)																													uc001hku.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3409-3411)GTA>TTA		usherin isoform B							96.0	94.0	95.0					1																	216373371		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216373371C>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3409G>T	1.37:g.216373371C>A	ENSP00000305941:p.Val1137Leu	HNSCC(13;0.011)				USH2A_uc001hkv.2_Missense_Mutation_p.V1137L	p.V1137L	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	17	3796	-			1137			Extracellular (Potential).|Fibronectin type-III 1.		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.3409G>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577466	0.28180	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	D;T;T	0.84589	-1.87;0.63;0.63	6.02	0.223	0.15292	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.719605	0.11666	N	0.541345	T	0.64427	0.2597	N	0.03608	-0.345	0.09310	N	0.999999	B;B	0.12630	0.002;0.006	B;B	0.09377	0.001;0.004	T	0.51779	-0.8662	10	0.35671	T	0.21	.	6.2296	0.20728	0.0:0.5703:0.1196:0.31	.	1137;1137	O75445-2;O75445	.;USH2A_HUMAN	L	1137	ENSP00000305941:V1137L;ENSP00000355910:V1137L;ENSP00000355909:V1137L	ENSP00000305941:V1137L	V	-	1	0	USH2A	214439994	0.477000	0.25909	0.277000	0.24703	0.638000	0.38207	0.278000	0.18753	-0.196000	0.10366	-0.136000	0.14681	GTA		0.408	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		26	100	1	0	1.42536e-11	0.004656	1.95684e-11	26	100				
HHIPL2	79802	broad.mit.edu	37	1	222696185	222696185	+	Nonsense_Mutation	SNP	T	T	A	rs371162182		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:222696185T>A	ENST00000343410.6	-	9	1991	c.1933A>T	c.(1933-1935)Aga>Tga	p.R645*	HHIPL2_ENST00000473144.1_5'UTR	NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	645					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)	p.R645*(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GAAGATTTTCTAGCAGCTTTC	0.428																																							uc001hnh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1933-1935)AGA>TGA		HHIP-like 2 precursor							96.0	100.0	99.0					1																	222696185		2203	4300	6503	SO:0001587	stop_gained	79802				carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding	g.chr1:222696185T>A	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1933A>T	1.37:g.222696185T>A	ENSP00000342118:p.Arg645*						p.R645*	NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN		GBM - Glioblastoma multiforme(131;0.0185)	9	1991	-			645					Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Nonsense_Mutation	SNP	ENST00000343410.6	37	c.1933A>T	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	T	36	5.762720	0.96906	.	.	ENSG00000143512	ENST00000343410	.	.	.	5.5	0.603	0.17541	.	0.425408	0.23330	N	0.049346	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-2.3275	4.3053	0.10944	0.0:0.2638:0.1665:0.5698	.	.	.	.	X	645	.	ENSP00000342118:R645X	R	-	1	2	HHIPL2	220762808	0.000000	0.05858	0.096000	0.21009	0.836000	0.47400	-0.080000	0.11339	-0.148000	0.11234	0.533000	0.62120	AGA		0.428	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746		40	183	0	0	0	0.00623	0	40	183				
HHIPL2	79802	broad.mit.edu	37	1	222712016	222712016	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:222712016C>A	ENST00000343410.6	-	5	1609	c.1551G>T	c.(1549-1551)ctG>ctT	p.L517L		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	517					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)	p.L517L(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CAAAGATATACAGGCCATTGA	0.413																																							uc001hnh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1549-1551)CTG>CTT		HHIP-like 2 precursor							115.0	99.0	104.0					1																	222712016		2203	4300	6503	SO:0001819	synonymous_variant	79802				carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding	g.chr1:222712016C>A	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1551G>T	1.37:g.222712016C>A							p.L517L	NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN		GBM - Glioblastoma multiforme(131;0.0185)	5	1609	-			517					Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Silent	SNP	ENST00000343410.6	37	c.1551G>T	CCDS1530.2																																																																																				0.413	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746		8	58	1	0	2.17888e-05	0.006214	2.44445e-05	8	58				
ABCB10	23456	broad.mit.edu	37	1	229675222	229675222	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:229675222C>A	ENST00000344517.4	-	6	1362	c.1320G>T	c.(1318-1320)tgG>tgT	p.W440C		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	440	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.W440C(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TTATTCCAACCCAGAAAGCAT	0.423																																							uc001htp.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)	2						c.(1318-1320)TGG>TGT		ATP-binding cassette, sub-family B, member 10							112.0	109.0	110.0					1																	229675222		2203	4300	6503	SO:0001583	missense	23456					integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity	g.chr1:229675222C>A	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1320G>T	1.37:g.229675222C>A	ENSP00000355637:p.Trp440Cys						p.W440C	NM_012089	NP_036221	Q9NRK6	ABCBA_HUMAN			6	1363	-	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)	440			Mitochondrial intermembrane (Potential).|ABC transmembrane type-1.|Helical; (Potential).		Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	ENST00000344517.4	37	c.1320G>T	CCDS1580.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174508	0.78452	.	.	ENSG00000135776	ENST00000344517	T	0.80123	-1.34	5.15	5.15	0.70609	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.88477	0.6447	M	0.63843	1.955	0.80722	D	1	D	0.71674	0.998	D	0.75020	0.985	D	0.88600	0.3149	10	0.54805	T	0.06	-15.9154	18.9948	0.92809	0.0:1.0:0.0:0.0	.	440	Q9NRK6	ABCBA_HUMAN	C	440	ENSP00000355637:W440C	ENSP00000355637:W440C	W	-	3	0	ABCB10	227741845	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.468000	0.80943	2.562000	0.86427	0.655000	0.94253	TGG		0.423	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095240.1	NM_012089		55	71	1	0	4.17463e-26	0.01441	7.35098e-26	55	71				
GNPAT	8443	broad.mit.edu	37	1	231410987	231410987	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:231410987G>C	ENST00000366647.4	+	13	1933	c.1764G>C	c.(1762-1764)ttG>ttC	p.L588F	GNPAT_ENST00000366646.3_Missense_Mutation_p.L527F|GNPAT_ENST00000469332.1_3'UTR	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	588					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)	p.L588F(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				AGTACCTTTTGAGTGAAGAAG	0.408																																							uc001hup.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1762-1764)TTG>TTC		glyceronephosphate O-acyltransferase							96.0	92.0	94.0					1																	231410987		2203	4300	6503	SO:0001583	missense	8443				ether lipid biosynthetic process|fatty acid metabolic process|organ morphogenesis	peroxisomal matrix|peroxisomal membrane	glycerone-phosphate O-acyltransferase activity	g.chr1:231410987G>C	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1764G>C	1.37:g.231410987G>C	ENSP00000355607:p.Leu588Phe					GNPAT_uc009xfp.2_Missense_Mutation_p.L527F	p.L588F	NM_014236	NP_055051	O15228	GNPAT_HUMAN			13	1970	+	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)	588					B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	ENST00000366647.4	37	c.1764G>C	CCDS1592.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.467812	0.26335	.	.	ENSG00000116906	ENST00000366647;ENST00000366646;ENST00000416000	T;T;T	0.66460	-0.17;-0.17;-0.21	4.88	1.93	0.25924	.	0.285102	0.35436	N	0.003204	T	0.53449	0.1797	L	0.51422	1.61	0.18873	N	0.999982	P;B	0.47910	0.902;0.049	B;B	0.44278	0.445;0.024	T	0.41858	-0.9485	10	0.14252	T	0.57	.	3.7945	0.08734	0.3528:0.0:0.4818:0.1653	.	527;588	B4DNM9;O15228	.;GNPAT_HUMAN	F	588;527;578	ENSP00000355607:L588F;ENSP00000355606:L527F;ENSP00000411640:L578F	ENSP00000355606:L527F	L	+	3	2	GNPAT	229477610	0.995000	0.38212	0.559000	0.28332	0.974000	0.67602	1.336000	0.33850	0.659000	0.30945	0.460000	0.39030	TTG		0.408	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1			5	54	0	0	0	0.000602	0	5	54				
PCNXL2	80003	broad.mit.edu	37	1	233122108	233122108	+	Silent	SNP	C	C	T	rs372086633		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:233122108C>T	ENST00000258229.9	-	33	6204	c.5970G>A	c.(5968-5970)tcG>tcA	p.S1990S	PCNXL2_ENST00000344698.2_Silent_p.S642S	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1990	Ser-rich.					integral component of membrane (GO:0016021)		p.S1990S(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GGGACGTGGCCGAGGCGTGCA	0.687																																							uc001hvl.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|pancreas(1)	2						c.(5968-5970)TCG>TCA		pecanex-like 2		C		0,4102		0,0,2051	17.0	25.0	22.0		5970	-10.8	0.0	1		22	1,8363		0,1,4181	no	coding-synonymous	PCNXL2	NM_014801.3		0,1,6232	TT,TC,CC		0.012,0.0,0.0080		1990/2138	233122108	1,12465	2051	4182	6233	SO:0001819	synonymous_variant	80003					integral to membrane		g.chr1:233122108C>T	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5970G>A	1.37:g.233122108C>T						PCNXL2_uc001hvk.1_Silent_p.S642S|PCNXL2_uc001hvm.1_RNA	p.S1990S	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN			33	6205	-		all_cancers(173;0.0347)|Prostate(94;0.137)	1990			Ser-rich.		O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Silent	SNP	ENST00000258229.9	37	c.5970G>A	CCDS44335.1																																																																																				0.687	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801		13	9	0	0	0	0.001855	0	13	9				
RYR2	6262	broad.mit.edu	37	1	237865347	237865347	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:237865347T>A	ENST00000366574.2	+	66	9754	c.9437T>A	c.(9436-9438)aTt>aAt	p.I3146N	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.I3130N|RYR2_ENST00000360064.6_Missense_Mutation_p.I3144N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3146					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.I3144N(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGCAAGAGTATTTACGTGGAG	0.323																																							uc001hyl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(9436-9438)ATT>AAT		cardiac muscle ryanodine receptor							116.0	105.0	109.0					1																	237865347		1810	4077	5887	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237865347T>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.9437T>A	1.37:g.237865347T>A	ENSP00000355533:p.Ile3146Asn					RYR2_uc010pxz.1_Missense_Mutation_p.I101N	p.I3146N	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		66	9557	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3146					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.9437T>A	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.627974	0.66901	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288;ENST00000540213	T;T;T	0.64085	-0.08;1.42;-0.08	4.83	4.83	0.62350	.	0.000000	0.64402	U	0.000007	T	0.67776	0.2929	M	0.68952	2.095	0.80722	D	1	D	0.60575	0.988	P	0.49528	0.614	T	0.72600	-0.4244	10	0.56958	D	0.05	.	14.6861	0.69049	0.0:0.0:0.0:1.0	.	3146	Q92736	RYR2_HUMAN	N	3146;3144;3130;101;141	ENSP00000355533:I3146N;ENSP00000353174:I3144N;ENSP00000443798:I3130N	ENSP00000353174:I3144N	I	+	2	0	RYR2	235931970	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.153000	0.58118	1.920000	0.55613	0.467000	0.42956	ATT		0.323	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		10	19	0	0	0	0.006214	0	10	19				
FMN2	56776	broad.mit.edu	37	1	240371044	240371044	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:240371044C>A	ENST00000319653.9	+	5	3162	c.2932C>A	c.(2932-2934)Cca>Aca	p.P978T		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	978	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.P1121T(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AATACCTCCTCCACCCCCTCT	0.716																																							uc010pyd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(2932-2934)CCA>ACA		formin 2							20.0	22.0	21.0					1																	240371044		2200	4288	6488	SO:0001583	missense	56776				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding	g.chr1:240371044C>A	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2932C>A	1.37:g.240371044C>A	ENSP00000318884:p.Pro978Thr					FMN2_uc010pye.1_Missense_Mutation_p.P982T	p.P978T	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)		5	3157	+	Ovarian(103;0.127)	all_cancers(173;0.013)	978			Pro-rich.|FH1.		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	c.2932C>A	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	6.616	0.482160	0.12581	.	.	ENSG00000155816	ENST00000319653	T	0.65364	-0.15	3.82	0.621	0.17643	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (1);	.	.	.	.	T	0.66790	0.2825	M	0.75884	2.315	0.28499	N	0.914108	P	0.48998	0.918	P	0.49192	0.602	T	0.61642	-0.7021	8	.	.	.	.	10.5916	0.45312	0.1331:0.4338:0.433:0.0	.	978	Q9NZ56	FMN2_HUMAN	T	978	ENSP00000318884:P978T	.	P	+	1	0	FMN2	238437667	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-0.132000	0.10467	0.049000	0.15920	-0.550000	0.04213	CCA		0.716	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352		5	21	1	0	3.86212e-05	0.008291	4.26201e-05	5	21				
RGS7	6000	broad.mit.edu	37	1	241094038	241094038	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:241094038C>A	ENST00000407727.1	-	5	363	c.364G>T	c.(364-366)Gag>Tag	p.E122*	RGS7_ENST00000401882.1_Intron|RGS7_ENST00000366564.1_Nonsense_Mutation_p.E122*|RGS7_ENST00000331110.7_Nonsense_Mutation_p.E96*|RGS7_ENST00000366565.1_Nonsense_Mutation_p.E122*|RGS7_ENST00000366562.4_Nonsense_Mutation_p.E122*|RGS7_ENST00000348120.2_Intron|RGS7_ENST00000446183.2_Nonsense_Mutation_p.E38*|RGS7_ENST00000366563.1_Nonsense_Mutation_p.E122*			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	122					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.E122*(4)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TTTTCCGGCTCCCAACAATTT	0.388																																							uc001hyv.2		NA																	4	Substitution - Nonsense(4)		lung(4)	ovary(4)|skin(2)|kidney(1)	7						c.(364-366)GAG>TAG		regulator of G-protein signaling 7							124.0	137.0	133.0					1																	241094038		2203	4300	6503	SO:0001587	stop_gained	6000				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity	g.chr1:241094038C>A	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.364G>T	1.37:g.241094038C>A	ENSP00000384428:p.Glu122*					RGS7_uc010pyh.1_Nonsense_Mutation_p.E96*|RGS7_uc010pyj.1_Nonsense_Mutation_p.E38*|RGS7_uc001hyu.2_Nonsense_Mutation_p.E122*|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Nonsense_Mutation_p.E122*	p.E122*	NM_002924	NP_002915	P49802	RGS7_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.027)		6	694	-		all_cancers(173;0.0131)	122					Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Nonsense_Mutation	SNP	ENST00000407727.1	37	c.364G>T		.	.	.	.	.	.	.	.	.	.	C	41	8.924745	0.99004	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000446183;ENST00000366562;ENST00000407727	.	.	.	5.83	4.92	0.64577	.	0.053442	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-8.9562	12.4923	0.55907	0.0:0.9233:0.0:0.0767	.	.	.	.	X	96;122;122;122;38;122;122	.	ENSP00000331485:E96X	E	-	1	0	RGS7	239160661	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.126000	0.77201	1.481000	0.48307	-0.150000	0.13652	GAG		0.388	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924		39	193	1	0	6.68952e-21	0.013114	1.11035e-20	39	193				
AHCTF1	25909	broad.mit.edu	37	1	247025359	247025359	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:247025359C>G	ENST00000391829.2	-	28	3760	c.3637G>C	c.(3637-3639)Gca>Cca	p.A1213P	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000366508.1_Missense_Mutation_p.A1248P|AHCTF1_ENST00000326225.3_Missense_Mutation_p.A1222P			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1213	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A1213P(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GAGGGAGATGCTAAAGGTGTT	0.433																																					Colon(145;197 1800 4745 15099 26333)	Colon(145;197 1800 4745 15099 26333)	uc001ibu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(2)	7						c.(3637-3639)GCA>CCA		transcription factor ELYS							66.0	66.0	66.0					1																	247025359		2202	4280	6482	SO:0001583	missense	25909				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding	g.chr1:247025359C>G		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3637G>C	1.37:g.247025359C>G	ENSP00000375705:p.Ala1213Pro					AHCTF1_uc001ibv.1_Missense_Mutation_p.A1222P|AHCTF1_uc009xgs.1_Missense_Mutation_p.A74P|AHCTF1_uc001ibw.1_RNA	p.A1213P	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00271)		27	3644	-	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	1213			Necessary for nuclear localization (By similarity).		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37	c.3637G>C		.	.	.	.	.	.	.	.	.	.	C	9.746	1.166292	0.21621	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.38887	1.11;1.12;1.12	5.86	4.95	0.65309	.	0.508622	0.20603	N	0.089102	T	0.30070	0.0753	N	0.16656	0.425	0.39804	D	0.972614	B;B;B	0.23249	0.082;0.015;0.009	B;B;B	0.22601	0.04;0.009;0.004	T	0.08066	-1.0740	10	0.37606	T	0.19	-4.7992	15.2315	0.73395	0.0:0.8517:0.1483:0.0	.	74;1248;1213	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	P	1248;1222;1213	ENSP00000355464:A1248P;ENSP00000355465:A1222P;ENSP00000375705:A1213P	ENSP00000355465:A1222P	A	-	1	0	AHCTF1	245091982	0.999000	0.42202	0.837000	0.33122	0.037000	0.13140	3.349000	0.52217	1.473000	0.48159	0.650000	0.86243	GCA		0.433	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446		44	58	0	0	0	0.00874	0	44	58				
VN1R5	317705	broad.mit.edu	37	1	247420349	247420349	+	IGR	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:247420349C>A								RP11-488L18.8 (15224 upstream) : Y_RNA (37787 downstream)																							TGCTGATAACCAAATATTCAA	0.378																																						GBM(98;63 1399 4825 21305 33017)	uc010pyu.1		NA																	0					0						c.(976-978)CAA>AAA		vomeronasal 1 receptor 5							61.0	57.0	58.0					1																	247420349		1872	4103	5975	SO:0001628	intergenic_variant	317705				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity	g.chr1:247420349C>A																													1.37:g.247420349C>A							p.Q326K	NM_173858	NP_776257	Q7Z5H4	VN1R5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00854)		2	976	+	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	326			Cytoplasmic (Potential).			Missense_Mutation	SNP		37	c.976C>A																																																																																				0	0.378									23	98	1	0	2.89027e-11	0.014323	3.90186e-11	23	98				
OR2G3	81469	broad.mit.edu	37	1	247769612	247769612	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:247769612C>A	ENST00000320002.2	+	1	757	c.725C>A	c.(724-726)tCc>tAc	p.S242Y	RP11-978I15.10_ENST00000435333.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S242Y(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGCACCTGCTCCTCCCACCTT	0.483																																							uc010pyz.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(724-726)TCC>TAC		olfactory receptor, family 2, subfamily G,							143.0	128.0	133.0					1																	247769612		2203	4300	6503	SO:0001583	missense	81469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247769612C>A	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.725C>A	1.37:g.247769612C>A	ENSP00000326301:p.Ser242Tyr						p.S242Y	NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	725	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		242			Helical; Name=6; (Potential).		B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	ENST00000320002.2	37	c.725C>A	CCDS31093.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680426	0.47886	.	.	ENSG00000177476	ENST00000320002	T	0.38401	1.14	3.65	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.210003	0.23300	U	0.049698	T	0.64382	0.2593	H	0.96333	3.805	0.22185	N	0.999304	D	0.55605	0.972	D	0.64042	0.921	T	0.57382	-0.7821	10	0.87932	D	0	.	6.9441	0.24508	0.0:0.7184:0.1762:0.1055	.	242	Q8NGZ4	OR2G3_HUMAN	Y	242	ENSP00000326301:S242Y	ENSP00000326301:S242Y	S	+	2	0	OR2G3	245836235	0.000000	0.05858	0.996000	0.52242	0.892000	0.51952	0.080000	0.14802	0.290000	0.22444	0.492000	0.49549	TCC		0.483	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1			15	47	1	0	1.52009e-12	0.003163	2.13763e-12	15	47				
OR1C1	26188	broad.mit.edu	37	1	247921471	247921471	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:247921471G>T	ENST00000408896.2	-	1	511	c.238C>A	c.(238-240)Caa>Aaa	p.Q80K		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	80					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q80K(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			ACTACCATTTGGGGGACTGTA	0.463																																							uc010pza.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(238-240)CAA>AAA		olfactory receptor, family 1, subfamily C,							67.0	63.0	64.0					1																	247921471		2023	4188	6211	SO:0001583	missense	26188				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247921471G>T	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.238C>A	1.37:g.247921471G>T	ENSP00000386138:p.Gln80Lys						p.Q80K	NM_012353	NP_036485	Q15619	OR1C1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	238	-	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	80			Extracellular (Potential).		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	37	c.238C>A	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.867587	0.00063	.	.	ENSG00000221888	ENST00000408896	T	0.03035	4.07	2.92	-1.27	0.09347	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00906	0.0030	N	0.00237	-1.79	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.46317	-0.9200	9	0.02654	T	1	.	11.3706	0.49697	0.0:0.0:0.2151:0.7848	.	80	Q15619	OR1C1_HUMAN	K	80	ENSP00000386138:Q80K	ENSP00000386138:Q80K	Q	-	1	0	OR1C1	245988094	0.045000	0.20229	0.024000	0.17045	0.019000	0.09904	1.678000	0.37586	-0.007000	0.14345	-0.311000	0.09066	CAA		0.463	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1			12	43	1	0	9.31168e-06	0.001855	1.06532e-05	12	43				
TRIM58	25893	broad.mit.edu	37	1	248039358	248039358	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:248039358C>T	ENST00000366481.3	+	6	1076	c.1028C>T	c.(1027-1029)tCa>tTa	p.S343L	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	343	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S343L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGCTTCTCATCAGGGAGGCAT	0.562																																							uc001ido.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7						c.(1027-1029)TCA>TTA		tripartite motif-containing 58							112.0	98.0	103.0					1																	248039358		2203	4300	6503	SO:0001583	missense	25893					intracellular	zinc ion binding	g.chr1:248039358C>T	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1028C>T	1.37:g.248039358C>T	ENSP00000355437:p.Ser343Leu					OR2W3_uc001idp.1_Intron	p.S343L	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		6	1076	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	343			B30.2/SPRY.		Q6B0H9	Missense_Mutation	SNP	ENST00000366481.3	37	c.1028C>T	CCDS1636.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.108899	0.56398	.	.	ENSG00000162722	ENST00000366481	T	0.68479	-0.33	3.96	3.96	0.45880	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.48767	D	0.000173	D	0.86648	0.5983	H	0.96175	3.78	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.90541	0.4502	10	0.87932	D	0	.	14.3373	0.66600	0.0:1.0:0.0:0.0	.	343	Q8NG06	TRI58_HUMAN	L	343	ENSP00000355437:S343L	ENSP00000355437:S343L	S	+	2	0	TRIM58	246105981	0.333000	0.24731	0.074000	0.20217	0.067000	0.16453	2.149000	0.42244	2.512000	0.84698	0.585000	0.79938	TCA		0.562	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431		8	80	0	0	0	0.00308	0	8	80				
OR2T8	343172	broad.mit.edu	37	1	248084593	248084593	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:248084593C>A	ENST00000319968.4	+	1	274	c.274C>A	c.(274-276)Cgc>Agc	p.R92S		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R92S(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGCCATCTCCCGCGCTGGCTG	0.582																																							uc010pzc.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(274-276)CGC>AGC		olfactory receptor, family 2, subfamily T,							19.0	16.0	17.0					1																	248084593		2098	4088	6186	SO:0001583	missense	343172				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248084593C>A		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.274C>A	1.37:g.248084593C>A	ENSP00000326225:p.Arg92Ser						p.R92S	NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		1	274	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	92			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000319968.4	37	c.274C>A	CCDS31100.1	.	.	.	.	.	.	.	.	.	.	c	8.106	0.777772	0.16120	.	.	ENSG00000177462	ENST00000319968	T	0.00384	7.6	3.81	-1.83	0.07833	GPCR, rhodopsin-like superfamily (1);	1.057770	0.07557	U	0.916397	T	0.00178	0.0005	N	0.10972	0.075	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.24621	-1.0155	10	0.56958	D	0.05	.	8.9741	0.35924	0.0:0.401:0.0:0.599	.	92	A6NH00	OR2T8_HUMAN	S	92	ENSP00000326225:R92S	ENSP00000326225:R92S	R	+	1	0	OR2T8	246151216	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.201000	0.03026	-0.244000	0.09639	-0.199000	0.12753	CGC		0.582	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096862.1	NM_001005522		16	17	1	0	5.60225e-13	0.009535	7.96109e-13	16	17				
OR2L8	391190	broad.mit.edu	37	1	248112520	248112520	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:248112520C>T	ENST00000357191.3	+	1	361	c.361C>T	c.(361-363)Cgt>Tgt	p.R121C	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R121C(2)|p.R121S(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GGCCTATGATCGTTACATTGC	0.443																																							uc001idt.1		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|skin(1)	2						c.(361-363)CGT>TGT		olfactory receptor, family 2, subfamily L,							303.0	257.0	273.0					1																	248112520		2203	4300	6503	SO:0001583	missense	391190				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248112520C>T	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.361C>T	1.37:g.248112520C>T	ENSP00000349719:p.Arg121Cys					OR2L13_uc001ids.2_Intron	p.R121C	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	361	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		121			Cytoplasmic (Potential).		Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	c.361C>T	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	9.405	1.078897	0.20227	.	.	ENSG00000196936	ENST00000357191	T	0.77358	-1.09	1.64	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.540487	0.13896	N	0.355267	T	0.77363	0.4119	M	0.86343	2.81	0.43360	D	0.995436	B	0.34103	0.437	B	0.27170	0.077	T	0.79555	-0.1755	10	0.72032	D	0.01	.	11.1275	0.48328	0.0:1.0:0.0:0.0	.	121	Q8NGY9	OR2L8_HUMAN	C	121	ENSP00000349719:R121C	ENSP00000349719:R121C	R	+	1	0	OR2L8	246179143	0.522000	0.26266	0.049000	0.19019	0.036000	0.12997	0.737000	0.26144	0.905000	0.36596	0.479000	0.44913	CGT		0.443	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2			33	322	0	0	0	0.010818	0	33	322				
OR2L8	391190	broad.mit.edu	37	1	248112648	248112648	+	Silent	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:248112648C>T	ENST00000357191.3	+	1	489	c.489C>T	c.(487-489)ctC>ctT	p.L163L	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L163L(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TATATGTACTCCATATTCCTT	0.478																																							uc001idt.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(487-489)CTC>CTT		olfactory receptor, family 2, subfamily L,							220.0	150.0	174.0					1																	248112648		2203	4300	6503	SO:0001819	synonymous_variant	391190				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248112648C>T	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.489C>T	1.37:g.248112648C>T						OR2L13_uc001ids.2_Intron	p.L163L	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	489	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		163			Extracellular (Potential).		Q6IF03	Silent	SNP	ENST00000357191.3	37	c.489C>T	CCDS31101.1																																																																																				0.478	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2			19	154	0	0	0	0.008871	0	19	154				
OR2AK2	391191	broad.mit.edu	37	1	248129213	248129213	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:248129213T>A	ENST00000366480.3	+	1	679	c.580T>A	c.(580-582)Tgt>Agt	p.C194S	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C194S(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CCACTTTTTCTGTGAAGTTCC	0.433																																					Melanoma(45;390 1181 23848 28461 41504)	Melanoma(45;390 1181 23848 28461 41504)	uc010pzd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(580-582)TGT>AGT		olfactory receptor, family 2, subfamily AK,							103.0	91.0	95.0					1																	248129213		2203	4300	6503	SO:0001583	missense	391191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248129213T>A	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.580T>A	1.37:g.248129213T>A	ENSP00000355436:p.Cys194Ser					OR2L13_uc001ids.2_Intron	p.C194S	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		1	580	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		194			Extracellular (Potential).		B2RND1|Q6IF05	Missense_Mutation	SNP	ENST00000366480.3	37	c.580T>A	CCDS31102.1	.	.	.	.	.	.	.	.	.	.	.	16.36	3.100662	0.56183	.	.	ENSG00000187080	ENST00000366480	T	0.62364	0.03	2.89	2.89	0.33648	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.85128	0.5626	H	0.98005	4.125	0.30598	N	0.760871	D	0.89917	1.0	D	0.91635	0.999	T	0.83084	-0.0136	9	0.72032	D	0.01	.	10.2894	0.43586	0.0:0.0:0.0:1.0	.	194	Q8NG84	O2AK2_HUMAN	S	194	ENSP00000355436:C194S	ENSP00000355436:C194S	C	+	1	0	OR2AK2	246195836	1.000000	0.71417	0.022000	0.16811	0.202000	0.24057	3.609000	0.54117	1.311000	0.45024	0.374000	0.22700	TGT		0.433	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	NM_001004491		48	44	0	0	0	0.01441	0	48	44				
OR2L13	284521	broad.mit.edu	37	1	248263110	248263111	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:248263110_248263111GG>TT	ENST00000358120.2	+	2	578_579	c.433_434GG>TT	c.(433-435)GGa>TTa	p.G145L	OR2L13_ENST00000366478.2_Missense_Mutation_p.G145L			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			GAAGATGATTGGAGGCTCTTGG	0.485																																							uc001ids.2		NA																	0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(433-435)GGA>TTA		olfactory receptor, family 2, subfamily L,																																				SO:0001583	missense	284521				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding	g.chr1:248263110_248263111GG>TT	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	Exception_encountered	1.37:g.248263110_248263111delinsTT	ENSP00000350836:p.Gly145Leu						p.G145L	NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0132)		3	770_771	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		145			Helical; Name=4; (Potential).		Q5VUR5	Missense_Mutation	DNP	ENST00000358120.2	37	c.433_434GG>TT	CCDS1637.1																																																																																				0.485	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911		82	275	0	0	0	0.004672	0	82	275				
TUBB8	347688	broad.mit.edu	37	10	93393	93393	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr10:93393C>A	ENST00000309812.4	-	4	1001	c.939G>T	c.(937-939)gcG>gcT	p.A313A	TUBB8_ENST00000413237.3_5'Flank|TUBB8_ENST00000447903.2_Silent_p.A241A	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	313					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.A313A(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		AAATGGCAGCCGCCGTTAGGT	0.537																																					Pancreas(192;2041 3010 9013 18103)	Pancreas(192;2041 3010 9013 18103)	uc001ifi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(937-939)GCG>GCT		tubulin, beta 8 isoform 1							54.0	68.0	63.0					10																	93393		1979	3862	5841	SO:0001819	synonymous_variant	347688				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr10:93393C>A	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.939G>T	10.37:g.93393C>A						TUBB8_uc009xhe.2_Silent_p.A276A|TUBB8_uc010pzs.1_Silent_p.A241A	p.A313A	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)	4	939	-		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)	313					Q5SQX9|Q8WZ78	Silent	SNP	ENST00000309812.4	37	c.939G>T	CCDS7051.1																																																																																				0.537	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987		54	33	1	0	2.14255e-21	0.01441	3.58567e-21	54	33				
CUBN	8029	broad.mit.edu	37	10	17146427	17146427	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr10:17146427G>A	ENST00000377833.4	-	12	1473	c.1408C>T	c.(1408-1410)Cct>Tct	p.P470S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	470					cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.P470S(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCTTGCTGAGGAACCTGACAG	0.488																																							uc001ioo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(1408-1410)CCT>TCT		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						118.0	90.0	99.0					10																	17146427		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:17146427G>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1408C>T	10.37:g.17146427G>A	ENSP00000367064:p.Pro470Ser						p.P470S	NM_001081	NP_001072	O60494	CUBN_HUMAN			12	1460	-			470					B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.1408C>T	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	9.876	1.200277	0.22121	.	.	ENSG00000107611	ENST00000377833	T	0.60171	0.21	5.45	2.51	0.30379	.	0.148628	0.31589	N	0.007387	T	0.34048	0.0884	N	0.20845	0.615	0.80722	D	1	B	0.32693	0.38	B	0.27887	0.084	T	0.05338	-1.0891	10	0.16896	T	0.51	.	8.2314	0.31601	0.1425:0.3928:0.4646:0.0	.	470	O60494	CUBN_HUMAN	S	470	ENSP00000367064:P470S	ENSP00000367064:P470S	P	-	1	0	CUBN	17186433	1.000000	0.71417	0.967000	0.41034	0.322000	0.28314	3.240000	0.51368	0.255000	0.21593	-0.175000	0.13238	CCT		0.488	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		11	25	0	0	0	0.013537	0	11	25				
NSUN6	221078	broad.mit.edu	37	10	18931430	18931430	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr10:18931430A>T	ENST00000377304.4	-	3	704	c.286T>A	c.(286-288)Tta>Ata	p.L96I	RP11-139J15.7_ENST00000606425.1_Missense_Mutation_p.L84I	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	96							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.L96I(1)		endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						GGAATAAGTAACACATCTTGA	0.308																																							uc010qcp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(286-288)TTA>ATA		NOL1/NOP2/Sun domain family, member 6							140.0	145.0	144.0					10																	18931430		2203	4299	6502	SO:0001583	missense	221078						methyltransferase activity|RNA binding	g.chr10:18931430A>T	BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.286T>A	10.37:g.18931430A>T	ENSP00000366519:p.Leu96Ile						p.L96I	NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN			3	704	-			96					B0YJ54	Missense_Mutation	SNP	ENST00000377304.4	37	c.286T>A	CCDS7130.1	.	.	.	.	.	.	.	.	.	.	A	18.96	3.733571	0.69189	.	.	ENSG00000241058	ENST00000377304	T	0.35421	1.31	5.58	-2.24	0.06909	.	0.000000	0.85682	D	0.000000	T	0.37348	0.1000	M	0.78916	2.43	0.53688	D	0.99997	P	0.46220	0.874	P	0.45138	0.471	T	0.41270	-0.9518	10	0.21540	T	0.41	.	11.0188	0.47705	0.5698:0.0:0.4301:0.0	.	96	Q8TEA1	NSUN6_HUMAN	I	96	ENSP00000366519:L96I	ENSP00000366519:L96I	L	-	1	2	NSUN6	18971436	0.993000	0.37304	0.828000	0.32881	0.952000	0.60782	1.302000	0.33459	-0.407000	0.07576	-0.371000	0.07208	TTA		0.308	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047083.1	NM_182543		34	67	0	0	0	0.003755	0	34	67				
PARD3	56288	broad.mit.edu	37	10	34400396	34400396	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr10:34400396T>A	ENST00000374789.3	-	25	4097	c.3772A>T	c.(3772-3774)Agg>Tgg	p.R1258W	PARD3_ENST00000545260.1_Missense_Mutation_p.R1168W|PARD3_ENST00000346874.4_Missense_Mutation_p.R1221W|PARD3_ENST00000374788.3_Missense_Mutation_p.R1255W|PARD3_ENST00000374790.3_Missense_Mutation_p.R1198W|PARD3_ENST00000350537.4_Missense_Mutation_p.R1212W|PARD3_ENST00000545693.1_Missense_Mutation_p.R1242W|PARD3_ENST00000374794.3_Missense_Mutation_p.R1146W	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	1258					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.R1258W(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CTGGAGTACCTGGGGTTCTCT	0.572																																							uc010qej.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(3772-3774)AGG>TGG		partitioning-defective protein 3 homolog							71.0	72.0	72.0					10																	34400396		2203	4300	6503	SO:0001583	missense	56288				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chr10:34400396T>A	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.3772A>T	10.37:g.34400396T>A	ENSP00000363921:p.Arg1258Trp					PARD3_uc010qek.1_Missense_Mutation_p.R1255W|PARD3_uc010qel.1_Missense_Mutation_p.R1221W|PARD3_uc010qem.1_Missense_Mutation_p.R1242W|PARD3_uc010qen.1_Missense_Mutation_p.R1212W|PARD3_uc010qeo.1_Missense_Mutation_p.R1175W|PARD3_uc010qep.1_Missense_Mutation_p.R1168W|PARD3_uc010qeq.1_Missense_Mutation_p.R1146W|uc001ixe.1_5'Flank	p.R1258W	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN			25	3772	-		Breast(68;0.0707)	1258					F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	c.3772A>T	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.053787	0.75960	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790	T;T;T;T;T;T;T;T	0.37752	1.8;1.63;1.89;1.89;1.21;1.18;1.63;1.82	5.87	-8.54	0.00912	.	0.047960	0.64402	D	0.000001	T	0.51550	0.1681	L	0.55481	1.735	0.54753	D	0.999981	D;D;D;D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;1.0;1.0;1.0;1.0	D;P;D;D;D;D;D;D	0.91635	0.999;0.891;0.999;0.999;0.999;0.999;0.999;0.997	T	0.66787	-0.5835	10	0.66056	D	0.02	.	23.6449	0.99984	0.0:0.0:0.7752:0.2248	.	1146;1168;1175;1212;1242;1221;1255;1258	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0	.;.;.;.;.;.;.;PARD3_HUMAN	W	1242;1168;1258;1255;1221;1146;1212;1198	ENSP00000443147:R1242W;ENSP00000440857:R1168W;ENSP00000363921:R1258W;ENSP00000363920:R1255W;ENSP00000340591:R1221W;ENSP00000363926:R1146W;ENSP00000311986:R1212W;ENSP00000363922:R1198W	ENSP00000340591:R1221W	R	-	1	2	PARD3	34440402	0.962000	0.33011	0.750000	0.31169	0.987000	0.75469	-0.048000	0.11944	-1.149000	0.02843	-1.243000	0.01532	AGG		0.572	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619		60	28	0	0	0	0.01441	0	60	28				
ANKRD30A	91074	broad.mit.edu	37	10	37433954	37433954	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr10:37433954G>A	ENST00000602533.1	+	8	1356	c.1257G>A	c.(1255-1257)gaG>gaA	p.E419E	ANKRD30A_ENST00000374660.1_Silent_p.E419E|ANKRD30A_ENST00000361713.1_Silent_p.E419E			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	475					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E419E(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CCAAACAAGAGGAAGATGAAG	0.259																																							uc001iza.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(7)|breast(1)|skin(1)	9						c.(1255-1257)GAG>GAA		ankyrin repeat domain 30A							113.0	109.0	110.0					10																	37433954		1780	4064	5844	SO:0001819	synonymous_variant	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37433954G>A	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1257G>A	10.37:g.37433954G>A							p.E419E	NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN			8	1356	+			475					Q5W025	Silent	SNP	ENST00000602533.1	37	c.1257G>A																																																																																					0.259	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		61	33	0	0	0	0.01441	0	61	33				
AGAP12P	414224	broad.mit.edu	37	10	49218553	49218553	+	IGR	SNP	T	T	C	rs77581903		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr10:49218553T>C								FAM25C (10735 upstream) : RNA5SP315 (29922 downstream)																							ATATTTGGAATGGATCCAGCG	0.567																																							uc001jgd.2		NA																	0					NA						c.(1585-1587)CAT>CGT		RecName: Full=Arf-GAP, GTPase, ANK repeat and PH domain-containing protein 11; AltName: Full=Centaurin-gamma-like protein KIAA1975;																																				SO:0001628	intergenic_variant	0							g.chr10:49218553T>C																													10.37:g.49218553T>C						uc001jge.1_5'Flank	p.H529R							8	1745	-									Missense_Mutation	SNP		37	c.1586A>G																																																																																				0	0.567									6	12	0	0	0	0.001984	0	6	12				
PNLIPRP3	119548	broad.mit.edu	37	10	118202626	118202626	+	Silent	SNP	C	C	A	rs369740447		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr10:118202626C>A	ENST00000369230.3	+	3	410	c.264C>A	c.(262-264)atC>atA	p.I88I		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	88					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.I88I(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		CAGACAAGATCACCCGTATCA	0.383																																							uc001lcl.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(262-264)ATC>ATA		pancreatic lipase-related protein 3 precursor							105.0	95.0	98.0					10																	118202626		2203	4300	6503	SO:0001819	synonymous_variant	119548				lipid catabolic process	extracellular region	triglyceride lipase activity	g.chr10:118202626C>A	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.264C>A	10.37:g.118202626C>A							p.I88I	NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN		all cancers(201;0.0131)	3	365	+			88						Silent	SNP	ENST00000369230.3	37	c.264C>A	CCDS31292.1																																																																																				0.383	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404		31	16	1	0	2.81731e-10	0.010818	3.66885e-10	31	16				
MRGPRE	116534	broad.mit.edu	37	11	3249776	3249776	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:3249776A>C	ENST00000389832.5	-	2	560	c.254T>G	c.(253-255)cTg>cGg	p.L85R	MRGPRE_ENST00000436689.2_Missense_Mutation_p.L84R|AC109309.4_ENST00000418995.2_RNA			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L84R(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCGGCCTTGCAGCAAGTCGGG	0.627																																							uc001lxq.3		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(250-252)CTG>CGG		MAS-related GPR, member E							54.0	66.0	62.0					11																	3249776		2146	4256	6402	SO:0001583	missense	116534					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:3249776A>C	AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.254T>G	11.37:g.3249776A>C	ENSP00000374482:p.Leu85Arg						p.L84R	NM_001039165	NP_001034254	Q86SM8	MRGRE_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)	2	561	-		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)	84			Extracellular (Potential).		Q2M1V7	Missense_Mutation	SNP	ENST00000389832.5	37	c.251T>G		.	.	.	.	.	.	.	.	.	.	a	13.56	2.274412	0.40194	.	.	ENSG00000184350	ENST00000436689;ENST00000389832	T	0.11169	2.8	3.62	1.04	0.20106	GPCR, rhodopsin-like superfamily (1);	0.513979	0.14203	U	0.334553	T	0.18964	0.0455	L	0.47190	1.495	0.09310	N	1	D	0.65815	0.995	D	0.70227	0.968	T	0.08086	-1.0739	10	0.48119	T	0.1	-4.0077	3.9953	0.09556	0.7066:0.0:0.1109:0.1825	.	84	Q86SM8	MRGRE_HUMAN	R	85;84	ENSP00000374482:L84R	ENSP00000374482:L84R	L	-	2	0	MRGPRE	3206352	0.001000	0.12720	0.004000	0.12327	0.018000	0.09664	1.456000	0.35201	0.462000	0.27095	0.477000	0.44152	CTG		0.627	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000032346.5	XM_171536		25	32	0	0	0	0.005443	0	25	32				
OR51D1	390038	broad.mit.edu	37	11	4661295	4661295	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:4661295C>A	ENST00000357605.2	+	1	351	c.275C>A	c.(274-276)cCc>cAc	p.P92H		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P92H(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATCACCATGCCCAAGATGGCC	0.527																																							uc010qyk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(274-276)CCC>CAC		olfactory receptor, family 51, subfamily D,							154.0	119.0	131.0					11																	4661295		2201	4298	6499	SO:0001583	missense	390038				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4661295C>A	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.275C>A	11.37:g.4661295C>A	ENSP00000350222:p.Pro92His						p.P92H	NM_001004751	NP_001004751	Q8NGF3	O51D1_HUMAN		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	275	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	92			Extracellular (Potential).		B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	37	c.275C>A	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664307	0.47572	.	.	ENSG00000197428	ENST00000357605	T	0.25749	1.78	4.62	4.62	0.57501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44688	D	0.000432	T	0.63931	0.2553	H	0.95365	3.66	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.76383	-0.2979	10	0.87932	D	0	.	16.5415	0.84386	0.0:1.0:0.0:0.0	.	92	Q8NGF3	O51D1_HUMAN	H	92	ENSP00000350222:P92H	ENSP00000350222:P92H	P	+	2	0	OR51D1	4617871	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	4.611000	0.61162	2.536000	0.85505	0.563000	0.77884	CCC		0.527	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751		27	38	1	0	2.79863e-10	0.004656	3.66885e-10	27	38				
CCKBR	887	broad.mit.edu	37	11	6291448	6291448	+	Silent	SNP	G	G	T	rs201539336		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:6291448G>T	ENST00000334619.2	+	3	727	c.534G>T	c.(532-534)acG>acT	p.T178T	CCKBR_ENST00000532715.1_Silent_p.T94T|CCKBR_ENST00000525462.1_Silent_p.T178T|CCKBR_ENST00000525014.1_3'UTR	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	178					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.T178T(2)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TTGTAGCCACGTGGCTGCTGT	0.657																																							uc001mcp.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(5)|ovary(2)|breast(1)	8						c.(532-534)ACG>ACT		cholecystokinin B receptor	Pentagastrin(DB00183)						53.0	43.0	47.0					11																	6291448		2201	4296	6497	SO:0001819	synonymous_variant	887				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding	g.chr11:6291448G>T	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.534G>T	11.37:g.6291448G>T						CCKBR_uc001mcq.2_Silent_p.T106T|CCKBR_uc001mcr.2_Silent_p.T178T|CCKBR_uc001mcs.2_Silent_p.T178T	p.T178T	NM_176875	NP_795344	P32239	GASR_HUMAN		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	3	727	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	178			Helical; Name=4; (Potential).		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Silent	SNP	ENST00000334619.2	37	c.534G>T	CCDS7761.1																																																																																				0.657	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875		24	21	1	0	2.41591e-17	0.004656	3.76998e-17	24	21				
INSC	387755	broad.mit.edu	37	11	15243094	15243094	+	Silent	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:15243094T>A	ENST00000379554.3	+	8	1078	c.1032T>A	c.(1030-1032)gcT>gcA	p.A344A	INSC_ENST00000424273.1_Silent_p.A255A|INSC_ENST00000379556.3_Silent_p.A297A|INSC_ENST00000525218.1_Silent_p.A255A|INSC_ENST00000447214.2_3'UTR|INSC_ENST00000530161.1_Silent_p.A297A|INSC_ENST00000528567.1_Silent_p.A297A	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	344					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)		p.A344A(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						GGGCTGAGGCTGCGGCTGTGG	0.637																																							uc001mly.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						c.(1030-1032)GCT>GCA		inscuteable isoform a							51.0	58.0	56.0					11																	15243094		2131	4230	6361	SO:0001819	synonymous_variant	387755				cell differentiation|nervous system development	cytoplasm	binding	g.chr11:15243094T>A	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.1032T>A	11.37:g.15243094T>A						INSC_uc001mlz.2_Silent_p.A297A|INSC_uc001mma.2_Silent_p.A297A|INSC_uc010rcs.1_Silent_p.A332A|INSC_uc001mmb.2_Silent_p.A297A|INSC_uc001mmc.2_Silent_p.A255A	p.A344A	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN			8	1078	+			344					A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Silent	SNP	ENST00000379554.3	37	c.1032T>A	CCDS41621.1																																																																																				0.637	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		35	31	0	0	0	0.003755	0	35	31				
IGSF22	283284	broad.mit.edu	37	11	18731092	18731092	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:18731092C>A	ENST00000513874.1	-	18	2979	c.2840G>T	c.(2839-2841)tGg>tTg	p.W947L	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	846								p.W947L(1)|p.W846L(1)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						GCACTTGGACCACTCCTTTGT	0.562																																							uc009yht.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(2)|kidney(1)	7						c.(2839-2841)TGG>TTG		immunoglobulin superfamily, member 22							89.0	94.0	93.0					11																	18731092		1974	4146	6120	SO:0001583	missense	283284							g.chr11:18731092C>A	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2840G>T	11.37:g.18731092C>A	ENSP00000421191:p.Trp947Leu					IGSF22_uc001mpa.2_RNA	p.W947L	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN			18	3030	-			846			Fibronectin type-III 2.		A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	37	c.2840G>T	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169456	0.78452	.	.	ENSG00000179057	ENST00000513874	T	0.54866	0.55	4.58	3.64	0.41730	.	.	.	.	.	T	0.77018	0.4069	M	0.91249	3.19	0.28030	N	0.934174	D	0.76494	0.999	D	0.83275	0.996	T	0.71490	-0.4577	9	0.72032	D	0.01	.	12.4793	0.55833	0.0:0.8314:0.1686:0.0	.	947	D6RGV7	.	L	947	ENSP00000421191:W947L	ENSP00000322422:W846L	W	-	2	0	IGSF22	18687668	0.993000	0.37304	0.941000	0.38009	0.997000	0.91878	2.728000	0.47319	1.102000	0.41551	0.655000	0.94253	TGG		0.562	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588		36	37	1	0	1.414e-09	0.003755	1.78402e-09	36	37				
SLC17A6	57084	broad.mit.edu	37	11	22387098	22387098	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:22387098T>C	ENST00000263160.3	+	7	1191	c.754T>C	c.(754-756)Ttt>Ctt	p.F252L		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	252					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.F252L(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TGCAGGAAGCTTTGGAATGGT	0.383																																							uc001mqk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(754-756)TTT>CTT		solute carrier family 17 (sodium-dependent							237.0	217.0	224.0					11																	22387098		2203	4300	6503	SO:0001583	missense	57084				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity	g.chr11:22387098T>C	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.754T>C	11.37:g.22387098T>C	ENSP00000263160:p.Phe252Leu						p.F252L	NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN			7	1167	+			252			Helical; (Potential).		A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	c.754T>C	CCDS7856.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.462685	0.63513	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.53423	0.62	5.64	5.64	0.86602	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.093804	0.85682	D	0.000000	T	0.26448	0.0646	N	0.05619	-0.005	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	T	0.16630	-1.0396	10	0.02654	T	1	.	16.1449	0.81559	0.0:0.0:0.0:1.0	.	252	Q9P2U8	VGLU2_HUMAN	L	252;140	ENSP00000263160:F252L	ENSP00000263160:F252L	F	+	1	0	SLC17A6	22343674	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.247000	0.72411	2.269000	0.75478	0.455000	0.32223	TTT		0.383	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346		6	95	0	0	0	0.001168	0	6	95				
BBOX1	8424	broad.mit.edu	37	11	27078781	27078781	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:27078781G>A	ENST00000529202.1	+	3	592	c.253G>A	c.(253-255)Gaa>Aaa	p.E85K	BBOX1_ENST00000525090.1_Missense_Mutation_p.E85K|BBOX1_ENST00000263182.3_Missense_Mutation_p.E85K|BBOX1_ENST00000527505.1_3'UTR|BBOX1_ENST00000528583.1_Missense_Mutation_p.E85K|RP11-1L12.3_ENST00000526061.1_RNA			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	85					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)	p.E85K(1)		breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	GCATTACAGTGAATTCCAGGC	0.403																																							uc001mre.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(253-255)GAA>AAA		gamma-butyrobetaine dioxygenase	Succinic acid(DB00139)|Vitamin C(DB00126)						149.0	151.0	150.0					11																	27078781		2202	4299	6501	SO:0001583	missense	8424				carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr11:27078781G>A	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.253G>A	11.37:g.27078781G>A	ENSP00000435781:p.Glu85Lys					BBOX1_uc009yih.1_Missense_Mutation_p.E85K|BBOX1_uc001mrg.1_Missense_Mutation_p.E85K	p.E85K	NM_003986	NP_003977	O75936	BODG_HUMAN			4	621	+			85					B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	ENST00000529202.1	37	c.253G>A	CCDS7862.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425193	0.43020	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	5.67	3.78	0.43462	.	0.147233	0.64402	D	0.000014	T	0.75583	0.3869	L	0.56769	1.78	0.54753	D	0.999988	B	0.06786	0.001	B	0.04013	0.001	T	0.64394	-0.6418	10	0.06757	T	0.87	.	10.8029	0.46500	0.157:0.0:0.843:0.0	.	85	O75936	BODG_HUMAN	K	85	ENSP00000435781:E85K;ENSP00000263182:E85K;ENSP00000434918:E85K;ENSP00000433772:E85K	ENSP00000263182:E85K	E	+	1	0	BBOX1	27035357	1.000000	0.71417	0.969000	0.41365	0.998000	0.95712	4.321000	0.59209	0.735000	0.32537	0.561000	0.74099	GAA		0.403	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1	NM_003986		19	95	0	0	0	0.00278	0	19	95				
DCDC1	341019	broad.mit.edu	37	11	31287134	31287134	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:31287134C>A	ENST00000452803.1	-	8	1175	c.974G>T	c.(973-975)tGt>tTt	p.C325F	DCDC1_ENST00000597505.1_Missense_Mutation_p.C325F	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	325					intracellular signal transduction (GO:0035556)			p.C325F(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TCTTATTGTACAAGTATCTAA	0.259																																							uc001msv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(973-975)TGT>TTT		doublecortin domain containing 1							34.0	40.0	38.0					11																	31287134		2165	4199	6364	SO:0001583	missense	341019				intracellular signal transduction			g.chr11:31287134C>A	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.974G>T	11.37:g.31287134C>A	ENSP00000389792:p.Cys325Phe					DCDC1_uc001msu.1_5'UTR	p.C325F	NM_181807	NP_861523	P59894	DCDC1_HUMAN			8	1176	-	Lung SC(675;0.225)		325					A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	37	c.974G>T	CCDS7872.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.961689	0.34659	.	.	ENSG00000188682	ENST00000452803	D	0.93763	-3.28	4.36	4.36	0.52297	Doublecortin domain (2);	0.463790	0.17892	N	0.158470	D	0.95367	0.8496	L	0.59436	1.845	0.31552	N	0.658584	D	0.89917	1.0	D	0.91635	0.999	D	0.93744	0.7053	9	.	.	.	-9.2223	13.135	0.59403	0.0:1.0:0.0:0.0	.	325	P59894	DCDC1_HUMAN	F	325	ENSP00000389792:C325F	.	C	-	2	0	DCDC1	31243710	1.000000	0.71417	0.655000	0.29622	0.006000	0.05464	3.767000	0.55288	2.368000	0.80403	0.650000	0.86243	TGT		0.259	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807		12	15	1	0	1.08611e-07	0.010729	1.30915e-07	12	15				
CCDC73	493860	broad.mit.edu	37	11	32663549	32663549	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:32663549T>C	ENST00000335185.5	-	13	1062	c.1019A>G	c.(1018-1020)cAt>cGt	p.H340R	CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	340								p.H340R(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					TGCTTTTTCATGCTCATTTTG	0.249																																							uc001mtv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1018-1020)CAT>CGT		sarcoma antigen NY-SAR-79							77.0	67.0	70.0					11																	32663549		1784	4049	5833	SO:0001583	missense	493860							g.chr11:32663549T>C	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.1019A>G	11.37:g.32663549T>C	ENSP00000335325:p.His340Arg					CCDC73_uc001mtw.1_Missense_Mutation_p.H330R	p.H340R	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN			13	1063	-	Breast(20;0.112)		340			Potential.		Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	c.1019A>G	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.224723	0.58668	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.43	5.43	0.79202	.	0.199983	0.43747	D	0.000539	T	0.74596	0.3737	M	0.63843	1.955	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67382	0.943;0.951	T	0.72561	-0.4256	9	0.29301	T	0.29	.	15.4785	0.75504	0.0:0.0:0.0:1.0	.	330;340	Q6ZRK6-2;Q6ZRK6	.;CCD73_HUMAN	R	340	.	ENSP00000335325:H340R	H	-	2	0	CCDC73	32620125	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.306000	0.59117	2.052000	0.61016	0.383000	0.25322	CAT		0.249	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391		7	26	0	0	0	0.00308	0	7	26				
RAG1	5896	broad.mit.edu	37	11	36594888	36594888	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:36594888A>C	ENST00000299440.5	+	2	146	c.34A>C	c.(34-36)Agt>Cgt	p.S12R		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	12	Interaction with importin alpha-1.				adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S12R(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				CTTGGGACTCAGTTCTGCCCC	0.433									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	uc001mwu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5						c.(34-36)AGT>CGT		recombination activating gene 1							65.0	66.0	66.0					11																	36594888		2202	4298	6500	SO:0001583	missense	5896	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:36594888A>C	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.34A>C	11.37:g.36594888A>C	ENSP00000299440:p.Ser12Arg					RAG1_uc001mwt.2_RNA	p.S12R	NM_000448	NP_000439	P15918	RAG1_HUMAN			2	158	+	all_lung(20;0.226)	all_hematologic(20;0.107)	12			Interaction with importin alpha-1.		E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	37	c.34A>C	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	A	13.13	2.146658	0.37923	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	T;T	0.72615	-0.67;-0.67	6.14	4.97	0.65823	.	0.532223	0.21271	N	0.077301	T	0.50034	0.1592	N	0.14661	0.345	0.39287	D	0.964668	B	0.02656	0.0	B	0.04013	0.001	T	0.49606	-0.8922	10	0.33940	T	0.23	.	7.3702	0.26798	0.7115:0.1473:0.0:0.1412	.	12	P15918	RAG1_HUMAN	R	12	ENSP00000434610:S12R;ENSP00000299440:S12R	ENSP00000299440:S12R	S	+	1	0	RAG1	36551464	0.985000	0.35326	1.000000	0.80357	0.972000	0.66771	1.297000	0.33400	2.367000	0.80283	0.529000	0.55759	AGT		0.433	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448		6	69	0	0	0	0.001168	0	6	69				
OR4C15	81309	broad.mit.edu	37	11	55322373	55322373	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:55322373G>A	ENST00000314644.2	+	1	591	c.591G>A	c.(589-591)ctG>ctA	p.L197L		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L197L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						GTGGCATTCTGATGGGGGTAG	0.473										HNSCC(20;0.049)																													uc010rig.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(589-591)CTG>CTA		olfactory receptor, family 4, subfamily C,							96.0	93.0	94.0					11																	55322373		2201	4296	6497	SO:0001819	synonymous_variant	81309				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55322373G>A	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.591G>A	11.37:g.55322373G>A		HNSCC(20;0.049)					p.L197L	NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN			1	591	+			143			Helical; Name=4; (Potential).		Q6IFE2	Silent	SNP	ENST00000314644.2	37	c.591G>A	CCDS31501.1																																																																																				0.473	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920		37	40	0	0	0	0.005524	0	37	40				
OR8I2	120586	broad.mit.edu	37	11	55861237	55861237	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:55861237G>T	ENST00000302124.2	+	1	485	c.454G>T	c.(454-456)Ggc>Tgc	p.G152C		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G152C(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					ATATGTGATAGGCTTCACAAG	0.443																																							uc010rix.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(454-456)GGC>TGC		olfactory receptor, family 8, subfamily I,							147.0	138.0	141.0					11																	55861237		2201	4296	6497	SO:0001583	missense	120586				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55861237G>T	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.454G>T	11.37:g.55861237G>T	ENSP00000303864:p.Gly152Cys						p.G152C	NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN			1	454	+	Esophageal squamous(21;0.00693)		152			Helical; Name=4; (Potential).		B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	ENST00000302124.2	37	c.454G>T	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.242894	0.22796	.	.	ENSG00000172154	ENST00000302124	T	0.39997	1.05	4.33	3.4	0.38934	GPCR, rhodopsin-like superfamily (1);	0.182610	0.26311	U	0.025103	T	0.64560	0.2609	M	0.88241	2.94	0.09310	N	1	D	0.67145	0.996	D	0.64877	0.93	T	0.58612	-0.7606	10	0.62326	D	0.03	-2.8331	10.0349	0.42122	0.0973:0.0:0.9027:0.0	.	152	Q8N0Y5	OR8I2_HUMAN	C	152	ENSP00000303864:G152C	ENSP00000303864:G152C	G	+	1	0	OR8I2	55617813	0.969000	0.33509	0.007000	0.13788	0.032000	0.12392	1.684000	0.37649	0.934000	0.37316	0.440000	0.28878	GGC		0.443	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750		16	101	1	0	1.15088e-07	0.004007	1.37494e-07	16	101				
OR5T1	390155	broad.mit.edu	37	11	56043390	56043390	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:56043390A>T	ENST00000313033.2	+	1	362	c.276A>T	c.(274-276)aaA>aaT	p.K92N		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K92N(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TCACTCCAAAAATGTTGGTCA	0.373																																							uc001nio.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(274-276)AAA>AAT		olfactory receptor, family 5, subfamily T,							105.0	103.0	104.0					11																	56043390		2201	4296	6497	SO:0001583	missense	390155				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56043390A>T	AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.276A>T	11.37:g.56043390A>T	ENSP00000323612:p.Lys92Asn						p.K92N	NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN			1	276	+	Esophageal squamous(21;0.00448)		92			Extracellular (Potential).		B2RNM9	Missense_Mutation	SNP	ENST00000313033.2	37	c.276A>T	CCDS31525.1	.	.	.	.	.	.	.	.	.	.	A	9.473	1.096106	0.20552	.	.	ENSG00000181698	ENST00000313033	T	0.01359	4.98	3.59	-5.52	0.02560	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000295	T	0.01454	0.0047	M	0.71920	2.185	0.09310	N	1	B	0.12013	0.005	B	0.15870	0.014	T	0.44605	-0.9317	10	0.46703	T	0.11	.	1.3376	0.02148	0.219:0.1248:0.1674:0.4888	.	92	Q8NG75	OR5T1_HUMAN	N	92	ENSP00000323612:K92N	ENSP00000323612:K92N	K	+	3	2	OR5T1	55799966	0.000000	0.05858	0.022000	0.16811	0.092000	0.18411	-2.546000	0.00932	-1.217000	0.02604	0.381000	0.24937	AAA		0.373	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745		19	92	0	0	0	0.006122	0	19	92				
CTNND1	1500	broad.mit.edu	37	11	57575995	57575995	+	Missense_Mutation	SNP	G	G	T	rs201606412		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:57575995G>T	ENST00000399050.4	+	14	2761	c.2225G>T	c.(2224-2226)cGc>cTc	p.R742L	CTNND1_ENST00000524630.1_Missense_Mutation_p.R736L|CTNND1_ENST00000528232.1_Missense_Mutation_p.R641L|CTNND1_ENST00000529526.1_Missense_Mutation_p.R682L|CTNND1_ENST00000530094.1_Missense_Mutation_p.R635L|CTNND1_ENST00000360682.6_Missense_Mutation_p.R742L|CTNND1_ENST00000361332.4_Missense_Mutation_p.R736L|CTNND1_ENST00000526938.1_Missense_Mutation_p.R742L|CTNND1_ENST00000415361.2_Missense_Mutation_p.R641L|CTNND1_ENST00000534579.1_Missense_Mutation_p.R682L|CTNND1_ENST00000527467.1_Missense_Mutation_p.R419L|CTNND1_ENST00000530748.1_Missense_Mutation_p.R688L|CTNND1_ENST00000529986.1_Missense_Mutation_p.R635L|CTNND1_ENST00000358694.6_Missense_Mutation_p.R736L|CTNND1_ENST00000526357.1_Missense_Mutation_p.R682L|CTNND1_ENST00000529919.1_Missense_Mutation_p.R742L|CTNND1_ENST00000532463.1_Missense_Mutation_p.R635L|CTNND1_ENST00000532844.1_Missense_Mutation_p.R688L|CTNND1_ENST00000528621.1_Missense_Mutation_p.R682L|CTNND1_ENST00000361796.4_Missense_Mutation_p.R736L|CTNND1_ENST00000533667.1_Missense_Mutation_p.R413L|CTNND1_ENST00000526772.1_Missense_Mutation_p.R413L|CTNND1_ENST00000428599.2_Missense_Mutation_p.R736L|CTNND1_ENST00000532787.1_Missense_Mutation_p.R635L|CTNND1_ENST00000426142.2_Missense_Mutation_p.R635L|CTNND1_ENST00000532649.1_Missense_Mutation_p.R682L|CTNND1_ENST00000531014.1_Missense_Mutation_p.R413L|CTNND1_ENST00000399039.4_Missense_Mutation_p.R742L|CTNND1_ENST00000529873.1_Missense_Mutation_p.R682L|CTNND1_ENST00000361391.6_Missense_Mutation_p.R736L|CTNND1_ENST00000532245.1_Missense_Mutation_p.R635L|CTNND1_ENST00000525902.1_Missense_Mutation_p.R419L	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	742					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)	p.R742L(1)|p.R736L(1)		breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				GTGGATGCTCGCAACAAAGAA	0.428																																							uc001nmc.3		NA																	2	Substitution - Missense(2)		lung(2)	breast(4)|ovary(1)|kidney(1)	6						c.(2224-2226)CGC>CTC		catenin, delta 1 isoform 1ABC		G	LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG,LEU/ARG	1,3987		0,1,1993	68.0	69.0	69.0		2225,2207,2207,2207,2207,1922,1904,1904,1922,1904,1904,1904,2063,2063,2225,2045,2045,2045,2045,1904,2045,2207	5.4	1.0	11		69	0,8332		0,0,4166	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	CTNND1	NM_001085458.1,NM_001085459.1,NM_001085460.1,NM_001085461.1,NM_001085462.1,NM_001085463.1,NM_001085464.1,NM_001085465.1,NM_001085466.1,NM_001085467.1,NM_001085468.1,NM_001085469.1,NM_001206883.1,NM_001206884.1,NM_001206885.1,NM_001206886.1,NM_001206887.1,NM_001206888.1,NM_001206889.1,NM_001206890.1,NM_001206891.1,NM_001331.2	102,102,102,102,102,102,102,102,102,102,102,102,102,102,102,102,102,102,102,102,102,102	0,1,6159	TT,TG,GG		0.0,0.0251,0.0081	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	742/969,736/963,736/934,736/934,736/934,641/868,635/862,635/841,641/839,635/833,635/833,635/833,688/915,688/886,742/940,682/909,682/888,682/880,682/880,635/833,682/880,736/942	57575995	1,12319	1994	4166	6160	SO:0001583	missense	1500				adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding	g.chr11:57575995G>T	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.2225G>T	11.37:g.57575995G>T	ENSP00000382004:p.Arg742Leu					CTNND1_uc001nlh.1_Missense_Mutation_p.R742L|CTNND1_uc001nlu.3_Missense_Mutation_p.R635L|CTNND1_uc001nlt.3_Missense_Mutation_p.R635L|CTNND1_uc001nls.3_Missense_Mutation_p.R635L|CTNND1_uc001nlw.3_Missense_Mutation_p.R635L|CTNND1_uc001nmf.3_Missense_Mutation_p.R742L|CTNND1_uc001nmd.3_Missense_Mutation_p.R688L|CTNND1_uc001nlk.3_Missense_Mutation_p.R688L|CTNND1_uc001nme.3_Missense_Mutation_p.R736L|CTNND1_uc001nll.3_Missense_Mutation_p.R682L|CTNND1_uc001nmg.3_Missense_Mutation_p.R682L|CTNND1_uc001nlj.3_Missense_Mutation_p.R682L|CTNND1_uc001nlr.3_Missense_Mutation_p.R682L|CTNND1_uc001nlp.3_Missense_Mutation_p.R682L|CTNND1_uc001nlx.3_Missense_Mutation_p.R419L|CTNND1_uc001nlz.3_Missense_Mutation_p.R419L|CTNND1_uc009ymn.2_Missense_Mutation_p.R413L|CTNND1_uc001nlm.3_Missense_Mutation_p.R736L|CTNND1_uc001nly.3_Missense_Mutation_p.R413L|CTNND1_uc001nmb.3_Missense_Mutation_p.R413L|CTNND1_uc001nma.3_Missense_Mutation_p.R413L|CTNND1_uc001nmi.3_Missense_Mutation_p.R641L|CTNND1_uc001nmh.3_Missense_Mutation_p.R736L|CTNND1_uc001nlq.3_Missense_Mutation_p.R641L|CTNND1_uc001nln.3_Missense_Mutation_p.R736L|CTNND1_uc001nli.3_Missense_Mutation_p.R736L|CTNND1_uc001nlo.3_Missense_Mutation_p.R635L|CTNND1_uc001nlv.3_Missense_Mutation_p.R635L	p.R742L	NM_001085458	NP_001078927	O60716	CTND1_HUMAN			14	2796	+		all_epithelial(135;0.155)	742			ARM 9.		A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	ENST00000399050.4	37	c.2225G>T	CCDS44604.1	.	.	.	.	.	.	.	.	.	.	G	31	5.063306	0.93898	2.51E-4	0.0	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000533667;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000527467;ENST00000528232;ENST00000531014;ENST00000526772;ENST00000529873;ENST00000525902;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.44	5.44	0.79542	Armadillo-like helical (1);Armadillo-type fold (1);	0.056205	0.64402	D	0.000001	T	0.70561	0.3238	M	0.75447	2.3	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.87578	0.998;0.998;0.995;0.998;0.998;0.998;0.997;0.998;0.995	T	0.73681	-0.3906	10	0.87932	D	0	-7.3036	18.8697	0.92308	0.0:0.0:1.0:0.0	.	742;736;742;635;682;682;736;742;742	O60716-3;O60716-2;O60716;O60716-18;O60716-14;O60716-10;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.;.;.;.	L	736;742;742;742;736;682;635;742;736;736;635;635;736;635;413;682;682;688;736;419;641;413;413;682;419;688;682;635;641;635;682;742	ENSP00000436543:R736L;ENSP00000434808:R742L;ENSP00000381996:R742L;ENSP00000353902:R742L;ENSP00000354907:R736L;ENSP00000436323:R682L;ENSP00000409930:R635L;ENSP00000382004:R742L;ENSP00000354785:R736L;ENSP00000354823:R736L;ENSP00000432075:R635L;ENSP00000437156:R635L;ENSP00000351527:R736L;ENSP00000434949:R635L;ENSP00000437051:R413L;ENSP00000435379:R682L;ENSP00000432243:R682L;ENSP00000436744:R688L;ENSP00000413586:R736L;ENSP00000434900:R419L;ENSP00000435266:R641L;ENSP00000432623:R413L;ENSP00000433158:R413L;ENSP00000435494:R682L;ENSP00000434672:R419L;ENSP00000433276:R688L;ENSP00000433334:R682L;ENSP00000437327:R635L;ENSP00000403518:R641L;ENSP00000434017:R635L;ENSP00000435789:R682L;ENSP00000432041:R742L	ENSP00000351527:R736L	R	+	2	0	CTNND1	57332571	1.000000	0.71417	0.998000	0.56505	0.884000	0.51177	7.628000	0.83189	2.570000	0.86706	0.467000	0.42956	CGC		0.428	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331		38	25	1	0	4.14481e-20	0.00623	6.76874e-20	38	25				
ZFP91	80829	broad.mit.edu	37	11	58385171	58385171	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:58385171G>T	ENST00000316059.6	+	11	1876	c.1705G>T	c.(1705-1707)Gga>Tga	p.G569*	ZFP91-CNTF_ENST00000389919.4_Intron	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	569					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)	p.G569*(1)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				AGACTCTGCCGGACCTTAGTG	0.438																																							uc001nmx.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(1705-1707)GGA>TGA		zinc finger protein 91							84.0	88.0	87.0					11																	58385171		2201	4295	6496	SO:0001587	stop_gained	80829				activation of NF-kappaB-inducing kinase activity|protein K63-linked ubiquitination	nucleus	nucleic acid binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr11:58385171G>T	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.1705G>T	11.37:g.58385171G>T	ENSP00000339030:p.Gly569*					ZFP91_uc001nmy.3_Nonsense_Mutation_p.G568*|ZFP91-CNTF_uc010rkm.1_Intron	p.G569*	NM_053023	NP_444251	Q96JP5	ZFP91_HUMAN			11	1873	+		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)	569					A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Nonsense_Mutation	SNP	ENST00000316059.6	37	c.1705G>T	CCDS31553.1	.	.	.	.	.	.	.	.	.	.	G	37	6.607677	0.97701	.	.	ENSG00000186660	ENST00000316059	.	.	.	5.93	5.93	0.95920	.	0.111164	0.40385	N	0.001104	.	.	.	.	.	.	0.35087	D	0.763988	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-18.0758	19.1254	0.93380	0.0:0.0:1.0:0.0	.	.	.	.	X	569	.	ENSP00000339030:G569X	G	+	1	0	ZFP91	58141747	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.220000	0.78008	2.826000	0.97356	0.655000	0.94253	GGA		0.438	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	NM_053023		66	51	1	0	1.31311e-47	0.01441	2.6069e-47	66	51				
RCE1	9986	broad.mit.edu	37	11	66613459	66613459	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:66613459T>C	ENST00000309657.3	+	8	927	c.883T>C	c.(883-885)Ttc>Ctc	p.F295L	RCE1_ENST00000524506.1_Missense_Mutation_p.F274L|PC_ENST00000528224.1_5'Flank|RCE1_ENST00000525356.1_Missense_Mutation_p.F172L	NM_001032279.1|NM_005133.2	NP_001027450.1|NP_005124.1	Q9Y256	FACE2_HUMAN	Ras converting CAAX endopeptidase 1	295					CAAX-box protein processing (GO:0071586)|proteolysis (GO:0006508)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|metalloendopeptidase activity (GO:0004222)	p.F295L(1)		breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10						TGTGGGACTCTTCCTGCTTCT	0.627																																							uc001ojk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(883-885)TTC>CTC		prenyl protein peptidase RCE1 isoform 1							85.0	85.0	85.0					11																	66613459		2200	4295	6495	SO:0001583	missense	9986				proteolysis	endoplasmic reticulum membrane|integral to plasma membrane	metalloendopeptidase activity	g.chr11:66613459T>C	AF121951	CCDS8151.1	11q13	2013-10-18	2013-10-18	2001-06-29	ENSG00000173653	ENSG00000173653			13721	protein-coding gene	gene with protein product	"""farnesylated protein-converting enzyme 2"", ""prenyl protein-specific endoprotease 2"", ""RCE1 homolog, prenyl protein protease"", ""CAAX prenyl protease 2"""	605385	"""RCE1 (S. Cerevisiae) homolog, prenyl protein protease"", ""RCE1 homolog, prenyl protein peptidase (S. cerevisiae)"", ""RCE1 homolog, prenyl protein protease (S. cerevisiae)"""	RCE1A, RCE1B		10085068, 10373325	Standard	NM_005133		Approved	hRCE1, FACE-2, FACE2	uc001ojk.1	Q9Y256	OTTHUMG00000167098	ENST00000309657.3:c.883T>C	11.37:g.66613459T>C	ENSP00000309163:p.Phe295Leu					RCE1_uc001ojl.1_Missense_Mutation_p.F191L	p.F295L	NM_005133	NP_005124	Q9Y256	FACE2_HUMAN			8	927	+			295			Helical; (Potential).		Q52LZ9	Missense_Mutation	SNP	ENST00000309657.3	37	c.883T>C	CCDS8151.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.809570	0.90707	.	.	ENSG00000173653	ENST00000309657;ENST00000524506;ENST00000525356	.	.	.	5.24	5.24	0.73138	.	0.064498	0.64402	D	0.000008	T	0.76564	0.4005	M	0.79123	2.44	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.78755	-0.2080	9	0.52906	T	0.07	-23.7048	13.1222	0.59334	0.0:0.0:0.0:1.0	.	295	Q9Y256	FACE2_HUMAN	L	295;274;172	.	ENSP00000309163:F295L	F	+	1	0	RCE1	66370035	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.677000	0.68142	1.981000	0.57761	0.533000	0.62120	TTC		0.627	RCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393105.1	NM_005133		31	66	0	0	0	0.009535	0	31	66				
P2RY6	5031	broad.mit.edu	37	11	73008427	73008427	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:73008427G>A	ENST00000393590.2	+	2	1163	c.864G>A	c.(862-864)ccG>ccA	p.P288P	P2RY6_ENST00000349767.2_Silent_p.P288P|P2RY6_ENST00000393592.2_Silent_p.P288P|P2RY6_ENST00000542092.1_Silent_p.P288P|P2RY6_ENST00000540342.1_Silent_p.P288P|P2RY6_ENST00000540124.1_Silent_p.P288P|P2RY6_ENST00000393591.1_Silent_p.P288P|P2RY6_ENST00000538328.1_Silent_p.P288P	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	288					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)	p.P288P(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						GCACGCGGCCGTTTGCCAGTG	0.602																																							uc001otm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(862-864)CCG>CCA		pyrimidinergic receptor P2Y6							46.0	49.0	48.0					11																	73008427		2200	4291	6491	SO:0001819	synonymous_variant	5031				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr11:73008427G>A		CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.864G>A	11.37:g.73008427G>A						P2RY6_uc001otn.2_Silent_p.P288P|P2RY6_uc001oto.2_Silent_p.P288P|P2RY6_uc001otp.2_Silent_p.P288P|P2RY6_uc001otq.2_Silent_p.P288P|P2RY6_uc001otr.2_Silent_p.P288P|P2RY6_uc001ots.2_Silent_p.P288P	p.P288P	NM_176796	NP_789766	Q15077	P2RY6_HUMAN			4	1269	+			288			Helical; Name=7; (Potential).		Q15754	Silent	SNP	ENST00000393590.2	37	c.864G>A	CCDS8220.1																																																																																				0.602	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397349.1			5	50	0	0	0	0.000602	0	5	50				
SLCO2B1	11309	broad.mit.edu	37	11	74904298	74904298	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:74904298C>T	ENST00000289575.5	+	9	1506	c.1111C>T	c.(1111-1113)Ccc>Tcc	p.P371S	SLCO2B1_ENST00000532236.1_Missense_Mutation_p.P255S|SLCO2B1_ENST00000341411.4_Missense_Mutation_p.P144S|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.P349S|SLCO2B1_ENST00000525650.1_Missense_Mutation_p.P227S|SLCO2B1_ENST00000454962.2_Missense_Mutation_p.P144S|SLCO2B1_ENST00000531756.1_Missense_Mutation_p.P116S	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	371					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	CCTACGCCACCCCATCTTCCT	0.627																																							uc001owb.2		NA																	0				ovary(1)|breast(1)	2						c.(1111-1113)CCC>TCC		solute carrier organic anion transporter family,	Ergoloid mesylate(DB01049)						86.0	80.0	82.0					11																	74904298		2200	4293	6493	SO:0001583	missense	11309				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity	g.chr11:74904298C>T	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.1111C>T	11.37:g.74904298C>T	ENSP00000289575:p.Pro371Ser					SLCO2B1_uc010rrq.1_Missense_Mutation_p.P116S|SLCO2B1_uc010rrr.1_Missense_Mutation_p.P227S|SLCO2B1_uc010rrs.1_Missense_Mutation_p.P255S|SLCO2B1_uc001owc.2_Missense_Mutation_p.P144S|SLCO2B1_uc001owd.2_Missense_Mutation_p.P349S	p.P371S	NM_007256	NP_009187	O94956	SO2B1_HUMAN			9	1498	+			371			Helical; Name=7; (Potential).		A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	37	c.1111C>T	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518756	0.85495	.	.	ENSG00000137491	ENST00000289575;ENST00000341411;ENST00000532236;ENST00000531756;ENST00000525650;ENST00000454962;ENST00000428359	T;D;D;D;D;D;T	0.82984	0.01;-1.67;-1.67;-1.67;-1.67;-1.67;0.01	5.21	5.21	0.72293	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.92001	0.7466	M	0.86502	2.82	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92723	0.6193	10	0.54805	T	0.06	.	16.3153	0.82918	0.0:1.0:0.0:0.0	.	227;116;144;371	E9PPU8;E9PPJ4;O94956-2;O94956	.;.;.;SO2B1_HUMAN	S	371;144;255;116;227;144;349	ENSP00000289575:P371S;ENSP00000341286:P144S;ENSP00000434112:P255S;ENSP00000432650:P116S;ENSP00000436324:P227S;ENSP00000389653:P144S;ENSP00000388912:P349S	ENSP00000289575:P371S	P	+	1	0	SLCO2B1	74581946	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	5.066000	0.64351	2.456000	0.83038	0.556000	0.70494	CCC		0.627	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256		40	20	0	0	0	0.005524	0	40	20				
GDPD4	220032	broad.mit.edu	37	11	76944186	76944186	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:76944186C>T	ENST00000376217.2	-	13	1523	c.1273G>A	c.(1273-1275)Gta>Ata	p.V425I	GDPD4_ENST00000315938.4_Missense_Mutation_p.V425I			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	425	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)	p.V425I(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						ACGGTGTATACGTTGATATGG	0.438																																							uc001oyf.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1273-1275)GTA>ATA		glycerophosphodiester phosphodiesterase domain							173.0	152.0	159.0					11																	76944186		2200	4292	6492	SO:0001583	missense	220032				glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding	g.chr11:76944186C>T	AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.1273G>A	11.37:g.76944186C>T	ENSP00000365390:p.Val425Ile						p.V425I	NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN			13	1524	-			425			GDPD.|Extracellular (Potential).		Q7Z5B0	Missense_Mutation	SNP	ENST00000376217.2	37	c.1273G>A		.	.	.	.	.	.	.	.	.	.	C	6.871	0.530092	0.13127	.	.	ENSG00000178795	ENST00000376217;ENST00000315938	T;T	0.45668	0.89;0.89	5.88	-9.8	0.00490	.	0.662303	0.14786	N	0.298503	T	0.21387	0.0515	L	0.45352	1.415	0.09310	N	0.999999	B	0.13145	0.007	B	0.08055	0.003	T	0.09079	-1.0691	10	0.42905	T	0.14	-1.6993	2.5455	0.04736	0.132:0.3682:0.1352:0.3646	.	425	Q6W3E5-2	.	I	425	ENSP00000365390:V425I;ENSP00000320815:V425I	ENSP00000320815:V425I	V	-	1	0	GDPD4	76621834	0.029000	0.19370	0.141000	0.22245	0.014000	0.08584	-1.240000	0.02914	-1.205000	0.02645	-1.368000	0.01194	GTA		0.438	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382075.1	NM_182833		30	25	0	0	0	0.010818	0	30	25				
CASP5	838	broad.mit.edu	37	11	104871047	104871047	+	Missense_Mutation	SNP	C	C	T	rs45464699	byFrequency	TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:104871047C>T	ENST00000260315.3	-	6	892	c.893G>A	c.(892-894)cGc>cAc	p.R298H	CASP5_ENST00000418434.1_Missense_Mutation_p.R156H|CASP5_ENST00000531367.1_Missense_Mutation_p.R156H|CASP5_ENST00000393139.2_3'UTR|CASP5_ENST00000393141.2_Missense_Mutation_p.R311H|CASP5_ENST00000526056.1_Missense_Mutation_p.R311H|CASP5_ENST00000444749.2_Missense_Mutation_p.R240H			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	298			R -> H (in dbSNP:rs45464699). {ECO:0000269|Ref.7}.		apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.R311H(1)|p.R282H(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		GAGGCAGTTGCGGTTGTTGAA	0.468													C|||	7	0.00139776	0.0015	0.0072	5008	,	,		20654	0.0		0.0	False		,,,				2504	0.0						uc010rva.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)	3						c.(892-894)CGC>CAC		caspase 5 isoform a precursor		C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	7,4397		0,7,2195	223.0	193.0	203.0		719,467,932,893	1.2	0.0	11	dbSNP_127	203	1,8597		0,1,4298	no	missense,missense,missense,missense	CASP5	NM_001136109.1,NM_001136110.1,NM_001136112.1,NM_004347.3	29,29,29,29	0,8,6493	TT,TC,CC		0.0116,0.1589,0.0615	benign,benign,benign,benign	240/377,156/293,311/448,298/435	104871047	8,12994	2202	4299	6501	SO:0001583	missense	838				apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding	g.chr11:104871047C>T		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.893G>A	11.37:g.104871047C>T	ENSP00000260315:p.Arg298His					CASP5_uc010ruz.1_Missense_Mutation_p.R311H|CASP5_uc010rvb.1_Missense_Mutation_p.R240H|CASP5_uc010rvc.1_Missense_Mutation_p.R156H|CASP5_uc009yxh.2_Missense_Mutation_p.R80H|CASP5_uc010rvd.1_Missense_Mutation_p.R80H	p.R298H	NM_004347	NP_004338	P51878	CASP5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)	6	925	-		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)	298		R -> H.			B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	ENST00000260315.3	37	c.893G>A	CCDS8328.2	4	0.0018315018315018315	1	0.0020325203252032522	3	0.008287292817679558	0	0.0	0	0.0	.	7.659	0.684468	0.14973	0.001589	1.16E-4	ENSG00000137757	ENST00000393141;ENST00000418434;ENST00000260315;ENST00000444749;ENST00000526056;ENST00000531367	T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05	4.34	1.2	0.21068	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.639153	0.16149	N	0.227346	T	0.13713	0.0332	M	0.72576	2.205	0.09310	N	1	B;B;B;B	0.17852	0.012;0.024;0.016;0.005	B;B;B;B	0.17979	0.012;0.019;0.02;0.005	T	0.16424	-1.0403	10	0.40728	T	0.16	.	3.1757	0.06567	0.3284:0.457:0.0:0.2146	rs45464699	156;240;298;311	P51878-3;P51878-2;P51878;P51878-5	.;.;CASP5_HUMAN;.	H	311;156;298;240;311;156	ENSP00000376849:R311H;ENSP00000398130:R156H;ENSP00000260315:R298H;ENSP00000388365:R240H;ENSP00000436877:R311H;ENSP00000434471:R156H	ENSP00000260315:R298H	R	-	2	0	CASP5	104376257	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.421000	0.07053	0.964000	0.38108	-0.501000	0.04562	CGC		0.468	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347		31	100	0	0	0	0.003271	0	31	100				
FXYD2	486	broad.mit.edu	37	11	117693433	117693433	+	Splice_Site	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:117693433C>T	ENST00000292079.2	-	2	91		c.e2-1		FXYD2_ENST00000528014.1_Splice_Site|FXYD2_ENST00000532119.1_Splice_Site|RP11-728F11.3_ENST00000596805.1_RNA|RP11-728F11.3_ENST00000531850.2_RNA|FXYD2_ENST00000260287.2_Splice_Site|FXYD6-FXYD2_ENST00000532984.1_Splice_Site	NM_001680.4	NP_001671.2	P54710	ATNG_HUMAN	FXYD domain containing ion transport regulator 2						ion transmembrane transport (GO:0034220)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ion channel activity (GO:0005216)|sodium:potassium-exchanging ATPase activity (GO:0005391)|transporter activity (GO:0005215)	p.?(1)		breast(1)|kidney(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;2.83e-05)|Epithelial(105;0.00114)	Cyclothiazide(DB00606)	GGGCTGCCGCCTAGGAGAGAG	0.637																																							uc001prj.2		NA																	1	Unknown(1)		lung(1)		0						c.e2-1		FXYD domain-containing ion transport regulator 2	Cyclothiazide(DB00606)						28.0	24.0	25.0					11																	117693433		2200	4295	6495	SO:0001630	splice_region_variant	486					sodium:potassium-exchanging ATPase complex	ion channel activity|sodium:potassium-exchanging ATPase activity	g.chr11:117693433C>T	AF241236	CCDS8385.1, CCDS8386.1	11q23	2008-02-05	2003-02-28						4026	protein-coding gene	gene with protein product		601814	"""hypomagnesemia 2, renal"""	ATP1G1, HOMG2		9048881, 9915957	Standard	NM_021603		Approved	MGC12372		P54710		ENST00000292079.2:c.26-1G>A	11.37:g.117693433C>T						FXYD2_uc001prl.2_Intron|FXYD2_uc001prk.1_Splice_Site_p.G7_splice	p.G9_splice	NM_001680	NP_001671	P54710	ATNG_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.83e-05)|Epithelial(105;0.00114)	2	92	-	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)						Q15332|Q53YC1|Q9GZP3|Q9GZQ7	Splice_Site	SNP	ENST00000292079.2	37	c.26_splice	CCDS8386.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.902576	0.52227	.	.	ENSG00000137731	ENST00000532119;ENST00000528014;ENST00000292079;ENST00000547335;ENST00000260287	.	.	.	4.35	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.571	0.56337	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FXYD2	117198643	0.997000	0.39634	0.997000	0.53966	0.796000	0.44982	3.928000	0.56506	2.415000	0.81967	0.655000	0.94253	.		0.637	FXYD2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390050.1	NM_021603	Intron	8	9	0	0	0	0.00308	0	8	9				
CLEC12B	387837	broad.mit.edu	37	12	10168005	10168005	+	Splice_Site	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:10168005G>T	ENST00000338896.5	+	4	692	c.564G>T	c.(562-564)aaG>aaT	p.K188N	RP11-133L14.5_ENST00000544225.1_RNA|CLEC1B_ENST00000428126.2_5'Flank|CLEC12B_ENST00000396502.1_Splice_Site_p.K188N	NM_001129998.1	NP_001123470.1	Q2HXU8	CL12B_HUMAN	C-type lectin domain family 12, member B	188	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.K188N(1)		central_nervous_system(2)|large_intestine(2)|lung(5)	9						TGGAAGAAAAGGTAGGATTGA	0.358																																							uc001qwz.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(562-564)AAG>AAT		C-type lectin domain family 12, member B isoform							84.0	88.0	87.0					12																	10168005		2203	4300	6503	SO:0001630	splice_region_variant	387837					integral to membrane|plasma membrane	receptor activity|sugar binding	g.chr12:10168005G>T	AK128243	CCDS8610.1, CCDS44830.1	12p13.2	2010-08-17			ENSG00000256660	ENSG00000256660		"""C-type lectin domain containing"""	31966	protein-coding gene	gene with protein product						17562706	Standard	NM_205852		Approved		uc001qwz.2	Q2HXU8	OTTHUMG00000168397	ENST00000338896.5:c.564+1G>T	12.37:g.10168005G>T						CLEC12B_uc001qwx.1_Missense_Mutation_p.K188N|CLEC12B_uc001qwy.1_Missense_Mutation_p.K85N|CLEC12B_uc009zhe.2_RNA	p.K188N	NM_001129998	NP_001123470	Q2HXU8	CL12B_HUMAN			4	692	+			188			Extracellular (Potential).|C-type lectin.		Q6UWF2|Q6ZRG0	Missense_Mutation	SNP	ENST00000338896.5	37	c.564G>T	CCDS44830.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.320277	0.60634	.	.	ENSG00000256660	ENST00000396502;ENST00000338896	T;T	0.14144	2.53;2.53	4.55	4.55	0.56014	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.679440	0.13728	N	0.366907	T	0.14657	0.0354	N	0.11313	0.125	0.80722	D	1	P;P	0.52577	0.954;0.944	P;P	0.54060	0.741;0.624	T	0.13361	-1.0512	10	0.44086	T	0.13	.	13.5334	0.61635	0.0:0.0:1.0:0.0	.	188;188	Q2HXU8;Q2HXU8-2	CL12B_HUMAN;.	N	188	ENSP00000379759:K188N;ENSP00000344563:K188N	ENSP00000344563:K188N	K	+	3	2	CLEC12B	10059272	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	1.754000	0.38369	2.488000	0.83962	0.491000	0.48974	AAG		0.358	CLEC12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399554.2	NM_205852	Missense_Mutation	5	35	1	0	3.59834e-05	0.001168	3.99267e-05	5	35				
LRP6	4040	broad.mit.edu	37	12	12340001	12340001	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:12340001C>T	ENST00000261349.4	-	4	776	c.700G>A	c.(700-702)Gag>Aag	p.E234K	LRP6_ENST00000543091.1_Missense_Mutation_p.E234K	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	234	Beta-propeller 1.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.E234K(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				AATATGTCCTCAAATAACGTC	0.393																																							uc001rah.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12						c.(700-702)GAG>AAG		low density lipoprotein receptor-related protein							133.0	113.0	120.0					12																	12340001		2203	4300	6503	SO:0001583	missense	4040				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding	g.chr12:12340001C>T	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.700G>A	12.37:g.12340001C>T	ENSP00000261349:p.Glu234Lys					BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.E234K	p.E234K	NM_002336	NP_002327	O75581	LRP6_HUMAN			4	842	-		Prostate(47;0.0865)	234			Extracellular (Potential).|Beta-propeller 1.|LDL-receptor class B 4.		Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	c.700G>A	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652948	0.47362	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.91686	-2.89;-2.89	5.81	5.81	0.92471	Six-bladed beta-propeller, TolB-like (1);	0.102456	0.42420	D	0.000704	D	0.90103	0.6908	L	0.47078	1.49	0.48632	D	0.999687	B;B	0.15930	0.013;0.015	B;B	0.16722	0.009;0.016	D	0.84725	0.0742	10	0.30854	T	0.27	.	20.077	0.97749	0.0:1.0:0.0:0.0	.	234;234	F5H7J9;O75581	.;LRP6_HUMAN	K	234	ENSP00000261349:E234K;ENSP00000442472:E234K	ENSP00000261349:E234K	E	-	1	0	LRP6	12231268	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.939000	0.63526	2.750000	0.94351	0.544000	0.68410	GAG		0.393	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1			29	39	0	0	0	0.00632	0	29	39				
CMAS	55907	broad.mit.edu	37	12	22214339	22214339	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:22214339G>T	ENST00000229329.2	+	6	1043	c.913G>T	c.(913-915)Gta>Tta	p.V305L		NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase	305					lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)	p.V305L(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						ATCTTATGATGTAAAAGATGC	0.313																																							uc001rfm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(913-915)GTA>TTA		cytidine monophospho-N-acetylneuraminic acid							66.0	70.0	68.0					12																	22214339		2203	4298	6501	SO:0001583	missense	55907				lipopolysaccharide biosynthetic process	nucleus	N-acylneuraminate cytidylyltransferase activity	g.chr12:22214339G>T	AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	ENST00000229329.2:c.913G>T	12.37:g.22214339G>T	ENSP00000229329:p.Val305Leu					CMAS_uc001rfn.2_Intron	p.V305L	NM_018686	NP_061156	Q8NFW8	NEUA_HUMAN			6	992	+			305					Q96AX5|Q9NQZ0	Missense_Mutation	SNP	ENST00000229329.2	37	c.913G>T	CCDS8696.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653160	0.29425	.	.	ENSG00000111726	ENST00000229329	T	0.22134	1.97	5.82	1.98	0.26296	HAD-like domain (2);	0.388592	0.28098	N	0.016606	T	0.16171	0.0389	M	0.63428	1.95	0.28750	N	0.901471	B	0.02656	0.0	B	0.01281	0.0	T	0.19095	-1.0316	10	0.20519	T	0.43	-19.8313	2.692	0.05123	0.2636:0.1053:0.5122:0.1189	.	305	Q8NFW8	NEUA_HUMAN	L	305	ENSP00000229329:V305L	ENSP00000229329:V305L	V	+	1	0	CMAS	22105606	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.344000	0.44010	0.400000	0.25396	0.591000	0.81541	GTA		0.313	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402235.1	NM_018686		21	67	1	0	1.15919e-05	0.008871	1.31137e-05	21	67				
FGD4	121512	broad.mit.edu	37	12	32735020	32735020	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:32735020G>A	ENST00000427716.2	+	4	643	c.219G>A	c.(217-219)caG>caA	p.Q73Q	FGD4_ENST00000531134.1_Silent_p.Q158Q|FGD4_ENST00000534526.2_Silent_p.Q210Q|FGD4_ENST00000546442.1_5'UTR|FGD4_ENST00000525053.1_Silent_p.Q185Q|FGD4_ENST00000472289.1_Silent_p.Q73Q|FGD4_ENST00000266482.3_5'UTR	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	73	Actin filament-binding. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.Q73Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					ACTTGCCACAGAGGCAGGGAA	0.493																																							uc001rkz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(217-219)CAG>CAA		FYVE, RhoGEF and PH domain containing 4							117.0	112.0	114.0					12																	32735020		2203	4300	6503	SO:0001819	synonymous_variant	121512				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr12:32735020G>A	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.219G>A	12.37:g.32735020G>A						FGD4_uc001rlc.2_Silent_p.Q158Q|FGD4_uc001rky.2_5'UTR|FGD4_uc001rla.2_5'UTR|FGD4_uc010ske.1_Silent_p.Q185Q|FGD4_uc001rlb.1_RNA|FGD4_uc001rkx.3_Silent_p.Q73Q	p.Q73Q	NM_139241	NP_640334	Q96M96	FGD4_HUMAN			4	696	+	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		73			Actin filament-binding (By similarity).		Q6ULS2|Q8TCP6	Silent	SNP	ENST00000427716.2	37	c.219G>A	CCDS8727.1																																																																																				0.493	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241		32	68	0	0	0	0.003755	0	32	68				
NAV3	89795	broad.mit.edu	37	12	78443851	78443851	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:78443851C>A	ENST00000397909.2	+	10	2275	c.2102C>A	c.(2101-2103)tCc>tAc	p.S701Y	NAV3_ENST00000228327.6_Missense_Mutation_p.S701Y|NAV3_ENST00000536525.2_Missense_Mutation_p.S701Y|RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000266692.7_Missense_Mutation_p.S701Y			Q8IVL0	NAV3_HUMAN	neuron navigator 3	701						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.S701Y(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GAGACTATGTCCAGTCTTCGT	0.328										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2101-2103)TCC>TAC		neuron navigator 3							84.0	82.0	82.0					12																	78443851		1828	4080	5908	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78443851C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2102C>A	12.37:g.78443851C>A	ENSP00000381007:p.Ser701Tyr	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.S701Y|NAV3_uc010sub.1_Missense_Mutation_p.S201Y	p.S701Y	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			10	2275	+			701			Potential.		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2102C>A		.	.	.	.	.	.	.	.	.	.	C	29.9	5.041489	0.93685	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.15952	2.38;2.38;2.38;2.38	5.58	5.58	0.84498	.	0.000000	0.39985	U	0.001202	T	0.45216	0.1331	M	0.74647	2.275	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.997;0.998	T	0.23547	-1.0185	9	.	.	.	-12.1505	19.5809	0.95467	0.0:1.0:0.0:0.0	.	701;701;701	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	Y	701	ENSP00000446132:S701Y;ENSP00000381007:S701Y;ENSP00000228327:S701Y;ENSP00000266692:S701Y	.	S	+	2	0	NAV3	76967982	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.632000	0.89209	0.650000	0.86243	TCC		0.328	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		25	19	1	0	4.22769e-11	0.00632	5.66959e-11	25	19				
NAV3	89795	broad.mit.edu	37	12	78515872	78515872	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:78515872C>A	ENST00000397909.2	+	16	4075	c.3902C>A	c.(3901-3903)gCt>gAt	p.A1301D	NAV3_ENST00000228327.6_Missense_Mutation_p.A1301D|NAV3_ENST00000536525.2_Missense_Mutation_p.A1301D|NAV3_ENST00000266692.7_Intron			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1301	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.A1301D(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ATGGGCAGTGCTGGTGGGCTA	0.552										HNSCC(70;0.22)																													uc001syp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(3901-3903)GCT>GAT		neuron navigator 3							49.0	51.0	50.0					12																	78515872		2105	4225	6330	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78515872C>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3902C>A	12.37:g.78515872C>A	ENSP00000381007:p.Ala1301Asp	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.A1301D|NAV3_uc010sub.1_Missense_Mutation_p.A801D|NAV3_uc009zsf.2_Intron	p.A1301D	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			16	4075	+			1301			Ser-rich.		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.3902C>A		.	.	.	.	.	.	.	.	.	.	C	19.87	3.907750	0.72868	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327	T;T;T	0.27402	1.67;1.68;1.67	5.96	5.96	0.96718	.	0.000000	0.39834	U	0.001247	T	0.34454	0.0898	L	0.36672	1.1	0.80722	D	1	P;P;P	0.46512	0.474;0.808;0.879	B;B;P	0.45829	0.258;0.348;0.494	T	0.01036	-1.1473	10	0.35671	T	0.21	-18.8882	20.4082	0.99013	0.0:1.0:0.0:0.0	.	1301;1301;1301	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	D	1301	ENSP00000446132:A1301D;ENSP00000381007:A1301D;ENSP00000228327:A1301D	ENSP00000228327:A1301D	A	+	2	0	NAV3	77040003	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.617000	0.61204	2.814000	0.96858	0.655000	0.94253	GCT		0.552	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		16	19	1	0	8.60227e-14	0.004007	1.24426e-13	16	19				
C12orf50	160419	broad.mit.edu	37	12	88381709	88381709	+	Silent	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:88381709T>A	ENST00000298699.2	-	9	915	c.735A>T	c.(733-735)ctA>ctT	p.L245L	C12orf50_ENST00000550553.1_Intron	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	245								p.L245L(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						GTCGGGTAGTTAGGGAATGCT	0.343																																							uc001tam.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)|ovary(1)	3						c.(733-735)CTA>CTT		hypothetical protein LOC160419							165.0	145.0	152.0					12																	88381709		2203	4300	6503	SO:0001819	synonymous_variant	160419							g.chr12:88381709T>A	AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.735A>T	12.37:g.88381709T>A						C12orf50_uc001tan.2_Intron	p.L245L	NM_152589	NP_689802	Q8NA57	CL050_HUMAN			9	903	-			245					Q6P674	Silent	SNP	ENST00000298699.2	37	c.735A>T	CCDS9031.1																																																																																				0.343	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406328.1	NM_152589		24	19	0	0	0	0.00632	0	24	19				
GALNT4	8693	broad.mit.edu	37	12	89918307	89918307	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:89918307C>G	ENST00000529983.2	-	1	276	c.20G>C	c.(19-21)tGg>tCg	p.W7S	POC1B_ENST00000541909.1_Intron|RP11-734K2.4_ENST00000605233.1_RNA|POC1B_ENST00000549035.1_Intron|POC1B-GALNT4_ENST00000547474.1_Intron|POC1B_ENST00000393179.4_Intron|POC1B_ENST00000313546.3_Intron|POC1B-GALNT4_ENST00000548729.1_Intron|GALNT4_ENST00000413530.1_Intron|POC1B_ENST00000549504.1_Intron	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	7					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.W7S(1)		endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						CTTGCCTGCCCAAGTCCACCT	0.627											OREG0022018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001tbd.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(19-21)TGG>TCG		polypeptide N-acetylgalactosaminyltransferase 4							21.0	24.0	23.0					12																	89918307		1983	4146	6129	SO:0001583	missense	8693				carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:89918307C>G	Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.20G>C	12.37:g.89918307C>G	ENSP00000436604:p.Trp7Ser		OREG0022018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1271	POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Intron|GALNT4_uc010suo.1_Intron	p.W7S	NM_003774	NP_003765	Q8N4A0	GALT4_HUMAN			1	229	-			7			Cytoplasmic (Potential).		B2R775|B4DMX6|O00208	Missense_Mutation	SNP	ENST00000529983.2	37	c.20G>C	CCDS53817.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430076	0.62844	.	.	ENSG00000257594	ENST00000529983	T	0.51817	0.69	5.54	5.54	0.83059	.	.	.	.	.	T	0.35711	0.0941	L	0.29908	0.895	0.49213	D	0.999763	B	0.23735	0.09	B	0.21708	0.036	T	0.11767	-1.0574	8	.	.	.	.	13.4359	0.61084	0.1567:0.8432:0.0:0.0	.	7	Q8N4A0	GALT4_HUMAN	S	7	ENSP00000436604:W7S	.	W	-	2	0	GALNT4	88442438	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.599000	0.61076	2.606000	0.88127	0.491000	0.48974	TGG		0.627	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388973.2	NM_003774		15	17	0	0	0	0.00499	0	15	17				
AMDHD1	144193	broad.mit.edu	37	12	96361533	96361533	+	Splice_Site	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:96361533G>C	ENST00000266736.2	+	9	1299		c.e9-1			NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1						cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)	p.?(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						TTTTTTTCTAGATGGGAGCAT	0.264																																							uc001tel.1		NA																	1	Unknown(1)		lung(1)	central_nervous_system(1)	1						c.e9-1		amidohydrolase domain containing 1							21.0	22.0	22.0					12																	96361533		2190	4264	6454	SO:0001630	splice_region_variant	144193				histidine catabolic process to glutamate and formamide	cytosol	imidazolonepropionase activity|metal ion binding	g.chr12:96361533G>C	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.1194-1G>C	12.37:g.96361533G>C						AMDHD1_uc009zth.1_Splice_Site_p.R289_splice	p.R398_splice	NM_152435	NP_689648	Q96NU7	HUTI_HUMAN			9	1300	+								A8K463|Q68CI8	Splice_Site	SNP	ENST00000266736.2	37	c.1194_splice	CCDS9057.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334962	0.60853	.	.	ENSG00000139344	ENST00000266736	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3129	0.98645	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AMDHD1	94885664	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	9.281000	0.95811	2.800000	0.96347	0.650000	0.86243	.		0.264	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	Intron	5	6	0	0	0	0.001984	0	5	6				
UBE3B	89910	broad.mit.edu	37	12	109921467	109921467	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:109921467G>T	ENST00000342494.3	+	3	706	c.111G>T	c.(109-111)caG>caT	p.Q37H	UBE3B_ENST00000540230.1_Missense_Mutation_p.Q37H|UBE3B_ENST00000434735.2_Missense_Mutation_p.Q37H|UBE3B_ENST00000340074.5_Missense_Mutation_p.Q37H|UBE3B_ENST00000537063.1_Missense_Mutation_p.Q37H|UBE3B_ENST00000536398.1_Missense_Mutation_p.Q37H|UBE3B_ENST00000280774.5_Missense_Mutation_p.Q37H	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	37	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.Q37H(1)		NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						TTGTGATCCAGGCCCATGTCC	0.532																																							uc001top.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(2)	4						c.(109-111)CAG>CAT		ubiquitin protein ligase E3B							159.0	151.0	154.0					12																	109921467		2203	4300	6503	SO:0001583	missense	89910				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity	g.chr12:109921467G>T	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.111G>T	12.37:g.109921467G>T	ENSP00000340596:p.Gln37His					UBE3B_uc001toq.2_Missense_Mutation_p.Q37H|UBE3B_uc001tol.1_Missense_Mutation_p.Q37H|UBE3B_uc001tom.2_Missense_Mutation_p.Q37H|UBE3B_uc001ton.2_Missense_Mutation_p.Q37H|UBE3B_uc001too.1_RNA|UBE3B_uc009zvj.1_Missense_Mutation_p.Q37H|UBE3B_uc001tor.2_Missense_Mutation_p.Q37H	p.Q37H	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN			3	714	+			37			IQ.		A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	ENST00000342494.3	37	c.111G>T	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835547	0.50951	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000536398;ENST00000539599;ENST00000342494;ENST00000340074;ENST00000540230;ENST00000537063	D;D;D;D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1	5.36	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.92519	0.7624	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.93212	0.6601	10	0.87932	D	0	.	12.9976	0.58657	0.0769:0.0:0.9231:0.0	.	37;37;37	Q7Z3V4;Q7Z3V4-3;F5H6D6	UBE3B_HUMAN;.;.	H	37	ENSP00000391529:Q37H;ENSP00000280774:Q37H;ENSP00000440585:Q37H;ENSP00000443131:Q37H;ENSP00000340596:Q37H;ENSP00000342614:Q37H;ENSP00000443565:Q37H;ENSP00000437694:Q37H	ENSP00000280774:Q37H	Q	+	3	2	UBE3B	108405850	1.000000	0.71417	1.000000	0.80357	0.142000	0.21351	2.497000	0.45354	1.495000	0.48549	0.655000	0.94253	CAG		0.532	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415		66	50	1	0	1.1794e-34	0.01441	2.25311e-34	66	50				
TRPV4	59341	broad.mit.edu	37	12	110236693	110236693	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:110236693G>T	ENST00000418703.2	-	5	972	c.878C>A	c.(877-879)gCc>gAc	p.A293D	TRPV4_ENST00000541794.1_Missense_Mutation_p.A246D|TRPV4_ENST00000537083.1_Missense_Mutation_p.A293D|TRPV4_ENST00000544971.1_Missense_Mutation_p.A246D|TRPV4_ENST00000536838.1_Missense_Mutation_p.A259D|TRPV4_ENST00000346520.2_Missense_Mutation_p.A293D|TRPV4_ENST00000261740.2_Missense_Mutation_p.A293D|TRPV4_ENST00000392719.2_Missense_Mutation_p.A246D	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	293					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						GTTGGTGCAGGCAGCCAGCGA	0.667																																							uc001tpj.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(877-879)GCC>GAC		transient receptor potential cation channel,							49.0	49.0	49.0					12																	110236693		2203	4300	6503	SO:0001583	missense	59341				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding	g.chr12:110236693G>T	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.878C>A	12.37:g.110236693G>T	ENSP00000406191:p.Ala293Asp					TRPV4_uc001tpg.1_Missense_Mutation_p.A259D|TRPV4_uc001tph.1_Missense_Mutation_p.A246D|TRPV4_uc001tpi.1_Missense_Mutation_p.A246D|TRPV4_uc001tpk.1_Missense_Mutation_p.A293D|TRPV4_uc001tpl.1_Missense_Mutation_p.A293D	p.A293D	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN			5	973	-			293			Cytoplasmic (Potential).|ANK 2.		B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	c.878C>A	CCDS9134.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.710481	0.89018	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	T;T;T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	4.37	4.37	0.52481	Ankyrin repeat-containing domain (3);	0.054993	0.64402	D	0.000001	D	0.90321	0.6972	H	0.96365	3.81	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.97;0.999;0.994;0.987	D	0.93393	0.6753	10	0.87932	D	0	-14.3074	16.0511	0.80763	0.0:0.0:1.0:0.0	.	293;293;246;246;259	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	D	293;293;246;293;246;293;246;259	ENSP00000406191:A293D;ENSP00000261740:A293D;ENSP00000376480:A246D;ENSP00000319003:A293D;ENSP00000443611:A246D;ENSP00000442738:A293D;ENSP00000442167:A246D;ENSP00000444336:A259D	ENSP00000261740:A293D	A	-	2	0	TRPV4	108721076	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	9.156000	0.94705	2.435000	0.82474	0.655000	0.94253	GCC		0.667	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625		27	31	1	0	8.16721e-17	0.010818	1.2435e-16	27	31				
RBM19	9904	broad.mit.edu	37	12	114374839	114374839	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:114374839C>T	ENST00000545145.2	-	16	2119	c.2041G>A	c.(2041-2043)Gaa>Aaa	p.E681K	RP11-780K2.1_ENST00000550206.1_RNA|RBM19_ENST00000392561.3_Missense_Mutation_p.E681K|RBM19_ENST00000261741.5_Missense_Mutation_p.E681K	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	681					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E681K(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					GGGTCCTTTTCCATGGGTTCT	0.567																																							uc009zwi.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6						c.(2041-2043)GAA>AAA		RNA binding motif protein 19							151.0	149.0	150.0					12																	114374839		2203	4300	6503	SO:0001583	missense	9904				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding	g.chr12:114374839C>T	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2041G>A	12.37:g.114374839C>T	ENSP00000442053:p.Glu681Lys					RBM19_uc001tvn.3_Missense_Mutation_p.E681K|RBM19_uc001tvm.2_Missense_Mutation_p.E681K	p.E681K	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN			16	2185	-	Medulloblastoma(191;0.163)|all_neural(191;0.178)		681					A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	ENST00000545145.2	37	c.2041G>A	CCDS9172.1	.	.	.	.	.	.	.	.	.	.	C	9.004	0.980902	0.18812	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.05786	3.39;3.39;3.39	4.8	3.9	0.45041	Nucleotide-binding, alpha-beta plait (1);	0.729551	0.12996	N	0.422009	T	0.04952	0.0133	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.45308	-0.9270	10	0.06236	T	0.91	-0.1352	8.104	0.30874	0.0:0.7432:0.1627:0.094	.	681	Q9Y4C8	RBM19_HUMAN	K	681	ENSP00000442053:E681K;ENSP00000376344:E681K;ENSP00000261741:E681K	ENSP00000261741:E681K	E	-	1	0	RBM19	112859222	0.002000	0.14202	0.001000	0.08648	0.005000	0.04900	1.529000	0.35996	0.996000	0.38943	0.655000	0.94253	GAA		0.567	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196		11	118	0	0	0	0.013537	0	11	118				
MAP1LC3B2	643246	broad.mit.edu	37	12	117013775	117013775	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:117013775C>G	ENST00000556529.1	+	1	120	c.28C>G	c.(28-30)Cgg>Ggg	p.R10G	MAP1LC3B2_ENST00000306985.4_Missense_Mutation_p.R10G			A6NCE7	MP3B2_HUMAN	microtubule-associated protein 1 light chain 3 beta 2	10					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|microtubule (GO:0005874)		p.R10G(1)		breast(1)|large_intestine(2)|lung(3)	6						CTTCAAGCAGCGGCGCACCTT	0.607																																							uc009zwk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(28-30)CGG>GGG		microtubule-associated protein 1 light chain 3							83.0	81.0	82.0					12																	117013775		2203	4300	6503	SO:0001583	missense	643246				autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule		g.chr12:117013775C>G		CCDS41841.1	12q24.22	2014-02-12			ENSG00000171471	ENSG00000171471			34390	protein-coding gene	gene with protein product							Standard	NM_001085481		Approved	ATG8G	uc009zwk.1	A6NCE7		ENST00000556529.1:c.28C>G	12.37:g.117013775C>G	ENSP00000450524:p.Arg10Gly						p.R10G	NM_001085481	NP_001078950	A6NCE7	MP3B2_HUMAN			2	182	+			10						Missense_Mutation	SNP	ENST00000556529.1	37	c.28C>G	CCDS41841.1	.	.	.	.	.	.	.	.	.	.	c	2.900	-0.227697	0.06022	.	.	ENSG00000171471	ENST00000306985;ENST00000556529	T;T	0.45276	0.9;0.9	2.71	0.0969	0.14492	.	0.137625	0.43919	U	0.000504	T	0.24967	0.0606	L	0.33710	1.025	0.22610	N	0.998937	B	0.10296	0.003	B	0.15484	0.013	T	0.15780	-1.0425	10	0.72032	D	0.01	-7.7031	2.2994	0.04158	0.2699:0.4932:0.0:0.237	.	10	A6NCE7	MP3B2_HUMAN	G	10	ENSP00000305059:R10G;ENSP00000450524:R10G	ENSP00000305059:R10G	R	+	1	2	MAP1LC3B2	115498158	1.000000	0.71417	0.087000	0.20705	0.038000	0.13279	0.594000	0.24014	-0.096000	0.12329	0.375000	0.23000	CGG		0.607	MAP1LC3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413900.1	NM_001085481		14	62	0	0	0	0.00245	0	14	62				
KSR2	283455	broad.mit.edu	37	12	117907527	117907527	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:117907527T>A	ENST00000339824.5	-	19	3513	c.2786A>T	c.(2785-2787)gAg>gTg	p.E929V	KSR2_ENST00000425217.1_Missense_Mutation_p.E900V|KSR2_ENST00000302438.5_3'UTR			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	929	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.E961V(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGCAGTTTCTCCAGCATGTC	0.483																																							uc001two.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15						c.(2698-2700)GAG>GTG		kinase suppressor of ras 2							124.0	124.0	124.0					12																	117907527		1986	4177	6163	SO:0001583	missense	283455				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr12:117907527T>A	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.2786A>T	12.37:g.117907527T>A	ENSP00000339952:p.Glu929Val						p.E900V	NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN			19	2754	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		929			Protein kinase.		A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	37	c.2699A>T		.	.	.	.	.	.	.	.	.	.	T	23.8	4.460411	0.84317	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	T;T	0.81078	-1.45;-1.45	4.68	4.68	0.58851	Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91593	0.7344	M	0.93638	3.44	0.80722	D	1	D	0.69078	0.997	D	0.69824	0.966	D	0.93699	0.7014	10	0.87932	D	0	.	14.1343	0.65276	0.0:0.0:0.0:1.0	.	929	Q6VAB6	KSR2_HUMAN	V	900;929	ENSP00000389715:E900V;ENSP00000339952:E929V	ENSP00000339952:E929V	E	-	2	0	KSR2	116391910	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.008000	0.88588	1.738000	0.51689	0.460000	0.39030	GAG		0.483	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598		15	11	0	0	0	0.004007	0	15	11				
RIMBP2	23504	broad.mit.edu	37	12	130926753	130926753	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:130926753G>T	ENST00000261655.4	-	8	1256	c.1093C>A	c.(1093-1095)Cgc>Agc	p.R365S	RIMBP2_ENST00000535703.1_Missense_Mutation_p.R273S|RIMBP2_ENST00000536002.1_Missense_Mutation_p.R273S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	365	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.R365S(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		ACGGAGATGCGGTAGGTGCAG	0.627																																							uc001uil.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11						c.(1093-1095)CGC>AGC		RIM-binding protein 2							158.0	151.0	153.0					12																	130926753		2203	4300	6503	SO:0001583	missense	23504					cell junction|synapse		g.chr12:130926753G>T	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1093C>A	12.37:g.130926753G>T	ENSP00000261655:p.Arg365Ser					RIMBP2_uc001uim.2_Missense_Mutation_p.R273S|RIMBP2_uc001uin.1_Missense_Mutation_p.R24S	p.R365S	NM_015347	NP_056162	O15034	RIMB2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)	8	1257	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	365			Fibronectin type-III 1.		Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	c.1093C>A	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	g	23.4	4.415541	0.83449	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.52754	0.65;0.65;0.65	4.09	4.09	0.47781	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.70587	0.3241	M	0.85859	2.78	0.80722	D	1	D;D;D	0.69078	0.997;0.983;0.997	P;D;D	0.76071	0.866;0.921;0.987	T	0.73814	-0.3864	10	0.34782	T	0.22	-31.2126	16.3122	0.82883	0.0:0.0:1.0:0.0	.	273;273;365	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	S	365;273;273;273	ENSP00000261655:R365S;ENSP00000440347:R273S;ENSP00000439159:R273S	ENSP00000261655:R365S	R	-	1	0	RIMBP2	129492706	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	5.581000	0.67471	1.795000	0.52594	0.431000	0.28591	CGC		0.627	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347		40	26	1	0	2.2871e-25	0.007835	4.00984e-25	40	26				
EP400	57634	broad.mit.edu	37	12	132529882	132529882	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr12:132529882A>G	ENST00000333577.4	+	39	7020	c.6911A>G	c.(6910-6912)aAg>aGg	p.K2304R	EP400_ENST00000330386.6_Missense_Mutation_p.K2187R|EP400_ENST00000332482.4_Missense_Mutation_p.K2231R|EP400_ENST00000389562.2_Missense_Mutation_p.K2267R|EP400_ENST00000389561.2_Missense_Mutation_p.K2268R			Q96L91	EP400_HUMAN	E1A binding protein p400	2304					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.K2267R(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		AGGAAGAAGAAGCAGCGTCAC	0.557																																							uc001ujn.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12						c.(6802-6804)AAG>AGG		E1A binding protein p400							45.0	45.0	45.0					12																	132529882		2203	4300	6503	SO:0001583	missense	57634				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity	g.chr12:132529882A>G	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.6911A>G	12.37:g.132529882A>G	ENSP00000333602:p.Lys2304Arg					EP400_uc001ujl.2_Missense_Mutation_p.K2267R|EP400_uc001ujm.2_Missense_Mutation_p.K2187R	p.K2268R	NM_015409	NP_056224	Q96L91	EP400_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)	37	6838	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)	2304					O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37	c.6803A>G		.	.	.	.	.	.	.	.	.	.	A	15.96	2.986172	0.53934	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.91843	-2.91;-2.9;-2.92;-2.91;-2.9	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.96303	0.8794	M	0.85197	2.74	0.37755	D	0.926108	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	D	0.98143	1.0437	10	0.66056	D	0.02	.	15.6208	0.76805	1.0:0.0:0.0:0.0	.	2268;2187;2267	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	R	2304;2268;2267;2231;2187;2268	ENSP00000333602:K2304R;ENSP00000374212:K2268R;ENSP00000374213:K2267R;ENSP00000331737:K2231R;ENSP00000330620:K2187R	ENSP00000330620:K2187R	K	+	2	0	EP400	131095835	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	8.948000	0.93006	2.098000	0.63641	0.533000	0.62120	AAG		0.557	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409		6	24	0	0	0	0.001168	0	6	24				
IFT88	8100	broad.mit.edu	37	13	21166539	21166539	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr13:21166539G>C	ENST00000319980.6	+	9	748	c.421G>C	c.(421-423)Gat>Cat	p.D141H	IFT88_ENST00000382778.4_Missense_Mutation_p.D141H|IFT88_ENST00000351808.5_Missense_Mutation_p.D132H|IFT88_ENST00000537103.1_Missense_Mutation_p.D113H	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	141					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)		p.D141H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		CAAGAAAAAAGATAGGTATGT	0.348																																							uc001unh.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(421-423)GAT>CAT		intraflagellar transport 88 homolog isoform 1							57.0	55.0	55.0					13																	21166539		2203	4300	6503	SO:0001583	missense	8100				cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding	g.chr13:21166539G>C	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.421G>C	13.37:g.21166539G>C	ENSP00000323580:p.Asp141His					IFT88_uc001uni.2_Missense_Mutation_p.D132H|IFT88_uc001unj.2_Missense_Mutation_p.D131H|IFT88_uc010tcq.1_Missense_Mutation_p.D112H	p.D141H	NM_175605	NP_783195	Q13099	IFT88_HUMAN		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)	9	817	+		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)	141					A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	c.421G>C	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	G	14.80	2.644989	0.47258	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.88518	0.6458	M	0.78049	2.395	0.80722	D	1	B;D	0.89917	0.314;1.0	B;D	0.85130	0.34;0.997	D	0.88972	0.3401	10	0.66056	D	0.02	-30.1449	17.849	0.88739	0.0:0.0:1.0:0.0	.	113;141	F5H6C2;Q13099	.;IFT88_HUMAN	H	141;38;132;141;113	ENSP00000372228:D141H;ENSP00000261632:D132H;ENSP00000323580:D141H;ENSP00000437719:D113H	ENSP00000323580:D141H	D	+	1	0	IFT88	20064539	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	8.077000	0.89505	2.733000	0.93635	0.650000	0.86243	GAT		0.348	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531		3	37	0	0	0	0.009096	0	3	37				
PROSER1	80209	broad.mit.edu	37	13	39586310	39586310	+	Silent	SNP	C	C	A	rs370484502		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr13:39586310C>A	ENST00000352251.3	-	12	3455	c.2622G>T	c.(2620-2622)ccG>ccT	p.P874P	PROSER1_ENST00000484434.3_5'UTR|PROSER1_ENST00000350125.3_Silent_p.P852P	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	874								p.P874P(1)									CAGGGATACCCGGGAGGGACA	0.453																																							uc001uwy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	5						c.(2620-2622)CCG>CCT		hypothetical protein LOC80209 isoform 1							145.0	163.0	157.0					13																	39586310		2203	4300	6503	SO:0001819	synonymous_variant	80209							g.chr13:39586310C>A	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.2622G>T	13.37:g.39586310C>A						C13orf23_uc001uwz.2_Silent_p.P852P	p.P874P	NM_025138	NP_079414	Q86XN7	CM023_HUMAN		all cancers(112;3.7e-08)|Epithelial(112;4.28e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00114)|BRCA - Breast invasive adenocarcinoma(63;0.00366)|GBM - Glioblastoma multiforme(144;0.0146)	12	3495	-		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)	874					A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Silent	SNP	ENST00000352251.3	37	c.2622G>T	CCDS9368.2																																																																																				0.453	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138		19	148	1	0	4.96729e-08	0.008871	6.02321e-08	19	148				
DIAPH3	81624	broad.mit.edu	37	13	60485886	60485886	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr13:60485886C>T	ENST00000400324.4	-	20	2570	c.2350G>A	c.(2350-2352)Gag>Aag	p.E784K	DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400330.1_Missense_Mutation_p.E784K|DIAPH3_ENST00000267215.4_Missense_Mutation_p.E784K|DIAPH3_ENST00000400320.1_Missense_Mutation_p.E738K|DIAPH3_ENST00000377908.2_Missense_Mutation_p.E773K|DIAPH3_ENST00000400319.1_Missense_Mutation_p.E714K	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	784	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E784K(1)		cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		ACAAACTGCTCAGGTTCACAT	0.343																																							uc001vht.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2350-2352)GAG>AAG		diaphanous homolog 3 isoform a							85.0	79.0	81.0					13																	60485886		1861	4117	5978	SO:0001583	missense	81624				actin cytoskeleton organization		actin binding|Rho GTPase binding	g.chr13:60485886C>T	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2350G>A	13.37:g.60485886C>T	ENSP00000383178:p.Glu784Lys					DIAPH3_uc001vhu.2_Missense_Mutation_p.E521K|DIAPH3_uc001vhv.2_Missense_Mutation_p.E362K	p.E784K	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN		GBM - Glioblastoma multiforme(99;2.77e-05)	20	2569	-		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)	784			FH2.		A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	c.2350G>A	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013386	0.93346	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44	5.92	5.92	0.95590	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.117466	0.64402	D	0.000013	T	0.69593	0.3128	H	0.94183	3.505	0.58432	D	0.999996	D;D;D	0.89917	0.98;0.985;1.0	P;D;D	0.87578	0.871;0.913;0.998	T	0.77451	-0.2583	10	0.87932	D	0	.	20.3343	0.98733	0.0:1.0:0.0:0.0	.	521;521;784	Q9NSV4-2;Q9NSV4-1;Q9NSV4	.;.;DIAP3_HUMAN	K	784;784;773;738;714;773;714;738;784;521;784	ENSP00000383178:E784K;ENSP00000383184:E784K;ENSP00000367141:E773K;ENSP00000383173:E714K;ENSP00000383174:E738K;ENSP00000267215:E784K	ENSP00000267214:E521K	E	-	1	0	DIAPH3	59383887	1.000000	0.71417	0.982000	0.44146	0.881000	0.50899	7.326000	0.79133	2.822000	0.97130	0.650000	0.86243	GAG		0.343	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517		19	25	0	0	0	0.007413	0	19	25				
GPC5	2262	broad.mit.edu	37	13	92797141	92797141	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr13:92797141G>T	ENST00000377067.3	+	7	1832	c.1460G>T	c.(1459-1461)gGt>gTt	p.G487V		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	487					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.G487V(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CTGGGCAGTGGTGGAGGCATG	0.463																																							uc010tif.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5						c.(1459-1461)GGT>GTT		glypican 5 precursor							178.0	158.0	165.0					13																	92797141		2203	4300	6503	SO:0001583	missense	2262					anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chr13:92797141G>T	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1460G>T	13.37:g.92797141G>T	ENSP00000366267:p.Gly487Val						p.G487V	NM_004466	NP_004457	P78333	GPC5_HUMAN			7	1826	+	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)	487					B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	c.1460G>T	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.487576	0.64074	.	.	ENSG00000179399	ENST00000377067	D	0.81908	-1.55	5.68	5.68	0.88126	.	0.138592	0.49305	D	0.000147	D	0.90834	0.7121	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91147	0.4950	10	0.62326	D	0.03	-2.3764	16.9496	0.86240	0.0:0.0:1.0:0.0	.	487	P78333	GPC5_HUMAN	V	487	ENSP00000366267:G487V	ENSP00000366267:G487V	G	+	2	0	GPC5	91595142	1.000000	0.71417	0.920000	0.36463	0.544000	0.35116	6.945000	0.75947	2.677000	0.91161	0.563000	0.77884	GGT		0.463	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466		25	55	1	0	8.24728e-16	0.004656	1.24169e-15	25	55				
NALCN	259232	broad.mit.edu	37	13	101748033	101748033	+	Splice_Site	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr13:101748033T>C	ENST00000251127.6	-	28	3244		c.e28-2			NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective						calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.?(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCAATCTTCCTAAAGTAGAAA	0.378																																							uc001vox.1		NA																	1	Unknown(1)		lung(1)	ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.e28-1		voltage gated channel like 1							49.0	53.0	52.0					13																	101748033		2203	4299	6502	SO:0001630	splice_region_variant	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101748033T>C	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3163-2A>G	13.37:g.101748033T>C							p.E1055_splice	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			28	3352	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)							Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Splice_Site	SNP	ENST00000251127.6	37	c.3163_splice	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.995412	0.74703	.	.	ENSG00000102452	ENST00000251127	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7248	0.69336	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NALCN	100546034	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.551000	0.82182	1.884000	0.54569	0.459000	0.35465	.		0.378	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	Intron	11	62	0	0	0	0.010729	0	11	62				
DAOA	267012	broad.mit.edu	37	13	106119472	106119472	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr13:106119472A>T	ENST00000375936.3	+	2	161	c.115A>T	c.(115-117)Aac>Tac	p.N39Y	DAOA-AS1_ENST00000448407.1_RNA|DAOA_ENST00000329625.5_5'UTR	NM_001161812.1|NM_172370.3	NP_001155284.1|NP_758958.3	P59103	DAOA_HUMAN	D-amino acid oxidase activator	39					negative regulation of D-amino-acid oxidase activity (GO:1900758)|positive regulation of catalytic activity (GO:0043085)	Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)	p.N39Y(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	13	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					CAAATCTGAAAACTCTCTAAA	0.284																																							uc001vqb.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(115-117)AAC>TAC		D-amino acid oxidase activator isoform 1							82.0	79.0	80.0					13																	106119472		1791	4056	5847	SO:0001583	missense	267012					Golgi apparatus		g.chr13:106119472A>T	AY138547	CCDS41905.1, CCDS53880.1, CCDS59242.1	13q33.2	2011-08-01			ENSG00000182346	ENSG00000182346			21191	protein-coding gene	gene with protein product	"""G72 transcript"""	607408				12364586, 15057823	Standard	NM_001161814		Approved	G72	uc010tjg.2	P59103	OTTHUMG00000041333	ENST00000375936.3:c.115A>T	13.37:g.106119472A>T	ENSP00000365103:p.Asn39Tyr					DAOA_uc010tjf.1_5'UTR|DAOA_uc001vpz.2_RNA|DAOA_uc010agd.2_RNA|DAOA_uc010tjg.1_5'UTR|DAOA_uc001vqc.2_RNA|DAOA_uc001vqe.2_RNA	p.N39Y	NM_172370	NP_758958	P59103	DAOA_HUMAN			2	389	+	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)		39					A6NKG7|Q0VAE6|Q5VX59|Q86Y17|Q8IWM4	Missense_Mutation	SNP	ENST00000375936.3	37	c.115A>T	CCDS41905.1	.	.	.	.	.	.	.	.	.	.	A	7.496	0.651580	0.14516	.	.	ENSG00000182346	ENST00000375936	T	0.31510	1.49	3.58	2.4	0.29515	.	.	.	.	.	T	0.22003	0.0530	N	0.14661	0.345	0.09310	N	0.999997	P	0.49447	0.924	P	0.47981	0.563	T	0.07443	-1.0772	9	0.87932	D	0	.	5.8059	0.18440	0.8772:0.0:0.1228:0.0	.	39	P59103	DAOA_HUMAN	Y	39	ENSP00000365103:N39Y	ENSP00000365103:N39Y	N	+	1	0	DAOA	104917473	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.302000	0.19192	0.733000	0.32492	-0.280000	0.10049	AAC		0.284	DAOA-005	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099040.2	NM_172370		8	62	0	0	0	0.004482	0	8	62				
MYO16	23026	broad.mit.edu	37	13	109707460	109707460	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr13:109707460G>A	ENST00000357550.2	+	25	3090	c.3049G>A	c.(3049-3051)Gca>Aca	p.A1017T	MYO16_ENST00000356711.2_Missense_Mutation_p.A1017T|MYO16_ENST00000457511.2_Missense_Mutation_p.A529T	NM_001198950.1	NP_001185879.1			myosin XVI									p.A1017T(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			AGTCACCATAGCATCACAACT	0.328																																							uc001vqt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(3049-3051)GCA>ACA		myosin heavy chain Myr 8							70.0	70.0	70.0					13																	109707460		2203	4299	6502	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109707460G>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3049G>A	13.37:g.109707460G>A	ENSP00000350160:p.Ala1017Thr					MYO16_uc010agk.1_Missense_Mutation_p.A1039T|MYO16_uc001vqu.1_Missense_Mutation_p.A817T|MYO16_uc010tjh.1_Missense_Mutation_p.A529T	p.A1017T	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		26	3175	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		1017			Myosin head-like 2.			Missense_Mutation	SNP	ENST00000357550.2	37	c.3049G>A	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284937	0.80803	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000375857;ENST00000457511	D;D;D	0.88509	-2.39;-2.39;-2.39	5.09	5.09	0.68999	Myosin head, motor domain (2);	0.000000	0.36101	U	0.002790	D	0.87132	0.6101	L	0.46885	1.475	0.48696	D	0.999694	D;B;P	0.53745	0.962;0.326;0.933	P;B;P	0.48552	0.581;0.231;0.572	D	0.85899	0.1433	9	.	.	.	.	11.0362	0.47802	0.0846:0.0:0.9154:0.0	.	529;1017;1017	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	T	1017;1017;805;529	ENSP00000349145:A1017T;ENSP00000350160:A1017T;ENSP00000401633:A529T	.	A	+	1	0	MYO16	108505461	1.000000	0.71417	0.117000	0.21633	0.974000	0.67602	5.837000	0.69381	2.358000	0.79984	0.655000	0.94253	GCA		0.328	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		7	26	0	0	0	0.006214	0	7	26				
OR4M1	441670	broad.mit.edu	37	14	20248996	20248996	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:20248996A>G	ENST00000315957.4	+	1	596	c.515A>G	c.(514-516)aAt>aGt	p.N172S		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTGGGCCCAATGAGTTAGAC	0.498																																							uc010tku.1		NA																	0					0						c.(514-516)AAT>AGT		olfactory receptor, family 4, subfamily M,							236.0	238.0	238.0					14																	20248996		2203	4298	6501	SO:0001583	missense	441670				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20248996A>G		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.515A>G	14.37:g.20248996A>G	ENSP00000319654:p.Asn172Ser						p.N172S	NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	515	+	all_cancers(95;0.00108)		172			Extracellular (Potential).		B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	c.515A>G	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	14.93	2.683049	0.47991	.	.	ENSG00000176299	ENST00000315957	T	0.00241	8.46	4.43	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000059	T	0.00300	0.0009	M	0.87682	2.9	0.26196	N	0.979512	P	0.42123	0.771	B	0.42916	0.402	T	0.19063	-1.0317	10	0.66056	D	0.02	-11.4509	6.7335	0.23397	0.8956:0.0:0.1044:0.0	.	172	Q8NGD0	OR4M1_HUMAN	S	172	ENSP00000319654:N172S	ENSP00000319654:N172S	N	+	2	0	OR4M1	19318836	0.391000	0.25221	1.000000	0.80357	0.994000	0.84299	1.929000	0.40114	1.995000	0.58328	0.414000	0.27820	AAT		0.498	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1			107	250	0	0	0	0.01441	0	107	250				
NGDN	25983	broad.mit.edu	37	14	23944436	23944436	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:23944436G>A	ENST00000408901.3	+	4	229	c.201G>A	c.(199-201)ttG>ttA	p.L67L	NGDN_ENST00000397154.3_Silent_p.L67L|NGDN_ENST00000556580.1_5'Flank	NM_001042635.1|NM_015514.1	NP_001036100.1|NP_056329.1	Q8NEJ9	NGDN_HUMAN	neuroguidin, EIF4E binding protein	67	Necessary for interaction with EIF4E. {ECO:0000250}.				regulation of translation (GO:0006417)	cell projection (GO:0042995)|chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L67L(2)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	12	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		TTATGGATTTGACCCACCTCA	0.458																																							uc001wjy.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(199-201)TTG>TTA		neuroguidin isoform 1							142.0	131.0	135.0					14																	23944436		2203	4300	6503	SO:0001819	synonymous_variant	25983				regulation of translation	axon|cytoplasm|dendrite|filopodium|nucleus		g.chr14:23944436G>A	AK022215	CCDS32051.1, CCDS41926.1	14q11.2	2014-06-13	2006-08-02	2006-08-02	ENSG00000129460	ENSG00000129460			20271	protein-coding gene	gene with protein product		610777	"""chromosome 14 open reading frame 120"""	C14orf120		16705177	Standard	NM_001042635		Approved	DKFZP564O092, LCP5, lpd-2, NGD	uc001wjy.3	Q8NEJ9	OTTHUMG00000171501	ENST00000408901.3:c.201G>A	14.37:g.23944436G>A						NGDN_uc001wjz.2_Silent_p.L67L|NGDN_uc001wka.2_5'Flank	p.L67L	NM_001042635	NP_001036100	Q8NEJ9	NGDN_HUMAN		GBM - Glioblastoma multiforme(265;0.00654)	4	228	+	all_cancers(95;0.000251)		67			Necessary for interaction with EIF4E (By similarity).		A8K760|Q9Y400	Silent	SNP	ENST00000408901.3	37	c.201G>A	CCDS41926.1	.	.	.	.	.	.	.	.	.	.	G	7.833	0.720191	0.15372	.	.	ENSG00000129460	ENST00000556483	.	.	.	6.17	3.24	0.37175	.	.	.	.	.	T	0.59473	0.2196	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53129	-0.8482	4	.	.	.	-0.3185	9.9411	0.41580	0.2374:0.0:0.7626:0.0	.	.	.	.	N	61	.	.	D	+	1	0	NGDN	23014276	0.998000	0.40836	0.997000	0.53966	0.934000	0.57294	0.219000	0.17641	0.410000	0.25675	-0.140000	0.14226	GAC		0.458	NGDN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413782.3	NM_001042635		9	163	0	0	0	0.006214	0	9	163				
FBXO34	55030	broad.mit.edu	37	14	55817595	55817595	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:55817595C>T	ENST00000313833.4	+	2	732	c.487C>T	c.(487-489)Cag>Tag	p.Q163*	FBXO34_ENST00000440021.1_Nonsense_Mutation_p.Q163*	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	163								p.Q163*(1)		breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						AGCCAAGGTACAGGTGGAAAG	0.438																																							uc001xbu.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|lung(2)|skin(1)	5						c.(487-489)CAG>TAG		F-box only protein 34							66.0	60.0	62.0					14																	55817595		2203	4300	6503	SO:0001587	stop_gained	55030							g.chr14:55817595C>T	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.487C>T	14.37:g.55817595C>T	ENSP00000313159:p.Gln163*					FBXO34_uc001xbv.2_RNA|FBXO34_uc010aoo.2_Nonsense_Mutation_p.Q163*	p.Q163*	NM_017943	NP_060413	Q9NWN3	FBX34_HUMAN			2	732	+			163					Q2VPB5|Q4VBP5|Q86TY4	Nonsense_Mutation	SNP	ENST00000313833.4	37	c.487C>T	CCDS32086.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093905	0.36952	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	.	.	.	5.34	5.34	0.76211	.	0.423205	0.19711	U	0.107812	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	19.2334	0.93849	0.0:1.0:0.0:0.0	.	.	.	.	X	163	.	ENSP00000313159:Q163X	Q	+	1	0	FBXO34	54887348	0.999000	0.42202	0.927000	0.36925	0.007000	0.05969	4.362000	0.59467	2.781000	0.95711	0.650000	0.86243	CAG		0.438	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1			7	54	0	0	0	0.00308	0	7	54				
PRKCH	5583	broad.mit.edu	37	14	61917613	61917613	+	Silent	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:61917613C>T	ENST00000332981.5	+	6	1141	c.756C>T	c.(754-756)aaC>aaT	p.N252N	PRKCH_ENST00000555082.1_Silent_p.N91N	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	252					blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.N252N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		GCATCCACAACTACAAAGTGC	0.448																																					Melanoma(135;863 1779 8064 14443 26348)	Melanoma(135;863 1779 8064 14443 26348)	uc001xfn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6						c.(754-756)AAC>AAT		protein kinase C, eta							176.0	139.0	151.0					14																	61917613		2203	4300	6503	SO:0001819	synonymous_variant	5583				intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity	g.chr14:61917613C>T	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.756C>T	14.37:g.61917613C>T						PRKCH_uc010tsa.1_Silent_p.N91N	p.N252N	NM_006255	NP_006246	P24723	KPCL_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)	6	1061	+			252			Phorbol-ester/DAG-type 2.		B4DJN5|Q16246|Q8NE03	Silent	SNP	ENST00000332981.5	37	c.756C>T	CCDS9752.1																																																																																				0.448	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255		20	54	0	0	0	0.008871	0	20	54				
RPS6KL1	83694	broad.mit.edu	37	14	75388074	75388074	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:75388074G>T	ENST00000555647.1	-	3	458	c.171C>A	c.(169-171)atC>atA	p.I57I	RPS6KL1_ENST00000557413.1_Silent_p.I57I|RPS6KL1_ENST00000354625.2_Silent_p.I57I|RPS6KL1_ENST00000358328.4_Silent_p.I57I|RPS6KL1_ENST00000554900.1_5'UTR			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	57						ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.I57I(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		GGGCCAGCCGGATCTGCGTGG	0.592																																							uc010tux.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|stomach(1)|central_nervous_system(1)	3						c.(169-171)ATC>ATA		ribosomal protein S6 kinase-like 1							126.0	107.0	113.0					14																	75388074		2203	4300	6503	SO:0001819	synonymous_variant	83694					ribosome	ATP binding|protein serine/threonine kinase activity	g.chr14:75388074G>T	BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.171C>A	14.37:g.75388074G>T						RPS6KL1_uc001xqw.2_Silent_p.I57I|RPS6KL1_uc010asd.1_RNA|RPS6KL1_uc001xqy.1_Silent_p.I57I	p.I57I	NM_031464	NP_113652	Q9Y6S9	RPKL1_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00658)	2	699	-			57					A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Silent	SNP	ENST00000555647.1	37	c.171C>A	CCDS9834.2																																																																																				0.592	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413732.1			19	81	1	0	7.45023e-12	0.010504	1.02981e-11	19	81				
MLH3	27030	broad.mit.edu	37	14	75515141	75515141	+	Silent	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:75515141C>T	ENST00000556740.1	-	1	1253	c.1218G>A	c.(1216-1218)ttG>ttA	p.L406L	MLH3_ENST00000238662.7_Silent_p.L406L|MLH3_ENST00000544985.1_5'Flank|MLH3_ENST00000556257.1_Silent_p.L406L|MLH3_ENST00000555671.1_5'Flank|MLH3_ENST00000380968.2_5'UTR|MLH3_ENST00000355774.2_Silent_p.L406L			Q9UHC1	MLH3_HUMAN	mutL homolog 3	406					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)	p.L406L(2)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		CTTTTGACTGCAAATTAAACA	0.353								Mismatch excision repair (MMR)																															uc001xrd.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(1216-1218)TTG>TTA	MMR	mutL homolog 3 isoform 1							48.0	48.0	48.0					14																	75515141		2202	4300	6502	SO:0001819	synonymous_variant	27030				mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding	g.chr14:75515141C>T	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.1218G>A	14.37:g.75515141C>T						MLH3_uc001xre.1_Silent_p.L406L|MLH3_uc010tuy.1_RNA	p.L406L	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.00688)	2	1434	-			406					P49751|Q56DK9|Q9P292|Q9UHC0	Silent	SNP	ENST00000556740.1	37	c.1218G>A	CCDS32123.1																																																																																				0.353	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381		13	41	0	0	0	0.013537	0	13	41				
TSHR	7253	broad.mit.edu	37	14	81534648	81534648	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:81534648A>G	ENST00000541158.2	+	4	615	c.293A>G	c.(292-294)tAc>tGc	p.Y98C	TSHR_ENST00000298171.2_Missense_Mutation_p.Y98C|TSHR_ENST00000554263.1_Missense_Mutation_p.Y98C|TSHR_ENST00000342443.6_Missense_Mutation_p.Y98C|TSHR_ENST00000554435.1_Missense_Mutation_p.Y98C			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	98					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)	p.Y98C(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	CACTCCTTCTACAATTTGAGT	0.403			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																																uc001xvd.1		NA	yes	Dom	yes		14	14q31	7253	Mis	thyroid stimulating hormone receptor	yes	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 	E		thyroid  adenoma	toxic thyroid adenoma		2	Substitution - Missense(2)		lung(2)	thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299						c.(292-294)TAC>TGC		thyroid stimulating hormone receptor isoform 1	Thyrotropin Alfa(DB00024)						111.0	97.0	101.0					14																	81534648		2203	4300	6503	SO:0001583	missense	7253				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity	g.chr14:81534648A>G	AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.293A>G	14.37:g.81534648A>G	ENSP00000441235:p.Tyr98Cys					TSHR_uc001xvb.1_Missense_Mutation_p.Y98C|TSHR_uc001xvc.2_Missense_Mutation_p.Y98C|TSHR_uc010tvs.1_Missense_Mutation_p.Y98C	p.Y98C	NM_000369	NP_000360	P16473	TSHR_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0402)	3	449	+			98			Extracellular (Potential).		A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	ENST00000541158.2	37	c.293A>G	CCDS9872.1	.	.	.	.	.	.	.	.	.	.	A	17.85	3.489369	0.64074	.	.	ENSG00000165409	ENST00000541158;ENST00000342443;ENST00000298171;ENST00000554263;ENST00000554435	T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26	6.06	4.89	0.63831	.	0.242564	0.43919	D	0.000502	T	0.81384	0.4811	L	0.43152	1.355	0.49051	D	0.999748	D;D;D;D	0.89917	0.986;0.998;1.0;0.998	P;P;D;D	0.66602	0.86;0.866;0.945;0.918	T	0.80329	-0.1428	10	0.46703	T	0.11	.	10.4294	0.44398	0.8544:0.0:0.0:0.1456	.	98;98;98;98	G3V2A9;F5GYU5;P16473-2;P16473	.;.;.;TSHR_HUMAN	C	98	ENSP00000441235:Y98C;ENSP00000340113:Y98C;ENSP00000298171:Y98C;ENSP00000451202:Y98C;ENSP00000450549:Y98C	ENSP00000298171:Y98C	Y	+	2	0	TSHR	80604401	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.664000	0.68045	1.074000	0.40909	0.533000	0.62120	TAC		0.403	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369		14	47	0	0	0	0.004007	0	14	47				
BTBD7	55727	broad.mit.edu	37	14	93709365	93709365	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:93709365C>A	ENST00000334746.5	-	11	2960	c.2653G>T	c.(2653-2655)Gac>Tac	p.D885Y	BTBD7_ENST00000554565.1_Missense_Mutation_p.D534Y|BTBD7_ENST00000393170.2_Missense_Mutation_p.D459Y	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	885					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)		p.D885Y(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		AGCCTCCTGTCCTTGAGTGAC	0.532																																							uc001ybo.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2653-2655)GAC>TAC		BTB (POZ) domain containing 7 isoform 1							157.0	143.0	147.0					14																	93709365		2203	4300	6503	SO:0001583	missense	55727							g.chr14:93709365C>A	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.2653G>T	14.37:g.93709365C>A	ENSP00000335615:p.Asp885Tyr					BTBD7_uc010aur.2_Missense_Mutation_p.D410Y|BTBD7_uc010two.1_Missense_Mutation_p.D705Y|BTBD7_uc001ybp.2_Missense_Mutation_p.D534Y	p.D885Y	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)	11	2979	-		all_cancers(154;0.08)	885					A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	ENST00000334746.5	37	c.2653G>T	CCDS32146.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166052	0.78339	.	.	ENSG00000011114	ENST00000334746;ENST00000554565;ENST00000553975;ENST00000393170	T;T	0.54071	0.93;0.59	5.86	5.86	0.93980	.	0.083381	0.85682	D	0.000000	T	0.61874	0.2382	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.994	D;D;P	0.73380	0.98;0.939;0.819	T	0.65475	-0.6159	10	0.72032	D	0.01	.	20.2504	0.98404	0.0:1.0:0.0:0.0	.	459;534;885	E7ERI4;Q9P203-5;Q9P203	.;.;BTBD7_HUMAN	Y	885;534;500;459	ENSP00000335615:D885Y;ENSP00000451010:D534Y	ENSP00000335615:D885Y	D	-	1	0	BTBD7	92779118	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.199000	0.77831	2.800000	0.96347	0.650000	0.86243	GAC		0.532	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860		19	163	1	0	6.94344e-10	0.006122	8.89903e-10	19	163				
UNC79	57578	broad.mit.edu	37	14	94139777	94139777	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:94139777T>A	ENST00000393151.2	+	42	6834	c.6834T>A	c.(6832-6834)gaT>gaA	p.D2278E	UNC79_ENST00000256339.4_Missense_Mutation_p.D2101E|UNC79_ENST00000555664.1_Missense_Mutation_p.D2239E|UNC79_ENST00000553484.1_Missense_Mutation_p.D2300E			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2278					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D2300E(1)|p.D2101E(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CTTTACCAGATACAAACCTTC	0.378																																							uc001ybv.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(10)|skin(4)|large_intestine(3)	17						c.(6367-6369)GAT>GAA		hypothetical protein LOC57578							157.0	151.0	153.0					14																	94139777		2203	4300	6503	SO:0001583	missense	57578					integral to membrane		g.chr14:94139777T>A	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6834T>A	14.37:g.94139777T>A	ENSP00000376858:p.Asp2278Glu					KIAA1409_uc001ybs.1_Missense_Mutation_p.D2101E	p.D2123E	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	40	6452	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	2278					B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37	c.6369T>A		.	.	.	.	.	.	.	.	.	.	T	19.69	3.874956	0.72180	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.24151	1.87;1.91;1.87;1.87	5.9	-3.82	0.04281	.	0.000000	0.85682	D	0.000000	T	0.36552	0.0971	L	0.46741	1.465	0.37305	D	0.908884	P	0.39883	0.693	P	0.54026	0.74	T	0.37454	-0.9705	10	0.87932	D	0	-23.2686	18.1764	0.89762	0.0:0.7029:0.0:0.2971	.	2300	C9JQL1	.	E	2101;2239;2300;2278;2300	ENSP00000256339:D2101E;ENSP00000450868:D2239E;ENSP00000451360:D2300E;ENSP00000376858:D2278E	ENSP00000256339:D2101E	D	+	3	2	KIAA1409	93209530	0.600000	0.26899	0.926000	0.36857	0.900000	0.52787	-0.192000	0.09587	-0.944000	0.03686	-0.256000	0.11100	GAT		0.378	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		24	146	0	0	0	0.007291	0	24	146				
TCL1B	9623	broad.mit.edu	37	14	96157078	96157078	+	Missense_Mutation	SNP	A	A	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:96157078A>C	ENST00000340722.7	+	2	219	c.168A>C	c.(166-168)gaA>gaC	p.E56D	RP11-1070N10.6_ENST00000461160.1_RNA	NM_004918.3	NP_004909.1	O95988	TCL1B_HUMAN	T-cell leukemia/lymphoma 1B	56								p.E56D(1)		cervix(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		TTCAGTATGAACCCAGCATCA	0.602																																							uc001yez.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(166-168)GAA>GAC		T-cell leukemia/lymphoma 1B							130.0	127.0	128.0					14																	96157078		2203	4300	6503	SO:0001583	missense	9623							g.chr14:96157078A>C	AB018563	CCDS32151.1	14q32.1	2008-09-05			ENSG00000213231	ENSG00000213231			11649	protein-coding gene	gene with protein product		603769				10077617	Standard	NM_004918		Approved	TML1	uc001yez.3	O95988	OTTHUMG00000028912	ENST00000340722.7:c.168A>C	14.37:g.96157078A>C	ENSP00000343223:p.Glu56Asp					TCL1B_uc001yew.2_RNA|TCL1B_uc001yex.2_RNA|TCL1B_uc010avj.2_RNA|TCL1B_uc001yfa.2_Missense_Mutation_p.E56D	p.E56D	NM_004918	NP_004909	O95988	TCL1B_HUMAN		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)	2	210	+		all_cancers(154;0.103)	56					A6NEK7|Q6IAR7|Q9UBQ4	Missense_Mutation	SNP	ENST00000340722.7	37	c.168A>C	CCDS32151.1	.	.	.	.	.	.	.	.	.	.	A	8.375	0.836120	0.16891	.	.	ENSG00000213231	ENST00000340722;ENST00000538038	T	0.35789	1.29	2.58	-1.4	0.08968	.	.	.	.	.	T	0.19525	0.0469	N	0.21282	0.65	0.09310	N	1	B	0.24651	0.108	B	0.25987	0.065	T	0.23404	-1.0189	9	0.38643	T	0.18	-0.266	2.1933	0.03905	0.4806:0.0:0.2885:0.2309	.	56	O95988	TCL1B_HUMAN	D	56	ENSP00000343223:E56D	ENSP00000343223:E56D	E	+	3	2	TCL1B	95226831	0.000000	0.05858	0.000000	0.03702	0.228000	0.25075	-2.213000	0.01224	-0.305000	0.08831	0.379000	0.24179	GAA		0.602	TCL1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315123.2			5	145	0	0	0	0.001168	0	5	145				
BEGAIN	57596	broad.mit.edu	37	14	101004814	101004814	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:101004814T>C	ENST00000355173.2	-	7	1345	c.1274A>G	c.(1273-1275)gAc>gGc	p.D425G	BEGAIN_ENST00000556751.1_Missense_Mutation_p.D361G|BEGAIN_ENST00000443071.2_Missense_Mutation_p.D425G|CTD-2062F14.3_ENST00000553301.1_lincRNA	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	425						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)		p.D425G(1)		cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				GGCGCCGATGTCCTCCACGCT	0.731																																					NSCLC(159;1889 2010 9965 27479 40101)	NSCLC(159;1889 2010 9965 27479 40101)	uc010txa.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1273-1275)GAC>GGC		brain-enriched guanylate kinase-associated							9.0	13.0	12.0					14																	101004814		2143	4248	6391	SO:0001583	missense	57596					cytoplasm|membrane	protein binding	g.chr14:101004814T>C	BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.1274A>G	14.37:g.101004814T>C	ENSP00000347301:p.Asp425Gly					BEGAIN_uc001yhp.2_Missense_Mutation_p.D361G|BEGAIN_uc001yhq.2_Missense_Mutation_p.D425G	p.D425G	NM_001159531	NP_001153003	Q9BUH8	BEGIN_HUMAN			6	1420	-		Melanoma(154;0.212)	425					Q9NPU3|Q9P282	Missense_Mutation	SNP	ENST00000355173.2	37	c.1274A>G	CCDS9962.1	.	.	.	.	.	.	.	.	.	.	t	15.62	2.886403	0.51908	.	.	ENSG00000183092	ENST00000355173;ENST00000556751;ENST00000443071	.	.	.	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.77232	0.4100	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80453	-0.1376	9	0.87932	D	0	.	13.7824	0.63089	0.0:0.0:0.0:1.0	.	425	Q9BUH8	BEGIN_HUMAN	G	425;361;425	.	ENSP00000347301:D425G	D	-	2	0	BEGAIN	100074567	1.000000	0.71417	0.967000	0.41034	0.338000	0.28826	5.736000	0.68597	1.665000	0.50811	0.370000	0.22315	GAC		0.731	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414329.1	NM_020836		5	15	0	0	0	0.001168	0	5	15				
IGHV4-31	28396	broad.mit.edu	37	14	106805666	106805666	+	RNA	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr14:106805666G>T	ENST00000438142.2	-	0	50									immunoglobulin heavy variable 4-31																		GGAGGTCCAGGACTCTCAGAA	0.498																																							uc010tyt.1		NA																	0					0						c.e359-1		Parts of antibodies, mostly variable regions.							43.0	59.0	54.0					14																	106805666		1822	4070	5892			8755							g.chr14:106805666G>T	L10098		14q32.33	2012-02-08			ENSG00000231475	ENSG00000231475		"""Immunoglobulins / IGH locus"""	5649	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152097		14.37:g.106805666G>T						uc001ysw.1_5'Flank								359		-									Splice_Site	SNP	ENST00000438142.2	37	c.13625_splice																																																																																					0.498	IGHV4-31-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000325194.1	NG_001019		10	14	1	0	4.14922e-12	0.004007	5.7946e-12	10	14				
OR4N4	283694	broad.mit.edu	37	15	22382661	22382661	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr15:22382661G>T	ENST00000328795.4	+	1	280	c.189G>T	c.(187-189)ctG>ctT	p.L63L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L63L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ATTTATTTCTGGGCAACTTGG	0.458																																							uc001yuc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(1)	5						c.(187-189)CTG>CTT		olfactory receptor, family 4, subfamily N,							141.0	143.0	142.0					15																	22382661		2201	4292	6493	SO:0001819	synonymous_variant	283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22382661G>T	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.189G>T	15.37:g.22382661G>T						LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Silent_p.L63L	p.L63L	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	7	1170	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	63			Helical; Name=2; (Potential).		Q6IEY3|Q6IF56	Silent	SNP	ENST00000328795.4	37	c.189G>T	CCDS32173.1																																																																																				0.458	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			13	232	1	0	6.97489e-18	0.004878	1.12096e-17	13	232				
NPAP1	23742	broad.mit.edu	37	15	24923271	24923271	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr15:24923271G>T	ENST00000329468.2	+	1	2731	c.2257G>T	c.(2257-2259)Gtc>Ttc	p.V753F		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	753					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.V753F(1)									TGCACAGTCAGTCAGGGCACC	0.567																																							uc001ywo.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(2257-2259)GTC>TTC		hypothetical protein LOC23742							116.0	123.0	121.0					15																	24923271		2203	4300	6503	SO:0001583	missense	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24923271G>T	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2257G>T	15.37:g.24923271G>T	ENSP00000333735:p.Val753Phe						p.V753F	NM_018958	NP_061831	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	2731	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	753						Missense_Mutation	SNP	ENST00000329468.2	37	c.2257G>T	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	6.818	0.520095	0.13005	.	.	ENSG00000185823	ENST00000329468	T	0.08102	3.13	2.2	-1.08	0.09936	.	2.649080	0.01792	N	0.032397	T	0.08758	0.0217	N	0.14661	0.345	0.09310	N	1	D	0.65815	0.995	P	0.55011	0.766	T	0.15578	-1.0432	10	0.23302	T	0.38	.	2.6893	0.05116	0.3457:0.2586:0.3957:0.0	.	753	Q9NZP6	CO002_HUMAN	F	753	ENSP00000333735:V753F	ENSP00000333735:V753F	V	+	1	0	C15orf2	22474364	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.265000	0.08644	-0.281000	0.09141	0.195000	0.17529	GTC		0.567	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		78	65	1	0	1.75807e-36	0.01441	3.37449e-36	78	65				
MYEF2	50804	broad.mit.edu	37	15	48435217	48435217	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr15:48435217C>A	ENST00000324324.7	-	17	1970	c.1691G>T	c.(1690-1692)tGt>tTt	p.C564F	MYEF2_ENST00000267836.6_Missense_Mutation_p.C540F	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	564	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.C564F(1)		endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		GACTGTTCCACAGCCTTTTGA	0.348																																							uc001zwi.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)|ovary(1)	3						c.(1690-1692)TGT>TTT		myelin expression factor 2							129.0	124.0	125.0					15																	48435217		2198	4297	6495	SO:0001583	missense	50804				transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding	g.chr15:48435217C>A	AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.1691G>T	15.37:g.48435217C>A	ENSP00000316950:p.Cys564Phe					MYEF2_uc001zwg.3_Missense_Mutation_p.C102F|MYEF2_uc001zwh.3_Missense_Mutation_p.C152F|MYEF2_uc001zwj.3_Missense_Mutation_p.C540F	p.C564F	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)	17	1815	-		all_lung(180;0.00217)	564			RRM 3.		A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	SNP	ENST00000324324.7	37	c.1691G>T	CCDS32230.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878438	0.72294	.	.	ENSG00000104177	ENST00000324324;ENST00000267836;ENST00000454655	T;T	0.69306	-0.39;-0.39	5.48	5.48	0.80851	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.51295	0.1666	N	0.00122	-2.065	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	T	0.78732	-0.2089	10	0.38643	T	0.18	-10.8837	19.7098	0.96094	0.0:1.0:0.0:0.0	.	540;564	Q9P2K5-2;Q9P2K5	.;MYEF2_HUMAN	F	564;540;152	ENSP00000316950:C564F;ENSP00000267836:C540F	ENSP00000267836:C540F	C	-	2	0	MYEF2	46222509	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.748000	0.85085	2.713000	0.92767	0.655000	0.94253	TGT		0.348	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416909.2	NM_016132		21	17	1	0	7.45023e-12	0.010504	1.02981e-11	21	17				
C15orf39	56905	broad.mit.edu	37	15	75499431	75499431	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr15:75499431G>T	ENST00000360639.2	+	2	1362	c.1042G>T	c.(1042-1044)Gcc>Tcc	p.A348S	C15orf39_ENST00000394987.4_Missense_Mutation_p.A348S|C15orf39_ENST00000567617.1_Missense_Mutation_p.A348S			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	348						cytoplasm (GO:0005737)		p.A348S(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						CTACCCCTCTGCCCCTCTCCC	0.647																																							uc002azp.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1042-1044)GCC>TCC		hypothetical protein LOC56905							66.0	72.0	70.0					15																	75499431		2197	4295	6492	SO:0001583	missense	56905							g.chr15:75499431G>T	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.1042G>T	15.37:g.75499431G>T	ENSP00000353854:p.Ala348Ser					C15orf39_uc002azq.3_Missense_Mutation_p.A348S|C15orf39_uc002azr.3_5'Flank	p.A348S	NM_015492	NP_056307	Q6ZRI6	CO039_HUMAN			2	1362	+			348					B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	ENST00000360639.2	37	c.1042G>T	CCDS10276.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.306724	0.23736	.	.	ENSG00000167173	ENST00000360639;ENST00000394987	T;T	0.70282	-0.47;-0.47	4.85	3.94	0.45596	.	0.627020	0.14328	N	0.326529	T	0.65719	0.2718	L	0.60455	1.87	0.22961	N	0.998503	P	0.48162	0.906	B	0.43386	0.418	T	0.53634	-0.8411	10	0.22706	T	0.39	-11.3197	9.3661	0.38226	0.0999:0.0:0.9001:0.0	.	348	Q6ZRI6	CO039_HUMAN	S	348	ENSP00000353854:A348S;ENSP00000378438:A348S	ENSP00000353854:A348S	A	+	1	0	C15orf39	73286484	0.014000	0.17966	0.581000	0.28614	0.278000	0.26855	0.975000	0.29449	1.055000	0.40461	-0.369000	0.07265	GCC		0.647	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492		51	37	1	0	1.89013e-27	0.01441	3.40223e-27	51	37				
MEX3B	84206	broad.mit.edu	37	15	82336286	82336286	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr15:82336286C>A	ENST00000329713.4	-	2	1360	c.925G>T	c.(925-927)Gca>Tca	p.A309S	AC026956.1_ENST00000410589.1_RNA|MEX3B_ENST00000558133.1_3'UTR	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	309					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A309S(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						GTAGCCGCTGCGCTGCTGCTG	0.617																																							uc002bgq.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)|kidney(1)	2						c.(925-927)GCA>TCA		mex-3 homolog B							30.0	37.0	35.0					15																	82336286		2186	4281	6467	SO:0001583	missense	84206				protein autophosphorylation	cytoplasmic mRNA processing body|nucleus	calcium ion binding|RNA binding|zinc ion binding	g.chr15:82336286C>A	AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.925G>T	15.37:g.82336286C>A	ENSP00000329918:p.Ala309Ser						p.A309S	NM_032246	NP_115622	Q6ZN04	MEX3B_HUMAN			2	1240	-			309					Q4G0W1|Q8IVG2|Q9H0J0	Missense_Mutation	SNP	ENST00000329713.4	37	c.925G>T	CCDS10319.1	.	.	.	.	.	.	.	.	.	.	C	2.494	-0.316740	0.05386	.	.	ENSG00000183496	ENST00000329713	T	0.22539	1.95	4.85	0.838	0.18902	.	0.882556	0.09541	N	0.788222	T	0.11495	0.0280	N	0.22421	0.69	0.80722	D	1	B	0.22604	0.072	B	0.19666	0.026	T	0.25916	-1.0118	10	0.07813	T	0.8	-7.7534	7.1935	0.25839	0.0:0.6275:0.0:0.3725	.	309	Q6ZN04	MEX3B_HUMAN	S	309	ENSP00000329918:A309S	ENSP00000329918:A309S	A	-	1	0	MEX3B	80123341	0.000000	0.05858	0.096000	0.21009	0.205000	0.24178	-1.290000	0.02777	0.002000	0.14630	-0.244000	0.11960	GCA		0.617	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304000.1	XM_290645		27	23	1	0	1.42536e-11	0.004656	1.95684e-11	27	23				
OR4F15	390649	broad.mit.edu	37	15	102358587	102358587	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr15:102358587C>A	ENST00000332238.4	+	1	222	c.198C>A	c.(196-198)ctC>ctA	p.L66L		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TGGCTAACCTCTCAATCATTG	0.428																																							uc010uts.1		NA																	0					0						c.(196-198)CTC>CTA		olfactory receptor, family 4, subfamily F,							256.0	220.0	232.0					15																	102358587		2203	4300	6503	SO:0001819	synonymous_variant	390649				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:102358587C>A	BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.198C>A	15.37:g.102358587C>A							p.L66L	NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)		1	198	+	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		66			Helical; Name=2; (Potential).		B2RNQ5|Q6IF57|Q96R70	Silent	SNP	ENST00000332238.4	37	c.198C>A	CCDS32342.1																																																																																				0.428	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417594.1	NM_001001674		52	85	1	0	1.63038e-21	0.01441	2.73985e-21	52	85				
PTX4	390667	broad.mit.edu	37	16	1537678	1537678	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr16:1537678G>T	ENST00000447419.2	-	2	460	c.435C>A	c.(433-435)gcC>gcA	p.A145A	PTX4_ENST00000440447.2_Intron|PTX4_ENST00000293922.1_Silent_p.A140A			Q96A99	PTX4_HUMAN	pentraxin 4, long	145						extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.A140A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CGTCCCTCTGGGCCTTGTGTG	0.726																																							uc010uvf.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(418-420)GCC>GCA		neuronal pentraxin II-like							26.0	31.0	29.0					16																	1537678		2194	4290	6484	SO:0001819	synonymous_variant	390667					extracellular region	metal ion binding	g.chr16:1537678G>T		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.435C>A	16.37:g.1537678G>T							p.A140A	NM_001013658	NP_001013680	Q96A99	PTX4_HUMAN			2	420	-			145						Silent	SNP	ENST00000447419.2	37	c.420C>A																																																																																					0.726	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658		16	15	1	0	1.37522e-17	0.007413	2.17565e-17	16	15				
GPR139	124274	broad.mit.edu	37	16	20043958	20043958	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr16:20043958A>T	ENST00000570682.1	-	2	461	c.161T>A	c.(160-162)cTg>cAg	p.L54Q		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	54					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)	p.L54Q(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						TCTTGCCACCAGCTGGGAGAG	0.483																																							uc002dgu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(160-162)CTG>CAG		G protein-coupled receptor 139							55.0	56.0	56.0					16																	20043958		2203	4300	6503	SO:0001583	missense	124274					integral to membrane|plasma membrane		g.chr16:20043958A>T	AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.161T>A	16.37:g.20043958A>T	ENSP00000458791:p.Leu54Gln					GPR139_uc010vaw.1_5'UTR	p.L54Q	NM_001002911	NP_001002911	Q6DWJ6	GP139_HUMAN			2	323	-			54			Cytoplasmic (Potential).		A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	ENST00000570682.1	37	c.161T>A	CCDS32398.1	.	.	.	.	.	.	.	.	.	.	A	19.04	3.750918	0.69533	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.3	5.3	0.74995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.69975	0.3171	L	0.49126	1.545	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.68633	-0.5357	9	0.37606	T	0.19	-18.4149	14.7183	0.69286	1.0:0.0:0.0:0.0	.	54	Q6DWJ6	GP139_HUMAN	Q	54	.	ENSP00000370779:L54Q	L	-	2	0	GPR139	19951459	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.910000	0.92685	2.132000	0.65825	0.460000	0.39030	CTG		0.483	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438522.1	NM_001002911		20	13	0	0	0	0.014323	0	20	13				
ACSM5	54988	broad.mit.edu	37	16	20429402	20429402	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr16:20429402C>A	ENST00000331849.4	+	3	373	c.226C>A	c.(226-228)Cct>Act	p.P76T	ACSM5_ENST00000575584.1_Missense_Mutation_p.P76T	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	76					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.P76T(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CCCCCCAAATCCTGCCTTCTG	0.493																																							uc002dhe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(226-228)CCT>ACT		acyl-CoA synthetase medium-chain family member 5							44.0	41.0	42.0					16																	20429402		2203	4300	6503	SO:0001583	missense	54988				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding	g.chr16:20429402C>A		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.226C>A	16.37:g.20429402C>A	ENSP00000327916:p.Pro76Thr					ACSM5_uc002dhd.1_Missense_Mutation_p.P76T	p.P76T	NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN			3	373	+			76					Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	c.226C>A	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659922	0.67586	.	.	ENSG00000183549	ENST00000331849	T	0.50001	0.76	4.43	4.43	0.53597	.	0.104416	0.42964	D	0.000626	T	0.58595	0.2133	L	0.39326	1.205	0.38345	D	0.944179	D	0.71674	0.998	D	0.64410	0.925	T	0.64313	-0.6437	10	0.52906	T	0.07	-13.1433	16.8435	0.85974	0.0:1.0:0.0:0.0	.	76	Q6NUN0	ACSM5_HUMAN	T	76	ENSP00000327916:P76T	ENSP00000327916:P76T	P	+	1	0	ACSM5	20336903	0.966000	0.33281	0.243000	0.24186	0.787000	0.44495	2.749000	0.47492	2.292000	0.77174	0.561000	0.74099	CCT		0.493	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		10	9	1	0	0.000673444	0.008291	0.000708428	10	9				
KIAA0556	23247	broad.mit.edu	37	16	27585278	27585278	+	Splice_Site	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr16:27585278G>T	ENST00000261588.4	+	2	82		c.e2+1			NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556							extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.?(2)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GAAAAAGGAGGTAAATGTGTC	0.493																																							uc002dow.2		NA																	2	Unknown(2)		lung(2)	ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						c.e2+1		hypothetical protein LOC23247							78.0	69.0	72.0					16																	27585278		2197	4300	6497	SO:0001630	splice_region_variant	23247							g.chr16:27585278G>T	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.63+1G>T	16.37:g.27585278G>T							p.E21_splice	NM_015202	NP_056017	O60303	K0556_HUMAN			2	87	+								A7E2C2	Splice_Site	SNP	ENST00000261588.4	37	c.63_splice	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.013434	0.54468	.	.	ENSG00000047578	ENST00000261588	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9987	0.71455	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA0556	27492779	1.000000	0.71417	0.999000	0.59377	0.766000	0.43426	4.489000	0.60309	2.598000	0.87819	0.650000	0.86243	.		0.493	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	Intron	8	55	1	0	1.12685e-05	0.004482	1.28195e-05	8	55				
ZNF423	23090	broad.mit.edu	37	16	49669627	49669627	+	Missense_Mutation	SNP	G	G	T	rs200585157		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr16:49669627G>T	ENST00000561648.1	-	4	3489	c.3436C>A	c.(3436-3438)Ctc>Atc	p.L1146I	ZNF423_ENST00000567169.1_Missense_Mutation_p.L1029I|ZNF423_ENST00000563137.2_Missense_Mutation_p.L1086I|ZNF423_ENST00000562871.1_Missense_Mutation_p.L1086I|ZNF423_ENST00000562520.1_Missense_Mutation_p.L1086I|ZNF423_ENST00000262383.2_Missense_Mutation_p.L1146I|ZNF423_ENST00000535559.1_Missense_Mutation_p.L1029I	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1146					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L1146I(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TCCGGCGTGAGGTCACGGTGG	0.662																																							uc002efs.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(3436-3438)CTC>ATC		zinc finger protein 423							77.0	72.0	74.0					16																	49669627		2199	4300	6499	SO:0001583	missense	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49669627G>T	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3436C>A	16.37:g.49669627G>T	ENSP00000455426:p.Leu1146Ile					ZNF423_uc010vgn.1_Missense_Mutation_p.L1029I	p.L1146I	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN			5	3734	-		all_cancers(37;0.0155)	1146					O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	c.3436C>A	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.568949	0.28003	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.09255	3.0;3.06	5.04	5.04	0.67666	Zinc finger, C2H2 (1);	0.224631	0.40222	N	0.001146	T	0.07413	0.0187	N	0.19112	0.55	0.28469	N	0.915509	B	0.10296	0.003	B	0.10450	0.005	T	0.22487	-1.0215	9	.	.	.	-32.2913	11.844	0.52374	0.08:0.0:0.92:0.0	.	1146	Q2M1K9	ZN423_HUMAN	I	1146;1029	ENSP00000262383:L1146I;ENSP00000442321:L1029I	.	L	-	1	0	ZNF423	48227128	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.063000	0.49978	2.344000	0.79699	0.561000	0.74099	CTC		0.662	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		38	60	1	0	3.38236e-24	0.006999	5.8792e-24	38	60				
NLRC5	84166	broad.mit.edu	37	16	57111855	57111855	+	Splice_Site	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr16:57111855G>T	ENST00000262510.6	+	43	5229	c.5004G>T	c.(5002-5004)atG>atT	p.M1668I	NLRC5_ENST00000436936.1_3'UTR|NLRC5_ENST00000308149.7_Splice_Site_p.M1639I|NLRC5_ENST00000539144.1_Splice_Site_p.M1639I	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1668					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.M1668I(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CCTCTTCCAGGCTTGGCTGCA	0.677																																							uc002ekk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|breast(1)	7						c.(5002-5004)ATG>ATT		nucleotide-binding oligomerization domains 27							49.0	46.0	47.0					16																	57111855		2198	4300	6498	SO:0001630	splice_region_variant	84166				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding	g.chr16:57111855G>T	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.5004-1G>T	16.37:g.57111855G>T						NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekq.1_Missense_Mutation_p.M210I|NLRC5_uc002ekr.1_Missense_Mutation_p.M555I	p.M1668I	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN			43	5229	+		all_neural(199;0.225)	1668			LRR 22.		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	c.5004G>T	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.460491	0.26248	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000539144	T;T;T	0.51325	0.71;0.71;0.71	4.72	-0.979	0.10276	.	1.033080	0.07771	N	0.951736	T	0.29423	0.0733	L	0.33710	1.025	0.40296	D	0.978552	B	0.06786	0.001	B	0.14023	0.01	T	0.38672	-0.9650	9	.	.	.	.	1.3923	0.02253	0.1942:0.3171:0.3264:0.1622	.	1668	Q86WI3	NLRC5_HUMAN	I	1668;1639;1639	ENSP00000262510:M1668I;ENSP00000308886:M1639I;ENSP00000441727:M1639I	.	M	+	3	0	NLRC5	55669356	0.941000	0.31946	0.623000	0.29173	0.571000	0.35966	0.194000	0.17135	0.200000	0.20447	0.462000	0.41574	ATG		0.677	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	Missense_Mutation	8	21	1	0	6.40141e-05	0.010729	6.96928e-05	8	21				
DPEP3	64180	broad.mit.edu	37	16	68012481	68012481	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr16:68012481G>T	ENST00000268793.4	-	3	911	c.538C>A	c.(538-540)Cgc>Agc	p.R180S	DPEP3_ENST00000574342.1_5'UTR	NM_001129758.1|NM_022357.3	NP_001123230.1|NP_071752.3	Q9H4B8	DPEP3_HUMAN	dipeptidase 3	155					male meiosis (GO:0007140)	anchored component of membrane (GO:0031225)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)	p.R180S(1)		breast(4)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)		AGGGCGAGGCGCACGGCAGTC	0.607																																							uc002evc.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)	3						c.(538-540)CGC>AGC		dipeptidase 3 isoform a							149.0	131.0	137.0					16																	68012481		2198	4300	6498	SO:0001583	missense	64180				meiosis	anchored to membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity	g.chr16:68012481G>T	AJ291679	CCDS10856.1	16q22.1	2011-07-22			ENSG00000141096	ENSG00000141096	3.4.13.19		23029	protein-coding gene	gene with protein product		609926					Standard	NM_022357		Approved		uc002evc.4	Q9H4B8	OTTHUMG00000137544	ENST00000268793.4:c.538C>A	16.37:g.68012481G>T	ENSP00000268793:p.Arg180Ser					DPEP3_uc010cex.2_Missense_Mutation_p.R180S	p.R180S	NM_022357	NP_071752	Q9H4B8	DPEP3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)	3	632	-		Ovarian(137;0.192)	155					B3KQ48|Q6PEZ5|Q6UXE4	Missense_Mutation	SNP	ENST00000268793.4	37	c.538C>A	CCDS10856.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144227	0.57044	.	.	ENSG00000141096	ENST00000268793	T	0.22945	1.93	4.88	4.88	0.63580	.	0.120700	0.50627	D	0.000107	T	0.32556	0.0833	M	0.66560	2.04	0.47659	D	0.999487	B	0.30542	0.284	B	0.39094	0.29	T	0.11060	-1.0603	10	0.40728	T	0.16	.	10.7548	0.46230	0.0:0.0:0.8101:0.1899	.	155	Q9H4B8	DPEP3_HUMAN	S	180	ENSP00000268793:R180S	ENSP00000268793:R180S	R	-	1	0	DPEP3	66569982	1.000000	0.71417	0.860000	0.33809	0.658000	0.38924	2.169000	0.42434	2.269000	0.75478	0.561000	0.74099	CGC		0.607	DPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268875.3	NM_022357		56	59	1	0	2.78941e-39	0.01441	5.4313e-39	56	59				
TAT	6898	broad.mit.edu	37	16	71604626	71604626	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr16:71604626C>A	ENST00000355962.4	-	8	1001	c.868G>T	c.(868-870)Ggc>Tgc	p.G290C	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	290					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)	p.G290C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	AGGATCCAGCCCAACCTCCAG	0.488																																					Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	uc002fap.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(868-870)GGC>TGC		tyrosine aminotransferase	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)						81.0	73.0	76.0					16																	71604626		2198	4300	6498	SO:0001583	missense	6898				2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding	g.chr16:71604626C>A		CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.868G>T	16.37:g.71604626C>A	ENSP00000348234:p.Gly290Cys						p.G290C	NM_000353	NP_000344	P17735	ATTY_HUMAN		Kidney(780;0.0157)	8	967	-		Ovarian(137;0.125)	290					B2R8I1|D3DWS2	Missense_Mutation	SNP	ENST00000355962.4	37	c.868G>T	CCDS10903.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020679	0.93462	.	.	ENSG00000198650	ENST00000355962	D	0.98717	-5.09	5.44	5.44	0.79542	Tyrosine aminotransferase (1);Aminotransferase, class I/classII (1);Tyrosine/nicotianamine aminotransferase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99477	0.9814	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98304	1.0520	10	0.87932	D	0	-19.9617	19.2736	0.94021	0.0:1.0:0.0:0.0	.	290	P17735	ATTY_HUMAN	C	290	ENSP00000348234:G290C	ENSP00000348234:G290C	G	-	1	0	TAT	70162127	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.783000	0.85696	2.546000	0.85860	0.563000	0.77884	GGC		0.488	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1			17	12	1	0	1.50039e-11	0.012319	2.0529e-11	17	12				
CA5A	763	broad.mit.edu	37	16	87936058	87936058	+	Silent	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr16:87936058A>T	ENST00000309893.2	-	4	593	c.528T>A	c.(526-528)ggT>ggA	p.G176G		NM_001739.1	NP_001730.1	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial	176					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.G176G(1)		large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(80;0.0513)	Brinzolamide(DB01194)|Zonisamide(DB00909)	TCACAGCCAAACCATTCTCTC	0.373																																							uc002fkn.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(526-528)GGT>GGA		carbonic anhydrase VA, mitochondrial precursor							94.0	84.0	87.0					16																	87936058		2198	4300	6498	SO:0001819	synonymous_variant	763				one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding	g.chr16:87936058A>T	L19297	CCDS10965.1	16q24.2	2012-08-21			ENSG00000174990	ENSG00000174990	4.2.1.1	"""Carbonic anhydrases"""	1377	protein-coding gene	gene with protein product		114761		CA5		8356065, 7490083	Standard	NM_001739		Approved	CAV, CAVA	uc002fkn.1	P35218	OTTHUMG00000137677	ENST00000309893.2:c.528T>A	16.37:g.87936058A>T							p.G176G	NM_001739	NP_001730	P35218	CAH5A_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0513)	4	584	-			176					B2RPF2	Silent	SNP	ENST00000309893.2	37	c.528T>A	CCDS10965.1																																																																																				0.373	CA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269164.1	NM_001739		10	59	0	0	0	0.010729	0	10	59				
TP53	7157	broad.mit.edu	37	17	7579312	7579312	+	Splice_Site	SNP	C	C	A	rs55863639		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:7579312C>A	ENST00000269305.4	-	4	564	c.375G>T	c.(373-375)acG>acT	p.T125T	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site_p.T125T|TP53_ENST00000413465.2_Splice_Site_p.T125T|TP53_ENST00000359597.4_Splice_Site_p.T125T|TP53_ENST00000455263.2_Splice_Site_p.T125T|TP53_ENST00000420246.2_Splice_Site_p.T125T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	125	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125T(51)|p.0?(8)|p.?(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAACTGACCGTGCAAGTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		66	Substitution - coding silent(51)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Insertion - In frame(1)	p.T125T(15)|p.0?(7)|p.T125M(7)|p.T125K(3)|p.T125R(3)|p.?(2)|p.V73fs*9(1)|p.T125P(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.T125fs*45(1)|p.T125fs*24(1)|p.T125A(1)|p.P13fs*18(1)|p.T125_Y126insX(1)	lung(21)|haematopoietic_and_lymphoid_tissue(14)|large_intestine(8)|upper_aerodigestive_tract(7)|bone(4)|central_nervous_system(3)|biliary_tract(3)|stomach(1)|liver(1)|urinary_tract(1)|kidney(1)|ovary(1)|pancreas(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CS004351|CS011573|CS971913	TP53	S	rs55863639	c.(373-375)ACG>ACT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							66.0	61.0	63.0					17																	7579312		2203	4300	6503	SO:0001630	splice_region_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579312C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>T	17.37:g.7579312C>A		HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Silent_p.T125T|TP53_uc002gih.2_Silent_p.T125T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Silent_p.T125T|TP53_uc010cni.1_Silent_p.T125T|TP53_uc002gij.2_Silent_p.T125T|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Silent_p.T86T|TP53_uc010cnk.1_Silent_p.T140T	p.T125T	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	569	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	125		T -> A (in a sporadic cancer; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	ENST00000269305.4	37	c.375G>T	CCDS11118.1																																																																																				0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Silent	38	29	1	0	1.465e-08	0.00874	1.80892e-08	38	29				
MYH2	4620	broad.mit.edu	37	17	10439865	10439865	+	Silent	SNP	T	T	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:10439865T>G	ENST00000245503.5	-	17	2340	c.1956A>C	c.(1954-1956)acA>acC	p.T652T	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Silent_p.T652T|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Silent_p.T652T	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	652	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.T652T(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GGGCAGACACTGTCTGGAAAG	0.388																																							uc010coi.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						c.(1954-1956)ACA>ACC		myosin heavy chain IIa							46.0	45.0	46.0					17																	10439865		2203	4300	6503	SO:0001819	synonymous_variant	4620				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10439865T>G		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1956A>C	17.37:g.10439865T>G						uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.T652T|MYH2_uc010coj.2_Silent_p.T652T	p.T652T	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN			17	2084	-			652			Myosin head-like.		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	ENST00000245503.5	37	c.1956A>C	CCDS11156.1																																																																																				0.388	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		13	12	0	0	0	0.001855	0	13	12				
DNAH9	1770	broad.mit.edu	37	17	11787015	11787015	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:11787015T>C	ENST00000262442.4	+	56	10987	c.10919T>C	c.(10918-10920)cTg>cCg	p.L3640P	DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000454412.2_Missense_Mutation_p.L3640P|DNAH9_ENST00000608377.1_5'UTR	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3640	AAA 5. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAAACAGTGCTGGTGGAAAAC	0.512																																							uc002gne.2		NA																	0				skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(10918-10920)CTG>CCG		dynein, axonemal, heavy chain 9 isoform 2							87.0	83.0	84.0					17																	11787015		2203	4300	6503	SO:0001583	missense	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11787015T>C	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10919T>C	17.37:g.11787015T>C	ENSP00000262442:p.Leu3640Pro					DNAH9_uc010coo.2_Missense_Mutation_p.L2934P|DNAH9_uc002gnf.2_5'UTR|DNAH9_uc010vvh.1_5'Flank	p.L3640P	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	56	10987	+		Breast(5;0.0122)|all_epithelial(5;0.131)	3640			Potential.|AAA 5 (By similarity).		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	c.10919T>C	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	15.24	2.775976	0.49786	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.57107	0.42;0.42	5.01	5.01	0.66863	.	0.073608	0.53938	D	0.000046	D	0.85371	0.5681	H	0.99806	4.795	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92127	0.5709	10	0.87932	D	0	.	15.1785	0.72934	0.0:0.0:0.0:1.0	.	3640	Q9NYC9	DYH9_HUMAN	P	3640;3640;2222	ENSP00000262442:L3640P;ENSP00000414874:L3640P	ENSP00000262442:L3640P	L	+	2	0	DNAH9	11727740	1.000000	0.71417	0.918000	0.36340	0.017000	0.09413	7.825000	0.86693	2.232000	0.73038	0.533000	0.62120	CTG		0.512	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		42	27	0	0	0	0.01441	0	42	27				
NF1	4763	broad.mit.edu	37	17	29553702	29553702	+	Splice_Site	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:29553702G>T	ENST00000358273.4	+	18	2634	c.2251G>T	c.(2251-2253)Gga>Tga	p.G751*	NF1_ENST00000356175.3_Splice_Site_p.G751*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	751					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.G751*(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GATGTCAACAGGTAAATGTGA	0.403			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		14	Whole gene deletion(8)|Unknown(4)|Substitution - Nonsense(2)	p.?(2)	soft_tissue(7)|lung(3)|autonomic_ganglia(2)|central_nervous_system(2)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330	GRCh37	CS076636	NF1	S		c.(2251-2253)GGA>TGA		neurofibromin isoform 1							118.0	105.0	110.0					17																	29553702		2203	4300	6503	SO:0001630	splice_region_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29553702G>T		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.2251+1G>T	17.37:g.29553702G>T		TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_uc002hgh.2_Nonsense_Mutation_p.G751*|NF1_uc010csn.1_Nonsense_Mutation_p.G611*|NF1_uc002hgi.1_Translation_Start_Site	p.G751*	NM_001042492	NP_001035957	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	18	2584	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	751					O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	ENST00000358273.4	37	c.2251G>T	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	38	7.030076	0.98013	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0278	0.97529	0.0:0.0:1.0:0.0	.	.	.	.	X	751;751;417	.	ENSP00000348498:G751X	G	+	1	0	NF1	26577828	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.288000	0.96055	2.717000	0.92951	0.650000	0.86243	GGA		0.403	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	Nonsense_Mutation	64	44	1	0	1.46168e-27	0.01441	2.64277e-27	64	44				
SPACA3	124912	broad.mit.edu	37	17	31318959	31318959	+	Start_Codon_SNP	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:31318959G>T	ENST00000269053.3	+	1	73	c.3G>T	c.(1-3)atG>atT	p.M1I	SPACA3_ENST00000580599.1_Intron|SPACA3_ENST00000394638.1_Start_Codon_SNP_p.M1I	NM_173847.3	NP_776246.1	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	1					cell wall macromolecule catabolic process (GO:0016998)|defense response to Gram-positive bacterium (GO:0050830)|monocyte activation (GO:0042117)|peptidoglycan catabolic process (GO:0009253)|positive regulation of macrophage activation (GO:0043032)|positive regulation of phagocytosis (GO:0050766)|response to virus (GO:0009615)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|secretory granule (GO:0030141)	lysozyme activity (GO:0003796)	p.M1I(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(9;0.193)			TTGTCACCATGGTCTCAGCTC	0.607																																							uc002hhs.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1-3)ATG>ATT		sperm acrosome associated 3							83.0	65.0	71.0					17																	31318959		2203	4300	6503	SO:0001582	initiator_codon_variant	124912				cell wall macromolecule catabolic process|defense response to Gram-positive bacterium|monocyte activation|peptidoglycan catabolic process|positive regulation of macrophage activation|positive regulation of phagocytosis|response to virus	acrosomal membrane|extracellular region|integral to membrane|lysosome	bacterial cell surface binding|lysozyme activity|protein binding	g.chr17:31318959G>T	AF216311, AF099029	CCDS11275.1	17q12	2014-07-23			ENSG00000141316	ENSG00000141316			16260	protein-coding gene	gene with protein product	"""cancer/testis antigen 54"", ""sperm lyzozyme-like acrosomal protein 1"""	612749				12606493	Standard	NM_173847		Approved	ALLP17, SLLP1, LYC3, LYZL3, CT54	uc002hhs.1	Q8IXA5	OTTHUMG00000132886	ENST00000269053.3:c.3G>T	17.37:g.31318959G>T	ENSP00000269053:p.Met1Ile					SPACA3_uc010cte.1_5'Flank	p.M1I	NM_173847	NP_776246	Q8IXA5	SACA3_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.193)		1	78	+			1			Cytoplasmic (Potential).		Q7Z4Y5	Missense_Mutation	SNP	ENST00000269053.3	37	c.3G>T	CCDS11275.1	.	.	.	.	.	.	.	.	.	.	G	5.582	0.292171	0.10567	.	.	ENSG00000141316	ENST00000269053;ENST00000394638	T;T	0.70986	-0.25;-0.53	3.05	-0.457	0.12186	.	.	.	.	.	T	0.55337	0.1914	.	.	.	0.80722	D	1	B	0.16166	0.016	B	0.09377	0.004	T	0.27468	-1.0073	8	0.87932	D	0	.	2.9761	0.05937	0.0:0.3165:0.2639:0.4196	.	1	Q8IXA5	SACA3_HUMAN	I	1	ENSP00000269053:M1I;ENSP00000378134:M1I	ENSP00000269053:M1I	M	+	3	0	SPACA3	28343072	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.193000	0.03049	-1.171000	0.02765	-1.267000	0.01435	ATG		0.607	SPACA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256380.1	NM_173847	Missense_Mutation	14	6	1	0	3.41278e-10	0.00499	4.4159e-10	14	6				
DDX52	11056	broad.mit.edu	37	17	35979858	35979858	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:35979858C>A	ENST00000349699.2	-	13	1647	c.1604G>T	c.(1603-1605)gGg>gTg	p.G535V	DDX52_ENST00000394367.3_Missense_Mutation_p.G427V	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	535	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.G535V(1)		biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				TACAGGACACCCAGCCTGCTG	0.338																																							uc002hoi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1603-1605)GGG>GTG		ATP-dependent RNA helicase ROK1 isoform a							104.0	104.0	104.0					17																	35979858		2203	4300	6503	SO:0001583	missense	11056					nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding	g.chr17:35979858C>A	AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.1604G>T	17.37:g.35979858C>A	ENSP00000268854:p.Gly535Val					DDX52_uc002hoh.1_Missense_Mutation_p.G427V	p.G535V	NM_007010	NP_008941	Q9Y2R4	DDX52_HUMAN			13	1642	-		Breast(25;0.00637)|Ovarian(249;0.15)	535			Helicase C-terminal.		Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	ENST00000349699.2	37	c.1604G>T	CCDS11323.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359656	0.61403	.	.	ENSG00000141141	ENST00000349699;ENST00000394367	T;T	0.16743	2.32;2.37	5.81	5.81	0.92471	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45597	0.1350	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.38908	-0.9639	10	0.87932	D	0	.	17.2257	0.86970	0.0:1.0:0.0:0.0	.	535	Q9Y2R4	DDX52_HUMAN	V	535;427	ENSP00000268854:G535V;ENSP00000377893:G427V	ENSP00000268854:G535V	G	-	2	0	DDX52	33053971	1.000000	0.71417	0.926000	0.36857	0.082000	0.17680	6.674000	0.74487	2.751000	0.94390	0.609000	0.83330	GGG		0.338	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256795.1	NM_152300		25	20	1	0	1.55811e-20	0.008361	2.57565e-20	25	20				
KRTAP4-3	85290	broad.mit.edu	37	17	39324029	39324029	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:39324029G>T	ENST00000391356.2	-	1	395	c.396C>A	c.(394-396)ccC>ccA	p.P132P		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	132	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].		Missing (in allele KAP3-v2). {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.P132P(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TACAGCAGCTGGGGCGGCAGC	0.622																																							uc010cxl.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(394-396)CCC>CCA		keratin associated protein 4-3							16.0	20.0	19.0					17																	39324029		2125	4251	6376	SO:0001819	synonymous_variant	85290					keratin filament		g.chr17:39324029G>T	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.396C>A	17.37:g.39324029G>T							p.P132P	NM_033187	NP_149443	Q9BYR4	KRA43_HUMAN	STAD - Stomach adenocarcinoma(17;0.000449)		1	396	-		Breast(137;0.000496)	132		Missing (in allele KAP3-v2).	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].|20.			Silent	SNP	ENST00000391356.2	37	c.396C>A	CCDS42331.1																																																																																				0.622	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1			8	3	1	0	0.000442599	0.006214	0.000472962	8	3				
KRT33A	3883	broad.mit.edu	37	17	39506806	39506806	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:39506806C>A	ENST00000007735.3	-	1	258	c.214G>T	c.(214-216)Gag>Tag	p.E72*		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	72	Coil 1A.|Rod.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.E72*(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				CGCACCTTCTCCAGGTAGCTG	0.607																																							uc002hwk.1		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(214-216)GAG>TAG		keratin 33A							95.0	95.0	95.0					17																	39506806		2203	4298	6501	SO:0001587	stop_gained	3883					intermediate filament	protein binding|structural molecule activity	g.chr17:39506806C>A	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.214G>T	17.37:g.39506806C>A	ENSP00000007735:p.Glu72*						p.E72*	NM_004138	NP_004129	O76009	KT33A_HUMAN			1	251	-		Breast(137;0.000496)	72			Coil 1A.|Rod.		B2RA87|Q6NTB9|Q6ZZB9	Nonsense_Mutation	SNP	ENST00000007735.3	37	c.214G>T	CCDS11388.1	.	.	.	.	.	.	.	.	.	.	C	36	5.767724	0.96914	.	.	ENSG00000006059	ENST00000007735	.	.	.	5.22	4.24	0.50183	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.2995	0.73936	0.0:0.8596:0.1404:0.0	.	.	.	.	X	72	.	ENSP00000007735:E72X	E	-	1	0	KRT33A	36760332	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.894000	0.56250	1.549000	0.49425	0.650000	0.86243	GAG		0.607	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	NM_004138		34	30	1	0	9.88483e-10	0.007835	1.26289e-09	34	30				
KIF2B	84643	broad.mit.edu	37	17	51901793	51901793	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:51901793G>T	ENST00000268919.4	+	1	1555	c.1399G>T	c.(1399-1401)Gaa>Taa	p.E467*		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	467	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E467*(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AAGGCAGCTGGAAGGGGCAGA	0.493																																							uc002iua.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|skin(3)	8						c.(1399-1401)GAA>TAA		kinesin family member 2B							47.0	44.0	45.0					17																	51901793		2203	4300	6503	SO:0001587	stop_gained	84643				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity	g.chr17:51901793G>T	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1399G>T	17.37:g.51901793G>T	ENSP00000268919:p.Glu467*					uc010wna.1_RNA	p.E467*	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN			1	1555	+			467			Kinesin-motor.		Q96MA2|Q9BXG6	Nonsense_Mutation	SNP	ENST00000268919.4	37	c.1399G>T	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	G	38	7.128391	0.98081	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	.	.	.	5.73	4.76	0.60689	.	0.000000	0.45867	D	0.000339	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.2257	0.82288	0.0:0.133:0.867:0.0	.	.	.	.	X	467;355	.	ENSP00000268919:E467X	E	+	1	0	KIF2B	49256792	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.967000	0.87967	1.540000	0.49301	0.655000	0.94253	GAA		0.493	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		13	12	1	0	1.61879e-10	0.013537	2.14954e-10	13	12				
RECQL5	9400	broad.mit.edu	37	17	73627305	73627305	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr17:73627305G>A	ENST00000317905.5	-	10	1632	c.1473C>T	c.(1471-1473)agC>agT	p.S491S	SMIM5_ENST00000375215.3_5'Flank|RECQL5_ENST00000443199.2_5'UTR|RECQL5_ENST00000423245.2_Silent_p.S464S	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	491	Interaction with POLR2A.				chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)	p.S464S(1)		breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CTTCATCCCCGCTGCCTCCAG	0.617								Other identified genes with known or suspected DNA repair function																															uc010dgl.2		NA																	1	Substitution - coding silent(1)		lung(1)	kidney(3)	3						c.(1471-1473)AGC>AGT	Other_identified_genes_with_known_or_suspected_DNA_repair_function	RecQ protein-like 5 isoform 1							55.0	60.0	58.0					17																	73627305		2200	4297	6497	SO:0001819	synonymous_variant	9400				DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding	g.chr17:73627305G>A	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.1473C>T	17.37:g.73627305G>A						RECQL5_uc010dgk.2_Silent_p.S464S|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	p.S491S	NM_004259	NP_004250	O94762	RECQ5_HUMAN	all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)		10	1629	-	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		491					Q9H0B1|Q9P1W7|Q9UNC8	Silent	SNP	ENST00000317905.5	37	c.1473C>T	CCDS42380.1																																																																																				0.617	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1	NM_004259		15	50	0	0	0	0.003163	0	15	50				
LAMA1	284217	broad.mit.edu	37	18	7080334	7080334	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr18:7080334G>T	ENST00000389658.3	-	2	277	c.184C>A	c.(184-186)Cga>Aga	p.R62R	RP11-76K13.3_ENST00000581502.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	62	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.R62R(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TGTGGGTTTCGGACGGGCCGA	0.552																																							uc002knm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(184-186)CGA>AGA		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						83.0	84.0	84.0					18																	7080334		2203	4300	6503	SO:0001819	synonymous_variant	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:7080334G>T	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.184C>A	18.37:g.7080334G>T						LAMA1_uc010wzj.1_5'UTR	p.R62R	NM_005559	NP_005550	P25391	LAMA1_HUMAN			2	278	-		Colorectal(10;0.172)	62			Laminin N-terminal.			Silent	SNP	ENST00000389658.3	37	c.184C>A	CCDS32787.1																																																																																				0.552	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		24	32	1	0	3.01185e-09	0.003954	3.76481e-09	24	32				
MC2R	4158	broad.mit.edu	37	18	13884841	13884841	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr18:13884841C>A	ENST00000327606.3	-	2	857	c.677G>T	c.(676-678)gGg>gTg	p.G226V		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	226					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)			breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	GATGAAGACCCCGAGCAGGAT	0.552																																					Colon(141;1584 1782 35999 48227 48692)	Colon(141;1584 1782 35999 48227 48692)	uc002ksp.1		NA																	0				ovary(4)|skin(1)	5						c.(676-678)GGG>GTG		melanocortin 2 receptor	Corticotropin(DB01285)|Cosyntropin(DB01284)						78.0	68.0	72.0					18																	13884841		2203	4300	6503	SO:0001583	missense	4158				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding	g.chr18:13884841C>A		CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.677G>T	18.37:g.13884841C>A	ENSP00000333821:p.Gly226Val						p.G226V	NM_000529	NP_000520	Q01718	ACTHR_HUMAN			2	854	-			226			Helical; Name=6; (By similarity).		A8K016|Q3MI45|Q504X6	Missense_Mutation	SNP	ENST00000327606.3	37	c.677G>T	CCDS11869.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065140	0.76187	.	.	ENSG00000185231	ENST00000327606;ENST00000399821	T	0.34859	1.34	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.65015	0.2651	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.71856	-0.4466	10	0.87932	D	0	.	15.0969	0.72242	0.0:0.8579:0.1421:0.0	.	226	Q01718	ACTHR_HUMAN	V	226	ENSP00000333821:G226V	ENSP00000333821:G226V	G	-	2	0	MC2R	13874841	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	5.445000	0.66594	2.411000	0.81874	0.655000	0.94253	GGG		0.552	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254639.2			25	11	1	0	7.87624e-14	0.00278	1.14744e-13	25	11				
ASXL3	80816	broad.mit.edu	37	18	31323882	31323882	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr18:31323882C>A	ENST00000269197.5	+	12	4070	c.4070C>A	c.(4069-4071)tCt>tAt	p.S1357Y		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1357	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1357Y(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TCCACTAGCTCTGTCTTGATT	0.468											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010dmg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(4069-4071)TCT>TAT		additional sex combs like 3							139.0	140.0	140.0					18																	31323882		1944	4141	6085	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31323882C>A	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4070C>A	18.37:g.31323882C>A	ENSP00000269197:p.Ser1357Tyr		OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	823	ASXL3_uc002kxq.2_Missense_Mutation_p.S1064Y	p.S1357Y	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN			12	4125	+			1357			Ser-rich.		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.4070C>A	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808289	0.70797	.	.	ENSG00000141431	ENST00000269197	T	0.25414	1.8	6.03	6.03	0.97812	.	.	.	.	.	T	0.42720	0.1215	L	0.27053	0.805	0.46478	D	0.99906	D	0.89917	1.0	D	0.85130	0.997	T	0.28744	-1.0034	9	0.87932	D	0	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	1357	Q9C0F0	ASXL3_HUMAN	Y	1357	ENSP00000269197:S1357Y	ENSP00000269197:S1357Y	S	+	2	0	ASXL3	29577880	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.359000	0.66074	2.861000	0.98227	0.655000	0.94253	TCT		0.468	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			75	64	1	0	6.06247e-24	0.01441	1.04927e-23	75	64				
TNFRSF11A	8792	broad.mit.edu	37	18	60036389	60036389	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr18:60036389G>T	ENST00000586569.1	+	9	1277	c.1239G>T	c.(1237-1239)tgG>tgT	p.W413C	TNFRSF11A_ENST00000269485.7_Intron	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	413					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)	p.W413C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				GGACTGATTGGACTCCCATGT	0.567																																							uc002lin.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|lung(1)	3						c.(1237-1239)TGG>TGT		tumor necrosis factor receptor superfamily,							54.0	53.0	54.0					18																	60036389		2203	4300	6503	SO:0001583	missense	8792	Paget_Disease_of_Bone			adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity	g.chr18:60036389G>T	AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.1239G>T	18.37:g.60036389G>T	ENSP00000465500:p.Trp413Cys					TNFRSF11A_uc010dpv.2_Intron	p.W413C	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN			9	1277	+		Colorectal(73;0.188)	413			Cytoplasmic (Potential).		I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Missense_Mutation	SNP	ENST00000586569.1	37	c.1239G>T	CCDS11980.1	.	.	.	.	.	.	.	.	.	.	G	5.616	0.298339	0.10622	.	.	ENSG00000141655	ENST00000269485	.	.	.	4.97	1.85	0.25348	.	4.147290	0.00644	N	0.000534	T	0.46151	0.1378	L	0.57536	1.79	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.15235	-1.0444	8	.	.	.	-2.4991	7.1486	0.25597	0.0:0.4374:0.2957:0.2669	.	413	Q9Y6Q6	TNR11_HUMAN	C	413	.	.	W	+	3	0	TNFRSF11A	58187369	0.049000	0.20398	0.013000	0.15412	0.020000	0.10135	0.799000	0.27028	0.413000	0.25759	0.514000	0.50259	TGG		0.567	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256186.2			24	18	1	0	1.64293e-13	0.00333	2.35953e-13	24	18				
MUC16	94025	broad.mit.edu	37	19	9063963	9063963	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:9063963G>T	ENST00000397910.4	-	3	23686	c.23483C>A	c.(23482-23484)tCc>tAc	p.S7828Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7830	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S7828Y(2)|p.S3461Y(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGGGTCAGGGAGGAAGCTAG	0.542																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(23482-23484)TCC>TAC		mucin 16							105.0	102.0	103.0					19																	9063963		2059	4217	6276	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9063963G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23483C>A	19.37:g.9063963G>T	ENSP00000381008:p.Ser7828Tyr						p.S7828Y	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	23687	-			7830			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.23483C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.461	-0.324026	0.05350	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.71	0.633	0.17712	.	.	.	.	.	T	0.02649	0.0080	L	0.29908	0.895	.	.	.	D	0.58268	0.982	P	0.44518	0.452	T	0.43523	-0.9386	8	0.87932	D	0	.	4.0449	0.09768	0.2285:0.0:0.7715:0.0	.	7828	B5ME49	.	Y	7828	ENSP00000381008:S7828Y	ENSP00000381008:S7828Y	S	-	2	0	MUC16	8924963	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.168000	0.03123	0.274000	0.22072	0.187000	0.17357	TCC		0.542	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		32	60	1	0	3.99451e-17	0.009535	6.19837e-17	32	60				
MUC16	94025	broad.mit.edu	37	19	9067932	9067932	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:9067932A>T	ENST00000397910.4	-	3	19717	c.19514T>A	c.(19513-19515)gTg>gAg	p.V6505E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6507	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.V6505E(2)|p.V2138E(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTTTTTTCCACAGAGGGTGG	0.473																																							uc002mkp.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(19513-19515)GTG>GAG		mucin 16							123.0	123.0	123.0					19																	9067932		1926	4135	6061	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9067932A>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.19514T>A	19.37:g.9067932A>T	ENSP00000381008:p.Val6505Glu						p.V6505E	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	19718	-			6507			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.19514T>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	0.087	-1.173918	0.01646	.	.	ENSG00000181143	ENST00000397910	T	0.32023	1.47	1.83	-3.65	0.04502	.	.	.	.	.	T	0.15176	0.0366	N	0.17474	0.49	.	.	.	B	0.06786	0.001	B	0.04013	0.001	T	0.11179	-1.0598	8	0.87932	D	0	.	3.3763	0.07238	0.2905:0.0:0.251:0.4585	.	6505	B5ME49	.	E	6505	ENSP00000381008:V6505E	ENSP00000381008:V6505E	V	-	2	0	MUC16	8928932	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.837000	0.01689	-3.502000	0.00151	-1.245000	0.01525	GTG		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		6	26	0	0	0	0.001168	0	6	26				
MUC16	94025	broad.mit.edu	37	19	9088957	9088957	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:9088957C>A	ENST00000397910.4	-	1	3061	c.2858G>T	c.(2857-2859)aGa>aTa	p.R953I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	953	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.R953I(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AAACGTGTCTCTATTGGTCTG	0.473																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(2857-2859)AGA>ATA		mucin 16							179.0	175.0	176.0					19																	9088957		2005	4166	6171	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9088957C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2858G>T	19.37:g.9088957C>A	ENSP00000381008:p.Arg953Ile						p.R953I	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			1	3062	-			953			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.2858G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	0	-2.756292	0.00085	.	.	ENSG00000181143	ENST00000397910	T	0.02916	4.11	0.638	-1.28	0.09318	.	.	.	.	.	T	0.01523	0.0049	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.45818	-0.9235	7	0.87932	D	0	.	.	.	.	.	953	B5ME49	.	I	953	ENSP00000381008:R953I	ENSP00000381008:R953I	R	-	2	0	MUC16	8949957	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-3.964000	0.00324	-0.999000	0.03442	-1.086000	0.02197	AGA		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		92	63	1	0	1.38319e-45	0.01441	2.71937e-45	92	63				
P2RY11	5032	broad.mit.edu	37	19	10225118	10225118	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:10225118C>A	ENST00000321826.4	+	2	1013	c.829C>A	c.(829-831)Cgc>Agc	p.R277S	PPAN_ENST00000556468.1_Missense_Mutation_p.R697S|PPAN-P2RY11_ENST00000428358.1_3'UTR|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.R697S	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11	277					activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)	p.R277S(1)|p.R697S(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			TGCTCGGCGGCGCTGGAGCAC	0.667																																							uc002mna.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(2089-2091)CGC>AGC		PPAN-P2RY11 protein							41.0	42.0	42.0					19																	10225118		2202	4299	6501	SO:0001583	missense	692312				RNA splicing	nucleolus	protein binding	g.chr19:10225118C>A	AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.829C>A	19.37:g.10225118C>A	ENSP00000323872:p.Arg277Ser					PPAN-P2RY11_uc010xla.1_3'UTR|P2RY11_uc002mnc.2_Missense_Mutation_p.R277S	p.R697S	NM_001040664	NP_001035754	Q9NQ55	SSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)		13	2089	+			Error:Variant_position_missing_in_Q9NQ55_after_alignment					B2R8X9|O43190|Q9BYU4|Q9H170	Missense_Mutation	SNP	ENST00000321826.4	37	c.2089C>A	CCDS12226.1	.	.	.	.	.	.	.	.	.	.	c	13.82	2.350315	0.41599	.	.	ENSG00000243207;ENSG00000130810;ENSG00000244165	ENST00000393796;ENST00000556468;ENST00000321826	T;T;T	0.70631	-0.5;-0.5;-0.5	4.33	2.05	0.26809	GPCR, rhodopsin-like superfamily (1);	0.740248	0.12493	U	0.464087	T	0.55353	0.1915	L	0.39898	1.24	0.09310	N	0.999998	B	0.28178	0.202	B	0.27262	0.078	T	0.36986	-0.9725	10	0.07813	T	0.8	-3.648	8.5511	0.33451	0.0:0.757:0.1542:0.0887	.	277	Q96G91	P2Y11_HUMAN	S	697;697;277	ENSP00000377385:R697S;ENSP00000450710:R697S;ENSP00000323872:R277S	ENSP00000323872:R277S	R	+	1	0	PPAN;P2RY11;PPAN-P2RY11	10086118	0.000000	0.05858	0.069000	0.20011	0.020000	0.10135	0.155000	0.16362	0.408000	0.25621	0.556000	0.70494	CGC		0.667	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316664.2	NM_002566		35	16	1	0	6.70999e-13	0.004289	9.5019e-13	35	16				
KEAP1	9817	broad.mit.edu	37	19	10602727	10602727	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:10602727T>A	ENST00000171111.5	-	3	1398	c.851A>T	c.(850-852)cAg>cTg	p.Q284L	KEAP1_ENST00000393623.2_Missense_Mutation_p.Q284L|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'UTR	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	284	BACK.		Q -> L (in a lung adenocarcinoma patient). {ECO:0000269|PubMed:17020408}.		cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.Q284L(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CTTCTGCAGCTGCATCTGCAG	0.612																																							uc002moq.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(850-852)CAG>CTG		kelch-like ECH-associated protein 1							59.0	60.0	60.0					19																	10602727		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10602727T>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.851A>T	19.37:g.10602727T>A	ENSP00000171111:p.Gln284Leu					KEAP1_uc002mop.1_Missense_Mutation_p.Q2L|KEAP1_uc002mor.1_Missense_Mutation_p.Q284L	p.Q284L	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		3	1007	-			284		Q -> L (in a lung adenocarcinoma patient).	BACK.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.851A>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	T	32	5.105999	0.94292	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.68025	-0.3;-0.3	5.61	5.61	0.85477	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.71492	0.3346	L	0.43701	1.375	0.80722	D	1	D	0.58268	0.982	P	0.59825	0.864	T	0.68689	-0.5342	10	0.28530	T	0.3	.	13.7725	0.63034	0.0:0.0:0.0:1.0	.	284	Q14145	KEAP1_HUMAN	L	284	ENSP00000171111:Q284L;ENSP00000377245:Q284L	ENSP00000171111:Q284L	Q	-	2	0	KEAP1	10463727	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.707000	0.68370	2.146000	0.66826	0.459000	0.35465	CAG		0.612	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		21	17	0	0	0	0.012319	0	21	17				
DNM2	1785	broad.mit.edu	37	19	10886572	10886572	+	Silent	SNP	C	C	T	rs201924777		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:10886572C>T	ENST00000355667.6	+	4	659	c.579C>T	c.(577-579)gtC>gtT	p.V193V	DNM2_ENST00000585892.1_Silent_p.V193V|DNM2_ENST00000314646.5_Silent_p.V193V|DNM2_ENST00000389253.4_Silent_p.V193V|DNM2_ENST00000408974.4_Silent_p.V193V|DNM2_ENST00000591819.1_3'UTR|DNM2_ENST00000359692.6_Silent_p.V193V	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	193	Dynamin-type G.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)	p.V193V(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CCAAGGAAGTCGATCCCCAAG	0.607			"""F, N, Splice, Mis, O"""		ETP ALL																																		uc002mps.1		NA		Rec	yes		19	19p13.2	1785		dynamin 2			L					2	Substitution - coding silent(2)		lung(2)	central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6						c.(577-579)GTC>GTT		dynamin 2 isoform 2		C	,,,,	0,4406		0,0,2203	49.0	46.0	47.0		579,579,579,579,579	-10.4	0.2	19		47	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DNM2	NM_001005360.2,NM_001005361.2,NM_001005362.2,NM_001190716.1,NM_004945.3	,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	193/871,193/871,193/867,193/870,193/867	10886572	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1785				G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding	g.chr19:10886572C>T		CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.579C>T	19.37:g.10886572C>T						DNM2_uc010dxk.2_RNA|DNM2_uc002mpt.1_Silent_p.V193V|DNM2_uc002mpv.1_Silent_p.V193V|DNM2_uc002mpu.1_Silent_p.V193V|DNM2_uc010dxl.1_Silent_p.V193V	p.V193V	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)		4	743	+			193					A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	ENST00000355667.6	37	c.579C>T	CCDS45968.1																																																																																				0.607	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945		4	26	0	0	0	0.009096	0	4	26				
SLC1A6	6511	broad.mit.edu	37	19	15064949	15064949	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:15064949G>A	ENST00000221742.3	-	7	1369	c.1362C>T	c.(1360-1362)atC>atT	p.I454I	SLC1A6_ENST00000600144.1_Silent_p.I376I|SLC1A6_ENST00000430939.2_Silent_p.I390I	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	454					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.I454I(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						CCCCTCACCTGATGGTTGTGA	0.592																																							uc002naa.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(3)|ovary(2)|skin(1)	6						c.(1360-1362)ATC>ATT		solute carrier family 1 (high affinity	L-Glutamic Acid(DB00142)						73.0	65.0	68.0					19																	15064949		2203	4300	6503	SO:0001819	synonymous_variant	6511				synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity	g.chr19:15064949G>A		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1362C>T	19.37:g.15064949G>A						SLC1A6_uc010dzu.1_Silent_p.I376I|SLC1A6_uc010xod.1_Silent_p.I390I	p.I454I	NM_005071	NP_005062	P48664	EAA4_HUMAN			7	1370	-			454					Q8N753	Silent	SNP	ENST00000221742.3	37	c.1362C>T	CCDS12321.1																																																																																				0.592	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071		29	20	0	0	0	0.007291	0	29	20				
NOTCH3	4854	broad.mit.edu	37	19	15291560	15291560	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:15291560G>T	ENST00000263388.2	-	19	3149	c.3074C>A	c.(3073-3075)cCc>cAc	p.P1025H		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1025	EGF-like 26. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.P1025H(2)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCATCCAGGGGGACAAAGGCA	0.657																																							uc002nan.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21						c.(3073-3075)CCC>CAC		Notch homolog 3 precursor							37.0	33.0	35.0					19																	15291560		2198	4298	6496	SO:0001583	missense	4854				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr19:15291560G>T	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3074C>A	19.37:g.15291560G>T	ENSP00000263388:p.Pro1025His					NOTCH3_uc002nao.1_Missense_Mutation_p.P973H	p.P1025H	NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)		19	3150	-			1025			Extracellular (Potential).|EGF-like 26.		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	c.3074C>A	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.937254	0.34189	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.96265	-3.96	5.13	2.96	0.34315	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.273747	0.19751	N	0.106900	D	0.96216	0.8766	L	0.49699	1.58	0.09310	N	1	B;P	0.36110	0.028;0.537	B;P	0.58577	0.043;0.841	D	0.90176	0.4239	10	0.44086	T	0.13	.	4.4249	0.11498	0.0851:0.1566:0.5964:0.1618	.	976;1025	Q59FL3;Q9UM47	.;NOTC3_HUMAN	H	1025;975	ENSP00000263388:P1025H	ENSP00000263388:P1025H	P	-	2	0	NOTCH3	15152560	0.000000	0.05858	0.025000	0.17156	0.304000	0.27724	-0.151000	0.10175	1.126000	0.42016	0.563000	0.77884	CCC		0.657	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435		5	8	1	0	0.000602214	0.000602	0.000636806	5	8				
UNC13A	23025	broad.mit.edu	37	19	17758168	17758168	+	Silent	SNP	C	C	A	rs369056957		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:17758168C>A	ENST00000519716.2	-	17	1949	c.1950G>T	c.(1948-1950)gcG>gcT	p.A650A	UNC13A_ENST00000252773.7_Silent_p.A650A|UNC13A_ENST00000551649.1_Silent_p.A650A|UNC13A_ENST00000428389.2_Silent_p.A738A|UNC13A_ENST00000550896.1_Silent_p.A648A|UNC13A_ENST00000552293.1_Silent_p.A650A	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	650					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.A650A(1)|p.A738A(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TCTTGGTCACCGCGAAGATCT	0.597																																							uc002nhd.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)	3						c.(2212-2214)GCG>GCT		unc-13 homolog A							64.0	69.0	67.0					19																	17758168		2133	4270	6403	SO:0001819	synonymous_variant	23025				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr19:17758168C>A	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1950G>T	19.37:g.17758168C>A							p.A738A	NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN			17	2214	-			650					E5RHY9	Silent	SNP	ENST00000519716.2	37	c.2214G>T	CCDS46013.2																																																																																				0.597	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604		7	12	1	0	0.00198382	0.001984	0.00206541	7	12				
CRLF1	9244	broad.mit.edu	37	19	18710443	18710443	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:18710443G>T	ENST00000392386.3	-	2	522	c.329C>A	c.(328-330)tCg>tAg	p.S110*		NM_004750.4	NP_004741.1	O75462	CRLF1_HUMAN	cytokine receptor-like factor 1	110	Ig-like C2-type.				negative regulation of motor neuron apoptotic process (GO:2000672)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|ureteric bud development (GO:0001657)	CRLF-CLCF1 complex (GO:0097058)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.S110*(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	9						GTTGTCCCCCGACCGCTGCCT	0.672																																							uc010ebt.1		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(1)	1						c.(328-330)TCG>TAG		cytokine receptor-like factor 1 precursor							30.0	30.0	30.0					19																	18710443		2203	4300	6503	SO:0001587	stop_gained	9244				negative regulation of neuron apoptosis|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein	extracellular space	cytokine binding|protein heterodimerization activity|receptor activity	g.chr19:18710443G>T	AF059293	CCDS32962.1	19p12	2013-02-11				ENSG00000006016		"""Fibronectin type III domain containing"""	2364	protein-coding gene	gene with protein product	"""cold-induced sweating syndrome"""	604237				9686600	Standard	NM_004750		Approved	CLF-1, CLF, CISS, CISS1	uc010ebt.2	O75462		ENST00000392386.3:c.329C>A	19.37:g.18710443G>T	ENSP00000376188:p.Ser110*						p.S110*	NM_004750	NP_004741	O75462	CRLF1_HUMAN			2	523	-			110			Ig-like C2-type.		Q9UHH5	Nonsense_Mutation	SNP	ENST00000392386.3	37	c.329C>A	CCDS32962.1	.	.	.	.	.	.	.	.	.	.	G	38	6.899462	0.97920	.	.	ENSG00000006016	ENST00000392386	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-14.8055	17.3617	0.87353	0.0:0.0:1.0:0.0	.	.	.	.	X	110	.	ENSP00000376188:S110X	S	-	2	0	CRLF1	18571443	1.000000	0.71417	0.947000	0.38551	0.798000	0.45092	8.931000	0.92884	2.449000	0.82847	0.511000	0.50034	TCG		0.672	CRLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465129.1			10	24	1	0	1.58986e-06	0.008291	1.86097e-06	10	24				
KLHL26	55295	broad.mit.edu	37	19	18778916	18778916	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:18778916G>T	ENST00000300976.4	+	3	799	c.709G>T	c.(709-711)Gac>Tac	p.D237Y	KLHL26_ENST00000599006.1_Intron	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	237	BACK.							p.D237Y(1)		breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						GCTGCAGCATGAcccggcccg	0.687																																							uc002njz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(709-711)GAC>TAC		kelch-like 26							19.0	21.0	20.0					19																	18778916		2196	4287	6483	SO:0001583	missense	55295							g.chr19:18778916G>T		CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.709G>T	19.37:g.18778916G>T	ENSP00000300976:p.Asp237Tyr						p.D237Y	NM_018316	NP_060786	Q53HC5	KLH26_HUMAN			3	736	+			237			BACK.		Q8TAP0|Q9NUX3	Missense_Mutation	SNP	ENST00000300976.4	37	c.709G>T	CCDS12384.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.716172	0.68844	.	.	ENSG00000167487	ENST00000300976	T	0.72394	-0.65	5.04	5.04	0.67666	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.86075	0.5846	M	0.88704	2.975	0.80722	D	1	D	0.57571	0.98	D	0.66847	0.947	D	0.88363	0.2989	9	.	.	.	.	17.3648	0.87360	0.0:0.0:1.0:0.0	.	237	Q53HC5	KLH26_HUMAN	Y	237	ENSP00000300976:D237Y	.	D	+	1	0	KLHL26	18639916	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	7.679000	0.84048	2.341000	0.79615	0.591000	0.81541	GAC		0.687	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465145.1	NM_018316		9	27	1	0	2.74318e-10	0.006214	3.61885e-10	9	27				
ZNF429	353088	broad.mit.edu	37	19	21720876	21720876	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:21720876G>T	ENST00000358491.4	+	4	2229	c.2021G>T	c.(2020-2022)gGc>gTc	p.G674V	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	674					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G674V(1)		endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						gaccgtcctggctaacatggt	0.493																																							uc002nqd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(2020-2022)GGC>GTC		zinc finger protein 429							13.0	12.0	13.0					19																	21720876		1835	4067	5902	SO:0001583	missense	353088				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21720876G>T	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.2021G>T	19.37:g.21720876G>T	ENSP00000351280:p.Gly674Val					ZNF429_uc010ecu.1_Intron	p.G674V	NM_001001415	NP_001001415	Q86V71	ZN429_HUMAN			4	2158	+			674					A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	c.2021G>T	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	9.142	1.014110	0.19277	.	.	ENSG00000197013	ENST00000358491	T	0.07327	3.2	0.717	-0.648	0.11464	.	.	.	.	.	T	0.09202	0.0227	M	0.67397	2.05	0.09310	N	1	P	0.43477	0.808	B	0.39119	0.291	T	0.18524	-1.0334	9	0.87932	D	0	.	4.816	0.13367	0.4262:0.0:0.5738:0.0	.	674	Q86V71	ZN429_HUMAN	V	674	ENSP00000351280:G674V	ENSP00000351280:G674V	G	+	2	0	ZNF429	21512716	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.041000	0.12084	-0.172000	0.10779	-0.361000	0.07541	GGC		0.493	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415		14	10	1	0	9.31168e-06	0.001855	1.06532e-05	14	10				
RYR1	6261	broad.mit.edu	37	19	38949803	38949803	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:38949803G>T	ENST00000359596.3	+	19	2185	c.2185G>T	c.(2185-2187)Gtg>Ttg	p.V729L	RYR1_ENST00000360985.3_Missense_Mutation_p.V729L|RYR1_ENST00000355481.4_Missense_Mutation_p.V729L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	729	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.V729L(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGCACGCCCAGTGACTTCCCC	0.587																																							uc002oit.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(2185-2187)GTG>TTG		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						87.0	72.0	77.0					19																	38949803		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:38949803G>T	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2185G>T	19.37:g.38949803G>T	ENSP00000352608:p.Val729Leu					RYR1_uc002oiu.2_Missense_Mutation_p.V729L	p.V729L	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		19	2315	+	all_cancers(60;7.91e-06)		729			Cytoplasmic.|B30.2/SPRY 1.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.2185G>T	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.450625	0.43531	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.69306	-0.39;-0.39;-0.39	4.58	4.58	0.56647	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	U	0.000014	T	0.81470	0.4829	M	0.74881	2.28	0.58432	D	0.99999	D;D	0.76494	0.994;0.999	P;D	0.76575	0.876;0.988	D	0.84182	0.0440	10	0.72032	D	0.01	.	17.1655	0.86814	0.0:0.0:1.0:0.0	.	729;729	P21817-2;P21817	.;RYR1_HUMAN	L	729	ENSP00000352608:V729L;ENSP00000347667:V729L;ENSP00000354254:V729L	ENSP00000347667:V729L	V	+	1	0	RYR1	43641643	1.000000	0.71417	0.924000	0.36721	0.568000	0.35870	9.657000	0.98554	2.367000	0.80283	0.462000	0.41574	GTG		0.587	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			10	14	1	0	6.40141e-05	0.010729	6.96928e-05	10	14				
TMEM145	284339	broad.mit.edu	37	19	42821933	42821933	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:42821933G>T	ENST00000301204.3	+	12	1014	c.973G>T	c.(973-975)Gcg>Tcg	p.A325S	TMEM145_ENST00000598766.1_Missense_Mutation_p.A349S	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	325					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)		p.A325S(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				ACTGCAGGTGGCGGCCTACGT	0.562																																							uc002otk.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(973-975)GCG>TCG		transmembrane protein 145							164.0	127.0	140.0					19																	42821933		2203	4300	6503	SO:0001583	missense	284339					integral to membrane		g.chr19:42821933G>T	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.973G>T	19.37:g.42821933G>T	ENSP00000301204:p.Ala325Ser						p.A325S	NM_173633	NP_775904	Q8NBT3	TM145_HUMAN			12	1025	+		Prostate(69;0.00682)	325			Helical; (Potential).			Missense_Mutation	SNP	ENST00000301204.3	37	c.973G>T	CCDS12603.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615441	0.28801	.	.	ENSG00000167619	ENST00000301204	T	0.41758	0.99	4.45	4.45	0.53987	Rhodopsin-like GPCR transmembrane domain (1);	0.480380	0.19324	N	0.117066	T	0.30386	0.0763	L	0.40543	1.245	0.32494	N	0.539858	B	0.33413	0.411	B	0.28916	0.096	T	0.35301	-0.9794	10	0.20519	T	0.43	-11.2364	10.9501	0.47323	0.0:0.1904:0.8096:0.0	.	325	Q8NBT3	TM145_HUMAN	S	325	ENSP00000301204:A325S	ENSP00000301204:A325S	A	+	1	0	TMEM145	47513773	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	1.982000	0.40638	2.198000	0.70561	0.591000	0.81541	GCG		0.562	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633		28	13	1	0	4.22769e-11	0.00632	5.66959e-11	28	13				
ZNF285	26974	broad.mit.edu	37	19	44891284	44891284	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:44891284C>A	ENST00000330997.4	-	4	1187	c.1123G>T	c.(1123-1125)Gaa>Taa	p.E375*	ZNF285_ENST00000544719.2_Nonsense_Mutation_p.E375*|ZNF285_ENST00000591679.1_Nonsense_Mutation_p.E382*|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	375					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E375*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						CCACACTCTTCACATTTATAG	0.468																																							uc002ozd.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|skin(2)	4						c.(1123-1125)GAA>TAA		zinc finger protein 285							63.0	64.0	64.0					19																	44891284		2203	4300	6503	SO:0001587	stop_gained	26974				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44891284C>A	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1123G>T	19.37:g.44891284C>A	ENSP00000333595:p.Glu375*					ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Nonsense_Mutation_p.E382*	p.E375*	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN			4	1210	-			375			C2H2-type 5.		Q17RJ3|Q6B0A8|Q6ISR5	Nonsense_Mutation	SNP	ENST00000330997.4	37	c.1123G>T	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	C	31	5.076239	0.94000	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	.	.	.	3.5	-1.93	0.07594	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	0.3539	0.00353	0.2691:0.2183:0.284:0.2287	.	.	.	.	X	398;375	.	ENSP00000333595:E375X	E	-	1	0	ZNF285	49583124	0.000000	0.05858	0.010000	0.14722	0.973000	0.67179	-2.473000	0.00988	0.093000	0.17368	0.454000	0.30748	GAA		0.468	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354		14	15	1	0	0.000151284	0.001855	0.000163387	14	15				
PLA2G4C	8605	broad.mit.edu	37	19	48558213	48558213	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:48558213C>A	ENST00000599921.1	-	15	1708	c.1351G>T	c.(1351-1353)Gcc>Tcc	p.A451S	PLA2G4C_ENST00000354276.3_Missense_Mutation_p.A451S|PLA2G4C_ENST00000413144.2_Missense_Mutation_p.A451S|PLA2G4C_ENST00000596510.1_5'UTR|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.A461S			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	451	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)	p.A451S(1)|p.A451T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		TAGCAGCTGGCGGGGGCCTTG	0.567																																							uc002phx.2		NA																	2	Substitution - Missense(2)		lung(1)|prostate(1)	ovary(1)|skin(1)	2						c.(1351-1353)GCC>TCC		phospholipase A2, group IVC isoform 1 precursor							99.0	98.0	99.0					19																	48558213		2203	4300	6503	SO:0001583	missense	8605				arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding	g.chr19:48558213C>A	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1351G>T	19.37:g.48558213C>A	ENSP00000469473:p.Ala451Ser					PLA2G4C_uc002phv.2_RNA|PLA2G4C_uc002phw.2_Missense_Mutation_p.A386S|PLA2G4C_uc010elr.2_Missense_Mutation_p.A451S|PLA2G4C_uc010xzd.1_Missense_Mutation_p.A461S	p.A451S	NM_003706	NP_003697	Q9UP65	PA24C_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)	15	1749	-		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)	451			PLA2c.		B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	37	c.1351G>T	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	C	0.718	-0.784598	0.02907	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.03951	3.75;3.75	3.19	-0.648	0.11464	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	1.617290	0.04127	N	0.317219	T	0.02929	0.0087	N	0.12182	0.205	0.09310	N	1	B;B	0.26744	0.158;0.112	B;B	0.23150	0.044;0.028	T	0.41787	-0.9489	10	0.33940	T	0.23	-0.0515	3.0116	0.06046	0.353:0.3356:0.0:0.3114	.	461;451	B4DI40;Q9UP65	.;PA24C_HUMAN	S	451	ENSP00000346228:A451S;ENSP00000400036:A451S	ENSP00000346228:A451S	A	-	1	0	PLA2G4C	53250025	0.000000	0.05858	0.002000	0.10522	0.205000	0.24178	-0.172000	0.09868	-0.423000	0.07394	-0.495000	0.04643	GCC		0.567	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1			24	24	1	0	1.85244e-09	0.00333	2.32993e-09	24	24				
AP2A1	160	broad.mit.edu	37	19	50296349	50296349	+	Splice_Site	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:50296349G>T	ENST00000359032.5	+	6	705	c.705G>T	c.(703-705)cgG>cgT	p.R235R	AP2A1_ENST00000354293.5_Splice_Site_p.R235R|AP2A1_ENST00000600199.1_3'UTR	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	235					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)	p.R235R(2)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		GCCTGAGCCGGGTGGGTGTGG	0.637																																							uc002ppn.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(703-705)CGG>CGT		adaptor-related protein complex 2, alpha 1							60.0	70.0	67.0					19																	50296349		2095	4220	6315	SO:0001630	splice_region_variant	160				axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity	g.chr19:50296349G>T	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.705+1G>T	19.37:g.50296349G>T						AP2A1_uc010enj.1_RNA|AP2A1_uc002ppo.2_Silent_p.R235R	p.R235R	NM_014203	NP_055018	O95782	AP2A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)	6	916	+		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)	235					Q96CI7|Q96PP6|Q96PP7|Q9H070	Silent	SNP	ENST00000359032.5	37	c.705G>T	CCDS46148.1																																																																																				0.637	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1		Silent	7	3	1	0	0.00307968	0.00308	0.00318995	7	3				
SIGLEC9	27180	broad.mit.edu	37	19	51628941	51628941	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:51628941G>T	ENST00000250360.3	+	2	576	c.509G>T	c.(508-510)tGt>tTt	p.C170F	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.C170F	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	170	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.C170F(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CCCTGGGCCTGTGAGCAGGGG	0.652																																							uc002pvu.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(508-510)TGT>TTT		sialic acid binding Ig-like lectin 9 precursor							97.0	97.0	97.0					19																	51628941		2203	4300	6503	SO:0001583	missense	27180				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding	g.chr19:51628941G>T	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.509G>T	19.37:g.51628941G>T	ENSP00000250360:p.Cys170Phe					SIGLEC9_uc010yct.1_Missense_Mutation_p.C170F	p.C170F	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)	2	576	+		all_neural(266;0.0529)	170			Extracellular (Potential).|Ig-like C2-type 1.		Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	c.509G>T	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	14.11	2.436514	0.43224	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.02709	4.19;4.19	2.88	2.88	0.33553	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.44902	D	0.000403	T	0.09202	0.0227	L	0.53561	1.675	0.40801	D	0.983342	D	0.89917	1.0	D	0.83275	0.996	T	0.13361	-1.0512	10	0.39692	T	0.17	.	9.0034	0.36097	0.0:0.0:1.0:0.0	.	170	Q9Y336	SIGL9_HUMAN	F	170	ENSP00000413861:C170F;ENSP00000250360:C170F	ENSP00000250360:C170F	C	+	2	0	SIGLEC9	56320753	0.116000	0.22171	0.953000	0.39169	0.919000	0.55068	1.161000	0.31773	1.425000	0.47237	0.514000	0.50259	TGT		0.652	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441		51	83	1	0	5.13769e-22	0.01441	8.70612e-22	51	83				
ZNF71	58491	broad.mit.edu	37	19	57133832	57133832	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:57133832G>T	ENST00000328070.6	+	3	1411	c.1177G>T	c.(1177-1179)Ggg>Tgg	p.G393W		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G393W(1)		endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		GCACTTCACGGGGCGCTCGTC	0.632																																							uc002qnm.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1177-1179)GGG>TGG		zinc finger protein 71							89.0	71.0	77.0					19																	57133832		2203	4300	6503	SO:0001583	missense	58491					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57133832G>T	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.1177G>T	19.37:g.57133832G>T	ENSP00000328245:p.Gly393Trp						p.G393W	NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN		GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)	3	1415	+			393			C2H2-type 10.		Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	ENST00000328070.6	37	c.1177G>T	CCDS12947.1	.	.	.	.	.	.	.	.	.	.	G	9.690	1.151740	0.21371	.	.	ENSG00000197951	ENST00000328070	T	0.07444	3.19	3.58	2.45	0.29901	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10723	0.0262	N	0.12527	0.23	0.09310	N	1	D	0.69078	0.997	P	0.61592	0.891	T	0.31503	-0.9941	9	0.42905	T	0.14	.	9.825	0.40905	0.0:0.357:0.643:0.0	.	393	Q9NQZ8	ZNF71_HUMAN	W	393	ENSP00000328245:G393W	ENSP00000328245:G393W	G	+	1	0	ZNF71	61825644	0.000000	0.05858	0.972000	0.41901	0.991000	0.79684	-0.895000	0.04118	1.815000	0.52974	0.561000	0.74099	GGG		0.632	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216		20	10	1	0	2.39187e-15	0.008871	3.56143e-15	20	10				
ZSCAN4	201516	broad.mit.edu	37	19	58189585	58189585	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr19:58189585T>A	ENST00000318203.5	+	5	1311	c.614T>A	c.(613-615)gTa>gAa	p.V205E		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	205					telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V205E(1)		endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ACTACTCGAGTAAATGAAAAT	0.398																																							uc002qpu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(613-615)GTA>GAA		zinc finger and SCAN domain containing 4							65.0	64.0	65.0					19																	58189585		2203	4300	6503	SO:0001583	missense	201516				telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58189585T>A	AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.614T>A	19.37:g.58189585T>A	ENSP00000321963:p.Val205Glu						p.V205E	NM_152677	NP_689890	Q8NAM6	ZSCA4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	5	1311	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)	205					Q3MIQ2	Missense_Mutation	SNP	ENST00000318203.5	37	c.614T>A	CCDS12958.1	.	.	.	.	.	.	.	.	.	.	T	0.078	-1.189500	0.01607	.	.	ENSG00000180532	ENST00000318203	T	0.06687	3.27	4.35	-0.226	0.13106	.	2.181420	0.02165	N	0.059143	T	0.05502	0.0145	L	0.34521	1.04	0.09310	N	1	P	0.37423	0.594	B	0.35413	0.202	T	0.26360	-1.0105	10	0.02654	T	1	0.5424	2.9344	0.05810	0.198:0.3347:0.0:0.4673	.	205	Q8NAM6	ZSCA4_HUMAN	E	205	ENSP00000321963:V205E	ENSP00000321963:V205E	V	+	2	0	ZSCAN4	62881397	0.023000	0.18921	0.000000	0.03702	0.002000	0.02628	1.585000	0.36600	-0.018000	0.14079	0.533000	0.62120	GTA		0.398	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466812.1	NM_152677		13	10	0	0	0	0.001855	0	13	10				
APOB	338	broad.mit.edu	37	2	21228767	21228767	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:21228767T>G	ENST00000233242.1	-	26	11100	c.10973A>C	c.(10972-10974)cAc>cCc	p.H3658P		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3658					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.H3658P(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATGTCAAGGTGTGCCTTTTC	0.433																																							uc002red.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(10972-10974)CAC>CCC		apolipoprotein B precursor	Atorvastatin(DB01076)						88.0	84.0	85.0					2																	21228767		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21228767T>G	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10973A>C	2.37:g.21228767T>G	ENSP00000233242:p.His3658Pro						p.H3658P	NM_000384	NP_000375	P04114	APOB_HUMAN			26	11101	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		3658					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.10973A>C	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	16.28	3.079334	0.55753	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.69561	-0.41	5.75	3.9	0.45041	.	0.436893	0.20614	N	0.088920	T	0.52853	0.1760	N	0.22421	0.69	0.45390	D	0.998374	B	0.31611	0.331	B	0.36030	0.216	T	0.52260	-0.8599	10	0.72032	D	0.01	.	7.874	0.29582	0.0:0.6592:0.0:0.3408	.	3658	P04114	APOB_HUMAN	P	3658	ENSP00000233242:H3658P	ENSP00000233242:H3658P	H	-	2	0	APOB	21082272	0.128000	0.22383	0.130000	0.21974	0.843000	0.47879	1.337000	0.33862	0.710000	0.31997	0.533000	0.62120	CAC		0.433	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			36	15	0	0	0	0.003271	0	36	15				
GALNT14	79623	broad.mit.edu	37	2	31189075	31189075	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:31189075G>T	ENST00000349752.5	-	3	1032	c.393C>A	c.(391-393)atC>atA	p.I131I	GALNT14_ENST00000420311.2_Silent_p.I96I|GALNT14_ENST00000356174.3_Intron|GALNT14_ENST00000406653.1_Silent_p.I111I|GALNT14_ENST00000324589.5_Silent_p.I136I	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	131	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.I131I(1)		cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CTCACCTGCGGATGGTCCTGA	0.602																																							uc002rnr.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(2)|skin(1)	3						c.(391-393)ATC>ATA		N-acetylgalactosaminyltransferase 14							205.0	163.0	177.0					2																	31189075		2203	4300	6503	SO:0001819	synonymous_variant	79623					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:31189075G>T	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.393C>A	2.37:g.31189075G>T						GALNT14_uc002rnq.2_Silent_p.I111I|GALNT14_uc002rns.2_Silent_p.I136I|GALNT14_uc010ymr.1_Silent_p.I96I|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Silent_p.I102I	p.I131I	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN			3	1012	-	Acute lymphoblastic leukemia(172;0.155)		131			Lumenal (Potential).|Catalytic subdomain A.		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Silent	SNP	ENST00000349752.5	37	c.393C>A	CCDS1773.2																																																																																				0.602	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		19	10	1	0	7.45023e-12	0.010504	1.02981e-11	19	10				
LTBP1	4052	broad.mit.edu	37	2	33442709	33442709	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:33442709C>A	ENST00000404816.2	+	8	2145	c.1792C>A	c.(1792-1794)Ccc>Acc	p.P598T	LTBP1_ENST00000404525.1_Missense_Mutation_p.P272T|LTBP1_ENST00000407925.1_Missense_Mutation_p.P272T|LTBP1_ENST00000402934.1_Missense_Mutation_p.P272T|LTBP1_ENST00000354476.3_Missense_Mutation_p.P598T|LTBP1_ENST00000390003.4_Missense_Mutation_p.P272T|LTBP1_ENST00000418533.2_Missense_Mutation_p.P272T			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	598	TB 1.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.P598T(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CCAGAAATGCCCCAAGAAACC	0.433																																							uc002ros.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8						c.(1792-1794)CCC>ACC		latent transforming growth factor beta binding							79.0	72.0	74.0					2																	33442709		2203	4300	6503	SO:0001583	missense	4052				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity	g.chr2:33442709C>A		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1792C>A	2.37:g.33442709C>A	ENSP00000386043:p.Pro598Thr					LTBP1_uc002rot.2_Missense_Mutation_p.P272T|LTBP1_uc002rou.2_Missense_Mutation_p.P272T|LTBP1_uc002rov.2_Missense_Mutation_p.P272T|LTBP1_uc010ymz.1_Missense_Mutation_p.P272T|LTBP1_uc010yna.1_Missense_Mutation_p.P272T	p.P598T	NM_206943	NP_996826	Q14766	LTBP1_HUMAN			8	1792	+	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)	598			TB 1.		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	c.1792C>A	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627860	0.87560	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.98135	-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74	5.63	5.63	0.86233	Matrix fibril-associated (3);TGF-beta binding (1);	.	.	.	.	D	0.98667	0.9553	M	0.74881	2.28	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.993;0.999;0.999;0.999	D	0.99647	1.0990	9	0.87932	D	0	.	20.0499	0.97621	0.0:1.0:0.0:0.0	.	598;272;272;272;272;598	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	T	598;598;272;272;272;272;272	ENSP00000386043:P598T;ENSP00000346467:P598T;ENSP00000374653:P272T;ENSP00000393057:P272T;ENSP00000384373:P272T;ENSP00000385359:P272T;ENSP00000384091:P272T	ENSP00000346467:P598T	P	+	1	0	LTBP1	33296213	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.235000	0.78143	2.798000	0.96311	0.655000	0.94253	CCC		0.433	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943		25	9	1	0	1.26454e-06	0.005443	1.48446e-06	25	9				
EIF2AK2	5610	broad.mit.edu	37	2	37349652	37349652	+	Nonsense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:37349652G>C	ENST00000233057.4	-	12	1386	c.1064C>G	c.(1063-1065)tCa>tGa	p.S355*	EIF2AK2_ENST00000395127.2_Nonsense_Mutation_p.S355*|EIF2AK2_ENST00000405334.1_Nonsense_Mutation_p.S314*	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	355	2 X 13 AA approximate repeats.|Interaction with TRAF5.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)	p.S355*(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				TAGTTACCTTGAACTATTTTT	0.363																																							uc010ynh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|lung(2)|pancreas(1)	5						c.(1063-1065)TCA>TGA		eukaryotic translation initiation factor 2-alpha							122.0	113.0	116.0					2																	37349652		2203	4300	6503	SO:0001587	stop_gained	5610				evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity	g.chr2:37349652G>C	BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.1064C>G	2.37:g.37349652G>C	ENSP00000233057:p.Ser355*					EIF2AK2_uc010fab.1_Nonsense_Mutation_p.S314*|EIF2AK2_uc010yng.1_Nonsense_Mutation_p.S355*|EIF2AK2_uc010fac.2_Nonsense_Mutation_p.S355*|EIF2AK2_uc010fad.2_Intron	p.S355*	NM_002759	NP_002750	P19525	E2AK2_HUMAN			12	1621	-		all_hematologic(82;0.248)	355			2.|2 X 13 AA approximate repeats.|Protein kinase.		A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Nonsense_Mutation	SNP	ENST00000233057.4	37	c.1064C>G	CCDS1786.1	.	.	.	.	.	.	.	.	.	.	G	36	5.824879	0.96989	.	.	ENSG00000055332	ENST00000233057;ENST00000395127;ENST00000405334	.	.	.	3.46	-4.61	0.03380	.	2.524030	0.01624	N	0.023204	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	0.8524	0.01175	0.3217:0.1121:0.3272:0.2389	.	.	.	.	X	355;355;314	.	ENSP00000233057:S355X	S	-	2	0	EIF2AK2	37203156	0.093000	0.21703	0.000000	0.03702	0.003000	0.03518	0.022000	0.13511	-1.330000	0.02255	-1.312000	0.01307	TCA		0.363	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218571.2	NM_002759		10	72	0	0	0	0.008291	0	10	72				
NRXN1	9378	broad.mit.edu	37	2	50723056	50723056	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:50723056G>T	ENST00000406316.2	-	15	4533	c.3057C>A	c.(3055-3057)aaC>aaA	p.N1019K	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000401669.2_Missense_Mutation_p.N1019K|NRXN1_ENST00000404971.1_Missense_Mutation_p.N1059K|NRXN1_ENST00000401710.1_Missense_Mutation_p.N28K|NRXN1_ENST00000402717.3_Missense_Mutation_p.N1011K|NRXN1_ENST00000406859.3_Missense_Mutation_p.N1019K|NRXN1_ENST00000405472.3_Missense_Mutation_p.N1011K	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1019	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.N1059K(1)|p.N1060K(1)|p.N1019K(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGAGGTCTAAGTTCCTGGCTC	0.478																																							uc010fbq.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(2)	2						c.(3175-3177)AAC>AAA		neurexin 1 isoform alpha2 precursor							188.0	185.0	186.0					2																	50723056		2093	4220	6313	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50723056G>T	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3057C>A	2.37:g.50723056G>T	ENSP00000384311:p.Asn1019Lys					NRXN1_uc002rxb.3_Missense_Mutation_p.N691K|NRXN1_uc002rxe.3_Missense_Mutation_p.N1019K|NRXN1_uc002rxc.1_RNA	p.N1059K	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		15	4654	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.3177C>A	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.926838	0.73327	.	.	ENSG00000179915	ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.61	1.54	0.23209	.	0.000000	0.85682	D	0.000000	T	0.81654	0.4868	L	0.49455	1.56	0.34426	D	0.698045	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.966;0.999;1.0	T	0.81682	-0.0822	10	0.25751	T	0.34	.	11.1388	0.48390	0.3556:0.0:0.6444:0.0	.	1059;1019;1011	Q9ULB1-3;F8WB18;A7E294	.;.;.	K	28;1059;1019;1011;1019;1060;1011;1019	ENSP00000385580:N28K;ENSP00000385142:N1059K;ENSP00000384311:N1019K;ENSP00000434015:N1011K;ENSP00000385017:N1019K;ENSP00000385434:N1011K;ENSP00000385681:N1019K	ENSP00000385017:N1019K	N	-	3	2	NRXN1	50576560	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.345000	0.44018	0.340000	0.23745	0.655000	0.94253	AAC		0.478	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			6	39	1	0	8.12818e-05	0.001984	8.82551e-05	6	39				
CLEC4F	165530	broad.mit.edu	37	2	71043709	71043709	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:71043709C>G	ENST00000272367.2	-	4	880	c.804G>C	c.(802-804)agG>agC	p.R268S	CLEC4F_ENST00000426626.1_Missense_Mutation_p.R268S	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	268					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R268S(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						GGTTCTGGGTCCTCAAGTCAT	0.423																																					Colon(107;10 2157 6841 26035)	Colon(107;10 2157 6841 26035)	uc002shf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)	5						c.(802-804)AGG>AGC		C-type lectin, superfamily member 13							75.0	76.0	76.0					2																	71043709		2203	4299	6502	SO:0001583	missense	165530				endocytosis	integral to membrane	receptor activity|sugar binding	g.chr2:71043709C>G	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.804G>C	2.37:g.71043709C>G	ENSP00000272367:p.Arg268Ser					CLEC4F_uc010yqv.1_Missense_Mutation_p.R268S	p.R268S	NM_173535	NP_775806	Q8N1N0	CLC4F_HUMAN			4	881	-			268			Extracellular (Potential).		A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	c.804G>C	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	C	10.12	1.262423	0.23051	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.78481	-1.18;-1.18	3.51	0.504	0.16946	.	0.414976	0.17755	N	0.163085	T	0.54351	0.1853	N	0.11870	0.19	0.09310	N	1	B;B	0.22346	0.025;0.068	B;B	0.21546	0.014;0.035	T	0.37502	-0.9703	10	0.25751	T	0.34	.	5.8028	0.18424	0.3909:0.4184:0.1907:0.0	.	268;268	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	S	268	ENSP00000272367:R268S;ENSP00000390581:R268S	ENSP00000272367:R268S	R	-	3	2	CLEC4F	70897217	0.000000	0.05858	0.000000	0.03702	0.797000	0.45037	-1.714000	0.01881	0.090000	0.17273	0.313000	0.20887	AGG		0.423	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535		97	41	0	0	0	0.01441	0	97	41				
ALMS1	7840	broad.mit.edu	37	2	73678721	73678721	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:73678721G>T	ENST00000264448.6	+	8	5175	c.5064G>T	c.(5062-5064)ctG>ctT	p.L1688L	ALMS1_ENST00000409009.1_Silent_p.L1646L|ALMS1_ENST00000377715.1_Silent_p.L1688L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1688	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AAGAAGCTCTGAAAGTTCCAC	0.443																																							uc002sje.1		NA																	0				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(5068-5070)CTG>CTT		Alstrom syndrome 1							97.0	99.0	98.0					2																	73678721		1869	4097	5966	SO:0001819	synonymous_variant	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73678721G>T	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.5064G>T	2.37:g.73678721G>T						ALMS1_uc002sjf.1_Silent_p.L1646L|ALMS1_uc002sjg.2_Silent_p.L1076L|ALMS1_uc002sjh.1_Silent_p.L1076L	p.L1690L	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN			10	5181	+			1688			25.|34 X 47 AA approximate tandem repeat.		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	37	c.5070G>T	CCDS42697.1																																																																																				0.443	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		78	35	1	0	4.75426e-39	0.01441	9.16892e-39	78	35				
C2orf78	388960	broad.mit.edu	37	2	74040979	74040979	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:74040979C>A	ENST00000409561.1	+	2	594	c.473C>A	c.(472-474)tCc>tAc	p.S158Y		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	158								p.S158Y(2)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						GCTGTCTCTTCCATGTCTATG	0.448																																							uc002sjr.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(472-474)TCC>TAC		hypothetical protein LOC388960							68.0	62.0	63.0					2																	74040979		1930	4139	6069	SO:0001583	missense	388960							g.chr2:74040979C>A	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.473C>A	2.37:g.74040979C>A	ENSP00000387124:p.Ser158Tyr						p.S158Y	NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN			2	594	+			158						Missense_Mutation	SNP	ENST00000409561.1	37	c.473C>A	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897740	0.33535	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.34275	1.37	5.14	4.25	0.50352	.	0.000000	0.30556	U	0.009367	T	0.60340	0.2261	M	0.80183	2.485	0.31764	N	0.633001	D	0.89917	1.0	D	0.91635	0.999	T	0.70483	-0.4859	10	0.87932	D	0	-22.8005	11.9341	0.52864	0.0:0.8245:0.1755:0.0	.	158	A6NCI8	CB078_HUMAN	Y	158	ENSP00000387124:S158Y	ENSP00000340692:S158Y	S	+	2	0	C2orf78	73894487	0.031000	0.19500	0.812000	0.32479	0.051000	0.14879	1.997000	0.40786	1.284000	0.44531	0.655000	0.94253	TCC		0.448	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		31	8	1	0	8.16721e-17	0.010818	1.2435e-16	31	8				
PROM2	150696	broad.mit.edu	37	2	95941743	95941743	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:95941743G>T	ENST00000317620.9	+	3	493	c.360G>T	c.(358-360)gtG>gtT	p.V120V	PROM2_ENST00000463580.1_Intron|PROM2_ENST00000403131.2_Silent_p.V120V|PROM2_ENST00000542147.1_Silent_p.V120V|PROM2_ENST00000317668.4_Silent_p.V120V	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	120					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)	p.V120V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						TGCTGCTGGTGCCCACTGCCG	0.701																																							uc002suh.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(358-360)GTG>GTT		prominin 2 precursor							22.0	33.0	29.0					2																	95941743		2201	4298	6499	SO:0001819	synonymous_variant	150696					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane		g.chr2:95941743G>T	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.360G>T	2.37:g.95941743G>T						PROM2_uc002sui.2_Silent_p.V120V|PROM2_uc002suj.2_5'UTR|PROM2_uc002suk.2_Silent_p.V120V|PROM2_uc002sul.2_5'UTR	p.V120V	NM_144707	NP_653308	Q8N271	PROM2_HUMAN			3	493	+			120			Helical; (Potential).		A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Silent	SNP	ENST00000317620.9	37	c.360G>T	CCDS2012.1																																																																																				0.701	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707		6	33	1	0	0.00116845	0.001168	0.00122596	6	33				
ZAP70	7535	broad.mit.edu	37	2	98341688	98341688	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:98341688C>T	ENST00000264972.5	+	4	751	c.536C>T	c.(535-537)tCt>tTt	p.S179F	ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.S53F	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	179	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.S179F(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						AAACTTTACTCTGGGGCGCAG	0.652																																							uc002syd.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						c.(535-537)TCT>TTT		zeta-chain associated protein kinase 70kDa							50.0	47.0	48.0					2																	98341688		2203	4300	6503	SO:0001583	missense	7535				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr2:98341688C>T	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.536C>T	2.37:g.98341688C>T	ENSP00000264972:p.Ser179Phe					ZAP70_uc010yvf.1_Missense_Mutation_p.S179F|ZAP70_uc002sye.1_Missense_Mutation_p.S69F	p.S179F	NM_001079	NP_001070	P43403	ZAP70_HUMAN			4	743	+			179			SH2 2.		A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	37	c.536C>T	CCDS33254.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.011050	0.35511	.	.	ENSG00000115085	ENST00000264972;ENST00000442208	D;D	0.89485	-2.52;-2.52	5.33	3.4	0.38934	SH2 motif (4);	0.159778	0.29438	N	0.012153	D	0.91747	0.7390	M	0.87758	2.905	0.47905	D	0.999547	P;P;D	0.54047	0.611;0.956;0.964	B;P;P	0.57371	0.316;0.723;0.819	D	0.89748	0.3938	10	0.10111	T	0.7	.	8.9488	0.35776	0.0:0.7663:0.1497:0.0841	.	179;53;179	B4E0E2;P43403-3;P43403	.;.;ZAP70_HUMAN	F	179;53	ENSP00000264972:S179F;ENSP00000411141:S53F	ENSP00000264972:S179F	S	+	2	0	ZAP70	97708120	0.247000	0.23920	0.191000	0.23289	0.230000	0.25150	1.853000	0.39358	1.376000	0.46267	0.591000	0.81541	TCT		0.652	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1			6	109	0	0	0	0.001168	0	6	109				
CNTNAP5	129684	broad.mit.edu	37	2	124783245	124783245	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:124783245G>T	ENST00000431078.1	+	1	382	c.18G>T	c.(16-18)cgG>cgT	p.R6R	AC079154.1_ENST00000438816.1_RNA|CNTNAP5_ENST00000423939.2_3'UTR	NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	6					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.R6R(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CTTTACCACGGCTGACCAGCG	0.552																																							uc002tno.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(10)	10						c.(16-18)CGG>CGT		contactin associated protein-like 5 precursor							122.0	127.0	125.0					2																	124783245		2000	4164	6164	SO:0001819	synonymous_variant	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:124783245G>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.18G>T	2.37:g.124783245G>T						CNTNAP5_uc010flu.2_Silent_p.R6R	p.R6R	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	1	382	+			6					Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	c.18G>T	CCDS46401.1																																																																																				0.552	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			14	53	1	0	1.05317e-09	0.00245	1.33292e-09	14	53				
NCKAP5	344148	broad.mit.edu	37	2	133483297	133483297	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:133483297G>T	ENST00000409261.1	-	19	5989	c.5616C>A	c.(5614-5616)agC>agA	p.S1872R	NCKAP5_ENST00000317721.6_Missense_Mutation_p.S1872R|NCKAP5_ENST00000409213.1_Missense_Mutation_p.S553R|NCKAP5_ENST00000405974.3_Missense_Mutation_p.S553R	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1872								p.S1872S(1)|p.S1872R(1)|p.S392R(1)|p.S392S(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TACTGCCACCGCTGGCAGAGT	0.458																																							uc002ttp.2		NA																	4	Substitution - Missense(2)|Substitution - coding silent(2)		large_intestine(2)|lung(2)		0						c.(5614-5616)AGC>AGA		Nck-associated protein 5 isoform 1							101.0	96.0	98.0					2																	133483297		1951	4167	6118	SO:0001583	missense	344148						protein binding	g.chr2:133483297G>T	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5616C>A	2.37:g.133483297G>T	ENSP00000387128:p.Ser1872Arg					NCKAP5_uc002ttq.2_Missense_Mutation_p.S553R	p.S1872R	NM_207363	NP_997246	O14513	NCKP5_HUMAN			19	5990	-			1872					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.5616C>A	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.746757	0.30955	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.44482	2.93;0.92;2.93;0.92	4.25	-3.37	0.04898	.	1.629490	0.04352	U	0.355896	T	0.27098	0.0664	N	0.19112	0.55	0.21499	N	0.999669	B;B	0.20671	0.026;0.047	B;B	0.23852	0.018;0.049	T	0.32052	-0.9921	10	0.87932	D	0	.	4.9314	0.13919	0.4867:0.0:0.371:0.1423	.	553;1872	O14513-2;O14513	.;NCKP5_HUMAN	R	1872;553;1872;553;553	ENSP00000387128:S1872R;ENSP00000386952:S553R;ENSP00000380603:S1872R;ENSP00000385692:S553R	ENSP00000380603:S1872R	S	-	3	2	NCKAP5	133199767	0.978000	0.34361	0.354000	0.25760	0.990000	0.78478	0.465000	0.22004	-0.913000	0.03832	0.563000	0.77884	AGC		0.458	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		6	19	1	0	3.59834e-05	0.001168	3.99267e-05	6	19				
LCT	3938	broad.mit.edu	37	2	136570190	136570190	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:136570190C>A	ENST00000264162.2	-	7	2054	c.2044G>T	c.(2044-2046)Ggt>Tgt	p.G682C	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	682	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.G682C(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TGCGACAGACCCAGAAAATCA	0.537																																							uc002tuu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(2044-2046)GGT>TGT		lactase-phlorizin hydrolase preproprotein							101.0	93.0	96.0					2																	136570190		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136570190C>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2044G>T	2.37:g.136570190C>A	ENSP00000264162:p.Gly682Cys						p.G682C	NM_002299	NP_002290	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	7	2055	-			682			Extracellular (Potential).|4 X approximate repeats.|2.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.2044G>T	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.464752	0.84425	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.67865	-0.29	5.49	5.49	0.81192	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.107150	0.64402	D	0.000005	D	0.85923	0.5810	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88482	0.3069	10	0.87932	D	0	-19.5595	19.3929	0.94592	0.0:1.0:0.0:0.0	.	682	P09848	LPH_HUMAN	C	682;114	ENSP00000264162:G682C	ENSP00000264162:G682C	G	-	1	0	LCT	136286660	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.920000	0.70017	2.583000	0.87209	0.655000	0.94253	GGT		0.537	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		11	53	1	0	0.000673444	0.008291	0.000708428	11	53				
LCT	3938	broad.mit.edu	37	2	136594342	136594342	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:136594342T>C	ENST00000264162.2	-	1	408	c.398A>G	c.(397-399)cAc>cGc	p.H133R		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	133	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.H133R(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GAGGGTCTGGTGGTGCAGGAT	0.597																																							uc002tuu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13						c.(397-399)CAC>CGC		lactase-phlorizin hydrolase preproprotein							92.0	81.0	84.0					2																	136594342		2203	4300	6503	SO:0001583	missense	3938				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity	g.chr2:136594342T>C	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.398A>G	2.37:g.136594342T>C	ENSP00000264162:p.His133Arg						p.H133R	NM_002299	NP_002290	P09848	LPH_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.169)	1	409	-			133			Extracellular (Potential).|4 X approximate repeats.|1.		Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	c.398A>G	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	t	5.927	0.355104	0.11239	.	.	ENSG00000115850	ENST00000264162	T	0.61040	0.14	5.83	3.45	0.39498	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.853182	0.11016	N	0.608900	T	0.62648	0.2445	M	0.86805	2.84	0.09310	N	0.999991	B	0.06786	0.001	B	0.12156	0.007	T	0.55630	-0.8111	10	0.46703	T	0.11	-4.5371	9.9195	0.41455	0.0:0.1979:0.0:0.8021	.	133	P09848	LPH_HUMAN	R	133	ENSP00000264162:H133R	ENSP00000264162:H133R	H	-	2	0	LCT	136310812	0.947000	0.32204	0.062000	0.19696	0.028000	0.11728	2.131000	0.42074	0.469000	0.27268	-0.295000	0.09555	CAC		0.597	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		10	26	0	0	0	0.010729	0	10	26				
LRP1B	53353	broad.mit.edu	37	2	141272306	141272306	+	Missense_Mutation	SNP	C	C	T	rs372667614		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:141272306C>T	ENST00000389484.3	-	51	9156	c.8185G>A	c.(8185-8187)Gca>Aca	p.A2729T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2729	LDL-receptor class A 16. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.A2729T(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATTTTTGTGCGGAACAAGCA	0.378										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(8185-8187)GCA>ACA		low density lipoprotein-related protein 1B		C	THR/ALA	0,4406		0,0,2203	106.0	98.0	101.0		8185	-0.6	0.2	2		101	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRP1B	NM_018557.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	2729/4600	141272306	1,13005	2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141272306C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8185G>A	2.37:g.141272306C>T	ENSP00000374135:p.Ala2729Thr	TSP Lung(27;0.18)					p.A2729T	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	51	9157	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	2729			Extracellular (Potential).|LDL-receptor class A 16.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.8185G>A	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.027884	0.35797	0.0	1.16E-4	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.42131	0.98	5.53	-0.648	0.11464	.	0.393240	0.25283	U	0.031787	T	0.09468	0.0233	N	0.00583	-1.355	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25257	-1.0137	10	0.24483	T	0.36	.	2.6592	0.05021	0.1113:0.4676:0.1083:0.3128	.	2729	Q9NZR2	LRP1B_HUMAN	T	2729;2667	ENSP00000374135:A2729T	ENSP00000374135:A2729T	A	-	1	0	LRP1B	140988776	0.512000	0.26186	0.246000	0.24233	0.992000	0.81027	1.014000	0.29950	-0.103000	0.12175	0.655000	0.94253	GCA		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		9	26	0	0	0	0.004482	0	9	26				
KCNJ3	3760	broad.mit.edu	37	2	155555721	155555721	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:155555721G>C	ENST00000295101.2	+	1	911	c.434G>C	c.(433-435)gGc>gCc	p.G145A	KCNJ3_ENST00000544049.1_Missense_Mutation_p.G145A|AC061961.2_ENST00000443901.1_RNA	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	145					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.G145A(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	GCCACCATCGGCTATGGCTAC	0.562																																							uc002tyv.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|pancreas(1)	2						c.(433-435)GGC>GCC		potassium inwardly-rectifying channel J3	Halothane(DB01159)						101.0	76.0	84.0					2																	155555721		2203	4300	6503	SO:0001583	missense	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155555721G>C	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.434G>C	2.37:g.155555721G>C	ENSP00000295101:p.Gly145Ala					KCNJ3_uc010zce.1_Missense_Mutation_p.G145A	p.G145A	NM_002239	NP_002230	P48549	IRK3_HUMAN			1	629	+			145			Selectivity filter (By similarity).		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	c.434G>C	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085207	0.76642	.	.	ENSG00000162989	ENST00000295101;ENST00000544049	D;D	0.99910	-7.91;-2.66	5.26	5.26	0.73747	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.99939	0.9973	H	0.97983	4.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95989	0.8984	10	0.87932	D	0	.	17.4142	0.87495	0.0:0.0:1.0:0.0	.	145;145	B4DEW7;P48549	.;IRK3_HUMAN	A	145	ENSP00000295101:G145A;ENSP00000438410:G145A	ENSP00000295101:G145A	G	+	2	0	KCNJ3	155263967	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.778000	0.99011	2.452000	0.82932	0.555000	0.69702	GGC		0.562	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		17	28	0	0	0	0.007413	0	17	28				
XIRP2	129446	broad.mit.edu	37	2	168108351	168108351	+	Silent	SNP	G	G	T	rs186691484	byFrequency	TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:168108351G>T	ENST00000409195.1	+	9	10538	c.10449G>T	c.(10447-10449)acG>acT	p.T3483T	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Silent_p.T3483T|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Silent_p.T3261T|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3308					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.T3483T(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTCAAAAGACGTGGCAAGAGA	0.413																																							uc002udx.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(7)|ovary(6)|pancreas(1)	14						c.(10447-10449)ACG>ACT		xin actin-binding repeat containing 2 isoform 1							62.0	63.0	63.0					2																	168108351		1860	4083	5943	SO:0001819	synonymous_variant	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168108351G>T	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.10449G>T	2.37:g.168108351G>T						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.T3308T|XIRP2_uc010fpq.2_Silent_p.T3261T|XIRP2_uc010fpr.2_Intron	p.T3483T	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN			8	10467	+			3308					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	c.10449G>T	CCDS42769.1																																																																																				0.413	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		18	35	1	0	5.35267e-07	0.007413	6.3202e-07	18	35				
ZAK	51776	broad.mit.edu	37	2	174131278	174131278	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:174131278A>G	ENST00000375213.3	+	20	2281	c.2203A>G	c.(2203-2205)Agg>Ggg	p.R735G	MLTK_ENST00000409176.2_Missense_Mutation_p.R735G|MLK7-AS1_ENST00000422703.1_RNA|MLK7-AS1_ENST00000423106.2_RNA	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		735					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)	p.R735G(1)									GAGAAGCCCCAGGGACCTCCA	0.542																																							uc002uhz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(3)|stomach(1)|ovary(1)|skin(1)	6						c.(2203-2205)AGG>GGG		MLK-related kinase isoform 1							61.0	64.0	63.0					2																	174131278		1924	4122	6046	SO:0001583	missense	51776				activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding	g.chr2:174131278A>G																												ENST00000375213.3:c.2203A>G	2.37:g.174131278A>G	ENSP00000364361:p.Arg735Gly					uc002uib.2_Intron	p.R735G	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.176)		20	2403	+			735					B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	ENST00000375213.3	37	c.2203A>G	CCDS42777.1	.	.	.	.	.	.	.	.	.	.	A	4.413	0.076333	0.08485	.	.	ENSG00000091436	ENST00000409176;ENST00000375213	T;T	0.74106	-0.81;-0.81	6.08	2.18	0.27775	.	0.713793	0.14049	N	0.344893	T	0.55146	0.1902	N	0.14661	0.345	0.09310	N	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.43653	-0.9378	10	0.37606	T	0.19	.	8.8739	0.35334	0.5765:0.3519:0.0716:0.0	.	735	Q9NYL2	MLTK_HUMAN	G	735	ENSP00000387259:R735G;ENSP00000364361:R735G	ENSP00000364361:R735G	R	+	1	2	AC013461.1	173839524	0.009000	0.17119	0.003000	0.11579	0.054000	0.15201	1.457000	0.35212	0.518000	0.28383	0.482000	0.46254	AGG		0.542	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255401.1			17	35	0	0	0	0.008871	0	17	35				
TTN	7273	broad.mit.edu	37	2	179435936	179435936	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:179435936C>G	ENST00000591111.1	-	276	70224	c.70000G>C	c.(70000-70002)Gaa>Caa	p.E23334Q	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E16035Q|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E22407Q|TTN_ENST00000589042.1_Missense_Mutation_p.E24975Q|TTN_ENST00000460472.2_Missense_Mutation_p.E15910Q|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E16102Q|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23334	Fibronectin type-III 69. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E22407Q(1)|p.E16102Q(1)|p.E22405Q(1)|p.E16035Q(1)|p.E15910Q(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAACACCTTCTTCAAGGCCA	0.418																																							uc010zfg.1		NA																	5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(67219-67221)GAA>CAA		titin isoform N2-A							96.0	94.0	95.0					2																	179435936		1936	4135	6071	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179435936C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70000G>C	2.37:g.179435936C>G	ENSP00000465570:p.Glu23334Gln					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E16102Q|TTN_uc010zfi.1_Missense_Mutation_p.E16035Q|TTN_uc010zfj.1_Missense_Mutation_p.E15910Q	p.E22407Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	67443	-			23334					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.67219G>C		.	.	.	.	.	.	.	.	.	.	C	13.33	2.205222	0.39003	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.28	5.28	0.74379	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70211	0.3198	L	0.53249	1.67	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.72272	-0.4342	9	0.87932	D	0	.	19.2734	0.94019	0.0:1.0:0.0:0.0	.	15910;16035;16102;23334	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	22407;15910;16102;16035;15908	ENSP00000343764:E22407Q;ENSP00000434586:E15910Q;ENSP00000340554:E16102Q;ENSP00000352154:E16035Q	ENSP00000340554:E16102Q	E	-	1	0	TTN	179144182	1.000000	0.71417	0.944000	0.38274	0.908000	0.53690	6.001000	0.70685	2.630000	0.89119	0.650000	0.86243	GAA		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		6	102	0	0	0	0.001984	0	6	102				
TTN	7273	broad.mit.edu	37	2	179588619	179588619	+	Missense_Mutation	SNP	C	C	A	rs377229283		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:179588619C>A	ENST00000591111.1	-	71	20640	c.20416G>T	c.(20416-20418)Ggg>Tgg	p.G6806W	TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.G5879W|TTN_ENST00000589042.1_Missense_Mutation_p.G7123W|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12403	Ig-like 49.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G5879W(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATCAGACCCAGCGACATTA	0.423																																							uc010zfg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(17635-17637)GGG>TGG		titin isoform N2-A							111.0	108.0	109.0					2																	179588619		2018	4182	6200	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179588619C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.20416G>T	2.37:g.179588619C>A	ENSP00000465570:p.Gly6806Trp					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G2540W	p.G5879W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		70	17859	-			6806					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.17635G>T		.	.	.	.	.	.	.	.	.	.	C	16.03	3.007167	0.54361	.	.	ENSG00000155657	ENST00000342992	T	0.75260	-0.92	6.08	6.08	0.98989	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.93038	0.7784	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95087	0.8218	9	0.87932	D	0	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	6806	Q8WZ42	TITIN_HUMAN	W	5879	ENSP00000343764:G5879W	ENSP00000343764:G5879W	G	-	1	0	TTN	179296864	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.657000	0.67996	2.894000	0.99253	0.655000	0.94253	GGG		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		16	48	1	0	1.15088e-07	0.004007	1.37494e-07	16	48				
PARD3B	117583	broad.mit.edu	37	2	205829880	205829880	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:205829880T>G	ENST00000406610.2	+	3	435	c.228T>G	c.(226-228)atT>atG	p.I76M	PARD3B_ENST00000462231.1_Missense_Mutation_p.I76M|PARD3B_ENST00000358768.2_Missense_Mutation_p.I76M|PARD3B_ENST00000349953.3_Missense_Mutation_p.I76M|PARD3B_ENST00000351153.1_Missense_Mutation_p.I76M	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	76					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)		p.I76M(2)|p.I77M(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		TGTAGCTGATTGCTGTGTTTG	0.453																																							uc002var.1		NA																	3	Substitution - Missense(3)		lung(3)	skin(2)|ovary(1)|breast(1)	4						c.(226-228)ATT>ATG		par-3 partitioning defective 3 homolog B isoform							112.0	108.0	109.0					2																	205829880		1914	4120	6034	SO:0001583	missense	117583				cell cycle|cell division	endomembrane system|tight junction		g.chr2:205829880T>G	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.228T>G	2.37:g.205829880T>G	ENSP00000385848:p.Ile76Met					PARD3B_uc010fub.1_Missense_Mutation_p.I76M|PARD3B_uc002vao.1_Missense_Mutation_p.I76M|PARD3B_uc002vap.1_Missense_Mutation_p.I76M|PARD3B_uc002vaq.1_Missense_Mutation_p.I76M	p.I76M	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN		Epithelial(149;0.0739)	3	435	+		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)	76					E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	ENST00000406610.2	37	c.228T>G		.	.	.	.	.	.	.	.	.	.	T	20.6	4.017794	0.75161	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.76	5.76	0.90799	.	0.057647	0.64402	D	0.000003	T	0.65995	0.2745	L	0.59436	1.845	0.42077	D	0.991235	D;D;D;D;P	0.89917	0.999;1.0;0.997;1.0;0.824	D;D;D;D;P	0.91635	0.997;0.999;0.972;0.984;0.474	T	0.68157	-0.5483	10	0.59425	D	0.04	.	16.079	0.80989	0.0:0.0:0.0:1.0	.	76;76;76;76;76	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	M	76	ENSP00000385848:I76M;ENSP00000351618:I76M;ENSP00000317261:I76M;ENSP00000340280:I76M	ENSP00000340280:I76M	I	+	3	3	PARD3B	205538125	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.901000	0.56303	2.192000	0.70111	0.460000	0.39030	ATT		0.453	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177		5	14	0	0	0	0.001168	0	5	14				
VWC2L	402117	broad.mit.edu	37	2	215279259	215279259	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:215279259C>A	ENST00000312504.5	+	2	1144	c.342C>A	c.(340-342)aaC>aaA	p.N114K	VWC2L_ENST00000427124.1_Missense_Mutation_p.N114K|AC107218.3_ENST00000437883.1_RNA|AC107218.3_ENST00000412896.1_RNA	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	114	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)		p.N114K(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						AAGTAAAAAACTTCTGTGAAT	0.383																																							uc002vet.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(340-342)AAC>AAA		von Willebrand factor C domain-containing							44.0	42.0	43.0					2																	215279259		1848	4094	5942	SO:0001583	missense	402117					extracellular region		g.chr2:215279259C>A	AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.342C>A	2.37:g.215279259C>A	ENSP00000308976:p.Asn114Lys					VWC2L_uc010zjl.1_Missense_Mutation_p.N114K	p.N114K	NM_001080500	NP_001073969	B2RUY7	VWC2L_HUMAN			2	472	+			114			VWFC 2.		A6NC69|B2RUW7|B7X8X1	Missense_Mutation	SNP	ENST00000312504.5	37	c.342C>A	CCDS46509.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109093	0.77096	.	.	ENSG00000174453	ENST00000312504;ENST00000427124	T;T	0.15487	2.42;2.42	5.51	4.62	0.57501	von Willebrand factor, type C (1);	0.000000	0.85682	D	0.000000	T	0.29850	0.0746	L	0.55481	1.735	0.54753	D	0.999983	D;P	0.61080	0.989;0.708	D;B	0.70487	0.969;0.227	T	0.03898	-1.0994	10	0.02654	T	1	-5.5352	14.0937	0.65006	0.0:0.9277:0.0:0.0723	.	114;114	B7ZW27;B2RUY7	.;VWC2L_HUMAN	K	114	ENSP00000308976:N114K;ENSP00000403779:N114K	ENSP00000308976:N114K	N	+	3	2	VWC2L	214987504	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.927000	0.63440	2.746000	0.94184	0.655000	0.94253	AAC		0.383	VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337175.1	NM_001080500		14	7	1	0	4.3838e-07	0.001855	5.19134e-07	14	7				
XRCC5	7520	broad.mit.edu	37	2	216981433	216981433	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:216981433G>T	ENST00000392133.3	+	5	648	c.187G>T	c.(187-189)Ggc>Tgc	p.G63C	XRCC5_ENST00000392132.2_Missense_Mutation_p.G63C			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	63					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.G63C(1)		endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		TGGTACAGATGGCACTGACAA	0.418								Non-homologous end-joining																															uc002vfy.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|kidney(1)	2						c.(187-189)GGC>TGC	Direct_reversal_of_damage|NHEJ	ATP-dependent DNA helicase II							150.0	133.0	139.0					2																	216981433		2203	4300	6503	SO:0001583	missense	7520				double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|provirus integration|telomere maintenance|transcription, DNA-dependent	Ku70:Ku80 complex|nonhomologous end joining complex|nuclear telomere cap complex|nucleoplasm	ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|telomeric DNA binding|transcription regulatory region DNA binding	g.chr2:216981433G>T	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.187G>T	2.37:g.216981433G>T	ENSP00000375978:p.Gly63Cys					XRCC5_uc002vfz.2_5'Flank	p.G63C	NM_021141	NP_066964	P13010	XRCC5_HUMAN		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)	3	327	+		Renal(323;0.0328)	63					A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	ENST00000392133.3	37	c.187G>T	CCDS2402.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.627001	0.66901	.	.	ENSG00000079246	ENST00000392133;ENST00000392132;ENST00000417391	T;T	0.32023	1.47;1.47	5.8	2.86	0.33363	Ku70/Ku80, N-terminal alpha/beta (1);von Willebrand factor, type A (1);	0.341265	0.30392	N	0.009721	T	0.41719	0.1171	M	0.62723	1.935	0.33791	D	0.625455	D	0.58620	0.983	P	0.58454	0.839	T	0.56013	-0.8049	10	0.62326	D	0.03	.	6.5438	0.22394	0.2087:0.0:0.6593:0.132	.	63	P13010	XRCC5_HUMAN	C	63;63;50	ENSP00000375978:G63C;ENSP00000375977:G63C	ENSP00000375977:G63C	G	+	1	0	XRCC5	216689678	0.000000	0.05858	0.995000	0.50966	0.806000	0.45545	0.200000	0.17257	1.430000	0.47334	0.655000	0.94253	GGC		0.418	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141		28	71	1	0	2.41591e-17	0.004656	3.76998e-17	28	71				
SLC11A1	6556	broad.mit.edu	37	2	219252294	219252294	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:219252294G>T	ENST00000233202.6	+	7	918	c.578G>T	c.(577-579)cGg>cTg	p.R193L	SLC11A1_ENST00000539932.1_Missense_Mutation_p.R75L	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	193					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)	p.R193L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTAGGGCTGCGGAAGCTGGAA	0.463																																							uc002vhv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(577-579)CGG>CTG		natural resistance-associated macrophage protein							316.0	330.0	325.0					2																	219252294		2203	4300	6503	SO:0001583	missense	6556				activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity	g.chr2:219252294G>T	D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.578G>T	2.37:g.219252294G>T	ENSP00000233202:p.Arg193Leu					SLC11A1_uc010fvp.1_Missense_Mutation_p.R193L|SLC11A1_uc010fvq.1_Missense_Mutation_p.R126L|SLC11A1_uc010zkc.1_Missense_Mutation_p.R126L|SLC11A1_uc002vhu.1_5'UTR|SLC11A1_uc002vhw.2_Missense_Mutation_p.R75L|SLC11A1_uc010fvr.2_5'UTR	p.R193L	NM_000578	NP_000569	P49279	NRAM1_HUMAN		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	7	918	+		Renal(207;0.0474)	193			Cytoplasmic (Potential).		C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	37	c.578G>T	CCDS2415.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148520	0.78001	.	.	ENSG00000018280	ENST00000233202;ENST00000539932	T;T	0.74526	-0.85;-0.85	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000001	D	0.91549	0.7331	H	0.97587	4.035	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	D	0.94266	0.7506	10	0.87932	D	0	-30.8787	18.7659	0.91873	0.0:0.0:1.0:0.0	.	193;75;193	B4DQ73;C0H5Y3;P49279	.;.;NRAM1_HUMAN	L	193;75	ENSP00000233202:R193L;ENSP00000443435:R75L	ENSP00000233202:R193L	R	+	2	0	SLC11A1	218960538	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	9.310000	0.96267	2.677000	0.91161	0.561000	0.74099	CGG		0.463	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578		54	449	1	0	3.40343e-31	0.01441	6.32288e-31	54	449				
SLC4A3	6508	broad.mit.edu	37	2	220498124	220498124	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:220498124C>T	ENST00000358055.3	+	10	1918	c.1406C>T	c.(1405-1407)gCt>gTt	p.A469V	SLC4A3_ENST00000373762.3_Missense_Mutation_p.A496V|SLC4A3_ENST00000273063.6_Missense_Mutation_p.A496V|SLC4A3_ENST00000373760.2_Missense_Mutation_p.A469V|SLC4A3_ENST00000317151.3_Missense_Mutation_p.A469V			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	469					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.A496V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTACCATGGCTGATGACCTG	0.617																																							uc002vmp.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5						c.(1405-1407)GCT>GTT		solute carrier family 4, anion exchanger, member							62.0	56.0	58.0					2																	220498124		2203	4300	6503	SO:0001583	missense	6508				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity	g.chr2:220498124C>T		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.1406C>T	2.37:g.220498124C>T	ENSP00000350756:p.Ala469Val					SLC4A3_uc002vmo.3_Missense_Mutation_p.A496V|SLC4A3_uc010fwm.2_Silent_p.L11L|SLC4A3_uc010fwn.1_5'UTR	p.A469V	NM_005070	NP_005061	P48751	B3A3_HUMAN		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	10	1675	+		Renal(207;0.0183)	469			Cytoplasmic.		A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	37	c.1406C>T	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050723	0.36181	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	4.75	2.86	0.33363	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.705821	0.13257	N	0.401635	T	0.50205	0.1602	L	0.36672	1.1	0.27856	N	0.940586	B;B	0.33345	0.095;0.409	B;B	0.29440	0.102;0.098	T	0.40098	-0.9581	10	0.35671	T	0.21	.	6.9398	0.24486	0.0:0.5766:0.3227:0.1007	.	469;496	P48751;P48751-3	B3A3_HUMAN;.	V	469;469;496;496;469	ENSP00000350756:A469V;ENSP00000362865:A469V;ENSP00000273063:A496V;ENSP00000362867:A496V;ENSP00000314006:A469V	ENSP00000273063:A496V	A	+	2	0	SLC4A3	220206368	0.932000	0.31603	0.997000	0.53966	0.943000	0.58893	1.607000	0.36836	2.469000	0.83416	0.549000	0.68633	GCT		0.617	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070		8	52	0	0	0	0.00308	0	8	52				
TM4SF20	79853	broad.mit.edu	37	2	228235652	228235652	+	Silent	SNP	C	C	A	rs138547735		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:228235652C>A	ENST00000304568.3	-	2	265	c.228G>T	c.(226-228)gcG>gcT	p.A76A		NM_024795.3	NP_079071.2	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(2)|large_intestine(1)|lung(4)|stomach(2)	10		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TGTTGCAGCACGCTCTTTTTC	0.428																																							uc002vpb.2		NA																	0					0						c.(226-228)GCG>GCT		transmembrane 4 L six family member 20							437.0	406.0	416.0					2																	228235652		2203	4300	6503	SO:0001819	synonymous_variant	79853					integral to membrane|plasma membrane		g.chr2:228235652C>A	AK026453	CCDS2466.1	2q36.3	2008-02-05			ENSG00000168955	ENSG00000168955			26230	protein-coding gene	gene with protein product		615404				12975309	Standard	NM_024795		Approved	FLJ22800, TCCE518	uc002vpb.2	Q53R12	OTTHUMG00000133187	ENST00000304568.3:c.228G>T	2.37:g.228235652C>A							p.A76A	NM_024795	NP_079071	Q53R12	T4S20_HUMAN		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)	2	266	-		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)	76			Cytoplasmic (Potential).		B2RP42|Q5U609|Q6UWS1|Q9H5X9	Silent	SNP	ENST00000304568.3	37	c.228G>T	CCDS2466.1																																																																																				0.428	TM4SF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256896.2	NM_024795		86	318	1	0	1.2711e-46	0.01441	2.5112e-46	86	318				
UGT1A6	54578	broad.mit.edu	37	2	234602162	234602162	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:234602162T>A	ENST00000305139.6	+	1	651	c.512T>A	c.(511-513)tTc>tAc	p.F171Y	UGT1A6_ENST00000373424.1_Intron|AC114812.8_ENST00000439336.1_RNA|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_5'Flank|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000609637.1_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	171					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.F171Y(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	GTGTACCTCTTCAGGGGTTTT	0.498																																							uc002vuv.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(511-513)TTC>TAC		UDP glycosyltransferase 1 family, polypeptide A6							143.0	135.0	138.0					2																	234602162		2203	4300	6503	SO:0001583	missense	54578				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity	g.chr2:234602162T>A	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.512T>A	2.37:g.234602162T>A	ENSP00000303174:p.Phe171Tyr					UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Missense_Mutation_p.F171Y	p.F171Y	NM_001072	NP_001063	P19224	UD16_HUMAN		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	1	651	+		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)	171					A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	ENST00000305139.6	37	c.512T>A	CCDS2507.1	.	.	.	.	.	.	.	.	.	.	T	19.80	3.894316	0.72639	.	.	ENSG00000167165	ENST00000441351;ENST00000305139	T;T	0.06849	3.25;3.25	5.31	2.88	0.33553	.	.	.	.	.	T	0.16599	0.0399	L	0.56124	1.755	0.80722	D	1	D;B	0.64830	0.994;0.287	P;B	0.58820	0.846;0.296	T	0.00660	-1.1622	9	0.72032	D	0.01	.	7.1336	0.25515	0.131:0.0707:0.0:0.7983	.	171;171	B8K289;P19224	.;UD16_HUMAN	Y	171	ENSP00000389637:F171Y;ENSP00000303174:F171Y	ENSP00000303174:F171Y	F	+	2	0	UGT1A6	234266901	0.399000	0.25287	1.000000	0.80357	0.781000	0.44180	3.866000	0.56040	0.440000	0.26502	0.533000	0.62120	TTC		0.498	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862		44	128	0	0	0	0.01441	0	44	128				
HDAC4	9759	broad.mit.edu	37	2	240011772	240011772	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:240011772C>A	ENST00000345617.3	-	18	3097	c.2306G>T	c.(2305-2307)gGg>gTg	p.G769V	HDAC4_ENST00000543185.1_Missense_Mutation_p.G353V	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	769	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.G769V(1)|p.G769E(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GCGGGCTGCCCCCGCCGAGTG	0.647																																							uc002vyk.3		NA																	2	Substitution - Missense(2)		lung(1)|breast(1)	breast(3)|skin(2)|ovary(1)	6						c.(2305-2307)GGG>GTG		histone deacetylase 4							59.0	59.0	59.0					2																	240011772		2203	4300	6503	SO:0001583	missense	9759				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding	g.chr2:240011772C>A	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2306G>T	2.37:g.240011772C>A	ENSP00000264606:p.Gly769Val					HDAC4_uc010fyz.1_Missense_Mutation_p.G764V|HDAC4_uc010fyy.2_Missense_Mutation_p.G726V	p.G769V	NM_006037	NP_006028	P56524	HDAC4_HUMAN		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)	18	3098	-		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)	769			Histone deacetylase.		Q9UND6	Missense_Mutation	SNP	ENST00000345617.3	37	c.2306G>T	CCDS2529.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.450244	0.26074	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185	T;T	0.69685	-0.42;-0.42	3.98	3.98	0.46160	Histone deacetylase domain (2);	0.099758	0.64402	D	0.000002	T	0.60919	0.2306	L	0.41710	1.295	0.80722	D	1	B;B	0.19817	0.023;0.039	B;B	0.28465	0.035;0.09	T	0.59473	-0.7448	10	0.35671	T	0.21	.	16.9494	0.86240	0.0:1.0:0.0:0.0	.	737;769	Q53SM2;P56524	.;HDAC4_HUMAN	V	769;657;353	ENSP00000264606:G769V;ENSP00000440481:G353V	ENSP00000264606:G769V	G	-	2	0	HDAC4	239676709	0.943000	0.32029	0.266000	0.24541	0.229000	0.25112	4.600000	0.61083	2.168000	0.68352	0.557000	0.71058	GGG		0.647	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037		9	44	1	0	2.74318e-10	0.006214	3.61885e-10	9	44				
SIGLEC1	6614	broad.mit.edu	37	20	3684006	3684006	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr20:3684006G>A	ENST00000344754.4	-	5	1065	c.1066C>T	c.(1066-1068)Ctc>Ttc	p.L356F	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.L356F	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	356	Ig-like C2-type 3.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.L356F(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CTGTAGCGGAGATCACTGGGT	0.577																																							uc002wja.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						c.(1066-1068)CTC>TTC		sialoadhesin precursor							159.0	119.0	133.0					20																	3684006		2203	4300	6503	SO:0001583	missense	6614				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding	g.chr20:3684006G>A	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.1066C>T	20.37:g.3684006G>A	ENSP00000341141:p.Leu356Phe					SIGLEC1_uc002wiz.3_Missense_Mutation_p.L356F|SIGLEC1_uc002wjc.2_Missense_Mutation_p.L267F	p.L356F	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN			5	1066	-			356			Extracellular (Potential).|Ig-like C2-type 3.		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	c.1066C>T	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457344	0.43634	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.12672	2.66;2.66	5.46	4.46	0.54185	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.225765	0.22876	N	0.054580	T	0.35653	0.0939	M	0.87827	2.91	0.35170	D	0.771465	P;D;P	0.53151	0.948;0.958;0.948	P;P;P	0.58266	0.817;0.836;0.747	T	0.54931	-0.8219	10	0.72032	D	0.01	.	9.9173	0.41442	0.0:0.0:0.5042:0.4958	.	356;356;356	Q9BZZ2-2;Q9BZZ2;Q9BZZ2-3	.;SN_HUMAN;.	F	356	ENSP00000341141:L356F;ENSP00000202578:L356F	ENSP00000202578:L356F	L	-	1	0	SIGLEC1	3632006	0.005000	0.15991	0.822000	0.32727	0.017000	0.09413	0.682000	0.25335	1.212000	0.43366	0.655000	0.94253	CTC		0.577	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068		12	40	0	0	0	0.010729	0	12	40				
CENPB	1059	broad.mit.edu	37	20	3766048	3766048	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr20:3766048G>A	ENST00000379751.4	-	1	1289	c.1083C>T	c.(1081-1083)ctC>ctT	p.L361L	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	361					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)	p.L361L(1)		kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						GGGCCTCCGTGAGACCCAGCT	0.662																																							uc002wjk.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1081-1083)CTC>CTT		centromere protein B							12.0	11.0	12.0					20																	3766048		2190	4287	6477	SO:0001819	synonymous_variant	1059				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|satellite DNA binding	g.chr20:3766048G>A	X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1083C>T	20.37:g.3766048G>A						CDC25B_uc010zqk.1_5'Flank|CDC25B_uc010zql.1_5'Flank|CDC25B_uc010zqm.1_5'Flank	p.L361L	NM_001810	NP_001801	P07199	CENPB_HUMAN			1	1290	-			361					Q96EI4	Silent	SNP	ENST00000379751.4	37	c.1083C>T	CCDS13064.1																																																																																				0.662	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2	NM_001810		3	8	0	0	0	0.004672	0	3	8				
BTBD3	22903	broad.mit.edu	37	20	11904038	11904038	+	Missense_Mutation	SNP	G	G	T	rs150807132		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr20:11904038G>T	ENST00000405977.1	+	5	1918	c.1293G>T	c.(1291-1293)caG>caT	p.Q431H	BTBD3_ENST00000399006.2_Missense_Mutation_p.Q370H|BTBD3_ENST00000378226.2_Missense_Mutation_p.Q431H|BTBD3_ENST00000254977.3_Missense_Mutation_p.Q370H	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	431					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.Q431H(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						TTAAGCGGCAGGGCGTTGTCC	0.493																																							uc002wnz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)	3						c.(1291-1293)CAG>CAT		BTB/POZ domain containing protein 3 isoform a							105.0	99.0	101.0					20																	11904038		2203	4300	6503	SO:0001583	missense	22903							g.chr20:11904038G>T	AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.1293G>T	20.37:g.11904038G>T	ENSP00000384545:p.Gln431His					BTBD3_uc002wny.2_Missense_Mutation_p.Q370H|BTBD3_uc002woa.2_Missense_Mutation_p.Q370H|BTBD3_uc010zrf.1_Missense_Mutation_p.Q280H|BTBD3_uc010zrg.1_Missense_Mutation_p.Q280H|BTBD3_uc010zrh.1_Missense_Mutation_p.Q280H	p.Q431H	NM_014962	NP_055777	Q9Y2F9	BTBD3_HUMAN			4	1652	+			431					D3DW19|Q5JY73	Missense_Mutation	SNP	ENST00000405977.1	37	c.1293G>T	CCDS13113.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172159	0.38315	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000378226	T;T;T;T	0.79554	-1.25;-1.25;-1.28;-1.28	6.02	4.07	0.47477	PHR (1);	0.000000	0.85682	D	0.000000	T	0.78071	0.4226	L	0.36672	1.1	0.58432	D	0.999999	P	0.49358	0.923	P	0.56343	0.796	T	0.71642	-0.4531	10	0.15499	T	0.54	.	7.8496	0.29446	0.3135:0.0:0.6865:0.0	.	431	Q9Y2F9	BTBD3_HUMAN	H	370;370;431;431	ENSP00000254977:Q370H;ENSP00000381971:Q370H;ENSP00000384545:Q431H;ENSP00000367471:Q431H	ENSP00000254977:Q370H	Q	+	3	2	BTBD3	11852038	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.532000	0.36029	0.873000	0.35799	-0.136000	0.14681	CAG		0.493	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078021.3			31	26	1	0	3.80469e-20	0.009535	6.23847e-20	31	26				
DEFB116	245930	broad.mit.edu	37	20	29891154	29891154	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr20:29891154T>A	ENST00000400549.1	-	2	169	c.170A>T	c.(169-171)cAa>cTa	p.Q57L		NM_001037731.1	NP_001032820.1	Q30KQ4	DB116_HUMAN	defensin, beta 116	57					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.Q57L(1)		kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GGTTAAGTATTGGATTTCATA	0.443																																							uc010ztm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(169-171)CAA>CTA		beta-defensin 116 precursor							360.0	317.0	330.0					20																	29891154		1862	4092	5954	SO:0001583	missense	245930				defense response to bacterium	extracellular region		g.chr20:29891154T>A	DQ012020	CCDS42860.1	20q11.21	2008-07-17			ENSG00000215545	ENSG00000215545		"""Defensins, beta"""	18097	protein-coding gene	gene with protein product	"""defensin, beta 16"""					11854508, 16033865	Standard	NM_001037731		Approved	DEFB-16	uc010ztm.2	Q30KQ4	OTTHUMG00000159285	ENST00000400549.1:c.170A>T	20.37:g.29891154T>A	ENSP00000383396:p.Gln57Leu						p.Q57L	NM_001037731	NP_001032820	Q30KQ4	DB116_HUMAN	Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)		2	170	-	all_hematologic(12;0.158)		57						Missense_Mutation	SNP	ENST00000400549.1	37	c.170A>T	CCDS42860.1	.	.	.	.	.	.	.	.	.	.	T	11.59	1.684792	0.29872	.	.	ENSG00000215545	ENST00000400549	T	0.11821	2.74	3.43	3.43	0.39272	.	.	.	.	.	T	0.18759	0.0450	N	0.17082	0.46	0.09310	N	1	D	0.76494	0.999	D	0.67900	0.954	T	0.07443	-1.0772	9	0.72032	D	0.01	-1.0054	8.6029	0.33756	0.0:0.0:0.0:1.0	.	57	Q30KQ4	DB116_HUMAN	L	57	ENSP00000383396:Q57L	ENSP00000383396:Q57L	Q	-	2	0	DEFB116	29354815	0.522000	0.26266	0.060000	0.19600	0.308000	0.27856	0.706000	0.25690	1.809000	0.52856	0.533000	0.62120	CAA		0.443	DEFB116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354403.1	NM_001037731		161	164	0	0	0	0.01441	0	161	164				
ZNF831	128611	broad.mit.edu	37	20	57767000	57767000	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr20:57767000C>T	ENST00000371030.2	+	1	926	c.926C>T	c.(925-927)gCc>gTc	p.A309V		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	309							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.A309V(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TCGCCGACCGCCGGGAAGCCG	0.701																																							uc002yan.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(13)|ovary(1)	14						c.(925-927)GCC>GTC		zinc finger protein 831							15.0	19.0	18.0					20																	57767000		1877	4020	5897	SO:0001583	missense	128611					intracellular	nucleic acid binding|zinc ion binding	g.chr20:57767000C>T	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.926C>T	20.37:g.57767000C>T	ENSP00000360069:p.Ala309Val						p.A309V	NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN			1	926	+	all_lung(29;0.0085)		309					Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	c.926C>T	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	C	8.316	0.823298	0.16678	.	.	ENSG00000124203	ENST00000371030	T	0.04862	3.54	4.06	-1.86	0.07760	.	.	.	.	.	T	0.06234	0.0161	L	0.44542	1.39	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.28839	-1.0031	9	0.48119	T	0.1	.	8.9521	0.35796	0.0:0.5257:0.332:0.1423	.	309	Q5JPB2	ZN831_HUMAN	V	309	ENSP00000360069:A309V	ENSP00000360069:A309V	A	+	2	0	ZNF831	57200395	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.243000	0.18106	-1.274000	0.02421	-3.460000	0.00035	GCC		0.701	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457		19	21	0	0	0	0.007413	0	19	21				
TPTE	7179	broad.mit.edu	37	21	10934106	10934106	+	Missense_Mutation	SNP	C	C	A	rs373367615		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr21:10934106C>A	ENST00000361285.4	-	16	1200	c.871G>T	c.(871-873)Gat>Tat	p.D291Y	TPTE_ENST00000342420.5_Missense_Mutation_p.D253Y|TPTE_ENST00000298232.7_Missense_Mutation_p.D273Y|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	291	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.D291Y(2)|p.D273Y(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGCTTAGGATCGTAAGCTCTT	0.308																																							uc002yip.1		NA																	4	Substitution - Missense(4)	p.V291I(1)	lung(2)|endometrium(2)	ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(871-873)GAT>TAT		transmembrane phosphatase with tensin homology							162.0	164.0	163.0					21																	10934106		2203	4300	6503	SO:0001583	missense	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10934106C>A	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.871G>T	21.37:g.10934106C>A	ENSP00000355208:p.Asp291Tyr					TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.D273Y|TPTE_uc002yir.1_Missense_Mutation_p.D253Y|TPTE_uc010gkv.1_Missense_Mutation_p.D153Y	p.D291Y	NM_199261	NP_954870	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	16	1239	-			291			Phosphatase tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	c.871G>T	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	9.439	1.087650	0.20390	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	T;T;T	0.31769	1.48;1.48;1.48	2.07	1.17	0.20885	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.164595	0.51477	U	0.000095	T	0.61375	0.2342	H	0.96111	3.77	0.58432	D	0.999994	D;D;D	0.89917	0.999;1.0;0.995	D;D;D	0.79784	0.987;0.993;0.93	T	0.63589	-0.6603	10	0.87932	D	0	-11.4843	6.8778	0.24156	0.0:0.8411:0.0:0.1589	.	253;273;291	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	Y	273;291;253	ENSP00000298232:D273Y;ENSP00000355208:D291Y;ENSP00000344441:D253Y	ENSP00000298232:D273Y	D	-	1	0	TPTE	9955977	1.000000	0.71417	0.911000	0.35937	0.050000	0.14768	1.881000	0.39638	0.433000	0.26313	0.194000	0.17425	GAT		0.308	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			40	80	1	0	7.63091e-17	0.007835	1.1751e-16	40	80				
MORC3	23515	broad.mit.edu	37	21	37711173	37711173	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr21:37711173A>G	ENST00000400485.1	+	5	638	c.562A>G	c.(562-564)Att>Gtt	p.I188V	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	188					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)	p.I188V(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						ACTTGATGCTATTATAGGCAA	0.428																																							uc002yvi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(562-564)ATT>GTT		MORC family CW-type zinc finger 3							183.0	163.0	169.0					21																	37711173		1937	4139	6076	SO:0001583	missense	23515				cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding	g.chr21:37711173A>G	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.562A>G	21.37:g.37711173A>G	ENSP00000383333:p.Ile188Val						p.I188V	NM_015358	NP_056173	Q14149	MORC3_HUMAN			5	638	+			188					A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	c.562A>G	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	A	16.60	3.168163	0.57476	.	.	ENSG00000159256	ENST00000400485	T	0.73258	-0.73	5.55	1.77	0.24775	ATPase-like, ATP-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.66479	0.2793	M	0.76328	2.33	0.54753	D	0.999983	B	0.15719	0.014	B	0.21151	0.033	T	0.57545	-0.7793	9	.	.	.	-13.4725	9.6868	0.40103	0.8111:0.0:0.1889:0.0	.	188	Q14149	MORC3_HUMAN	V	188	ENSP00000383333:I188V	.	I	+	1	0	MORC3	36633043	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	3.673000	0.54591	0.078000	0.16900	0.482000	0.46254	ATT		0.428	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358		109	200	0	0	0	0.01441	0	109	200				
KCNJ6	3763	broad.mit.edu	37	21	39086924	39086924	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr21:39086924G>T	ENST00000609713.1	-	3	1125	c.536C>A	c.(535-537)tCc>tAc	p.S179Y	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Missense_Mutation_p.S179Y	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	179					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)	p.S179F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	ATTGACAATGGACCCCAACAC	0.453																																					Pancreas(48;379 1118 2936 19024 28214)	Pancreas(48;379 1118 2936 19024 28214)	uc011aej.1		NA																	1	Substitution - Missense(1)		skin(1)	skin(1)	1						c.(535-537)TCC>TAC		potassium inwardly-rectifying channel J6	Halothane(DB01159)						67.0	66.0	66.0					21																	39086924		1877	4123	6000	SO:0001583	missense	3763				synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr21:39086924G>T	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.536C>A	21.37:g.39086924G>T	ENSP00000477437:p.Ser179Tyr					KCNJ6_uc002ywo.2_Missense_Mutation_p.S179Y	p.S179Y	NM_002240	NP_002231	P48051	IRK6_HUMAN			3	589	-			179			Helical; Name=M2; (By similarity).		Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	37	c.536C>A	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256642	0.80246	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.95788	-3.81;-3.81	6.03	6.03	0.97812	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.97810	0.9281	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97664	1.0162	10	0.62326	D	0.03	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	179	P48051	IRK6_HUMAN	Y	179	ENSP00000383330:S179Y;ENSP00000288309:S179Y	ENSP00000288309:S179Y	S	-	2	0	KCNJ6	38008794	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.854000	0.98071	0.655000	0.94253	TCC		0.453	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240		42	91	1	0	1.05386e-31	0.01441	1.97598e-31	42	91				
UMODL1	89766	broad.mit.edu	37	21	43557548	43557548	+	Splice_Site	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr21:43557548G>T	ENST00000408910.2	+	22	3775		c.e22-1		UMODL1_ENST00000400427.1_Splice_Site|UMODL1_ENST00000400424.2_Splice_Site|UMODL1_ENST00000408989.2_Splice_Site|UMODL1_ENST00000400423.2_Splice_Site	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1						adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)	p.?(2)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TCCTCCCCGAGGTGAGCCTCC	0.597																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	uc002zaf.1		NA																	2	Unknown(2)		lung(2)	ovary(2)|skin(1)	3						c.e22-1		uromodulin-like 1 isoform 1 precursor							138.0	149.0	145.0					21																	43557548		2087	4204	6291	SO:0001630	splice_region_variant	89766					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity	g.chr21:43557548G>T		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3776-1G>T	21.37:g.43557548G>T						UMODL1_uc002zad.1_Splice_Site_p.G1187_splice|UMODL1_uc002zae.1_Splice_Site_p.G1315_splice|UMODL1_uc002zag.1_Splice_Site_p.G1387_splice|UMODL1_uc002zal.1_Splice_Site_p.G209_splice|UMODL1_uc010gpa.1_Splice_Site	p.G1259_splice	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN			22	3776	+								C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Splice_Site	SNP	ENST00000408910.2	37	c.3776_splice	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	8.946	0.966934	0.18659	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	.	.	.	2.9	2.9	0.33743	.	.	.	.	.	.	.	.	.	.	.	0.47245	D	0.999362	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.521	0.39135	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UMODL1	42430617	0.884000	0.30299	0.134000	0.22075	0.068000	0.16541	3.263000	0.51546	1.953000	0.56701	0.561000	0.74099	.		0.597	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		Intron	66	123	1	0	2.10328e-26	0.01441	3.71978e-26	66	123				
U2AF1	7307	broad.mit.edu	37	21	44524456	44524456	+	Missense_Mutation	SNP	G	G	A	rs371769427		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr21:44524456G>A	ENST00000291552.4	-	2	193	c.101C>T	c.(100-102)tCt>tTt	p.S34F	U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F|U2AF1_ENST00000398137.1_5'UTR|U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000486519.1_5'UTR	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	34					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S34F(45)|p.S34Y(12)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						GTGCAACCGAGAGCACCTGTC	0.358			Mis		"""CLL, MDS"""																																		uc002zda.1		NA		Dom	yes		21	21q22.3	7307		U2 small nuclear RNA auxiliary factor 1			L					57	Substitution - Missense(57)		haematopoietic_and_lymphoid_tissue(43)|lung(12)|endometrium(2)		0						c.(100-102)TCT>TTT		U2 small nuclear RNA auxillary factor 1 isoform		G	PHE/SER,PHE/SER,	1,4405		0,1,2202	67.0	64.0	65.0		101,101,	5.5	1.0	21		65	0,8600		0,0,4300	no	missense,missense,utr-5	U2AF1	NM_001025203.1,NM_006758.2,NM_001025204.1	155,155,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,	34/241,34/241,	44524456	1,13005	2203	4300	6503	SO:0001583	missense	7307				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	Cajal body|catalytic step 2 spliceosome|nuclear speck	nucleotide binding|RNA binding|zinc ion binding	g.chr21:44524456G>A	BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.101C>T	21.37:g.44524456G>A	ENSP00000291552:p.Ser34Phe					U2AF1_uc002zcy.1_5'UTR|U2AF1_uc002zcz.1_5'UTR|U2AF1_uc002zdb.1_Missense_Mutation_p.S34F|U2AF1_uc010gpi.1_Missense_Mutation_p.S34F|U2AF1_uc002zdc.1_Missense_Mutation_p.S34F	p.S34F	NM_001025203	NP_001020374	Q01081	U2AF1_HUMAN			2	185	-			34			C3H1-type 1.		Q701P4|Q71RF1	Missense_Mutation	SNP	ENST00000291552.4	37	c.101C>T	CCDS13694.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025187	0.93518	2.27E-4	0.0	ENSG00000160201	ENST00000380276;ENST00000291552	T;T	0.46063	0.88;0.88	5.47	5.47	0.80525	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.77239	0.4101	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	D	0.84864	0.0821	10	0.87932	D	0	-15.7954	19.3169	0.94218	0.0:0.0:1.0:0.0	.	34;34;34	Q69YM7;Q01081;Q701P4	.;U2AF1_HUMAN;.	F	34	ENSP00000369629:S34F;ENSP00000291552:S34F	ENSP00000291552:S34F	S	-	2	0	U2AF1	43397525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.864000	0.92294	2.560000	0.86352	0.563000	0.77884	TCT		0.358	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195541.1	NM_006758		31	55	0	0	0	0.010818	0	31	55				
KRTAP10-2	386679	broad.mit.edu	37	21	45970944	45970944	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr21:45970944G>C	ENST00000391621.1	-	1	444	c.398C>G	c.(397-399)tCt>tGt	p.S133C	KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	133	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						GCAGGAGGAAGAGGCACAGCA	0.617																																							uc002zfi.1		NA																	0				large_intestine(1)	1						c.(397-399)TCT>TGT		keratin associated protein 10-2							100.0	107.0	104.0					21																	45970944		2203	4300	6503	SO:0001583	missense	386679					keratin filament		g.chr21:45970944G>C	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.398C>G	21.37:g.45970944G>C	ENSP00000375479:p.Ser133Cys					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.S133C	NM_198693	NP_941966	P60368	KR102_HUMAN			1	445	-			133			22 X 5 AA repeats of C-C-X(3).|11.		Q70LJ5	Missense_Mutation	SNP	ENST00000391621.1	37	c.398C>G	CCDS42955.1	.	.	.	.	.	.	.	.	.	.	g	8.697	0.908910	0.17833	.	.	ENSG00000205445	ENST00000391621	T	0.00792	5.69	3.79	2.9	0.33743	.	.	.	.	.	T	0.03136	0.0092	M	0.79805	2.47	0.09310	N	1	D	0.69078	0.997	D	0.63703	0.917	T	0.37126	-0.9719	9	0.56958	D	0.05	.	6.0093	0.19567	0.2458:0.0:0.7542:0.0	.	133	P60368	KR102_HUMAN	C	133	ENSP00000375479:S133C	ENSP00000375479:S133C	S	-	2	0	KRTAP10-2	44795372	0.267000	0.24122	0.000000	0.03702	0.001000	0.01503	1.780000	0.38634	0.567000	0.29293	0.448000	0.29417	TCT		0.617	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1			4	113	0	0	0	0.009096	0	4	113				
POTEH	23784	broad.mit.edu	37	22	16279254	16279254	+	Silent	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr22:16279254T>C	ENST00000343518.6	-	4	1020	c.969A>G	c.(967-969)caA>caG	p.Q323Q	POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	323								p.Q323Q(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						ATTTCACCACTTGCTGTTTTT	0.323																																							uc010gqp.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(967-969)CAA>CAG		ANKRD26-like family C, member 3																																				SO:0001819	synonymous_variant	23784							g.chr22:16279254T>C	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.969A>G	22.37:g.16279254T>C						POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Silent_p.Q42Q|POTEH_uc002zlj.1_Silent_p.Q158Q	p.Q323Q	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN			4	1021	-			323			ANK 5.		A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	ENST00000343518.6	37	c.969A>G	CCDS46658.1																																																																																				0.323	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		40	445	0	0	0	0.01441	0	40	445				
RTCB	51493	broad.mit.edu	37	22	32792123	32792123	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr22:32792123T>G	ENST00000216038.5	-	8	1026	c.928A>C	c.(928-930)Atg>Ctg	p.M310L	RTCB_ENST00000451746.2_Intron|RTCB_ENST00000476619.1_5'Flank	NM_014306.4	NP_055121.1			RNA 2',3'-cyclic phosphate and 5'-OH ligase									p.M310L(1)									GCAGCTGCCATTCCCTTCAGA	0.493																																							uc003amm.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(928-930)ATG>CTG		hypothetical protein LOC51493							222.0	209.0	213.0					22																	32792123		2203	4300	6503	SO:0001583	missense	51493				cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding	g.chr22:32792123T>G	BC016707	CCDS13905.1	22q12.3	2013-05-22	2013-05-22	2013-05-22	ENSG00000100220	ENSG00000100220	6.5.1.3		26935	protein-coding gene	gene with protein product	"""focal adhesion-associated protein"""	613901	"""chromosome 22 open reading frame 28"""	C22orf28		11042152, 21209330, 21311021	Standard	NM_014306		Approved	HSPC117, FAAP		Q9Y3I0	OTTHUMG00000030300	ENST00000216038.5:c.928A>C	22.37:g.32792123T>G	ENSP00000216038:p.Met310Leu					C22orf28_uc011ama.1_RNA	p.M310L	NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN			8	1059	-			310						Missense_Mutation	SNP	ENST00000216038.5	37	c.928A>C	CCDS13905.1	.	.	.	.	.	.	.	.	.	.	T	31	5.087600	0.94100	.	.	ENSG00000100220	ENST00000216038	T	0.34859	1.34	5.79	5.79	0.91817	.	0.035217	0.85682	D	0.000000	T	0.59729	0.2215	M	0.66378	2.025	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62320	-0.6879	10	0.66056	D	0.02	-26.5132	16.1171	0.81314	0.0:0.0:0.0:1.0	.	310	Q9Y3I0	RTCB_HUMAN	L	310	ENSP00000216038:M310L	ENSP00000216038:M310L	M	-	1	0	C22orf28	31122123	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.773000	0.85462	2.212000	0.71576	0.459000	0.35465	ATG		0.493	RTCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075188.3	NM_014306		63	288	0	0	0	0.01441	0	63	288				
ARFGAP3	26286	broad.mit.edu	37	22	43195156	43195156	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr22:43195156G>C	ENST00000263245.5	-	15	1641	c.1422C>G	c.(1420-1422)agC>agG	p.S474R	ARFGAP3_ENST00000437119.2_Missense_Mutation_p.S430R|ARFGAP3_ENST00000429508.2_Missense_Mutation_p.S402R	NM_001142293.1|NM_014570.4	NP_001135765.1|NP_055385.3	Q9NP61	ARFG3_HUMAN	ADP-ribosylation factor GTPase activating protein 3	474					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|protein secretion (GO:0009306)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.S474R(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	11						CACTGGACAGGCTGTAGTTCC	0.577																																					GBM(58;544 1030 21460 27159 48838)	GBM(58;544 1030 21460 27159 48838)	uc003bdd.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1420-1422)AGC>AGG		ADP-ribosylation factor GTPase activating							125.0	108.0	114.0					22																	43195156		2203	4300	6503	SO:0001583	missense	26286				intracellular protein transport|protein secretion|regulation of ARF GTPase activity|vesicle-mediated transport	cytosol|Golgi membrane	ARF GTPase activator activity|protein transporter activity|zinc ion binding	g.chr22:43195156G>C	AK002083	CCDS14042.1, CCDS46722.1	22q13.2	2009-11-30	2002-08-20	2002-08-23	ENSG00000242247	ENSG00000242247		"""ADP-ribosylation factor GTPase activating proteins"""	661	protein-coding gene	gene with protein product		612439	"""ADP-ribosylation factor GTPase activating protein 1"""	ARFGAP1		10704287, 11172815	Standard	NM_014570		Approved		uc003bdd.2	Q9NP61	OTTHUMG00000150718	ENST00000263245.5:c.1422C>G	22.37:g.43195156G>C	ENSP00000263245:p.Ser474Arg					ARFGAP3_uc010gzf.2_Missense_Mutation_p.S430R	p.S474R	NM_014570	NP_055385	Q9NP61	ARFG3_HUMAN			15	1642	-			474					E9PB03|Q9BSC6|Q9H9J0|Q9NT10|Q9NUP5|Q9Y4V3|Q9Y4V4	Missense_Mutation	SNP	ENST00000263245.5	37	c.1422C>G	CCDS14042.1	.	.	.	.	.	.	.	.	.	.	G	6.007	0.369676	0.11352	.	.	ENSG00000242247	ENST00000263245;ENST00000429508;ENST00000437119	T;T;T	0.06528	3.45;3.29;3.41	4.65	1.41	0.22369	.	0.380114	0.30093	N	0.010435	T	0.03220	0.0094	N	0.13299	0.325	0.19575	N	0.999969	B;B	0.28552	0.001;0.215	B;B	0.21360	0.003;0.034	T	0.46247	-0.9205	10	0.23891	T	0.37	-1.106	8.0395	0.30513	0.3521:0.0:0.6479:0.0	.	430;474	E9PB03;Q9NP61	.;ARFG3_HUMAN	R	474;402;430	ENSP00000263245:S474R;ENSP00000393959:S402R;ENSP00000388791:S430R	ENSP00000263245:S474R	S	-	3	2	ARFGAP3	41525100	1.000000	0.71417	0.555000	0.28281	0.680000	0.39746	1.388000	0.34442	0.079000	0.16929	-0.136000	0.14681	AGC		0.577	ARFGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319747.2	NM_014570		11	19	0	0	0	0.013537	0	11	19				
KCNH8	131096	broad.mit.edu	37	3	19554470	19554470	+	Silent	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:19554470C>T	ENST00000328405.2	+	13	2354	c.2088C>T	c.(2086-2088)ccC>ccT	p.P696P		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	696					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.P696P(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						AGTCAGAGCCCAAGGGAAATG	0.458																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(1)	5						c.(2086-2088)CCC>CCT		potassium voltage-gated channel, subfamily H,							38.0	38.0	38.0					3																	19554470		2203	4300	6503	SO:0001819	synonymous_variant	131096					integral to membrane	two-component sensor activity	g.chr3:19554470C>T	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2088C>T	3.37:g.19554470C>T						KCNH8_uc010hex.1_Silent_p.P157P	p.P696P	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN			13	2283	+			696			Cytoplasmic (Potential).		B7Z2I7|Q59GQ6	Silent	SNP	ENST00000328405.2	37	c.2088C>T	CCDS2632.1																																																																																				0.458	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		8	51	0	0	0	0.006214	0	8	51				
ZNF385D	79750	broad.mit.edu	37	3	21706480	21706480	+	Silent	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:21706480A>T	ENST00000281523.2	-	2	581	c.63T>A	c.(61-63)cgT>cgA	p.R21R	ZNF385D_ENST00000494118.1_Intron	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	21						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R21R(1)		NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						GGGCTGGTGGACGGACAAGGG	0.517																																							uc003cce.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|skin(2)|ovary(1)	5						c.(61-63)CGT>CGA		zinc finger protein 385D							77.0	72.0	74.0					3																	21706480		2203	4300	6503	SO:0001819	synonymous_variant	79750					nucleus	nucleic acid binding|zinc ion binding	g.chr3:21706480A>T	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.63T>A	3.37:g.21706480A>T						ZNF385D_uc010hfb.1_Intron	p.R21R	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN			2	471	-			21						Silent	SNP	ENST00000281523.2	37	c.63T>A	CCDS2636.1																																																																																				0.517	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697		17	32	0	0	0	0.006122	0	17	32				
ARPP21	10777	broad.mit.edu	37	3	35778767	35778767	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:35778767G>T	ENST00000187397.4	+	16	2013	c.1557G>T	c.(1555-1557)caG>caT	p.Q519H	ARPP21_ENST00000458225.1_Missense_Mutation_p.Q485H|ARPP21_ENST00000444190.1_Missense_Mutation_p.Q465H|ARPP21_ENST00000337271.5_Missense_Mutation_p.Q465H|ARPP21_ENST00000417925.1_Missense_Mutation_p.Q485H	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	519	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.Q519H(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						AGTCCCAACAGCAGCCACCAC	0.647																																							uc003cgb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1555-1557)CAG>CAT		cyclic AMP-regulated phosphoprotein, 21 kD							36.0	43.0	41.0					3																	35778767		2203	4299	6502	SO:0001583	missense	10777					cytoplasm	nucleic acid binding	g.chr3:35778767G>T	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1557G>T	3.37:g.35778767G>T	ENSP00000187397:p.Gln519His					ARPP21_uc003cga.2_Missense_Mutation_p.Q465H|ARPP21_uc011axy.1_Missense_Mutation_p.Q485H|ARPP21_uc003cgf.2_Missense_Mutation_p.Q320H|ARPP21_uc003cgg.2_Missense_Mutation_p.Q7H	p.Q519H	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN			16	1821	+			519			Gln-rich.		B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	c.1557G>T	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	G	5.860	0.342943	0.11069	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.55234	1.69;1.61;1.61;0.53;1.69	4.53	-0.5	0.12012	.	0.543637	0.19193	N	0.120396	T	0.40322	0.1112	L	0.50333	1.59	0.28369	N	0.920105	P;P;B;B	0.37276	0.589;0.589;0.412;0.007	B;B;B;B	0.41036	0.346;0.346;0.121;0.003	T	0.32587	-0.9901	10	0.13853	T	0.58	0.8305	4.9798	0.14158	0.3254:0.0:0.5352:0.1394	.	485;7;519;465	Q9UBL0-3;Q9UBL0-5;Q9UBL0;Q9UBL0-4	.;.;ARP21_HUMAN;.	H	485;465;465;519;485	ENSP00000414351:Q485H;ENSP00000337792:Q465H;ENSP00000405276:Q465H;ENSP00000187397:Q519H;ENSP00000412326:Q485H	ENSP00000187397:Q519H	Q	+	3	2	ARPP21	35753771	0.983000	0.35010	0.280000	0.24747	0.349000	0.29174	0.607000	0.24209	-0.100000	0.12241	-0.136000	0.14681	CAG		0.647	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399		27	32	1	0	9.86323e-18	0.003954	1.5789e-17	27	32				
SCN10A	6336	broad.mit.edu	37	3	38781172	38781172	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:38781172G>T	ENST00000449082.2	-	14	2113	c.2114C>A	c.(2113-2115)aCc>aAc	p.T705N		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	705					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.T705N(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AAAAAATATGGTAAAGACCTA	0.383																																							uc003ciq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(2113-2115)ACC>AAC		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						46.0	45.0	45.0					3																	38781172		2203	4300	6503	SO:0001583	missense	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38781172G>T	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.2114C>A	3.37:g.38781172G>T	ENSP00000390600:p.Thr705Asn						p.T705N	NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	14	2114	-			705			Helical; Name=S2 of repeat II; (Potential).|II.		A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	c.2114C>A	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567201	0.65651	.	.	ENSG00000185313	ENST00000449082	D	0.98807	-5.15	4.19	4.19	0.49359	Ion transport (1);	0.120593	0.53938	D	0.000056	D	0.99369	0.9778	H	0.95294	3.65	0.58432	D	0.999995	D	0.76494	0.999	D	0.72625	0.978	D	0.98455	1.0593	10	0.87932	D	0	.	16.3152	0.82918	0.0:0.0:1.0:0.0	.	705	Q9Y5Y9	SCNAA_HUMAN	N	705	ENSP00000390600:T705N	ENSP00000390600:T705N	T	-	2	0	SCN10A	38756176	1.000000	0.71417	0.137000	0.22149	0.524000	0.34500	9.545000	0.98095	2.174000	0.68829	0.655000	0.94253	ACC		0.383	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		14	39	1	0	6.81908e-15	0.00245	1.00793e-14	14	39				
TGM4	7047	broad.mit.edu	37	3	44952602	44952603	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:44952602_44952603CC>AA	ENST00000296125.4	+	12	1827_1828	c.1759_1760CC>AA	c.(1759-1761)CCt>AAt	p.P587N		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	587					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.P587N(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	TTTCCAGTACCCTGAGTTCTCT	0.49																																							uc003coc.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1759-1761)CCT>AAT		transglutaminase 4 (prostate)	L-Glutamine(DB00130)																																			SO:0001583	missense	7047				peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr3:44952602_44952603CC>AA	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	Exception_encountered	3.37:g.44952602_44952603delinsAA	ENSP00000296125:p.Pro587Asn						p.P587N	NM_003241	NP_003232	P49221	TGM4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	12	1832_1833	+			587					Q16707|Q96QN4	Missense_Mutation	DNP	ENST00000296125.4	37	c.1759_1760CC>AA	CCDS2723.1																																																																																				0.490	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241		26	52	0	0	0	0.004672	0	26	52				
UBA7	7318	broad.mit.edu	37	3	49848422	49848422	+	Missense_Mutation	SNP	C	C	A	rs192842960		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:49848422C>A	ENST00000333486.3	-	10	1383	c.1225G>T	c.(1225-1227)Gcc>Tcc	p.A409S	UBA7_ENST00000494212.1_5'Flank	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	409	2 approximate repeats.				cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)	p.A409S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTCACCAGGGCACAGTCCTCA	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		20156	0.0		0.001	False		,,,				2504	0.0						uc003cxr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(1225-1227)GCC>TCC		ubiquitin-like modifier activating enzyme 7							55.0	59.0	58.0					3																	49848422		2203	4300	6503	SO:0001583	missense	7318				ISG15-protein conjugation|negative regulation of type I interferon production	cytosol	ATP binding|ISG15 activating enzyme activity|ligase activity	g.chr3:49848422C>A	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.1225G>T	3.37:g.49848422C>A	ENSP00000333266:p.Ala409Ser						p.A409S	NM_003335	NP_003326	P41226	UBA7_HUMAN		BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)	10	1396	-			409			2 approximate repeats.		Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	37	c.1225G>T	CCDS2805.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.20	1.284126	0.23392	.	.	ENSG00000182179	ENST00000333486	T	0.64260	-0.09	5.55	-1.91	0.07641	Molybdenum cofactor biosynthesis, MoeB (1);	1.473070	0.03824	N	0.267934	T	0.49474	0.1559	L	0.55017	1.72	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.05835	-1.0861	10	0.15499	T	0.54	2.3958	0.8773	0.01227	0.2224:0.3482:0.1137:0.3157	.	409	P41226	UBA7_HUMAN	S	409	ENSP00000333266:A409S	ENSP00000333266:A409S	A	-	1	0	UBA7	49823426	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	0.444000	0.21661	-0.806000	0.04398	-1.401000	0.01141	GCC		0.537	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335		10	24	1	0	0.00136819	0.013537	0.00143183	10	24				
ERC2	26059	broad.mit.edu	37	3	55922538	55922538	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:55922538C>A	ENST00000288221.6	-	14	2698	c.2443G>T	c.(2443-2445)Gaa>Taa	p.E815*		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	815						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		GCATCCAGTTCCTGTCTGGTC	0.512																																							uc003dhr.1		NA																	0				ovary(2)	2						c.(2443-2445)GAA>TAA		cytomatrix protein p110							232.0	239.0	237.0					3																	55922538		2098	4223	6321	SO:0001587	stop_gained	26059					cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding	g.chr3:55922538C>A	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2443G>T	3.37:g.55922538C>A	ENSP00000288221:p.Glu815*					ERC2_uc003dhq.1_RNA|ERC2_uc003dht.1_Nonsense_Mutation_p.E294*	p.E815*	NM_015576	NP_056391	O15083	ERC2_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)	14	2699	-			815			Potential.		Q2T9F6|Q86TK4	Nonsense_Mutation	SNP	ENST00000288221.6	37	c.2443G>T	CCDS46851.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.973724|6.973724	0.97975|0.97975	.|.	.|.	ENSG00000187672|ENSG00000187672	ENST00000288221|ENST00000492584	.|.	.|.	.|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.051971|.	0.85682|.	D|.	0.000000|.	.|T	.|0.80082	.|0.4558	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77749	.|-0.2471	.|3	0.59425|.	D|.	0.04|.	-19.1244|-19.1244	20.031|20.031	0.97536|0.97536	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|S	815|461	.|.	ENSP00000288221:E815X|.	E|R	-|-	1|3	0|2	ERC2|ERC2	55897578|55897578	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.989000|0.989000	0.77384|0.77384	7.818000|7.818000	0.86416|0.86416	2.728000|2.728000	0.93425|0.93425	0.561000|0.561000	0.74099|0.74099	GAA|AGG		0.512	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576		79	151	1	0	2.84431e-33	0.01441	5.35788e-33	79	151				
PROK2	60675	broad.mit.edu	37	3	71830726	71830726	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:71830726G>T	ENST00000295619.3	-	2	122	c.114C>A	c.(112-114)tcC>tcA	p.S38S	PROK2_ENST00000353065.3_Silent_p.S38S	NM_001126128.1	NP_001119600.1	Q9HC23	PROK2_HUMAN	prokineticin 2	38					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of smooth muscle contraction (GO:0045987)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	G-protein coupled receptor binding (GO:0001664)	p.S38S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		CACCACATTGGGAGTCCTTGT	0.443																																							uc003dpa.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(112-114)TCC>TCA		prokineticin 2 isoform a precursor							85.0	76.0	79.0					3																	71830726		2203	4300	6503	SO:0001819	synonymous_variant	60675				activation of MAPK activity|angiogenesis|anti-apoptosis|cell proliferation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response|neuropeptide signaling pathway|positive regulation of smooth muscle contraction|sensory perception of pain|spermatogenesis	extracellular region	G-protein-coupled receptor binding	g.chr3:71830726G>T	AF333025	CCDS2916.1, CCDS46868.1	3p21.1	2013-02-28			ENSG00000163421	ENSG00000163421		"""Endogenous ligands"""	18455	protein-coding gene	gene with protein product	"""protein Bv8 homolog"""	607002				11054548, 11259612	Standard	NM_021935		Approved	PK2, BV8, MIT1, KAL4	uc003dpa.4	Q9HC23	OTTHUMG00000158809	ENST00000295619.3:c.114C>A	3.37:g.71830726G>T						PROK2_uc003doz.3_Silent_p.S38S	p.S38S	NM_001126128	NP_001119600	Q9HC23	PROK2_HUMAN		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)	2	268	-		Prostate(10;0.00899)	38					Q53Z79|Q6ISR0	Silent	SNP	ENST00000295619.3	37	c.114C>A	CCDS46868.1																																																																																				0.443	PROK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352302.1	NM_001126128		17	54	1	0	3.32936e-07	0.006122	3.95422e-07	17	54				
GABRR3	200959	broad.mit.edu	37	3	97731232	97731232	+	RNA	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:97731232G>A	ENST00000472788.1	-	0	487					NM_001105580.2	NP_001099050.1	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 3 (gene/pseudogene)						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			large_intestine(2)|lung(1)	3					Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	CGCGCAGCATGATATTCTCCA	0.453																																							uc011bgr.1		NA																	0					0						c.(484-486)ATC>ATT		gamma-aminobutyric acid (GABA) receptor, rho 3							117.0	113.0	114.0					3																	97731232		1943	4139	6082			200959				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr3:97731232G>A	Y18994	CCDS54617.1	3q11.2	2014-03-25	2014-03-25		ENSG00000183185	ENSG00000183185		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	17969	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 3"""		"""gamma-aminobutyric acid (GABA) receptor, rho 3"", ""gamma-aminobutyric acid (GABA) A receptor, rho 3"""			10542332	Standard	NM_001105580		Approved		uc021xbp.1	A8MPY1	OTTHUMG00000159135		3.37:g.97731232G>A							p.I162I	NM_001105580	NP_001099050	A8MPY1	GBRR3_HUMAN			4	486	-			162			Extracellular (Potential).		Q9UIV9	Silent	SNP	ENST00000472788.1	37	c.486C>T																																																																																					0.453	GABRR3-002	KNOWN	not_organism_supported|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000353445.2			9	22	0	0	0	0.006214	0	9	22				
GPR15	2838	broad.mit.edu	37	3	98251936	98251936	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:98251936G>T	ENST00000284311.3	+	1	1194	c.1059G>T	c.(1057-1059)agG>agT	p.R353S		NM_005290.1	NP_005281.1	P49685	GPR15_HUMAN	G protein-coupled receptor 15	353					G-protein coupled receptor signaling pathway (GO:0007186)|T cell migration (GO:0072678)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.R353S(1)		endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		TTGCCAGGAGGAGGAAGAGGT	0.438																																							uc011bgy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1057-1059)AGG>AGT		G protein-coupled receptor 15							59.0	61.0	60.0					3																	98251936		2203	4300	6503	SO:0001583	missense	2838					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr3:98251936G>T		CCDS2931.1	3q11.2-q13.1	2014-01-30			ENSG00000154165	ENSG00000154165		"""GPCR / Class A : Orphans"""	4469	protein-coding gene	gene with protein product		601166				8838812	Standard	NM_005290		Approved		uc011bgy.3	P49685	OTTHUMG00000160017	ENST00000284311.3:c.1059G>T	3.37:g.98251936G>T	ENSP00000284311:p.Arg353Ser						p.R353S	NM_005290	NP_005281	P49685	GPR15_HUMAN		Lung(72;0.246)	1	1059	+		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)	353			Cytoplasmic (Potential).		Q3MIL4|Q6ISN6	Missense_Mutation	SNP	ENST00000284311.3	37	c.1059G>T	CCDS2931.1	.	.	.	.	.	.	.	.	.	.	G	7.810	0.715423	0.15306	.	.	ENSG00000154165	ENST00000284311	T	0.67698	-0.28	5.08	-0.324	0.12706	.	0.375008	0.22132	N	0.064179	T	0.46521	0.1397	N	0.24115	0.695	0.29664	N	0.842991	B	0.30793	0.295	B	0.31016	0.123	T	0.39375	-0.9617	10	0.41790	T	0.15	-6.9942	7.8965	0.29710	0.6624:0.0:0.3376:0.0	.	353	P49685	GPR15_HUMAN	S	353	ENSP00000284311:R353S	ENSP00000284311:R353S	R	+	3	2	GPR15	99734626	0.999000	0.42202	0.889000	0.34880	0.226000	0.24999	0.402000	0.20965	-0.114000	0.11936	-0.768000	0.03414	AGG		0.438	GPR15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358907.1			12	56	1	0	6.40141e-05	0.010729	6.96928e-05	12	56				
MYH15	22989	broad.mit.edu	37	3	108110731	108110731	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:108110731G>A	ENST00000273353.3	-	38	5422	c.5366C>T	c.(5365-5367)gCc>gTc	p.A1789V		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1789						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A1789V(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TTCCAAGTGGGCAATGGTGTC	0.443																																							uc003dxa.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(2)	7						c.(5365-5367)GCC>GTC		myosin, heavy polypeptide 15							244.0	225.0	231.0					3																	108110731		1889	4118	6007	SO:0001583	missense	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108110731G>A	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5366C>T	3.37:g.108110731G>A	ENSP00000273353:p.Ala1789Val						p.A1789V	NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN			38	5423	-			1789			Potential.			Missense_Mutation	SNP	ENST00000273353.3	37	c.5366C>T	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.342386	0.61073	.	.	ENSG00000144821	ENST00000273353	T	0.78003	-1.14	5.62	2.81	0.32909	Myosin tail (1);	.	.	.	.	T	0.81088	0.4750	L	0.50919	1.6	0.35695	D	0.815174	D	0.56035	0.974	D	0.62955	0.909	T	0.81671	-0.0827	9	0.54805	T	0.06	.	8.2175	0.31521	0.1359:0.0:0.7355:0.1286	.	1789	Q9Y2K3	MYH15_HUMAN	V	1789	ENSP00000273353:A1789V	ENSP00000273353:A1789V	A	-	2	0	MYH15	109593421	0.950000	0.32346	0.008000	0.14137	0.455000	0.32408	2.759000	0.47573	0.295000	0.22570	-0.140000	0.14226	GCC		0.443	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		16	168	0	0	0	0.00499	0	16	168				
CPNE4	131034	broad.mit.edu	37	3	131254166	131254166	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:131254166G>A	ENST00000512055.1	-	20	3673	c.1547C>T	c.(1546-1548)cCa>cTa	p.P516L	CPNE4_ENST00000502818.1_Missense_Mutation_p.P534L|CPNE4_ENST00000512332.1_Missense_Mutation_p.P534L|CPNE4_ENST00000503204.1_5'UTR|CPNE4_ENST00000511604.1_Missense_Mutation_p.P516L|CPNE4_ENST00000429747.1_Missense_Mutation_p.P516L			Q96A23	CPNE4_HUMAN	copine IV	516						extracellular vesicular exosome (GO:0070062)		p.P516L(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						CAGGGCAGCTGGAGATGCCTG	0.453																																							uc003eok.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(1546-1548)CCA>CTA		copine IV							101.0	95.0	97.0					3																	131254166		2203	4300	6503	SO:0001583	missense	131034							g.chr3:131254166G>A	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.1547C>T	3.37:g.131254166G>A	ENSP00000421705:p.Pro516Leu					CPNE4_uc011blq.1_Missense_Mutation_p.P534L|CPNE4_uc003eol.2_Missense_Mutation_p.P534L|CPNE4_uc003eom.2_Missense_Mutation_p.P516L|CPNE4_uc003eoj.2_Missense_Mutation_p.P67L	p.P516L	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN			16	1982	-			516					D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	37	c.1547C>T	CCDS3072.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719096	0.68844	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.70263	0.3204	M	0.66506	2.035	0.80722	D	1	D;D	0.61697	0.99;0.975	D;P	0.65140	0.932;0.703	T	0.70303	-0.4909	10	0.45353	T	0.12	-11.6104	18.8677	0.92300	0.0:0.0:1.0:0.0	.	534;516	Q96A23-2;Q96A23	.;CPNE4_HUMAN	L	516;516;534;516;534	ENSP00000421705:P516L;ENSP00000411904:P516L;ENSP00000424853:P534L;ENSP00000423811:P516L;ENSP00000421646:P534L	ENSP00000411904:P516L	P	-	2	0	CPNE4	132736856	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.540000	0.82074	2.460000	0.83146	0.557000	0.71058	CCA		0.453	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808		17	45	0	0	0	0.00499	0	17	45				
KY	339855	broad.mit.edu	37	3	134323159	134323159	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:134323159G>C	ENST00000423778.2	-	11	1309	c.1248C>G	c.(1246-1248)atC>atG	p.I416M	KY_ENST00000508956.1_Missense_Mutation_p.I395M|KY_ENST00000503669.1_3'UTR	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	416					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)	p.I416M(2)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						CCTTGGCAAAGATCTGCAGCT	0.537																																							uc010hty.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1246-1248)ATC>ATG		kyphoscoliosis peptidase							85.0	84.0	84.0					3																	134323159		2124	4243	6367	SO:0001583	missense	339855					cytoskeleton|Z disc	peptidase activity	g.chr3:134323159G>C	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.1248C>G	3.37:g.134323159G>C	ENSP00000397598:p.Ile416Met					KY_uc011blw.1_3'UTR|KY_uc011blx.1_Missense_Mutation_p.I395M	p.I416M	NM_178554	NP_848649	Q8NBH2	KY_HUMAN			11	1310	-			416					B7Z1S4|Q6ZT15	Missense_Mutation	SNP	ENST00000423778.2	37	c.1248C>G	CCDS46920.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965311	0.53507	.	.	ENSG00000174611	ENST00000508956;ENST00000423778;ENST00000310263	.	.	.	5.48	5.48	0.80851	.	0.068782	0.64402	D	0.000019	T	0.77061	0.4075	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.77004	0.982;0.989	T	0.78889	-0.2026	9	0.72032	D	0.01	-34.3816	14.9003	0.70672	0.0:0.143:0.857:0.0	.	395;416	Q8NBH2-3;Q8NBH2-4	.;.	M	395;416;416	.	ENSP00000309520:I416M	I	-	3	3	KY	135805849	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	3.359000	0.52292	2.578000	0.87016	0.561000	0.74099	ATC		0.537	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554		21	48	0	0	0	0.00278	0	21	48				
CP	1356	broad.mit.edu	37	3	148927062	148927062	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:148927062G>T	ENST00000264613.6	-	4	979	c.717C>A	c.(715-717)taC>taA	p.Y239*		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	239	F5/8 type A 1.|Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.Y239*(1)		breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GTTCTGAGCAGTAGGTTTTAA	0.348																																							uc003ewy.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(715-717)TAC>TAA		ceruloplasmin precursor	Drotrecogin alfa(DB00055)						195.0	184.0	188.0					3																	148927062		2203	4300	6503	SO:0001587	stop_gained	1356				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity	g.chr3:148927062G>T	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.717C>A	3.37:g.148927062G>T	ENSP00000264613:p.Tyr239*					CP_uc011bnr.1_RNA|CP_uc003ewx.3_Nonsense_Mutation_p.Y20*|CP_uc003ewz.2_Nonsense_Mutation_p.Y239*|CP_uc010hvf.1_5'Flank	p.Y239*	NM_000096	NP_000087	P00450	CERU_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		4	970	-		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	239			F5/8 type A 1.|Plastocyanin-like 2.		Q14063|Q2PP18|Q9UKS4	Nonsense_Mutation	SNP	ENST00000264613.6	37	c.717C>A	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	G	39	7.330256	0.98217	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	.	.	.	5.6	3.81	0.43845	.	0.120150	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.9153	9.3136	0.37921	0.2179:0.0:0.7821:0.0	.	.	.	.	X	239;22	.	ENSP00000264613:Y239X	Y	-	3	2	CP	150409752	1.000000	0.71417	0.994000	0.49952	0.466000	0.32739	2.202000	0.42743	0.701000	0.31803	0.650000	0.86243	TAC		0.348	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096		18	64	1	0	5.01169e-05	0.00499	5.51559e-05	18	64				
SLITRK3	22865	broad.mit.edu	37	3	164907671	164907671	+	Silent	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:164907671A>T	ENST00000475390.1	-	2	1391	c.948T>A	c.(946-948)tcT>tcA	p.S316S	SLITRK3_ENST00000241274.3_Silent_p.S316S			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	316					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.S316S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TAAAATGAACAGAGGATAGCA	0.473										HNSCC(40;0.11)																													uc003fej.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(3)|pancreas(1)	10						c.(946-948)TCT>TCA		slit and trk like 3 protein precursor							191.0	197.0	195.0					3																	164907671		2203	4300	6503	SO:0001819	synonymous_variant	22865					integral to membrane		g.chr3:164907671A>T	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.948T>A	3.37:g.164907671A>T		HNSCC(40;0.11)				SLITRK3_uc003fek.2_Silent_p.S316S	p.S316S	NM_014926	NP_055741	O94933	SLIK3_HUMAN			2	1392	-			316			Extracellular (Potential).		Q1RMY6	Silent	SNP	ENST00000475390.1	37	c.948T>A	CCDS3197.1																																																																																				0.473	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		50	108	0	0	0	0.01441	0	50	108				
ZBBX	79740	broad.mit.edu	37	3	167016239	167016239	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:167016239T>A	ENST00000392766.2	-	18	2073	c.1733A>T	c.(1732-1734)cAa>cTa	p.Q578L	ZBBX_ENST00000392764.1_Missense_Mutation_p.Q549L|ZBBX_ENST00000392767.2_Missense_Mutation_p.Q578L|ZBBX_ENST00000307529.5_Missense_Mutation_p.Q578L|ZBBX_ENST00000455345.2_Missense_Mutation_p.Q578L	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	578						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.Q578L(2)|p.Q578fs*1(2)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						GGCTATTTCTTGTAACAACTA	0.284																																							uc003fep.2		NA																	4	Substitution - Missense(2)|Deletion - Frameshift(2)	p.Q578fs*0(1)	ovary(2)|lung(2)	ovary(2)	2						c.(1732-1734)CAA>CTA		zinc finger, B-box domain containing							110.0	109.0	109.0					3																	167016239		1808	4063	5871	SO:0001583	missense	79740					intracellular	zinc ion binding	g.chr3:167016239T>A	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1733A>T	3.37:g.167016239T>A	ENSP00000376519:p.Gln578Leu					ZBBX_uc011bpc.1_Missense_Mutation_p.Q578L|ZBBX_uc003feq.2_Missense_Mutation_p.Q549L	p.Q578L	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN			18	2056	-			578					A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	c.1733A>T	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	T	12.77	2.037948	0.35989	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.12147	2.88;2.88;2.82;2.82;2.71	4.9	3.69	0.42338	.	0.311314	0.30667	N	0.009137	T	0.24198	0.0586	L	0.59436	1.845	0.31779	N	0.63114	D;D	0.57571	0.98;0.965	P;P	0.57152	0.814;0.656	T	0.19844	-1.0293	10	0.72032	D	0.01	-6.9951	7.8615	0.29511	0.0:0.0984:0.0:0.9016	.	578;578	A8MT70-2;A8MT70	.;ZBBX_HUMAN	L	578;578;578;578;549	ENSP00000376519:Q578L;ENSP00000376520:Q578L;ENSP00000390232:Q578L;ENSP00000305065:Q578L;ENSP00000376517:Q549L	ENSP00000305065:Q578L	Q	-	2	0	ZBBX	168498933	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	0.696000	0.25541	0.766000	0.33244	0.482000	0.46254	CAA		0.284	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687		6	76	0	0	0	0.001168	0	6	76				
LRRC31	79782	broad.mit.edu	37	3	169574170	169574170	+	Silent	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:169574170C>T	ENST00000316428.5	-	5	834	c.777G>A	c.(775-777)ctG>ctA	p.L259L	LRRC31_ENST00000397805.2_5'UTR|LRRC31_ENST00000523069.1_Silent_p.L259L|LRRC31_ENST00000264676.5_Silent_p.L203L	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	259								p.L259L(1)		cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			AATGTAACTTCAGTACTTTCA	0.333																																							uc003fgc.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(775-777)CTG>CTA		leucine rich repeat containing 31							131.0	121.0	124.0					3																	169574170		1856	4093	5949	SO:0001819	synonymous_variant	79782							g.chr3:169574170C>T	AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.777G>A	3.37:g.169574170C>T						LRRC31_uc010hwp.1_Silent_p.L203L	p.L259L	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)		5	854	-	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		259			LRR 2.		B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Silent	SNP	ENST00000316428.5	37	c.777G>A	CCDS43167.1																																																																																				0.333	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378699.1	NM_024727		20	97	0	0	0	0.012319	0	20	97				
ADIPOQ	9370	broad.mit.edu	37	3	186570891	186570891	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:186570891G>T	ENST00000412955.2	+	2	185	c.44G>T	c.(43-45)gGt>gTt	p.G15V	ADIPOQ-AS1_ENST00000422718.1_RNA|ADIPOQ_ENST00000320741.2_Missense_Mutation_p.G15V|ADIPOQ_ENST00000444204.2_Missense_Mutation_p.G15V			Q15848	ADIPO_HUMAN	adiponectin, C1Q and collagen domain containing	15					adiponectin-activated signaling pathway (GO:0033211)|brown fat cell differentiation (GO:0050873)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to insulin stimulus (GO:0032869)|circadian rhythm (GO:0007623)|detection of oxidative stress (GO:0070994)|fatty acid beta-oxidation (GO:0006635)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|low-density lipoprotein particle clearance (GO:0034383)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of hormone secretion (GO:0046888)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular protein transport (GO:0090317)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metanephric mesenchymal cell migration (GO:2000590)|negative regulation of phagocytosis (GO:0050765)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of receptor binding (GO:1900121)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of synaptic transmission (GO:0050805)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|positive regulation of blood pressure (GO:0045777)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of metanephric glomerular visceral epithelial cell development (GO:2000478)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myeloid cell apoptotic process (GO:0033034)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal albumin absorption (GO:2000534)|positive regulation of signal transduction (GO:0009967)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|regulation of glucose metabolic process (GO:0010906)|response to activity (GO:0014823)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to linoleic acid (GO:0070543)|response to nutrient (GO:0007584)|response to sucrose (GO:0009744)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|sialic acid binding (GO:0033691)	p.G15V(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(2)	16	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		GCTCTGCCCGGTCATGACCAG	0.617																																							uc003fra.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(43-45)GGT>GTT		adiponectin precursor							88.0	81.0	83.0					3																	186570891		2203	4300	6503	SO:0001583	missense	9370				brown fat cell differentiation|cellular response to drug|cellular response to insulin stimulus|detection of oxidative stress|fatty acid beta-oxidation|generation of precursor metabolites and energy|glucose homeostasis|glucose metabolic process|low-density lipoprotein particle clearance|negative regulation of blood pressure|negative regulation of DNA biosynthetic process|negative regulation of ERK1 and ERK2 cascade|negative regulation of eukaryotic cell surface binding|negative regulation of fat cell differentiation|negative regulation of gluconeogenesis|negative regulation of granulocyte differentiation|negative regulation of heterotypic cell-cell adhesion|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of intracellular protein transport|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|negative regulation of macrophage differentiation|negative regulation of MAP kinase activity|negative regulation of phagocytosis|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein autophosphorylation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|negative regulation of synaptic transmission|negative regulation of transcription, DNA-dependent|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|positive regulation of cAMP-dependent protein kinase activity|positive regulation of cholesterol efflux|positive regulation of fatty acid metabolic process|positive regulation of glucose import|positive regulation of glycogen (starch) synthase activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of metanephric glomerular visceral epithelial cell development|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myeloid cell apoptosis|positive regulation of protein kinase A signaling cascade|positive regulation of renal albumin absorption|protein homooligomerization|protein localization in plasma membrane|response to glucose stimulus|response to tumor necrosis factor	collagen|endoplasmic reticulum|extracellular space	cytokine activity|eukaryotic cell surface binding|hormone activity|protein homodimerization activity	g.chr3:186570891G>T	D45371	CCDS3284.1	3q27	2013-02-26	2005-01-24	2005-01-27	ENSG00000181092	ENSG00000181092		"""Endogenous ligands"""	13633	protein-coding gene	gene with protein product	"""adipose most abundant gene transcript 1"", ""adiponectin precursor"""	605441	"""adipocyte, C1Q and collagen domain containing"""	ACDC		7592907, 8631877	Standard	NM_001177800		Approved	ACRP30, AdipoQ, apM1, GBP28, adiponectin	uc003fra.3	Q15848	OTTHUMG00000156521	ENST00000412955.2:c.44G>T	3.37:g.186570891G>T	ENSP00000405611:p.Gly15Val					ADIPOQ_uc010hyy.2_Missense_Mutation_p.G15V	p.G15V	NM_004797	NP_004788	Q15848	ADIPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)	2	128	+	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		15					Q58EX9	Missense_Mutation	SNP	ENST00000412955.2	37	c.44G>T	CCDS3284.1	.	.	.	.	.	.	.	.	.	.	G	10.80	1.453986	0.26161	.	.	ENSG00000181092	ENST00000412955;ENST00000320741;ENST00000444204	D;D;D	0.90444	-2.67;-2.67;-2.67	5.31	-4.9	0.03094	.	1.158660	0.06158	N	0.675367	T	0.75939	0.3918	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.61888	-0.6970	10	0.26408	T	0.33	.	5.1763	0.15137	0.0682:0.3984:0.2297:0.3036	.	15	Q15848	ADIPO_HUMAN	V	15	ENSP00000405611:G15V;ENSP00000320709:G15V;ENSP00000389814:G15V	ENSP00000320709:G15V	G	+	2	0	ADIPOQ	188053585	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	1.123000	0.31308	-0.809000	0.04381	-0.962000	0.02626	GGT		0.617	ADIPOQ-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344490.2	NM_004797		24	46	1	0	8.24728e-16	0.004656	1.24169e-15	24	46				
ATP13A5	344905	broad.mit.edu	37	3	193039469	193039469	+	Splice_Site	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:193039469C>G	ENST00000342358.4	-	16	2033		c.e16+1			NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.?(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AGTGTTAGTACCTGTTTCAGA	0.458																																							uc011bsq.1		NA																	1	Unknown(1)		lung(1)	ovary(5)|skin(4)|large_intestine(2)	11						c.e16+1		ATPase type 13A5							66.0	66.0	66.0					3																	193039469		2203	4300	6503	SO:0001630	splice_region_variant	344905				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding	g.chr3:193039469C>G	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1915+1G>C	3.37:g.193039469C>G							p.V639_splice	NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)	16	1915	-	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)							Q6UWS4|Q6ZWL0	Splice_Site	SNP	ENST00000342358.4	37	c.1915_splice	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300780	0.40694	.	.	ENSG00000187527	ENST00000342358	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6443	0.91405	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP13A5	194522163	1.000000	0.71417	1.000000	0.80357	0.220000	0.24768	6.900000	0.75687	2.755000	0.94549	0.650000	0.86243	.		0.458	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	Intron	4	84	0	0	0	0.000602	0	4	84				
TECRL	253017	broad.mit.edu	37	4	65170927	65170927	+	Silent	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:65170927A>G	ENST00000381210.3	-	7	797	c.687T>C	c.(685-687)tcT>tcC	p.S229S	TECRL_ENST00000507440.1_Silent_p.S229S|TECRL_ENST00000513125.1_5'UTR	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	229					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.S229S(1)		endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						AGGCAATCCAAGAAGTAAATC	0.313																																							uc003hcv.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(685-687)TCT>TCC		steroid 5 alpha-reductase 2-like 2							139.0	146.0	144.0					4																	65170927		2203	4298	6501	SO:0001819	synonymous_variant	253017				lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors	g.chr4:65170927A>G	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.687T>C	4.37:g.65170927A>G						TECRL_uc003hcw.2_Silent_p.S229S	p.S229S	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN			7	796	-			229			Helical; (Potential).			Silent	SNP	ENST00000381210.3	37	c.687T>C	CCDS33990.1																																																																																				0.313	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874		25	61	0	0	0	0.004656	0	25	61				
UGT2B15	7366	broad.mit.edu	37	4	69513061	69513061	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:69513061C>A	ENST00000338206.5	-	6	1363	c.1354G>T	c.(1354-1356)Gac>Tac	p.D452Y		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	452					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.D452Y(1)|p.D452N(1)								Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	ATTGGTTGGTCATGATGAATT	0.388																																							uc011cal.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1354-1356)GAC>TAC		UDP glycosyltransferase 2B15 precursor							115.0	121.0	119.0					4																	69513061		2203	4296	6499	SO:0001583	missense	7366				steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69513061C>A	AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.1354G>T	4.37:g.69513061C>A	ENSP00000341045:p.Asp452Tyr						p.D452Y	NM_001076	NP_001067	P54855	UDB15_HUMAN			6	1392	-			452					A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	ENST00000338206.5	37	c.1354G>T	CCDS3524.1	.	.	.	.	.	.	.	.	.	.	c	12.96	2.095893	0.36952	.	.	ENSG00000196620	ENST00000338206	T	0.73575	-0.76	2.96	2.11	0.27256	.	0.000000	0.64402	U	0.000001	D	0.89291	0.6673	H	0.97983	4.12	0.33585	D	0.600424	D	0.89917	1.0	D	0.91635	0.999	D	0.89895	0.4040	10	0.87932	D	0	.	7.5946	0.28041	0.0:0.8657:0.0:0.1343	.	452	P54855	UDB15_HUMAN	Y	452	ENSP00000341045:D452Y	ENSP00000341045:D452Y	D	-	1	0	UGT2B15	69195656	0.998000	0.40836	0.127000	0.21898	0.440000	0.31957	4.172000	0.58243	0.445000	0.26639	0.552000	0.68991	GAC		0.388	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365172.1	NM_001076		31	86	1	0	3.62531e-18	0.004289	5.8496e-18	31	86				
UGT2B4	7363	broad.mit.edu	37	4	70361499	70361499	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:70361499C>A	ENST00000305107.6	-	1	127	c.81G>T	c.(79-81)ctG>ctT	p.L27L	UGT2B4_ENST00000512583.1_Silent_p.L27L|UGT2B4_ENST00000381096.3_Intron|UGT2B4_ENST00000506580.1_5'UTR	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	27					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.L27L(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	TGGGCCACACCAGCACCTTTC	0.458																																							uc003hek.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(2)	2						c.(79-81)CTG>CTT		UDP glucuronosyltransferase 2B4 precursor							152.0	152.0	152.0					4																	70361499		2203	4300	6503	SO:0001819	synonymous_variant	7363				estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70361499C>A	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.81G>T	4.37:g.70361499C>A						UGT2B4_uc011cap.1_Intron|UGT2B4_uc003hel.3_Silent_p.L27L	p.L27L	NM_021139	NP_066962	P06133	UD2B4_HUMAN			1	128	-			27					A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Silent	SNP	ENST00000305107.6	37	c.81G>T	CCDS43234.1																																																																																				0.458	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139		40	106	1	0	2.5098e-30	0.004878	4.62032e-30	40	106				
G3BP2	9908	broad.mit.edu	37	4	76582913	76582913	+	Splice_Site	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:76582913T>C	ENST00000359707.4	-	4	964	c.179A>G	c.(178-180)gAt>gGt	p.D60G	G3BP2_ENST00000395719.3_Splice_Site_p.D60G|G3BP2_ENST00000502654.1_5'UTR|G3BP2_ENST00000357854.3_Splice_Site_p.D60G	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	60	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)	p.D60G(1)		breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GTGGTGTATATCCTTTATTAG	0.373																																							uc003hir.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|central_nervous_system(1)	3						c.(178-180)GAT>GGT		Ras-GTPase activating protein SH3 domain-binding							124.0	129.0	127.0					4																	76582913		2203	4300	6503	SO:0001630	splice_region_variant	9908				cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding	g.chr4:76582913T>C	AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.178-1A>G	4.37:g.76582913T>C						G3BP2_uc003his.2_Missense_Mutation_p.D60G|G3BP2_uc003hit.2_Missense_Mutation_p.D60G	p.D60G	NM_012297	NP_036429	Q9UN86	G3BP2_HUMAN	Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)		4	344	-			60			NTF2.		A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	ENST00000359707.4	37	c.179A>G	CCDS3571.1	.	.	.	.	.	.	.	.	.	.	T	17.80	3.479497	0.63849	.	.	ENSG00000138757	ENST00000395719;ENST00000359707;ENST00000357854;ENST00000503660;ENST00000507745;ENST00000509100;ENST00000511146;ENST00000515457;ENST00000507252;ENST00000511868;ENST00000509561	T;T;T	0.77358	-1.06;-1.06;-1.09	5.87	5.87	0.94306	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.108819	0.64402	D	0.000009	T	0.71702	0.3371	L	0.31157	0.91	0.53688	D	0.999972	B;B	0.30114	0.008;0.269	B;B	0.35899	0.023;0.213	T	0.68992	-0.5263	10	0.35671	T	0.21	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	60;60	Q9UN86-2;Q9UN86	.;G3BP2_HUMAN	G	60	ENSP00000379069:D60G;ENSP00000352738:D60G;ENSP00000350518:D60G	ENSP00000350518:D60G	D	-	2	0	G3BP2	76801937	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.655000	0.83696	2.371000	0.80710	0.533000	0.62120	GAT		0.373	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252399.2	NM_012297	Missense_Mutation	46	89	0	0	0	0.010771	0	46	89				
USO1	8615	broad.mit.edu	37	4	76726398	76726398	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:76726398G>T	ENST00000538159.1	+	20	2258	c.2258G>T	c.(2257-2259)cGt>cTt	p.R753L	USO1_ENST00000514213.2_Missense_Mutation_p.R729L			O60763	USO1_HUMAN	USO1 vesicle transport factor	744					ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.R753L(1)|p.R672L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GAATTAAAACGTAATCAGGAA	0.363																																							uc003hiu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(2230-2232)CGT>CTT		USO1 homolog, vesicle docking protein							61.0	57.0	58.0					4																	76726398		1835	4091	5926	SO:0001583	missense	8615				intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity	g.chr4:76726398G>T	AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.2258G>T	4.37:g.76726398G>T	ENSP00000440586:p.Arg753Leu					USO1_uc003hiv.2_Missense_Mutation_p.R586L|USO1_uc003hiw.2_Missense_Mutation_p.R579L	p.R744L	NM_003715	NP_003706	O60763	USO1_HUMAN	Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)		18	2406	+			744			Potential.		B2RAQ0|Q6PK63|Q86TB8|Q8N592	Missense_Mutation	SNP	ENST00000538159.1	37	c.2231G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.564|2.564	-0.301243|-0.301243	0.05495|0.05495	.|.	.|.	ENSG00000138768|ENSG00000138768	ENST00000508939;ENST00000538159;ENST00000514213;ENST00000264904|ENST00000441296	.|.	.|.	.|.	5.8|5.8	3.75|3.75	0.43078|0.43078	Armadillo-type fold (1);|.	0.436525|.	0.30800|.	N|.	0.008846|.	T|T	0.31420|0.31420	0.0796|0.0796	N|N	0.14661|0.14661	0.345|0.345	0.19300|0.19300	N|N	0.999974|0.999974	B;B|.	0.33777|.	0.425;0.029|.	B;B|.	0.30495|.	0.116;0.018|.	T|T	0.18777|0.18777	-1.0326|-1.0326	9|5	0.23302|.	T|.	0.38|.	.|.	14.9172|14.9172	0.70807|0.70807	0.1879:0.0:0.8121:0.0|0.1879:0.0:0.8121:0.0	.|.	753;744|.	F5GYR8;O60763|.	.;USO1_HUMAN|.	L|L	579;753;729;672|420	.|.	ENSP00000264904:R672L|.	R|V	+|+	2|1	0|0	USO1|USO1	76945422|76945422	0.195000|0.195000	0.23338|0.23338	0.372000|0.372000	0.25991|0.25991	0.009000|0.009000	0.06853|0.06853	0.194000|0.194000	0.17135|0.17135	0.809000|0.809000	0.34255|0.34255	-1.644000|-1.644000	0.00765|0.00765	CGT|GTA		0.363	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003715		14	13	1	0	9.31168e-06	0.001855	1.06532e-05	14	13				
MEPE	56955	broad.mit.edu	37	4	88767549	88767549	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:88767549G>T	ENST00000424957.3	+	4	1602	c.1529G>T	c.(1528-1530)aGt>aTt	p.S510I	MEPE_ENST00000361056.3_Missense_Mutation_p.S510I|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000540395.1_Missense_Mutation_p.S397I|MEPE_ENST00000497649.2_Missense_Mutation_p.S486I|MEPE_ENST00000395102.4_Missense_Mutation_p.S541I|MEPE_ENST00000560249.1_Missense_Mutation_p.S397I	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	510					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		AGGGATGACAGTAGTGAGTCA	0.517																																							uc003hqy.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(1528-1530)AGT>ATT		matrix, extracellular phosphoglycoprotein with							152.0	143.0	146.0					4																	88767549		2203	4300	6503	SO:0001583	missense	56955				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr4:88767549G>T	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.1529G>T	4.37:g.88767549G>T	ENSP00000416984:p.Ser510Ile					MEPE_uc010ikn.2_Missense_Mutation_p.S397I	p.S510I	NM_020203	NP_064588	Q9NQ76	MEPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000432)	4	1568	+		Hepatocellular(203;0.114)	510					A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	37	c.1529G>T	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.541581	0.27563	.	.	ENSG00000152595	ENST00000424957;ENST00000395102;ENST00000497649;ENST00000540395;ENST00000361056	T;T;T;T;T	0.65178	-0.1;-0.08;-0.14;-0.1;-0.1	5.09	5.09	0.68999	.	0.000000	0.52532	D	0.000062	T	0.80491	0.4633	M	0.86953	2.85	0.23210	N	0.998119	D	0.89917	1.0	D	0.70227	0.968	T	0.74386	-0.3682	10	0.87932	D	0	-15.9724	13.8581	0.63542	0.0:0.0:1.0:0.0	.	510	Q9NQ76	MEPE_HUMAN	I	510;541;486;397;510	ENSP00000416984:S510I;ENSP00000378534:S541I;ENSP00000422747:S486I;ENSP00000443491:S397I;ENSP00000354341:S510I	ENSP00000354341:S510I	S	+	2	0	MEPE	88986573	0.990000	0.36364	0.240000	0.24138	0.141000	0.21300	4.630000	0.61297	2.637000	0.89404	0.563000	0.77884	AGT		0.517	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1			49	123	1	0	9.59835e-30	0.01441	1.75105e-29	49	123				
UNC5C	8633	broad.mit.edu	37	4	96091427	96091427	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:96091427G>T	ENST00000453304.1	-	15	2856	c.2508C>A	c.(2506-2508)gtC>gtA	p.V836V		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	836					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.V836V(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TGGGCCCCGTGACCGTGGTGA	0.577																																							uc003htp.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(2506-2508)GTC>GTA		unc5C precursor							174.0	165.0	168.0					4																	96091427		2203	4300	6503	SO:0001819	synonymous_variant	8633				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity	g.chr4:96091427G>T	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.2508C>A	4.37:g.96091427G>T						uc003hto.2_5'Flank	p.V836V	NM_003728	NP_003719	O95185	UNC5C_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)	15	2662	-		Hepatocellular(203;0.114)	836			Cytoplasmic (Potential).		Q8IUT0	Silent	SNP	ENST00000453304.1	37	c.2508C>A	CCDS3643.1																																																																																				0.577	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		58	144	1	0	2.2129e-31	0.01441	4.13006e-31	58	144				
ANK2	287	broad.mit.edu	37	4	114275528	114275528	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:114275528C>A	ENST00000357077.4	+	38	5807	c.5754C>A	c.(5752-5754)ccC>ccA	p.P1918P	ANK2_ENST00000264366.6_Silent_p.P1885P|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1918	Repeat-rich region.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.P1918P(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTGTATCGCCCTCCGGGAGGA	0.507																																							uc003ibe.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(5752-5754)CCC>CCA		ankyrin 2 isoform 1							56.0	52.0	54.0					4																	114275528		2203	4300	6503	SO:0001819	synonymous_variant	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114275528C>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5754C>A	4.37:g.114275528C>A						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Silent_p.P1933P	p.P1918P	NM_001148	NP_001139	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	5854	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	1885			Repeat-rich region.|Repeat A.		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	c.5754C>A	CCDS3702.1																																																																																				0.507	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		17	22	1	0	3.45872e-05	0.004007	3.86956e-05	17	22				
FAT4	79633	broad.mit.edu	37	4	126372736	126372736	+	Missense_Mutation	SNP	G	G	T	rs200082059		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:126372736G>T	ENST00000394329.3	+	9	10578	c.10565G>T	c.(10564-10566)cGg>cTg	p.R3522L	FAT4_ENST00000335110.5_Missense_Mutation_p.R1820L	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3522	Cadherin 34. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R3522L(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GAAAACAAACGGCCAGGCACT	0.488																																							uc003ifj.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(10564-10566)CGG>CTG		FAT tumor suppressor homolog 4 precursor							120.0	117.0	118.0					4																	126372736		2203	4300	6503	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126372736G>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10565G>T	4.37:g.126372736G>T	ENSP00000377862:p.Arg3522Leu					FAT4_uc011cgp.1_Missense_Mutation_p.R1820L|FAT4_uc003ifi.1_Missense_Mutation_p.R1000L	p.R3522L	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN			9	10565	+			3522			Cadherin 34.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.10565G>T	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	16.40	3.112055	0.56398	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.52526	0.66;0.66	5.77	2.92	0.33932	Cadherin (3);Cadherin-like (1);	0.000000	0.34652	U	0.003792	T	0.48677	0.1513	N	0.13235	0.315	0.47511	D	0.999445	D;D;D	0.76494	0.959;0.999;0.998	P;D;D	0.83275	0.738;0.996;0.994	T	0.51702	-0.8672	10	0.66056	D	0.02	.	10.7438	0.46168	0.0667:0.2469:0.6864:0.0	.	1820;3522;3522	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	L	3522;1820	ENSP00000377862:R3522L;ENSP00000335169:R1820L	ENSP00000335169:R1820L	R	+	2	0	FAT4	126592186	1.000000	0.71417	0.874000	0.34290	0.815000	0.46073	4.570000	0.60872	0.762000	0.33152	-0.215000	0.12644	CGG		0.488	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		37	70	1	0	2.75727e-19	0.004878	4.48472e-19	37	70				
INPP4B	8821	broad.mit.edu	37	4	143045795	143045795	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:143045795G>T	ENST00000513000.1	-	20	2272	c.1839C>A	c.(1837-1839)agC>agA	p.S613R	INPP4B_ENST00000509777.1_Missense_Mutation_p.S613R|INPP4B_ENST00000308502.4_Missense_Mutation_p.S613R|INPP4B_ENST00000508116.1_Missense_Mutation_p.S613R|INPP4B_ENST00000262992.4_Missense_Mutation_p.S613R	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	613					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.S613R(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					ACTGGGGCAAGCTGTACGCAA	0.498																																							uc003iix.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)	2						c.(1837-1839)AGC>AGA		inositol polyphosphate-4-phosphatase, type II,							119.0	98.0	105.0					4																	143045795		2203	4300	6503	SO:0001583	missense	8821				signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity	g.chr4:143045795G>T	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.1839C>A	4.37:g.143045795G>T	ENSP00000425487:p.Ser613Arg					INPP4B_uc003iiw.3_Missense_Mutation_p.S613R|INPP4B_uc011chm.1_RNA|INPP4B_uc011chn.1_Missense_Mutation_p.S428R|INPP4B_uc011cho.1_RNA|INPP4B_uc011chp.1_Missense_Mutation_p.S484R	p.S613R	NM_003866	NP_003857	O15327	INP4B_HUMAN			20	2434	-	all_hematologic(180;0.158)		613					Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	37	c.1839C>A	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937530	0.73557	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11;2.11;2.11	5.91	3.22	0.36961	.	0.135313	0.64402	D	0.000002	T	0.18509	0.0444	L	0.32530	0.975	0.44048	D	0.996781	P;P	0.46706	0.853;0.883	P;P	0.50231	0.529;0.635	T	0.09707	-1.0662	10	0.18710	T	0.47	.	5.0378	0.14443	0.3537:0.1467:0.4995:0.0	.	484;613	B7Z6T2;O15327	.;INP4B_HUMAN	R	613;613;613;484;613;613;428;428;613;484	ENSP00000425487:S613R;ENSP00000262992:S613R;ENSP00000308441:S613R;ENSP00000423954:S613R;ENSP00000422793:S613R;ENSP00000426207:S428R;ENSP00000427250:S613R;ENSP00000421065:S484R	ENSP00000262992:S613R	S	-	3	2	INPP4B	143265245	0.925000	0.31364	0.999000	0.59377	0.993000	0.82548	0.216000	0.17585	0.820000	0.34516	0.655000	0.94253	AGC		0.498	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866		20	24	1	0	0.000132079	0.008871	0.000143027	20	24				
MAB21L2	10586	broad.mit.edu	37	4	151504265	151504265	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:151504265C>A	ENST00000317605.4	+	1	1189	c.84C>A	c.(82-84)gcC>gcA	p.A28A	LRBA_ENST00000507224.1_Intron|LRBA_ENST00000357115.3_Intron|LRBA_ENST00000503716.1_5'Flank|LRBA_ENST00000510413.1_Intron|LRBA_ENST00000535741.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	28					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.A28A(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		CGGCCATCGCCAAAACCATCC	0.592																																							uc003ilw.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(82-84)GCC>GCA		mab-21-like protein 2							37.0	34.0	35.0					4																	151504265		2203	4300	6503	SO:0001819	synonymous_variant	10586				nervous system development	nucleus		g.chr4:151504265C>A	AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.84C>A	4.37:g.151504265C>A						LRBA_uc003ils.3_5'Flank|LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron|LRBA_uc010ipj.2_Intron	p.A28A	NM_006439	NP_006430	Q9Y586	MB212_HUMAN		GBM - Glioblastoma multiforme(119;0.159)	1	1189	+	all_hematologic(180;0.151)		28					B3KP37|Q9HBA7	Silent	SNP	ENST00000317605.4	37	c.84C>A	CCDS3774.1																																																																																				0.592	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1	NM_006439		5	18	1	0	0.000602214	0.000602	0.000636806	5	18				
VEGFC	7424	broad.mit.edu	37	4	177632762	177632762	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:177632762C>A	ENST00000280193.2	-	4	1010	c.595G>T	c.(595-597)Gta>Tta	p.V199L	VEGFC_ENST00000507638.1_5'UTR	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	199					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)	p.V199L(1)		biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		CTGATTGTTACTGGTTTGGGG	0.383																																							uc003ius.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(5)	5						c.(595-597)GTA>TTA		vascular endothelial growth factor C							170.0	161.0	164.0					4																	177632762		1887	4119	6006	SO:0001583	missense	7424				angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity	g.chr4:177632762C>A	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.595G>T	4.37:g.177632762C>A	ENSP00000280193:p.Val199Leu						p.V199L	NM_005429	NP_005420	P49767	VEGFC_HUMAN		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)	4	1025	-		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)	199					B2R9Q8	Missense_Mutation	SNP	ENST00000280193.2	37	c.595G>T	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.197205	0.58126	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.98	5.14	0.70334	Platelet-derived growth factor (PDGF) (3);	0.000000	0.85682	D	0.000000	T	0.67183	0.2866	M	0.89214	3.015	0.80722	D	1	P	0.35959	0.53	B	0.34301	0.179	T	0.72017	-0.4417	9	0.59425	D	0.04	-13.9793	12.3857	0.55330	0.0:0.8648:0.0:0.1352	.	199	P49767	VEGFC_HUMAN	L	199	.	ENSP00000280193:V199L	V	-	1	0	VEGFC	177869756	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.790000	0.55461	1.548000	0.49413	-0.224000	0.12420	GTA		0.383	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429		39	74	1	0	2.59497e-14	0.007835	3.82168e-14	39	74				
SORBS2	8470	broad.mit.edu	37	4	186544384	186544384	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:186544384C>A	ENST00000284776.7	-	13	2696	c.2187G>T	c.(2185-2187)gaG>gaT	p.E729D	SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.E729D|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000355634.5_Missense_Mutation_p.E829D|SORBS2_ENST00000418609.1_Missense_Mutation_p.E633D|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000498125.1_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	729					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		AGTCCAGAGCCTCAAACACAG	0.458																																					Esophageal Squamous(153;41 2433 9491 36028)	Esophageal Squamous(153;41 2433 9491 36028)	uc003iyl.2		NA																	0				ovary(1)	1						c.(2185-2187)GAG>GAT		sorbin and SH3 domain containing 2 isoform 2							147.0	163.0	157.0					4																	186544384		2203	4300	6503	SO:0001583	missense	8470					actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chr4:186544384C>A		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2187G>T	4.37:g.186544384C>A	ENSP00000284776:p.Glu729Asp					SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Missense_Mutation_p.E829D|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Missense_Mutation_p.E633D|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Missense_Mutation_p.E843D|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	p.E729D	NM_021069	NP_066547	O94875	SRBS2_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)	13	3045	-		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)	729					A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	c.2187G>T	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	C	9.004	0.980806	0.18812	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.39406	1.22;1.22;1.08;1.2	5.77	3.84	0.44239	.	0.097026	0.64402	D	0.000001	T	0.22360	0.0539	N	0.16656	0.425	0.48288	D	0.999627	B;B;B	0.13594	0.008;0.002;0.004	B;B;B	0.14023	0.01;0.004;0.004	T	0.08086	-1.0739	10	0.35671	T	0.21	-24.8438	3.8367	0.08897	0.2665:0.4642:0.0:0.2694	.	633;829;729	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	D	729;729;633;829	ENSP00000284776:E729D;ENSP00000411764:E729D;ENSP00000397482:E633D;ENSP00000347852:E829D	ENSP00000284776:E729D	E	-	3	2	SORBS2	186781378	1.000000	0.71417	1.000000	0.80357	0.585000	0.36419	1.038000	0.30254	1.421000	0.47157	0.561000	0.74099	GAG		0.458	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603		72	221	1	0	4.66136e-34	0.01441	8.82174e-34	72	221				
F11	2160	broad.mit.edu	37	4	187197457	187197457	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:187197457C>A	ENST00000403665.2	+	7	1020	c.668C>A	c.(667-669)gCt>gAt	p.A223D	F11_ENST00000264692.4_Missense_Mutation_p.A171D	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	223	Apple 3. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)	p.A223D(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	GCTCCCGATGCTTTTGTCTGT	0.473																																							uc003iza.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(667-669)GCT>GAT		coagulation factor XI precursor	Coagulation Factor IX(DB00100)						169.0	148.0	155.0					4																	187197457		2203	4300	6503	SO:0001583	missense	2160				blood coagulation, intrinsic pathway|plasminogen activation|positive regulation of fibrinolysis	extracellular space|plasma membrane	heparin binding|serine-type endopeptidase activity	g.chr4:187197457C>A	M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.668C>A	4.37:g.187197457C>A	ENSP00000384957:p.Ala223Asp						p.A223D	NM_000128	NP_000119	P03951	FA11_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	7	1001	+		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)	223			Apple 3.		D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	ENST00000403665.2	37	c.668C>A	CCDS3847.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.81|10.81	1.454312|1.454312	0.26161|0.26161	.|.	.|.	ENSG00000088926|ENSG00000088926	ENST00000403665;ENST00000264692|ENST00000452239	D;D|.	0.89939|.	-2.59;-2.59|.	5.47|5.47	1.67|1.67	0.24075|0.24075	Apple domain (3);PAN-1 domain (1);Apple-like (1);|.	0.922380|.	0.09254|.	N|.	0.827454|.	T|T	0.60792|0.60792	0.2296|0.2296	M|M	0.85197|0.85197	2.74|2.74	0.09310|0.09310	N|N	1|1	D|.	0.56746|.	0.977|.	P|.	0.49799|.	0.622|.	T|T	0.53486|0.53486	-0.8432|-0.8432	10|5	0.87932|.	D|.	0|.	.|.	10.1282|10.1282	0.42663|0.42663	0.0:0.4744:0.0:0.5256|0.0:0.4744:0.0:0.5256	.|.	223|.	P03951|.	FA11_HUMAN|.	D|I	223;171|39	ENSP00000384957:A223D;ENSP00000264692:A171D|.	ENSP00000264692:A171D|.	A|L	+|+	2|1	0|0	F11|F11	187434451|187434451	0.001000|0.001000	0.12720|0.12720	0.032000|0.032000	0.17829|0.17829	0.001000|0.001000	0.01503|0.01503	-0.135000|-0.135000	0.10420|0.10420	-0.017000|-0.017000	0.14103|0.14103	-0.150000|-0.150000	0.13652|0.13652	GCT|CTT		0.473	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4			18	50	1	0	1.15919e-05	0.008871	1.31137e-05	18	50				
TRIML1	339976	broad.mit.edu	37	4	189068134	189068134	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr4:189068134G>T	ENST00000332517.3	+	6	1155	c.1015G>T	c.(1015-1017)Ggg>Tgg	p.G339W	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	339	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.G339W(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		CTTCACCAGTGGGAGACACTA	0.552																																					Melanoma(31;213 1036 16579 23968 32372)	Melanoma(31;213 1036 16579 23968 32372)	uc003izm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|breast(1)|skin(1)	4						c.(1015-1017)GGG>TGG		tripartite motif family-like 1							83.0	81.0	82.0					4																	189068134		2203	4300	6503	SO:0001583	missense	339976				multicellular organismal development		ligase activity|zinc ion binding	g.chr4:189068134G>T	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.1015G>T	4.37:g.189068134G>T	ENSP00000327738:p.Gly339Trp					TRIML1_uc003izn.1_Missense_Mutation_p.G63W	p.G339W	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)	6	1130	+		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)	339			B30.2/SPRY.		Q96BE5	Missense_Mutation	SNP	ENST00000332517.3	37	c.1015G>T	CCDS3851.1	.	.	.	.	.	.	.	.	.	.	g	16.93	3.258342	0.59321	.	.	ENSG00000184108	ENST00000332517	D	0.87412	-2.25	4.92	4.92	0.64577	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.53938	D	0.000044	D	0.95592	0.8567	H	0.96547	3.84	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.96605	0.9448	10	0.87932	D	0	-43.6848	16.0461	0.80722	0.0:0.0:1.0:0.0	.	339	Q8N9V2	TRIML_HUMAN	W	339	ENSP00000327738:G339W	ENSP00000327738:G339W	G	+	1	0	TRIML1	189305128	1.000000	0.71417	0.966000	0.40874	0.303000	0.27691	7.706000	0.84615	2.749000	0.94314	0.550000	0.68814	GGG		0.552	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556		23	47	1	0	5.26018e-13	0.012319	7.50131e-13	23	47				
FASTKD3	79072	broad.mit.edu	37	5	7866830	7866830	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:7866830G>A	ENST00000264669.5	-	2	1503	c.1367C>T	c.(1366-1368)tCa>tTa	p.S456L	MTRR_ENST00000440940.2_5'Flank|MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000341013.6_5'Flank|FASTKD3_ENST00000513658.1_Intron	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	456					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.S456L(1)|p.S456*(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TTCATTAAGTGAACATGAATG	0.368																																							uc003jeb.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		large_intestine(1)|lung(1)	ovary(2)|breast(1)|pancreas(1)	4						c.(1366-1368)TCA>TTA		FAST kinase domains 3							63.0	64.0	64.0					5																	7866830		2203	4300	6503	SO:0001583	missense	79072				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr5:7866830G>A	AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.1367C>T	5.37:g.7866830G>A	ENSP00000264669:p.Ser456Leu					FASTKD3_uc011cmp.1_Missense_Mutation_p.S158L|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	p.S456L	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN			2	1504	-			456					Q9BVD3	Missense_Mutation	SNP	ENST00000264669.5	37	c.1367C>T	CCDS3873.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123530	0.37436	.	.	ENSG00000124279	ENST00000264669	T	0.42513	0.97	4.95	4.05	0.47172	FAST kinase leucine-rich (1);	0.424965	0.24813	N	0.035388	T	0.36331	0.0963	L	0.41236	1.265	0.25630	N	0.98631	P	0.36944	0.574	B	0.41764	0.366	T	0.24728	-1.0152	10	0.51188	T	0.08	-6.8164	7.5157	0.27600	0.2839:0.0:0.7161:0.0	.	456	Q14CZ7	FAKD3_HUMAN	L	456	ENSP00000264669:S456L	ENSP00000264669:S456L	S	-	2	0	FASTKD3	7919830	0.995000	0.38212	0.183000	0.23137	0.428000	0.31595	2.314000	0.43743	1.226000	0.43582	0.655000	0.94253	TCA		0.368	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091		13	182	0	0	0	0.013537	0	13	182				
CTNND2	1501	broad.mit.edu	37	5	11364842	11364842	+	Silent	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:11364842C>T	ENST00000304623.8	-	8	1527	c.1338G>A	c.(1336-1338)ccG>ccA	p.P446P	CTNND2_ENST00000458100.2_Silent_p.P13P|CTNND2_ENST00000359640.2_Silent_p.P446P|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Silent_p.P355P|CTNND2_ENST00000503622.1_Silent_p.P109P	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	446					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P446P(2)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGTGTGCTGGCGGCAGAGGGT	0.617																																							uc003jfa.1		NA																	2	Substitution - coding silent(2)		large_intestine(1)|lung(1)	large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(1336-1338)CCG>CCA		catenin (cadherin-associated protein), delta 2							35.0	40.0	38.0					5																	11364842		2203	4300	6503	SO:0001819	synonymous_variant	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11364842C>T	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1338G>A	5.37:g.11364842C>T						CTNND2_uc010itt.2_Silent_p.P355P|CTNND2_uc011cmy.1_Silent_p.P109P|CTNND2_uc011cmz.1_Silent_p.P13P|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Silent_p.P13P	p.P446P	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN			8	1483	-			446					B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	c.1338G>A	CCDS3881.1																																																																																				0.617	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		4	43	0	0	0	0.001168	0	4	43				
IL7R	3575	broad.mit.edu	37	5	35876392	35876392	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:35876392A>T	ENST00000303115.3	+	8	1313	c.1184A>T	c.(1183-1185)aAg>aTg	p.K395M	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	395					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.K395M(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			GAGAGTGGCAAGAATGGGCCT	0.542			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																uc003jjs.2		NA		Dom	yes		5	5p13	146661		interleukin 7 receptor	yes		L					1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)|skin(1)	5						c.(1183-1185)AAG>ATG		interleukin 7 receptor precursor							97.0	86.0	90.0					5																	35876392		2203	4300	6503	SO:0001583	missense	3575				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity	g.chr5:35876392A>T	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.1184A>T	5.37:g.35876392A>T	ENSP00000306157:p.Lys395Met					IL7R_uc011cop.1_RNA	p.K395M	NM_002185	NP_002176	P16871	IL7RA_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)		8	1273	+	all_lung(31;0.00015)		395			Cytoplasmic (Potential).		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	c.1184A>T	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	A	10.14	1.267846	0.23136	.	.	ENSG00000168685	ENST00000303115;ENST00000505875	T;T	0.36340	1.76;1.26	5.6	1.94	0.25998	.	1.208740	0.05553	N	0.567908	T	0.37128	0.0992	L	0.56769	1.78	0.09310	N	0.999999	P	0.37955	0.612	B	0.40101	0.319	T	0.26467	-1.0102	10	0.49607	T	0.09	-9.5514	4.4416	0.11577	0.6608:0.1703:0.169:0.0	.	395	P16871	IL7RA_HUMAN	M	395;161	ENSP00000306157:K395M;ENSP00000420923:K161M	ENSP00000306157:K395M	K	+	2	0	IL7R	35912149	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	0.422000	0.21296	0.092000	0.17331	-0.291000	0.09656	AAG		0.542	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			6	75	0	0	0	0.001984	0	6	75				
C9	735	broad.mit.edu	37	5	39306769	39306769	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:39306769C>T	ENST00000263408.4	-	9	1461	c.1366G>A	c.(1366-1368)Gtc>Atc	p.V456I		NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	456	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)		p.V456I(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			GCCCAGTTGACAAAGTCAGTC	0.363																																							uc003jlv.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1366-1368)GTC>ATC		complement component 9 precursor							149.0	127.0	135.0					5																	39306769		2203	4300	6503	SO:0001583	missense	735				complement activation, alternative pathway|complement activation, classical pathway|cytolysis|hemolysis by symbiont of host erythrocytes	extracellular region|membrane attack complex		g.chr5:39306769C>T		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.1366G>A	5.37:g.39306769C>T	ENSP00000263408:p.Val456Ile						p.V456I	NM_001737	NP_001728	P02748	CO9_HUMAN	Epithelial(62;0.158)		9	1455	-	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	456			MACPF.			Missense_Mutation	SNP	ENST00000263408.4	37	c.1366G>A	CCDS3929.1	.	.	.	.	.	.	.	.	.	.	C	5.867	0.344155	0.11126	.	.	ENSG00000113600	ENST00000263408	D	0.84146	-1.81	4.98	-0.207	0.13189	Membrane attack complex component/perforin (MACPF) domain (3);	0.920162	0.09411	N	0.805745	T	0.74619	0.3740	L	0.28400	0.85	0.09310	N	1	B	0.15141	0.012	B	0.19946	0.027	T	0.59473	-0.7448	10	0.35671	T	0.21	-7.7614	6.4351	0.21819	0.0:0.4604:0.1329:0.4068	.	456	P02748	CO9_HUMAN	I	456	ENSP00000263408:V456I	ENSP00000263408:V456I	V	-	1	0	C9	39342526	0.028000	0.19301	0.008000	0.14137	0.590000	0.36582	0.145000	0.16157	0.029000	0.15352	0.563000	0.77884	GTC		0.363	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211576.3			26	107	0	0	0	0.008361	0	26	107				
PTGER4	5734	broad.mit.edu	37	5	40681206	40681206	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:40681206G>T	ENST00000302472.3	+	2	1135	c.111G>T	c.(109-111)gtG>gtT	p.V37V	PTGER4_ENST00000514343.1_3'UTR	NM_000958.2	NP_000949.1	P35408	PE2R4_HUMAN	prostaglandin E receptor 4 (subtype EP4)	37					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|bone development (GO:0060348)|cellular response to mechanical stimulus (GO:0071260)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|JNK cascade (GO:0007254)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of eosinophil extravasation (GO:2000420)|negative regulation of inflammatory response (GO:0050728)|negative regulation of integrin activation (GO:0033624)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|regulation of ossification (GO:0030278)|regulation of stress fiber assembly (GO:0051492)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|T-helper cell differentiation (GO:0042093)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)	p.V37V(1)		breast(1)|endometrium(3)|liver(1)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23					Dinoprostone(DB00917)|Misoprostol(DB00929)	GCAACCTGGTGGCCATCGTGG	0.622											OREG0016588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003jlz.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)	2						c.(109-111)GTG>GTT		prostaglandin E receptor 4, subtype EP4							63.0	58.0	60.0					5																	40681206		2203	4300	6503	SO:0001819	synonymous_variant	5734				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity	g.chr5:40681206G>T	L28175	CCDS3930.1	5p13.1	2012-08-08			ENSG00000171522	ENSG00000171522		"""GPCR / Class A : Prostanoid receptors"""	9596	protein-coding gene	gene with protein product		601586				7759114, 8661119	Standard	NM_000958		Approved	EP4	uc003jlz.3	P35408	OTTHUMG00000094769	ENST00000302472.3:c.111G>T	5.37:g.40681206G>T			OREG0016588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	895		p.V37V	NM_000958	NP_000949	P35408	PE2R4_HUMAN			2	703	+			37			Helical; Name=1; (Potential).		Q3MJ87	Silent	SNP	ENST00000302472.3	37	c.111G>T	CCDS3930.1																																																																																				0.622	PTGER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211578.2	NM_000958		13	115	1	0	2.23348e-06	0.004007	2.59931e-06	13	115				
ELOVL7	79993	broad.mit.edu	37	5	60067911	60067911	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:60067911A>T	ENST00000508821.1	-	4	388	c.74T>A	c.(73-75)gTt>gAt	p.V25D	ELOVL7_ENST00000425382.1_Missense_Mutation_p.V25D|ELOVL7_ENST00000438340.1_Missense_Mutation_p.V25D|ELOVL7_ENST00000505959.1_Missense_Mutation_p.V12D	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	25					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.V25D(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				CCAATCTTCAACTCTTGGATC	0.438																																							uc003jsi.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(73-75)GTT>GAT		elongation of very long chain fatty acids-like							44.0	41.0	42.0					5																	60067911		2203	4300	6503	SO:0001583	missense	79993				fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding	g.chr5:60067911A>T	AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.74T>A	5.37:g.60067911A>T	ENSP00000424123:p.Val25Asp					ELOVL7_uc011cqo.1_Translation_Start_Site|ELOVL7_uc010iwk.2_Missense_Mutation_p.V25D|ELOVL7_uc003jsj.3_Missense_Mutation_p.V12D	p.V25D	NM_024930	NP_079206	A1L3X0	ELOV7_HUMAN			4	274	-		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)	25					Q589T3|Q9H5D0|Q9NT66	Missense_Mutation	SNP	ENST00000508821.1	37	c.74T>A	CCDS34164.1	.	.	.	.	.	.	.	.	.	.	A	18.71	3.682619	0.68157	.	.	ENSG00000164181	ENST00000508821;ENST00000438340;ENST00000425382;ENST00000505959;ENST00000507047;ENST00000511799	T;T;T;T	0.25579	1.81;1.81;1.81;1.79	5.73	5.73	0.89815	.	0.180521	0.48767	D	0.000164	T	0.56171	0.1967	M	0.92923	3.36	0.58432	D	0.999993	P;P	0.52692	0.955;0.913	P;P	0.55871	0.726;0.786	T	0.68085	-0.5502	10	0.87932	D	0	-16.2199	16.3143	0.82909	1.0:0.0:0.0:0.0	.	12;25	D6RHD0;A1L3X0	.;ELOV7_HUMAN	D	25;25;25;12;25;25	ENSP00000424123:V25D;ENSP00000411255:V25D;ENSP00000402634:V25D;ENSP00000421043:V12D	ENSP00000402634:V25D	V	-	2	0	ELOVL7	60103668	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.782000	0.62396	2.313000	0.78055	0.454000	0.30748	GTT		0.438	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368195.1			6	22	0	0	0	0.00308	0	6	22				
CD180	4064	broad.mit.edu	37	5	66492422	66492422	+	Silent	SNP	G	G	T	rs146337741		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:66492422G>T	ENST00000256447.4	-	1	205	c.48C>A	c.(46-48)gcC>gcA	p.A16A		NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	16					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A16A(1)		cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		CTTTACAGCCGGCAGAAAACA	0.448																																							uc003juy.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(46-48)GCC>GCA		CD180 molecule precursor		G		1,4405	2.1+/-5.4	0,1,2202	172.0	174.0	173.0		48	-1.0	0.0	5	dbSNP_134	173	0,8600		0,0,4300	no	coding-synonymous	CD180	NM_005582.2		0,1,6502	TT,TG,GG		0.0,0.0227,0.0077		16/662	66492422	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4064				inflammatory response|innate immune response	integral to membrane|plasma membrane	receptor activity	g.chr5:66492422G>T	D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.48C>A	5.37:g.66492422G>T							p.A16A	NM_005582	NP_005573	Q99467	CD180_HUMAN		Lung(70;0.0046)	1	196	-		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)	16					B2R7Z7|Q32MM5	Silent	SNP	ENST00000256447.4	37	c.48C>A	CCDS3992.1																																																																																				0.448	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253973.2	NM_005582		108	59	1	0	1.37938e-74	0.01441	2.76558e-74	108	59				
CENPH	64946	broad.mit.edu	37	5	68491566	68491566	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:68491566G>C	ENST00000283006.2	+	4	349	c.262G>C	c.(262-264)Gaa>Caa	p.E88Q	CENPH_ENST00000515001.1_Missense_Mutation_p.E88Q	NM_022909.3	NP_075060.1			centromere protein H									p.E88Q(1)		kidney(15)|large_intestine(2)|lung(3)	20		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)		CCTGGAAAATGAAATTGAAGA	0.274																																							uc003jvp.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)	1						c.(262-264)GAA>CAA		centromere protein H							34.0	35.0	35.0					5																	68491566		2197	4296	6493	SO:0001583	missense	64946				cell division|CenH3-containing nucleosome assembly at centromere|chromosome segregation|kinetochore organization|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm	kinetochore binding|protein binding	g.chr5:68491566G>C	AB035124	CCDS3998.1	5p15.2	2013-11-05			ENSG00000153044	ENSG00000153044			17268	protein-coding gene	gene with protein product		605607				11092768, 15502821	Standard	NM_022909		Approved		uc003jvp.3	Q9H3R5	OTTHUMG00000097816	ENST00000283006.2:c.262G>C	5.37:g.68491566G>C	ENSP00000283006:p.Glu88Gln					CENPH_uc010ixc.2_Missense_Mutation_p.E88Q	p.E88Q	NM_022909	NP_075060	Q9H3R5	CENPH_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)	4	349	+		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)	88			Potential.			Missense_Mutation	SNP	ENST00000283006.2	37	c.262G>C	CCDS3998.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046797	0.75846	.	.	ENSG00000153044	ENST00000283006;ENST00000515001	T;T	0.60920	0.15;0.15	4.72	4.72	0.59763	.	0.091055	0.48286	D	0.000199	T	0.62998	0.2474	L	0.29908	0.895	0.40348	D	0.979107	D;D	0.76494	0.997;0.999	P;D	0.66084	0.888;0.941	T	0.65969	-0.6039	10	0.87932	D	0	-31.6469	13.5031	0.61469	0.0:0.0:1.0:0.0	.	88;88	B3KVZ3;Q9H3R5	.;CENPH_HUMAN	Q	88	ENSP00000283006:E88Q;ENSP00000426014:E88Q	ENSP00000283006:E88Q	E	+	1	0	CENPH	68527322	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	4.225000	0.58600	2.906000	0.99361	0.655000	0.94253	GAA		0.274	CENPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215083.1			14	18	0	0	0	0.004007	0	14	18				
IQGAP2	10788	broad.mit.edu	37	5	75950817	75950817	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:75950817A>G	ENST00000274364.6	+	20	2606	c.2309A>G	c.(2308-2310)tAc>tGc	p.Y770C	IQGAP2_ENST00000396234.3_Missense_Mutation_p.Y266C|IQGAP2_ENST00000379730.3_Missense_Mutation_p.Y272C|IQGAP2_ENST00000502745.1_Missense_Mutation_p.Y266C	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	770	IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.Y770C(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AGAGATGACTACAAAACATTG	0.393																																							uc003kek.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(1)	7						c.(2308-2310)TAC>TGC		IQ motif containing GTPase activating protein 2							87.0	89.0	88.0					5																	75950817		2203	4300	6503	SO:0001583	missense	10788				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity	g.chr5:75950817A>G	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.2309A>G	5.37:g.75950817A>G	ENSP00000274364:p.Tyr770Cys					IQGAP2_uc010izv.2_Missense_Mutation_p.Y323C|IQGAP2_uc011csv.1_Missense_Mutation_p.Y266C|IQGAP2_uc003kel.2_Missense_Mutation_p.Y266C	p.Y770C	NM_006633	NP_006624	Q13576	IQGA2_HUMAN		all cancers(79;1.38e-36)	20	2531	+		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)	770			IQ 3.		A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	c.2309A>G	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.349456	0.82132	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000514350;ENST00000505766;ENST00000514001;ENST00000396234;ENST00000545384;ENST00000502745	T;T;T;T;T;T;T	0.73575	3.64;-0.76;3.19;3.55;3.03;-0.76;-0.76	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.87637	0.6227	M	0.85630	2.765	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.89508	0.3769	10	0.87932	D	0	-18.0582	16.0147	0.80427	1.0:0.0:0.0:0.0	.	272;720;266;770	F5H7S7;E7EWC2;Q13576-2;Q13576	.;.;.;IQGA2_HUMAN	C	770;272;743;720;323;266;323;266	ENSP00000274364:Y770C;ENSP00000442313:Y272C;ENSP00000423672:Y743C;ENSP00000421097:Y720C;ENSP00000422661:Y323C;ENSP00000379535:Y266C;ENSP00000426027:Y266C	ENSP00000274364:Y770C	Y	+	2	0	IQGAP2	75986573	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.268000	0.95675	2.311000	0.77944	0.528000	0.53228	TAC		0.393	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		47	22	0	0	0	0.01441	0	47	22				
TTC37	9652	broad.mit.edu	37	5	94876421	94876421	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:94876421C>G	ENST00000358746.2	-	8	814	c.516G>C	c.(514-516)gaG>gaC	p.E172D		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	172						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.E172D(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TATTCTGGTCCTCTGTACTTT	0.353																																							uc003klb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)	4						c.(514-516)GAG>GAC		tetratricopeptide repeat domain 37							169.0	163.0	165.0					5																	94876421		2203	4300	6503	SO:0001583	missense	9652						binding	g.chr5:94876421C>G	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.516G>C	5.37:g.94876421C>G	ENSP00000351596:p.Glu172Asp					TTC37_uc010jbf.1_Missense_Mutation_p.E124D	p.E172D	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN			8	786	-			172					O15077|Q6PJI3	Missense_Mutation	SNP	ENST00000358746.2	37	c.516G>C	CCDS4072.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.631096	0.28978	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.77620	-1.11;-0.14	5.63	0.151	0.14888	.	0.378417	0.29266	N	0.012656	T	0.62441	0.2428	L	0.41710	1.295	0.09310	N	1	B;B	0.17268	0.021;0.007	B;B	0.12156	0.007;0.004	T	0.44711	-0.9310	10	0.23302	T	0.38	.	6.649	0.22951	0.1153:0.4567:0.0:0.428	.	124;172	D6RCE2;Q6PGP7	.;TTC37_HUMAN	D	172;124	ENSP00000351596:E172D;ENSP00000423742:E124D	ENSP00000351596:E172D	E	-	3	2	TTC37	94902177	0.000000	0.05858	0.296000	0.24974	0.152000	0.21847	-0.669000	0.05262	0.060000	0.16281	-0.145000	0.13849	GAG		0.353	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639		33	37	0	0	0	0.013726	0	33	37				
MCC	4163	broad.mit.edu	37	5	112720711	112720711	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:112720711C>A	ENST00000408903.3	-	2	784	c.369G>T	c.(367-369)ctG>ctT	p.L123L	CTD-2201G3.1_ENST00000416046.2_RNA	NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.L123L(1)		endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TTCTATCCCTCAGCTTCTTTG	0.478																																							uc003kql.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(367-369)CTG>CTT		mutated in colorectal cancers isoform 1							145.0	140.0	142.0					5																	112720711		1912	4135	6047	SO:0001819	synonymous_variant	4163				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity	g.chr5:112720711C>A		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.369G>T	5.37:g.112720711C>A						MCC_uc003kqk.3_RNA	p.L123L	NM_001085377	NP_001078846	P23508	CRCM_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)	2	785	-		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)	Error:Variant_position_missing_in_P23508_after_alignment					D3DT05|Q6ZR04	Silent	SNP	ENST00000408903.3	37	c.369G>T	CCDS43351.1																																																																																				0.478	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377		33	28	1	0	4.74835e-14	0.010818	6.94254e-14	33	28				
COMMD10	51397	broad.mit.edu	37	5	115469791	115469791	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:115469791C>A	ENST00000274458.4	+	5	488	c.426C>A	c.(424-426)aaC>aaA	p.N142K	COMMD10_ENST00000515539.1_Missense_Mutation_p.N128K	NM_016144.2	NP_057228.1	Q9Y6G5	COMDA_HUMAN	COMM domain containing 10	142	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.							p.N142K(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(2)	9		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)		GGCAGCTTAACCTTCAGATGG	0.413																																							uc003krt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(424-426)AAC>AAA		COMM domain containing 10							122.0	101.0	108.0					5																	115469791		2202	4300	6502	SO:0001583	missense	51397						protein binding	g.chr5:115469791C>A	AY542165	CCDS34215.1	5q23.1	2008-02-05				ENSG00000145781			30201	protein-coding gene	gene with protein product						15799966	Standard	NM_016144		Approved	PTD002	uc003krt.1	Q9Y6G5		ENST00000274458.4:c.426C>A	5.37:g.115469791C>A	ENSP00000274458:p.Asn142Lys						p.N142K	NM_016144	NP_057228	Q9Y6G5	COMDA_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)	5	449	+		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)	142			COMM.		D3DT07|Q9P077	Missense_Mutation	SNP	ENST00000274458.4	37	c.426C>A	CCDS34215.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933678	0.73442	.	.	ENSG00000145781	ENST00000274458;ENST00000515539	T;T	0.10005	2.92;2.92	6.02	5.16	0.70880	COMM domain (1);	0.000000	0.85682	D	0.000000	T	0.34250	0.0891	M	0.83953	2.67	0.50313	D	0.999868	D	0.71674	0.998	D	0.70935	0.971	T	0.16808	-1.0390	10	0.72032	D	0.01	-31.7792	12.1925	0.54278	0.0:0.86:0.0:0.14	.	142	Q9Y6G5	COMDA_HUMAN	K	142;128	ENSP00000274458:N142K;ENSP00000427319:N128K	ENSP00000274458:N142K	N	+	3	2	COMMD10	115497690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.456000	0.44997	1.554000	0.49487	0.650000	0.86243	AAC		0.413	COMMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371033.1	NM_016144		7	18	1	0	5.18039e-06	0.00308	5.99445e-06	7	18				
ADAMTS19	171019	broad.mit.edu	37	5	128994400	128994400	+	Nonsense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:128994400A>T	ENST00000274487.4	+	15	2522	c.2377A>T	c.(2377-2379)Aaa>Taa	p.K793*	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	793	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.K793*(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CAAGATCATTAAAGGGGATTT	0.343																																							uc003kvb.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(5)|breast(2)|lung(1)|skin(1)	9						c.(2377-2379)AAA>TAA		ADAM metallopeptidase with thrombospondin type 1							146.0	146.0	146.0					5																	128994400		2203	4300	6503	SO:0001587	stop_gained	171019				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:128994400A>T	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2377A>T	5.37:g.128994400A>T	ENSP00000274487:p.Lys793*					ADAMTS19_uc010jdh.1_RNA	p.K793*	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)	15	2377	+		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	793			Spacer.			Nonsense_Mutation	SNP	ENST00000274487.4	37	c.2377A>T	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	A	40	8.167331	0.98686	.	.	ENSG00000145808	ENST00000274487	.	.	.	3.79	3.79	0.43588	.	0.144852	0.45361	D	0.000375	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5855	0.61928	1.0:0.0:0.0:0.0	.	.	.	.	X	793	.	.	K	+	1	0	ADAMTS19	129022299	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.008000	0.88588	1.950000	0.56595	0.477000	0.44152	AAA		0.343	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638		40	74	0	0	0	0.00623	0	40	74				
PCDHGA1	56114	broad.mit.edu	37	5	140711144	140711144	+	Missense_Mutation	SNP	C	C	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:140711144C>G	ENST00000517417.1	+	1	893	c.893C>G	c.(892-894)aCa>aGa	p.T298R	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.T298R	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	298	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T298R(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATTCTTACACAGGAGAAATA	0.423																																							uc003lji.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|pancreas(1)	3						c.(892-894)ACA>AGA		protocadherin gamma subfamily A, 1 isoform 1							57.0	58.0	58.0					5																	140711144		2203	4300	6503	SO:0001583	missense	56114				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140711144C>G	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.893C>G	5.37:g.140711144C>G	ENSP00000431083:p.Thr298Arg					PCDHGA1_uc011dan.1_Missense_Mutation_p.T298R	p.T298R	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	893	+			298			Cadherin 3.|Extracellular (Potential).		Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	c.893C>G	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.391206	0.42410	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.01767	4.65;4.65	4.19	3.31	0.37934	Cadherin (4);Cadherin-like (1);	0.145778	0.31797	N	0.007049	T	0.11580	0.0282	M	0.93197	3.39	0.21473	N	0.999678	P;D	0.53745	0.818;0.962	P;P	0.62885	0.721;0.908	T	0.03630	-1.1018	10	0.87932	D	0	.	9.045	0.36341	0.1526:0.5503:0.2971:0.0	.	298;298	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	R	298	ENSP00000431083:T298R;ENSP00000367345:T298R	ENSP00000367345:T298R	T	+	2	0	PCDHGA1	140691328	0.000000	0.05858	0.965000	0.40720	0.928000	0.56348	-0.023000	0.12456	1.104000	0.41587	0.650000	0.86243	ACA		0.423	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912		4	47	0	0	0	0.009096	0	4	47				
PCDHGA2	56113	broad.mit.edu	37	5	140720142	140720142	+	Missense_Mutation	SNP	G	G	T	rs116787237	byFrequency	TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:140720142G>T	ENST00000394576.2	+	1	1604	c.1604G>T	c.(1603-1605)cGg>cTg	p.R535L	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	535	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R535L(2)|p.R535Q(2)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGATAGCGCGGGACAGCGGG	0.537																																							uc003ljk.1		NA																	4	Substitution - Missense(4)		lung(2)|endometrium(2)	skin(2)|ovary(1)	3						c.(1603-1605)CGG>CTG		protocadherin gamma subfamily A, 2 isoform 1							159.0	157.0	158.0					5																	140720142		2203	4300	6503	SO:0001583	missense	56113				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140720142G>T	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1604G>T	5.37:g.140720142G>T	ENSP00000378077:p.Arg535Leu					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.R535L	p.R535L	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1789	+			535			Extracellular (Potential).|Cadherin 5.		Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	c.1604G>T	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	6.051	0.377798	0.11466	.	.	ENSG00000081853	ENST00000394576	T	0.01665	4.7	5.21	-4.4	0.03600	Cadherin (5);Cadherin-like (1);	2.917390	0.02195	U	0.061757	T	0.02929	0.0087	M	0.69358	2.11	0.09310	N	1	B;B	0.13145	0.005;0.007	B;B	0.19666	0.009;0.026	T	0.45585	-0.9251	10	0.72032	D	0.01	.	4.1097	0.10053	0.5619:0.0929:0.2215:0.1236	.	535;535	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	L	535	ENSP00000378077:R535L	ENSP00000378077:R535L	R	+	2	0	PCDHGA2	140700326	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.704000	0.00822	-1.160000	0.02804	0.591000	0.81541	CGG		0.537	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915		37	48	1	0	8.69298e-16	0.006999	1.30395e-15	37	48				
PCDHGA3	56112	broad.mit.edu	37	5	140724495	140724495	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:140724495G>A	ENST00000253812.6	+	1	895	c.895G>A	c.(895-897)Gga>Aga	p.G299R	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	299	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G299R(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAGTGAGTGGAGAAGTATC	0.388																																							uc003ljm.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(895-897)GGA>AGA		protocadherin gamma subfamily A, 3 isoform 1							36.0	37.0	37.0					5																	140724495		1882	4121	6003	SO:0001583	missense	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140724495G>A	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.895G>A	5.37:g.140724495G>A	ENSP00000253812:p.Gly299Arg					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Missense_Mutation_p.G59R|PCDHGA3_uc011dap.1_Missense_Mutation_p.G299R	p.G299R	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	895	+			299			Cadherin 3.|Extracellular (Potential).		Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	c.895G>A	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	15.81	2.943898	0.53079	.	.	ENSG00000254245	ENST00000253812	T	0.04502	3.61	5.41	5.41	0.78517	Cadherin (4);Cadherin-like (1);	0.000000	0.32488	U	0.006035	T	0.45196	0.1330	H	0.99820	4.81	0.45097	D	0.99811	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.72450	-0.4290	10	0.87932	D	0	.	19.1813	0.93625	0.0:0.0:1.0:0.0	.	299;299	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	R	299	ENSP00000253812:G299R	ENSP00000253812:G299R	G	+	1	0	PCDHGA3	140704679	1.000000	0.71417	1.000000	0.80357	0.225000	0.24961	9.695000	0.98691	2.709000	0.92574	0.655000	0.94253	GGA		0.388	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		16	11	0	0	0	0.004007	0	16	11				
SLC36A2	153201	broad.mit.edu	37	5	150696494	150696494	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:150696494G>T	ENST00000335244.4	-	10	1465	c.1336C>A	c.(1336-1338)Ctg>Atg	p.L446M	SLC36A2_ENST00000450886.1_Missense_Mutation_p.L170M	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	446					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)	p.L446M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	ATGCTGATCAGGGCGTCCTTG	0.612																																							uc003lty.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1336-1338)CTG>ATG		solute carrier family 36, member 2							79.0	70.0	73.0					5																	150696494		2203	4300	6503	SO:0001583	missense	153201				cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity	g.chr5:150696494G>T	AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.1336C>A	5.37:g.150696494G>T	ENSP00000334223:p.Leu446Met					GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_Missense_Mutation_p.L248M	p.L446M	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		10	1466	-		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	446			Helical; (Potential).		Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	ENST00000335244.4	37	c.1336C>A	CCDS4315.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432384	0.25813	.	.	ENSG00000186335	ENST00000335244;ENST00000450886	T;T	0.02525	4.26;4.26	4.92	3.08	0.35506	.	0.403425	0.24561	N	0.037476	T	0.04003	0.0112	M	0.61703	1.905	0.24266	N	0.995264	B	0.13145	0.007	B	0.26969	0.075	T	0.36311	-0.9753	10	0.31617	T	0.26	-9.9603	5.5599	0.17137	0.1476:0.0:0.5714:0.281	.	446	Q495M3	S36A2_HUMAN	M	446;170	ENSP00000334223:L446M;ENSP00000399479:L170M	ENSP00000334223:L446M	L	-	1	2	SLC36A2	150676687	0.029000	0.19370	0.928000	0.36995	0.989000	0.77384	-0.327000	0.07955	0.743000	0.32719	0.650000	0.86243	CTG		0.612	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252437.1			18	9	1	0	2.35188e-11	0.006122	3.19635e-11	18	9				
ITK	3702	broad.mit.edu	37	5	156668716	156668716	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:156668716C>A	ENST00000422843.3	+	11	1198	c.1046C>A	c.(1045-1047)gCa>gAa	p.A349E	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	349					activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.A349E(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CCAGTTACAGCAGGGCTGAGA	0.498			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	Esophageal Squamous(70;1378 1469 8785 19883)	uc003lwo.1		NA		Dom	yes		5	5q31-q32	3702	T	IL2-inducible T-cell kinase			L	SYK		peripheral T-cell lymphoma		1	Substitution - Missense(1)	p.A349S(1)	lung(1)	lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26						c.(1045-1047)GCA>GAA		IL2-inducible T-cell kinase							79.0	67.0	71.0					5																	156668716		2203	4300	6503	SO:0001583	missense	3702				cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr5:156668716C>A	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1046C>A	5.37:g.156668716C>A	ENSP00000398655:p.Ala349Glu						p.A349E	NM_005546	NP_005537	Q08881	ITK_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		11	1128	+	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	349					B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	c.1046C>A	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596741	0.46318	.	.	ENSG00000113263	ENST00000422843	T	0.75260	-0.92	6.08	6.08	0.98989	Protein kinase-like domain (1);	0.219510	0.47455	D	0.000238	T	0.78660	0.4318	M	0.79805	2.47	0.58432	D	0.999993	B	0.23650	0.089	B	0.22601	0.04	T	0.75485	-0.3301	10	0.72032	D	0.01	.	19.6516	0.95815	0.0:1.0:0.0:0.0	.	349	Q08881	ITK_HUMAN	E	349	ENSP00000398655:A349E	ENSP00000398655:A349E	A	+	2	0	ITK	156601294	1.000000	0.71417	0.995000	0.50966	0.071000	0.16799	6.475000	0.73582	2.894000	0.99253	0.655000	0.94253	GCA		0.498	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			18	14	1	0	6.94344e-10	0.006122	8.89903e-10	18	14				
STK10	6793	broad.mit.edu	37	5	171533719	171533719	+	Silent	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr5:171533719G>C	ENST00000176763.5	-	6	1036	c.693C>G	c.(691-693)gcC>gcG	p.A231A		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	231	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.A231A(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCTCGATCTGGGCCATCTCAA	0.607											OREG0017039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003mbo.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8						c.(691-693)GCC>GCG		serine/threonine kinase 10							111.0	101.0	104.0					5																	171533719		2203	4300	6503	SO:0001819	synonymous_variant	6793						ATP binding|protein serine/threonine kinase activity	g.chr5:171533719G>C	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.693C>G	5.37:g.171533719G>C			OREG0017039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1893		p.A231A	NM_005990	NP_005981	O94804	STK10_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		6	993	-	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	231			Protein kinase.		A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	ENST00000176763.5	37	c.693C>G	CCDS34290.1																																																																																				0.607	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990		9	38	0	0	0	0.006214	0	9	38				
GFOD1	54438	broad.mit.edu	37	6	13470384	13470384	+	Intron	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:13470384G>C	ENST00000379287.3	-	1	918				AL583828.1_ENST00000558378.1_Missense_Mutation_p.I43M|GFOD1_ENST00000603223.1_3'UTR|GFOD1_ENST00000379278.3_5'UTR	NM_018988.3	NP_061861.1	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain containing 1							extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)	p.I43M(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)	18	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			TGTAGCCAGTGATGTCCCACT	0.483																																							uc003nav.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(127-129)ATC>ATG		hypothetical protein LOC85411							65.0	59.0	61.0					6																	13470384		2203	4300	6503	SO:0001627	intron_variant	85411							g.chr6:13470384G>C	AK000337	CCDS4524.1, CCDS56397.1, CCDS64351.1	6p24.1-p23	2013-09-19			ENSG00000145990	ENSG00000145990			21096	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 114"""	C6orf114			Standard	NM_018988		Approved	FLJ20330, ADG-90	uc003nat.2	Q9NXC2	OTTHUMG00000014276	ENST00000379287.3:c.253+16485C>G	6.37:g.13470384G>C						GFOD1_uc003nas.1_Intron|GFOD1_uc003nat.1_Intron|C6orf114_uc003nau.2_RNA	p.I43M	NM_033069	NP_149060			Epithelial(50;0.0504)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.147)		2	652	-	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)						A8E4L6|Q5T058|Q96JD4|Q9H5K2	Missense_Mutation	SNP	ENST00000379287.3	37	c.129C>G	CCDS4524.1	.	.	.	.	.	.	.	.	.	.	G	9.975	1.226582	0.22542	.	.	ENSG00000187461	ENST00000379278	.	.	.	4.03	3.08	0.35506	.	.	.	.	.	T	0.13543	0.0328	.	.	.	0.09310	N	0.999994	P	0.36048	0.534	B	0.33196	0.159	T	0.08806	-1.0704	7	0.87932	D	0	.	8.3941	0.32546	0.0:0.0:0.7665:0.2335	.	43	Q9NXC2-3	.	M	43	.	ENSP00000368580:I43M	I	-	3	3	AL583828.1	13578363	0.000000	0.05858	0.014000	0.15608	0.006000	0.05464	0.040000	0.13905	2.243000	0.73865	0.561000	0.74099	ATC		0.483	GFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039902.1	NM_018988		15	40	0	0	0	0.00499	0	15	40				
DHX16	8449	broad.mit.edu	37	6	30633333	30633333	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:30633333C>A	ENST00000376442.3	-	5	1039	c.844G>T	c.(844-846)Gag>Tag	p.E282*		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	282					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.E282*(1)		kidney(2)|ovary(2)	4						GCCCGGTACTCCCGGGCGAGA	0.627																																							uc003nqz.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(2)|kidney(2)	4						c.(844-846)GAG>TAG		DEAH (Asp-Glu-Ala-His) box polypeptide 16							77.0	72.0	74.0					6																	30633333		1509	2709	4218	SO:0001587	stop_gained	8449				mRNA processing|RNA splicing	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity	g.chr6:30633333C>A	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.844G>T	6.37:g.30633333C>A	ENSP00000365625:p.Glu282*					DHX16_uc011dmo.1_Nonsense_Mutation_p.E222*	p.E282*	NM_003587	NP_003578	O60231	DHX16_HUMAN			5	1056	-			282					O60322|Q5JP45|Q969X7|Q96QC1	Nonsense_Mutation	SNP	ENST00000376442.3	37	c.844G>T	CCDS4685.1	.	.	.	.	.	.	.	.	.	.	c	31	5.065871	0.93898	.	.	ENSG00000204560	ENST00000376442;ENST00000415603	.	.	.	5.65	4.73	0.59995	.	0.214672	0.47093	D	0.000242	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	10.6791	0.45804	0.1456:0.7132:0.1412:0.0	.	.	.	.	X	282;222	.	ENSP00000365625:E282X	E	-	1	0	DHX16	30741312	0.999000	0.42202	0.999000	0.59377	0.987000	0.75469	2.422000	0.44696	2.652000	0.90054	0.586000	0.80456	GAG		0.627	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587		32	41	1	0	2.46105e-21	0.010818	4.10175e-21	32	41				
VARS	7407	broad.mit.edu	37	6	31749539	31749539	+	Splice_Site	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:31749539C>A	ENST00000375663.3	-	20	2788		c.e20-1		VARS_ENST00000482996.1_Splice_Site|Y_RNA_ENST00000364685.1_RNA|VARS_ENST00000444930.2_Splice_Site	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase						gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.?(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	ACATCCTCATCTGAGAGAGGC	0.602																																							uc003nxe.2		NA																	1	Unknown(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.e20-1		valyl-tRNA synthetase	L-Valine(DB00161)						81.0	81.0	81.0					6																	31749539		1511	2709	4220	SO:0001630	splice_region_variant	7407				translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity	g.chr6:31749539C>A	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.2348-1G>T	6.37:g.31749539C>A						VARS_uc003nxf.1_5'Flank|VARS_uc011doi.1_Intron	p.D783_splice	NM_006295	NP_006286	P26640	SYVC_HUMAN			20	2771	-								B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Splice_Site	SNP	ENST00000375663.3	37	c.2348_splice	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.407059	0.62399	.	.	ENSG00000204394	ENST00000375663;ENST00000428445	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2093	0.86926	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VARS	31857518	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.103000	0.77014	2.664000	0.90586	0.655000	0.94253	.		0.602	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	Intron	39	69	1	0	1.30998e-17	0.005524	2.08056e-17	39	69				
DNAH8	1769	broad.mit.edu	37	6	38891908	38891908	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:38891908T>G	ENST00000359357.3	+	71	10535	c.10281T>G	c.(10279-10281)aaT>aaG	p.N3427K	DNAH8_ENST00000449981.2_Missense_Mutation_p.N3644K|RP1-207H1.3_ENST00000418399.1_RNA|RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000441566.1_Missense_Mutation_p.N3391K			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3427					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.N3427K(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AAAACCTGAATCTTATTTCAA	0.353																																							uc003ooe.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(10279-10281)AAT>AAG		dynein, axonemal, heavy polypeptide 8							102.0	114.0	109.0					6																	38891908		2203	4300	6503	SO:0001583	missense	1769							g.chr6:38891908T>G	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.10281T>G	6.37:g.38891908T>G	ENSP00000352312:p.Asn3427Lys					uc003oof.1_Intron	p.N3427K	NM_001371	NP_001362					71	10881	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37	c.10281T>G		.	.	.	.	.	.	.	.	.	.	T	21.1	4.091826	0.76756	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.24538	1.87;1.86;1.85	6.06	2.25	0.28309	.	0.046204	0.85682	D	0.000000	T	0.29524	0.0736	M	0.69463	2.115	0.53688	D	0.999975	D	0.62365	0.991	D	0.64595	0.927	T	0.04796	-1.0926	10	0.51188	T	0.08	.	8.6679	0.34132	0.0:0.3513:0.0:0.6487	.	3427	Q96JB1	DYH8_HUMAN	K	3632;3632;3427;3391	ENSP00000333363:N3632K;ENSP00000352312:N3427K;ENSP00000402294:N3391K	ENSP00000333363:N3632K	N	+	3	2	DNAH8	38999886	0.985000	0.35326	1.000000	0.80357	0.992000	0.81027	0.284000	0.18864	0.477000	0.27464	-0.408000	0.06270	AAT		0.353	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		30	70	0	0	0	0.008361	0	30	70				
DAAM2	23500	broad.mit.edu	37	6	39835296	39835296	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:39835296C>T	ENST00000398904.2	+	6	621	c.439C>T	c.(439-441)Cgc>Tgc	p.R147C	DAAM2_ENST00000538976.1_Missense_Mutation_p.R147C|DAAM2_ENST00000274867.4_Missense_Mutation_p.R147C|DAAM2_ENST00000494405.1_3'UTR			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	147	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)			p.R147C(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GTTTGTGACCCGCTTCATTGA	0.478																																							uc003oow.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(439-441)CGC>TGC		dishevelled associated activator of							105.0	107.0	106.0					6																	39835296		2060	4197	6257	SO:0001583	missense	23500				actin cytoskeleton organization		actin binding|Rho GTPase binding	g.chr6:39835296C>T	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.439C>T	6.37:g.39835296C>T	ENSP00000381876:p.Arg147Cys					DAAM2_uc010jxc.2_Missense_Mutation_p.R147C|DAAM2_uc003oox.2_Missense_Mutation_p.R147C	p.R147C	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN			6	595	+	Ovarian(28;0.0355)|Colorectal(47;0.196)		147			GBD/FH3.		G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	37	c.439C>T	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098323	0.76870	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	D;D;D	0.87809	-2.3;-2.3;-2.3	5.43	5.43	0.79202	GTPase-binding/formin homology 3 (1);Armadillo-like helical (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.000000	0.85682	D	0.000000	D	0.92535	0.7629	M	0.85542	2.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.93379	0.6742	10	0.87932	D	0	.	12.204	0.54342	0.2836:0.7164:0.0:0.0	.	147;147	G5EA45;Q86T65	.;DAAM2_HUMAN	C	147	ENSP00000274867:R147C;ENSP00000381876:R147C;ENSP00000437808:R147C	ENSP00000274867:R147C	R	+	1	0	DAAM2	39943274	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.041000	0.57339	2.540000	0.85666	0.561000	0.74099	CGC		0.478	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1			5	112	0	0	0	0.000602	0	5	112				
TRERF1	55809	broad.mit.edu	37	6	42236542	42236542	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:42236542G>T	ENST00000372922.4	-	5	1349	c.787C>A	c.(787-789)Cag>Aag	p.Q263K	TRERF1_ENST00000354325.2_Missense_Mutation_p.Q263K|TRERF1_ENST00000541110.1_Missense_Mutation_p.Q263K|TRERF1_ENST00000372917.4_Missense_Mutation_p.Q263K|TRERF1_ENST00000340840.2_Missense_Mutation_p.Q263K	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	263	Gln-rich.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Q263K(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGCTGCATCTGTTGCATGTGC	0.567																																							uc003osd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|pancreas(1)|skin(1)	5						c.(787-789)CAG>AAG		transcriptional regulating factor 1							67.0	61.0	63.0					6																	42236542		2203	4300	6503	SO:0001583	missense	55809				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding	g.chr6:42236542G>T	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.787C>A	6.37:g.42236542G>T	ENSP00000362013:p.Gln263Lys					TRERF1_uc011duq.1_Missense_Mutation_p.Q263K|TRERF1_uc003osb.2_Missense_Mutation_p.Q102K|TRERF1_uc003osc.2_Missense_Mutation_p.Q102K|TRERF1_uc003ose.2_Missense_Mutation_p.Q263K	p.Q263K	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)		5	1350	-	Colorectal(47;0.196)		263			Gln-rich.		Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	c.787C>A	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.379710	0.42207	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.13307	2.79;2.6;2.78;2.6;2.61	5.4	5.4	0.78164	.	0.590445	0.15300	N	0.269700	T	0.06416	0.0165	L	0.27053	0.805	0.34668	D	0.72336	B;B;B;B;B	0.26258	0.145;0.09;0.09;0.145;0.145	B;B;B;B;B	0.26864	0.074;0.034;0.034;0.074;0.074	T	0.20009	-1.0288	10	0.45353	T	0.12	-9.0799	18.1699	0.89742	0.0:0.0:1.0:0.0	.	263;263;263;102;102	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	K	263	ENSP00000439689:Q263K;ENSP00000362008:Q263K;ENSP00000362013:Q263K;ENSP00000339438:Q263K;ENSP00000346285:Q263K	ENSP00000339438:Q263K	Q	-	1	0	TRERF1	42344520	1.000000	0.71417	0.905000	0.35620	0.992000	0.81027	5.048000	0.64238	2.526000	0.85167	0.561000	0.74099	CAG		0.567	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502		23	100	1	0	1.22574e-08	0.014323	1.51812e-08	23	100				
CRIP3	401262	broad.mit.edu	37	6	43276112	43276112	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:43276112G>C	ENST00000274990.4	-	2	83	c.79C>G	c.(79-81)Cgc>Ggc	p.R27G	ZNF318_ENST00000607252.1_5'UTR|CRIP3_ENST00000372569.3_Missense_Mutation_p.R27G			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	27	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.R27G(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			AGGCAGAAGCGGTGCCAGTTC	0.607																																							uc010jyn.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(79-81)CGC>GGC		cysteine-rich protein 3							60.0	53.0	55.0					6																	43276112		2203	4300	6503	SO:0001583	missense	401262					cytoplasm	zinc ion binding	g.chr6:43276112G>C	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.79C>G	6.37:g.43276112G>C	ENSP00000274990:p.Arg27Gly					CRIP3_uc003ouu.1_Missense_Mutation_p.R27G	p.R27G	NM_206922	NP_996805	Q6Q6R5	CRIP3_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		2	79	-			27			LIM zinc-binding 1.		A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	ENST00000274990.4	37	c.79C>G		.	.	.	.	.	.	.	.	.	.	G	24.0	4.477311	0.84640	.	.	ENSG00000146215	ENST00000372569;ENST00000274990	T;T	0.49432	0.78;0.78	5.03	5.03	0.67393	Zinc finger, LIM-type (5);	0.156705	0.42053	D	0.000780	T	0.43942	0.1270	M	0.76170	2.325	0.49915	D	0.999832	P;P	0.39480	0.549;0.675	B;B	0.41174	0.349;0.222	T	0.54774	-0.8243	10	0.87932	D	0	-18.348	15.8946	0.79325	0.0:0.0:1.0:0.0	.	27;27	Q6Q6R5;Q6Q6R5-3	CRIP3_HUMAN;.	G	27	ENSP00000361650:R27G;ENSP00000274990:R27G	ENSP00000274990:R27G	R	-	1	0	CRIP3	43384090	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	3.460000	0.53028	2.605000	0.88082	0.561000	0.74099	CGC		0.607	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1			5	49	0	0	0	0.000602	0	5	49				
MEP1A	4224	broad.mit.edu	37	6	46806780	46806780	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:46806780C>A	ENST00000230588.4	+	14	2157	c.2148C>A	c.(2146-2148)ggC>ggA	p.G716G		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	716					digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G716G(1)		NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			AGGTGCACGGCAGTGTCCTGG	0.577																																							uc010jzh.1		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(2146-2148)GGC>GGA		meprin A alpha precursor							131.0	116.0	121.0					6																	46806780		2203	4300	6503	SO:0001819	synonymous_variant	4224				digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding	g.chr6:46806780C>A		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.2148C>A	6.37:g.46806780C>A						MEP1A_uc011dwg.1_Silent_p.G438G|MEP1A_uc011dwh.1_Silent_p.G744G|MEP1A_uc011dwi.1_Silent_p.G616G	p.G716G	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	Lung(136;0.192)		14	2190	+			716			Helical; (Potential).		A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Silent	SNP	ENST00000230588.4	37	c.2148C>A	CCDS4918.1																																																																																				0.577	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588		27	140	1	0	1.75199e-13	0.007291	2.50726e-13	27	140				
PGK2	5232	broad.mit.edu	37	6	49754615	49754615	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:49754615G>A	ENST00000304801.3	-	1	438	c.286C>T	c.(286-288)Ctg>Ttg	p.L96L		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	96					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.L96L(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CAGTCCTTCAGGAACAGAACA	0.522																																							uc003ozu.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(286-288)CTG>TTG		phosphoglycerate kinase 2							132.0	120.0	124.0					6																	49754615		2203	4300	6503	SO:0001819	synonymous_variant	5232				glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chr6:49754615G>A	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.286C>T	6.37:g.49754615G>A							p.L96L	NM_138733	NP_620061	P07205	PGK2_HUMAN			1	393	-	Lung NSC(77;0.0402)		96					B2R6Y8|Q9H107	Silent	SNP	ENST00000304801.3	37	c.286C>T	CCDS4930.1																																																																																				0.522	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1			45	66	0	0	0	0.013114	0	45	66				
EYS	346007	broad.mit.edu	37	6	66205157	66205157	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:66205157G>T	ENST00000370621.3	-	4	673	c.147C>A	c.(145-147)atC>atA	p.I49I	EYS_ENST00000370616.2_Silent_p.I49I|EYS_ENST00000370618.3_Silent_p.I49I|EYS_ENST00000393380.2_Silent_p.I49I|EYS_ENST00000342421.5_Silent_p.I49I|EYS_ENST00000503581.1_Silent_p.I49I			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	49					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.I49I(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AGTCCAAGCAGATGTTTTCTG	0.403																																							uc011dxu.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(4)|ovary(1)|skin(1)	6						c.(145-147)ATC>ATA		eyes shut homolog isoform 1							111.0	110.0	110.0					6																	66205157		2203	4300	6503	SO:0001819	synonymous_variant	346007				response to stimulus|visual perception	extracellular region	calcium ion binding	g.chr6:66205157G>T		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.147C>A	6.37:g.66205157G>T						EYS_uc003peq.2_Silent_p.I49I|EYS_uc003per.1_Silent_p.I49I|EYS_uc010kaj.1_RNA	p.I49I	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN			4	685	-			49					A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	37	c.147C>A																																																																																					0.403	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050		23	126	1	0	3.5997e-14	0.014323	5.28217e-14	23	126				
GJA10	84694	broad.mit.edu	37	6	90605636	90605636	+	Silent	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:90605636G>A	ENST00000369352.1	+	1	1449	c.1449G>A	c.(1447-1449)caG>caA	p.Q483Q	Y_RNA_ENST00000517082.1_RNA	NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	0					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.Q483Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		TGGTAAGACAGGCAGCCCTAC	0.478																																							uc011eaa.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1447-1449)CAG>CAA		gap junction protein, alpha 10							144.0	136.0	139.0					6																	90605636		2203	4300	6503	SO:0001819	synonymous_variant	84694				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity	g.chr6:90605636G>A	AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.1449G>A	6.37:g.90605636G>A							p.Q483Q	NM_032602	NP_115991	Q969M2	CXA10_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0915)	1	1449	+		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)	483			Cytoplasmic (Potential).		B2R722|B3KVQ2|Q5TA63|Q96KG0	Silent	SNP	ENST00000369352.1	37	c.1449G>A	CCDS5025.1																																																																																				0.478	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041505.1	NM_032602		18	52	0	0	0	0.008871	0	18	52				
FBXL4	26235	broad.mit.edu	37	6	99374630	99374630	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:99374630C>A	ENST00000369244.2	-	4	663	c.235G>T	c.(235-237)Gct>Tct	p.A79S	FBXL4_ENST00000229971.1_Missense_Mutation_p.A79S	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	79					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.A79S(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		GGTACACCAGCCAAATTCCAC	0.438																																							uc003ppf.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(235-237)GCT>TCT		F-box and leucine-rich repeat protein 4							158.0	137.0	144.0					6																	99374630		2203	4300	6503	SO:0001583	missense	26235				ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex		g.chr6:99374630C>A	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.235G>T	6.37:g.99374630C>A	ENSP00000358247:p.Ala79Ser					FBXL4_uc003ppg.1_Missense_Mutation_p.A79S|FBXL4_uc003pph.1_5'UTR	p.A79S	NM_012160	NP_036292	Q9UKA2	FBXL4_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0413)	3	593	-		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)	79					B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	ENST00000369244.2	37	c.235G>T	CCDS5041.1	.	.	.	.	.	.	.	.	.	.	C	18.45	3.626854	0.66901	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.15372	2.43;2.43	5.52	2.74	0.32292	.	0.097545	0.64402	N	0.000001	T	0.23572	0.0570	M	0.69823	2.125	0.58432	D	0.999999	D	0.63880	0.993	D	0.72625	0.978	T	0.02126	-1.1209	10	0.72032	D	0.01	.	7.5662	0.27881	0.127:0.6852:0.122:0.0657	.	79	Q9UKA2	FBXL4_HUMAN	S	79	ENSP00000358247:A79S;ENSP00000229971:A79S	ENSP00000229971:A79S	A	-	1	0	FBXL4	99481351	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	5.739000	0.68622	0.367000	0.24454	-0.188000	0.12872	GCT		0.438	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2			19	62	1	0	1.01871e-10	0.008871	1.36165e-10	19	62				
SLC22A16	85413	broad.mit.edu	37	6	110763799	110763799	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:110763799C>A	ENST00000368919.3	-	4	897	c.831G>T	c.(829-831)gtG>gtT	p.V277V	SLC22A16_ENST00000330550.4_Silent_p.V243V|RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000456137.2_3'UTR|SLC22A16_ENST00000439654.1_Silent_p.V277V	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	277					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)	p.V277V(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	AGGGGACAGTCACTGTGGAGA	0.478																																							uc003puf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(829-831)GTG>GTT		solute carrier family 22, member 16							110.0	111.0	111.0					6																	110763799		2203	4300	6503	SO:0001819	synonymous_variant	85413				acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity	g.chr6:110763799C>A		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.831G>T	6.37:g.110763799C>A						SLC22A16_uc003pue.2_Silent_p.V258V	p.V277V	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	4	898	-		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)	277			Helical; (Potential).		O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Silent	SNP	ENST00000368919.3	37	c.831G>T	CCDS5084.1																																																																																				0.478	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125		11	44	1	0	5.50884e-06	0.013537	6.35635e-06	11	44				
ENPP3	5169	broad.mit.edu	37	6	132058512	132058512	+	Missense_Mutation	SNP	G	G	T	rs371282868		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:132058512G>T	ENST00000414305.1	+	23	2435	c.2107G>T	c.(2107-2109)Gat>Tat	p.D703Y	ENPP3_ENST00000357639.3_Missense_Mutation_p.D703Y|ENPP3_ENST00000358229.5_Missense_Mutation_p.Q657H			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	703	Nuclease.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.D703Y(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		TAGAACATCAGATAGCCAATA	0.294																																							uc003qcu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(2107-2109)GAT>TAT		ectonucleotide pyrophosphatase/phosphodiesterase							136.0	139.0	138.0					6																	132058512		2203	4295	6498	SO:0001583	missense	5169				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity	g.chr6:132058512G>T	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.2107G>T	6.37:g.132058512G>T	ENSP00000406261:p.Asp703Tyr					ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Missense_Mutation_p.D703Y	p.D703Y	NM_005021	NP_005012	O14638	ENPP3_HUMAN		GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)	23	2454	+	Breast(56;0.0753)		703			Extracellular (Potential).|Nuclease.		Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	37	c.2107G>T	CCDS5148.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.472|2.472	-0.321635|-0.321635	0.05386|0.05386	.|.	.|.	ENSG00000154269|ENSG00000154269	ENST00000414305;ENST00000357639|ENST00000358229	T;T|T	0.71341|0.75050	-0.56;-0.56|-0.9	5.69|5.69	0.56|0.56	0.17279|0.17279	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);|.	1.473130|.	0.03744|.	N|.	0.255522|.	T|T	0.44973|0.44973	0.1319|0.1319	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	P|.	0.34826|.	0.471|.	B|.	0.42738|.	0.396|.	T|T	0.45116|0.45116	-0.9283|-0.9283	10|7	0.72032|0.54805	D|T	0.01|0.06	-1.6969|-1.6969	2.5125|2.5125	0.04660|0.04660	0.2658:0.3017:0.3323:0.1003|0.2658:0.3017:0.3323:0.1003	.|.	703|.	O14638|.	ENPP3_HUMAN|.	Y|H	703|657	ENSP00000406261:D703Y;ENSP00000350265:D703Y|ENSP00000350964:Q657H	ENSP00000350265:D703Y|ENSP00000350964:Q657H	D|Q	+|+	1|3	0|2	ENPP3|ENPP3	132100205|132100205	0.000000|0.000000	0.05858|0.05858	0.128000|0.128000	0.21923|0.21923	0.033000|0.033000	0.12548|0.12548	0.371000|0.371000	0.20450|0.20450	0.339000|0.339000	0.23719|0.23719	0.455000|0.455000	0.32223|0.32223	GAT|CAG		0.294	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2			17	67	1	0	4.63292e-17	0.008871	7.16158e-17	17	67				
TAAR9	134860	broad.mit.edu	37	6	132859760	132859760	+	RNA	SNP	T	T	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:132859760T>G	ENST00000434551.1	+	0	332					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)					Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		CATACATGTTTTGACACATCC	0.418																																					Colon(10;433 445 15992 45047 47213)	Colon(10;433 445 15992 45047 47213)	uc011eci.1		NA																	0					0						c.(331-333)TTT>TGT		trace amine associated receptor 9							214.0	208.0	210.0					6																	132859760		2131	4244	6375			134860					plasma membrane	G-protein coupled receptor activity	g.chr6:132859760T>G	AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132859760T>G							p.F111C	NM_175057	NP_778227	Q96RI9	TAAR9_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)	2	334	+	Breast(56;0.112)		111			Helical; Name=3; (Potential).			Missense_Mutation	SNP	ENST00000434551.1	37	c.332T>G																																																																																					0.418	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000042254.2	NM_175057		11	47	0	0	0	0.013537	0	11	47				
EYA4	2070	broad.mit.edu	37	6	133785997	133785997	+	Splice_Site	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:133785997G>A	ENST00000367895.5	+	10	1268		c.e10+1		EYA4_ENST00000355286.6_Splice_Site|EYA4_ENST00000431403.2_Splice_Site|EYA4_ENST00000430974.2_Splice_Site|EYA4_ENST00000452339.2_Splice_Site|EYA4_ENST00000531901.1_Splice_Site|EYA4_ENST00000525849.1_Splice_Site|EYA4_ENST00000355167.3_Splice_Site	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4						anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.?(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TTCACAACAGGTATAGTAGCT	0.323																																					Melanoma(57;398 1237 3528 4702 7415)	Melanoma(57;398 1237 3528 4702 7415)	uc003qec.3		NA																	2	Unknown(2)		lung(2)	large_intestine(2)	2						c.e10+1		eyes absent 4 isoform a							87.0	83.0	84.0					6																	133785997		2200	4294	6494	SO:0001630	splice_region_variant	2070				anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	g.chr6:133785997G>A	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.804+1G>A	6.37:g.133785997G>A						EYA4_uc011ecq.1_Splice_Site_p.Q214_splice|EYA4_uc011ecr.1_Splice_Site_p.Q214_splice|EYA4_uc003qed.3_Splice_Site_p.Q268_splice|EYA4_uc003qee.3_Splice_Site_p.Q245_splice|EYA4_uc011ecs.1_Splice_Site_p.Q268_splice|uc003qef.1_Intron	p.Q268_splice	NM_004100	NP_004091	O95677	EYA4_HUMAN		GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)	10	1262	+	Colorectal(23;0.221)							B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Splice_Site	SNP	ENST00000367895.5	37	c.804_splice	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400463	0.83120	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EYA4	133827690	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.817000	0.86213	2.840000	0.97914	0.655000	0.94253	.		0.323	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100	Intron	6	22	0	0	0	0.001168	0	6	22				
ELMO1	9844	broad.mit.edu	37	7	36927225	36927225	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:36927225G>T	ENST00000310758.4	-	18	2301	c.1654C>A	c.(1654-1656)Cgc>Agc	p.R552S	ELMO1_ENST00000442504.1_Missense_Mutation_p.R552S|ELMO1_ENST00000448602.1_Missense_Mutation_p.R552S|ELMO1_ENST00000396045.3_Missense_Mutation_p.R72S|ELMO1_ENST00000396040.2_Missense_Mutation_p.R72S|ELMO1_ENST00000341056.3_Missense_Mutation_p.R254S	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	552					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.R552S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						CGGTTCAGGCGTTGCTGTTTG	0.473																																							uc003tfk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						c.(1654-1656)CGC>AGC		engulfment and cell motility 1 isoform 1							165.0	148.0	154.0					7																	36927225		2203	4300	6503	SO:0001583	missense	9844				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding	g.chr7:36927225G>T	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1654C>A	7.37:g.36927225G>T	ENSP00000312185:p.Arg552Ser					ELMO1_uc003tfi.1_Missense_Mutation_p.R72S|ELMO1_uc003tfj.1_Missense_Mutation_p.R72S|ELMO1_uc011kbb.1_Intron|ELMO1_uc011kbc.1_Missense_Mutation_p.R456S|ELMO1_uc010kxg.1_Missense_Mutation_p.R552S	p.R552S	NM_014800	NP_055615	Q92556	ELMO1_HUMAN			18	1961	-			552					A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	c.1654C>A	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.817286	0.90790	.	.	ENSG00000155849	ENST00000341056;ENST00000396045;ENST00000310758;ENST00000361912;ENST00000396040;ENST00000442504;ENST00000448602	T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64	5.97	5.97	0.96955	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.75384	0.3842	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78119	-0.2328	10	0.87932	D	0	.	20.4238	0.99064	0.0:0.0:1.0:0.0	.	552	Q92556	ELMO1_HUMAN	S	254;72;552;456;72;552;552	ENSP00000342142:R254S;ENSP00000379360:R72S;ENSP00000312185:R552S;ENSP00000379355:R72S;ENSP00000406952:R552S;ENSP00000394458:R552S	ENSP00000312185:R552S	R	-	1	0	ELMO1	36893750	1.000000	0.71417	0.985000	0.45067	0.995000	0.86356	4.280000	0.58959	2.828000	0.97474	0.655000	0.94253	CGC		0.473	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442		34	66	1	0	2.40579e-17	0.00623	3.76998e-17	34	66				
ELMO1	9844	broad.mit.edu	37	7	37252959	37252959	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:37252959T>G	ENST00000310758.4	-	12	1582	c.935A>C	c.(934-936)aAa>aCa	p.K312T	ELMO1_ENST00000442504.1_Missense_Mutation_p.K312T|ELMO1_ENST00000448602.1_Missense_Mutation_p.K312T	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	312					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.K312T(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GGGGTCCATTTTGGTCATCAT	0.498																																							uc003tfk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						c.(934-936)AAA>ACA		engulfment and cell motility 1 isoform 1							135.0	118.0	124.0					7																	37252959		2203	4300	6503	SO:0001583	missense	9844				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding	g.chr7:37252959T>G	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.935A>C	7.37:g.37252959T>G	ENSP00000312185:p.Lys312Thr					ELMO1_uc011kbc.1_Missense_Mutation_p.K216T|ELMO1_uc010kxg.1_Missense_Mutation_p.K312T	p.K312T	NM_014800	NP_055615	Q92556	ELMO1_HUMAN			12	1242	-			312					A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	c.935A>C	CCDS5449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.5|20.5	4.003656|4.003656	0.74932|0.74932	.|.	.|.	ENSG00000155849|ENSG00000155849	ENST00000433246|ENST00000310758;ENST00000361912;ENST00000442504;ENST00000448602;ENST00000424212	T|T;T;T;T	0.30448|0.30981	1.53|1.51;1.51;1.51;1.51	5.2|5.2	2.9|2.9	0.33743|0.33743	.|Engulfment/cell motility, ELMO (1);	0.050961|0.050961	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.42765|0.42765	0.1217|0.1217	L|L	0.55743|0.55743	1.74|1.74	0.80722|0.80722	D|D	1|1	.|D	.|0.71674	.|0.998	.|D	.|0.70487	.|0.969	T|T	0.21621|0.21621	-1.0240|-1.0240	8|10	0.54805|0.18710	T|T	0.06|0.47	.|.	9.4017|9.4017	0.38437|0.38437	0.0:0.1474:0.0:0.8526|0.0:0.1474:0.0:0.8526	.|.	.|312	.|Q92556	.|ELMO1_HUMAN	Q|T	92|312;216;312;312;53	ENSP00000413108:K92Q|ENSP00000312185:K312T;ENSP00000406952:K312T;ENSP00000394458:K312T;ENSP00000395933:K53T	ENSP00000413108:K92Q|ENSP00000312185:K312T	K|K	-|-	1|2	0|0	ELMO1|ELMO1	37219484|37219484	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.127000|5.127000	0.64727|0.64727	1.079000|1.079000	0.41038|0.41038	0.533000|0.533000	0.62120|0.62120	AAA|AAA		0.498	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442		5	146	0	0	0	0.000602	0	5	146				
ABCA13	154664	broad.mit.edu	37	7	48320968	48320968	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:48320968C>T	ENST00000435803.1	+	19	8779	c.8755C>T	c.(8755-8757)Cag>Tag	p.Q2919*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2919					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.Q2864*(1)|p.Q2919*(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AGTTTTCCAGCAGACTGTGAA	0.428																																							uc003toq.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(8755-8757)CAG>TAG		ATP binding cassette, sub-family A (ABC1),							120.0	112.0	115.0					7																	48320968		1973	4180	6153	SO:0001587	stop_gained	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48320968C>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8755C>T	7.37:g.48320968C>T	ENSP00000411096:p.Gln2919*					ABCA13_uc010kys.1_5'UTR	p.Q2919*	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN			19	8780	+			2919					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	37	c.8755C>T	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	48	14.375700	0.99792	.	.	ENSG00000179869	ENST00000435803	.	.	.	4.81	3.87	0.44632	.	0.575340	0.15725	N	0.247686	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.8596	0.46819	0.1875:0.8125:0.0:0.0	.	.	.	.	X	2919	.	ENSP00000411096:Q2919X	Q	+	1	0	ABCA13	48291514	0.429000	0.25530	0.593000	0.28771	0.120000	0.20174	0.252000	0.18278	2.358000	0.79984	0.650000	0.86243	CAG		0.428	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		3	12	0	0	0	0.009096	0	3	12				
ABCA13	154664	broad.mit.edu	37	7	48520676	48520676	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:48520676A>G	ENST00000435803.1	+	46	13043	c.13019A>G	c.(13018-13020)cAc>cGc	p.H4340R	ABCA13_ENST00000544596.1_Missense_Mutation_p.H70R	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4340					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.H4285R(1)|p.H4340R(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTGACCAACCACCTGGGCCAC	0.408																																							uc003toq.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|central_nervous_system(4)|skin(1)	10						c.(13018-13020)CAC>CGC		ATP binding cassette, sub-family A (ABC1),							96.0	89.0	91.0					7																	48520676		1864	4117	5981	SO:0001583	missense	154664				transport	integral to membrane	ATP binding|ATPase activity	g.chr7:48520676A>G	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.13019A>G	7.37:g.48520676A>G	ENSP00000411096:p.His4340Arg					ABCA13_uc010kys.1_Missense_Mutation_p.H1415R|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Missense_Mutation_p.H70R	p.H4340R	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN			46	13044	+			4340					K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	c.13019A>G	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	5.568	0.289711	0.10567	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.86297	-1.89;-2.1;-2.04	5.35	-2.68	0.06041	.	0.981736	0.08300	N	0.967108	T	0.61924	0.2386	N	0.00960	-1.095	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.52290	-0.8595	10	0.23891	T	0.37	.	6.5488	0.22420	0.6099:0.0:0.2535:0.1366	.	70;2042;4340	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	R	4340;113;70	ENSP00000411096:H4340R;ENSP00000391042:H113R;ENSP00000442634:H70R	ENSP00000391042:H113R	H	+	2	0	ABCA13	48491222	0.000000	0.05858	0.012000	0.15200	0.946000	0.59487	-0.705000	0.05052	-0.522000	0.06417	-0.334000	0.08254	CAC		0.408	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		4	13	0	0	0	0.000602	0	4	13				
CDC14C	168448	broad.mit.edu	37	7	48964946	48964946	+	IGR	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:48964946T>C								AC004899.1 (73725 upstream) : AC010971.1 (304786 downstream)																							AGAATCACAATGTTACTACCA	0.403																																							uc010kyv.1		NA																	0					0						c.(676-678)AAT>AAC		SubName: Full=Putative uncharacterized protein MGC26484;																																				SO:0001628	intergenic_variant	168448							g.chr7:48964946T>C																													7.37:g.48964946T>C							p.N226N	NR_003595						1	790	+									Silent	SNP		37	c.678T>C																																																																																				0	0.403									14	39	0	0	0	0.00333	0	14	39				
ZPBP	11055	broad.mit.edu	37	7	50129290	50129290	+	Missense_Mutation	SNP	C	C	A	rs148222395		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:50129290C>A	ENST00000046087.2	-	2	212	c.143G>T	c.(142-144)cGa>cTa	p.R48L	ZPBP_ENST00000419417.1_Missense_Mutation_p.R48L	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	48					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)		p.R48L(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					TCTTGGTAATCGAACCAAGTG	0.284																																							uc003tou.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(142-144)CGA>CTA		zona pellucida binding protein isoform 1							34.0	34.0	34.0					7																	50129290		2203	4298	6501	SO:0001583	missense	11055				binding of sperm to zona pellucida	extracellular region		g.chr7:50129290C>A	D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.143G>T	7.37:g.50129290C>A	ENSP00000046087:p.Arg48Leu					ZPBP_uc010kyw.2_Missense_Mutation_p.R48L	p.R48L	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN			2	213	-	Glioma(55;0.08)|all_neural(89;0.245)		48					A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Missense_Mutation	SNP	ENST00000046087.2	37	c.143G>T	CCDS5509.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050180	0.36181	.	.	ENSG00000042813	ENST00000046087;ENST00000419417;ENST00000450231	T;T;T	0.53857	0.6;0.6;1.24	5.49	3.7	0.42460	.	0.365143	0.20359	N	0.093885	T	0.43700	0.1259	L	0.60455	1.87	0.18873	N	0.999987	P;P	0.43024	0.798;0.798	B;B	0.37267	0.245;0.245	T	0.34254	-0.9836	9	.	.	.	-6.6381	7.7184	0.28719	0.0:0.7042:0.0:0.2958	.	48;48	C9JPU1;Q9BS86	.;ZPBP1_HUMAN	L	48;48;9	ENSP00000046087:R48L;ENSP00000402071:R48L;ENSP00000390054:R9L	.	R	-	2	0	ZPBP	50099836	0.954000	0.32549	0.842000	0.33263	0.871000	0.50021	0.870000	0.28010	0.822000	0.34565	0.557000	0.71058	CGA		0.284	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251374.1	NM_007009		7	23	1	0	0.00307968	0.00308	0.00318995	7	23				
SEC61G	23480	broad.mit.edu	37	7	54825215	54825215	+	Missense_Mutation	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:54825215T>C	ENST00000415949.1	-	3	433	c.67A>G	c.(67-69)Aaa>Gaa	p.K23E	SEC61G_ENST00000395535.3_Missense_Mutation_p.K23E|SEC61G_ENST00000450622.1_Missense_Mutation_p.K23E|SEC61G_ENST00000352861.4_Missense_Mutation_p.K23E|RP11-745C15.2_ENST00000439413.2_RNA			P60059	SC61G_HUMAN	Sec61 gamma subunit	23					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|protein targeting to ER (GO:0045047)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)|protein transporter activity (GO:0008565)	p.K23E(1)		kidney(1)|lung(5)	6	Esophageal squamous(2;7.55e-08)|Breast(14;0.0654)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)			GTGCATCTTTTAACCAGCCGA	0.358																																							uc003tqf.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(67-69)AAA>GAA		Sec61 gamma subunit							125.0	114.0	118.0					7																	54825215		2203	4300	6503	SO:0001583	missense	23480				protein targeting to ER	endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity	g.chr7:54825215T>C	AF086539	CCDS5513.1	7p11.2	2014-05-19			ENSG00000132432	ENSG00000132432			18277	protein-coding gene	gene with protein product		609215				8107851, 10212142	Standard	NM_014302		Approved	SSS1	uc003tqg.3	P60059	OTTHUMG00000023430	ENST00000415949.1:c.67A>G	7.37:g.54825215T>C	ENSP00000388337:p.Lys23Glu					SEC61G_uc003tqg.2_Missense_Mutation_p.K23E	p.K23E	NM_001012456	NP_001012474	P60059	SC61G_HUMAN	Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)		2	158	-	Esophageal squamous(2;7.55e-08)|Breast(14;0.0654)		23			Cytoplasmic (Potential).		B2R4J0|P38384|Q6IB25	Missense_Mutation	SNP	ENST00000415949.1	37	c.67A>G	CCDS5513.1	.	.	.	.	.	.	.	.	.	.	T	19.40	3.820259	0.71028	.	.	ENSG00000132432	ENST00000395535;ENST00000352861;ENST00000415949;ENST00000450622	.	.	.	5.51	5.51	0.81932	Protein translocase SecE domain (2);	0.049117	0.85682	D	0.000000	T	0.58708	0.2141	.	.	.	0.80722	D	1	B	0.18610	0.029	B	0.28784	0.094	T	0.58047	-0.7705	8	0.56958	D	0.05	-8.4425	13.5768	0.61879	0.0:0.0:0.0:1.0	.	23	P60059	SC61G_HUMAN	E	23	.	ENSP00000341538:K23E	K	-	1	0	SEC61G	54792709	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.448000	0.80631	2.093000	0.63338	0.533000	0.62120	AAA		0.358	SEC61G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251384.2	NM_014302		39	90	0	0	0	0.007835	0	39	90				
ZNF117	51351	broad.mit.edu	37	7	64438693	64438693	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:64438693C>A	ENST00000282869.6	-	4	2540	c.1256G>T	c.(1255-1257)tGt>tTt	p.C419F		NM_015852.3	NP_056936.2	Q03924	ZN117_HUMAN	zinc finger protein 117	419					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C419F(1)		breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(1)|skin(1)	22		Lung NSC(55;0.0295)|all_lung(88;0.0691)				ACATTCTTCACATTTGTAGAG	0.378																																							uc003ttr.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1255-1257)TGT>TTT		zinc finger protein 117							85.0	89.0	87.0					7																	64438693		2073	4239	6312	SO:0001583	missense	51351					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:64438693C>A	M27879	CCDS43593.1	7q11.2	2013-01-08	2006-06-12		ENSG00000152926	ENSG00000152926		"""Zinc fingers, C2H2-type"""	12897	protein-coding gene	gene with protein product		194624	"""zinc finger protein 117 (HPF9)"""			1427907	Standard	NM_015852		Approved	HPF9, H-plk	uc003ttr.2	Q03924	OTTHUMG00000156631	ENST00000282869.6:c.1256G>T	7.37:g.64438693C>A	ENSP00000282869:p.Cys419Phe						p.C419F	NM_015852	NP_056936	Q03924	ZN117_HUMAN			4	2541	-		Lung NSC(55;0.0295)|all_lung(88;0.0691)	419			C2H2-type 12.		Q02313|Q7Z7Q7	Missense_Mutation	SNP	ENST00000282869.6	37	c.1256G>T	CCDS43593.1	.	.	.	.	.	.	.	.	.	.	.	12.20	1.867756	0.32977	.	.	ENSG00000152926	ENST00000282869	D	0.85088	-1.94	1.11	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93956	0.8065	H	0.97340	3.985	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	D	0.84171	0.0434	9	0.87932	D	0	.	7.6354	0.28264	0.0:1.0:0.0:0.0	.	419	Q03924	ZN117_HUMAN	F	419	ENSP00000282869:C419F	ENSP00000282869:C419F	C	-	2	0	ZNF117	64076128	0.973000	0.33851	0.033000	0.17914	0.022000	0.10575	3.784000	0.55416	0.518000	0.28383	0.313000	0.20887	TGT		0.378	ZNF117-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344863.3	NM_024498		41	25	1	0	2.26627e-22	0.007835	3.85648e-22	41	25				
PCLO	27445	broad.mit.edu	37	7	82546048	82546048	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:82546048A>T	ENST00000333891.9	-	7	11591	c.11254T>A	c.(11254-11256)Tgc>Agc	p.C3752S	PCLO_ENST00000437081.1_Missense_Mutation_p.C472S|PCLO_ENST00000423517.2_Missense_Mutation_p.C3752S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.C3752S(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTGGTTCTGCAGATCCTTCTC	0.458																																							uc003uhx.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)	7						c.(11254-11256)TGC>AGC		piccolo isoform 1							128.0	114.0	118.0					7																	82546048		1894	4145	6039	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82546048A>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11254T>A	7.37:g.82546048A>T	ENSP00000334319:p.Cys3752Ser					PCLO_uc003uhv.2_Missense_Mutation_p.C3752S|PCLO_uc010lec.2_Missense_Mutation_p.C717S	p.C3752S	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			7	11543	-			3683						Missense_Mutation	SNP	ENST00000333891.9	37	c.11254T>A	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	A	9.435	1.086537	0.20390	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.15017	2.47;2.46	5.82	4.63	0.57726	.	.	.	.	.	T	0.18087	0.0434	L	0.51422	1.61	0.46279	D	0.998966	B;P;P	0.46142	0.361;0.873;0.873	B;B;B	0.39660	0.058;0.306;0.306	T	0.01259	-1.1403	9	0.87932	D	0	.	13.007	0.58710	0.8652:0.1347:0.0:0.0	.	3683;3752;3752	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	S	3752;3752;472	ENSP00000334319:C3752S;ENSP00000388393:C3752S	ENSP00000334319:C3752S	C	-	1	0	PCLO	82383984	1.000000	0.71417	0.996000	0.52242	0.969000	0.65631	4.661000	0.61518	0.991000	0.38814	0.456000	0.33151	TGC		0.458	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		7	53	0	0	0	0.001984	0	7	53				
ABCB4	5244	broad.mit.edu	37	7	87037453	87037453	+	Missense_Mutation	SNP	T	T	G	rs373011908		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:87037453T>G	ENST00000265723.4	-	25	3290	c.3179A>C	c.(3178-3180)aAg>aCg	p.K1060T	ABCB4_ENST00000359206.3_Missense_Mutation_p.K1060T|ABCB4_ENST00000358400.3_Missense_Mutation_p.K1013T|ABCB4_ENST00000453593.1_Missense_Mutation_p.K1013T|ABCB4_ENST00000545634.1_Missense_Mutation_p.K1060T	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1060	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.K1060T(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CTGGCCTTTCTTCACCTCCAG	0.552																																							uc003uiv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)|pancreas(1)	6						c.(3178-3180)AAG>ACG		ATP-binding cassette, subfamily B, member 4		T	THR/LYS,THR/LYS,THR/LYS	1,4405	2.1+/-5.4	0,1,2202	80.0	79.0	79.0		3179,3179,3038	4.0	1.0	7		79	0,8600		0,0,4300	no	missense,missense,missense	ABCB4	NM_000443.3,NM_018849.2,NM_018850.2	78,78,78	0,1,6502	GG,GT,TT		0.0,0.0227,0.0077	benign,benign,benign	1060/1280,1060/1287,1013/1233	87037453	1,13005	2203	4300	6503	SO:0001583	missense	5244				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity	g.chr7:87037453T>G	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.3179A>C	7.37:g.87037453T>G	ENSP00000265723:p.Lys1060Thr					ABCB4_uc003uiw.1_Missense_Mutation_p.K1060T|ABCB4_uc003uix.1_Missense_Mutation_p.K1013T	p.K1060T	NM_018849	NP_061337	P21439	MDR3_HUMAN			25	3255	-	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		1060			ABC transporter 2.|Cytoplasmic (By similarity).		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	c.3179A>C	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.810614	0.50421	2.27E-4	0.0	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41;-3.41	5.19	4.03	0.46877	ABC transporter-like (1);	0.343482	0.33834	N	0.004505	D	0.91088	0.7195	L	0.46885	1.475	0.46131	D	0.998884	P;P;B	0.45672	0.864;0.553;0.417	B;P;B	0.47864	0.441;0.559;0.356	D	0.90122	0.4200	10	0.54805	T	0.06	-16.8015	7.3604	0.26744	0.0:0.0758:0.1457:0.7785	.	1013;1060;1060	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	T	1060;1013;1060;1013;1060	ENSP00000352135:K1060T;ENSP00000351172:K1013T;ENSP00000265723:K1060T;ENSP00000392983:K1013T;ENSP00000437465:K1060T	ENSP00000265723:K1060T	K	-	2	0	ABCB4	86875389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.398000	0.52579	2.083000	0.62718	0.533000	0.62120	AAG		0.552	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443		5	89	0	0	0	0.000602	0	5	89				
TECPR1	25851	broad.mit.edu	37	7	97852397	97852397	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:97852397C>A	ENST00000447648.2	-	21	3132	c.2833G>T	c.(2833-2835)Ggt>Tgt	p.G945C	TECPR1_ENST00000379795.3_Missense_Mutation_p.G947C|TECPR1_ENST00000479975.1_5'UTR			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	945					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)	p.G946C(1)		central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CCCTCGGCACCCGGGCTCTCC	0.672																																							uc003upg.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(2833-2835)GGT>TGT		tectonin beta-propeller repeat containing 1							18.0	23.0	21.0					7																	97852397		2024	4159	6183	SO:0001583	missense	25851					integral to membrane	protein binding	g.chr7:97852397C>A		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.2833G>T	7.37:g.97852397C>A	ENSP00000404923:p.Gly945Cys						p.G945C	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN			21	3038	-			945					A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	ENST00000447648.2	37	c.2833G>T	CCDS47648.1	.	.	.	.	.	.	.	.	.	.	C	7.218	0.596831	0.13875	.	.	ENSG00000205356	ENST00000447648;ENST00000379795	T;T	0.31247	1.5;1.5	4.91	0.573	0.17363	.	2.024000	0.01893	N	0.038705	T	0.26882	0.0658	L	0.40543	1.245	0.09310	N	0.999995	B	0.09022	0.002	B	0.04013	0.001	T	0.17379	-1.0371	10	0.37606	T	0.19	0.4034	6.425	0.21764	0.1213:0.5657:0.2376:0.0754	.	945	Q7Z6L1	TCPR1_HUMAN	C	945;947	ENSP00000404923:G945C;ENSP00000369121:G947C	ENSP00000369121:G947C	G	-	1	0	TECPR1	97690333	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	0.548000	0.23314	0.247000	0.21414	-0.254000	0.11334	GGT		0.672	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	NM_015395		3	2	1	0	0.00024832	0.009096	0.000266057	3	2				
FOXP2	93986	broad.mit.edu	37	7	114269998	114269998	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:114269998C>A	ENST00000393494.2	+	5	814	c.535C>A	c.(535-537)Cag>Aag	p.Q179K	FOXP2_ENST00000408937.3_Missense_Mutation_p.Q204K|FOXP2_ENST00000360232.4_Missense_Mutation_p.Q179K|FOXP2_ENST00000393500.3_Missense_Mutation_p.Q104K|FOXP2_ENST00000390668.3_Missense_Mutation_p.Q203K|FOXP2_ENST00000393498.2_Missense_Mutation_p.Q159K|FOXP2_ENST00000393491.3_Missense_Mutation_p.Q87K|FOXP2_ENST00000378237.3_Missense_Mutation_p.Q179K|FOXP2_ENST00000350908.4_Missense_Mutation_p.Q179K|FOXP2_ENST00000393489.3_Missense_Mutation_p.Q87K|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000403559.4_Missense_Mutation_p.Q196K			O15409	FOXP2_HUMAN	forkhead box P2	179	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q204K(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						gcagcaacaacagcagcagca	0.498																																							uc003vhb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						c.(535-537)CAG>AAG		forkhead box P2 isoform I							41.0	39.0	39.0					7																	114269998		2201	4282	6483	SO:0001583	missense	93986				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding	g.chr7:114269998C>A	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.535C>A	7.37:g.114269998C>A	ENSP00000377132:p.Gln179Lys					FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Missense_Mutation_p.Q204K|FOXP2_uc003vha.2_Missense_Mutation_p.Q87K|FOXP2_uc011kmu.1_Missense_Mutation_p.Q196K|FOXP2_uc011kmv.1_Missense_Mutation_p.Q179K|FOXP2_uc010ljz.1_Missense_Mutation_p.Q87K|FOXP2_uc003vgt.1_RNA|FOXP2_uc003vgv.1_Missense_Mutation_p.Q179K|FOXP2_uc003vgx.2_Missense_Mutation_p.Q179K|FOXP2_uc003vhd.2_Missense_Mutation_p.Q179K|FOXP2_uc003vhc.2_Missense_Mutation_p.Q204K	p.Q179K	NM_014491	NP_055306	O15409	FOXP2_HUMAN			5	909	+			179			Gln-rich.		A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	37	c.535C>A	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437091	0.43224	.	.	ENSG00000128573	ENST00000393500;ENST00000324462;ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000378237;ENST00000393489;ENST00000360232;ENST00000452963;ENST00000390668;ENST00000393491	T;T;T;T;T;T;T;T;T;T	0.36699	1.56;1.56;1.56;1.56;1.56;1.56;1.24;1.56;1.56;1.24	6.03	6.03	0.97812	.	0.491185	0.20204	N	0.097040	T	0.28499	0.0705	N	0.19112	0.55	0.58432	D	0.999996	B;B;P;B;B;B;B	0.34662	0.231;0.231;0.462;0.341;0.341;0.231;0.341	B;B;B;B;B;B;B	0.29785	0.05;0.05;0.05;0.107;0.107;0.05;0.107	T	0.06752	-1.0809	10	0.49607	T	0.09	.	20.17	0.98157	0.0:1.0:0.0:0.0	.	179;196;87;179;203;179;204	B7ZLK5;B4DLD9;Q0PRL4;O15409-6;Q8N6B5;O15409;O15409-4	.;.;.;.;.;FOXP2_HUMAN;.	K	104;179;179;204;196;179;157;179;87;179;185;203;87	ENSP00000377137:Q104K;ENSP00000377132:Q179K;ENSP00000386200:Q204K;ENSP00000385069:Q196K;ENSP00000265436:Q179K;ENSP00000367482:Q179K;ENSP00000377129:Q87K;ENSP00000353367:Q179K;ENSP00000375084:Q203K;ENSP00000377130:Q87K	ENSP00000319424:Q179K	Q	+	1	0	FOXP2	114057234	0.974000	0.33945	0.999000	0.59377	0.960000	0.62799	1.346000	0.33964	2.868000	0.98415	0.555000	0.69702	CAG		0.498	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491		6	47	1	0	4.096e-09	0.001168	5.10425e-09	6	47				
ASZ1	136991	broad.mit.edu	37	7	117025861	117025861	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:117025861C>T	ENST00000284629.2	-	5	505	c.443G>A	c.(442-444)aGa>aAa	p.R148K		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1									p.R148K(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			GGTCATAAGTCTCCTAAGGAG	0.418																																							uc003vjb.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|ovary(1)	3						c.(442-444)AGA>AAA		ankyrin repeat, SAM and basic leucine zipper							88.0	85.0	86.0					7																	117025861		2203	4300	6503	SO:0001583	missense	136991				cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity	g.chr7:117025861C>T	AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.443G>A	7.37:g.117025861C>T	ENSP00000284629:p.Arg148Lys					ASZ1_uc011kno.1_Missense_Mutation_p.R148K|ASZ1_uc011knp.1_Intron	p.R148K	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	STAD - Stomach adenocarcinoma(10;0.000512)		5	506	-	Lung NSC(10;0.00156)|all_lung(10;0.00175)		148			ANK 4.			Missense_Mutation	SNP	ENST00000284629.2	37	c.443G>A	CCDS5772.1	.	.	.	.	.	.	.	.	.	.	C	9.406	1.079270	0.20227	.	.	ENSG00000154438	ENST00000284629	T	0.70869	-0.52	5.91	3.89	0.44902	Ankyrin repeat-containing domain (4);	0.250156	0.43579	D	0.000550	T	0.43255	0.1239	N	0.10916	0.065	0.30007	N	0.815463	B;B	0.12013	0.005;0.005	B;B	0.16289	0.015;0.015	T	0.28839	-1.0031	10	0.10636	T	0.68	-35.8556	4.906	0.13799	0.0:0.6194:0.0:0.3806	.	148;148	B7ZM20;Q8WWH4	.;ASZ1_HUMAN	K	148	ENSP00000284629:R148K	ENSP00000284629:R148K	R	-	2	0	ASZ1	116813097	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	2.292000	0.43549	1.512000	0.48834	0.650000	0.86243	AGA		0.418	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000138907.7	NM_130768		4	42	0	0	0	0.009096	0	4	42				
WDR91	29062	broad.mit.edu	37	7	134873253	134873253	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:134873253C>A	ENST00000354475.4	-	13	1844	c.1813G>T	c.(1813-1815)Ggg>Tgg	p.G605W	WDR91_ENST00000423565.1_Missense_Mutation_p.G570W|WDR91_ENST00000344400.5_Intron	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	605								p.G605W(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						TAGACCTCCCCGTAGTGGGCC	0.577																																							uc003vsp.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(2)|ovary(1)|skin(1)	4						c.(1813-1815)GGG>TGG		WD repeat domain 91							167.0	154.0	158.0					7																	134873253		2203	4300	6503	SO:0001583	missense	29062							g.chr7:134873253C>A	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.1813G>T	7.37:g.134873253C>A	ENSP00000346466:p.Gly605Trp					WDR91_uc010lmq.2_Missense_Mutation_p.G194W|WDR91_uc010lmr.2_Intron	p.G605W	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN			13	1875	-			605			WD 5.		A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	c.1813G>T	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	C	33	5.195849	0.94960	.	.	ENSG00000105875	ENST00000354475;ENST00000423565	T;T	0.01516	4.81;4.81	5.8	5.8	0.92144	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047525	0.85682	D	0.000000	T	0.09818	0.0241	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.00389	-1.1770	10	0.87932	D	0	-34.5422	20.0693	0.97712	0.0:1.0:0.0:0.0	.	605	A4D1P6	WDR91_HUMAN	W	605;570	ENSP00000346466:G605W;ENSP00000392555:G570W	ENSP00000346466:G605W	G	-	1	0	WDR91	134523793	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	7.610000	0.82949	2.758000	0.94735	0.563000	0.77884	GGG		0.577	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149		75	67	1	0	1.69331e-39	0.01441	3.31301e-39	75	67				
DGKI	9162	broad.mit.edu	37	7	137170135	137170135	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:137170135C>A	ENST00000288490.5	-	24	2412	c.2412G>T	c.(2410-2412)caG>caT	p.Q804H	DGKI_ENST00000424189.2_Missense_Mutation_p.Q807H|DGKI_ENST00000446122.1_Missense_Mutation_p.Q786H|DGKI_ENST00000453654.2_Missense_Mutation_p.Q504H	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	804					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.Q804H(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						AATGAACTCTCTGGGAGCCAG	0.353																																							uc003vtt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|kidney(1)|skin(1)	3						c.(2410-2412)CAG>CAT		diacylglycerol kinase, iota							83.0	84.0	84.0					7																	137170135		2203	4300	6503	SO:0001583	missense	9162				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chr7:137170135C>A	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2412G>T	7.37:g.137170135C>A	ENSP00000288490:p.Gln804His					DGKI_uc003vtu.2_Missense_Mutation_p.Q504H	p.Q804H	NM_004717	NP_004708	O75912	DGKI_HUMAN			24	2413	-			804					A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	c.2412G>T	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816832	0.32145	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.34667	1.94;1.35;1.55	6.17	4.36	0.52297	.	1.270220	0.05149	N	0.495761	T	0.23727	0.0574	N	0.16478	0.41	0.37680	D	0.923445	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.14952	-1.0454	10	0.16420	T	0.52	.	6.5765	0.22569	0.0:0.6763:0.167:0.1567	.	504;804	E9PFX6;O75912	.;DGKI_HUMAN	H	504;752;807;804;786	ENSP00000392161:Q504H;ENSP00000288490:Q804H;ENSP00000399131:Q786H	ENSP00000288490:Q804H	Q	-	3	2	DGKI	136820675	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.747000	0.26290	0.901000	0.36495	0.655000	0.94253	CAG		0.353	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717		10	8	1	0	2.80697e-09	0.010729	3.51958e-09	10	8				
FAM115A	9747	broad.mit.edu	37	7	143573464	143573464	+	Missense_Mutation	SNP	C	C	T	rs150435300		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:143573464C>T	ENST00000479870.1	-	2	446	c.238G>A	c.(238-240)Gca>Aca	p.A80T	FAM115A_ENST00000355951.2_Missense_Mutation_p.A80T|FAM115A_ENST00000392900.3_Intron	NM_001206938.1|NM_001206941.1|NM_014719.2	NP_001193867.1|NP_001193870.1|NP_055534	Q9Y4C2	F115A_HUMAN	family with sequence similarity 115, member A	80								p.A80T(1)		NS(1)|endometrium(1)|lung(5)	7	Melanoma(164;0.0903)					CACCCCACTGCGTTCAGGAGA	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17833	0.0		0.0	False		,,,				2504	0.0						uc003wdo.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(238-240)GCA>ACA		hypothetical protein LOC9747		C	THR/ALA,,THR/ALA	7,4399	12.9+/-30.5	0,7,2196	53.0	48.0	50.0		238,,238	4.0	0.8	7	dbSNP_134	50	1,8599	1.2+/-3.3	0,1,4299	yes	missense,intron,missense	FAM115A	NM_001206938.1,NM_001206941.1,NM_014719.2	58,,58	0,8,6495	TT,TC,CC		0.0116,0.1589,0.0615	benign,,benign	80/920,,80/922	143573464	8,12998	2203	4300	6503	SO:0001583	missense	9747							g.chr7:143573464C>T	AB018281	CCDS5886.1, CCDS56514.1	7q35	2011-05-03	2006-03-23	2006-03-23	ENSG00000198420	ENSG00000198420			22201	protein-coding gene	gene with protein product						9872452	Standard	NM_014719		Approved	KIAA0738	uc003wdo.2	Q9Y4C2	OTTHUMG00000157773	ENST00000479870.1:c.238G>A	7.37:g.143573464C>T	ENSP00000419235:p.Ala80Thr					FAM115A_uc011ktu.1_Intron|FAM115A_uc003wdp.1_Missense_Mutation_p.A80T	p.A80T	NM_014719	NP_055534	Q9Y4C2	F115A_HUMAN			2	371	-	Melanoma(164;0.0903)		80					A8K6E0|Q75KM8|Q75KM9|Q7L665|Q9BW63	Missense_Mutation	SNP	ENST00000479870.1	37	c.238G>A	CCDS5886.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.451960	0.63290	0.001589	1.16E-4	ENSG00000198420	ENST00000479870;ENST00000355951;ENST00000460532;ENST00000491908;ENST00000478172	T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98	4.01	4.01	0.46588	.	0.056713	0.64402	D	0.000001	T	0.47358	0.1441	M	0.80982	2.52	0.36350	D	0.860005	D	0.89917	1.0	D	0.72625	0.978	T	0.61486	-0.7053	10	0.87932	D	0	-5.7446	14.4166	0.67155	0.0:1.0:0.0:0.0	.	80	Q9Y4C2	F115A_HUMAN	T	80	ENSP00000419235:A80T;ENSP00000348220:A80T;ENSP00000420607:A80T;ENSP00000417600:A80T;ENSP00000419622:A80T	ENSP00000348220:A80T	A	-	1	0	FAM115A	143204397	1.000000	0.71417	0.838000	0.33150	0.292000	0.27327	5.189000	0.65098	2.526000	0.85167	0.585000	0.79938	GCA		0.607	FAM115A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349583.1	NM_014719		25	17	0	0	0	0.00278	0	25	17				
OR2A12	346525	broad.mit.edu	37	7	143792988	143792988	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:143792988C>T	ENST00000408949.2	+	1	848	c.788C>T	c.(787-789)tCa>tTa	p.S263L		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					GCCCCCAAGTCAAGCCATTCT	0.552																																							uc011kty.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(787-789)TCA>TTA		olfactory receptor, family 2, subfamily A,							167.0	160.0	162.0					7																	143792988		1908	4143	6051	SO:0001583	missense	346525				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143792988C>T		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.788C>T	7.37:g.143792988C>T	ENSP00000386174:p.Ser263Leu						p.S263L	NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN			1	788	+	Melanoma(164;0.0783)		263			Extracellular (Potential).		Q6IF43	Missense_Mutation	SNP	ENST00000408949.2	37	c.788C>T	CCDS43670.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.416207	0.25552	.	.	ENSG00000221858	ENST00000408949	T	0.79454	-1.27	4.33	2.39	0.29439	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.85013	0.5600	M	0.66378	2.025	0.09310	N	1	D	0.58620	0.983	D	0.65773	0.938	T	0.75048	-0.3455	9	0.87932	D	0	-27.0693	12.2961	0.54847	0.0:0.6758:0.3242:0.0	.	263	Q8NGT7	O2A12_HUMAN	L	263	ENSP00000386174:S263L	ENSP00000386174:S263L	S	+	2	0	OR2A12	143423921	0.000000	0.05858	0.047000	0.18901	0.088000	0.18126	0.087000	0.14958	1.023000	0.39654	0.505000	0.49811	TCA		0.552	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1			157	127	0	0	0	0.01441	0	157	127				
OR2A2	442361	broad.mit.edu	37	7	143806748	143806748	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:143806748C>A	ENST00000408979.2	+	1	142	c.73C>A	c.(73-75)Ctc>Atc	p.L25I		NM_001005480.2	NP_001005480.2	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A, member 2	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L25I(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)|skin(4)	22	Melanoma(164;0.0783)					ACTGGCGATTCTCCTCTGTGG	0.517																																							uc011ktz.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(73-75)CTC>ATC		olfactory receptor, family 2, subfamily A,							147.0	142.0	144.0					7																	143806748		1996	4196	6192	SO:0001583	missense	442361				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143806748C>A		CCDS43671.1	7q35	2013-09-20		2004-03-10	ENSG00000221989	ENSG00000221989		"""GPCR / Class A : Olfactory receptors"""	8230	protein-coding gene	gene with protein product				OR2A2P, OR2A17P			Standard	NM_001005480		Approved	OST008	uc011ktz.2	Q6IF42	OTTHUMG00000158001	ENST00000408979.2:c.73C>A	7.37:g.143806748C>A	ENSP00000386209:p.Leu25Ile						p.L25I	NM_001005480	NP_001005480	Q6IF42	OR2A2_HUMAN			1	73	+	Melanoma(164;0.0783)		25			Helical; Name=1; (Potential).		B2RN85|Q8NGT6	Missense_Mutation	SNP	ENST00000408979.2	37	c.73C>A	CCDS43671.1	.	.	.	.	.	.	.	.	.	.	C	3.230	-0.157587	0.06544	.	.	ENSG00000221989	ENST00000408979	T	0.00630	6.1	3.61	-5.09	0.02920	.	.	.	.	.	T	0.00580	0.0019	L	0.35288	1.05	0.09310	N	1	B	0.15141	0.012	B	0.13407	0.009	T	0.45440	-0.9261	9	0.07030	T	0.85	.	12.8432	0.57815	0.0:0.1596:0.0:0.8404	.	25	Q6IF42	OR2A2_HUMAN	I	25	ENSP00000386209:L25I	ENSP00000386209:L25I	L	+	1	0	OR2A2	143437681	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-6.062000	0.00083	-1.271000	0.02430	-0.908000	0.02827	CTC		0.517	OR2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349978.1			12	106	1	0	0.00185496	0.001855	0.00193623	12	106				
TEX15	56154	broad.mit.edu	37	8	30701125	30701125	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:30701125G>T	ENST00000256246.2	-	1	5483	c.5409C>A	c.(5407-5409)tgC>tgA	p.C1803*		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1803					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.C1803*(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AAAAATCAAAGCAATCGGAAC	0.323																																							uc003xil.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(5407-5409)TGC>TGA		testis expressed 15							81.0	78.0	79.0					8																	30701125		2203	4300	6503	SO:0001587	stop_gained	56154							g.chr8:30701125G>T	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.5409C>A	8.37:g.30701125G>T	ENSP00000256246:p.Cys1803*						p.C1803*	NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	5409	-			1803						Nonsense_Mutation	SNP	ENST00000256246.2	37	c.5409C>A	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	G	42	9.362977	0.99148	.	.	ENSG00000133863	ENST00000256246	.	.	.	5.54	2.69	0.31865	.	0.117907	0.38720	N	0.001583	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.8521	0.29462	0.3437:0.0:0.6563:0.0	.	.	.	.	X	1803	.	ENSP00000256246:C1803X	C	-	3	2	TEX15	30820667	1.000000	0.71417	1.000000	0.80357	0.382000	0.30200	0.701000	0.25616	0.260000	0.21731	-0.781000	0.03364	TGC		0.323	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			9	18	1	0	0.00448238	0.004482	0.00463103	9	18				
ANK1	286	broad.mit.edu	37	8	41519408	41519408	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:41519408G>A	ENST00000347528.4	-	41	5613	c.5530C>T	c.(5530-5532)Cag>Tag	p.Q1844*	ANK1_ENST00000522543.1_Nonsense_Mutation_p.Q119*|ANK1_ENST00000396945.1_Intron|ANK1_ENST00000289734.7_Nonsense_Mutation_p.Q1844*|ANK1_ENST00000379758.2_Intron|ANK1_ENST00000457297.1_Intron|ANK1_ENST00000396942.1_Nonsense_Mutation_p.Q1844*|ANK1_ENST00000265709.8_Nonsense_Mutation_p.Q1885*|ANK1_ENST00000352337.4_Intron|MIR486_ENST00000408108.1_RNA|ANK1_ENST00000522231.1_Nonsense_Mutation_p.Q119*|RP11-930P14.1_ENST00000520418.1_RNA|RP11-930P14.1_ENST00000522388.1_RNA|RP11-930P14.1_ENST00000585088.1_RNA|ANK1_ENST00000314214.8_Nonsense_Mutation_p.Q119*	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1844	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.Q1844*(1)|p.Q119*(1)|p.Q1885*(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TCGTGCTCCTGGGCGGCATCG	0.577																																							uc003xok.2		NA																	3	Substitution - Nonsense(3)		lung(3)	ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9						c.(5530-5532)CAG>TAG		ankyrin 1 isoform 1							50.0	55.0	53.0					8																	41519408		2203	4300	6503	SO:0001587	stop_gained	286				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	g.chr8:41519408G>A	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.5530C>T	8.37:g.41519408G>A	ENSP00000339620:p.Gln1844*					NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Nonsense_Mutation_p.Q998*|ANK1_uc003xoi.2_Nonsense_Mutation_p.Q1844*|ANK1_uc003xoj.2_Nonsense_Mutation_p.Q1844*|ANK1_uc003xol.2_Nonsense_Mutation_p.Q1682*|ANK1_uc003xom.2_Nonsense_Mutation_p.Q1885*|ANK1_uc011lcl.1_Nonsense_Mutation_p.Q119*|ANK1_uc003xod.2_Nonsense_Mutation_p.Q119*|ANK1_uc003xoc.2_Nonsense_Mutation_p.Q119*|ANK1_uc003xof.2_Intron|MIR486_hsa-mir-486|MI0002470_5'Flank	p.Q1844*	NM_020476	NP_065209	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)		41	5614	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	1844			55 kDa regulatory domain.		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Nonsense_Mutation	SNP	ENST00000347528.4	37	c.5530C>T	CCDS6119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.103166|5.103166	0.94245|0.94245	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000520299|ENST00000347528;ENST00000289734;ENST00000396942;ENST00000522231;ENST00000522543;ENST00000314214;ENST00000265709	.|.	.|.	.|.	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	.|0.307617	.|0.31010	.|N	.|0.008428	T|.	0.67988|.	0.2952|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.69720|.	-0.5069|.	4|.	.|0.66056	.|D	.|0.02	.|.	11.4737|11.4737	0.50284|0.50284	0.0:0.134:0.7271:0.1388|0.0:0.134:0.7271:0.1388	.|.	.|.	.|.	.|.	L|X	1003|1844;1844;1844;119;119;119;1885	.|.	.|ENSP00000265709:Q1885X	P|Q	-|-	2|1	0|0	ANK1|ANK1	41638565|41638565	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.016000|0.016000	0.09150|0.09150	3.166000|3.166000	0.50785|0.50785	2.816000|2.816000	0.96949|0.96949	0.561000|0.561000	0.74099|0.74099	CCA|CAG		0.577	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		30	48	0	0	0	0.010818	0	30	48				
SNTG1	54212	broad.mit.edu	37	8	51571151	51571151	+	Splice_Site	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:51571151G>T	ENST00000522124.1	+	15	1627		c.e15-1		SNTG1_ENST00000518864.1_Splice_Site|SNTG1_ENST00000276467.5_Splice_Site|SNTG1_ENST00000517473.1_Splice_Site	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.?(2)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				ATCTTTTAAAGGTGACCACCT	0.303																																							uc010lxy.1		NA																	2	Unknown(2)		lung(2)	ovary(5)	5						c.e16-1		syntrophin, gamma 1							80.0	70.0	74.0					8																	51571151		2203	4300	6503	SO:0001630	splice_region_variant	54212				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding	g.chr8:51571151G>T	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.967-1G>T	8.37:g.51571151G>T						SNTG1_uc003xqs.1_Splice_Site_p.V323_splice|SNTG1_uc010lxz.1_Splice_Site_p.V323_splice|SNTG1_uc011ldl.1_Splice_Site	p.V323_splice	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN			16	1338	+		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)						Q2M3Q0|Q9NY98	Splice_Site	SNP	ENST00000522124.1	37	c.967_splice	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741139	0.69304	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4878	0.61377	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SNTG1	51733704	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.711000	0.84669	2.226000	0.72624	0.591000	0.81541	.		0.303	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1		Intron	6	71	1	0	2.7689e-08	0.001984	3.38792e-08	6	71				
PCMTD1	115294	broad.mit.edu	37	8	52773652	52773652	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:52773652T>A	ENST00000360540.5	-	3	466	c.60A>T	c.(58-60)gaA>gaT	p.E20D	PCMTD1_ENST00000522514.1_Missense_Mutation_p.E20D|PCMTD1_ENST00000544451.1_Intron|PCMTD1_ENST00000521344.1_Missense_Mutation_p.E20D|PCMTD1_ENST00000519559.1_Intron	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	20						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.E20D(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TATACTGAGCTTCTTTTAAAT	0.358																																							uc003xqx.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(58-60)GAA>GAT		protein-L-isoaspartate (D-aspartate)							51.0	50.0	50.0					8																	52773652		2203	4300	6503	SO:0001583	missense	115294					cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity	g.chr8:52773652T>A		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.60A>T	8.37:g.52773652T>A	ENSP00000353739:p.Glu20Asp					PCMTD1_uc003xqw.3_Missense_Mutation_p.E20D|PCMTD1_uc011ldn.1_Intron|PCMTD1_uc010lya.2_Intron|PCMTD1_uc011ldo.1_Missense_Mutation_p.E20D	p.E20D	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN			2	401	-		Lung NSC(129;0.0795)|all_lung(136;0.144)	20					Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	c.60A>T	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	T	18.16	3.562152	0.65538	.	.	ENSG00000168300	ENST00000360540;ENST00000522514;ENST00000521344	T;T;T	0.42513	0.97;0.97;0.97	5.33	4.17	0.49024	.	0.000000	0.85682	D	0.000000	T	0.32376	0.0827	L	0.31845	0.965	0.80722	D	1	B	0.21381	0.055	B	0.27715	0.082	T	0.12167	-1.0558	10	0.35671	T	0.21	-14.8219	10.8341	0.46677	0.0:0.0742:0.0:0.9258	.	20	Q96MG8	PCMD1_HUMAN	D	20	ENSP00000353739:E20D;ENSP00000428099:E20D;ENSP00000430168:E20D	ENSP00000353739:E20D	E	-	3	2	PCMTD1	52936205	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.368000	0.44222	2.144000	0.66660	0.528000	0.53228	GAA		0.358	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937		21	53	0	0	0	0.014323	0	21	53				
CLVS1	157807	broad.mit.edu	37	8	62212596	62212596	+	Silent	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:62212596T>A	ENST00000519846.1	+	3	682	c.210T>A	c.(208-210)cgT>cgA	p.R70R	RP11-787D18.1_ENST00000518064.1_RNA|RP11-787D18.1_ENST00000521801.1_RNA|CLVS1_ENST00000518592.1_Intron|CLVS1_ENST00000325897.4_Silent_p.R70R			Q8IUQ0	CLVS1_HUMAN	clavesin 1	70					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						GATTTTTACGTACAGATGATG	0.473																																							uc003xuh.2		NA																	0				skin(4)|ovary(1)	5						c.(208-210)CGT>CGA		retinaldehyde binding protein 1-like 1							125.0	106.0	112.0					8																	62212596		2203	4300	6503	SO:0001819	synonymous_variant	157807				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr8:62212596T>A	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.210T>A	8.37:g.62212596T>A						CLVS1_uc003xug.2_Silent_p.R70R|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Silent_p.R70R	p.R70R	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN			2	534	+			70					B2R7M5|C8UZT3|Q8NB32	Silent	SNP	ENST00000519846.1	37	c.210T>A	CCDS6176.1																																																																																				0.473	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519		22	68	0	0	0	0.014323	0	22	68				
TRPA1	8989	broad.mit.edu	37	8	72969995	72969995	+	Silent	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:72969995A>T	ENST00000262209.4	-	9	1257	c.1050T>A	c.(1048-1050)acT>acA	p.T350T		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	350					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.T350T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ATGCAGAAGCAGTTGCTAATA	0.373																																							uc003xza.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|lung(1)|kidney(1)	6						c.(1048-1050)ACT>ACA		ankyrin-like protein 1	Menthol(DB00825)						106.0	104.0	105.0					8																	72969995		2203	4300	6503	SO:0001819	synonymous_variant	8989					integral to plasma membrane		g.chr8:72969995A>T	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1050T>A	8.37:g.72969995A>T							p.T350T	NM_007332	NP_015628	O75762	TRPA1_HUMAN	Epithelial(68;0.223)		9	1225	-			350			Cytoplasmic (Potential).|ANK 9.		A6NIN6	Silent	SNP	ENST00000262209.4	37	c.1050T>A	CCDS34908.1																																																																																				0.373	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332		15	52	0	0	0	0.00499	0	15	52				
ZFHX4	79776	broad.mit.edu	37	8	77776697	77776697	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:77776697C>A	ENST00000521891.2	+	11	11195	c.10747C>A	c.(10747-10749)Cag>Aag	p.Q3583K	ZFHX4_ENST00000050961.6_Missense_Mutation_p.Q3534K|ZFHX4_ENST00000455469.2_Missense_Mutation_p.Q3538K|ZFHX4_ENST00000518282.1_Missense_Mutation_p.Q3557K	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3534					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.Q3567K(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGAGCTGAGCCAGAAGCTAGA	0.453										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(10612-10614)CAG>AAG		zinc finger homeodomain 4							61.0	60.0	60.0					8																	77776697		2037	4215	6252	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77776697C>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10747C>A	8.37:g.77776697C>A	ENSP00000430497:p.Gln3583Lys	HNSCC(33;0.089)					p.Q3538K	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		11	10999	+			3534					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.10612C>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	15.03	2.711119	0.48517	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.67171	-0.25;-0.15;-0.21;-0.23	4.6	4.6	0.57074	.	0.000000	0.42294	U	0.000722	T	0.79986	0.4541	M	0.66939	2.045	0.80722	D	1	P	0.48911	0.917	D	0.63488	0.915	T	0.82102	-0.0623	10	0.72032	D	0.01	.	17.9764	0.89129	0.0:1.0:0.0:0.0	.	3538	Q86UP3-4	.	K	3583;3567;3538;3534;3557	ENSP00000430497:Q3583K;ENSP00000399605:Q3538K;ENSP00000050961:Q3534K;ENSP00000430848:Q3557K	ENSP00000050961:Q3534K	Q	+	1	0	ZFHX4	77939252	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.563000	0.82314	2.551000	0.86045	0.650000	0.86243	CAG		0.453	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		29	65	1	0	2.48779e-11	0.005443	3.36976e-11	29	65				
OSR2	116039	broad.mit.edu	37	8	99961384	99961384	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:99961384C>A	ENST00000297565.4	+	2	700	c.204C>A	c.(202-204)acC>acA	p.T68T	OSR2_ENST00000523368.1_Silent_p.T68T|OSR2_ENST00000457907.2_Silent_p.T189T|OSR2_ENST00000522510.1_Silent_p.T68T|OSR2_ENST00000435298.2_Silent_p.T68T	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	68					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.T68T(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			CCCGCTCCACCATCACGGAGA	0.652																																							uc003yir.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(202-204)ACC>ACA		odd-skipped related 2 isoform a							59.0	66.0	64.0					8																	99961384		2038	4179	6217	SO:0001819	synonymous_variant	116039				bone morphogenesis|chondrocyte differentiation|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic hindlimb morphogenesis|embryonic leg joint morphogenesis|embryonic skeletal joint morphogenesis|eyelid development in camera-type eye|head development|mesonephros development|metanephros development|middle ear morphogenesis|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|osteoblast proliferation|palate development|positive regulation of bone mineralization|positive regulation of epithelial cell proliferation|positive regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|zinc ion binding	g.chr8:99961384C>A	AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.204C>A	8.37:g.99961384C>A						OSR2_uc010mbn.2_Silent_p.T68T|OSR2_uc003yiq.2_Silent_p.T68T|OSR2_uc011lgx.1_Silent_p.T189T	p.T68T	NM_001142462	NP_001135934	Q8N2R0	OSR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.0136)		2	739	+	Breast(36;4.14e-07)		68					A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Silent	SNP	ENST00000297565.4	37	c.204C>A	CCDS47901.1																																																																																				0.652	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379505.1	NM_053001		34	29	1	0	5.85407e-19	0.01441	9.48359e-19	34	29				
CSMD3	114788	broad.mit.edu	37	8	113420594	113420594	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:113420594G>T	ENST00000297405.5	-	34	5802	c.5558C>A	c.(5557-5559)aCt>aAt	p.T1853N	CSMD3_ENST00000343508.3_Missense_Mutation_p.T1813N|CSMD3_ENST00000352409.3_Intron|CSMD3_ENST00000455883.2_Missense_Mutation_p.T1749N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1853	CUB 10. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T1813N(1)|p.T1853N(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCCAACTGAAGTAAATCGAAT	0.338										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(5557-5559)ACT>AAT		CUB and Sushi multiple domains 3 isoform 1							177.0	174.0	175.0					8																	113420594		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113420594G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5558C>A	8.37:g.113420594G>T	ENSP00000297405:p.Thr1853Asn	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Missense_Mutation_p.T1813N|CSMD3_uc011lhx.1_Missense_Mutation_p.T1749N	p.T1853N	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			34	5717	-			1853			Extracellular (Potential).|CUB 10.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.5558C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100798	0.56183	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883	T;T;T	0.60171	0.21;0.21;0.21	4.98	4.98	0.66077	CUB (5);	0.070646	0.56097	D	0.000036	T	0.65668	0.2713	L	0.45051	1.395	0.80722	D	1	P;P;D	0.54601	0.913;0.929;0.967	P;P;P	0.58520	0.71;0.665;0.84	T	0.59584	-0.7427	10	0.27082	T	0.32	.	18.8043	0.92030	0.0:0.0:1.0:0.0	.	1749;1853;1813	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	N	1813;1853;1749	ENSP00000345799:T1813N;ENSP00000297405:T1853N;ENSP00000412263:T1749N	ENSP00000297405:T1853N	T	-	2	0	CSMD3	113489770	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.273000	0.65564	2.750000	0.94351	0.591000	0.81541	ACT		0.338	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		41	62	1	0	1.21353e-23	0.01441	2.09141e-23	41	62				
ZNF572	137209	broad.mit.edu	37	8	125989475	125989475	+	Missense_Mutation	SNP	A	A	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:125989475A>T	ENST00000319286.5	+	3	1119	c.965A>T	c.(964-966)cAt>cTt	p.H322L		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H322L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			CAGAGAATACATACAGGAGAA	0.403										HNSCC(60;0.17)																													uc003yrr.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(964-966)CAT>CTT		zinc finger protein 572							51.0	54.0	53.0					8																	125989475		2203	4299	6502	SO:0001583	missense	137209				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:125989475A>T	BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.965A>T	8.37:g.125989475A>T	ENSP00000319305:p.His322Leu	HNSCC(60;0.17)					p.H322L	NM_152412	NP_689625	Q7Z3I7	ZN572_HUMAN	STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		3	1120	+	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		322			C2H2-type 7.		A1L4F1|Q8N1Q0	Missense_Mutation	SNP	ENST00000319286.5	37	c.965A>T	CCDS6354.1	.	.	.	.	.	.	.	.	.	.	A	19.38	3.817342	0.70912	.	.	ENSG00000180938	ENST00000319286	T	0.67345	-0.26	4.85	4.85	0.62838	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000108	D	0.84737	0.5538	M	0.92268	3.29	0.38252	D	0.941628	D	0.89917	1.0	D	0.91635	0.999	D	0.89426	0.3713	10	0.87932	D	0	-11.5493	12.4173	0.55500	1.0:0.0:0.0:0.0	.	322	Q7Z3I7	ZN572_HUMAN	L	322	ENSP00000319305:H322L	ENSP00000319305:H322L	H	+	2	0	ZNF572	126058656	1.000000	0.71417	0.917000	0.36280	0.981000	0.71138	8.986000	0.93492	2.042000	0.60477	0.533000	0.62120	CAT		0.403	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1	NM_152412		21	55	0	0	0	0.008871	0	21	55				
ADCY8	114	broad.mit.edu	37	8	131792865	131792865	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:131792865G>T	ENST00000286355.5	-	18	5619	c.3527C>A	c.(3526-3528)cCc>cAc	p.P1176H	ADCY8_ENST00000377928.3_Missense_Mutation_p.P1045H	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	1176					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.P1176H(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GAATGGGTTGGGTTGGACTCT	0.517										HNSCC(32;0.087)																													uc003ytd.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(4)|large_intestine(1)|central_nervous_system(1)	6						c.(3526-3528)CCC>CAC		adenylate cyclase 8							183.0	193.0	189.0					8																	131792865		2203	4300	6503	SO:0001583	missense	114				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding	g.chr8:131792865G>T	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.3527C>A	8.37:g.131792865G>T	ENSP00000286355:p.Pro1176His	HNSCC(32;0.087)				ADCY8_uc010mds.2_Missense_Mutation_p.P1045H	p.P1176H	NM_001115	NP_001106	P40145	ADCY8_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000538)		18	3783	-	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		1176			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000286355.5	37	c.3527C>A	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902665	0.92035	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.78707	-1.2;-1.19	5.79	5.79	0.91817	.	0.057910	0.64402	D	0.000001	D	0.82628	0.5078	L	0.42245	1.32	0.50039	D	0.999841	D;D	0.64830	0.981;0.994	P;P	0.58660	0.843;0.706	T	0.82020	-0.0664	10	0.48119	T	0.1	.	19.0195	0.92908	0.0:0.0:1.0:0.0	.	1045;1176	E7EVL1;P40145	.;ADCY8_HUMAN	H	1176;1045	ENSP00000286355:P1176H;ENSP00000367161:P1045H	ENSP00000286355:P1176H	P	-	2	0	ADCY8	131862047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.661000	0.98601	2.746000	0.94184	0.655000	0.94253	CCC		0.517	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			58	74	1	0	1.54043e-34	0.01441	2.92899e-34	58	74				
CYP11B1	1584	broad.mit.edu	37	8	143960556	143960556	+	Missense_Mutation	SNP	T	T	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr8:143960556T>G	ENST00000292427.4	-	2	319	c.287A>C	c.(286-288)gAc>gCc	p.D96A	CYP11B1_ENST00000377675.3_Missense_Mutation_p.D141A|CYP11B1_ENST00000517471.1_Missense_Mutation_p.D96A	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	96					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.D96A(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CTTCTCCACGTCCTCCGGCAG	0.632									Familial Hyperaldosteronism type I																														uc003yxi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(286-288)GAC>GCC		cytochrome P450, family 11, subfamily B,	Mitotane(DB00648)						202.0	149.0	167.0					8																	143960556		2203	4300	6503	SO:0001583	missense	1584	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143960556T>G	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.287A>C	8.37:g.143960556T>G	ENSP00000292427:p.Asp96Ala					CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Missense_Mutation_p.D96A|CYP11B1_uc010mey.2_Missense_Mutation_p.D141A	p.D96A	NM_000497	NP_000488	P15538	C11B1_HUMAN			2	294	-	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		96					Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	c.287A>C	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	T	15.28	2.786075	0.49997	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.78816	-0.16;-0.16;-1.21	3.55	3.55	0.40652	.	0.000000	0.47852	D	0.000212	D	0.86226	0.5882	M	0.84773	2.715	0.45747	D	0.99864	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.74674	0.976;0.984;0.965	D	0.84734	0.0747	10	0.33141	T	0.24	.	8.7788	0.34778	0.0:0.0:0.0:1.0	.	141;96;96	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	A	96;96;141	ENSP00000292427:D96A;ENSP00000428043:D96A;ENSP00000366903:D141A	ENSP00000292427:D96A	D	-	2	0	CYP11B1	143957558	0.915000	0.31059	0.149000	0.22428	0.415000	0.31203	4.519000	0.60517	1.370000	0.46153	0.397000	0.26171	GAC		0.632	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2			8	83	0	0	0	0.004482	0	8	83				
ADAMTSL1	92949	broad.mit.edu	37	9	18574147	18574147	+	Silent	SNP	T	T	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr9:18574147T>C	ENST00000380548.4	+	4	696	c.357T>C	c.(355-357)tgT>tgC	p.C119C	ADAMTSL1_ENST00000380566.4_Silent_p.C119C|ADAMTSL1_ENST00000431052.2_Silent_p.C119C|MIR3152_ENST00000579801.1_RNA|ADAMTSL1_ENST00000380570.4_Silent_p.C119C|ADAMTSL1_ENST00000276935.6_Silent_p.C119C|ADAMTSL1_ENST00000327883.7_Silent_p.C119C	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	119						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C119C(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		ACAACCCATGTTCACTCAAGT	0.458																																							uc003zne.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5						c.(355-357)TGT>TGC		ADAMTS-like 1 isoform 4 precursor							186.0	159.0	168.0					9																	18574147		2203	4300	6503	SO:0001819	synonymous_variant	92949					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr9:18574147T>C	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.357T>C	9.37:g.18574147T>C						ADAMTSL1_uc003znb.2_Silent_p.C119C|ADAMTSL1_uc003znc.3_Silent_p.C119C	p.C119C	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN		GBM - Glioblastoma multiforme(50;1.29e-17)	4	484	+			119					A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	ENST00000380548.4	37	c.357T>C	CCDS47954.1																																																																																				0.458	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			42	94	0	0	0	0.01441	0	42	94				
PRUNE2	158471	broad.mit.edu	37	9	79325691	79325691	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr9:79325691G>T	ENST00000376718.3	-	8	1622	c.1499C>A	c.(1498-1500)cCc>cAc	p.P500H	PRUNE2_ENST00000428286.1_Missense_Mutation_p.P141H	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	500					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.P500H(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						AGAAGCCATGGGTGCTGGGTC	0.567																																							uc010mpk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1498-1500)CCC>CAC		prune homolog 2							50.0	48.0	48.0					9																	79325691		1568	3582	5150	SO:0001583	missense	158471				apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity	g.chr9:79325691G>T	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.1499C>A	9.37:g.79325691G>T	ENSP00000365908:p.Pro500His						p.P500H	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN			8	1623	-			500					B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	c.1499C>A	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262878	0.59431	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.62364	0.13;0.03	5.88	5.88	0.94601	.	0.125088	0.36854	N	0.002375	T	0.69984	0.3172	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.69142	0.962	T	0.72981	-0.4126	10	0.87932	D	0	-6.5135	20.2228	0.98330	0.0:0.0:1.0:0.0	.	500	Q8WUY3	PRUN2_HUMAN	H	500;141;499	ENSP00000365908:P500H;ENSP00000397425:P141H	ENSP00000365908:P500H	P	-	2	0	PRUNE2	78515511	1.000000	0.71417	0.987000	0.45799	0.984000	0.73092	5.352000	0.66028	2.789000	0.95967	0.655000	0.94253	CCC		0.567	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		20	17	1	0	1.00905e-13	0.008871	1.45432e-13	20	17				
XPA	7507	broad.mit.edu	37	9	100459595	100459595	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr9:100459595C>A	ENST00000375128.4	-	0	44				AL445531.1_ENST00000582499.1_RNA	NM_000380.3	NP_000371.1	P23025	XPA_HUMAN	xeroderma pigmentosum, complementation group A						DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(4)|large_intestine(1)|lung(4)|prostate(1)	11		Acute lymphoblastic leukemia(62;0.158)				CTCCGAGGACCTAGCTCCCAG	0.731			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														uc004axr.3		NA	yes	Rec		Xeroderma pigmentosum (A)	9	9q22.3	7507	Mis|N|F|S	"""xeroderma pigmentosum, complementation group A"""			E		skin basal cell|skin squamous cell|melanoma			0				breast(1)	1						c.(-22--18)TAGGT>TATGT	NER	xeroderma pigmentosum, complementation group A							11.0	15.0	14.0					9																	100459595		1872	3822	5694			7507	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	nucleotide-excision repair, DNA damage removal	nucleoplasm	damaged DNA binding|metal ion binding|nucleotide binding|protein domain specific binding|protein homodimerization activity	g.chr9:100459595C>A	D14533	CCDS6729.1	9q22.3	2014-09-17			ENSG00000136936	ENSG00000136936			12814	protein-coding gene	gene with protein product		611153					Standard	NM_000380		Approved	XPAC, XP1	uc004axr.4	P23025	OTTHUMG00000020330	ENST00000375128.4:c.-21G>T	9.37:g.100459595C>A						XPA_uc004axs.3_RNA		NM_000380	NP_000371	P23025	XPA_HUMAN			1	97	-		Acute lymphoblastic leukemia(62;0.158)						Q5T1U9|Q6LCW7|Q6LD02	Translation_Start_Site	SNP	ENST00000375128.4	37	c.-20G>T	CCDS6729.1																																																																																				0.731	XPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053332.1	NM_000380		6	26	1	0	1.12685e-05	0.004482	1.28195e-05	6	26				
RNF20	56254	broad.mit.edu	37	9	104303258	104303258	+	Splice_Site	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr9:104303258G>C	ENST00000389120.3	+	5	718		c.e5+1			NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase						histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		AACAGTGGAGGTGAGGCAAGA	0.438																																							uc004bbn.2		NA																	1	Unknown(1)		lung(1)	ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8						c.e5+1		ring finger protein 20							52.0	57.0	55.0					9																	104303258		2203	4300	6503	SO:0001630	splice_region_variant	56254				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr9:104303258G>C	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.628+1G>C	9.37:g.104303258G>C							p.D210_splice	NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)	5	718	+		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)						A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Splice_Site	SNP	ENST00000389120.3	37	c.628_splice	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.272920	0.40194	.	.	ENSG00000155827	ENST00000389120	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7427	0.88411	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF20	103343079	1.000000	0.71417	1.000000	0.80357	0.516000	0.34256	6.473000	0.73572	2.374000	0.81015	0.305000	0.20034	.		0.438	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592	Intron	26	28	0	0	0	0.00333	0	26	28				
ABCA1	19	broad.mit.edu	37	9	107547747	107547747	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr9:107547747C>A	ENST00000374736.3	-	49	6969	c.6575G>T	c.(6574-6576)aGc>aTc	p.S2192I		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	2192					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.S2192N(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GGAGAGGATGCTGAATATCCT	0.418																																							uc004bcl.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17	GRCh37	CI003726	ABCA1	I		c.(6574-6576)AGC>ATC		ATP-binding cassette, sub-family A member 1	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)						125.0	122.0	123.0					9																	107547747		2203	4300	6503	SO:0001583	missense	19				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding	g.chr9:107547747C>A	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.6575G>T	9.37:g.107547747C>A	ENSP00000363868:p.Ser2192Ile					NIPSNAP3B_uc004bcj.1_Intron	p.S2192I	NM_005502	NP_005493	O95477	ABCA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;0.023)	49	6888	-			2192					Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	c.6575G>T	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134190	0.77662	.	.	ENSG00000165029	ENST00000374736	D	0.83591	-1.74	6.0	6.0	0.97389	.	0.086315	0.85682	D	0.000000	D	0.86822	0.6025	M	0.84219	2.685	0.80722	D	1	P	0.47962	0.903	B	0.42738	0.396	D	0.88200	0.2883	10	0.62326	D	0.03	.	20.5469	0.99278	0.0:1.0:0.0:0.0	.	2192	O95477	ABCA1_HUMAN	I	2192	ENSP00000363868:S2192I	ENSP00000363868:S2192I	S	-	2	0	ABCA1	106587568	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.363000	0.52321	2.850000	0.98022	0.650000	0.86243	AGC		0.418	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502		34	37	1	0	8.4185e-14	0.012213	1.22204e-13	34	37				
SPTAN1	6709	broad.mit.edu	37	9	131345394	131345394	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr9:131345394G>T	ENST00000372731.4	+	15	1955	c.1845G>T	c.(1843-1845)caG>caT	p.Q615H	SPTAN1_ENST00000372739.3_Missense_Mutation_p.Q615H|SPTAN1_ENST00000358161.5_Missense_Mutation_p.Q615H	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	615					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.Q615H(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AGAAGCATCAGGCTTTTGAGG	0.463																																					NSCLC(120;833 1744 2558 35612 37579)	NSCLC(120;833 1744 2558 35612 37579)	uc004bvl.3		NA																	1	Substitution - Missense(1)		lung(1)	breast(5)|ovary(4)|pancreas(1)	10						c.(1843-1845)CAG>CAT		spectrin, alpha, non-erythrocytic 1							65.0	67.0	66.0					9																	131345394		2203	4300	6503	SO:0001583	missense	6709				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton	g.chr9:131345394G>T	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.1845G>T	9.37:g.131345394G>T	ENSP00000361816:p.Gln615His					SPTAN1_uc011mbg.1_Missense_Mutation_p.Q615H|SPTAN1_uc011mbh.1_Missense_Mutation_p.Q627H|SPTAN1_uc004bvm.3_Missense_Mutation_p.Q615H|SPTAN1_uc004bvn.3_Missense_Mutation_p.Q615H	p.Q615H	NM_003127	NP_003118	Q13813	SPTA2_HUMAN			15	1958	+			615			Spectrin 7.		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	c.1845G>T	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722205	0.68959	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.38887	1.11;1.11;1.11	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.66416	0.2787	M	0.83384	2.64	0.80722	D	1	D;D;D;D;D	0.69078	0.997;0.995;0.993;0.994;0.993	D;D;D;D;D	0.85130	0.997;0.916;0.936;0.973;0.964	T	0.69767	-0.5056	10	0.72032	D	0.01	.	12.6568	0.56791	0.0745:0.0:0.9255:0.0	.	615;615;615;615;615	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	H	615	ENSP00000350882:Q615H;ENSP00000361816:Q615H;ENSP00000361824:Q615H	ENSP00000350882:Q615H	Q	+	3	2	SPTAN1	130385215	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.460000	0.66691	2.824000	0.97209	0.655000	0.94253	CAG		0.463	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		5	53	1	0	3.59834e-05	0.001168	3.99267e-05	5	53				
ABCA2	20	broad.mit.edu	37	9	139910907	139910907	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr9:139910907C>A	ENST00000371605.3	-	20	3084	c.2937G>T	c.(2935-2937)atG>atT	p.M979I	ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000265662.5_Missense_Mutation_p.M980I|ABCA2_ENST00000341511.6_Missense_Mutation_p.M980I			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	979					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)	p.M980I(1)		central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GCTCCTCCTCCATGCCACGGG	0.642																																							uc011mem.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2935-2937)ATG>ATT		ATP-binding cassette, sub-family A, member 2							88.0	97.0	94.0					9																	139910907		2105	4223	6328	SO:0001583	missense	20				cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr9:139910907C>A	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.2937G>T	9.37:g.139910907C>A	ENSP00000360666:p.Met979Ile					ABCA2_uc011mel.1_Missense_Mutation_p.M980I|ABCA2_uc004ckl.1_Missense_Mutation_p.M910I|ABCA2_uc004ckm.1_Missense_Mutation_p.M1010I|ABCA2_uc004ckn.1_RNA	p.M979I	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)	20	3085	-	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	979					A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	37	c.2937G>T		.	.	.	.	.	.	.	.	.	.	c	0.287	-0.982765	0.02180	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.85955	-2.05;-2.05;-2.05	4.23	2.21	0.28008	.	0.231817	0.39274	N	0.001418	T	0.55449	0.1921	N	0.02973	-0.45	0.28839	N	0.896736	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.51545	-0.8692	10	0.05620	T	0.96	.	2.2495	0.04040	0.1363:0.4692:0.2067:0.1879	.	979;1010	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	I	980;979;1010;980	ENSP00000265662:M980I;ENSP00000360666:M979I;ENSP00000344155:M980I	ENSP00000265662:M980I	M	-	3	0	ABCA2	139030728	0.003000	0.15002	1.000000	0.80357	0.525000	0.34531	-1.349000	0.02627	1.898000	0.54952	0.306000	0.20318	ATG		0.642	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606		14	120	1	0	0.000219431	0.00245	0.000235729	14	120				
XG	7499	broad.mit.edu	37	X	2688630	2688630	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:2688630C>A	ENST00000381174.5	+	2	326	c.101C>A	c.(100-102)cCt>cAt	p.P34H	XG_ENST00000426774.1_Missense_Mutation_p.P34H|XG_ENST00000419513.2_Missense_Mutation_p.P34H			P55808	XG_HUMAN	Xg blood group	34						integral component of plasma membrane (GO:0005887)		p.P34H(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CTTGATGACCCTGGTAAGTGC	0.488																																							uc011mhg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(100-102)CCT>CAT		XG glycoprotein isoform 1 precursor							275.0	244.0	254.0					X																	2688630		2203	4296	6499	SO:0001583	missense	7499					integral to membrane|plasma membrane		g.chrX:2688630C>A	AF380356	CCDS14120.1, CCDS48073.1	Xp22.32	2014-07-19	2006-01-12		ENSG00000124343	ENSG00000124343		"""Blood group antigens"", ""Pseudoautosomal regions / PAR1"""	12806	protein-coding gene	gene with protein product		300879	"""Xg blood group (pseudoautosomal boundary-divided on the X chromosome)"""	PBDX		8054981	Standard	NM_175569		Approved		uc004cqp.3	P55808	OTTHUMG00000021075	ENST00000381174.5:c.101C>A	X.37:g.2688630C>A	ENSP00000370566:p.Pro34His					XG_uc010ndb.2_RNA|XG_uc004cqp.2_Missense_Mutation_p.P34H	p.P34H	NM_175569	NP_780778	P55808	XG_HUMAN			2	324	+		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)	34			Extracellular (Potential).		E9PCH1|Q496N8|Q496N9|Q496P0|Q71BZ5	Missense_Mutation	SNP	ENST00000381174.5	37	c.101C>A	CCDS14120.1	.	.	.	.	.	.	.	.	.	.	C	9.770	1.172352	0.21704	.	.	ENSG00000124343	ENST00000381174;ENST00000419513;ENST00000426774	T;T;T	0.25414	1.8;1.8;1.8	1.5	0.613	0.17597	.	0.626652	0.12822	U	0.436378	T	0.36991	0.0987	L	0.53249	1.67	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.68943	0.961;0.935	T	0.13818	-1.0495	10	0.59425	D	0.04	.	3.5997	0.08020	0.0:0.7371:0.0:0.2629	.	34;34	P55808;P55808-3	XG_HUMAN;.	H	34	ENSP00000370566:P34H;ENSP00000411004:P34H;ENSP00000398503:P34H	ENSP00000370566:P34H	P	+	2	0	XG	2698630	0.902000	0.30710	0.005000	0.12908	0.001000	0.01503	1.859000	0.39418	0.131000	0.18576	-0.342000	0.07992	CCT		0.488	XG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055633.2	NM_175569		30	76	1	0	1.74807e-11	0.010818	2.38373e-11	30	76				
MXRA5	25878	broad.mit.edu	37	X	3235859	3235859	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:3235859A>G	ENST00000217939.6	-	6	6017	c.5863T>C	c.(5863-5865)Tcc>Ccc	p.S1955P		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1955	Ig-like C2-type 4.					extracellular vesicular exosome (GO:0070062)		p.S1955P(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGGTAGTGGGAGGCTAGGATT	0.572																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(5863-5865)TCC>CCC		adlican precursor							122.0	92.0	103.0					X																	3235859		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3235859A>G	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5863T>C	X.37:g.3235859A>G	ENSP00000217939:p.Ser1955Pro						p.S1955P	NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN			6	6020	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	1955			Ig-like C2-type 4.		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.5863T>C	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	a	0.147	-1.096185	0.01843	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.78481	-1.18	3.64	-3.27	0.05048	Immunoglobulin-like (1);	0.229900	0.22162	U	0.063777	T	0.43411	0.1246	N	0.02011	-0.69	0.09310	N	1	B	0.17667	0.023	B	0.25140	0.058	T	0.36529	-0.9744	10	0.30078	T	0.28	.	3.1709	0.06551	0.3664:0.4135:0.0839:0.1362	.	1955	Q9NR99	MXRA5_HUMAN	P	1955	ENSP00000217939:S1955P	ENSP00000217939:S1955P	S	-	1	0	MXRA5	3245859	0.680000	0.27605	0.002000	0.10522	0.066000	0.16364	1.085000	0.30840	-0.630000	0.05567	0.486000	0.48141	TCC		0.572	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		12	35	0	0	0	0.013537	0	12	35				
MXRA5	25878	broad.mit.edu	37	X	3240143	3240143	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:3240143G>T	ENST00000217939.6	-	5	3737	c.3583C>A	c.(3583-3585)Caa>Aaa	p.Q1195K		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1195						extracellular vesicular exosome (GO:0070062)		p.Q1195K(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTCTCCACTTGACTTGAAATC	0.473																																							uc004crg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(3583-3585)CAA>AAA		adlican precursor							108.0	105.0	106.0					X																	3240143		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3240143G>T	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3583C>A	X.37:g.3240143G>T	ENSP00000217939:p.Gln1195Lys						p.Q1195K	NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN			5	3740	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	1195					Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.3583C>A	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	g	0.459	-0.889998	0.02511	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.60672	0.17	3.08	0.811	0.18739	.	1.093570	0.07190	U	0.855534	T	0.29882	0.0747	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21484	-1.0244	10	0.02654	T	1	.	5.9034	0.18980	0.0:0.1356:0.2395:0.6249	.	1195	Q9NR99	MXRA5_HUMAN	K	1195	ENSP00000217939:Q1195K	ENSP00000217939:Q1195K	Q	-	1	0	MXRA5	3250143	0.003000	0.15002	0.001000	0.08648	0.005000	0.04900	0.630000	0.24553	-0.025000	0.13918	0.519000	0.50382	CAA		0.473	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		41	59	1	0	4.92203e-23	0.00623	8.41106e-23	41	59				
FANCB	2187	broad.mit.edu	37	X	14863393	14863393	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:14863393C>A	ENST00000324138.3	-	7	1665	c.1512G>T	c.(1510-1512)gtG>gtT	p.V504V	FANCB_ENST00000398334.1_Silent_p.V504V	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	504					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					ATGATAAAGTCACATCATTCA	0.348								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc004cwg.1		NA																	0				lung(1)	1						c.(1510-1512)GTG>GTT	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia complementation group B							61.0	60.0	60.0					X																	14863393		2200	4290	6490	SO:0001819	synonymous_variant	2187	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	nucleoplasm		g.chrX:14863393C>A	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1512G>T	X.37:g.14863393C>A						FANCB_uc004cwh.1_Silent_p.V504V	p.V504V	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN			8	1780	-	Hepatocellular(33;0.183)		504					B2RMZ4|Q7Z2U2|Q86XG1	Silent	SNP	ENST00000324138.3	37	c.1512G>T	CCDS14161.1																																																																																				0.348	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633		18	57	1	0	3.32936e-07	0.006122	3.95422e-07	18	57				
MAP3K15	389840	broad.mit.edu	37	X	19389565	19389565	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:19389565G>T	ENST00000338883.4	-	23	3191	c.3192C>A	c.(3190-3192)caC>caA	p.H1064Q	MAP3K15_ENST00000359173.3_Missense_Mutation_p.H499Q|MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000469203.2_Missense_Mutation_p.H896Q	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	1064							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.H1111Q(1)|p.H539Q(1)		NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					CCATCACCCGGTGCTCTGGGG	0.502																																							uc004czk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|lung(2)|stomach(1)|skin(1)	7						c.(1615-1617)CAC>CAA		mitogen-activated protein kinase kinase kinase							130.0	105.0	113.0					X																	19389565		2203	4300	6503	SO:0001583	missense	389840						ATP binding|MAP kinase kinase kinase activity|metal ion binding	g.chrX:19389565G>T	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.3192C>A	X.37:g.19389565G>T	ENSP00000345629:p.His1064Gln					MAP3K15_uc004czj.1_Missense_Mutation_p.H499Q|MAP3K15_uc004czi.1_5'UTR	p.H539Q	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN			24	3254	-	Hepatocellular(33;0.183)		1064					A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	37	c.1617C>A		.	.	.	.	.	.	.	.	.	.	G	10.10	1.257680	0.22965	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.70869	-0.49;-0.52;-0.48	5.43	3.66	0.41972	.	0.202716	0.49305	D	0.000141	T	0.60366	0.2263	L	0.48877	1.53	0.29680	N	0.84178	B;B	0.22146	0.03;0.065	B;B	0.23852	0.049;0.025	T	0.55698	-0.8100	10	0.41790	T	0.15	.	7.0213	0.24916	0.1488:0.2595:0.5917:0.0	.	539;1064	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	Q	1064;499;896	ENSP00000345629:H1064Q;ENSP00000352093:H499Q;ENSP00000428356:H896Q	ENSP00000345629:H1064Q	H	-	3	2	MAP3K15	19299486	1.000000	0.71417	0.001000	0.08648	0.802000	0.45316	1.621000	0.36986	0.490000	0.27771	-0.332000	0.08345	CAC		0.502	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671		37	77	1	0	2.54651e-27	0.006999	4.54333e-27	37	77				
ACOT9	23597	broad.mit.edu	37	X	23723693	23723693	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:23723693G>T	ENST00000336430.7	-	12	1056	c.925C>A	c.(925-927)Cgg>Agg	p.R309R	ACOT9_ENST00000379303.5_Silent_p.R318R|ACOT9_ENST00000379295.1_Silent_p.R249R	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	309					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)	p.R309R(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						CCAAAGATCCGATTGAAAATG	0.398																																							uc004dap.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(925-927)CGG>AGG		acyl-Coenzyme A thioesterase 2, mitochondrial							135.0	127.0	130.0					X																	23723693		2203	4300	6503	SO:0001819	synonymous_variant	23597				acyl-CoA metabolic process	mitochondrion	acetyl-CoA hydrolase activity|carboxylesterase activity	g.chrX:23723693G>T	AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.925C>A	X.37:g.23723693G>T						ACOT9_uc004dan.2_Silent_p.R59R|ACOT9_uc004dao.2_Silent_p.R318R|ACOT9_uc004daq.2_Silent_p.R267R|ACOT9_uc004dar.2_Silent_p.R249R|ACOT9_uc011mjt.1_RNA|ACOT9_uc004das.2_Silent_p.R249R	p.R309R	NM_001033583	NP_001028755	Q9Y305	ACOT9_HUMAN			12	1071	-			309					B3KNC9|B7ZM94	Silent	SNP	ENST00000336430.7	37	c.925C>A	CCDS35216.1																																																																																				0.398	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056065.1	NM_012332		46	110	1	0	5.34276e-22	0.01441	9.0159e-22	46	110				
IL1RAPL1	11141	broad.mit.edu	37	X	29938179	29938179	+	Missense_Mutation	SNP	G	G	C			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:29938179G>C	ENST00000378993.1	+	8	1698	c.1025G>C	c.(1024-1026)cGt>cCt	p.R342P	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.R342P	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	342	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.R342P(4)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						GGAAATGGACGTCGACACGCC	0.438																																							uc004dby.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(3)|lung(1)|pancreas(1)	5						c.(1024-1026)CGT>CCT		interleukin 1 receptor accessory protein-like 1							151.0	122.0	132.0					X																	29938179		2202	4300	6502	SO:0001583	missense	11141				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity	g.chrX:29938179G>C	AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1025G>C	X.37:g.29938179G>C	ENSP00000368278:p.Arg342Pro						p.R342P	NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN			8	1533	+			342			Extracellular (Potential).|Ig-like C2-type 3.		A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	c.1025G>C	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810293	0.90707	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.67698	-0.28;-0.28	6.03	6.03	0.97812	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83041	0.5168	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82499	-0.0427	9	.	.	.	.	19.5069	0.95121	0.0:0.0:1.0:0.0	.	342	Q9NZN1	IRPL1_HUMAN	P	342	ENSP00000368278:R342P;ENSP00000305200:R342P	.	R	+	2	0	IL1RAPL1	29848100	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	9.476000	0.97823	2.561000	0.86390	0.523000	0.50628	CGT		0.438	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271		28	59	0	0	0	0.007291	0	28	59				
MAGEB1	4112	broad.mit.edu	37	X	30269550	30269550	+	Missense_Mutation	SNP	A	A	G			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:30269550A>G	ENST00000378981.3	+	4	1261	c.940A>G	c.(940-942)Aga>Gga	p.R314G	MAGEB1_ENST00000397550.1_Missense_Mutation_p.R314G|MAGEB1_ENST00000397548.2_Missense_Mutation_p.R314G	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	314								p.R314G(1)		NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						TGAGGAAGAGAGAGCCCAAGT	0.537																																							uc004dcc.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(940-942)AGA>GGA		melanoma antigen family B, 1							107.0	91.0	96.0					X																	30269550		2202	4300	6502	SO:0001583	missense	4112							g.chrX:30269550A>G		CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.940A>G	X.37:g.30269550A>G	ENSP00000368264:p.Arg314Gly					MAGEB1_uc004dcd.2_Missense_Mutation_p.R314G|MAGEB1_uc004dce.2_Missense_Mutation_p.R314G	p.R314G	NM_002363	NP_002354	P43366	MAGB1_HUMAN			4	1260	+			314					B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	ENST00000378981.3	37	c.940A>G	CCDS14222.1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.657242	0.47467	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.02236	4.38;4.38;4.38	3.73	1.18	0.20946	.	0.490245	0.19178	N	0.120778	T	0.08268	0.0206	M	0.73430	2.235	0.09310	N	1	D	0.69078	0.997	D	0.63597	0.916	T	0.07424	-1.0773	10	0.87932	D	0	.	7.2437	0.26109	0.5454:0.4546:0.0:0.0	.	314	P43366	MAGB1_HUMAN	G	314	ENSP00000368264:R314G;ENSP00000380683:R314G;ENSP00000380681:R314G	ENSP00000368264:R314G	R	+	1	2	MAGEB1	30179471	0.149000	0.22717	0.007000	0.13788	0.637000	0.38172	0.271000	0.18626	0.124000	0.18369	0.417000	0.27973	AGA		0.537	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363		20	56	0	0	0	0.012319	0	20	56				
MAGEB16	139604	broad.mit.edu	37	X	35820780	35820780	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:35820780T>A	ENST00000399989.1	+	2	746	c.467T>A	c.(466-468)cTg>cAg	p.L156Q	MAGEB16_ENST00000399992.1_Missense_Mutation_p.L188Q|MAGEB16_ENST00000399988.1_Missense_Mutation_p.L156Q|MAGEB16_ENST00000399987.1_Missense_Mutation_p.L156Q|MAGEB16_ENST00000399985.1_Missense_Mutation_p.L156Q	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	156	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.L323R(1)|p.L323Q(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						GAGATCCTCCTGAGAGCTTCT	0.468																																							uc010ngt.1		NA																	2	Substitution - Missense(2)	p.L323R(1)	ovary(1)|lung(1)	lung(3)|ovary(2)|breast(1)|skin(1)	7						c.(466-468)CTG>CAG		melanoma antigen family B, 16							82.0	80.0	80.0					X																	35820780		2040	4177	6217	SO:0001583	missense	139604							g.chrX:35820780T>A		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.467T>A	X.37:g.35820780T>A	ENSP00000382871:p.Leu156Gln						p.L156Q	NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN			2	746	+			156			MAGE.		A8MU30	Missense_Mutation	SNP	ENST00000399989.1	37	c.467T>A	CCDS43927.1	.	.	.	.	.	.	.	.	.	.	T	6.517	0.463613	0.12402	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.04317	3.65;3.65;3.65;3.65;3.65	2.91	-3.71	0.04424	.	1.151770	0.06335	N	0.706920	T	0.03959	0.0111	L	0.33485	1.01	0.09310	N	1	B	0.23058	0.079	B	0.25987	0.065	T	0.45614	-0.9249	10	0.38643	T	0.18	.	3.7445	0.08542	0.596:0.1302:0.0:0.2738	.	156	A2A368	MAGBG_HUMAN	Q	156;188;156;156;156	ENSP00000382870:L156Q;ENSP00000382874:L188Q;ENSP00000382869:L156Q;ENSP00000382871:L156Q;ENSP00000382867:L156Q	ENSP00000382867:L156Q	L	+	2	0	MAGEB16	35730701	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-0.267000	0.08619	-0.885000	0.03971	0.423000	0.28283	CTG		0.468	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1			16	60	0	0	0	0.004007	0	16	60				
FAM47C	442444	broad.mit.edu	37	X	37026557	37026557	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:37026557C>T	ENST00000358047.3	+	1	126	c.74C>T	c.(73-75)cCg>cTg	p.P25L		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	25								p.P25L(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TGTGACAAACCGCCTTCCAAG	0.647																																							uc004ddl.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(73-75)CCG>CTG		hypothetical protein LOC442444							28.0	26.0	27.0					X																	37026557		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37026557C>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.74C>T	X.37:g.37026557C>T	ENSP00000367913:p.Pro25Leu						p.P25L	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	88	+			25					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.74C>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.587011	0.00872	.	.	ENSG00000198173	ENST00000358047	T	0.22743	1.94	0.462	-0.924	0.10462	.	.	.	.	.	T	0.07954	0.0199	N	0.10945	0.07	0.09310	N	1	B	0.21821	0.061	B	0.11329	0.006	T	0.30268	-0.9984	8	0.29301	T	0.29	.	.	.	.	.	25	Q5HY64	FA47C_HUMAN	L	25	ENSP00000367913:P25L	ENSP00000367913:P25L	P	+	2	0	FAM47C	36936478	0.015000	0.18098	0.001000	0.08648	0.006000	0.05464	-1.227000	0.02950	-1.759000	0.01313	-1.393000	0.01150	CCG		0.647	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		8	28	0	0	0	0.00308	0	8	28				
RGN	9104	broad.mit.edu	37	X	46949272	46949272	+	Silent	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:46949272C>T	ENST00000352078.4	+	4	789	c.444C>T	c.(442-444)gaC>gaT	p.D148D	RGN_ENST00000336169.3_Silent_p.D148D|RNU6-1189P_ENST00000383958.1_RNA|RGN_ENST00000397180.1_Silent_p.D148D|RGN_ENST00000457380.1_Intron	NM_004683.4	NP_004674.1	Q15493	RGN_HUMAN	regucalcin	148					cellular calcium ion homeostasis (GO:0006874)|L-ascorbic acid biosynthetic process (GO:0019853)|positive regulation of ATPase activity (GO:0032781)|regulation of calcium-mediated signaling (GO:0050848)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|enzyme regulator activity (GO:0030234)|gluconolactonase activity (GO:0004341)|zinc ion binding (GO:0008270)	p.D148D(1)		breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	9						AGTACTTTGACCAGGTGGACA	0.502																																							uc004dgz.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(442-444)GAC>GAT		regucalcin							129.0	102.0	111.0					X																	46949272		2203	4300	6503	SO:0001819	synonymous_variant	9104				cellular calcium ion homeostasis|positive regulation of ATPase activity|regulation of calcium-mediated signaling	cytoplasm|nucleus	calcium ion binding|enzyme regulator activity|gluconolactonase activity|zinc ion binding	g.chrX:46949272C>T	D31815	CCDS14272.1, CCDS75968.1	Xp11.3	2014-03-14	2013-04-26		ENSG00000130988	ENSG00000130988	3.1.1.17		9989	protein-coding gene	gene with protein product	"""senescence marker protein-30"", ""gluconolactonase"""	300212	"""regucalcin (senescence marker protein-30)"""			7548213	Standard	NM_152869		Approved	SMP30, RC	uc004dha.1	Q15493	OTTHUMG00000021435	ENST00000352078.4:c.444C>T	X.37:g.46949272C>T						RGN_uc004dha.1_Silent_p.D148D|RGN_uc010nho.1_Silent_p.D95D|RGN_uc010nhp.1_Intron	p.D148D	NM_152869	NP_690608	Q15493	RGN_HUMAN			5	1413	+			148					A4FTW1|A8K271|Q53FC9|Q5JRR5	Silent	SNP	ENST00000352078.4	37	c.444C>T	CCDS14272.1																																																																																				0.502	RGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056385.1	NM_004683		18	61	0	0	0	0.00499	0	18	61				
XAGE5	170627	broad.mit.edu	37	X	52842245	52842245	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:52842245G>T	ENST00000375501.1	+	2	154	c.154G>T	c.(154-156)Gat>Tat	p.D52Y	XAGE5_ENST00000351072.1_Missense_Mutation_p.D52Y|XAGE5_ENST00000375503.3_Missense_Mutation_p.D52Y|XAGE5_ENST00000425386.1_Missense_Mutation_p.D52Y			Q8WWM1	XAGE5_HUMAN	X antigen family, member 5	52								p.D52Y(1)		endometrium(1)|large_intestine(1)|lung(5)|ovary(1)	8						GAGAGAAGATGATCAGGGTGC	0.547																																							uc004drd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(154-156)GAT>TAT		X antigen family, member 5							130.0	96.0	107.0					X																	52842245		2203	4300	6503	SO:0001583	missense	170627							g.chrX:52842245G>T	BC069129	CCDS14346.1	Xp11.23	2010-10-19		2005-01-27	ENSG00000171405	ENSG00000171405			30930	protein-coding gene	gene with protein product	"""cancer/testis antigen family 12, member 5"""		"""G antigen, family D, 5"""	GAGED5		12477932	Standard	NM_130775		Approved	XAGE-5, CT12.5	uc004drd.1	Q8WWM1	OTTHUMG00000021589	ENST00000375501.1:c.154G>T	X.37:g.52842245G>T	ENSP00000364651:p.Asp52Tyr						p.D52Y	NM_130775	NP_570131	Q8WWM1	GAGD5_HUMAN			3	219	+			52					Q5JS81	Missense_Mutation	SNP	ENST00000375501.1	37	c.154G>T	CCDS14346.1	.	.	.	.	.	.	.	.	.	.	g	9.658	1.143259	0.21205	.	.	ENSG00000171405	ENST00000351072;ENST00000425386;ENST00000375503;ENST00000375501	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	0.927	-0.225	0.13111	.	.	.	.	.	T	0.31827	0.0809	M	0.65975	2.015	0.09310	N	1	D	0.76494	0.999	D	0.71870	0.975	T	0.12142	-1.0559	9	0.87932	D	0	.	4.321	0.11016	0.0:0.4319:0.5681:0.0	.	52	Q8WWM1	GAGD5_HUMAN	Y	52	ENSP00000342240:D52Y;ENSP00000392864:D52Y;ENSP00000364653:D52Y;ENSP00000364651:D52Y	ENSP00000342240:D52Y	D	+	1	0	XAGE5	52858970	0.006000	0.16342	0.000000	0.03702	0.124000	0.20399	0.263000	0.18478	-0.126000	0.11682	0.292000	0.19580	GAT		0.547	XAGE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056689.1	NM_130775		10	35	1	0	1.08611e-07	0.010729	1.30915e-07	10	35				
HUWE1	10075	broad.mit.edu	37	X	53578393	53578393	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:53578393G>T	ENST00000342160.3	-	63	9387	c.8930C>A	c.(8929-8931)cCt>cAt	p.P2977H	HUWE1_ENST00000262854.6_Missense_Mutation_p.P2977H			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2977					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.P2867H(1)|p.P2977H(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GATGTCATCAGGCAGGGCAGC	0.537																																							uc004dsp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(8929-8931)CCT>CAT		HECT, UBA and WWE domain containing 1							59.0	46.0	51.0					X																	53578393		2203	4300	6503	SO:0001583	missense	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53578393G>T	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.8930C>A	X.37:g.53578393G>T	ENSP00000340648:p.Pro2977His					HUWE1_uc004dsn.2_Missense_Mutation_p.P1801H	p.P2977H	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN			64	9332	-			2977					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	c.8930C>A	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.491294	0.64074	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	D;D	0.96856	-4.15;-4.15	5.73	5.73	0.89815	.	0.125184	0.53938	D	0.000045	D	0.98648	0.9547	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99731	1.1012	10	0.87932	D	0	.	17.482	0.87675	0.0:0.0:1.0:0.0	.	2977;2977	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	H	2977	ENSP00000340648:P2977H;ENSP00000262854:P2977H	ENSP00000262854:P2977H	P	-	2	0	HUWE1	53595118	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.824000	0.92023	2.398000	0.81561	0.600000	0.82982	CCT		0.537	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		3	13	1	0	0.004672	0.004672	0.00481466	3	13				
WNK3	65267	broad.mit.edu	37	X	54224971	54224972	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:54224971_54224972GG>AT	ENST00000375159.2	-	23	5187_5188	c.5188_5189CC>AT	c.(5188-5190)CCa>ATa	p.P1730I	WNK3_ENST00000375169.3_Missense_Mutation_p.P1673I|WNK3_ENST00000354646.2_Missense_Mutation_p.P1730I			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1730					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P1730I(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TGATGATAATGGCCCAGGAAAT	0.485																																							uc004dtd.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						c.(5017-5019)CCA>ATA		WNK lysine deficient protein kinase 3 isoform 2																																				SO:0001583	missense	65267				intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity	g.chrX:54224971_54224972GG>AT	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.5188_5189delinsAT	X.37:g.54224971_54224972delinsAT	ENSP00000364301:p.Pro1730Ile					WNK3_uc004dtc.1_Missense_Mutation_p.P1730I|uc004dtb.1_5'Flank	p.P1673I	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN			23	5456_5457	-			1673					B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	DNP	ENST00000375159.2	37	c.5017_5018CC>AT	CCDS14357.1																																																																																				0.485	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		25	30	0	0	0	0.004672	0	25	30				
PFKFB1	5207	broad.mit.edu	37	X	54982650	54982650	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:54982650C>A	ENST00000375006.3	-	7	644	c.574G>T	c.(574-576)Gac>Tac	p.D192Y	PFKFB1_ENST00000374992.2_Intron|PFKFB1_ENST00000545676.1_Missense_Mutation_p.D127Y	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	192	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)	p.D192Y(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						TTTAGAAAGTCTTCCAGAACC	0.483																																							uc004dty.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(574-576)GAC>TAC		6-phosphofructo-2-kinase/fructose-2,							104.0	88.0	94.0					X																	54982650		2203	4300	6503	SO:0001583	missense	5207				energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding	g.chrX:54982650C>A		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.574G>T	X.37:g.54982650C>A	ENSP00000364145:p.Asp192Tyr					PFKFB1_uc010nkd.1_Intron|PFKFB1_uc011mol.1_Missense_Mutation_p.D127Y	p.D192Y	NM_002625	NP_002616	P16118	F261_HUMAN			7	645	-			192			6-phosphofructo-2-kinase.		B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	ENST00000375006.3	37	c.574G>T	CCDS14364.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365186	0.82463	.	.	ENSG00000158571	ENST00000375006;ENST00000545676	.	.	.	4.65	4.65	0.58169	6-phosphofructo-2-kinase (1);	0.000000	0.85682	D	0.000000	D	0.90580	0.7047	H	0.98769	4.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94476	0.7689	9	0.87932	D	0	-24.3148	16.0807	0.81003	0.0:1.0:0.0:0.0	.	127;192	B4DUN5;P16118	.;F261_HUMAN	Y	192;127	.	ENSP00000364145:D192Y	D	-	1	0	PFKFB1	54999375	1.000000	0.71417	0.990000	0.47175	0.976000	0.68499	7.585000	0.82584	2.248000	0.74166	0.600000	0.82982	GAC		0.483	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1			21	44	1	0	6.44725e-10	0.014323	8.31572e-10	21	44				
ZXDA	7789	broad.mit.edu	37	X	57936549	57936549	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:57936549G>T	ENST00000358697.4	-	1	518	c.306C>A	c.(304-306)acC>acA	p.T102T		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	102					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T102T(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						CGGAGCCCGCGGTCTCCACGT	0.736																																							uc004dve.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(304-306)ACC>ACA		zinc finger, X-linked, duplicated A							8.0	10.0	9.0					X																	57936549		2064	4081	6145	SO:0001819	synonymous_variant	7789				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:57936549G>T	L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.306C>A	X.37:g.57936549G>T							p.T102T	NM_007156	NP_009087	P98168	ZXDA_HUMAN			1	519	-			102					Q9UJP7	Silent	SNP	ENST00000358697.4	37	c.306C>A	CCDS14376.1																																																																																				0.736	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156		6	15	1	0	2.7689e-08	0.001984	3.38792e-08	6	15				
AMER1	139285	broad.mit.edu	37	X	63413106	63413106	+	Missense_Mutation	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:63413106G>T	ENST00000330258.3	-	2	333	c.61C>A	c.(61-63)Cgt>Agt	p.R21S	AMER1_ENST00000403336.1_Missense_Mutation_p.R21S|AMER1_ENST00000374869.3_Missense_Mutation_p.R21S	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	21					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R21S(2)									GTTTGTTCACGGGTACTCCCA	0.552																																							uc004dvo.2		NA																	69	Whole gene deletion(67)|Substitution - Missense(2)	p.0?(40)	kidney(65)|lung(2)|ovary(1)|large_intestine(1)	kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						c.(61-63)CGT>AGT		family with sequence similarity 123B							182.0	148.0	159.0					X																	63413106		2203	4300	6503	SO:0001583	missense	139285				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		g.chrX:63413106G>T	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.61C>A	X.37:g.63413106G>T	ENSP00000329117:p.Arg21Ser						p.R21S	NM_152424	NP_689637	Q5JTC6	F123B_HUMAN			2	334	-			21					A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	c.61C>A	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	2.346	-0.349962	0.05173	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.47177	0.85;0.87;0.85	4.59	3.72	0.42706	.	0.371581	0.23310	N	0.049564	T	0.27419	0.0673	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.19679	-1.0298	10	0.45353	T	0.12	-1.1054	11.0092	0.47652	0.0:0.0:0.6667:0.3333	.	21	Q5JTC6	F123B_HUMAN	S	21	ENSP00000364003:R21S;ENSP00000329117:R21S;ENSP00000384722:R21S	ENSP00000329117:R21S	R	-	1	0	FAM123B	63329831	0.007000	0.16637	0.009000	0.14445	0.009000	0.06853	0.605000	0.24179	1.268000	0.44264	0.600000	0.82982	CGT		0.552	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		32	124	1	0	2.81731e-10	0.010818	3.66885e-10	32	124				
MED12	9968	broad.mit.edu	37	X	70345265	70345265	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:70345265G>A	ENST00000374080.3	+	16	2323	c.2291G>A	c.(2290-2292)cGa>cAa	p.R764Q	MED12_ENST00000333646.6_Missense_Mutation_p.R764Q|MED12_ENST00000374102.1_Missense_Mutation_p.R764Q			Q93074	MED12_HUMAN	mediator complex subunit 12	764					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.R764Q(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GGAAAGCAGCGAGATGATGCC	0.537			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					2	Substitution - Missense(2)		lung(2)	ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(2290-2292)CGA>CAA		mediator complex subunit 12							59.0	62.0	61.0					X																	70345265		2179	4255	6434	SO:0001583	missense	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70345265G>A	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.2291G>A	X.37:g.70345265G>A	ENSP00000363193:p.Arg764Gln					MED12_uc011mpq.1_Missense_Mutation_p.R764Q|MED12_uc004dyz.2_Missense_Mutation_p.R764Q|MED12_uc004dza.2_Missense_Mutation_p.R611Q	p.R764Q	NM_005120	NP_005111	Q93074	MED12_HUMAN			16	2490	+	Renal(35;0.156)		764					O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	c.2291G>A	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	28.1	4.892134	0.91889	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.53	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.83036	0.5167	M	0.68593	2.085	0.80722	D	1	D;D;D;D	0.89917	0.972;0.998;1.0;0.976	P;P;D;P	0.87578	0.695;0.773;0.998;0.596	D	0.85336	0.1093	10	0.87932	D	0	-7.3361	17.3214	0.87238	0.0:0.0:1.0:0.0	.	764;611;764;764	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	Q	764;764;764;764;732	ENSP00000333125:R764Q;ENSP00000363215:R764Q;ENSP00000363193:R764Q;ENSP00000414203:R732Q	ENSP00000333125:R764Q	R	+	2	0	MED12	70261990	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.271000	0.75665	0.529000	0.55759	CGA		0.537	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		9	21	0	0	0	0.004482	0	9	21				
MAGEE2	139599	broad.mit.edu	37	X	75004593	75004593	+	Silent	SNP	G	G	A	rs370056993		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:75004593G>A	ENST00000373359.2	-	1	486	c.294C>T	c.(292-294)ttC>ttT	p.F98F		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	98	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.F98F(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TCATTCTCATGAAATTCACCA	0.532																																							uc004ecj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(292-294)TTC>TTT		melanoma antigen family E, 2							37.0	35.0	35.0					X																	75004593		2203	4300	6503	SO:0001819	synonymous_variant	139599							g.chrX:75004593G>A	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.294C>T	X.37:g.75004593G>A							p.F98F	NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN			1	479	-			98			MAGE 1.		Q5JSI5	Silent	SNP	ENST00000373359.2	37	c.294C>T	CCDS14431.1																																																																																				0.532	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703		10	148	0	0	0	0.008291	0	10	148				
NXF5	55998	broad.mit.edu	37	X	101095988	101095988	+	Splice_Site	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:101095988C>A	ENST00000361708.2	-	8	839	c.480G>T	c.(478-480)gaG>gaT	p.E160D	NXF5_ENST00000537026.1_Splice_Site_p.E160D|NXF5_ENST00000473265.2_Splice_Site_p.E160D			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	160					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.E160D(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						AAGGCTTCACCTCAGGGAAAT	0.493																																							uc011mrk.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(478-480)GAG>GAT		nuclear RNA export factor 5							117.0	107.0	111.0					X																	101095988		2201	4298	6499	SO:0001630	splice_region_variant	55998				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding	g.chrX:101095988C>A	AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.480+1G>T	X.37:g.101095988C>A						NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	p.E160D	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN			8	840	-			160			LRR 1.		A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Missense_Mutation	SNP	ENST00000361708.2	37	c.480G>T		.	.	.	.	.	.	.	.	.	.	.	16.19	3.052979	0.55218	.	.	ENSG00000126952	ENST00000537026;ENST00000473265;ENST00000361708	T;T;T	0.62364	0.03;0.03;0.03	2.05	1.13	0.20643	.	0.132959	0.48767	U	0.000172	T	0.52901	0.1763	L	0.43701	1.375	0.43267	D	0.99521	P	0.38167	0.621	P	0.45856	0.495	T	0.39820	-0.9595	9	.	.	.	.	3.7211	0.08456	0.0:0.7527:0.0:0.2473	.	160	A2RRM0	.	D	160	ENSP00000442401:E160D;ENSP00000426978:E160D;ENSP00000355286:E160D	.	E	-	3	2	NXF5	100982644	1.000000	0.71417	0.489000	0.27452	0.189000	0.23516	2.147000	0.42226	0.338000	0.23692	0.267000	0.19312	GAG		0.493	NXF5-201	KNOWN	basic	protein_coding	protein_coding			Missense_Mutation	53	114	1	0	1.93748e-29	0.01441	3.51874e-29	53	114				
PLP1	5354	broad.mit.edu	37	X	103041586	103041586	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:103041586C>A	ENST00000303958.2	+	3	530	c.384C>A	c.(382-384)ggC>ggA	p.G128G	PLP1_ENST00000361621.2_Intron|PLP1_ENST00000418604.1_Silent_p.G128G	NM_000533.3	NP_000524.3	P60201	MYPR_HUMAN	proteolipid protein 1	128			Missing (in HLD1).		astrocyte development (GO:0014002)|axon development (GO:0061564)|axon ensheathment (GO:0008366)|cell death (GO:0008219)|cell maturation (GO:0048469)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|long-chain fatty acid biosynthetic process (GO:0042759)|positive regulation of gene expression (GO:0010628)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	structural constituent of myelin sheath (GO:0019911)|structural molecule activity (GO:0005198)	p.G128G(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	17						GTTCCAGAGGCCAACATCAAG	0.547																																							uc010nov.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(382-384)GGC>GGA		proteolipid protein 1 isoform 1							143.0	122.0	129.0					X																	103041586		2203	4300	6503	SO:0001819	synonymous_variant	5354				cell death|synaptic transmission	integral to membrane		g.chrX:103041586C>A	M27110	CCDS14513.1, CCDS14514.1	Xq22	2013-05-14	2008-07-28		ENSG00000123560	ENSG00000123560			9086	protein-coding gene	gene with protein product	"""Pelizaeus-Merzbacher disease"""	300401	"""spastic paraplegia 2, uncomplicated"""	SPG2, PLP			Standard	NM_001128834		Approved	GPM6C	uc004elk.3	P60201	OTTHUMG00000022111	ENST00000303958.2:c.384C>A	X.37:g.103041586C>A						RAB9B_uc004eli.1_Intron|PLP1_uc004elk.2_Silent_p.G128G|PLP1_uc004elj.2_Intron|PLP1_uc011msf.1_Silent_p.G73G|PLP1_uc010now.1_Silent_p.G132G|PLP1_uc010nox.2_Silent_p.G82G	p.G128G	NM_001128834	NP_001122306	P60201	MYPR_HUMAN			4	664	+			128		Missing (in HLD1).	Cytoplasmic (Probable).		P04400|P06905|Q502Y1|Q6FHZ6	Silent	SNP	ENST00000303958.2	37	c.384C>A	CCDS14513.1																																																																																				0.547	PLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057743.2			41	128	1	0	6.48837e-15	0.010771	9.6256e-15	41	128				
LHFPL1	340596	broad.mit.edu	37	X	111914366	111914366	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:111914366T>A	ENST00000371968.3	-	2	492	c.253A>T	c.(253-255)Aca>Tca	p.T85S	LHFPL1_ENST00000536453.1_Missense_Mutation_p.T85S|LHFPL1_ENST00000478229.1_Intron	NM_178175.3	NP_835469.1	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1	85						integral component of membrane (GO:0016021)		p.T85S(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)	13						GTCACCACTGTGCACATCTGC	0.597																																							uc004epq.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(253-255)ACA>TCA		lipoma HMGIC fusion partner-like 1 precursor							99.0	84.0	89.0					X																	111914366		2203	4300	6503	SO:0001583	missense	340596					integral to membrane		g.chrX:111914366T>A	AY217350	CCDS14562.1	Xq23	2008-02-05			ENSG00000182508	ENSG00000182508			6587	protein-coding gene	gene with protein product		300566				10329012	Standard	NM_178175		Approved		uc004epq.3	Q86WI0	OTTHUMG00000022214	ENST00000371968.3:c.253A>T	X.37:g.111914366T>A	ENSP00000361036:p.Thr85Ser					LHFPL1_uc004epp.2_Missense_Mutation_p.T108S|LHFPL1_uc010nqa.2_Intron|LHFPL1_uc010nqb.2_Missense_Mutation_p.T85S	p.T85S	NM_178175	NP_835469	Q86WI0	LHPL1_HUMAN			2	586	-			85					A8K1N1|Q496M9|Q496N0|Q6UXU2	Missense_Mutation	SNP	ENST00000371968.3	37	c.253A>T	CCDS14562.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.591163	0.86851	.	.	ENSG00000182508	ENST00000371968;ENST00000536453	T;T	0.72282	-0.64;-0.64	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.82393	0.5027	M	0.76838	2.35	0.58432	D	0.99999	D;D	0.69078	0.988;0.997	D;D	0.74348	0.971;0.983	T	0.82839	-0.0259	10	0.42905	T	0.14	-16.0809	11.9977	0.53212	0.0:0.0:0.0:1.0	.	85;85	Q86WI0-2;Q86WI0	.;LHPL1_HUMAN	S	85	ENSP00000361036:T85S;ENSP00000444573:T85S	ENSP00000361036:T85S	T	-	1	0	LHFPL1	111801022	1.000000	0.71417	0.991000	0.47740	0.958000	0.62258	7.525000	0.81892	1.962000	0.57031	0.486000	0.48141	ACA		0.597	LHFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057947.1	NM_178175		19	36	0	0	0	0.008871	0	19	36				
PLS3	5358	broad.mit.edu	37	X	114863589	114863589	+	Missense_Mutation	SNP	T	T	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:114863589T>A	ENST00000420625.2	+	4	451	c.317T>A	c.(316-318)cTg>cAg	p.L106Q	PLS3_ENST00000539310.1_Missense_Mutation_p.L61Q|PLS3_ENST00000537301.1_Missense_Mutation_p.L84Q|PLS3_ENST00000289290.3_Missense_Mutation_p.L61Q|PLS3_ENST00000355899.3_Missense_Mutation_p.L106Q	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	106					bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)	p.L106Q(1)		NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						ATTTGTGCTCTGGGTGGAACT	0.373																																					Colon(160;1047 1864 8490 12969 29601)	Colon(160;1047 1864 8490 12969 29601)	uc004eqd.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(316-318)CTG>CAG		plastin 3							129.0	114.0	119.0					X																	114863589		2203	4300	6503	SO:0001583	missense	5358					cytoplasm	actin binding|calcium ion binding	g.chrX:114863589T>A	L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.317T>A	X.37:g.114863589T>A	ENSP00000398945:p.Leu106Gln					PLS3_uc010nqf.2_RNA|PLS3_uc010nqg.2_Intron|PLS3_uc011mtf.1_Missense_Mutation_p.L84Q|PLS3_uc004eqe.2_Missense_Mutation_p.L106Q|PLS3_uc011mtg.1_Missense_Mutation_p.L79Q|PLS3_uc011mth.1_Missense_Mutation_p.L61Q	p.L106Q	NM_005032	NP_005023	P13797	PLST_HUMAN			4	707	+			106					A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Missense_Mutation	SNP	ENST00000420625.2	37	c.317T>A	CCDS14568.1	.	.	.	.	.	.	.	.	.	.	T	17.39	3.378446	0.61735	.	.	ENSG00000102024	ENST00000355899;ENST00000537301;ENST00000289290;ENST00000420625;ENST00000539310	T;D;T;T;T	0.84660	-0.56;-1.88;0.52;-0.56;0.52	4.86	4.86	0.63082	.	0.055847	0.64402	D	0.000004	T	0.81413	0.4817	L	0.39898	1.24	0.80722	D	1	B;B;B	0.32101	0.356;0.132;0.004	B;B;B	0.37047	0.24;0.158;0.01	T	0.82118	-0.0615	10	0.72032	D	0.01	-2.4752	12.4048	0.55432	0.0:0.0:0.0:1.0	.	79;84;106	B4DPW9;B4DGB4;P13797	.;.;PLST_HUMAN	Q	106;84;61;106;61	ENSP00000348163:L106Q;ENSP00000445105:L84Q;ENSP00000289290:L61Q;ENSP00000398945:L106Q;ENSP00000445339:L61Q	ENSP00000289290:L61Q	L	+	2	0	PLS3	114769845	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	7.868000	0.87116	1.806000	0.52798	0.481000	0.45027	CTG		0.373	PLS3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057976.2			27	57	0	0	0	0.00632	0	27	57				
CXorf56	63932	broad.mit.edu	37	X	118676546	118676546	+	Silent	SNP	G	G	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:118676546G>T	ENST00000371594.4	-	5	513	c.435C>A	c.(433-435)acC>acA	p.T145T	CXorf56_ENST00000469448.1_5'UTR|CXorf56_ENST00000320339.4_Silent_p.T96T|CXorf56_ENST00000536133.1_Silent_p.T131T	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	145								p.T145T(1)		cervix(1)|endometrium(2)|lung(7)	10						TGGTCCGTTTGGTCATCATCA	0.522																																							uc004erk.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(433-435)ACC>ACA		hypothetical protein LOC63932							213.0	133.0	160.0					X																	118676546		2203	4300	6503	SO:0001819	synonymous_variant	63932						protein binding	g.chrX:118676546G>T	AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.435C>A	X.37:g.118676546G>T						CXorf56_uc004erj.1_Silent_p.T96T|CXorf56_uc011mtu.1_Silent_p.T131T	p.T145T	NM_022101	NP_071384	Q9H5V9	CX056_HUMAN			5	481	-			145					A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Silent	SNP	ENST00000371594.4	37	c.435C>A	CCDS14579.1																																																																																				0.522	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022101		27	78	1	0	1.77063e-15	0.005443	2.64615e-15	27	78				
TMEM255A	55026	broad.mit.edu	37	X	119410885	119410885	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:119410885C>A	ENST00000309720.5	-	8	725	c.602G>T	c.(601-603)gGt>gTt	p.G201V	TMEM255A_ENST00000371352.1_Missense_Mutation_p.G37V|TMEM255A_ENST00000440464.1_Intron|TMEM255A_ENST00000371369.4_Missense_Mutation_p.G177V	NM_017938.3	NP_060408.3	Q5JRV8	T255A_HUMAN	transmembrane protein 255A	201						integral component of membrane (GO:0016021)		p.G201V(1)									GTAGTACCCACCAGTGATCTC	0.587																																							uc004eso.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(601-603)GGT>GTT		hypothetical protein LOC55026 isoform 1							212.0	157.0	176.0					X																	119410885		2203	4300	6503	SO:0001583	missense	55026					integral to membrane		g.chrX:119410885C>A	BC047054	CCDS14597.1, CCDS43986.1, CCDS48157.1	Xq24	2012-11-30	2012-11-30	2012-11-30	ENSG00000125355	ENSG00000125355			26086	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member A"""	FAM70A		12477932	Standard	NM_017938		Approved	FLJ20716	uc004eso.4	Q5JRV8	OTTHUMG00000022298	ENST00000309720.5:c.602G>T	X.37:g.119410885C>A	ENSP00000310110:p.Gly201Val					FAM70A_uc004esp.3_Missense_Mutation_p.G177V|FAM70A_uc010nqo.2_Intron	p.G201V	NM_017938	NP_060408	Q5JRV8	FA70A_HUMAN			8	829	-			201					A8K0W9|B1APR4|B3KPI6|E9PAR3|Q86Y72|Q9NWN8	Missense_Mutation	SNP	ENST00000309720.5	37	c.602G>T	CCDS14597.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.586730	0.66105	.	.	ENSG00000125355	ENST00000309720;ENST00000371369;ENST00000371352	T;T;T	0.47869	0.83;0.83;0.83	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.67420	0.2891	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.982;1.0	T	0.68546	-0.5380	10	0.48119	T	0.1	-8.3669	16.7868	0.85576	0.0:1.0:0.0:0.0	.	177;201	B1APR4;Q5JRV8	.;FA70A_HUMAN	V	201;177;37	ENSP00000310110:G201V;ENSP00000360420:G177V;ENSP00000360403:G37V	ENSP00000310110:G201V	G	-	2	0	FAM70A	119294913	1.000000	0.71417	0.984000	0.44739	0.972000	0.66771	7.487000	0.81328	2.168000	0.68352	0.594000	0.82650	GGT		0.587	TMEM255A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058091.1	NM_017938		20	93	1	0	2.94398e-08	0.007413	3.5913e-08	20	93				
GRIA3	2892	broad.mit.edu	37	X	122528962	122528962	+	Silent	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:122528962C>A	ENST00000371251.1	+	6	946	c.894C>A	c.(892-894)gcC>gcA	p.A298A	GRIA3_ENST00000264357.5_Silent_p.A298A|GRIA3_ENST00000371256.5_Silent_p.A298A|GRIA3_ENST00000541091.1_Silent_p.A282A|GRIA3_ENST00000542149.1_Silent_p.A298A			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	298					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.A298A(3)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	TCCCTGAAGCCAAGAATGCAC	0.418																																							uc004etq.3		NA																	3	Substitution - coding silent(3)		lung(3)	ovary(3)|central_nervous_system(1)|pancreas(1)	5						c.(892-894)GCC>GCA		glutamate receptor, ionotrophic, AMPA 3 isoform	L-Glutamic Acid(DB00142)						113.0	107.0	109.0					X																	122528962		2203	4300	6503	SO:0001819	synonymous_variant	2892				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity	g.chrX:122528962C>A	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.894C>A	X.37:g.122528962C>A						GRIA3_uc004etr.3_Silent_p.A298A|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Silent_p.A282A	p.A298A	NM_007325	NP_015564	P42263	GRIA3_HUMAN			7	1187	+			298			Extracellular (Potential).		D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Silent	SNP	ENST00000371251.1	37	c.894C>A	CCDS14604.1																																																																																				0.418	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828		30	82	1	0	2.81731e-10	0.010818	3.66885e-10	30	82				
TENM1	10178	broad.mit.edu	37	X	123657421	123657421	+	Silent	SNP	G	G	A	rs376967455		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:123657421G>A	ENST00000371130.3	-	17	2889	c.2826C>T	c.(2824-2826)tcC>tcT	p.S942S	TENM1_ENST00000422452.2_Silent_p.S942S	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	942					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.S944S(1)									GCAGGAAAGGGGATCGGTCGA	0.443																																							uc004euj.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(2824-2826)TCC>TCT		odz, odd Oz/ten-m homolog 1 isoform 3		G	,,	1,3834		0,1,1631,571	104.0	86.0	92.0		2826,2823,2826	4.6	1.0	X		92	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	ODZ1	NM_001163278.1,NM_001163279.1,NM_014253.3	,,	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	,,	942/2733,941/2732,942/2726	123657421	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123657421G>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2826C>T	X.37:g.123657421G>A						ODZ1_uc011muj.1_Silent_p.S941S|ODZ1_uc010nqy.2_Silent_p.S942S	p.S942S	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN			17	2890	-			942			Extracellular (Potential).		B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	c.2826C>T	CCDS14609.1																																																																																				0.443	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		15	39	0	0	0	0.003163	0	15	39				
DCAF12L1	139170	broad.mit.edu	37	X	125685987	125685987	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:125685987C>A	ENST00000371126.1	-	1	847	c.605G>T	c.(604-606)tGg>tTg	p.W202L		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	202								p.W202L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						GTCACTCAGCCAGGCGACGGC	0.652																																							uc004eul.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(604-606)TGG>TTG		DDB1 and CUL4 associated factor 12-like 1							34.0	36.0	36.0					X																	125685987		2203	4298	6501	SO:0001583	missense	139170							g.chrX:125685987C>A	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.605G>T	X.37:g.125685987C>A	ENSP00000360167:p.Trp202Leu						p.W202L	NM_178470	NP_848565	Q5VU92	DC121_HUMAN			1	856	-			202			WD 2.		Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	c.605G>T	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484228	0.84854	.	.	ENSG00000198889	ENST00000371126	T	0.65549	-0.16	3.89	3.89	0.44902	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.31082	N	0.008282	T	0.78898	0.4356	M	0.83384	2.64	0.46478	D	0.999067	D	0.89917	1.0	D	0.91635	0.999	T	0.81529	-0.0891	10	0.56958	D	0.05	.	12.9015	0.58128	0.0:1.0:0.0:0.0	.	202	Q5VU92	DC121_HUMAN	L	202	ENSP00000360167:W202L	ENSP00000360167:W202L	W	-	2	0	DCAF12L1	125513668	1.000000	0.71417	0.896000	0.35187	0.960000	0.62799	6.591000	0.74090	2.203000	0.70933	0.429000	0.28392	TGG		0.652	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470		15	29	1	0	2.23348e-06	0.004007	2.59931e-06	15	29				
DCAF12L1	139170	broad.mit.edu	37	X	125686176	125686176	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:125686176C>A	ENST00000371126.1	-	1	658	c.416G>T	c.(415-417)aGt>aTt	p.S139I		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	139								p.S139I(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						CCTGGCCTCACTGTCCCGCAA	0.632																																							uc004eul.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(415-417)AGT>ATT		DDB1 and CUL4 associated factor 12-like 1							105.0	87.0	93.0					X																	125686176		2203	4300	6503	SO:0001583	missense	139170							g.chrX:125686176C>A	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.416G>T	X.37:g.125686176C>A	ENSP00000360167:p.Ser139Ile						p.S139I	NM_178470	NP_848565	Q5VU92	DC121_HUMAN			1	667	-			139					Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	c.416G>T	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	c	3.407	-0.121062	0.06838	.	.	ENSG00000198889	ENST00000371126	T	0.59772	0.24	4.15	-1.08	0.09936	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.41305	0.1153	L	0.39245	1.2	0.09310	N	1	B	0.22346	0.068	B	0.14023	0.01	T	0.23404	-1.0189	9	0.44086	T	0.13	.	4.0114	0.09624	0.1596:0.4346:0.0:0.4058	.	139	Q5VU92	DC121_HUMAN	I	139	ENSP00000360167:S139I	ENSP00000360167:S139I	S	-	2	0	DCAF12L1	125513857	0.646000	0.27295	0.000000	0.03702	0.002000	0.02628	2.843000	0.48238	-0.547000	0.06207	-1.613000	0.00800	AGT		0.632	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470		20	44	1	0	2.70639e-06	0.014323	3.14066e-06	20	44				
VGLL1	51442	broad.mit.edu	37	X	135630964	135630964	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:135630964C>A	ENST00000370634.3	+	3	601	c.431C>A	c.(430-432)cCt>cAt	p.P144H	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					TCCTTAGAGCCTGGCTACTCT	0.617																																							uc004ezy.2		NA																	0					0						c.(430-432)CCT>CAT		vestigial like 1							127.0	104.0	112.0					X																	135630964		2203	4300	6503	SO:0001583	missense	51442				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	transcription coactivator activity	g.chrX:135630964C>A	AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.431C>A	X.37:g.135630964C>A	ENSP00000359668:p.Pro144His					MIR934_hsa-mir-934|MI0005756_5'Flank	p.P144H	NM_016267	NP_057351	Q99990	VGLL1_HUMAN			3	601	+	Acute lymphoblastic leukemia(192;0.000127)		144					Q5H915	Missense_Mutation	SNP	ENST00000370634.3	37	c.431C>A	CCDS14658.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.655454	0.47467	.	.	ENSG00000102243	ENST00000370634	T	0.51574	0.7	5.81	3.04	0.35103	.	0.775582	0.12596	N	0.455109	T	0.52240	0.1722	L	0.36672	1.1	0.36560	D	0.872367	D	0.76494	0.999	D	0.64595	0.927	T	0.54036	-0.8353	10	0.66056	D	0.02	-2.9201	5.4468	0.16539	0.0:0.6564:0.1607:0.1828	.	144	Q99990	VGLL1_HUMAN	H	144	ENSP00000359668:P144H	ENSP00000359668:P144H	P	+	2	0	VGLL1	135458630	0.121000	0.22262	0.464000	0.27143	0.682000	0.39822	0.690000	0.25451	0.210000	0.20664	0.600000	0.82982	CCT		0.617	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	NM_016267		31	105	1	0	5.45727e-16	0.008361	8.27788e-16	31	105				
SPANXN2	494119	broad.mit.edu	37	X	142795227	142795227	+	Missense_Mutation	SNP	C	C	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:142795227C>A	ENST00000370498.1	-	2	1204	c.451G>T	c.(451-453)Gac>Tac	p.D151Y		NM_001009615.1	NP_001009615.1	Q5MJ10	SPXN2_HUMAN	SPANX family, member N2	151										NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)					AGGTCTTCGTCCTCCTGTGAA	0.512																																							uc004fbz.2		NA																	0				ovary(1)	1						c.(451-453)GAC>TAC		SPANX-N2 protein							293.0	269.0	277.0					X																	142795227		2203	4300	6503	SO:0001583	missense	494119							g.chrX:142795227C>A		CCDS35419.1	Xq27.3	2012-06-12			ENSG00000203924	ENSG00000268988			33175	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 7"""	300665				14973187, 17012309	Standard	NM_001009615		Approved	SPANX-N2, CT11.7	uc004fbz.3	Q5MJ10	OTTHUMG00000022583	ENST00000370498.1:c.451G>T	X.37:g.142795227C>A	ENSP00000359529:p.Asp151Tyr						p.D151Y	NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN			2	1205	-	Acute lymphoblastic leukemia(192;6.56e-05)		151					Q0ZNM2	Missense_Mutation	SNP	ENST00000370498.1	37	c.451G>T	CCDS35419.1	.	.	.	.	.	.	.	.	.	.	N	5.460	0.269985	0.10349	.	.	ENSG00000203924	ENST00000370498	T	0.08370	3.1	0.656	0.656	0.17844	.	.	.	.	.	T	0.11922	0.0290	M	0.65498	2.005	0.09310	N	1	D	0.59357	0.985	P	0.45538	0.484	T	0.18808	-1.0325	8	0.87932	D	0	.	.	.	.	.	151	Q5MJ10	SPXN2_HUMAN	Y	151	ENSP00000359529:D151Y	ENSP00000359529:D151Y	D	-	1	0	SPANXN2	142622893	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.831000	0.04405	0.638000	0.30545	0.387000	0.25754	GAC		0.512	SPANXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058621.2	NM_001009615		113	345	1	0	9.50027e-55	0.01441	1.89537e-54	113	345				
HAUS7	55559	broad.mit.edu	37	X	152721026	152721026	+	Missense_Mutation	SNP	G	G	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:152721026G>A	ENST00000370211.4	-	8	977	c.934C>T	c.(934-936)Cac>Tac	p.H312Y	TREX2_ENST00000370232.1_5'UTR|HAUS7_ENST00000484394.1_5'UTR|TREX2_ENST00000334497.2_5'UTR|HAUS7_ENST00000421080.2_Silent_p.R133R|TREX2_ENST00000330912.2_5'UTR|TREX2_ENST00000338525.2_5'UTR|HAUS7_ENST00000370212.3_Missense_Mutation_p.H312Y	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	312					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)	p.H312Y(1)		endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						AGATTCTGGTGCGTGGCCTGG	0.602																																							uc004fho.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(934-936)CAC>TAC		HAUS augmin-like complex subunit 7							94.0	70.0	78.0					X																	152721026		2202	4298	6500	SO:0001583	missense	55559				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleolus|plasma membrane|spindle	thioesterase binding	g.chrX:152721026G>A	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.934C>T	X.37:g.152721026G>A	ENSP00000359230:p.His312Tyr					HAUS7_uc004fhl.2_RNA|HAUS7_uc004fhm.2_RNA|HAUS7_uc004fhn.1_Missense_Mutation_p.H312Y|HAUS7_uc004fhp.1_RNA	p.H312Y	NM_017518	NP_059988	Q99871	HAUS7_HUMAN			8	1492	-			312					B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	SNP	ENST00000370211.4	37	c.934C>T	CCDS35438.1	.	.	.	.	.	.	.	.	.	.	G	0.039	-1.291101	0.01375	.	.	ENSG00000213397	ENST00000370211;ENST00000370219;ENST00000370212	T;T;T	0.20598	2.06;2.06;2.06	4.99	-6.16	0.02098	.	1.052600	0.07408	N	0.891913	T	0.04815	0.0130	N	0.00670	-1.27	0.09310	N	1	B;B	0.13594	0.0;0.008	B;B	0.11329	0.001;0.006	T	0.44345	-0.9334	10	0.15952	T	0.53	-4.8414	8.1295	0.31018	0.3484:0.1315:0.5201:0.0	.	312;312	Q99871;Q99871-2	HAUS7_HUMAN;.	Y	302;312;312	ENSP00000359230:H302Y;ENSP00000359239:H312Y;ENSP00000359231:H312Y	ENSP00000359230:H302Y	H	-	1	0	HAUS7	152374220	0.000000	0.05858	0.002000	0.10522	0.614000	0.37383	-1.096000	0.03353	-1.187000	0.02709	-0.698000	0.03680	CAC		0.602	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060963.2	NM_017518		7	43	0	0	0	0.001984	0	7	43				
FLNA	2316	broad.mit.edu	37	X	153590914	153590914	+	Missense_Mutation	SNP	C	C	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chrX:153590914C>T	ENST00000369850.3	-	17	2673	c.2437G>A	c.(2437-2439)Gga>Aga	p.G813R	FLNA_ENST00000360319.4_Missense_Mutation_p.G813R|FLNA_ENST00000422373.1_Missense_Mutation_p.G813R|FLNA_ENST00000344736.4_Missense_Mutation_p.G813R	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	813					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)	p.G813R(1)		breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCTACCACTCCAGGGGCACAC	0.652																																							uc004fkk.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(6)	6						c.(2437-2439)GGA>AGA		filamin A, alpha isoform 2							74.0	82.0	80.0					X																	153590914		2083	4180	6263	SO:0001583	missense	2316				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding	g.chrX:153590914C>T	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.2437G>A	X.37:g.153590914C>T	ENSP00000358866:p.Gly813Arg					FLNA_uc010nuu.1_Missense_Mutation_p.G813R	p.G813R	NM_001110556	NP_001104026	P21333	FLNA_HUMAN			17	2686	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		813			Filamin 6.		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	c.2437G>A	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773105	0.31411	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	5.13	5.13	0.70059	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.87426	0.6174	L	0.49640	1.575	0.80722	D	1	B;D	0.67145	0.064;0.996	B;D	0.77557	0.105;0.99	D	0.84809	0.0789	10	0.23891	T	0.37	.	14.5209	0.67849	0.0:0.8459:0.1541:0.0	.	813;813	P21333-2;P21333	.;FLNA_HUMAN	R	813;786;813;813;813	ENSP00000353467:G813R;ENSP00000416926:G813R;ENSP00000358866:G813R;ENSP00000358863:G813R	ENSP00000358863:G813R	G	-	1	0	FLNA	153244108	0.516000	0.26218	0.943000	0.38184	0.312000	0.27988	1.360000	0.34125	2.272000	0.75746	0.529000	0.55759	GGA		0.652	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			23	115	0	0	0	0.003954	0	23	115				
FBXO2	26232	broad.mit.edu	37	1	11710099	11710100	+	Frame_Shift_Ins	INS	-	-	A			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:11710099_11710100insA	ENST00000354287.4	-	3	764_765	c.423_424insT	c.(421-426)catggtfs	p.G142fs	FBXO2_ENST00000475961.1_5'Flank	NM_012168.5	NP_036300.2	Q9UK22	FBX2_HUMAN	F-box protein 2	142	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				cellular protein modification process (GO:0006464)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of protein ubiquitination (GO:0031396)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|SCF ubiquitin ligase complex (GO:0019005)	beta-amyloid binding (GO:0001540)|carbohydrate binding (GO:0030246)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(1)|lung(4)	6	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		CCGTCCCCACCATGCTCCACGT	0.599																																							uc001asj.2		NA																	0					0						c.(421-426)CATGGTfs		F-box only protein 2																																				SO:0001589	frameshift_variant	26232				glycoprotein catabolic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|endoplasmic reticulum|membrane|microsome|SCF ubiquitin ligase complex	sugar binding|ubiquitin-protein ligase activity	g.chr1:11710099_11710100insA	AF174594	CCDS130.1	1p36.21	2010-04-21	2004-06-15		ENSG00000116661	ENSG00000116661		"""F-boxes /  ""other"""""	13581	protein-coding gene	gene with protein product		607112	"""F-box only protein 2"", ""organ of Corti protein 1"""	OCP1		10531035, 10531037	Standard	NM_012168		Approved	FBX2, Nfb42, Fbs1, Fbg1	uc001asj.3	Q9UK22	OTTHUMG00000002072	ENST00000354287.4:c.424dupT	1.37:g.11710100_11710100dupA	ENSP00000346240:p.Gly142fs					FBXO2_uc009vna.2_Frame_Shift_Ins_p.H141fs|FBXO2_uc009vnb.1_RNA	p.H141fs	NM_012168	NP_036300	Q9UK22	FBX2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)	3	765_766	-	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	141_142			FBA.		B2R7K7|Q5TGY0|Q6FGJ7|Q8TB29|Q9UKC6	Frame_Shift_Ins	INS	ENST00000354287.4	37	c.423_424insT	CCDS130.1																																																																																				0.599	FBXO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005764.1	NM_012168		23	147	NA	NA	NA	NA	NA	23	147	---	---	---	---
UBR4	23352	broad.mit.edu	37	1	19481480	19481480	+	Frame_Shift_Del	DEL	T	T	-	rs149131327		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:19481480delT	ENST00000375254.3	-	44	6417	c.6390delA	c.(6388-6390)aaafs	p.K2130fs	UBR4_ENST00000375217.2_Frame_Shift_Del_p.K2130fs|UBR4_ENST00000375226.2_Frame_Shift_Del_p.K2130fs|UBR4_ENST00000375267.2_Frame_Shift_Del_p.K2130fs	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2130					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGCGAATGATTTGCCTTGAC	0.512																																							uc001bbi.2		NA																	0				kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25						c.(6388-6390)AAAfs		retinoblastoma-associated factor 600							208.0	175.0	186.0					1																	19481480		2203	4300	6503	SO:0001589	frameshift_variant	23352				interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:19481480delT	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.6390delA	1.37:g.19481480delT	ENSP00000364403:p.Lys2130fs					UBR4_uc001bbl.1_Frame_Shift_Del_p.K67fs|UBR4_uc001bbm.1_Frame_Shift_Del_p.K1342fs	p.K2130fs	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)	44	6394	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)	2130					A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Frame_Shift_Del	DEL	ENST00000375254.3	37	c.6390delA	CCDS189.1																																																																																				0.512	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765		15	119	NA	NA	NA	NA	NA	15	119	---	---	---	---
NLRP3	114548	broad.mit.edu	37	1	247588869	247588869	+	Frame_Shift_Del	DEL	C	C	-	rs149493236		TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr1:247588869delC	ENST00000336119.3	+	3	2870	c.2124delC	c.(2122-2124)ctcfs	p.L708fs	NLRP3_ENST00000366497.2_Frame_Shift_Del_p.L708fs|NLRP3_ENST00000348069.2_Frame_Shift_Del_p.L708fs|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366496.2_Frame_Shift_Del_p.L708fs|NLRP3_ENST00000391827.2_Frame_Shift_Del_p.L708fs|NLRP3_ENST00000391828.3_Frame_Shift_Del_p.L708fs	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	708					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGTGTGTCCTCCCAAGCTCCT	0.567																																							uc001icr.2		NA																	0				lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(2122-2124)CTCfs		NLR family, pyrin domain containing 3 isoform a							136.0	124.0	128.0					1																	247588869		2203	4300	6503	SO:0001589	frameshift_variant	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247588869delC	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2124delC	1.37:g.247588869delC	ENSP00000337383:p.Leu708fs					NLRP3_uc001ics.2_Frame_Shift_Del_p.L708fs|NLRP3_uc001icu.2_Frame_Shift_Del_p.L708fs|NLRP3_uc001icw.2_Frame_Shift_Del_p.L708fs|NLRP3_uc001icv.2_Frame_Shift_Del_p.L708fs|NLRP3_uc010pyw.1_Frame_Shift_Del_p.L706fs|NLRP3_uc001ict.1_Frame_Shift_Del_p.L706fs	p.L708fs	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	2262	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	708					B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Frame_Shift_Del	DEL	ENST00000336119.3	37	c.2124delC	CCDS1632.1																																																																																				0.567	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		21	74	NA	NA	NA	NA	NA	21	74	---	---	---	---
AKR1C2	1646	broad.mit.edu	37	10	5040858	5040859	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr10:5040858_5040859delGG	ENST00000380753.4	-	5	715_716	c.528_529delCC	c.(526-531)atcctcfs	p.L177fs	AKR1C2_ENST00000421196.3_Frame_Shift_Del_p.L151fs|RP11-499O7.7_ENST00000451575.2_RNA|RP11-499O7.7_ENST00000440414.1_RNA|AKR1C2_ENST00000407674.1_Frame_Shift_Del_p.L177fs	NM_205845.2	NP_995317.1	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2	177					cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway (GO:0007186)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|response to prostaglandin (GO:0034694)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin F receptor activity (GO:0004958)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(1)|large_intestine(5)|lung(3)|skin(1)	10					Ursodeoxycholic acid(DB01586)	GGCTTGTTGAGGATCATCTCCA	0.525																																							uc010qan.1		NA																	0					0						c.(526-531)ATCCTCfs		aldo-keto reductase family 1, member C2	NADH(DB00157)|Ursodeoxycholic acid(DB01586)																																			SO:0001589	frameshift_variant	1646				digestion|prostaglandin metabolic process|steroid metabolic process	cytoplasm	androsterone dehydrogenase (A-specific) activity|bile acid binding|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity	g.chr10:5040858_5040859delGG	L32592	CCDS7062.1, CCDS44350.1	10p15-p14	2014-01-29	2012-12-04		ENSG00000151632	ENSG00000151632	1.3.1.20, 1.1.1.213	"""Aldo-keto reductases"""	385	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III"""	600450	"""aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)"", ""testicular 17,20-desmolase deficiency"""	DDH2, TDD		9716498, 21802064	Standard	NM_001354		Approved	DD, BABP, DD2, HAKRD, MCDR2	uc001iht.3	P52895	OTTHUMG00000017584	ENST00000380753.4:c.528_529delCC	10.37:g.5040858_5040859delGG	ENSP00000370129:p.Leu177fs					AKR1E2_uc001ihl.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C2_uc009xhy.2_Frame_Shift_Del_p.I150fs|AKR1C2_uc001ihs.2_Frame_Shift_Del_p.I176fs|AKR1C2_uc001iht.2_Frame_Shift_Del_p.I176fs	p.I176fs	NM_205845	NP_995317	P52895	AK1C2_HUMAN			5	707_708	-			176_177					A8K2N9|B4DKR9|Q14133|Q5SR16|Q7M4N1|Q96A71	Frame_Shift_Del	DEL	ENST00000380753.4	37	c.528_529delCC	CCDS7062.1																																																																																				0.525	AKR1C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046531.1	NM_001354		10	57	NA	NA	NA	NA	NA	10	57	---	---	---	---
SYT9	143425	broad.mit.edu	37	11	7441837	7441837	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:7441837delC	ENST00000318881.6	+	6	1675	c.1438delC	c.(1438-1440)cccfs	p.P480fs		NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	480					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		TCCTCGGAAGCCCATTGCACA	0.502																																							uc001mfe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1438-1440)CCCfs		synaptotagmin IX							168.0	136.0	146.0					11																	7441837		2201	4296	6497	SO:0001589	frameshift_variant	143425					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr11:7441837delC	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.1438delC	11.37:g.7441837delC	ENSP00000324419:p.Pro480fs					SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_RNA	p.P480fs	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN		Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)	6	1675	+			480			Cytoplasmic (Potential).			Frame_Shift_Del	DEL	ENST00000318881.6	37	c.1438delC	CCDS7778.1																																																																																				0.502	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733		33	47	NA	NA	NA	NA	NA	33	47	---	---	---	---
CHST1	8534	broad.mit.edu	37	11	45671461	45671461	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr11:45671461delC	ENST00000308064.2	-	4	1683	c.1013delG	c.(1012-1014)ggcfs	p.G338fs	RP11-495O11.1_ENST00000525563.1_RNA|CHST1_ENST00000533673.1_5'Flank	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	338					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GGTGGGGTCGCCCCGCGTGTT	0.642																																							uc001mys.1		NA																	0				skin(4)|pancreas(1)	5						c.(1012-1014)GGCfs		carbohydrate (keratan sulfate Gal-6)							63.0	64.0	64.0					11																	45671461		2203	4299	6502	SO:0001589	frameshift_variant	8534				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity	g.chr11:45671461delC	U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.1013delG	11.37:g.45671461delC	ENSP00000309270:p.Gly338fs						p.G338fs	NM_003654	NP_003645	O43916	CHST1_HUMAN		GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)	4	1684	-			338			Lumenal (Potential).|Cell attachment site (Potential).		D3DQP2	Frame_Shift_Del	DEL	ENST00000308064.2	37	c.1013delG	CCDS7913.1																																																																																				0.642	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390127.1	NM_003654		40	72	NA	NA	NA	NA	NA	40	72	---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	140997062	140997062	+	Frame_Shift_Del	DEL	G	G	-			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr2:140997062delG	ENST00000389484.3	-	88	14335	c.13364delC	c.(13363-13365)actfs	p.T4455fs		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4455					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGTTATCAAAGTCACCAAGAG	0.323										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(13363-13365)ACTfs		low density lipoprotein-related protein 1B							102.0	96.0	98.0					2																	140997062		2200	4299	6499	SO:0001589	frameshift_variant	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:140997062delG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13364delC	2.37:g.140997062delG	ENSP00000374135:p.Thr4455fs	TSP Lung(27;0.18)					p.T4455fs	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	88	14336	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4455			Helical; (Potential).		Q8WY29|Q8WY30|Q8WY31	Frame_Shift_Del	DEL	ENST00000389484.3	37	c.13364delC	CCDS2182.1																																																																																				0.323	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		7	12	NA	NA	NA	NA	NA	7	12	---	---	---	---
CPB1	1360	broad.mit.edu	37	3	148558565	148558565	+	Frame_Shift_Del	DEL	G	G	-			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr3:148558565delG	ENST00000491148.1	+	5	699	c.365delG	c.(364-366)tggfs	p.W122fs	CPB1_ENST00000282957.4_Frame_Shift_Del_p.W122fs			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	122						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TACAACAAGTGGGAAACGGTA	0.423																																							uc003ewl.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(364-366)TGGfs		pancreatic carboxypeptidase B1 preproprotein							163.0	163.0	163.0					3																	148558565		2203	4300	6503	SO:0001589	frameshift_variant	1360				proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding	g.chr3:148558565delG	AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.365delG	3.37:g.148558565delG	ENSP00000417222:p.Trp122fs						p.W122fs	NM_001871	NP_001862	P15086	CBPB1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)		4	388	+			122					O60834|Q53XJ0|Q96BQ8	Frame_Shift_Del	DEL	ENST00000491148.1	37	c.365delG	CCDS33874.1																																																																																				0.423	CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355928.1	NM_001871		24	64	NA	NA	NA	NA	NA	24	64	---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11185423	11185423	+	Frame_Shift_Del	DEL	C	C	-			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr6:11185423delC	ENST00000379446.5	-	7	2643	c.2477delG	c.(2476-2478)cgcfs	p.R826fs	RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000504387.1_Frame_Shift_Del_p.R826fs	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	826					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			CAGCAAAGAGCGCTTGAACAG	0.498																																							uc003mzv.2		NA																	0					0						c.(2476-2478)CGCfs		neural precursor cell expressed, developmentally							65.0	64.0	64.0					6																	11185423		2203	4300	6503	SO:0001589	frameshift_variant	4739				actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding	g.chr6:11185423delC	L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.2477delG	6.37:g.11185423delC	ENSP00000368759:p.Arg826fs					NEDD9_uc010joz.2_Frame_Shift_Del_p.R826fs|NEDD9_uc003mzw.3_Frame_Shift_Del_p.R680fs	p.R826fs	NM_006403	NP_006394	Q14511	CASL_HUMAN	Epithelial(50;0.0647)|all cancers(50;0.179)		7	2644	-	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	826					A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Frame_Shift_Del	DEL	ENST00000379446.5	37	c.2477delG	CCDS4520.1																																																																																				0.498	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403		7	78	NA	NA	NA	NA	NA	7	78	---	---	---	---
LAMB1	3912	broad.mit.edu	37	7	107569639	107569640	+	Frame_Shift_Ins	INS	-	-	T			TCGA-49-4488-01A-01D-1753-08	TCGA-49-4488-11A-01D-1753-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	3635bb9c-a332-4445-ad81-83cec426dd02	232307bb-5ab4-48c2-a008-8684ce7e1056	g.chr7:107569639_107569640insT	ENST00000222399.6	-	31	4986_4987	c.4756_4757insA	c.(4756-4758)acafs	p.T1586fs	LAMB1_ENST00000474380.1_5'Flank|LAMB1_ENST00000393561.1_Frame_Shift_Ins_p.T1610fs	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1586	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TTTAACATCTGTTGCACTTTTG	0.386																																							uc003vew.2		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(4756-4758)ACAfs		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)																																			SO:0001589	frameshift_variant	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107569639_107569640insT	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4757dupA	7.37:g.107569641_107569641dupT	ENSP00000222399:p.Thr1586fs					LAMB1_uc003vev.2_Frame_Shift_Ins_p.T1610fs|LAMB1_uc003veu.2_Frame_Shift_Ins_p.T69fs	p.T1586fs	NM_002291	NP_002282	P07942	LAMB1_HUMAN			31	5091_5092	-			1586			Potential.|Domain I.		Q14D91	Frame_Shift_Ins	INS	ENST00000222399.6	37	c.4756_4757insA	CCDS5750.1																																																																																				0.386	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		77	72	NA	NA	NA	NA	NA	77	72	---	---	---	---
