#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
RAP1GAP	5909	broad.mit.edu	37	1	21940151	21940151	+	Silent	SNP	G	G	A	rs375841009		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:21940151G>A	ENST00000374765.4	-	9	644	c.444C>T	c.(442-444)acC>acT	p.T148T	RAP1GAP_ENST00000542643.2_Silent_p.T148T|RAP1GAP_ENST00000290101.4_Silent_p.T212T|RAP1GAP_ENST00000374763.2_Silent_p.T148T|RAP1GAP_ENST00000374757.3_5'UTR|RAP1GAP_ENST00000374761.2_Silent_p.T179T	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	148					GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)	p.T290T(1)|p.T179T(1)|p.T148T(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		TAGGGAACTCGGTGAGGCAGG	0.582													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20568	0.0		0.0	False		,,,				2504	0.0						uc001bex.2		NA																	3	Substitution - coding silent(3)		lung(3)	breast(2)|ovary(1)	3						c.(442-444)ACC>ACT		RAP1 GTPase activating protein isoform c		G	,,	0,4406		0,0,2203	149.0	134.0	139.0		444,636,444	-9.0	0.3	1		139	4,8596	3.0+/-9.4	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous	RAP1GAP	NM_001145657.1,NM_001145658.1,NM_002885.2	,,	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	,,	148/682,212/728,148/664	21940151	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	5909				regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding	g.chr1:21940151G>A	BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.444C>T	1.37:g.21940151G>A						RAP1GAP_uc001bev.2_Silent_p.T148T|RAP1GAP_uc001bew.2_Silent_p.T212T|RAP1GAP_uc001bey.2_Silent_p.T148T	p.T148T	NM_002885	NP_002876	P47736	RPGP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)	9	702	-		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)	148					J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Silent	SNP	ENST00000374765.4	37	c.444C>T	CCDS218.1																																																																																				0.582	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885		13	88	0	0	0	0.016723	0	13	88				
ZCCHC11	23318	broad.mit.edu	37	1	52911672	52911672	+	Silent	SNP	A	A	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:52911672A>G	ENST00000371544.3	-	23	3958	c.3696T>C	c.(3694-3696)ccT>ccC	p.P1232P	ZCCHC11_ENST00000257177.4_Silent_p.P1232P	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1232	PAP-associated 2.				cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.P1232P(2)		NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						TCAAGTCAAAAGGGTCTACAA	0.303																																							uc001ctx.2		NA																	2	Substitution - coding silent(2)		lung(1)|kidney(1)	ovary(2)|skin(1)	3						c.(3694-3696)CCT>CCC		zinc finger, CCHC domain containing 11 isoform							52.0	55.0	54.0					1																	52911672		2178	4280	6458	SO:0001819	synonymous_variant	23318				miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding	g.chr1:52911672A>G	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.3696T>C	1.37:g.52911672A>G						ZCCHC11_uc001cty.2_Silent_p.P1232P|ZCCHC11_uc001ctz.2_Silent_p.P1232P|ZCCHC11_uc009vze.1_Silent_p.P1232P|ZCCHC11_uc001cua.1_Silent_p.P149P	p.P1232P	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN			23	3930	-			1232			PAP-associated 2.		A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Silent	SNP	ENST00000371544.3	37	c.3696T>C	CCDS30716.1	.	.	.	.	.	.	.	.	.	.	A	7.610	0.674590	0.14841	.	.	ENSG00000134744	ENST00000474453	.	.	.	5.72	4.59	0.56863	.	.	.	.	.	T	0.62998	0.2474	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60089	-0.7331	4	.	.	.	.	11.4836	0.50339	0.9295:0.0:0.0705:0.0	.	.	.	.	L	82	.	.	F	-	1	0	ZCCHC11	52684260	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.677000	0.54619	0.996000	0.38943	0.533000	0.62120	TTT		0.303	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288		3	60	0	0	0	0.009096	0	3	60				
NFIA	4774	broad.mit.edu	37	1	61554263	61554263	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:61554263C>G	ENST00000403491.3	+	2	954	c.470C>G	c.(469-471)tCt>tGt	p.S157C	NFIA_ENST00000407417.3_Missense_Mutation_p.S149C|NFIA_ENST00000485903.2_Missense_Mutation_p.S157C|NFIA_ENST00000371184.2_Missense_Mutation_p.S157C|NFIA_ENST00000371187.3_Missense_Mutation_p.S157C|NFIA_ENST00000371185.2_Missense_Mutation_p.S157C|NFIA_ENST00000371191.1_Missense_Mutation_p.S180C|NFIA_ENST00000371189.4_Missense_Mutation_p.S202C|NFIA_ENST00000479364.1_Intron	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A	157					DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S202C(1)|p.S157C(1)	NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						CCACAATGCTCTAATCCAGGG	0.453																																							uc001czw.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(1)|skin(1)	2						c.(469-471)TCT>TGT		nuclear factor I/A isoform 1							80.0	86.0	84.0					1																	61554263		2203	4300	6503	SO:0001583	missense	4774				DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr1:61554263C>G	U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618	ENST00000403491.3:c.470C>G	1.37:g.61554263C>G	ENSP00000384523:p.Ser157Cys					NFIA_uc001czy.2_Missense_Mutation_p.S149C|NFIA_uc010oos.1_Missense_Mutation_p.S202C|NFIA_uc001czv.2_Missense_Mutation_p.S157C	p.S157C	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN			2	954	+			157			CTF/NF-I.		B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	Missense_Mutation	SNP	ENST00000403491.3	37	c.470C>G	CCDS44156.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.057370	0.76074	.	.	ENSG00000162599	ENST00000371191;ENST00000407417;ENST00000371189;ENST00000403491;ENST00000485903;ENST00000371185;ENST00000371184;ENST00000371187	T;T;T;T;T;T;T;T	0.48836	0.81;0.82;0.8;0.81;0.83;0.86;0.85;0.82	5.87	5.87	0.94306	MAD homology 1, Dwarfin-type (2);CTF transcription factor/nuclear factor 1, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.61937	0.2387	L	0.40543	1.245	0.58432	D	0.999999	D;D;D;D	0.71674	0.998;0.989;0.989;0.96	D;P;P;P	0.64595	0.927;0.879;0.879;0.808	T	0.62310	-0.6881	10	0.87932	D	0	-9.5889	20.2032	0.98269	0.0:1.0:0.0:0.0	.	202;180;157;157	F8W8W3;B1AKN8;Q12857;Q12857-2	.;.;NFIA_HUMAN;.	C	180;149;202;157;157;157;157;157	ENSP00000360233:S180C;ENSP00000384680:S149C;ENSP00000360231:S202C;ENSP00000384523:S157C;ENSP00000419785:S157C;ENSP00000360227:S157C;ENSP00000360226:S157C;ENSP00000360229:S157C	ENSP00000360226:S157C	S	+	2	0	NFIA	61326851	1.000000	0.71417	0.968000	0.41197	0.998000	0.95712	7.818000	0.86416	2.785000	0.95823	0.650000	0.86243	TCT		0.453	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023799.3	NM_005595		3	100	0	0	0	0.004672	0	3	100				
AGL	178	broad.mit.edu	37	1	100346852	100346852	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:100346852C>T	ENST00000294724.4	+	16	2484	c.2006C>T	c.(2005-2007)tCa>tTa	p.S669L	AGL_ENST00000361302.3_Missense_Mutation_p.S653L|AGL_ENST00000370161.2_Missense_Mutation_p.S653L|AGL_ENST00000370163.3_Missense_Mutation_p.S669L|AGL_ENST00000361915.3_Missense_Mutation_p.S669L|AGL_ENST00000361522.4_Missense_Mutation_p.S652L|AGL_ENST00000370165.3_Missense_Mutation_p.S669L	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	669					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)	p.S669L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GTCCAGATTTCAGTGGTTTCT	0.358																																							uc001dsi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2005-2007)TCA>TTA		amylo-1,6-glucosidase,							85.0	87.0	86.0					1																	100346852		2203	4300	6503	SO:0001583	missense	178				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding	g.chr1:100346852C>T	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2006C>T	1.37:g.100346852C>T	ENSP00000294724:p.Ser669Leu					AGL_uc001dsj.1_Missense_Mutation_p.S669L|AGL_uc001dsk.1_Missense_Mutation_p.S669L|AGL_uc001dsl.1_Missense_Mutation_p.S669L|AGL_uc001dsm.1_Missense_Mutation_p.S653L|AGL_uc001dsn.1_Missense_Mutation_p.S652L	p.S669L	NM_000642	NP_000633	P35573	GDE_HUMAN		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)	16	2406	+		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)	669			4-alpha-glucanotransferase.		A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	c.2006C>T	CCDS759.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833330	0.91036	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	D;D;D;D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85;-1.85;-1.85;-1.85	5.7	5.7	0.88788	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.90710	0.7085	M	0.74258	2.255	0.80722	D	1	D;D;P	0.55172	0.97;0.97;0.949	P;P;P	0.60789	0.879;0.879;0.76	D	0.90420	0.4416	10	0.66056	D	0.02	.	20.1979	0.98245	0.0:1.0:0.0:0.0	.	652;653;669	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	L	669;669;669;669;653;653;652	ENSP00000355106:S669L;ENSP00000359184:S669L;ENSP00000359182:S669L;ENSP00000294724:S669L;ENSP00000354971:S653L;ENSP00000359180:S653L;ENSP00000354635:S652L	ENSP00000294724:S669L	S	+	2	0	AGL	100119440	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.176000	0.77643	2.846000	0.97976	0.650000	0.86243	TCA		0.358	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028		17	74	0	0	0	0.004007	0	17	74				
AGL	178	broad.mit.edu	37	1	100346961	100346961	+	Silent	SNP	C	C	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:100346961C>A	ENST00000294724.4	+	16	2593	c.2115C>A	c.(2113-2115)atC>atA	p.I705I	AGL_ENST00000361302.3_Silent_p.I689I|AGL_ENST00000370161.2_Silent_p.I689I|AGL_ENST00000370163.3_Silent_p.I705I|AGL_ENST00000361915.3_Silent_p.I705I|AGL_ENST00000361522.4_Silent_p.I688I|AGL_ENST00000370165.3_Silent_p.I705I	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	705					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)	p.I705I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GGTGTGCTATCAGTAAACTTC	0.393																																							uc001dsi.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2113-2115)ATC>ATA		amylo-1,6-glucosidase,							111.0	112.0	112.0					1																	100346961		2203	4300	6503	SO:0001819	synonymous_variant	178				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding	g.chr1:100346961C>A	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2115C>A	1.37:g.100346961C>A						AGL_uc001dsj.1_Silent_p.I705I|AGL_uc001dsk.1_Silent_p.I705I|AGL_uc001dsl.1_Silent_p.I705I|AGL_uc001dsm.1_Silent_p.I689I|AGL_uc001dsn.1_Silent_p.I688I	p.I705I	NM_000642	NP_000633	P35573	GDE_HUMAN		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)	16	2515	+		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)	705			4-alpha-glucanotransferase.		A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Silent	SNP	ENST00000294724.4	37	c.2115C>A	CCDS759.1																																																																																				0.393	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028		20	85	1	0	0.00152264	0.010504	0.00178165	20	85				
AMPD2	271	broad.mit.edu	37	1	110168292	110168292	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:110168292C>G	ENST00000256578.3	+	3	753	c.393C>G	c.(391-393)ttC>ttG	p.F131L	AMPD2_ENST00000528454.1_Missense_Mutation_p.F13L|AMPD2_ENST00000526301.1_3'UTR|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000342115.4_Missense_Mutation_p.F50L|AMPD2_ENST00000358729.4_Missense_Mutation_p.F56L|AMPD2_ENST00000528667.1_Missense_Mutation_p.F131L|AMPD2_ENST00000393688.3_Missense_Mutation_p.F12L	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	131					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.F131L(1)		breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		AGGAGCTGTTCACCCGCTCAC	0.672																																							uc009wfh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(391-393)TTC>TTG		adenosine monophosphate deaminase 2 (isoform L)							49.0	56.0	53.0					1																	110168292		2203	4300	6503	SO:0001583	missense	271				purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr1:110168292C>G	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.393C>G	1.37:g.110168292C>G	ENSP00000256578:p.Phe131Leu					AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Missense_Mutation_p.F50L|AMPD2_uc001dyc.1_Missense_Mutation_p.F131L|AMPD2_uc010ovr.1_Missense_Mutation_p.F56L|AMPD2_uc010ovs.1_Missense_Mutation_p.F13L|AMPD2_uc001dyd.1_Missense_Mutation_p.F12L	p.F131L	NM_004037	NP_004028	Q01433	AMPD2_HUMAN		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)	4	935	+		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)	131					B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	37	c.393C>G	CCDS805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.25|17.25	3.342171|3.342171	0.61073|0.61073	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000531734;ENST00000342115;ENST00000528667;ENST00000531203;ENST00000256578;ENST00000358729;ENST00000527846;ENST00000528454;ENST00000393688|ENST00000369840	T;T;T;T;T;T;T;D|.	0.87179|.	1.26;1.26;1.26;1.26;1.25;1.26;1.25;-2.22|.	4.84|4.84	2.92|2.92	0.33932|0.33932	.|.	0.101306|.	0.64402|.	N|.	0.000002|.	T|T	0.36386|0.36386	0.0965|0.0965	L|L	0.45051|0.45051	1.395|1.395	0.35269|0.35269	D|D	0.780245|0.780245	B;B;B;B|.	0.13594|.	0.004;0.004;0.005;0.008|.	B;B;B;B|.	0.13407|.	0.006;0.009;0.004;0.009|.	T|T	0.19192|0.19192	-1.0313|-1.0313	10|5	0.62326|.	D|.	0.03|.	-29.0866|-29.0866	10.5014|10.5014	0.44808|0.44808	0.0:0.8335:0.0:0.1665|0.0:0.8335:0.0:0.1665	.|.	56;12;131;50|.	Q01433-4;Q01433-3;Q01433;Q01433-2|.	.;.;AMPD2_HUMAN;.|.	L|D	50;50;131;13;131;56;98;13;12|102	ENSP00000433739:F50L;ENSP00000345498:F50L;ENSP00000436541:F131L;ENSP00000256578:F131L;ENSP00000351573:F56L;ENSP00000431904:F98L;ENSP00000437164:F13L;ENSP00000377292:F12L|.	ENSP00000256578:F131L|.	F|H	+|+	3|1	2|0	AMPD2|AMPD2	109969815|109969815	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	1.080000|1.080000	0.30779|0.30779	1.257000|1.257000	0.44085|0.44085	0.462000|0.462000	0.41574|0.41574	TTC|CAC		0.672	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1			7	34	0	0	0	0.001984	0	7	34				
PRRC2C	23215	broad.mit.edu	37	1	171506560	171506560	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:171506560G>A	ENST00000338920.4	+	15	2683	c.2446G>A	c.(2446-2448)Gag>Aag	p.E816K	PRRC2C_ENST00000392078.3_Missense_Mutation_p.E818K|PRRC2C_ENST00000426496.2_Missense_Mutation_p.E816K|PRRC2C_ENST00000367742.3_Missense_Mutation_p.E818K	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	816					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.E818K(2)									TCCTCATGCTGAGCCTCAACA	0.408																																							uc010pmg.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2446-2448)GAG>AAG		HBxAg transactivated protein 2							55.0	45.0	48.0					1																	171506560		2203	4299	6502	SO:0001583	missense	23215						protein C-terminus binding	g.chr1:171506560G>A	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.2446G>A	1.37:g.171506560G>A	ENSP00000343629:p.Glu816Lys					BAT2L2_uc010pmh.1_5'Flank	p.E816K	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN			15	2712	+			816					Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	c.2446G>A	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	18.04	3.535238	0.64972	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.07567	3.18;3.18;3.18;3.18	5.42	5.42	0.78866	.	0.000000	0.47093	D	0.000248	T	0.12433	0.0302	L	0.34521	1.04	0.58432	D	0.999996	D	0.69078	0.997	P	0.61800	0.894	T	0.03630	-1.1018	10	0.66056	D	0.02	.	19.2961	0.94122	0.0:0.0:1.0:0.0	.	816	Q9Y520-4	.	K	818;817;816;818;816;573;575	ENSP00000375928:E818K;ENSP00000410219:E816K;ENSP00000356716:E818K;ENSP00000343629:E816K	ENSP00000343629:E816K	E	+	1	0	PRRC2C	169773184	1.000000	0.71417	0.945000	0.38365	0.989000	0.77384	8.494000	0.90477	2.563000	0.86464	0.650000	0.86243	GAG		0.408	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172		3	9	0	0	0	0.004672	0	3	9				
SWT1	54823	broad.mit.edu	37	1	185153948	185153948	+	Silent	SNP	A	A	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:185153948A>G	ENST00000367500.4	+	9	1479	c.1314A>G	c.(1312-1314)ctA>ctG	p.L438L	SWT1_ENST00000367501.3_Silent_p.L438L	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	438	PINc.							p.L438L(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						AAGGAAAACTACTAAAACGTG	0.363																																							uc001grg.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1312-1314)CTA>CTG		hypothetical protein LOC54823							119.0	117.0	118.0					1																	185153948		2203	4300	6503	SO:0001819	synonymous_variant	54823							g.chr1:185153948A>G	AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.1314A>G	1.37:g.185153948A>G						C1orf26_uc001grh.3_Silent_p.L438L	p.L438L	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN			9	1428	+			438			PINc.		Q8NEK9|Q9BZQ7|Q9NXQ0	Silent	SNP	ENST00000367500.4	37	c.1314A>G	CCDS1367.1																																																																																				0.363	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085790.1	NM_017673		22	88	0	0	0	0.004656	0	22	88				
NLRP3	114548	broad.mit.edu	37	1	247588432	247588432	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr1:247588432G>A	ENST00000336119.3	+	3	2433	c.1687G>A	c.(1687-1689)Gaa>Aaa	p.E563K	NLRP3_ENST00000348069.2_Missense_Mutation_p.E563K|NLRP3_ENST00000391827.2_Missense_Mutation_p.E563K|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366497.2_Missense_Mutation_p.E563K|NLRP3_ENST00000366496.2_Missense_Mutation_p.E563K|NLRP3_ENST00000391828.3_Missense_Mutation_p.E563K	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	563					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.E563K(2)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGTCCTTCTGGAAAACTATGG	0.478																																							uc001icr.2		NA																	2	Substitution - Missense(2)	p.E563K(1)	lung(1)|skin(1)	lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26						c.(1687-1689)GAA>AAA		NLR family, pyrin domain containing 3 isoform a							50.0	47.0	48.0					1																	247588432		2203	4300	6503	SO:0001583	missense	114548				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding	g.chr1:247588432G>A	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1687G>A	1.37:g.247588432G>A	ENSP00000337383:p.Glu563Lys					NLRP3_uc001ics.2_Missense_Mutation_p.E563K|NLRP3_uc001icu.2_Missense_Mutation_p.E563K|NLRP3_uc001icw.2_Missense_Mutation_p.E563K|NLRP3_uc001icv.2_Missense_Mutation_p.E563K|NLRP3_uc010pyw.1_Missense_Mutation_p.E561K|NLRP3_uc001ict.1_Missense_Mutation_p.E561K	p.E563K	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)		5	1825	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	563					B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	c.1687G>A	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764211	0.31228	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87;-1.87;-1.87	4.17	3.23	0.37069	.	0.000000	0.53938	D	0.000044	D	0.84687	0.5527	M	0.72118	2.19	0.27760	N	0.943878	B;P;P;B;B	0.46656	0.227;0.882;0.729;0.126;0.427	B;P;B;B;B	0.49085	0.248;0.6;0.413;0.07;0.258	T	0.75396	-0.3332	10	0.13470	T	0.59	.	9.9468	0.41613	0.0:0.2063:0.7937:0.0	.	563;563;563;563;563	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	K	563	ENSP00000375704:E563K;ENSP00000355453:E563K;ENSP00000337383:E563K;ENSP00000294752:E563K;ENSP00000355452:E563K;ENSP00000375703:E563K	ENSP00000337383:E563K	E	+	1	0	NLRP3	245655055	0.578000	0.26717	0.625000	0.29200	0.755000	0.42902	1.111000	0.31159	1.306000	0.44926	0.655000	0.94253	GAA		0.478	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		5	36	0	0	0	0.014758	0	5	36				
ITIH5	80760	broad.mit.edu	37	10	7658063	7658063	+	Splice_Site	SNP	T	T	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:7658063T>C	ENST00000256861.6	-	7	901		c.e7-2		ITIH5_ENST00000397145.2_Splice_Site|ITIH5_ENST00000298441.6_Splice_Site|ITIH5_ENST00000397146.2_Splice_Site|ITIH5_ENST00000446830.2_Splice_Site|ITIH5_ENST00000434980.1_Splice_Site	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5						hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.?(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						ATTTAGAACCTGGTGGAGGGA	0.423																																							uc001ijq.2		NA																	2	Unknown(2)		lung(2)	ovary(2)|central_nervous_system(2)	4						c.e7-1		inter-alpha trypsin inhibitor heavy chain							119.0	115.0	117.0					10																	7658063		2203	4300	6503	SO:0001630	splice_region_variant	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7658063T>C			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.823-2A>G	10.37:g.7658063T>C						ITIH5_uc001ijp.2_Splice_Site_p.V61_splice|ITIH5_uc001ijr.1_Splice_Site_p.V275_splice	p.V275_splice	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN			7	902	-								Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Splice_Site	SNP	ENST00000256861.6	37	c.823_splice		.	.	.	.	.	.	.	.	.	.	T	13.32	2.202822	0.38905	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	.	.	.	6.08	6.08	0.98989	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3164	0.82930	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITIH5	7698069	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	7.477000	0.81069	2.330000	0.79161	0.533000	0.62120	.		0.423	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	Intron	13	64	0	0	0	0.020292	0	13	64				
ANKRD26	22852	broad.mit.edu	37	10	27382712	27382712	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:27382712C>G	ENST00000376087.4	-	2	424	c.259G>C	c.(259-261)Gcc>Ccc	p.A87P	ANKRD26_ENST00000436985.2_Missense_Mutation_p.A87P	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	87					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)		p.A87P(1)		breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TTGGCACAGGCCAAATGTAGA	0.403																																							uc001ith.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						c.(259-261)GCC>CCC		ankyrin repeat domain 26							89.0	86.0	87.0					10																	27382712		1983	4220	6203	SO:0001583	missense	22852					centrosome		g.chr10:27382712C>G	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.259G>C	10.37:g.27382712C>G	ENSP00000365255:p.Ala87Pro					ANKRD26_uc009xku.1_Missense_Mutation_p.A87P	p.A87P	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN			2	431	-			87			ANK 2.		A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	c.259G>C	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.950381	0.92660	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.73047	-0.71;-0.71	4.16	4.16	0.48862	Ankyrin repeat-containing domain (4);	.	.	.	.	D	0.90679	0.7076	H	0.99425	4.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94209	0.7457	9	0.87932	D	0	.	13.9643	0.64199	0.0:1.0:0.0:0.0	.	87;87	Q9UPS8-3;Q9UPS8	.;ANR26_HUMAN	P	87	ENSP00000365255:A87P;ENSP00000405112:A87P	ENSP00000365255:A87P	A	-	1	0	ANKRD26	27422718	1.000000	0.71417	0.809000	0.32408	0.469000	0.32828	5.253000	0.65452	2.160000	0.67779	0.491000	0.48974	GCC		0.403	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1			20	72	0	0	0	0.010504	0	20	72				
MAP3K8	1326	broad.mit.edu	37	10	30740626	30740626	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:30740626C>T	ENST00000263056.1	+	6	1522	c.826C>T	c.(826-828)Caa>Taa	p.Q276*	MAP3K8_ENST00000542547.1_Nonsense_Mutation_p.Q276*|MAP3K8_ENST00000375321.1_Nonsense_Mutation_p.Q276*	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	276	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)	p.Q276*(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				CCTAAGTGTTCAAATGACCGA	0.313																																							uc001ivi.1		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(3)|central_nervous_system(1)	4						c.(826-828)CAA>TAA		mitogen-activated protein kinase kinase kinase							82.0	84.0	83.0					10																	30740626		2203	4300	6503	SO:0001587	stop_gained	1326				cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding	g.chr10:30740626C>T	D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.826C>T	10.37:g.30740626C>T	ENSP00000263056:p.Gln276*					MAP3K8_uc009xlf.1_Nonsense_Mutation_p.Q276*|MAP3K8_uc001ivj.1_Nonsense_Mutation_p.Q276*	p.Q276*	NM_005204	NP_005195	P41279	M3K8_HUMAN			6	1522	+		Prostate(175;0.151)	276			Protein kinase.		A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Nonsense_Mutation	SNP	ENST00000263056.1	37	c.826C>T	CCDS7166.1	.	.	.	.	.	.	.	.	.	.	C	43	10.473456	0.99411	.	.	ENSG00000107968	ENST00000375328;ENST00000263056;ENST00000542547;ENST00000375321	.	.	.	5.57	3.5	0.40072	.	0.104089	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	16.2672	0.82593	0.2516:0.7484:0.0:0.0	.	.	.	.	X	276	.	ENSP00000263056:Q276X	Q	+	1	0	MAP3K8	30780632	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	4.377000	0.59562	1.305000	0.44909	0.467000	0.42956	CAA		0.313	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047416.2	NM_005204		19	73	0	0	0	0.01892	0	19	73				
RET	5979	broad.mit.edu	37	10	43615593	43615593	+	Nonsense_Mutation	SNP	C	C	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:43615593C>A	ENST00000355710.3	+	15	2904	c.2672C>A	c.(2671-2673)tCg>tAg	p.S891*	RET_ENST00000340058.5_Nonsense_Mutation_p.S891*	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	891	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		S -> A (in MTC; familial form; dbSNP:rs75234356). {ECO:0000269|PubMed:9398735}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S891*(1)	CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	ATGAAGATTTCGGATTTCGGC	0.567		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	uc001jal.2		1	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	T|Mis|N|F	ret proto-oncogene	yes	Hirschsprung disease	"""E, O"""	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma		1	Substitution - Nonsense(1)		lung(1)	thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451						c.(2671-2673)TCG>TAG		ret proto-oncogene isoform a	Sunitinib(DB01268)						88.0	76.0	80.0					10																	43615593		2203	4300	6503	SO:0001587	stop_gained	5979	Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity	g.chr10:43615593C>A	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2672C>A	10.37:g.43615593C>A	ENSP00000347942:p.Ser891*					RET_uc001jak.1_Nonsense_Mutation_p.S891*|RET_uc010qez.1_Nonsense_Mutation_p.S637*	p.S891*	NM_020975	NP_066124	P07949	RET_HUMAN			15	2862	+		Ovarian(717;0.0423)	891		S -> A (in MTC; familial form).	Protein kinase.|Cytoplasmic (Potential).		A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Nonsense_Mutation	SNP	ENST00000355710.3	37	c.2672C>A	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	C	42	9.635522	0.99226	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5746	0.95436	0.0:1.0:0.0:0.0	.	.	.	.	X	891	.	ENSP00000344798:S891X	S	+	2	0	RET	42935599	1.000000	0.71417	0.929000	0.37066	0.897000	0.52465	7.818000	0.86416	2.638000	0.89438	0.655000	0.94253	TCG		0.567	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975		7	28	1	0	2.17888e-05	0.006214	2.61696e-05	7	28				
GDF10	2662	broad.mit.edu	37	10	48429252	48429252	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:48429252C>T	ENST00000224605.2	-	2	899	c.634G>A	c.(634-636)Gcg>Acg	p.A212T		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	212					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.A212T(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						CGGCGGGCCGCCTTGACGATG	0.726																																							uc001jfb.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|central_nervous_system(1)	2						c.(634-636)GCG>ACG		growth differentiation factor 10 precursor							9.0	14.0	12.0					10																	48429252		2146	4245	6391	SO:0001583	missense	2662				growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity	g.chr10:48429252C>T	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.634G>A	10.37:g.48429252C>T	ENSP00000224605:p.Ala212Thr					GDF10_uc009xnp.2_Missense_Mutation_p.A211T|GDF10_uc009xnq.1_Missense_Mutation_p.A212T	p.A212T	NM_004962	NP_004953	P55107	BMP3B_HUMAN			2	1090	-			212					Q5VSQ8|Q9UCX6	Missense_Mutation	SNP	ENST00000224605.2	37	c.634G>A	CCDS7220.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.264026	0.59431	.	.	ENSG00000107623	ENST00000374247;ENST00000224605	T	0.74737	-0.87	5.44	5.44	0.79542	.	0.212911	0.47852	D	0.000204	T	0.72463	0.3463	L	0.51422	1.61	0.28440	N	0.916867	B;P	0.49961	0.255;0.93	B;B	0.43623	0.071;0.425	T	0.69756	-0.5059	10	0.37606	T	0.19	.	18.2483	0.89995	0.0:1.0:0.0:0.0	.	22;212	Q8N6T2;P55107	.;BMP3B_HUMAN	T	22;212	ENSP00000224605:A212T	ENSP00000224605:A212T	A	-	1	0	GDF10	48049258	0.999000	0.42202	0.860000	0.33809	0.979000	0.70002	1.658000	0.37376	2.568000	0.86640	0.555000	0.69702	GCG		0.726	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962		4	23	0	0	0	0.009096	0	4	23				
ZMIZ1	57178	broad.mit.edu	37	10	81037046	81037046	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:81037046G>A	ENST00000334512.5	+	8	961	c.389G>A	c.(388-390)aGc>aAc	p.S130N	ZMIZ1_ENST00000478357.1_3'UTR	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	130					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S130N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CCCCCTCTCAGCTCCATGAGC	0.617																																							uc001kaf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|skin(1)	4						c.(388-390)AGC>AAC		retinoic acid induced 17							57.0	54.0	55.0					10																	81037046		2203	4300	6503	SO:0001583	missense	57178				transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding	g.chr10:81037046G>A	AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.389G>A	10.37:g.81037046G>A	ENSP00000334474:p.Ser130Asn					ZMIZ1_uc001kag.2_Missense_Mutation_p.S6N|ZMIZ1_uc001kah.1_Missense_Mutation_p.S6N	p.S130N	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)		8	961	+	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		130					Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	ENST00000334512.5	37	c.389G>A	CCDS7357.1	.	.	.	.	.	.	.	.	.	.	G	4.226	0.040814	0.08196	.	.	ENSG00000108175	ENST00000334512;ENST00000394592;ENST00000360331	D	0.97959	-4.63	5.56	3.18	0.36537	.	0.373259	0.18385	N	0.142848	D	0.87637	0.6227	N	0.01134	-0.995	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.80692	-0.1269	10	0.02654	T	1	-9.9904	9.6096	0.39654	0.8536:0.0:0.1464:0.0	.	40;130	Q9H7J0;Q9ULJ6	.;ZMIZ1_HUMAN	N	130;130;60	ENSP00000334474:S130N	ENSP00000334474:S130N	S	+	2	0	ZMIZ1	80707052	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.495000	0.53280	0.377000	0.24735	-0.367000	0.07326	AGC		0.617	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048944.2	NM_020338		6	30	0	0	0	0.001168	0	6	30				
SLK	9748	broad.mit.edu	37	10	105727608	105727608	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:105727608G>C	ENST00000369755.3	+	1	650	c.105G>C	c.(103-105)gaG>gaC	p.E35D	SLK_ENST00000335753.4_Missense_Mutation_p.E35D	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	35	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.E35D(1)		kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		ACTTTTGGGAGATTATAGGAG	0.498																																					NSCLC(111;540 1651 1927 4474 17706)	NSCLC(111;540 1651 1927 4474 17706)	uc001kxo.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8						c.(103-105)GAG>GAC		serine/threonine kinase 2							111.0	120.0	117.0					10																	105727608		2203	4300	6503	SO:0001583	missense	9748				apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity	g.chr10:105727608G>C		CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.105G>C	10.37:g.105727608G>C	ENSP00000358770:p.Glu35Asp					SLK_uc001kxp.1_Missense_Mutation_p.E35D	p.E35D	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)	1	139	+		Colorectal(252;0.178)	35			Protein kinase.		D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	ENST00000369755.3	37	c.105G>C	CCDS7553.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862632	0.51482	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.67698	-0.28;-0.28	4.57	-2.91	0.05631	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.138639	0.47852	D	0.000214	T	0.67720	0.2923	L	0.43152	1.355	0.49051	D	0.99974	P;P	0.52316	0.941;0.952	D;D	0.68765	0.934;0.96	T	0.63501	-0.6623	10	0.32370	T	0.25	.	9.3388	0.38067	0.2981:0.128:0.5738:0.0	.	35;35	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	D	35	ENSP00000336824:E35D;ENSP00000358770:E35D	ENSP00000336824:E35D	E	+	3	2	SLK	105717598	0.598000	0.26882	0.958000	0.39756	0.921000	0.55340	-0.285000	0.08410	-0.455000	0.07054	0.313000	0.20887	GAG		0.498	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1	NM_014720		5	108	0	0	0	0.014758	0	5	108				
HTRA1	5654	broad.mit.edu	37	10	124248444	124248444	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr10:124248444C>T	ENST00000368984.3	+	2	627	c.499C>T	c.(499-501)Cat>Tat	p.H167Y		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	167					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.H167Y(1)		endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				CAGTTTGCGCCATAAATATAA	0.448																																							uc001lgj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(499-501)CAT>TAT		HtrA serine peptidase 1 precursor							130.0	129.0	129.0					10																	124248444		2203	4300	6503	SO:0001583	missense	5654				proteolysis|regulation of cell growth	extracellular space	insulin-like growth factor binding|serine-type endopeptidase activity	g.chr10:124248444C>T	AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.499C>T	10.37:g.124248444C>T	ENSP00000357980:p.His167Tyr						p.H167Y	NM_002775	NP_002766	Q92743	HTRA1_HUMAN			2	627	+		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)	167					D3DRE4|Q9UNS5	Missense_Mutation	SNP	ENST00000368984.3	37	c.499C>T	CCDS7630.1	.	.	.	.	.	.	.	.	.	.	C	4.678	0.126007	0.08931	.	.	ENSG00000166033	ENST00000368984;ENST00000435263	T	0.80824	-1.42	5.42	5.42	0.78866	Peptidase cysteine/serine, trypsin-like (1);	0.239032	0.42821	D	0.000649	T	0.52964	0.1767	N	0.02142	-0.665	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.56866	-0.7908	10	0.02654	T	1	-9.6022	12.5484	0.56214	0.0:0.9242:0.0:0.0758	.	167	Q92743	HTRA1_HUMAN	Y	167;134	ENSP00000357980:H167Y	ENSP00000357980:H167Y	H	+	1	0	HTRA1	124238434	0.885000	0.30320	1.000000	0.80357	0.980000	0.70556	1.656000	0.37355	2.532000	0.85374	0.655000	0.94253	CAT		0.448	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	NM_002775		25	128	0	0	0	0.008361	0	25	128				
SMPD1	6609	broad.mit.edu	37	11	6413070	6413070	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:6413070C>G	ENST00000342245.4	+	2	943	c.775C>G	c.(775-777)Ctg>Gtg	p.L259V	SMPD1_ENST00000533196.1_Intron|SMPD1_ENST00000527275.1_Missense_Mutation_p.L258V|SMPD1_ENST00000299397.3_Missense_Mutation_p.L259V|SMPD1_ENST00000356761.2_Missense_Mutation_p.L259V	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	257					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.L259V(2)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	CCTGAGGACCCTGGAGAGCCT	0.647																																							uc001mcw.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(775-777)CTG>GTG		sphingomyelin phosphodiesterase 1, acid	Desipramine(DB01151)						76.0	91.0	86.0					11																	6413070		2199	4296	6495	SO:0001583	missense	6609				cell death|ceramide biosynthetic process|negative regulation of MAP kinase activity|nervous system development|positive regulation of protein dephosphorylation|signal transduction|sphingomyelin catabolic process|termination of signal transduction	lysosome	hydrolase activity, acting on glycosyl bonds|sphingomyelin phosphodiesterase activity	g.chr11:6413070C>G	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.775C>G	11.37:g.6413070C>G	ENSP00000340409:p.Leu259Val					SMPD1_uc001mcv.1_Intron|SMPD1_uc009yex.2_RNA|SMPD1_uc001mcx.2_Missense_Mutation_p.L259V|SMPD1_uc009yew.2_Missense_Mutation_p.L258V	p.L259V	NM_000543	NP_000534	P17405	ASM_HUMAN		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	949	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	257					A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	ENST00000342245.4	37	c.775C>G	CCDS44531.1	.	.	.	.	.	.	.	.	.	.	C	6.880	0.531767	0.13127	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82	5.02	1.87	0.25490	Metallophosphoesterase domain (1);	0.213105	0.32134	N	0.006522	T	0.79587	0.4471	N	0.00608	-1.33	0.32731	N	0.508968	B;B;B	0.29232	0.119;0.238;0.07	B;B;B	0.33392	0.134;0.082;0.163	T	0.78929	-0.2010	10	0.06891	T	0.86	-26.8119	5.4706	0.16668	0.3024:0.5281:0.0:0.1695	.	258;259;257	E9PKS3;G3XAB5;P17405	.;.;ASM_HUMAN	V	259;259;259;258	ENSP00000299397:L259V;ENSP00000349203:L259V;ENSP00000340409:L259V;ENSP00000435350:L258V	ENSP00000299397:L259V	L	+	1	2	SMPD1	6369646	0.717000	0.27966	1.000000	0.80357	0.970000	0.65996	1.078000	0.30754	1.087000	0.41251	0.561000	0.74099	CTG		0.647	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543		23	80	0	0	0	0.014323	0	23	80				
DBX1	120237	broad.mit.edu	37	11	20178619	20178619	+	Missense_Mutation	SNP	C	C	G	rs575803112		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:20178619C>G	ENST00000524983.2	-	3	924	c.636G>C	c.(634-636)aaG>aaC	p.K212N	DBX1_ENST00000227256.3_Missense_Mutation_p.K212N			A6NMT0	DBX1_HUMAN	developing brain homeobox 1	212					regulation of transcription from RNA polymerase II promoter (GO:0006357)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.K212N(1)		endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)	21						CCGCCAGCTTCTTGCGGTCGG	0.667																																							uc001mpw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(634-636)AAG>AAC		developing brain homeobox 1							43.0	45.0	44.0					11																	20178619		2203	4300	6503	SO:0001583	missense	120237				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:20178619C>G			11p15.1	2011-06-20				ENSG00000109851		"""Homeoboxes / ANTP class : NKL subclass"""	33185	protein-coding gene	gene with protein product						11239429	Standard	NM_001029865		Approved		uc021qey.1	A6NMT0		ENST00000524983.2:c.636G>C	11.37:g.20178619C>G	ENSP00000436881:p.Lys212Asn						p.K212N	NM_001029865	NP_001025036	A6NMT0	DBX1_HUMAN			3	636	-			212			Homeobox.			Missense_Mutation	SNP	ENST00000524983.2	37	c.636G>C		.	.	.	.	.	.	.	.	.	.	C	18.06	3.539107	0.65085	.	.	ENSG00000109851	ENST00000524983;ENST00000227256	D;D	0.96396	-4.0;-4.0	4.48	3.56	0.40772	.	0.000000	0.85682	D	0.000000	D	0.91068	0.7189	L	0.27975	0.815	0.80722	D	1	P	0.41848	0.763	B	0.33960	0.173	D	0.90808	0.4699	10	0.87932	D	0	-24.8622	11.9573	0.52988	0.0:0.9136:0.0:0.0864	.	212	F8W811	.	N	212	ENSP00000436881:K212N;ENSP00000227256:K212N	ENSP00000227256:K212N	K	-	3	2	DBX1	20135195	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.976000	0.49289	1.179000	0.42884	0.650000	0.86243	AAG		0.667	DBX1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387585.2	NM_001029865		16	40	0	0	0	0.00499	0	16	40				
TRIM51	84767	broad.mit.edu	37	11	55658753	55658753	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:55658753C>G	ENST00000449290.2	+	7	1096	c.1004C>G	c.(1003-1005)gCt>gGt	p.A335G	TRIM51_ENST00000244891.3_Missense_Mutation_p.A192G	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	335	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.A176G(1)|p.A335G(1)									GGGGCTCAGGCTTTCACATCT	0.423																																							uc010rip.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1003-1005)GCT>GGT		SPRY domain containing 5							89.0	96.0	93.0					11																	55658753		2105	4005	6110	SO:0001583	missense	84767					intracellular	zinc ion binding	g.chr11:55658753C>G	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.1004C>G	11.37:g.55658753C>G	ENSP00000395086:p.Ala335Gly					SPRYD5_uc010riq.1_Missense_Mutation_p.A192G	p.A335G	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN			7	1096	+		all_epithelial(135;0.226)	335			B30.2/SPRY.		A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	37	c.1004C>G		.	.	.	.	.	.	.	.	.	.	.	6.004	0.369158	0.11352	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.09073	3.02;3.02	1.36	-2.72	0.05968	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.03434	0.0099	N	0.11892	0.195	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44907	-0.9297	9	0.19147	T	0.46	.	3.0339	0.06116	0.0:0.4754:0.2825:0.2421	.	335	Q9BSJ1	SPRY5_HUMAN	G	335;192	ENSP00000395086:A335G;ENSP00000244891:A192G	ENSP00000244891:A192G	A	+	2	0	SPRYD5	55415329	0.025000	0.19082	0.000000	0.03702	0.151000	0.21798	1.047000	0.30367	-1.102000	0.03023	0.162000	0.16502	GCT		0.423	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681		37	157	0	0	0	0.019004	0	37	157				
SRPR	6734	broad.mit.edu	37	11	126135202	126135202	+	Silent	SNP	G	G	A	rs375322300		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:126135202G>A	ENST00000332118.6	-	10	1426	c.1272C>T	c.(1270-1272)tgC>tgT	p.C424C	SRPR_ENST00000532259.1_Silent_p.C396C|SRPR_ENST00000530680.1_5'Flank	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	424					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)	p.C424C(1)		endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		CATTAACGCCGCAGAAGGTGA	0.532																																							uc001qdh.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1270-1272)TGC>TGT		signal recognition particle receptor		G	,	0,4402		0,0,2201	69.0	69.0	69.0		1188,1272	2.9	1.0	11		69	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous	SRPR	NM_001177842.1,NM_003139.3	,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,	396/611,424/639	126135202	1,12999	2201	4299	6500	SO:0001819	synonymous_variant	6734				SRP-dependent cotranslational protein targeting to membrane	integral to membrane|signal recognition particle receptor complex	GTP binding|GTPase activity|receptor activity|signal recognition particle binding	g.chr11:126135202G>A	BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.1272C>T	11.37:g.126135202G>A						SRPR_uc010sbm.1_Silent_p.C396C	p.C424C	NM_003139	NP_003130	P08240	SRPR_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)	10	1323	-	all_hematologic(175;0.145)		424					A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Silent	SNP	ENST00000332118.6	37	c.1272C>T	CCDS31717.1																																																																																				0.532	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386425.2	NM_003139		12	59	0	0	0	0.016723	0	12	59				
TMEM45B	120224	broad.mit.edu	37	11	129724602	129724602	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr11:129724602G>A	ENST00000524567.1	+	3	557	c.276G>A	c.(274-276)atG>atA	p.M92I	TMEM45B_ENST00000281441.3_Missense_Mutation_p.M92I			Q96B21	TM45B_HUMAN	transmembrane protein 45B	92						integral component of membrane (GO:0016021)		p.M92I(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)		ACAGCACCATGTACCTATTCT	0.517																																							uc001qfe.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(274-276)ATG>ATA		transmembrane protein 45B							164.0	148.0	153.0					11																	129724602		2201	4297	6498	SO:0001583	missense	120224					integral to membrane		g.chr11:129724602G>A	AK098106	CCDS8482.1	11q24.3	2008-02-05				ENSG00000151715			25194	protein-coding gene	gene with protein product						12477932	Standard	NM_138788		Approved	BC016153, FLJ40787	uc001qfe.1	Q96B21		ENST00000524567.1:c.276G>A	11.37:g.129724602G>A	ENSP00000436293:p.Met92Ile					TMEM45B_uc001qff.1_Missense_Mutation_p.M92I	p.M92I	NM_138788	NP_620143	Q96B21	TM45B_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)	3	337	+	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)	92					A8K2L8	Missense_Mutation	SNP	ENST00000524567.1	37	c.276G>A	CCDS8482.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.038064	0.93630	.	.	ENSG00000151715	ENST00000281441;ENST00000524567	T;T	0.46063	0.88;0.88	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.64349	0.2590	M	0.86178	2.8	0.80722	D	1	D	0.65815	0.995	P	0.58013	0.831	T	0.62623	-0.6815	10	0.26408	T	0.33	-16.4722	18.5819	0.91174	0.0:0.0:1.0:0.0	.	92	Q96B21	TM45B_HUMAN	I	92	ENSP00000281441:M92I;ENSP00000436293:M92I	ENSP00000281441:M92I	M	+	3	0	TMEM45B	129229812	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.416000	0.97383	2.723000	0.93209	0.637000	0.83480	ATG		0.517	TMEM45B-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386062.1	NM_138788		5	94	0	0	0	0.014758	0	5	94				
RERGL	79785	broad.mit.edu	37	12	18234236	18234236	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:18234236G>C	ENST00000229002.2	-	6	713	c.507C>G	c.(505-507)atC>atG	p.I169M	RERGL_ENST00000541632.1_5'Flank|RERGL_ENST00000538724.1_Missense_Mutation_p.I168M	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	169	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)	p.I169M(2)		endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						GGATGTCCTTGATAATTCTGA	0.408																																							uc001rdq.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(505-507)ATC>ATG		RERG/RAS-like							123.0	115.0	118.0					12																	18234236		2203	4300	6503	SO:0001583	missense	79785				signal transduction	membrane	GTP binding|GTPase activity	g.chr12:18234236G>C	AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.507C>G	12.37:g.18234236G>C	ENSP00000229002:p.Ile169Met					RERGL_uc001rdr.2_Missense_Mutation_p.I168M	p.I169M	NM_024730	NP_079006	Q9H628	RERGL_HUMAN			6	701	-			169			Small GTPase-like.			Missense_Mutation	SNP	ENST00000229002.2	37	c.507C>G	CCDS8679.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165100	0.57476	.	.	ENSG00000111404	ENST00000229002;ENST00000538724	T;T	0.80824	-1.42;-1.42	5.16	5.16	0.70880	.	0.350198	0.31427	N	0.007663	D	0.85626	0.5740	M	0.75615	2.305	0.80722	D	1	P;D	0.54772	0.794;0.968	P;P	0.57620	0.659;0.824	D	0.86726	0.1945	10	0.87932	D	0	.	9.4747	0.38864	0.0:0.1644:0.6867:0.1489	.	168;169	F5H686;Q9H628	.;RERGL_HUMAN	M	169;168	ENSP00000229002:I169M;ENSP00000437814:I168M	ENSP00000229002:I169M	I	-	3	3	RERGL	18125503	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	1.025000	0.30090	2.559000	0.86315	0.552000	0.68991	ATC		0.408	RERGL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401198.1	NM_024730		10	150	0	0	0	0.008291	0	10	150				
SLCO1B1	10599	broad.mit.edu	37	12	21349967	21349967	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:21349967C>G	ENST00000256958.2	+	8	911	c.815C>G	c.(814-816)tCt>tGt	p.S272C		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	272					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.S272C(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	TCCATTATTTCTTCCATACCA	0.378																																							uc001req.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8						c.(814-816)TCT>TGT		solute carrier organic anion transporter family,	Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)						203.0	184.0	190.0					12																	21349967		2203	4300	6503	SO:0001583	missense	10599				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity	g.chr12:21349967C>G		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.815C>G	12.37:g.21349967C>G	ENSP00000256958:p.Ser272Cys						p.S272C	NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN			8	919	+			272			Helical; Name=6; (Potential).		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	c.815C>G	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	C	9.597	1.127803	0.20959	.	.	ENSG00000134538	ENST00000256958	T	0.59502	0.26	3.24	2.32	0.28847	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.310735	0.35179	N	0.003385	T	0.58566	0.2131	M	0.61703	1.905	0.31072	N	0.712875	B	0.28378	0.209	B	0.38954	0.286	T	0.64584	-0.6373	10	0.59425	D	0.04	.	10.761	0.46264	0.0:0.8073:0.1927:0.0	.	272	Q9Y6L6	SO1B1_HUMAN	C	272	ENSP00000256958:S272C	ENSP00000256958:S272C	S	+	2	0	SLCO1B1	21241234	0.998000	0.40836	0.913000	0.36048	0.517000	0.34286	4.191000	0.58372	0.651000	0.30788	0.491000	0.48974	TCT		0.378	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446		7	340	0	0	0	0.00308	0	7	340				
IAPP	3375	broad.mit.edu	37	12	21526328	21526328	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:21526328G>A	ENST00000240652.3	+	2	179	c.43G>A	c.(43-45)Gtt>Att	p.V15I	SLCO1A2_ENST00000537524.1_Intron|IAPP_ENST00000539393.1_Missense_Mutation_p.V15I|SLCO1A2_ENST00000307378.6_Intron|SLCO1A2_ENST00000473830.1_Intron|IAPP_ENST00000542023.1_Missense_Mutation_p.V15I	NM_000415.2	NP_000406.1	P10997	IAPP_HUMAN	islet amyloid polypeptide	15					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|endocrine pancreas development (GO:0031018)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell differentiation (GO:0045596)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.V15I(1)		lung(3)	3						TGTGCTCTCTGTTGCATTGAA	0.348																																							uc001rev.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(43-45)GTT>ATT		islet amyloid polypeptide precursor	Perindopril(DB00790)						158.0	147.0	151.0					12																	21526328		2203	4300	6503	SO:0001583	missense	3375				apoptosis|cell-cell signaling|endocrine pancreas development|signal transduction	extracellular region|soluble fraction	hormone activity	g.chr12:21526328G>A		CCDS8688.1	12p12.1	2013-02-25			ENSG00000121351	ENSG00000121351		"""Endogenous ligands"""	5329	protein-coding gene	gene with protein product	"""amylin"""	147940					Standard	NM_000415		Approved	AMYLIN, DAP, IAP	uc001rev.3	P10997	OTTHUMG00000169128	ENST00000240652.3:c.43G>A	12.37:g.21526328G>A	ENSP00000240652:p.Val15Ile					SLCO1A2_uc001res.2_Intron|SLCO1A2_uc010siq.1_Intron	p.V15I	NM_000415	NP_000406	P10997	IAPP_HUMAN			2	195	+			15					Q0ZD87|Q14598	Missense_Mutation	SNP	ENST00000240652.3	37	c.43G>A	CCDS8688.1	.	.	.	.	.	.	.	.	.	.	G	9.448	1.089836	0.20390	.	.	ENSG00000121351	ENST00000539393;ENST00000240652;ENST00000542023;ENST00000537593	T;T;T	0.78481	-1.16;-1.16;-1.18	5.77	2.87	0.33458	.	0.439705	0.22034	N	0.065550	T	0.70640	0.3247	.	.	.	0.09310	N	0.999999	P	0.48294	0.908	B	0.38842	0.283	T	0.62558	-0.6829	9	0.52906	T	0.07	-3.5432	15.7282	0.77780	0.0:0.3893:0.6107:0.0	.	15	P10997	IAPP_HUMAN	I	15	ENSP00000437357:V15I;ENSP00000240652:V15I;ENSP00000445980:V15I	ENSP00000240652:V15I	V	+	1	0	IAPP	21417595	0.163000	0.22920	0.017000	0.16124	0.136000	0.21042	0.617000	0.24359	0.327000	0.23409	-0.122000	0.15005	GTT		0.348	IAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402356.1	NM_000415		11	211	0	0	0	0.004007	0	11	211				
ITPR2	3709	broad.mit.edu	37	12	26629850	26629850	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:26629850C>G	ENST00000381340.3	-	44	6630	c.6214G>C	c.(6214-6216)Gaa>Caa	p.E2072Q		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2072					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.E2072*(1)|p.E2072Q(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CTTACCAGTTCTCTGGGTCTC	0.343																																							uc001rhg.2		NA																	2	Substitution - Missense(1)|Substitution - Nonsense(1)		large_intestine(1)|lung(1)	kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(6214-6216)GAA>CAA		inositol 1,4,5-triphosphate receptor, type 2							107.0	95.0	99.0					12																	26629850		1810	4074	5884	SO:0001583	missense	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26629850C>G	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.6214G>C	12.37:g.26629850C>G	ENSP00000370744:p.Glu2072Gln					ITPR2_uc009zjg.1_Missense_Mutation_p.E223Q	p.E2072Q	NM_002223	NP_002214	Q14571	ITPR2_HUMAN			44	6631	-	Colorectal(261;0.0847)		2072			Cytoplasmic (Potential).		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	c.6214G>C	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	10.60	1.395157	0.25205	.	.	ENSG00000123104	ENST00000381340	D	0.90788	-2.73	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.85635	0.5742	N	0.01668	-0.77	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81486	-0.0911	10	0.05436	T	0.98	.	18.49	0.90843	0.0:1.0:0.0:0.0	.	2072	Q14571	ITPR2_HUMAN	Q	2072	ENSP00000370744:E2072Q	ENSP00000370744:E2072Q	E	-	1	0	ITPR2	26521117	1.000000	0.71417	0.995000	0.50966	0.960000	0.62799	7.592000	0.82676	2.579000	0.87056	0.585000	0.79938	GAA		0.343	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		8	136	0	0	0	0.00308	0	8	136				
OVOS2	144203	broad.mit.edu	37	12	31301016	31301016	+	IGR	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:31301016C>G								RP11-551L14.1 (30611 upstream) : FAM60A (132501 downstream)														p.W415S(1)									AGGCGTCAACCAGCTGGGAAG	0.458																																							uc010sjy.1		NA																	1	Substitution - Missense(1)		lung(1)		NA						c.(1243-1245)TGG>TCG		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							132.0	132.0	132.0					12																	31301016		1950	4171	6121	SO:0001628	intergenic_variant	0							g.chr12:31301016C>G																													12.37:g.31301016C>G							p.W415S							11	1244	-									Missense_Mutation	SNP		37	c.1244G>C																																																																																				0	0.458									28	409	0	0	0	0.004656	0	28	409				
ABCD2	225	broad.mit.edu	37	12	40012767	40012767	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:40012767G>T	ENST00000308666.3	-	1	786	c.651C>A	c.(649-651)ttC>ttA	p.F217L		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	217	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.|Interaction with PEX19.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)	p.F217L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						CAGATTGGGAGAACATCATAA	0.393																																							uc001rmb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						c.(649-651)TTC>TTA		ATP-binding cassette, sub-family D, member 2							130.0	123.0	125.0					12																	40012767		2203	4300	6503	SO:0001583	missense	225				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding	g.chr12:40012767G>T	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.651C>A	12.37:g.40012767G>T	ENSP00000310688:p.Phe217Leu						p.F217L	NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN			1	1077	-			217			ABC transmembrane type-1.|Interaction with PEX19.		B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	c.651C>A	CCDS8734.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972821	0.53614	.	.	ENSG00000173208	ENST00000308666	D	0.99867	-7.31	4.96	2.1	0.27182	ABC transporter, N-terminal (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.99582	0.9849	M	0.73430	2.235	0.49582	D	0.9998	P	0.45396	0.857	P	0.51453	0.67	D	0.98404	1.0569	9	.	.	.	-10.5249	8.6489	0.34022	0.3017:0.0:0.6983:0.0	.	217	Q9UBJ2	ABCD2_HUMAN	L	217	ENSP00000310688:F217L	.	F	-	3	2	ABCD2	38299034	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	1.686000	0.37669	0.501000	0.28013	0.557000	0.71058	TTC		0.393	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164		29	61	1	0	7.26314e-15	0.007291	8.96051e-15	29	61				
LRRK2	120892	broad.mit.edu	37	12	40734215	40734215	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:40734215A>G	ENST00000298910.7	+	41	6126	c.6068A>G	c.(6067-6069)tAc>tGc	p.Y2023C		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2023	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.Y2030C(1)|p.Y2023C(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATTGCTCAGTACTGCTGTAGA	0.453																																							uc001rmg.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24						c.(6067-6069)TAC>TGC		leucine-rich repeat kinase 2							184.0	157.0	166.0					12																	40734215		2203	4300	6503	SO:0001583	missense	120892				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding	g.chr12:40734215A>G	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6068A>G	12.37:g.40734215A>G	ENSP00000298910:p.Tyr2023Cys					LRRK2_uc009zjw.2_Missense_Mutation_p.Y861C|LRRK2_uc001rmi.2_Missense_Mutation_p.Y856C	p.Y2023C	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN			41	6189	+	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)	2023			Protein kinase.		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	c.6068A>G	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.458083	0.84317	.	.	ENSG00000188906	ENST00000298910	T	0.66099	-0.19	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.052935	0.85682	D	0.000000	T	0.70780	0.3263	L	0.34521	1.04	0.58432	D	0.999997	D;D	0.76494	0.99;0.999	D;D	0.74023	0.982;0.982	T	0.74034	-0.3794	10	0.72032	D	0.01	.	15.9584	0.79906	1.0:0.0:0.0:0.0	.	2023;2023	Q17RV3;Q5S007	.;LRRK2_HUMAN	C	2023	ENSP00000298910:Y2023C	ENSP00000298910:Y2023C	Y	+	2	0	LRRK2	39020482	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.018000	0.93657	2.165000	0.68154	0.528000	0.53228	TAC		0.453	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513		20	142	0	0	0	0.012319	0	20	142				
CNTN1	1272	broad.mit.edu	37	12	41463834	41463834	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:41463834C>T	ENST00000551295.2	+	24	3171	c.3054C>T	c.(3052-3054)ttC>ttT	p.F1018F	CNTN1_ENST00000347616.1_Silent_p.F1018F|CNTN1_ENST00000348761.2_Silent_p.F1007F	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	1018					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.F1018F(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				ACTTGGAATTCTGAATGTGTT	0.507																																							uc001rmm.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|ovary(3)|large_intestine(1)|skin(1)	9						c.(3052-3054)TTC>TTT		contactin 1 isoform 1 precursor							179.0	136.0	150.0					12																	41463834		2203	4300	6503	SO:0001819	synonymous_variant	1272				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane		g.chr12:41463834C>T	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.3054C>T	12.37:g.41463834C>T						CNTN1_uc001rmn.1_Silent_p.F1007F	p.F1018F	NM_001843	NP_001834	Q12860	CNTN1_HUMAN			24	3167	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	1018					A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	ENST00000551295.2	37	c.3054C>T	CCDS8737.1																																																																																				0.507	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843		9	92	0	0	0	0.004482	0	9	92				
DHH	50846	broad.mit.edu	37	12	49485111	49485111	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:49485111C>T	ENST00000266991.2	-	2	671	c.365G>A	c.(364-366)cGc>cAc	p.R122H	RP11-386G11.8_ENST00000548030.1_RNA|RP11-386G11.8_ENST00000553174.1_RNA	NM_021044.2	NP_066382.1	O43323	DHH_HUMAN	desert hedgehog	122					cell-cell signaling (GO:0007267)|Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|myelination (GO:0042552)|regulation of steroid biosynthetic process (GO:0050810)|response to estradiol (GO:0032355)|spermatid development (GO:0007286)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)	p.R122H(1)		breast(1)|large_intestine(3)|lung(4)	8						CACTCGTAGGCGCACTCCGGG	0.607																																							uc001rtf.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|breast(1)	2						c.(364-366)CGC>CAC		desert hedgehog preproprotein							131.0	97.0	108.0					12																	49485111		2203	4300	6503	SO:0001583	missense	50846				cell-cell signaling|proteolysis	extracellular space|plasma membrane	calcium ion binding|peptidase activity|zinc ion binding	g.chr12:49485111C>T	AB010994	CCDS8779.1	12q13.1	2010-06-24	2010-06-24			ENSG00000139549			2865	protein-coding gene	gene with protein product		605423	"""desert hedgehog (Drosophila) homolog"""			10773676, 10640830	Standard	NM_021044		Approved	HHG-3, MGC35145	uc001rtf.3	O43323	OTTHUMG00000170408	ENST00000266991.2:c.365G>A	12.37:g.49485111C>T	ENSP00000266991:p.Arg122His						p.R122H	NM_021044	NP_066382	O43323	DHH_HUMAN			2	672	-			122					Q15794	Missense_Mutation	SNP	ENST00000266991.2	37	c.365G>A	CCDS8779.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986610	0.74589	.	.	ENSG00000139549	ENST00000266991	D	0.99466	-5.95	5.12	5.12	0.69794	Hedgehog/DD-peptidase (2);Hedgehog, N-terminal signaling domain (1);	0.133715	0.49916	D	0.000131	D	0.98375	0.9460	M	0.70595	2.14	0.40191	D	0.977409	B	0.24768	0.111	B	0.09377	0.004	D	0.97352	0.9964	10	0.62326	D	0.03	-3.6615	11.2687	0.49124	0.0:0.914:0.0:0.086	.	122	O43323	DHH_HUMAN	H	122	ENSP00000266991:R122H	ENSP00000266991:R122H	R	-	2	0	DHH	47771378	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.935000	0.40173	2.564000	0.86499	0.650000	0.86243	CGC		0.607	DHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408973.1	NM_021044		8	101	0	0	0	0.00308	0	8	101				
OR6C68	403284	broad.mit.edu	37	12	55886877	55886877	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:55886877G>A	ENST00000548615.1	+	1	716	c.716G>A	c.(715-717)tGt>tAt	p.C239Y	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|OR6C68_ENST00000379662.1_Missense_Mutation_p.C244Y	NM_001005519.2	NP_001005519.2	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C, member 68	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C244Y(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15						TTTTCTACCTGTTCTTCACAT	0.343																																							uc010spo.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(730-732)TGT>TAT		olfactory receptor, family 6, subfamily C,							86.0	84.0	84.0					12																	55886877		2203	4300	6503	SO:0001583	missense	403284				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55886877G>A		CCDS31826.1, CCDS31826.2	12q13.2	2013-09-23			ENSG00000205327	ENSG00000205327		"""GPCR / Class A : Olfactory receptors"""	31297	protein-coding gene	gene with protein product							Standard	NM_001005519		Approved		uc031qhq.1	A6NDL8	OTTHUMG00000169958	ENST00000548615.1:c.716G>A	12.37:g.55886877G>A	ENSP00000448811:p.Cys239Tyr						p.C244Y	NM_001005519	NP_001005519	A6NDL8	O6C68_HUMAN			1	731	+			239			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000548615.1	37	c.731G>A	CCDS31826.2	.	.	.	.	.	.	.	.	.	.	G	19.36	3.813103	0.70912	.	.	ENSG00000205327	ENST00000379662;ENST00000548615	T;T	0.00369	7.74;7.74	5.3	5.3	0.74995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000076	T	0.02649	0.0080	H	0.99705	4.715	0.45403	D	0.998382	D	0.53885	0.963	D	0.64776	0.929	T	0.03555	-1.1025	10	0.87932	D	0	.	18.9626	0.92682	0.0:0.0:1.0:0.0	.	239	A6NDL8	O6C68_HUMAN	Y	244;239	ENSP00000368983:C244Y;ENSP00000448811:C239Y	ENSP00000368983:C244Y	C	+	2	0	OR6C68	54173144	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	6.639000	0.74314	2.648000	0.89879	0.603000	0.83216	TGT		0.343	OR6C68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406677.1			11	55	0	0	0	0.008291	0	11	55				
SLC39A5	283375	broad.mit.edu	37	12	56630228	56630228	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:56630228C>T	ENST00000266980.4	+	7	1287	c.994C>T	c.(994-996)Ccg>Tcg	p.P332S	ANKRD52_ENST00000548241.1_5'Flank|SLC39A5_ENST00000454355.2_Missense_Mutation_p.P332S	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	332					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.P331S(1)		NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CAACTTGGATCCGGAGAATGG	0.542																																							uc010sqj.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(994-996)CCG>TCG		solute carrier family 39 (metal ion							137.0	134.0	135.0					12																	56630228		2203	4300	6503	SO:0001583	missense	283375				zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity	g.chr12:56630228C>T		CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.994C>T	12.37:g.56630228C>T	ENSP00000266980:p.Pro332Ser					SLC39A5_uc010sqk.1_Missense_Mutation_p.P332S	p.P332S	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN			9	1251	+			332			Cytoplasmic (Potential).		B2R808|Q8N6Y3	Missense_Mutation	SNP	ENST00000266980.4	37	c.994C>T	CCDS8912.2	.	.	.	.	.	.	.	.	.	.	C	7.002	0.554979	0.13436	.	.	ENSG00000139540	ENST00000454355;ENST00000266980	T;T	0.41758	0.99;0.99	4.22	3.3	0.37823	.	0.737765	0.12399	N	0.472284	T	0.23806	0.0576	N	0.12611	0.24	0.25828	N	0.984204	P	0.35468	0.503	B	0.37833	0.259	T	0.09952	-1.0651	10	0.07990	T	0.79	-9.2962	9.9692	0.41743	0.0:0.794:0.206:0.0	.	332	Q6ZMH5	S39A5_HUMAN	S	332	ENSP00000405360:P332S;ENSP00000266980:P332S	ENSP00000266980:P332S	P	+	1	0	SLC39A5	54916495	0.732000	0.28121	0.909000	0.35828	0.592000	0.36648	1.369000	0.34227	1.319000	0.45190	0.655000	0.94253	CCG		0.542	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346834.1	NM_173596		38	127	0	0	0	0.010771	0	38	127				
ARHGEF25	115557	broad.mit.edu	37	12	58007142	58007142	+	Splice_Site	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:58007142G>A	ENST00000286494.4	+	3	868	c.408G>A	c.(406-408)caG>caA	p.Q136Q	AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000356672.3_RNA|AC025165.8_ENST00000444467.1_RNA|ARHGEF25_ENST00000333972.7_Splice_Site_p.Q175Q|AC025165.8_ENST00000593846.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	136						cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q136Q(1)|p.Q175Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						ATAAGACGCAGGTGTGAGGAC	0.567																																							uc001spb.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(406-408)CAG>CAA		RhoA/RAC/CDC42 exchange factor isoform 1							65.0	63.0	63.0					12																	58007142		2203	4300	6503	SO:0001630	splice_region_variant	115557				regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity	g.chr12:58007142G>A		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.408+1G>A	12.37:g.58007142G>A						GEFT_uc009zpy.2_Silent_p.Q175Q|GEFT_uc001soz.1_Intron|GEFT_uc001spa.2_Silent_p.Q30Q|uc001spc.2_RNA|GEFT_uc001spd.2_5'Flank	p.Q136Q	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN			3	868	+	Melanoma(17;0.122)		136					A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Silent	SNP	ENST00000286494.4	37	c.408G>A	CCDS8947.1																																																																																				0.567	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483	Silent	5	176	0	0	0	0.014758	0	5	176				
ARHGEF25	115557	broad.mit.edu	37	12	58007229	58007229	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:58007229G>T	ENST00000286494.4	+	4	875	c.415G>T	c.(415-417)Gaa>Taa	p.E139*	AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000356672.3_RNA|AC025165.8_ENST00000444467.1_RNA|ARHGEF25_ENST00000333972.7_Nonsense_Mutation_p.E178*|AC025165.8_ENST00000593846.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	139						cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E139*(1)|p.E178*(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						CCAGCCACCTGAAGAGGAGAC	0.537																																							uc001spb.2		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(415-417)GAA>TAA		RhoA/RAC/CDC42 exchange factor isoform 1							101.0	105.0	104.0					12																	58007229		2203	4300	6503	SO:0001587	stop_gained	115557				regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity	g.chr12:58007229G>T		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.415G>T	12.37:g.58007229G>T	ENSP00000286494:p.Glu139*					GEFT_uc009zpy.2_Nonsense_Mutation_p.E178*|GEFT_uc001soz.1_Nonsense_Mutation_p.E13*|GEFT_uc001spa.2_Nonsense_Mutation_p.E33*|uc001spc.2_RNA|GEFT_uc001spd.2_5'Flank	p.E139*	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN			4	875	+	Melanoma(17;0.122)		139					A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Nonsense_Mutation	SNP	ENST00000286494.4	37	c.415G>T	CCDS8947.1	.	.	.	.	.	.	.	.	.	.	g	39	7.493329	0.98319	.	.	ENSG00000240771	ENST00000333972;ENST00000300189;ENST00000286494	.	.	.	2.84	2.84	0.33178	.	0.000000	0.38778	N	0.001578	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	9.3735	0.38268	0.0:0.0:1.0:0.0	.	.	.	.	X	178;13;139	.	ENSP00000286494:E139X	E	+	1	0	ARHGEF25	56293496	1.000000	0.71417	0.963000	0.40424	0.924000	0.55760	5.280000	0.65603	1.909000	0.55274	0.455000	0.32223	GAA		0.537	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483		10	371	1	0	6.40141e-05	0.010729	7.60796e-05	10	371				
TSPAN31	6302	broad.mit.edu	37	12	58140859	58140859	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:58140859C>T	ENST00000257910.3	+	5	777	c.503C>T	c.(502-504)tCa>tTa	p.S168L	CDK4_ENST00000551888.1_5'Flank|TSPAN31_ENST00000547992.1_Missense_Mutation_p.S84L|TSPAN31_ENST00000547472.1_Missense_Mutation_p.S85L	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	168					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.S168L(1)		endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CTTAAGCATTCAGACGAAGCC	0.443																																							uc001spt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(502-504)TCA>TTA		sarcoma amplified sequence							133.0	137.0	136.0					12																	58140859		2203	4300	6503	SO:0001583	missense	6302				positive regulation of cell proliferation	integral to plasma membrane|membrane fraction		g.chr12:58140859C>T		CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.503C>T	12.37:g.58140859C>T	ENSP00000257910:p.Ser168Leu					TSPAN31_uc009zqb.2_Missense_Mutation_p.S84L|TSPAN31_uc010ssa.1_Missense_Mutation_p.S90L	p.S168L	NM_005981	NP_005972	Q12999	TSN31_HUMAN	GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		5	657	+	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		168			Extracellular (Potential).		O00577|Q53X76	Missense_Mutation	SNP	ENST00000257910.3	37	c.503C>T	CCDS8952.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000919	0.74818	.	.	ENSG00000135452	ENST00000257910;ENST00000547992;ENST00000547472	T;T	0.75050	-0.9;-0.9	5.03	5.03	0.67393	.	0.145914	0.46442	D	0.000300	T	0.61135	0.2323	N	0.13098	0.295	0.80722	D	1	B;P	0.42078	0.16;0.77	B;B	0.40782	0.088;0.34	T	0.60515	-0.7248	9	.	.	.	-4.8703	17.6753	0.88229	0.0:1.0:0.0:0.0	.	84;168	F8VS78;Q12999	.;TSN31_HUMAN	L	168;84;85	ENSP00000257910:S168L;ENSP00000449199:S85L	.	S	+	2	0	TSPAN31	56427126	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.457000	0.66672	2.797000	0.96272	0.561000	0.74099	TCA		0.443	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408778.1			12	366	0	0	0	0.020292	0	12	366				
LGR5	8549	broad.mit.edu	37	12	71977945	71977945	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:71977945G>A	ENST00000266674.5	+	18	2466	c.2155G>A	c.(2155-2157)Gag>Aag	p.E719K	LGR5_ENST00000540815.2_Missense_Mutation_p.E695K|LGR5_ENST00000536515.1_Missense_Mutation_p.E647K|RP11-186F10.2_ENST00000546601.1_RNA			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	719					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.E719K(1)	NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						GCCTTTTGGGGAGCCCAGCAC	0.567																																							uc001swl.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|skin(3)|ovary(1)|pancreas(1)	9						c.(2155-2157)GAG>AAG		leucine-rich repeat-containing G protein-coupled							114.0	108.0	110.0					12																	71977945		2203	4300	6503	SO:0001583	missense	8549					integral to plasma membrane	protein-hormone receptor activity	g.chr12:71977945G>A	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2155G>A	12.37:g.71977945G>A	ENSP00000266674:p.Glu719Lys					LGR5_uc001swm.2_Missense_Mutation_p.E695K|LGR5_uc001swn.1_Intron	p.E719K	NM_003667	NP_003658	O75473	LGR5_HUMAN			18	2203	+			719			Extracellular (Potential).		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	ENST00000266674.5	37	c.2155G>A	CCDS9000.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854112	0.51270	.	.	ENSG00000139292	ENST00000266674;ENST00000536515;ENST00000540815	T;T;T	0.37058	1.22;1.22;1.22	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000004	T	0.30198	0.0757	L	0.31294	0.92	0.39383	D	0.966285	B;B	0.23058	0.079;0.045	B;B	0.29598	0.063;0.104	T	0.08269	-1.0730	10	0.30078	T	0.28	.	14.3251	0.66515	0.0705:0.0:0.9295:0.0	.	695;719	O75473-2;O75473	.;LGR5_HUMAN	K	719;647;695	ENSP00000266674:E719K;ENSP00000443033:E647K;ENSP00000441035:E695K	ENSP00000266674:E719K	E	+	1	0	LGR5	70264212	0.997000	0.39634	0.993000	0.49108	0.978000	0.69477	2.916000	0.48813	2.767000	0.95098	0.655000	0.94253	GAG		0.567	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667		20	238	0	0	0	0.010504	0	20	238				
SNRNP35	11066	broad.mit.edu	37	12	123950180	123950180	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr12:123950180C>T	ENST00000526639.2	+	2	672	c.93C>T	c.(91-93)gtC>gtT	p.V31V	SNRNP35_ENST00000350887.5_Silent_p.V31V|SNRNP35_ENST00000412157.2_Silent_p.V36V|SNRNP35_ENST00000527158.2_Intron	NM_022717.3	NP_073208.1	Q16560	U1SBP_HUMAN	small nuclear ribonucleoprotein 35kDa (U11/U12)	31					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V31V(1)		NS(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						ACCGCGCGGTCTGGAGGGCAA	0.547																																							uc001ufb.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(91-93)GTC>GTT		small nuclear ribonucleoprotein 35kDa (U11/U12)							94.0	75.0	82.0					12																	123950180		2203	4300	6503	SO:0001819	synonymous_variant	11066				mRNA processing	U12-type spliceosomal complex	nucleotide binding|RNA binding	g.chr12:123950180C>T	BC054034	CCDS9249.1, CCDS45005.1	12q24.31	2013-02-12				ENSG00000184209		"""RNA binding motif (RRM) containing"""	30852	protein-coding gene	gene with protein product	"""U1 snRNP binding protein homolog"""					10520751, 8889548	Standard	XM_005253545		Approved	U1SNRNPBP	uc001ufb.1	Q16560		ENST00000526639.2:c.93C>T	12.37:g.123950180C>T						SNRNP35_uc010tar.1_Silent_p.V36V|SNRNP35_uc009zxz.2_Silent_p.V36V|SNRNP35_uc001ufc.1_Intron	p.V31V	NM_022717	NP_073208	Q16560	U1SBP_HUMAN			2	209	+			31					A8K262|Q5XKN9	Silent	SNP	ENST00000526639.2	37	c.93C>T	CCDS9249.1																																																																																				0.547	SNRNP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395197.2	NM_007020		17	43	0	0	0	0.007413	0	17	43				
NAA16	79612	broad.mit.edu	37	13	41941661	41941661	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr13:41941661G>C	ENST00000379406.3	+	14	1950	c.1626G>C	c.(1624-1626)ttG>ttC	p.L542F	NAA16_ENST00000497143.1_3'UTR	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	542					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)	p.L542F(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						TTGACCTTTTGAGATTAGAAG	0.343																																							uc001uyf.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)	1						c.(1624-1626)TTG>TTC		NMDA receptor regulated 1-like protein isoform							96.0	93.0	94.0					13																	41941661		2203	4300	6503	SO:0001583	missense	79612				N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent	cytoplasm|transcription factor complex	binding	g.chr13:41941661G>C	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1626G>C	13.37:g.41941661G>C	ENSP00000368716:p.Leu542Phe					NAA16_uc010tfg.1_RNA	p.L542F	NM_024561	NP_078837	Q6N069	NAA16_HUMAN			14	1950	+			542					B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	37	c.1626G>C	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928386	0.73327	.	.	ENSG00000172766	ENST00000379406	T	0.60672	0.17	5.27	4.43	0.53597	.	0.000000	0.53938	D	0.000052	T	0.76793	0.4037	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80197	-0.1482	10	0.66056	D	0.02	-5.8119	13.5145	0.61533	0.0753:0.0:0.9247:0.0	.	542	Q6N069	NAA16_HUMAN	F	542	ENSP00000368716:L542F	ENSP00000368716:L542F	L	+	3	2	NAA16	40839661	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.153000	0.58118	1.223000	0.43536	0.585000	0.79938	TTG		0.343	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527		9	76	0	0	0	0.006214	0	9	76				
NALCN	259232	broad.mit.edu	37	13	101756652	101756652	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr13:101756652T>C	ENST00000251127.6	-	25	2964	c.2883A>G	c.(2881-2883)atA>atG	p.I961M		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	961					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.I961M(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTACAAGATATATAAATATGT	0.363																																							uc001vox.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(2881-2883)ATA>ATG		voltage gated channel like 1							66.0	69.0	68.0					13																	101756652		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101756652T>C	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2883A>G	13.37:g.101756652T>C	ENSP00000251127:p.Ile961Met						p.I961M	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			25	3072	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		961			Helical; Name=S3 of repeat III; (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.2883A>G	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	T	18.53	3.643634	0.67244	.	.	ENSG00000102452	ENST00000251127	D	0.98777	-5.13	5.42	-10.7	0.00240	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98789	0.9592	H	0.95816	3.725	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.95527	0.8600	10	0.87932	D	0	.	8.4087	0.32629	0.2999:0.0:0.4131:0.287	.	961	Q8IZF0	NALCN_HUMAN	M	961	ENSP00000251127:I961M	ENSP00000251127:I961M	I	-	3	3	NALCN	100554653	0.988000	0.35896	0.951000	0.38953	0.965000	0.64279	0.128000	0.15810	-1.201000	0.02659	-0.316000	0.08728	ATA		0.363	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		12	83	0	0	0	0.013537	0	12	83				
COL4A2	1284	broad.mit.edu	37	13	111088678	111088678	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr13:111088678G>A	ENST00000360467.5	+	13	1095	c.789G>A	c.(787-789)gcG>gcA	p.A263A		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	263	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)	p.A263A(1)		NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CCATCATCGCGCCCACAGGAG	0.453																																							uc001vqx.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(3)|central_nervous_system(2)|ovary(1)	6						c.(787-789)GCG>GCA		alpha 2 type IV collagen preproprotein							85.0	91.0	89.0					13																	111088678		1949	4131	6080	SO:0001819	synonymous_variant	1284				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding	g.chr13:111088678G>A	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.789G>A	13.37:g.111088678G>A							p.A263A	NM_001846	NP_001837	P08572	CO4A2_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)		13	1078	+	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	263			Triple-helical region.		Q14052|Q548C3|Q5VZA9|Q66K23	Silent	SNP	ENST00000360467.5	37	c.789G>A	CCDS41907.1																																																																																				0.453	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846		14	44	0	0	0	0.004007	0	14	44				
CHD8	57680	broad.mit.edu	37	14	21870611	21870611	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:21870611G>A	ENST00000557364.1	-	19	4029	c.3766C>T	c.(3766-3768)Cgc>Tgc	p.R1256C	CHD8_ENST00000555962.1_5'UTR|CHD8_ENST00000430710.3_Missense_Mutation_p.R977C|CHD8_ENST00000399982.2_Missense_Mutation_p.R1256C			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1256	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.R1256C(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GTGATGAGGCGGTACACCTTC	0.453																																							uc001was.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10						c.(2929-2931)CGC>TGC		chromodomain helicase DNA binding protein 8							86.0	82.0	83.0					14																	21870611		2203	4300	6503	SO:0001583	missense	57680				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding	g.chr14:21870611G>A	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3766C>T	14.37:g.21870611G>A	ENSP00000451601:p.Arg1256Cys					CHD8_uc001war.1_Missense_Mutation_p.R873C|CHD8_uc001wav.1_Missense_Mutation_p.R419C	p.R977C	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)	19	3023	-	all_cancers(95;0.00121)		1256			Helicase C-terminal.		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	c.2929C>T	CCDS53885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.144341|4.144341	0.77888|0.77888	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000555935|ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	.|D;D;D	.|0.96334	.|-3.98;-3.98;-3.98	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Helicase, C-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99099|0.99099	0.9690|0.9690	H|H	0.99800|0.99800	4.79|4.79	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.98385|0.98385	1.0560|1.0560	5|10	.|0.87932	.|D	.|0	-8.085|-8.085	13.5718|13.5718	0.61851|0.61851	0.0:0.0:0.8444:0.1556|0.0:0.0:0.8444:0.1556	.|.	.|1256;977	.|Q9HCK8;Q9HCK8-2	.|CHD8_HUMAN;.	L|C	481|977;1256;976;1256	.|ENSP00000406288:R977C;ENSP00000382863:R1256C;ENSP00000451601:R1256C	.|ENSP00000262707:R976C	P|R	-|-	2|1	0|0	CHD8|CHD8	20940451|20940451	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	3.686000|3.686000	0.54685|0.54685	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CCG|CGC		0.453	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920		7	56	0	0	0	0.001984	0	7	56				
FERMT2	10979	broad.mit.edu	37	14	53331254	53331254	+	Silent	SNP	A	A	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:53331254A>C	ENST00000395631.2	-	12	1683	c.1467T>G	c.(1465-1467)gtT>gtG	p.V489V	FERMT2_ENST00000341590.3_Silent_p.V489V|FERMT2_ENST00000557255.1_5'Flank|FERMT2_ENST00000553373.1_Silent_p.V489V|FERMT2_ENST00000343279.4_Silent_p.V489V|FERMT2_ENST00000399304.3_Silent_p.V489V			Q96AC1	FERM2_HUMAN	fermitin family member 2	489	FERM.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.V489V(1)	ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					GAATATTCTGAACTTCTAAGT	0.423																																							uc001xad.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1465-1467)GTT>GTG		fermitin family homolog 2 isoform 1							127.0	122.0	124.0					14																	53331254		2203	4300	6503	SO:0001819	synonymous_variant	10979				actin cytoskeleton organization|cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytosol|focal adhesion|stress fiber	binding	g.chr14:53331254A>C	Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.1467T>G	14.37:g.53331254A>C						FERMT2_uc001xac.2_Silent_p.V489V|FERMT2_uc001xae.2_Silent_p.V489V|FERMT2_uc001xaf.2_Silent_p.V489V	p.V489V	NM_006832	NP_006823	Q96AC1	FERM2_HUMAN			12	1522	-	Breast(41;0.0342)		489			FERM.		B5TJY2|Q14840|Q86TY7	Silent	SNP	ENST00000395631.2	37	c.1467T>G	CCDS9713.1																																																																																				0.423	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832		23	125	0	0	0	0.016522	0	23	125				
EXOC5	10640	broad.mit.edu	37	14	57684737	57684737	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:57684737C>G	ENST00000413566.2	-	15	1935	c.1576G>C	c.(1576-1578)Gaa>Caa	p.E526Q	EXOC5_ENST00000340918.7_Missense_Mutation_p.E461Q	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	526					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E528Q(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						TCCATTTGTTCAATTATTTCT	0.274																																							uc001xct.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)	3						c.(1576-1578)GAA>CAA		SEC10 protein							70.0	73.0	72.0					14																	57684737		1797	4055	5852	SO:0001583	missense	10640				exocytosis|post-Golgi vesicle-mediated transport|protein transport|vesicle docking	cytoplasm		g.chr14:57684737C>G	U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.1576G>C	14.37:g.57684737C>G	ENSP00000389934:p.Glu526Gln					EXOC5_uc001xcs.2_Missense_Mutation_p.E205Q|EXOC5_uc010trg.1_Missense_Mutation_p.E471Q|EXOC5_uc010trh.1_Missense_Mutation_p.E461Q	p.E526Q	NM_006544	NP_006535	O00471	EXOC5_HUMAN			15	1827	-			526					B2R6C5	Missense_Mutation	SNP	ENST00000413566.2	37	c.1576G>C	CCDS45111.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475702	0.84640	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	T;T	0.42513	0.97;0.97	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.997;0.998	T	0.44892	-0.9298	10	0.14656	T	0.56	-14.6465	18.6145	0.91297	0.0:1.0:0.0:0.0	.	461;526	F8W9B8;O00471	.;EXOC5_HUMAN	Q	526;461	ENSP00000389934:E526Q;ENSP00000342100:E461Q	ENSP00000342100:E461Q	E	-	1	0	EXOC5	56754490	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.542000	0.82095	2.462000	0.83206	0.555000	0.69702	GAA		0.274	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544		15	69	0	0	0	0.004007	0	15	69				
SYNE2	23224	broad.mit.edu	37	14	64634013	64634013	+	Silent	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:64634013C>G	ENST00000344113.4	+	91	16880	c.16668C>G	c.(16666-16668)ctC>ctG	p.L5556L	SYNE2_ENST00000555002.1_Silent_p.L2190L|SYNE2_ENST00000357395.3_Silent_p.L1941L|SYNE2_ENST00000358025.3_Silent_p.L5556L|SYNE2_ENST00000394768.2_Silent_p.L1941L|SYNE2_ENST00000554584.1_Silent_p.L5431L|ESR2_ENST00000542956.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5556					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.L5556L(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAGTGAGCCTCAAGCTCCCAC	0.463																																							uc001xgm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(16666-16668)CTC>CTG		spectrin repeat containing, nuclear envelope 2							61.0	59.0	60.0					14																	64634013		2203	4300	6503	SO:0001819	synonymous_variant	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64634013C>G	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.16668C>G	14.37:g.64634013C>G						SYNE2_uc001xgl.2_Silent_p.L5556L|SYNE2_uc010apy.2_Silent_p.L1941L|SYNE2_uc001xgn.2_Silent_p.L518L|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_5'UTR|SYNE2_uc001xgq.2_5'Flank	p.L5556L	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	91	16898	+			5556			Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	c.16668C>G	CCDS41963.1																																																																																				0.463	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		3	65	0	0	0	0.009096	0	3	65				
SMOC1	64093	broad.mit.edu	37	14	70477552	70477552	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:70477552C>A	ENST00000381280.4	+	8	999	c.746C>A	c.(745-747)cCt>cAt	p.P249H	SMOC1_ENST00000361956.3_Missense_Mutation_p.P249H	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	249	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)	p.P249H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		ATTGTCATCCCTGAATGTGCC	0.592																																							uc001xls.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|pancreas(1)	2						c.(745-747)CCT>CAT		secreted modular calcium-binding protein 1							101.0	106.0	104.0					14																	70477552		2203	4300	6503	SO:0001583	missense	64093				cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding	g.chr14:70477552C>A	AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.746C>A	14.37:g.70477552C>A	ENSP00000370680:p.Pro249His					SMOC1_uc001xlt.1_Missense_Mutation_p.P249H	p.P249H	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN		all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)	8	999	+			249			Thyroglobulin type-1 2.		A8K1S3|B2R7P5|Q96F78	Missense_Mutation	SNP	ENST00000381280.4	37	c.746C>A	CCDS9798.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276856	0.80580	.	.	ENSG00000198732	ENST00000361956;ENST00000381280	D;D	0.89415	-2.51;-2.51	5.47	5.47	0.80525	Thyroglobulin type-1 (5);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.96626	0.8899	H	0.96269	3.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97458	1.0032	10	0.87932	D	0	-13.5164	19.6781	0.95945	0.0:1.0:0.0:0.0	.	249;249	Q9H4F8-2;Q9H4F8	.;SMOC1_HUMAN	H	249	ENSP00000355110:P249H;ENSP00000370680:P249H	ENSP00000355110:P249H	P	+	2	0	SMOC1	69547305	1.000000	0.71417	0.991000	0.47740	0.497000	0.33675	7.776000	0.85560	2.728000	0.93425	0.557000	0.71058	CCT		0.592	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000412467.1			6	171	1	0	0.000157383	0.00308	0.000185109	6	171				
UNC79	57578	broad.mit.edu	37	14	94089157	94089157	+	Silent	SNP	C	C	T	rs368486256		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:94089157C>T	ENST00000393151.2	+	30	5578	c.5578C>T	c.(5578-5580)Ctg>Ttg	p.L1860L	UNC79_ENST00000553484.1_Silent_p.L1882L|UNC79_ENST00000256339.4_Silent_p.L1683L|UNC79_ENST00000555664.1_Silent_p.L1860L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1860					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L1683L(1)|p.L1882L(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CTTCAACATTCTGGACAAACT	0.453																																							uc001ybv.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(10)|skin(4)|large_intestine(3)	17						c.(5113-5115)CTG>TTG		hypothetical protein LOC57578							76.0	72.0	73.0					14																	94089157		2203	4300	6503	SO:0001819	synonymous_variant	57578					integral to membrane		g.chr14:94089157C>T	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.5578C>T	14.37:g.94089157C>T						KIAA1409_uc001ybs.1_Silent_p.L1683L	p.L1705L	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN		Epithelial(152;0.188)	28	5196	+		all_cancers(154;0.0354)|all_epithelial(191;0.216)	1860					B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37	c.5113C>T																																																																																					0.453	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395		9	80	0	0	0	0.004482	0	9	80				
DYNC1H1	1778	broad.mit.edu	37	14	102449530	102449530	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:102449530G>A	ENST00000360184.4	+	6	1300	c.1136G>A	c.(1135-1137)cGt>cAt	p.R379H		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	379	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.R379H(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AGGGCACTGCGTTTGGTGGAG	0.403																																							uc001yks.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(1135-1137)CGT>CAT		cytoplasmic dynein 1 heavy chain 1							79.0	75.0	76.0					14																	102449530		2203	4300	6503	SO:0001583	missense	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102449530G>A	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1136G>A	14.37:g.102449530G>A	ENSP00000348965:p.Arg379His						p.R379H	NM_001376	NP_001367	Q14204	DYHC1_HUMAN			6	1300	+			379			Stem (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	c.1136G>A	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.815693	0.70912	.	.	ENSG00000197102	ENST00000360184	T	0.56103	0.48	5.88	5.88	0.94601	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.69441	0.3111	M	0.64567	1.98	0.80722	D	1	D	0.62365	0.991	P	0.61201	0.885	T	0.66685	-0.5861	10	0.45353	T	0.12	.	20.1989	0.98252	0.0:0.0:1.0:0.0	.	379	Q14204	DYHC1_HUMAN	H	379	ENSP00000348965:R379H	ENSP00000348965:R379H	R	+	2	0	DYNC1H1	101519283	1.000000	0.71417	0.964000	0.40570	0.960000	0.62799	9.476000	0.97823	2.784000	0.95788	0.591000	0.81541	CGT		0.403	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		15	58	0	0	0	0.020292	0	15	58				
DYNC1H1	1778	broad.mit.edu	37	14	102495993	102495993	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr14:102495993G>A	ENST00000360184.4	+	49	9750	c.9586G>A	c.(9586-9588)Gag>Aag	p.E3196K		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3196	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.E3196K(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CGAGCTGGAGGAGCAGCAGAT	0.567																																							uc001yks.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(9586-9588)GAG>AAG		cytoplasmic dynein 1 heavy chain 1							90.0	77.0	81.0					14																	102495993		2203	4300	6503	SO:0001583	missense	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102495993G>A	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.9586G>A	14.37:g.102495993G>A	ENSP00000348965:p.Glu3196Lys						p.E3196K	NM_001376	NP_001367	Q14204	DYHC1_HUMAN			49	9750	+			3196			Potential.|Stalk (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	c.9586G>A	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	37	6.003707	0.97189	.	.	ENSG00000197102	ENST00000360184	T	0.57752	0.38	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.72661	0.3488	M	0.73753	2.245	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.70722	-0.4794	10	0.34782	T	0.22	.	19.1164	0.93343	0.0:0.0:1.0:0.0	.	3196	Q14204	DYHC1_HUMAN	K	3196	ENSP00000348965:E3196K	ENSP00000348965:E3196K	E	+	1	0	DYNC1H1	101565746	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.807000	0.99171	2.520000	0.84964	0.460000	0.39030	GAG		0.567	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		7	30	0	0	0	0.001984	0	7	30				
MGA	23269	broad.mit.edu	37	15	42003303	42003303	+	Nonsense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr15:42003303C>G	ENST00000570161.1	+	7	2840	c.2840C>G	c.(2839-2841)tCa>tGa	p.S947*	MGA_ENST00000389936.4_Nonsense_Mutation_p.S947*|MGA_ENST00000219905.7_Nonsense_Mutation_p.S947*|MGA_ENST00000566586.1_Nonsense_Mutation_p.S947*|MGA_ENST00000545763.1_Nonsense_Mutation_p.S947*			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.S947*(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGCATCATCTCAGAAAATCAG	0.393																																							uc001zog.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12						c.(2839-2841)TCA>TGA		MAX-interacting protein isoform 2							131.0	130.0	131.0					15																	42003303		1930	4158	6088	SO:0001587	stop_gained	23269					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr15:42003303C>G	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.2840C>G	15.37:g.42003303C>G	ENSP00000457035:p.Ser947*					MGA_uc010ucy.1_Nonsense_Mutation_p.S947*|MGA_uc010ucz.1_Nonsense_Mutation_p.S947*	p.S947*	NM_001080541	NP_001074010	Q8IWI9	MGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	8	2931	+		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)	947					Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	ENST00000570161.1	37	c.2840C>G	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	39	7.654761	0.98415	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	5.84	2.93	0.34026	.	1.386070	0.04852	N	0.442506	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	10.7514	0.46211	0.0:0.7551:0.0:0.2449	.	.	.	.	X	947	.	ENSP00000219905:S947X	S	+	2	0	MGA	39790595	0.006000	0.16342	0.990000	0.47175	0.979000	0.70002	0.141000	0.16076	1.488000	0.48433	0.655000	0.94253	TCA		0.393	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		40	110	0	0	0	0.011902	0	40	110				
BNC1	646	broad.mit.edu	37	15	83926860	83926860	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr15:83926860G>T	ENST00000345382.2	-	5	2404	c.2319C>A	c.(2317-2319)aaC>aaA	p.N773K	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.N766K	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	773					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N773K(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TTTGGTGGAGGTTTAGGTTTG	0.438																																							uc002bjt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2317-2319)AAC>AAA		basonuclin 1							130.0	119.0	123.0					15																	83926860		2203	4300	6503	SO:0001583	missense	646				epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr15:83926860G>T	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2319C>A	15.37:g.83926860G>T	ENSP00000307041:p.Asn773Lys					BNC1_uc010uos.1_Missense_Mutation_p.N761K	p.N773K	NM_001717	NP_001708	Q01954	BNC1_HUMAN			5	2407	-			773			C2H2-type 4.		Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	c.2319C>A	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271239	0.59649	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.53206	0.63	5.73	1.27	0.21489	Zinc finger, C2H2-like (1);	0.245918	0.46145	D	0.000301	T	0.55800	0.1943	M	0.72894	2.215	0.31222	N	0.697314	P;D	0.52996	0.947;0.957	B;P	0.54372	0.434;0.75	T	0.62854	-0.6766	10	0.87932	D	0	-17.2065	9.7009	0.40187	0.4074:0.0:0.5926:0.0	.	766;773	F5GY04;Q01954	.;BNC1_HUMAN	K	773;766	ENSP00000307041:N773K	ENSP00000307041:N773K	N	-	3	2	BNC1	81717864	1.000000	0.71417	0.985000	0.45067	0.794000	0.44872	1.062000	0.30555	0.370000	0.24538	0.563000	0.77884	AAC		0.438	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717		17	77	1	0	5.3912e-06	0.006122	6.50959e-06	17	77				
GP2	2813	broad.mit.edu	37	16	20335277	20335277	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr16:20335277G>A	ENST00000381362.4	-	3	472	c.396C>T	c.(394-396)atC>atT	p.I132I	GP2_ENST00000302555.5_Silent_p.I132I|GP2_ENST00000381360.5_Intron|GP2_ENST00000573897.1_5'Flank|GP2_ENST00000341642.5_Intron	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	132					antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)	p.I132I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TGTGGTTGGTGATGCCATCCC	0.597																																							uc002dgv.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(394-396)ATC>ATT		zymogen granule membrane glycoprotein 2 isoform							86.0	68.0	74.0					16																	20335277		2203	4300	6503	SO:0001819	synonymous_variant	2813					anchored to membrane|extracellular region|plasma membrane		g.chr16:20335277G>A	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.396C>T	16.37:g.20335277G>A						GP2_uc002dgw.2_Silent_p.I132I|GP2_uc002dgx.2_Intron|GP2_uc002dgy.2_Intron	p.I132I	NM_001007240	NP_001007241	P55259	GP2_HUMAN			3	479	-			132					A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	ENST00000381362.4	37	c.396C>T	CCDS42128.1																																																																																				0.597	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295		8	32	0	0	0	0.004482	0	8	32				
ARHGAP17	55114	broad.mit.edu	37	16	24981885	24981885	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr16:24981885G>A	ENST00000289968.6	-	4	284	c.215C>T	c.(214-216)aCa>aTa	p.T72I	ARHGAP17_ENST00000575975.1_5'UTR|ARHGAP17_ENST00000303665.5_Missense_Mutation_p.T72I|ARHGAP17_ENST00000441763.2_Missense_Mutation_p.T72I	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	72	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)	p.T72I(2)		breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		AGCAAGAGCTGTCAGAGGCAG	0.408																																							uc002dnb.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(214-216)ACA>ATA		nadrin isoform 1							186.0	179.0	181.0					16																	24981885		2197	4300	6497	SO:0001583	missense	55114				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding	g.chr16:24981885G>A	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.215C>T	16.37:g.24981885G>A	ENSP00000289968:p.Thr72Ile					ARHGAP17_uc002dnc.2_Missense_Mutation_p.T72I|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dnf.2_5'Flank|ARHGAP17_uc002dng.1_Missense_Mutation_p.T72I	p.T72I	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN		GBM - Glioblastoma multiforme(48;0.0407)	4	308	-			72			BAR.		A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	c.215C>T	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452482	0.63290	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000441763;ENST00000455311	T;T;T	0.67345	-0.26;-0.26;-0.26	5.61	5.61	0.85477	BAR (3);	0.000000	0.45867	D	0.000337	T	0.81221	0.4777	M	0.80847	2.515	0.49798	D	0.999825	D;D;D	0.89917	0.965;1.0;0.987	P;D;P	0.83275	0.726;0.996;0.843	T	0.78277	-0.2266	10	0.23302	T	0.38	.	15.1428	0.72623	0.0:0.0:1.0:0.0	.	72;72;72	Q68EM7-4;Q68EM7-2;Q68EM7	.;.;RHG17_HUMAN	I	72	ENSP00000289968:T72I;ENSP00000303130:T72I;ENSP00000406950:T72I	ENSP00000289968:T72I	T	-	2	0	ARHGAP17	24889386	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.928000	0.87587	2.650000	0.89964	0.655000	0.94253	ACA		0.408	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054		39	157	0	0	0	0.019004	0	39	157				
CHRNB1	1140	broad.mit.edu	37	17	7350939	7350939	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:7350939G>A	ENST00000306071.2	+	6	647	c.580G>A	c.(580-582)Gaa>Aaa	p.E194K	CHRNB1_ENST00000536404.2_Missense_Mutation_p.E122K|CHRNB1_ENST00000576360.1_Missense_Mutation_p.E122K|RP11-104H15.10_ENST00000575331.1_RNA	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	194					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)	p.E194K(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	AGGGCATCAGGAAATCCACAT	0.507																																							uc002ghb.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(580-582)GAA>AAA		nicotinic acetylcholine receptor beta 1 subunit							132.0	114.0	120.0					17																	7350939		2203	4300	6503	SO:0001583	missense	1140				behavioral response to nicotine|muscle contraction|muscle fiber development|neuromuscular synaptic transmission|postsynaptic membrane organization|regulation of membrane potential|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine binding|receptor activity	g.chr17:7350939G>A	X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.580G>A	17.37:g.7350939G>A	ENSP00000304290:p.Glu194Lys					CHRNB1_uc010vty.1_Missense_Mutation_p.E122K|CHRNB1_uc010vtz.1_Missense_Mutation_p.E28K	p.E194K	NM_000747	NP_000738	P11230	ACHB_HUMAN			6	621	+		Prostate(122;0.157)	194			Extracellular (Potential).		B7Z5H1|Q8IZ46|Q96FB8	Missense_Mutation	SNP	ENST00000306071.2	37	c.580G>A	CCDS11106.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517174	0.85495	.	.	ENSG00000170175	ENST00000306071;ENST00000536404	T;T	0.79033	-1.23;-1.23	4.96	4.96	0.65561	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.74680	0.3748	L	0.32530	0.975	0.80722	D	1	P	0.48640	0.913	P	0.51582	0.674	T	0.70890	-0.4749	10	0.21540	T	0.41	.	13.7047	0.62631	0.0:0.0:1.0:0.0	.	194	P11230	ACHB_HUMAN	K	194;122	ENSP00000304290:E194K;ENSP00000439209:E122K	ENSP00000304290:E194K	E	+	1	0	CHRNB1	7291663	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	6.485000	0.73625	2.299000	0.77371	0.561000	0.74099	GAA		0.507	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226942.3			12	60	0	0	0	0.010729	0	12	60				
MYO15A	51168	broad.mit.edu	37	17	18025526	18025526	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:18025526C>T	ENST00000205890.5	+	2	3750	c.3412C>T	c.(3412-3414)Caa>Taa	p.Q1138*		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1138					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.Q1138*(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CCTGAAGCCTCAAGTCCAGCC	0.612																																							uc010vxh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(3412-3414)CAA>TAA		myosin XV							48.0	56.0	53.0					17																	18025526		2034	4179	6213	SO:0001587	stop_gained	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18025526C>T	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.3412C>T	17.37:g.18025526C>T	ENSP00000205890:p.Gln1138*						p.Q1138*	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN			2	3750	+	all_neural(463;0.228)		1138			Myosin head-like.		B4DFC7	Nonsense_Mutation	SNP	ENST00000205890.5	37	c.3412C>T	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	c	41	8.554671	0.98861	.	.	ENSG00000091536	ENST00000205890	.	.	.	5.08	-4.61	0.03380	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	3.5245	0.07755	0.1058:0.2577:0.4175:0.219	.	.	.	.	X	1138	.	ENSP00000205890:Q1138X	Q	+	1	0	MYO15A	17966251	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.217000	0.09253	-0.377000	0.07930	-0.218000	0.12543	CAA		0.612	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		11	34	0	0	0	0.016723	0	11	34				
FBXO47	494188	broad.mit.edu	37	17	37118263	37118263	+	Silent	SNP	T	T	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:37118263T>G	ENST00000378079.2	-	3	418	c.219A>C	c.(217-219)acA>acC	p.T73T		NM_001008777.2	NP_001008777.2	Q5MNV8	FBX47_HUMAN	F-box protein 47	73	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.							p.T73T(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	20						GTTGGCTGACTGTTTTGGACA	0.373																																							uc002hrc.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(217-219)ACA>ACC		F-box protein 47							180.0	173.0	175.0					17																	37118263		2203	4300	6503	SO:0001819	synonymous_variant	494188							g.chr17:37118263T>G		CCDS32639.1	17q12	2014-08-12			ENSG00000204952	ENSG00000204952		"""F-boxes /  ""other"""""	31969	protein-coding gene	gene with protein product		609498				15723337	Standard	NM_001008777		Approved		uc002hrc.2	Q5MNV8	OTTHUMG00000178945	ENST00000378079.2:c.219A>C	17.37:g.37118263T>G							p.T73T	NM_001008777	NP_001008777	Q5MNV8	FBX47_HUMAN			3	419	-			73			F-box.		B2RTZ4	Silent	SNP	ENST00000378079.2	37	c.219A>C	CCDS32639.1																																																																																				0.373	FBXO47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444073.1	NM_001008777		22	74	0	0	0	0.016522	0	22	74				
KRTAP4-8	728224	broad.mit.edu	37	17	39253960	39253960	+	Missense_Mutation	SNP	C	C	T	rs144672535	byFrequency	TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:39253960C>T	ENST00000333822.4	-	1	433	c.377G>A	c.(376-378)cGc>cAc	p.R126H		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	126	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].			R -> H (in Ref. 2; CAC27579). {ECO:0000305}.	aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						gcagctggggcggcagcagtt	0.672													T|||	1899	0.379193	0.4198	0.3948	5008	,	,		14996	0.2292		0.4543	False		,,,				2504	0.3906						uc010wfo.1		NA																	0					0						c.(376-378)CGC>CAC		keratin associated protein 4.8							3.0	5.0	4.0					17																	39253960		568	1364	1932	SO:0001583	missense	728224					keratin filament		g.chr17:39253960C>T	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.377G>A	17.37:g.39253960C>T	ENSP00000328444:p.Arg126His						p.R126H	NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN			1	416	-			126	R -> H (in Ref. 2; CAC27579).		21.|25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].		A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	c.377G>A	CCDS45674.1	686	0.3141025641025641	142	0.2886178861788618	131	0.36187845303867405	103	0.18006993006993008	310	0.40897097625329815	.	14.80	2.642678	0.47153	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.01548	4.78	3.36	-2.03	0.07365	.	1.816570	0.03571	U	0.228564	T	0.00012	0.0000	L	0.46614	1.455	0.80722	P	0.0	D	0.54207	0.965	P	0.46389	0.515	T	0.42258	-0.9462	9	0.32370	T	0.25	.	4.6421	0.12555	0.1571:0.5787:0.0:0.2642	.	126	Q9BYQ9	KRA48_HUMAN	H	126;111	ENSP00000328444:R126H	ENSP00000414561:R111H	R	-	2	0	KRTAP4-8	36507486	0.000000	0.05858	0.052000	0.19188	0.698000	0.40448	-0.965000	0.03829	-0.703000	0.05049	-0.384000	0.06662	CGC		0.672	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960		4	19	0	0	0	0.001168	0	4	19				
EPX	8288	broad.mit.edu	37	17	56274464	56274464	+	Silent	SNP	G	G	A	rs201284086		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:56274464G>A	ENST00000225371.5	+	7	1076	c.966G>A	c.(964-966)tcG>tcA	p.S322S		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	322					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.S322S(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	TCTCCCTCTCGCTGCGGCTCC	0.617													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18554	0.0		0.0	False		,,,				2504	0.0						uc002ivq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(964-966)TCG>TCA		eosinophil peroxidase preproprotein							142.0	132.0	136.0					17																	56274464		2203	4300	6503	SO:0001819	synonymous_variant	8288				hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding	g.chr17:56274464G>A	M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.966G>A	17.37:g.56274464G>A							p.S322S	NM_000502	NP_000493	P11678	PERE_HUMAN			7	1052	+			322					Q4TVP3	Silent	SNP	ENST00000225371.5	37	c.966G>A	CCDS11602.1																																																																																				0.617	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502		22	102	0	0	0	0.014323	0	22	102				
RECQL5	9400	broad.mit.edu	37	17	73663525	73663525	+	5'Flank	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr17:73663525G>C	ENST00000317905.5	-	0	0				SAP30BP_ENST00000584667.1_Missense_Mutation_p.E25Q|SAP30BP_ENST00000355423.3_Missense_Mutation_p.E25Q|RECQL5_ENST00000423245.2_5'Flank|RECQL5_ENST00000420326.2_5'Flank|SAP30BP_ENST00000579864.1_3'UTR|RECQL5_ENST00000340830.5_5'Flank|RECQL5_ENST00000584999.1_5'Flank	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5						chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)	p.E25Q(1)		breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			GTCTGATGGCGAGGCTGGAAT	0.617								Other identified genes with known or suspected DNA repair function																															uc002jpe.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(73-75)GAG>CAG		transcriptional regulator protein							59.0	59.0	59.0					17																	73663525		2203	4300	6503	SO:0001631	upstream_gene_variant	29115				apoptosis|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding	g.chr17:73663525G>C	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762			17.37:g.73663525G>C	Exception_encountered					RECQL5_uc010dgk.2_5'Flank|RECQL5_uc010dgl.2_5'Flank|RECQL5_uc002jpb.1_5'Flank|RECQL5_uc002joz.3_5'Flank|RECQL5_uc002jpa.3_5'Flank|SAP30BP_uc010dgm.1_Missense_Mutation_p.E25Q|SAP30BP_uc002jpc.1_RNA|SAP30BP_uc010wsf.1_RNA|SAP30BP_uc010wsg.1_RNA|SAP30BP_uc002jpf.2_Missense_Mutation_p.E25Q	p.E25Q	NM_013260	NP_037392	Q9UHR5	S30BP_HUMAN	all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)		1	127	+	all_cancers(13;6.42e-08)		25					Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	ENST00000317905.5	37	c.73G>C	CCDS42380.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.197817	0.58126	.	.	ENSG00000161526	ENST00000355423;ENST00000542343;ENST00000293208	.	.	.	5.4	5.4	0.78164	.	0.092925	0.64402	D	0.000001	T	0.76407	0.3983	L	0.53249	1.67	0.53688	D	0.999977	D;D;D	0.89917	1.0;0.973;0.973	D;P;P	0.91635	0.999;0.754;0.715	T	0.74844	-0.3526	9	0.41790	T	0.15	-9.5137	19.1854	0.93641	0.0:0.0:1.0:0.0	.	25;25;25	F5H478;Q9UHR5-2;Q9UHR5	.;.;S30BP_HUMAN	Q	25	.	ENSP00000293208:E25Q	E	+	1	0	SAP30BP	71175120	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	6.053000	0.71089	2.509000	0.84616	0.650000	0.86243	GAG		0.617	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1	NM_004259		4	81	0	0	0	0.009096	0	4	81				
CETN1	1068	broad.mit.edu	37	18	580696	580696	+	Silent	SNP	G	G	A	rs114552098		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr18:580696G>A	ENST00000327228.3	+	1	330	c.288G>A	c.(286-288)aaG>aaA	p.K96K		NM_004066.1	NP_004057.1	Q12798	CETN1_HUMAN	centrin, EF-hand protein, 1	96	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to heat (GO:0034605)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|photoreceptor connecting cilium (GO:0032391)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)	p.K96K(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(2)	25						TGACGCAGAAGATGTCCGAGA	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19166	0.0		0.0	False		,,,				2504	0.0						uc002kko.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)	2						c.(286-288)AAG>AAA		centrin 1		G		2,4404	4.2+/-10.8	0,2,2201	67.0	66.0	66.0		288	2.5	1.0	18	dbSNP_132	66	0,8600		0,0,4300	no	coding-synonymous	CETN1	NM_004066.1		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		96/173	580696	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1068				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding	g.chr18:580696G>A	U03270	CCDS11820.1	18p11.32	2013-01-10			ENSG00000177143	ENSG00000177143		"""EF-hand domain containing"""	1866	protein-coding gene	gene with protein product		603187		CETN		8175926	Standard	NM_004066		Approved	CEN1	uc002kko.1	Q12798	OTTHUMG00000131471	ENST00000327228.3:c.288G>A	18.37:g.580696G>A							p.K96K	NM_004066	NP_004057	Q12798	CETN1_HUMAN			1	330	+			96			EF-hand 2.		B2R536	Silent	SNP	ENST00000327228.3	37	c.288G>A	CCDS11820.1																																																																																				0.507	CETN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254314.2	NM_004066		4	59	0	0	0	0.009096	0	4	59				
SMAD2	4087	broad.mit.edu	37	18	45368254	45368254	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr18:45368254C>T	ENST00000402690.2	-	11	1742	c.1348G>A	c.(1348-1350)Gac>Aac	p.D450N	SMAD2_ENST00000356825.4_Missense_Mutation_p.D420N|SMAD2_ENST00000262160.6_Missense_Mutation_p.D450N|SMAD2_ENST00000586040.1_Missense_Mutation_p.D420N	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	450	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		D -> E (in a colorectal carcinoma sample). {ECO:0000269|PubMed:8752209}.		activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.D450N(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						AATACTTTGTCCAACCACTGT	0.398																																							uc002lcy.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|lung(1)|central_nervous_system(1)	5						c.(1348-1350)GAC>AAC		Sma- and Mad-related protein 2 isoform 1							162.0	138.0	146.0					18																	45368254		2203	4300	6503	SO:0001583	missense	4087				anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding	g.chr18:45368254C>T	U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.1348G>A	18.37:g.45368254C>T	ENSP00000384449:p.Asp450Asn					SMAD2_uc002lcz.2_Missense_Mutation_p.D450N|SMAD2_uc010xdc.1_Missense_Mutation_p.D420N	p.D450N	NM_005901	NP_005892	Q15796	SMAD2_HUMAN			11	1596	-			450		D -> E (in a colorectal carcinoma sample).	MH2.			Missense_Mutation	SNP	ENST00000402690.2	37	c.1348G>A	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	C	34	5.307887	0.95629	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.97994	-4.65;-4.65;-4.65	5.65	5.65	0.86999	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (1);	0.000000	0.85682	D	0.000000	D	0.99137	0.9702	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99229	1.0881	10	0.87932	D	0	.	20.0965	0.97849	0.0:1.0:0.0:0.0	.	420;450	Q15796-2;Q15796	.;SMAD2_HUMAN	N	450;420;450	ENSP00000262160:D450N;ENSP00000349282:D420N;ENSP00000384449:D450N	ENSP00000262160:D450N	D	-	1	0	SMAD2	43622252	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.824000	0.97209	0.655000	0.94253	GAC		0.398	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901		7	56	0	0	0	0.001984	0	7	56				
MUC16	94025	broad.mit.edu	37	19	9047598	9047598	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:9047598C>G	ENST00000397910.4	-	5	34236	c.34033G>C	c.(34033-34035)Gag>Cag	p.E11345Q		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11347	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.E6978Q(1)|p.E11345Q(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCTGTTGCCTCTGATTCATGT	0.502																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(34033-34035)GAG>CAG		mucin 16							227.0	215.0	219.0					19																	9047598		2072	4219	6291	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9047598C>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34033G>C	19.37:g.9047598C>G	ENSP00000381008:p.Glu11345Gln						p.E11345Q	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			5	34237	-			11347			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.34033G>C	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	8.542	0.873435	0.17322	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	3.08	3.08	0.35506	.	.	.	.	.	T	0.04227	0.0117	N	0.11560	0.145	.	.	.	D	0.69078	0.997	P	0.59288	0.855	T	0.43491	-0.9388	8	0.87932	D	0	.	9.8835	0.41247	0.0:1.0:0.0:0.0	.	11345	B5ME49	.	Q	11345	ENSP00000381008:E11345Q	ENSP00000381008:E11345Q	E	-	1	0	MUC16	8908598	0.000000	0.05858	0.013000	0.15412	0.018000	0.09664	-0.232000	0.09055	2.033000	0.60031	0.586000	0.80456	GAG		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		10	212	0	0	0	0.010729	0	10	212				
OR7D2	162998	broad.mit.edu	37	19	9296806	9296806	+	Missense_Mutation	SNP	G	G	A	rs199962381		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:9296806G>A	ENST00000344248.2	+	1	528	c.349G>A	c.(349-351)Gtg>Atg	p.V117M		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	117					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V117M(1)		breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						ACTCCTGACCGTGATGGCCTA	0.512																																							uc002mkz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(349-351)GTG>ATG		olfactory receptor, family 7, subfamily D,							182.0	168.0	173.0					19																	9296806		2203	4300	6503	SO:0001583	missense	162998				regulation of transcription, DNA-dependent|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9296806G>A	AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.349G>A	19.37:g.9296806G>A	ENSP00000345563:p.Val117Met						p.V117M	NM_175883	NP_787079	Q96RA2	OR7D2_HUMAN			1	537	+			117			Helical; Name=3; (Potential).		Q6IFJ7|Q8N133	Missense_Mutation	SNP	ENST00000344248.2	37	c.349G>A	CCDS32900.1	.	.	.	.	.	.	.	.	.	.	G	6.984	0.551671	0.13374	.	.	ENSG00000188000	ENST00000344248	T	0.05855	3.38	2.21	1.16	0.20824	GPCR, rhodopsin-like superfamily (1);	1.176130	0.06763	U	0.782107	T	0.11965	0.0291	M	0.88570	2.965	0.09310	N	1	B	0.34015	0.435	B	0.28011	0.085	T	0.30937	-0.9961	10	0.56958	D	0.05	.	6.2137	0.20644	0.2813:0.0:0.7187:0.0	.	117	Q96RA2	OR7D2_HUMAN	M	117	ENSP00000345563:V117M	ENSP00000345563:V117M	V	+	1	0	OR7D2	9157806	0.000000	0.05858	0.006000	0.13384	0.623000	0.37688	-0.331000	0.07914	0.516000	0.28340	0.511000	0.50034	GTG		0.512	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449002.1			18	194	0	0	0	0.006122	0	18	194				
NOVA2	4858	broad.mit.edu	37	19	46443408	46443408	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:46443408C>G	ENST00000263257.5	-	4	1386	c.1192G>C	c.(1192-1194)Gag>Cag	p.E398Q		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	398	Ala-rich.				regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E398Q(1)		endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		GCCAGCTTCTCCGCCGTCAGG	0.756																																							uc002pdv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1192-1194)GAG>CAG		neuro-oncological ventral antigen 2							31.0	35.0	33.0					19																	46443408		2200	4283	6483	SO:0001583	missense	4858					nucleus	RNA binding	g.chr19:46443408C>G	U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.1192G>C	19.37:g.46443408C>G	ENSP00000263257:p.Glu398Gln						p.E398Q	NM_002516	NP_002507	Q9UNW9	NOVA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)	4	1240	-		all_neural(266;0.113)|Ovarian(192;0.127)	398			Ala-rich.		O43267|Q9UEA1	Missense_Mutation	SNP	ENST00000263257.5	37	c.1192G>C	CCDS12679.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.120302	0.37436	.	.	ENSG00000104967	ENST00000263257	T	0.41400	1.0	3.72	3.72	0.42706	.	0.174346	0.37955	U	0.001880	T	0.26919	0.0659	L	0.27053	0.805	0.46654	D	0.999149	B	0.19073	0.033	B	0.22601	0.04	T	0.05937	-1.0855	10	0.06494	T	0.89	-2.3711	13.0987	0.59208	0.0:1.0:0.0:0.0	.	398	Q9UNW9	NOVA2_HUMAN	Q	398	ENSP00000263257:E398Q	ENSP00000263257:E398Q	E	-	1	0	NOVA2	51135248	1.000000	0.71417	0.990000	0.47175	0.699000	0.40488	7.250000	0.78287	1.951000	0.56629	0.485000	0.47835	GAG		0.756	NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437210.2	NM_002516		6	42	0	0	0	0.001984	0	6	42				
KIR3DL1	3811	broad.mit.edu	37	19	55341715	55341715	+	Silent	SNP	T	T	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:55341715T>A	ENST00000391728.4	+	9	1353	c.1320T>A	c.(1318-1320)gtT>gtA	p.V440V	KIR3DL1_ENST00000538269.1_Silent_p.V440V|KIR3DL1_ENST00000326542.7_Silent_p.V423V|KIR3DL1_ENST00000541392.1_Silent_p.V423V|KIR2DS4_ENST00000339924.8_RNA|KIR3DL1_ENST00000402254.2_Intron|KIR3DL1_ENST00000358178.4_Silent_p.V345V	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	440					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.V440V(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		GATCCAAAGTTGTCTCCTGCC	0.527																																							uc002qhk.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5						c.(1318-1320)GTT>GTA		killer cell immunoglobulin-like receptor, three							232.0	216.0	222.0					19																	55341715		2173	4172	6345	SO:0001819	synonymous_variant	3811				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity	g.chr19:55341715T>A	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.1320T>A	19.37:g.55341715T>A						KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Silent_p.V365V|KIR3DL1_uc010esf.2_Silent_p.V345V|KIR3DL1_uc010yfo.1_Silent_p.V382V|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_5'Flank|KIR2DS4_uc002qhm.1_5'Flank	p.V440V	NM_013289	NP_037421	P43629	KI3L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	9	1383	+			440			Cytoplasmic (Potential).		O43473|Q14946|Q16541	Silent	SNP	ENST00000391728.4	37	c.1320T>A	CCDS42621.1																																																																																				0.527	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141238.1	NM_013289		51	370	0	0	0	0.01441	0	51	370				
ZSCAN5A	79149	broad.mit.edu	37	19	56736297	56736297	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:56736297G>A	ENST00000587340.1	-	4	814	c.119C>T	c.(118-120)cCt>cTt	p.P40L	ZSCAN5A_ENST00000254165.3_Intron|ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.P40L|ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.P40L|ZSCAN5A_ENST00000587492.1_Intron			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	40					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.P40L(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGAAATCTCAGGGTCCACGTC	0.542																																							uc002qmq.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)|skin(1)	3						c.(118-120)CCT>CTT		zinc finger and SCAN domain containing 5A							82.0	81.0	82.0					19																	56736297		2203	4300	6503	SO:0001583	missense	79149				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:56736297G>A	AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.119C>T	19.37:g.56736297G>A	ENSP00000467631:p.Pro40Leu					ZSCAN5A_uc010ygi.1_Intron|ZSCAN5A_uc002qmr.2_Missense_Mutation_p.P40L|ZSCAN5A_uc002qms.1_Missense_Mutation_p.P40L	p.P40L	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN			2	285	-			40					B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	ENST00000587340.1	37	c.119C>T	CCDS12941.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012645	0.35511	.	.	ENSG00000131848	ENST00000391713	T	0.06218	3.33	2.19	1.09	0.20402	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (2);	.	.	.	.	T	0.15739	0.0379	L	0.53671	1.685	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.12400	-1.0549	9	0.36615	T	0.2	.	6.8813	0.24174	0.0:0.3291:0.6709:0.0	.	40	Q9BUG6	ZSA5A_HUMAN	L	40	ENSP00000375593:P40L	ENSP00000375593:P40L	P	-	2	0	ZSCAN5A	61428109	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	-2.327000	0.01113	0.483000	0.27608	0.650000	0.86243	CCT		0.542	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303		21	62	0	0	0	0.012319	0	21	62				
ZIK1	284307	broad.mit.edu	37	19	58102051	58102051	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:58102051G>A	ENST00000597850.1	+	4	1087	c.872G>A	c.(871-873)gGa>gAa	p.G291E	ZIK1_ENST00000599456.1_Missense_Mutation_p.G236E|ZIK1_ENST00000536878.2_Missense_Mutation_p.G278E|ZIK1_ENST00000307468.4_3'UTR	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G291E(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ATCCACACCGGAGAAAGGCCT	0.458																																							uc002qpg.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(871-873)GGA>GAA		zinc finger protein interacting with K protein							59.0	62.0	61.0					19																	58102051		2203	4300	6503	SO:0001583	missense	284307				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:58102051G>A	AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.872G>A	19.37:g.58102051G>A	ENSP00000472867:p.Gly291Glu					ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.G236E|ZIK1_uc002qpi.2_Missense_Mutation_p.G278E|ZIK1_uc002qpj.2_Missense_Mutation_p.G188E	p.G291E	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)	4	969	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)	291					O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	37	c.872G>A	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.512067	0.27036	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.25749	1.78	3.06	0.731	0.18277	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43077	0.1231	M	0.67625	2.065	0.34640	D	0.720534	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.52852	-0.8520	9	0.87932	D	0	.	6.8993	0.24273	0.1072:0.1771:0.7157:0.0	.	278;291	F5H435;Q3SY52	.;ZIK1_HUMAN	E	278;272;291	ENSP00000438487:G278E	ENSP00000303820:G291E	G	+	2	0	ZIK1	62793863	0.005000	0.15991	0.001000	0.08648	0.028000	0.11728	0.345000	0.19979	0.134000	0.18681	-0.214000	0.12660	GGA		0.458	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879		11	50	0	0	0	0.008291	0	11	50				
ZNF135	7694	broad.mit.edu	37	19	58578972	58578972	+	Nonsense_Mutation	SNP	C	C	T	rs149615463	byFrequency	TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr19:58578972C>T	ENST00000313434.5	+	5	1221	c.1120C>T	c.(1120-1122)Cga>Tga	p.R374*	ZNF135_ENST00000511556.1_Nonsense_Mutation_p.R386*|ZNF135_ENST00000401053.4_Nonsense_Mutation_p.R398*|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000506786.1_Nonsense_Mutation_p.R332*|ZNF135_ENST00000359978.6_Intron|ZNF135_ENST00000439855.2_Nonsense_Mutation_p.R374*	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	374					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R398*(1)|p.R374*(1)		breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CAAACACCAGCGAATCCACAC	0.557													C|||	3	0.000599042	0.0	0.0014	5008	,	,		21609	0.0		0.002	False		,,,				2504	0.0						uc010yhq.1		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(1156-1158)CGA>TGA		zinc finger protein 135 isoform 2		C	,,stop/ARG,stop/ARG	2,4404	4.2+/-10.8	0,2,2201	67.0	61.0	63.0		,,1156,1192	-5.5	0.0	19	dbSNP_134	63	17,8583	12.6+/-44.7	0,17,4283	no	utr-3,intron,stop-gained,stop-gained	ZNF135	NM_001164529.1,NM_001164530.1,NM_003436.3,NM_007134.1	,,,	0,19,6484	TT,TC,CC		0.1977,0.0454,0.1461	,,,	,,386/671,398/683	58578972	19,12987	2203	4300	6503	SO:0001587	stop_gained	7694				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:58578972C>T	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.1120C>T	19.37:g.58578972C>T	ENSP00000321406:p.Arg374*					ZNF135_uc002qre.2_Nonsense_Mutation_p.R374*|ZNF135_uc002qrd.1_Intron|ZNF135_uc002qrf.2_Nonsense_Mutation_p.R332*|ZNF135_uc002qrg.2_Nonsense_Mutation_p.R344*|ZNF135_uc010yhr.1_Nonsense_Mutation_p.R195*	p.R386*	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)	5	1252	+		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)	386					B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Nonsense_Mutation	SNP	ENST00000313434.5	37	c.1156C>T		2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	10.62	1.402604	0.25291	4.54E-4	0.001977	ENSG00000176293	ENST00000401053;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786	.	.	.	3.1	-5.52	0.02560	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8814	0.63684	0.8276:0.1723:0.0:0.0	.	.	.	.	X	398;374;374;386;332	.	ENSP00000321406:R374X	R	+	1	2	ZNF135	63270784	0.000000	0.05858	0.009000	0.14445	0.006000	0.05464	-1.551000	0.02178	-0.602000	0.05775	-0.321000	0.08615	CGA		0.557	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436		11	56	0	0	0	0.010729	0	11	56				
ALLC	55821	broad.mit.edu	37	2	3744967	3744967	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:3744967G>A	ENST00000252505.3	+	10	933	c.771G>A	c.(769-771)ccG>ccA	p.P257P	ALLC_ENST00000471711.1_3'UTR	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	276					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)	p.P257P(1)		breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TCTTGGTTCCGGGTTGTGAAT	0.393										HNSCC(21;0.051)																													uc010ewt.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(769-771)CCG>CCA		allantoicase isoform a							153.0	150.0	151.0					2																	3744967		1858	4096	5954	SO:0001819	synonymous_variant	55821						allantoicase activity	g.chr2:3744967G>A	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.771G>A	2.37:g.3744967G>A		HNSCC(21;0.051)				ALLC_uc002qyf.2_Silent_p.P28P	p.P257P	NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)	10	932	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)	276					Q53T95|Q5RL81|Q96RE6|Q9NZA7	Silent	SNP	ENST00000252505.3	37	c.771G>A	CCDS46223.1																																																																																				0.393	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1			28	115	0	0	0	0.012213	0	28	115				
EIF2B4	8890	broad.mit.edu	37	2	27587635	27587635	+	Missense_Mutation	SNP	T	T	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:27587635T>C	ENST00000347454.4	-	12	1493	c.1322A>G	c.(1321-1323)tAc>tGc	p.Y441C	EIF2B4_ENST00000445933.2_Missense_Mutation_p.Y440C|AC074117.10_ENST00000412749.1_RNA|EIF2B4_ENST00000493344.2_Missense_Mutation_p.Y462C|EIF2B4_ENST00000451130.2_Missense_Mutation_p.Y461C	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	441					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)	p.Y461C(1)|p.Y441C(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACAGAACTTGTATGTTTCACA	0.522																																							uc002rkb.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1321-1323)TAC>TGC		eukaryotic translation initiation factor 2B,							120.0	107.0	112.0					2																	27587635		2203	4300	6503	SO:0001583	missense	8890				myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding	g.chr2:27587635T>C	AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.1322A>G	2.37:g.27587635T>C	ENSP00000233552:p.Tyr441Cys					EIF2B4_uc002rjz.2_Missense_Mutation_p.Y461C|EIF2B4_uc002rka.2_Missense_Mutation_p.Y426C|EIF2B4_uc002rkc.2_Missense_Mutation_p.Y440C|EIF2B4_uc002rkd.2_Missense_Mutation_p.Y235C|EIF2B4_uc002rke.2_Missense_Mutation_p.Y410C	p.Y441C	NM_001034116	NP_001029288	Q9UI10	EI2BD_HUMAN			12	1465	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		441					Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	ENST00000347454.4	37	c.1322A>G	CCDS33164.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.163403	0.78226	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.96015	0.8702	M	0.78285	2.405	0.80722	D	1	D;D;P;P	0.54397	0.966;0.966;0.559;0.503	P;P;P;B	0.56474	0.799;0.799;0.519;0.384	D	0.95801	0.8833	10	0.49607	T	0.09	-9.0559	13.5046	0.61477	0.0:0.0:0.0:1.0	.	438;440;441;461	F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;EI2BD_HUMAN;.	C	441;438;440;461;462	ENSP00000233552:Y441C;ENSP00000394397:Y440C;ENSP00000394869:Y461C;ENSP00000429323:Y462C	ENSP00000233552:Y441C	Y	-	2	0	EIF2B4	27441139	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.819000	0.86621	2.058000	0.61347	0.533000	0.62120	TAC		0.522	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324448.1			23	101	0	0	0	0.01892	0	23	101				
SOS1	6654	broad.mit.edu	37	2	39234206	39234206	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:39234206G>A	ENST00000426016.1	-	17	2725	c.2639C>T	c.(2638-2640)tCa>tTa	p.S880L	SOS1_ENST00000395038.2_Missense_Mutation_p.S880L|SOS1_ENST00000402219.2_Missense_Mutation_p.S880L			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	880	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S880L(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				AACAGGTGATGAATTCATAGC	0.343									Noonan syndrome																														uc002rrk.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10						c.(2638-2640)TCA>TTA		son of sevenless homolog 1							140.0	138.0	139.0					2																	39234206		2203	4300	6503	SO:0001583	missense	6654	Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr2:39234206G>A	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.2639C>T	2.37:g.39234206G>A	ENSP00000387784:p.Ser880Leu					SOS1_uc002rrj.3_Missense_Mutation_p.S494L	p.S880L	NM_005633	NP_005624	Q07889	SOS1_HUMAN			16	2680	-		all_hematologic(82;0.21)	880			Ras-GEF.		A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	c.2639C>T	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	G	35	5.439831	0.96168	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	T;T;T	0.36157	1.27;1.27;1.27	5.95	5.95	0.96441	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.66761	0.2822	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69221	-0.5202	10	0.87932	D	0	.	20.3886	0.98946	0.0:0.0:1.0:0.0	.	880	Q07889	SOS1_HUMAN	L	880;880;612;880;880	ENSP00000387784:S880L;ENSP00000384675:S880L;ENSP00000378479:S880L	ENSP00000263879:S880L	S	-	2	0	SOS1	39087710	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	9.726000	0.98782	2.810000	0.96702	0.650000	0.86243	TCA		0.343	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633		34	124	0	0	0	0.015359	0	34	124				
ABCG5	64240	broad.mit.edu	37	2	44051398	44051398	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:44051398C>G	ENST00000260645.1	-	8	1217	c.1078G>C	c.(1078-1080)Gat>Cat	p.D360H	ABCG5_ENST00000405322.1_Missense_Mutation_p.D189H|ABCG5_ENST00000543989.1_Intron	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	360					ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)	p.D360H(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CCAGGAGAATCTTTGGTTTTG	0.388																																							uc002rtn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1078-1080)GAT>CAT		ATP-binding cassette sub-family G member 5							110.0	114.0	112.0					2																	44051398		2203	4300	6503	SO:0001583	missense	64240				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44051398C>G	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1078G>C	2.37:g.44051398C>G	ENSP00000260645:p.Asp360His					ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Missense_Mutation_p.D189H|ABCG5_uc002rtp.2_Intron	p.D360H	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN			8	1218	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	360			Cytoplasmic (Potential).		Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	ENST00000260645.1	37	c.1078G>C	CCDS1814.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.267483	0.59540	.	.	ENSG00000138075	ENST00000260645;ENST00000405322	D;T	0.90197	-2.63;-1.29	5.91	1.7	0.24286	.	2.117490	0.01910	N	0.039771	D	0.85737	0.5766	N	0.14661	0.345	0.80722	D	1	P;D	0.54397	0.944;0.966	P;P	0.49012	0.598;0.541	T	0.77913	-0.2410	10	0.13853	T	0.58	.	8.6569	0.34068	0.0:0.6371:0.2308:0.1321	.	189;360	E7EX35;Q9H222	.;ABCG5_HUMAN	H	360;189	ENSP00000260645:D360H;ENSP00000384513:D189H	ENSP00000260645:D360H	D	-	1	0	ABCG5	43904902	1.000000	0.71417	0.979000	0.43373	0.593000	0.36681	1.630000	0.37081	0.773000	0.33404	0.655000	0.94253	GAT		0.388	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436		21	128	0	0	0	0.016522	0	21	128				
ABCG5	64240	broad.mit.edu	37	2	44051514	44051514	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:44051514C>G	ENST00000260645.1	-	8	1101	c.962G>C	c.(961-963)aGa>aCa	p.R321T	ABCG5_ENST00000405322.1_Missense_Mutation_p.R150T|ABCG5_ENST00000543989.1_Intron	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	321					ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)	p.R321T(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CATCTGGACTCTCTTGGAGGT	0.373																																							uc002rtn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(961-963)AGA>ACA		ATP-binding cassette sub-family G member 5							129.0	137.0	134.0					2																	44051514		2202	4300	6502	SO:0001583	missense	64240				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity	g.chr2:44051514C>G	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.962G>C	2.37:g.44051514C>G	ENSP00000260645:p.Arg321Thr					ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Missense_Mutation_p.R150T|ABCG5_uc002rtp.2_Intron	p.R321T	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN			8	1102	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	321			Cytoplasmic (Potential).		Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	ENST00000260645.1	37	c.962G>C	CCDS1814.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.217929	0.79352	.	.	ENSG00000138075	ENST00000260645;ENST00000405322	T;T	0.81330	1.35;-1.48	5.75	4.88	0.63580	.	1.348330	0.04458	N	0.373936	T	0.80297	0.4597	N	0.24115	0.695	0.80722	D	1	D;D	0.60575	0.988;0.961	P;P	0.50934	0.654;0.617	T	0.66296	-0.5959	10	0.40728	T	0.16	.	14.2225	0.65836	0.0:0.9282:0.0:0.0718	.	150;321	E7EX35;Q9H222	.;ABCG5_HUMAN	T	321;150	ENSP00000260645:R321T;ENSP00000384513:R150T	ENSP00000260645:R321T	R	-	2	0	ABCG5	43905018	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.294000	0.65687	1.439000	0.47511	0.655000	0.94253	AGA		0.373	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436		23	187	0	0	0	0.00632	0	23	187				
CTNNA2	1496	broad.mit.edu	37	2	80085262	80085262	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:80085262C>T	ENST00000402739.4	+	3	427	c.422C>T	c.(421-423)gCg>gTg	p.A141V	CTNNA2_ENST00000361291.4_Missense_Mutation_p.A175V|CTNNA2_ENST00000466387.1_Missense_Mutation_p.A141V|CTNNA2_ENST00000496558.1_Missense_Mutation_p.A141V|CTNNA2_ENST00000541047.1_Missense_Mutation_p.A141V|CTNNA2_ENST00000540488.1_Missense_Mutation_p.A141V	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	141					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.A141V(2)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CTCATCCTGGCGGACATGGCA	0.498																																							uc010ysh.1		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(4)|lung(3)|breast(1)|skin(1)	9						c.(421-423)GCG>GTG		catenin, alpha 2 isoform 1							73.0	72.0	73.0					2																	80085262		2045	4190	6235	SO:0001583	missense	1496				axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	g.chr2:80085262C>T		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.422C>T	2.37:g.80085262C>T	ENSP00000384638:p.Ala141Val					CTNNA2_uc010yse.1_Missense_Mutation_p.A141V|CTNNA2_uc010ysf.1_Missense_Mutation_p.A141V|CTNNA2_uc010ysg.1_Missense_Mutation_p.A141V	p.A141V	NM_004389	NP_004380	P26232	CTNA2_HUMAN			3	427	+			141					B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37	c.422C>T		.	.	.	.	.	.	.	.	.	.	C	36	5.968190	0.97156	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.74336	0.3703	M	0.92649	3.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.998	T	0.79169	-0.1914	10	0.54805	T	0.06	.	19.773	0.96379	0.0:1.0:0.0:0.0	.	141;141;141	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	V	141;141;175;141;141;141	ENSP00000418191:A141V;ENSP00000419295:A141V;ENSP00000355398:A175V;ENSP00000384638:A141V;ENSP00000444675:A141V;ENSP00000441705:A141V	ENSP00000355398:A175V	A	+	2	0	CTNNA2	79938770	1.000000	0.71417	0.981000	0.43875	0.994000	0.84299	7.818000	0.86416	2.677000	0.91161	0.655000	0.94253	GCG		0.498	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389		8	62	0	0	0	0.00308	0	8	62				
IMMT	10989	broad.mit.edu	37	2	86406604	86406604	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:86406604C>T	ENST00000410111.3	-	3	648	c.261G>A	c.(259-261)gaG>gaA	p.E87E	IMMT_ENST00000449247.2_Silent_p.E87E|IMMT_ENST00000442664.2_Silent_p.E87E|IMMT_ENST00000254636.5_5'UTR|IMMT_ENST00000409051.2_Silent_p.E87E	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	87					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)	p.E87E(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CAAGAACCATCTCGAAGAGTT	0.383																																							uc002sqz.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(259-261)GAG>GAA		inner membrane protein, mitochondrial isoform 1							57.0	54.0	55.0					2																	86406604		1834	4102	5936	SO:0001819	synonymous_variant	10989					integral to mitochondrial inner membrane	protein binding	g.chr2:86406604C>T	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.261G>A	2.37:g.86406604C>T						IMMT_uc002srb.3_Silent_p.E87E|IMMT_uc002sra.3_Silent_p.E87E|IMMT_uc010ytd.1_Silent_p.E87E|IMMT_uc010yte.1_Silent_p.E87E|IMMT_uc002srd.2_Silent_p.E87E|IMMT_uc002sre.3_Silent_p.E87E|IMMT_uc010ytf.1_Silent_p.E87E|IMMT_uc010fgs.1_Silent_p.E87E	p.E87E	NM_006839	NP_006830	Q16891	IMMT_HUMAN			3	649	-			87			Mitochondrial intermembrane (Potential).		B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Silent	SNP	ENST00000410111.3	37	c.261G>A	CCDS46355.1																																																																																				0.383	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839		5	34	0	0	0	0.014758	0	5	34				
THSD7B	80731	broad.mit.edu	37	2	138000026	138000026	+	Splice_Site	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:138000026G>A	ENST00000409968.1	+	10	2328		c.e10-1		THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Splice_Site|THSD7B_ENST00000272643.3_Splice_Site			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B							integral component of membrane (GO:0016021)		p.?(2)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CACATTGACAGATGTCCAGAT	0.443																																							uc002tva.1		NA																	2	Unknown(2)		lung(2)	ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.e9-1		thrombospondin, type I, domain containing 7B							122.0	115.0	118.0					2																	138000026		1944	4133	6077	SO:0001630	splice_region_variant	80731							g.chr2:138000026G>A			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2151-1G>A	2.37:g.138000026G>A						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Splice_Site_p.R576_splice	p.R686_splice	NM_001080427	NP_001073896				BRCA - Breast invasive adenocarcinoma(221;0.19)	9	2058	+									Splice_Site	SNP	ENST00000409968.1	37	c.2058_splice		.	.	.	.	.	.	.	.	.	.	G	15.75	2.926874	0.52759	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0124	0.97464	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	THSD7B	137716496	1.000000	0.71417	0.999000	0.59377	0.197000	0.23852	9.230000	0.95299	2.749000	0.94314	0.655000	0.94253	.		0.443	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	Intron	4	51	0	0	0	0.009096	0	4	51				
PLA2R1	22925	broad.mit.edu	37	2	160825826	160825826	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:160825826C>T	ENST00000283243.7	-	19	2911	c.2705G>A	c.(2704-2706)gGa>gAa	p.G902E	PLA2R1_ENST00000392771.1_Missense_Mutation_p.G902E	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	902	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.G902E(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TCTTTCTCTTCCTGTGTCCCA	0.388																																							uc002ube.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(2704-2706)GGA>GAA		phospholipase A2 receptor 1 isoform 1 precursor							127.0	121.0	123.0					2																	160825826		2203	4300	6503	SO:0001583	missense	22925				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding	g.chr2:160825826C>T	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2705G>A	2.37:g.160825826C>T	ENSP00000283243:p.Gly902Glu					PLA2R1_uc010zcp.1_Missense_Mutation_p.G902E|PLA2R1_uc002ubf.2_Missense_Mutation_p.G902E	p.G902E	NM_007366	NP_031392	Q13018	PLA2R_HUMAN			19	2912	-			902			Extracellular (Potential).|C-type lectin 5.		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	c.2705G>A	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.525642	0.00959	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.11169	2.8;2.8	5.8	1.23	0.21249	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.690937	0.14534	N	0.313685	T	0.11367	0.0277	M	0.66506	2.035	0.09310	N	0.999999	B;B;B	0.15719	0.014;0.004;0.002	B;B;B	0.23852	0.049;0.019;0.015	T	0.33624	-0.9861	10	0.31617	T	0.26	.	4.1162	0.10083	0.1598:0.363:0.0:0.4772	.	902;902;902	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	E	902	ENSP00000283243:G902E;ENSP00000376524:G902E	ENSP00000283243:G902E	G	-	2	0	PLA2R1	160534072	0.000000	0.05858	0.011000	0.14972	0.452000	0.32318	-1.988000	0.01482	-0.079000	0.12707	0.650000	0.86243	GGA		0.388	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1			19	70	0	0	0	0.008871	0	19	70				
TTN	7273	broad.mit.edu	37	2	179644903	179644903	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:179644903G>A	ENST00000591111.1	-	22	3777	c.3553C>T	c.(3553-3555)Caa>Taa	p.Q1185*	TTN_ENST00000460472.2_Nonsense_Mutation_p.Q1139*|TTN_ENST00000589042.1_Nonsense_Mutation_p.Q1185*|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.Q1139*|TTN_ENST00000360870.5_Nonsense_Mutation_p.Q1185*|TTN_ENST00000342992.6_Nonsense_Mutation_p.Q1185*|TTN_ENST00000359218.5_Nonsense_Mutation_p.Q1139*			Q8WZ42	TITIN_HUMAN	titin	33403					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Q1139*(3)|p.Q1185*(3)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCATTTCTTGCTGGGACTTC	0.353																																							uc010zfg.1		NA																	6	Substitution - Nonsense(6)		lung(6)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(3553-3555)CAA>TAA		titin isoform N2-A							105.0	100.0	101.0					2																	179644903		2203	4300	6503	SO:0001587	stop_gained	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179644903G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3553C>T	2.37:g.179644903G>A	ENSP00000465570:p.Gln1185*					TTN_uc010zfh.1_Nonsense_Mutation_p.Q1139*|TTN_uc010zfi.1_Nonsense_Mutation_p.Q1139*|TTN_uc010zfj.1_Nonsense_Mutation_p.Q1139*|TTN_uc002unb.2_Nonsense_Mutation_p.Q1185*	p.Q1185*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		22	3777	-			1185					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37	c.3553C>T		.	.	.	.	.	.	.	.	.	.	G	43	10.048449	0.99325	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.5103	0.75776	0.0:0.1376:0.8624:0.0	.	.	.	.	X	1185;1139;1139;1139;1139;1185	.	ENSP00000340554:Q1139X	Q	-	1	0	TTN	179353148	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.350000	0.59392	2.734000	0.93682	0.655000	0.94253	CAA		0.353	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		7	65	0	0	0	0.001984	0	7	65				
ANKRD44	91526	broad.mit.edu	37	2	197873717	197873717	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:197873717C>G	ENST00000328737.2	-	19	1964	c.1888G>C	c.(1888-1890)Gaa>Caa	p.E630Q	ANKRD44_ENST00000450567.1_Missense_Mutation_p.E630Q|ANKRD44_ENST00000282272.8_Missense_Mutation_p.E647Q|ANKRD44_ENST00000337207.5_Missense_Mutation_p.E630Q			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	655								p.E470Q(1)|p.E630Q(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TCTGCAATTTCTAGCAACAGC	0.438																																							uc002uua.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(1888-1890)GAA>CAA		ankyrin repeat domain 44							117.0	117.0	117.0					2																	197873717		2203	4300	6503	SO:0001583	missense	91526						protein binding	g.chr2:197873717C>G	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1888G>C	2.37:g.197873717C>G	ENSP00000331516:p.Glu630Gln					ANKRD44_uc002utz.3_Missense_Mutation_p.E362Q	p.E630Q	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)		19	1965	-			655			ANK 19.		Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	37	c.1888G>C		.	.	.	.	.	.	.	.	.	.	C	13.59	2.283383	0.40394	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207	T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28	4.69	4.69	0.59074	.	0.120807	0.56097	D	0.000032	T	0.66015	0.2747	N	0.05510	-0.035	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.67883	-0.5555	10	0.27082	T	0.32	.	17.8035	0.88595	0.0:1.0:0.0:0.0	.	673	Q8N8A2-2	.	Q	470;647;630;630;630	ENSP00000403415:E470Q;ENSP00000282272:E647Q;ENSP00000331516:E630Q;ENSP00000402420:E630Q;ENSP00000338794:E630Q	ENSP00000282272:E647Q	E	-	1	0	ANKRD44	197581962	1.000000	0.71417	0.997000	0.53966	0.639000	0.38242	6.911000	0.75746	2.441000	0.82636	0.462000	0.41574	GAA		0.438	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697		5	177	0	0	0	0.001168	0	5	177				
MDH1B	130752	broad.mit.edu	37	2	207621660	207621660	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:207621660C>T	ENST00000374412.3	-	4	650	c.375G>A	c.(373-375)ctG>ctA	p.L125L	MDH1B_ENST00000449792.1_Silent_p.L27L|MDH1B_ENST00000392214.2_Silent_p.L125L|MDH1B_ENST00000454776.2_Silent_p.L125L	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	125					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)	p.L125L(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		TGCAAGTTTTCAGGGCTTCTT	0.433																																					Pancreas(76;29 1355 28675 37177 51207)	Pancreas(76;29 1355 28675 37177 51207)	uc002vbs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|kidney(1)	4						c.(373-375)CTG>CTA		malate dehydrogenase 1B, NAD (soluble)							115.0	105.0	108.0					2																	207621660		2203	4300	6503	SO:0001819	synonymous_variant	130752				carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity	g.chr2:207621660C>T		CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.375G>A	2.37:g.207621660C>T						MDH1B_uc010ziw.1_RNA|MDH1B_uc010fui.2_Silent_p.L125L|MDH1B_uc010fuj.2_Silent_p.L27L|MDH1B_uc002vbt.2_RNA	p.L125L	NM_001039845	NP_001034934	Q5I0G3	MDH1B_HUMAN		LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)	4	430	-			125					A8K8M1|Q53TK9|Q8IV51	Silent	SNP	ENST00000374412.3	37	c.375G>A	CCDS33365.1																																																																																				0.433	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256429.2	NM_001039845		7	47	0	0	0	0.001984	0	7	47				
IKZF2	22807	broad.mit.edu	37	2	213886806	213886806	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:213886806C>T	ENST00000434687.1	-	7	932	c.623G>A	c.(622-624)cGc>cAc	p.R208H	IKZF2_ENST00000421754.2_Missense_Mutation_p.R182H|IKZF2_ENST00000342002.2_Missense_Mutation_p.R214H|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000374327.4_Missense_Mutation_p.R63H|IKZF2_ENST00000457361.1_Missense_Mutation_p.R208H|IKZF2_ENST00000451136.2_Intron|IKZF2_ENST00000374319.4_Missense_Mutation_p.R182H|IKZF2_ENST00000413091.3_Missense_Mutation_p.R208H			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	208					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R208H(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		CAGTGAACTGCGCTGCTTGTA	0.502																																							uc002vem.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(622-624)CGC>CAC		helios isoform 1							148.0	122.0	131.0					2																	213886806		2203	4300	6503	SO:0001583	missense	22807				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr2:213886806C>T	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.623G>A	2.37:g.213886806C>T	ENSP00000412869:p.Arg208His					IKZF2_uc010fuu.2_Missense_Mutation_p.R63H|IKZF2_uc002vej.2_Missense_Mutation_p.R155H|IKZF2_uc002vek.2_RNA|IKZF2_uc010fuv.2_Missense_Mutation_p.R182H|IKZF2_uc002vel.2_Missense_Mutation_p.R129H|IKZF2_uc010fuw.2_5'UTR|IKZF2_uc010fux.2_5'UTR|IKZF2_uc010fuy.2_Intron|IKZF2_uc002ven.2_Missense_Mutation_p.R182H	p.R208H	NM_016260	NP_057344	Q9UKS7	IKZF2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)	6	792	-		Esophageal squamous(248;0.0559)|Renal(323;0.218)	208			C2H2-type 4.		Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	ENST00000434687.1	37	c.623G>A	CCDS2395.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332667	0.81801	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000421754;ENST00000374327;ENST00000413091	T;T;T;T;T;T;T	0.61158	0.13;0.13;0.13;2.39;2.39;0.63;0.13	5.8	4.93	0.64822	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.070766	0.56097	N	0.000026	T	0.75889	0.3911	M	0.78049	2.395	0.80722	D	1	D;D;D;D	0.89917	0.999;0.994;0.991;1.0	D;P;P;D	0.80764	0.994;0.748;0.871;0.991	T	0.79179	-0.1910	10	0.62326	D	0.03	-7.8902	14.8335	0.70166	0.0:0.931:0.0:0.069	.	182;63;182;208	C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7	.;.;.;IKZF2_HUMAN	H	208;214;208;182;182;63;208	ENSP00000410447:R208H;ENSP00000342876:R214H;ENSP00000412869:R208H;ENSP00000363439:R182H;ENSP00000399574:R182H;ENSP00000363447:R63H;ENSP00000402334:R208H	ENSP00000342876:R214H	R	-	2	0	IKZF2	213595051	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.037000	0.70956	1.462000	0.47948	0.650000	0.86243	CGC		0.502	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260		15	74	0	0	0	0.004007	0	15	74				
SPEG	10290	broad.mit.edu	37	2	220355150	220355150	+	Nonsense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:220355150C>T	ENST00000312358.7	+	37	9073	c.8941C>T	c.(8941-8943)Cga>Tga	p.R2981*	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2981	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R2981*(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TGGTGTTGTGCGAGCGTGCCG	0.657																																							uc010fwg.2		NA																	1	Substitution - Nonsense(1)		lung(1)	stomach(9)|ovary(4)|central_nervous_system(1)	14						c.(8941-8943)CGA>TGA		SPEG complex locus							35.0	41.0	39.0					2																	220355150		2121	4215	6336	SO:0001587	stop_gained	10290				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr2:220355150C>T	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.8941C>T	2.37:g.220355150C>T	ENSP00000311684:p.Arg2981*						p.R2981*	NM_005876	NP_005867	Q15772	SPEG_HUMAN		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)	37	8941	+		Renal(207;0.0183)	2981			Protein kinase 2.		A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Nonsense_Mutation	SNP	ENST00000312358.7	37	c.8941C>T	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	51	17.511184	0.99888	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	.	.	.	4.64	3.69	0.42338	.	0.220932	0.21990	N	0.066178	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9989	0.71455	0.152:0.8479:0.0:0.0	.	.	.	.	X	2981	.	ENSP00000265327:R2981X	R	+	1	2	SPEG	220063394	1.000000	0.71417	0.988000	0.46212	0.993000	0.82548	2.287000	0.43505	2.417000	0.82017	0.591000	0.81541	CGA		0.657	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876		5	46	0	0	0	0.014758	0	5	46				
STK11IP	114790	broad.mit.edu	37	2	220480797	220480797	+	Missense_Mutation	SNP	G	G	A	rs531254740		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr2:220480797G>A	ENST00000456909.1	+	25	3239	c.3149G>A	c.(3148-3150)cGt>cAt	p.R1050H	STK11IP_ENST00000295641.10_Missense_Mutation_p.R1061H			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	1061					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)	p.R1061H(1)|p.R1050H(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGCACTCCGTGTGGTGTGT	0.617													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18509	0.0		0.0	False		,,,				2504	0.0						uc002vml.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(3181-3183)CGT>CAT		LKB1 interacting protein							53.0	60.0	58.0					2																	220480797		2106	4226	6332	SO:0001583	missense	114790				protein localization	cytoplasm	protein kinase binding	g.chr2:220480797G>A	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.3149G>A	2.37:g.220480797G>A	ENSP00000389383:p.Arg1050His						p.R1061H	NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	25	3225	+		Renal(207;0.0183)	1061					Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	37	c.3182G>A		.	.	.	.	.	.	.	.	.	.	G	13.13	2.144679	0.37825	.	.	ENSG00000144589	ENST00000456909;ENST00000295641	T;T	0.05786	3.4;3.39	4.51	2.66	0.31614	.	0.158467	0.42548	N	0.000685	T	0.07683	0.0193	M	0.65975	2.015	0.26243	N	0.978839	B	0.26902	0.163	B	0.22880	0.042	T	0.21143	-1.0254	10	0.37606	T	0.19	-4.5153	7.5182	0.27612	0.2014:0.0:0.7986:0.0	.	1061	Q8N1F8	S11IP_HUMAN	H	1050;1061	ENSP00000389383:R1050H;ENSP00000295641:R1061H	ENSP00000295641:R1061H	R	+	2	0	STK11IP	220189041	0.861000	0.29849	0.405000	0.26409	0.878000	0.50629	1.764000	0.38471	0.509000	0.28195	0.655000	0.94253	CGT		0.617	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902		6	28	0	0	0	0.001984	0	6	28				
ZSWIM3	140831	broad.mit.edu	37	20	44506472	44506472	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr20:44506472C>T	ENST00000255152.2	+	2	1484	c.1275C>T	c.(1273-1275)ttC>ttT	p.F425F	ZSWIM3_ENST00000454862.2_Silent_p.F419F	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	425							zinc ion binding (GO:0008270)	p.F425F(1)|p.F425L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				ACATAGACTTCTTTAATACCA	0.498																																							uc002xqd.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		large_intestine(1)|lung(1)	ovary(2)	2						c.(1273-1275)TTC>TTT		zinc finger, SWIM domain containing 3							62.0	58.0	60.0					20																	44506472		2203	4300	6503	SO:0001819	synonymous_variant	140831						zinc ion binding	g.chr20:44506472C>T	AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1275C>T	20.37:g.44506472C>T						ZSWIM3_uc010zxg.1_Silent_p.F419F	p.F425F	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN			2	1478	+		Myeloproliferative disorder(115;0.0122)	425					Q9BR13	Silent	SNP	ENST00000255152.2	37	c.1275C>T	CCDS13381.1																																																																																				0.498	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752		3	61	0	0	0	0.009096	0	3	61				
PREX1	57580	broad.mit.edu	37	20	47269227	47269227	+	Silent	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr20:47269227G>T	ENST00000371941.3	-	21	2386	c.2364C>A	c.(2362-2364)atC>atA	p.I788I	PREX1_ENST00000396220.1_Silent_p.I788I	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	788					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I788I(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGGTGTGGTAGATCCACTGGT	0.642																																							uc002xtw.1		NA																	2	Substitution - coding silent(2)		lung(2)	lung(3)|ovary(2)|pancreas(1)	6						c.(2362-2364)ATC>ATA		phosphatidylinositol-3,4,							62.0	51.0	55.0					20																	47269227		2203	4300	6503	SO:0001819	synonymous_variant	57580				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity	g.chr20:47269227G>T	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2364C>A	20.37:g.47269227G>T						PREX1_uc002xtv.1_Silent_p.I85I	p.I788I	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)		21	2387	-			788					E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	37	c.2364C>A	CCDS13410.1																																																																																				0.642	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820		7	43	1	0	8.12818e-05	0.001984	9.60988e-05	7	43				
CDH4	1002	broad.mit.edu	37	20	60498691	60498691	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr20:60498691C>T	ENST00000360469.5	+	10	1645	c.1557C>T	c.(1555-1557)ggC>ggT	p.G519G	CDH4_ENST00000543233.1_Silent_p.G445G	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	519	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G519G(1)		NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TGGAGGAGGGCGTGCCCCCCG	0.622																																							uc002ybn.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|ovary(2)|skin(1)	6						c.(1555-1557)GGC>GGT		cadherin 4, type 1 preproprotein							68.0	58.0	61.0					20																	60498691		2203	4300	6503	SO:0001819	synonymous_variant	1002				adherens junction organization|cell junction assembly		calcium ion binding	g.chr20:60498691C>T	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1557C>T	20.37:g.60498691C>T						CDH4_uc002ybp.1_Silent_p.G445G	p.G519G	NM_001794	NP_001785	P55283	CADH4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;2.36e-08)		10	1571	+			519			Cadherin 4.|Extracellular (Potential).		B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	ENST00000360469.5	37	c.1557C>T	CCDS13488.1																																																																																				0.622	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794		9	23	0	0	0	0.004482	0	9	23				
PCNT	5116	broad.mit.edu	37	21	47805840	47805840	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr21:47805840G>A	ENST00000359568.5	+	17	3513	c.3406G>A	c.(3406-3408)Gaa>Aaa	p.E1136K	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1136					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.E1136K(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GGAGAACCGGGAAGGCGCAAA	0.597																																							uc002zji.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|breast(2)|pancreas(2)	8						c.(3406-3408)GAA>AAA		pericentrin							144.0	117.0	126.0					21																	47805840		2203	4300	6503	SO:0001583	missense	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47805840G>A	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.3406G>A	21.37:g.47805840G>A	ENSP00000352572:p.Glu1136Lys					PCNT_uc002zjj.2_Missense_Mutation_p.E1018K	p.E1136K	NM_006031	NP_006022	O95613	PCNT_HUMAN			17	3513	+	Breast(49;0.112)		1136			Potential.		O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	c.3406G>A	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.493808	0.64186	.	.	ENSG00000160299	ENST00000359568	T	0.11930	2.73	5.27	5.27	0.74061	.	0.000000	0.33401	N	0.004954	T	0.35158	0.0922	M	0.68952	2.095	0.35215	D	0.775542	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.35101	-0.9802	10	0.44086	T	0.13	.	14.7438	0.69474	0.0:0.0:1.0:0.0	.	1018;1136	O95613-2;O95613	.;PCNT_HUMAN	K	1136	ENSP00000352572:E1136K	ENSP00000352572:E1136K	E	+	1	0	PCNT	46630268	1.000000	0.71417	0.702000	0.30337	0.009000	0.06853	5.640000	0.67875	2.640000	0.89533	0.585000	0.79938	GAA		0.597	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		15	125	0	0	0	0.020292	0	15	125				
CACNA1I	8911	broad.mit.edu	37	22	40015399	40015399	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr22:40015399C>G	ENST00000402142.3	+	4	567	c.567C>G	c.(565-567)atC>atG	p.I189M	CACNA1I_ENST00000407673.1_Missense_Mutation_p.I189M|CACNA1I_ENST00000336649.4_Missense_Mutation_p.I189M|CACNA1I_ENST00000404898.1_Missense_Mutation_p.I189M|CACNA1I_ENST00000400164.3_Missense_Mutation_p.I189M|CACNA1I_ENST00000401624.1_Missense_Mutation_p.I189M	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	189					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.I189M(2)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	TCAAAGCCATCAACCGCGTGC	0.617																																							uc003ayc.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(1)|central_nervous_system(1)	2						c.(565-567)ATC>ATG		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)						97.0	100.0	99.0					22																	40015399		2188	4283	6471	SO:0001583	missense	8911				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding	g.chr22:40015399C>G	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.567C>G	22.37:g.40015399C>G	ENSP00000385019:p.Ile189Met					CACNA1I_uc003ayd.2_Missense_Mutation_p.I189M|CACNA1I_uc003aye.2_Missense_Mutation_p.I104M|CACNA1I_uc003ayf.2_Missense_Mutation_p.I104M	p.I189M	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN			4	567	+	Melanoma(58;0.0749)		189			I.|Helical; Name=S4 of repeat I; (Potential).		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	37	c.567C>G	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	-	23.2	4.383126	0.82792	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.98901	-5.22;-5.22;-5.22;-5.22;-5.22;-5.22	5.11	5.11	0.69529	Ion transport (1);	0.123368	0.52532	D	0.000068	D	0.99242	0.9736	M	0.88241	2.94	0.47994	D	0.999564	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.994;0.995;0.994;0.999	D	0.99305	1.0902	10	0.87932	D	0	.	17.3138	0.87217	0.0:1.0:0.0:0.0	.	189;189;189;189	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	M	189	ENSP00000385019:I189M;ENSP00000384093:I189M;ENSP00000383887:I189M;ENSP00000385680:I189M;ENSP00000337829:I189M;ENSP00000383028:I189M	ENSP00000337829:I189M	I	+	3	3	CACNA1I	38345345	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.806000	0.47947	2.405000	0.81733	0.556000	0.70494	ATC		0.617	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406		15	62	0	0	0	0.00499	0	15	62				
MOV10L1	54456	broad.mit.edu	37	22	50553671	50553671	+	Nonsense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr22:50553671G>T	ENST00000262794.5	+	8	1338	c.1255G>T	c.(1255-1257)Gga>Tga	p.G419*	MOV10L1_ENST00000545383.1_Nonsense_Mutation_p.G419*|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000395858.3_Nonsense_Mutation_p.G419*|MOV10L1_ENST00000540615.1_Nonsense_Mutation_p.G399*	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	419					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.G419*(1)|p.G399*(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CATCTGTGACGGAAAGTAAGG	0.498																																							uc003bjj.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(2)|skin(1)	3						c.(1255-1257)GGA>TGA		MOV10-like 1 isoform 1							93.0	104.0	100.0					22																	50553671		2203	4300	6503	SO:0001587	stop_gained	54456				germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding	g.chr22:50553671G>T	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1255G>T	22.37:g.50553671G>T	ENSP00000262794:p.Gly419*					MOV10L1_uc003bjk.3_Nonsense_Mutation_p.G419*|MOV10L1_uc011arp.1_Nonsense_Mutation_p.G399*|MOV10L1_uc011arq.1_Nonsense_Mutation_p.G180*|MOV10L1_uc010hao.1_RNA	p.G419*	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)	8	1338	+		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)	419					A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Nonsense_Mutation	SNP	ENST00000262794.5	37	c.1255G>T	CCDS14084.1	.	.	.	.	.	.	.	.	.	.	G	37	6.535154	0.97646	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	.	.	.	5.53	5.53	0.82687	.	0.145242	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-20.1123	16.7549	0.85497	0.0:0.0:1.0:0.0	.	.	.	.	X	419;419;419;399	.	ENSP00000262794:G419X	G	+	1	0	MOV10L1	48895798	0.993000	0.37304	0.807000	0.32361	0.005000	0.04900	5.285000	0.65633	2.763000	0.94921	0.563000	0.77884	GGA		0.498	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995		24	133	1	0	2.79863e-10	0.004656	3.41554e-10	24	133				
ELP6	54859	broad.mit.edu	37	3	47545917	47545917	+	Missense_Mutation	SNP	G	G	A	rs373089295		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:47545917G>A	ENST00000296149.4	-	4	396	c.226C>T	c.(226-228)Cgg>Tgg	p.R76W	ELP6_ENST00000446787.1_Missense_Mutation_p.R3W|ELP6_ENST00000439305.1_Missense_Mutation_p.R3W	NM_001031703.2	NP_001026873.2	Q0PNE2	ELP6_HUMAN	elongator acetyltransferase complex subunit 6	76					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Elongator holoenzyme complex (GO:0033588)		p.R76W(1)									CCACGCTCCCGCGCCATGGTC	0.547																																							uc003crk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(226-228)CGG>TGG		transmembrane protein 103		G	TRP/ARG	0,4062		0,0,2031	52.0	57.0	55.0		226	5.1	1.0	3		55	1,8357		0,1,4178	no	missense	C3orf75	NM_001031703.2	101	0,1,6209	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	76/267	47545917	1,12419	2031	4179	6210	SO:0001583	missense	54859							g.chr3:47545917G>A	AK000218	CCDS43082.1	3p21.31	2012-08-14	2012-08-08	2012-08-08	ENSG00000163832	ENSG00000163832		"""Elongator acetyltransferase complex subunits"""	25976	protein-coding gene	gene with protein product		615020	"""transmembrane protein 103"", ""chromosome 3 open reading frame 75"""	TMEM103, C3orf75		22854966	Standard	XM_005265241		Approved	FLJ20211	uc003crk.3	Q0PNE2	OTTHUMG00000133521	ENST00000296149.4:c.226C>T	3.37:g.47545917G>A	ENSP00000296149:p.Arg76Trp					C3orf75_uc003crj.2_Missense_Mutation_p.R3W|C3orf75_uc011bba.1_Missense_Mutation_p.R27W|C3orf75_uc003crl.1_Missense_Mutation_p.R76W	p.R76W	NM_001031703	NP_001026873	Q0PNE2	CC075_HUMAN			4	345	-			76					Q9BW57|Q9NXJ3	Missense_Mutation	SNP	ENST00000296149.4	37	c.226C>T	CCDS43082.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699359	0.68501	0.0	1.2E-4	ENSG00000163832	ENST00000296149;ENST00000450051;ENST00000446787;ENST00000439305;ENST00000412761;ENST00000444760;ENST00000425291;ENST00000449409;ENST00000414236	.	.	.	6.06	5.14	0.70334	.	0.241385	0.41294	D	0.000917	T	0.76004	0.3927	M	0.71581	2.175	0.42748	D	0.993766	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.989;0.975;0.992	T	0.77360	-0.2617	9	0.66056	D	0.02	-17.4056	11.6581	0.51330	0.0:0.0:0.7199:0.2801	.	52;76;76	B4DP60;C9JAS1;Q0PNE2	.;.;CC075_HUMAN	W	76;52;3;3;3;3;3;3;3	.	ENSP00000296149:R76W	R	-	1	2	C3orf75	47520921	1.000000	0.71417	0.971000	0.41717	0.193000	0.23685	4.066000	0.57520	2.882000	0.98803	0.655000	0.94253	CGG		0.547	ELP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257493.1	NM_017713		5	33	0	0	0	0.001168	0	5	33				
TMF1	7110	broad.mit.edu	37	3	69073259	69073259	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:69073259C>T	ENST00000398559.2	-	16	3301	c.3085G>A	c.(3085-3087)Gat>Aat	p.D1029N	CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000599467.1_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.D1032N|TMF1_ENST00000489370.1_5'Flank|CTD-2013N24.2_ENST00000597366.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000601511.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	1029					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)	p.D1029N(1)		cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TCAAGTTCATCATTTTGATTT	0.323																																							uc003dnn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(3085-3087)GAT>AAT		TATA element modulatory factor 1							174.0	160.0	164.0					3																	69073259		1832	4081	5913	SO:0001583	missense	7110				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity	g.chr3:69073259C>T		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.3085G>A	3.37:g.69073259C>T	ENSP00000381567:p.Asp1029Asn					TMF1_uc011bfx.1_Missense_Mutation_p.D1032N	p.D1029N	NM_007114	NP_009045	P82094	TMF1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)	16	3332	-		Lung NSC(201;0.0193)|Prostate(884;0.174)	1029			Potential.		B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	ENST00000398559.2	37	c.3085G>A	CCDS43105.1	.	.	.	.	.	.	.	.	.	.	C	34	5.329046	0.95733	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248	D;D	0.82711	-1.64;-1.64	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.89382	0.6699	L	0.49455	1.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.993	D	0.88879	0.3338	10	0.51188	T	0.08	-24.43	19.6022	0.95568	0.0:1.0:0.0:0.0	.	1032;1029	P82094-2;P82094	.;TMF1_HUMAN	N	1029;1032;945	ENSP00000381567:D1029N;ENSP00000438706:D1032N	ENSP00000348582:D945N	D	-	1	0	TMF1	69155949	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.270000	0.78493	2.620000	0.88729	0.557000	0.71058	GAT		0.323	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114		13	124	0	0	0	0.013537	0	13	124				
PROK2	60675	broad.mit.edu	37	3	71830623	71830623	+	Missense_Mutation	SNP	G	G	A	rs121434272		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:71830623G>A	ENST00000295619.3	-	2	225	c.217C>T	c.(217-219)Cgt>Tgt	p.R73C	PROK2_ENST00000353065.3_Missense_Mutation_p.R73C	NM_001126128.1	NP_001119600.1	Q9HC23	PROK2_HUMAN	prokineticin 2	73			R -> C (in HH4; phenotype consistent with Kallmann syndrome). {ECO:0000269|PubMed:17054399}.		activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of smooth muscle contraction (GO:0045987)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	G-protein coupled receptor binding (GO:0001664)	p.R73C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		CTAACTTTACGAGTCAGTGGA	0.463																																							uc003dpa.3		NA																	1	Substitution - Missense(1)		lung(1)		0	GRCh37	CM065397	PROK2	M	rs121434272	c.(217-219)CGT>TGT		prokineticin 2 isoform a precursor		G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	106.0	100.0	102.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	217,217	5.7	0.6	3	dbSNP_132	102	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	PROK2	NM_001126128.1,NM_021935.3	180,180	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	73/130,73/109	71830623	2,13004	2203	4300	6503	SO:0001583	missense	60675				activation of MAPK activity|angiogenesis|anti-apoptosis|cell proliferation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response|neuropeptide signaling pathway|positive regulation of smooth muscle contraction|sensory perception of pain|spermatogenesis	extracellular region	G-protein-coupled receptor binding	g.chr3:71830623G>A	AF333025	CCDS2916.1, CCDS46868.1	3p21.1	2013-02-28			ENSG00000163421	ENSG00000163421		"""Endogenous ligands"""	18455	protein-coding gene	gene with protein product	"""protein Bv8 homolog"""	607002				11054548, 11259612	Standard	NM_021935		Approved	PK2, BV8, MIT1, KAL4	uc003dpa.4	Q9HC23	OTTHUMG00000158809	ENST00000295619.3:c.217C>T	3.37:g.71830623G>A	ENSP00000295619:p.Arg73Cys					PROK2_uc003doz.3_Missense_Mutation_p.R73C	p.R73C	NM_001126128	NP_001119600	Q9HC23	PROK2_HUMAN		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)	2	371	-		Prostate(10;0.00899)	73		R -> C (in KAL4).			Q53Z79|Q6ISR0	Missense_Mutation	SNP	ENST00000295619.3	37	c.217C>T	CCDS46868.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374465	0.82573	0.0	2.33E-4	ENSG00000163421	ENST00000353065;ENST00000295619	D;D	0.85629	-2.01;-2.01	5.72	5.72	0.89469	Prokineticin domain (2);	0.308106	0.31734	N	0.007160	D	0.90662	0.7071	L	0.51422	1.61	0.54753	A	0.99998	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.926	D	0.91105	0.4917	9	0.87932	D	0	-0.1313	18.6538	0.91441	0.0:0.0:1.0:0.0	.	73;73	Q9HC23;Q6ISR0	PROK2_HUMAN;.	C	73	ENSP00000295618:R73C;ENSP00000295619:R73C	ENSP00000295619:R73C	R	-	1	0	PROK2	71913313	1.000000	0.71417	0.628000	0.29241	0.998000	0.95712	5.872000	0.69636	2.692000	0.91855	0.650000	0.86243	CGT		0.463	PROK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352302.1	NM_001126128		12	135	0	0	0	0.020292	0	12	135				
ROBO2	6092	broad.mit.edu	37	3	77637907	77637907	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:77637907C>T	ENST00000461745.1	+	17	3406	c.2506C>T	c.(2506-2508)Cgc>Tgc	p.R836C	ROBO2_ENST00000332191.8_Missense_Mutation_p.R836C|ROBO2_ENST00000487694.3_Missense_Mutation_p.R852C	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	836	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.R836C(1)|p.R852C(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CATAGGGAGACGCAATGAAGT	0.343																																							uc003dpy.3		NA																	2	Substitution - Missense(2)		lung(2)	lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11						c.(2506-2508)CGC>TGC		roundabout, axon guidance receptor, homolog 2							92.0	83.0	86.0					3																	77637907		1841	4084	5925	SO:0001583	missense	6092				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding	g.chr3:77637907C>T	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2506C>T	3.37:g.77637907C>T	ENSP00000417164:p.Arg836Cys					ROBO2_uc003dpz.2_Missense_Mutation_p.R840C|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.R840C|ROBO2_uc003dqa.2_Translation_Start_Site	p.R836C	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN		Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)	17	3149	+			836			Extracellular (Potential).		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	c.2506C>T	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.266084	0.40095	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	T;T;T	0.62498	0.02;0.05;0.04	5.76	3.95	0.45737	.	0.000000	0.47093	D	0.000256	T	0.66096	0.2755	N	0.22421	0.69	0.35110	D	0.766033	D;D;D	0.89917	0.999;1.0;0.999	P;D;P	0.65874	0.828;0.939;0.818	T	0.73569	-0.3941	9	0.56958	D	0.05	.	15.2124	0.73235	0.2572:0.7428:0.0:0.0	.	852;836;836	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	C	852;852;856;836;836	ENSP00000417335:R852C;ENSP00000417164:R836C;ENSP00000327536:R836C	ENSP00000327536:R836C	R	+	1	0	ROBO2	77720597	1.000000	0.71417	0.998000	0.56505	0.550000	0.35303	3.359000	0.52292	0.761000	0.33130	0.650000	0.86243	CGC		0.343	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		8	32	0	0	0	0.004482	0	8	32				
ROBO1	6091	broad.mit.edu	37	3	78988027	78988027	+	Missense_Mutation	SNP	A	A	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:78988027A>G	ENST00000464233.1	-	4	336	c.223T>C	c.(223-225)Tca>Cca	p.S75P	RN7SL751P_ENST00000473281.2_RNA|ROBO1_ENST00000467549.1_Missense_Mutation_p.S36P|ROBO1_ENST00000436010.2_Missense_Mutation_p.S36P|ROBO1_ENST00000495273.1_Missense_Mutation_p.S36P	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	75	Ig-like C2-type 1.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.S75P(2)|p.S36P(1)|p.S52P(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ATCAGGTCTGAAGGGTGTTCA	0.453																																							uc003dqe.2		NA																	4	Substitution - Missense(4)		lung(4)	large_intestine(2)	2						c.(223-225)TCA>CCA		roundabout 1 isoform a							99.0	94.0	95.0					3																	78988027		1863	4096	5959	SO:0001583	missense	6091				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding	g.chr3:78988027A>G	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.223T>C	3.37:g.78988027A>G	ENSP00000420321:p.Ser75Pro					ROBO1_uc003dqb.2_Missense_Mutation_p.S36P|ROBO1_uc003dqc.2_Missense_Mutation_p.S36P|ROBO1_uc003dqd.2_Missense_Mutation_p.S36P	p.S75P	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)	4	431	-		Lung SC(41;0.0257)|Lung NSC(201;0.0439)	75			Extracellular (Potential).|Ig-like C2-type 1.		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	c.223T>C	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.317106	0.81469	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.53	5.53	0.82687	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.71896	0.3394	L	0.27944	0.81	0.58432	D	0.999998	D;D;D;P	0.89917	1.0;0.999;1.0;0.612	D;D;D;P	0.85130	0.997;0.993;0.996;0.508	T	0.71066	-0.4700	9	.	.	.	.	15.6664	0.77234	1.0:0.0:0.0:0.0	.	75;36;36;36	Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	ROBO1_HUMAN;.;.;.	P	36;36;75;36;36;75	ENSP00000406043:S36P;ENSP00000420321:S75P;ENSP00000420637:S36P;ENSP00000417992:S36P	.	S	-	1	0	ROBO1	79070717	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.307000	0.96226	2.110000	0.64415	0.379000	0.24179	TCA		0.453	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941		17	71	0	0	0	0.006122	0	17	71				
POPDC2	64091	broad.mit.edu	37	3	119367417	119367417	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:119367417G>A	ENST00000264231.3	-	3	865	c.699C>T	c.(697-699)ttC>ttT	p.F233F	POPDC2_ENST00000474523.1_5'UTR|POPDC2_ENST00000538678.1_Silent_p.F233F|POPDC2_ENST00000493094.1_Silent_p.F233F|POPDC2_ENST00000468801.1_Silent_p.F233F	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	233					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)	p.F233F(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		GCAGAGCCGAGAAGAGGCAGG	0.512																																							uc003ecx.1		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(697-699)TTC>TTT		popeye protein 2							65.0	63.0	63.0					3																	119367417		2203	4300	6503	SO:0001819	synonymous_variant	64091					integral to membrane		g.chr3:119367417G>A	AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.699C>T	3.37:g.119367417G>A						POPDC2_uc010hqw.1_Silent_p.F233F|POPDC2_uc003ecy.1_Silent_p.F51F	p.F233F	NM_022135	NP_071418	Q9HBU9	POPD2_HUMAN		GBM - Glioblastoma multiforme(114;0.242)	3	833	-			233					Q86UE7	Silent	SNP	ENST00000264231.3	37	c.699C>T	CCDS2992.1																																																																																				0.512	POPDC2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355378.1	NM_022135		13	65	0	0	0	0.013537	0	13	65				
DHX36	170506	broad.mit.edu	37	3	154027503	154027503	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:154027503C>T	ENST00000496811.1	-	5	832	c.752G>A	c.(751-753)aGa>aAa	p.R251K	DHX36_ENST00000329463.5_Missense_Mutation_p.R251K|DHX36_ENST00000308361.6_Missense_Mutation_p.R251K|DHX36_ENST00000544526.1_Missense_Mutation_p.R251K	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	251	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)	p.R251K(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TCCTTTTCCTCTTTCAATGTA	0.323																																							uc003ezy.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(751-753)AGA>AAA		DEAH (Asp-Glu-Ala-His) box polypeptide 36							90.0	89.0	90.0					3																	154027503		2202	4300	6502	SO:0001583	missense	170506					cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr3:154027503C>T	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.752G>A	3.37:g.154027503C>T	ENSP00000417078:p.Arg251Lys					DHX36_uc010hvq.2_Missense_Mutation_p.R251K|DHX36_uc003ezz.3_Missense_Mutation_p.R251K	p.R251K	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)		5	833	-			251			Helicase ATP-binding.		B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	ENST00000496811.1	37	c.752G>A	CCDS3171.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.806526	0.31961	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.13901	3.07;3.07;3.07;3.07;2.55	5.26	4.39	0.52855	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.052513	0.64402	D	0.000001	T	0.08447	0.0210	N	0.17764	0.52	0.49389	D	0.999787	B;B;B	0.13594	0.006;0.006;0.008	B;B;B	0.19666	0.015;0.015;0.026	T	0.08086	-1.0739	10	0.05351	T	0.99	.	13.7761	0.63055	0.0:0.926:0.0:0.074	.	251;251;251	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	K	251;251;251;251;165	ENSP00000417078:R251K;ENSP00000309296:R251K;ENSP00000444247:R251K;ENSP00000330113:R251K;ENSP00000419862:R165K	ENSP00000309296:R251K	R	-	2	0	DHX36	155510197	1.000000	0.71417	0.991000	0.47740	0.978000	0.69477	5.753000	0.68736	1.218000	0.43458	0.650000	0.86243	AGA		0.323	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	NM_020865		8	48	0	0	0	0.006214	0	8	48				
PSMD2	5708	broad.mit.edu	37	3	184026274	184026274	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:184026274G>A	ENST00000310118.4	+	20	3021	c.2463G>A	c.(2461-2463)ctG>ctA	p.L821L	PSMD2_ENST00000435761.1_Silent_p.L662L|PSMD2_ENST00000439383.1_Silent_p.L691L|EIF2B5_ENST00000444495.1_Intron	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	821					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)	p.L821L(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	TGTATGGGCTGGTGGCTGCCA	0.517											OREG0015948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(24;313 636 6917 9932 15554)	Colon(24;313 636 6917 9932 15554)	uc003fnn.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2461-2463)CTG>CTA		proteasome 26S non-ATPase subunit 2	Bortezomib(DB00188)						148.0	162.0	157.0					3																	184026274		2203	4300	6503	SO:0001819	synonymous_variant	5708				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding	g.chr3:184026274G>A	AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.2463G>A	3.37:g.184026274G>A			OREG0015948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1989	PSMD2_uc011brj.1_Silent_p.L662L|PSMD2_uc011brk.1_Silent_p.L691L	p.L821L	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		20	2496	+	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		821					B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Silent	SNP	ENST00000310118.4	37	c.2463G>A	CCDS3258.1																																																																																				0.517	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345843.1	NM_002808		8	348	0	0	0	0.00308	0	8	348				
EVC	2121	broad.mit.edu	37	4	5800411	5800411	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:5800411G>A	ENST00000264956.6	+	15	2380	c.2196G>A	c.(2194-2196)gtG>gtA	p.V732V	EVC_ENST00000382674.2_Silent_p.V732V|EVC_ENST00000515113.1_3'UTR	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	732					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V732V(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CCCAGGAGGTGGGGCAGCTTC	0.677																																							uc003gil.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(2194-2196)GTG>GTA		Ellis van Creveld syndrome protein							11.0	11.0	11.0					4																	5800411		2168	4251	6419	SO:0001819	synonymous_variant	2121				muscle organ development	integral to membrane		g.chr4:5800411G>A	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2196G>A	4.37:g.5800411G>A						EVC_uc003gim.1_RNA|CRMP1_uc003gin.1_Intron	p.V732V	NM_153717	NP_714928	P57679	EVC_HUMAN			15	2380	+		Myeloproliferative disorder(84;0.117)	732						Silent	SNP	ENST00000264956.6	37	c.2196G>A	CCDS3383.1																																																																																				0.677	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1			3	12	0	0	0	0.004672	0	3	12				
CHRNA9	55584	broad.mit.edu	37	4	40356452	40356452	+	Missense_Mutation	SNP	C	C	T	rs139982841		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:40356452C>T	ENST00000310169.2	+	5	1494	c.1355C>T	c.(1354-1356)gCg>gTg	p.A452V		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	452					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)	p.A452V(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	AAGAAGGTGGCGAAAGTCATA	0.433													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20140	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(115;1297 1602 22235 25158 43327)	Esophageal Squamous(115;1297 1602 22235 25158 43327)	uc003gva.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|skin(3)|central_nervous_system(1)	7						c.(1354-1356)GCG>GTG		cholinergic receptor, nicotinic, alpha 9	Nicotine(DB00184)	C	VAL/ALA	5,4401	9.9+/-24.2	0,5,2198	177.0	154.0	162.0		1355	5.5	0.9	4	dbSNP_134	162	0,8600		0,0,4300	yes	missense	CHRNA9	NM_017581.2	64	0,5,6498	TT,TC,CC		0.0,0.1135,0.0384	probably-damaging	452/480	40356452	5,13001	2203	4300	6503	SO:0001583	missense	55584				elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity	g.chr4:40356452C>T	AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.1355C>T	4.37:g.40356452C>T	ENSP00000312663:p.Ala452Val						p.A452V	NM_017581	NP_060051	Q9UGM1	ACHA9_HUMAN			5	1371	+			452			Cytoplasmic (Potential).		Q14CY7|Q4W5A2|Q9NYV2	Missense_Mutation	SNP	ENST00000310169.2	37	c.1355C>T	CCDS3459.1	.	.	.	.	.	.	.	.	.	.	C	31	5.072219	0.93950	0.001135	0.0	ENSG00000174343	ENST00000310169	D	0.88664	-2.41	5.48	5.48	0.80851	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.097095	0.64402	D	0.000001	D	0.96219	0.8767	H	0.94734	3.575	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	D	0.97056	0.9767	10	0.87932	D	0	.	19.3607	0.94436	0.0:1.0:0.0:0.0	.	452	Q9UGM1	ACHA9_HUMAN	V	452	ENSP00000312663:A452V	ENSP00000312663:A452V	A	+	2	0	CHRNA9	40051209	1.000000	0.71417	0.919000	0.36401	0.861000	0.49209	7.487000	0.81328	2.596000	0.87737	0.555000	0.69702	GCG		0.433	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1			7	100	0	0	0	0.001984	0	7	100				
CENPC	1060	broad.mit.edu	37	4	68380366	68380366	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:68380366C>T	ENST00000273853.6	-	8	1120	c.870G>A	c.(868-870)tcG>tcA	p.S290S		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	290					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)	p.S290S(1)									CGGGAGGACACGAATGAGGTG	0.373																																							uc003hdd.1		NA																	1	Substitution - coding silent(1)		lung(1)	urinary_tract(1)|lung(1)	2						c.(868-870)TCG>TCA		centromere protein C 1							48.0	44.0	45.0					4																	68380366		1914	4132	6046	SO:0001819	synonymous_variant	1060				mitotic prometaphase	condensed chromosome kinetochore|condensed nuclear chromosome, centromeric region|cytosol	DNA binding	g.chr4:68380366C>T	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.870G>A	4.37:g.68380366C>T						CENPC1_uc010ihj.1_RNA|CENPC1_uc010ihk.1_RNA|CENPC1_uc010ihm.1_Silent_p.S290S	p.S290S	NM_001812	NP_001803	Q03188	CENPC_HUMAN			8	1053	-			290					Q8IW27|Q9P0M5	Silent	SNP	ENST00000273853.6	37	c.870G>A	CCDS47063.1																																																																																				0.373	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2			4	15	0	0	0	0.001168	0	4	15				
ARHGAP24	83478	broad.mit.edu	37	4	86916545	86916545	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:86916545G>A	ENST00000395184.1	+	9	2204	c.1738G>A	c.(1738-1740)Gag>Aag	p.E580K	ARHGAP24_ENST00000264343.4_Missense_Mutation_p.E487K|ARHGAP24_ENST00000395183.2_Missense_Mutation_p.E485K	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	580					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)	p.E580K(1)|p.E487K(1)		breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		CACCTGCCCAGAGCAAGACTT	0.547																																							uc003hpk.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(1738-1740)GAG>AAG		Rho GTPase activating protein 24 isoform 1							78.0	79.0	79.0					4																	86916545		2203	4300	6503	SO:0001583	missense	83478				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding	g.chr4:86916545G>A	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.1738G>A	4.37:g.86916545G>A	ENSP00000378611:p.Glu580Lys					ARHGAP24_uc003hpl.2_Missense_Mutation_p.E485K|ARHGAP24_uc010ikf.2_Missense_Mutation_p.E495K|ARHGAP24_uc003hpm.2_Missense_Mutation_p.E487K	p.E580K	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000571)	9	2187	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	580					Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	37	c.1738G>A	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341290	0.81911	.	.	ENSG00000138639	ENST00000395184;ENST00000395183;ENST00000514229;ENST00000264343	T;T;T;T	0.14391	2.86;2.52;2.52;2.51	5.73	5.73	0.89815	.	0.047622	0.85682	D	0.000000	T	0.24470	0.0593	M	0.62723	1.935	0.80722	D	1	P;P;P	0.52463	0.804;0.9;0.953	B;B;P	0.47603	0.386;0.228;0.551	T	0.00485	-1.1711	10	0.31617	T	0.26	.	19.8932	0.96939	0.0:0.0:1.0:0.0	.	485;487;580	Q8N264-3;Q8N264-2;Q8N264	.;.;RHG24_HUMAN	K	580;485;495;487	ENSP00000378611:E580K;ENSP00000378610:E485K;ENSP00000425589:E495K;ENSP00000264343:E487K	ENSP00000264343:E487K	E	+	1	0	ARHGAP24	87135569	1.000000	0.71417	0.799000	0.32177	0.908000	0.53690	9.434000	0.97515	2.710000	0.92621	0.491000	0.48974	GAG		0.547	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305		5	117	0	0	0	0.00308	0	5	117				
SYNPO2	171024	broad.mit.edu	37	4	119951360	119951360	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr4:119951360G>C	ENST00000429713.2	+	4	1612	c.1430G>C	c.(1429-1431)aGa>aCa	p.R477T	SYNPO2_ENST00000307142.4_Missense_Mutation_p.R477T|SYNPO2_ENST00000434046.2_Missense_Mutation_p.R477T|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	477						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.R477T(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AAACTGAACAGAGGGGACAAG	0.473																																							uc003icm.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(1429-1431)AGA>ACA		synaptopodin 2 isoform b							106.0	106.0	106.0					4																	119951360		2203	4300	6503	SO:0001583	missense	171024					nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding	g.chr4:119951360G>C	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.1430G>C	4.37:g.119951360G>C	ENSP00000395143:p.Arg477Thr					SYNPO2_uc010ina.2_Missense_Mutation_p.R477T|SYNPO2_uc010inb.2_Missense_Mutation_p.R477T|SYNPO2_uc011cgh.1_Intron|SYNPO2_uc010inc.2_Missense_Mutation_p.R405T	p.R477T	NM_001128933	NP_001122405	Q9UMS6	SYNP2_HUMAN			4	1626	+			477					B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	c.1430G>C	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.399|2.399	-0.338046|-0.338046	0.05278|0.05278	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142;ENST00000429713;ENST00000434046	.|T;T;T	.|0.08193	.|3.12;3.12;3.12	5.55|5.55	3.77|3.77	0.43336|0.43336	.|.	.|0.360720	.|0.26106	.|N	.|0.026310	T|T	0.06554|0.06554	0.0168|0.0168	L|L	0.36672|0.36672	1.1|1.1	0.32213|0.32213	N|N	0.576258|0.576258	.|P;B;P;P	.|0.35844	.|0.524;0.228;0.524;0.524	.|B;B;B;B	.|0.28849	.|0.095;0.053;0.057;0.084	T|T	0.14420|0.14420	-1.0473|-1.0473	5|10	.|0.34782	.|T	.|0.22	-1.9505|-1.9505	10.3036|10.3036	0.43667|0.43667	0.0705:0.0:0.7936:0.1359|0.0705:0.0:0.7936:0.1359	.|.	.|477;477;477;477	.|B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.|.;.;.;SYNP2_HUMAN	H|T	428|477	.|ENSP00000306015:R477T;ENSP00000395143:R477T;ENSP00000390965:R477T	.|ENSP00000306015:R477T	Q|R	+|+	3|2	2|0	SYNPO2|SYNPO2	120170808|120170808	0.998000|0.998000	0.40836|0.40836	0.007000|0.007000	0.13788|0.13788	0.402000|0.402000	0.30811|0.30811	2.919000|2.919000	0.48836|0.48836	0.655000|0.655000	0.30866|0.30866	0.563000|0.563000	0.77884|0.77884	CAG|AGA		0.473	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1			7	39	0	0	0	0.001984	0	7	39				
CLPTM1L	81037	broad.mit.edu	37	5	1339046	1339046	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:1339046C>T	ENST00000320895.5	-	4	785	c.528G>A	c.(526-528)ctG>ctA	p.L176L	CLPTM1L_ENST00000507807.1_Silent_p.L43L|CLPTM1L_ENST00000320927.6_Silent_p.L176L	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	176					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.L176L(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		CCATCACGTTCAGCGCCAGCC	0.607																																							uc003jch.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|central_nervous_system(1)	2						c.(526-528)CTG>CTA		CLPTM1-like							60.0	57.0	58.0					5																	1339046		2203	4300	6503	SO:0001819	synonymous_variant	81037				apoptosis	integral to membrane		g.chr5:1339046C>T	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.528G>A	5.37:g.1339046C>T						CLPTM1L_uc003jcg.2_Silent_p.L43L	p.L176L	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)	4	574	-	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		176			Extracellular (Potential).		D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Silent	SNP	ENST00000320895.5	37	c.528G>A	CCDS3862.1																																																																																				0.607	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782		10	65	0	0	0	0.010729	0	10	65				
GUSBP1	728411	broad.mit.edu	37	5	21459805	21459805	+	RNA	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:21459805C>T	ENST00000607545.1	+	0	48					NR_027026.1		Q15486	GUSP1_HUMAN	glucuronidase, beta pseudogene 1						carbohydrate metabolic process (GO:0005975)|nervous system development (GO:0007399)|skeletal system development (GO:0001501)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										TCAGACGCATCGGGACCGGAC	0.642											OREG0016459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010iub.2		NA																	0					0						c.(43-45)TCG>TTG		SubName: Full=Putative uncharacterized protein GUSBL2;																																						728411							g.chr5:21459805C>T	BC064850, X75940		5p14.3	2012-10-04			ENSG00000183666	ENSG00000183666			13670	pseudogene	pseudogene						8565635	Standard	NR_027026		Approved		uc010iub.3	Q15486	OTTHUMG00000162474		5.37:g.21459805C>T			OREG0016459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	748	GUSBP1_uc011cnn.1_RNA|GUSBP1_uc003jgh.3_RNA|GUSBP1_uc003jgf.3_Missense_Mutation_p.S15L|GUSBP1_uc003jgg.3_RNA	p.S15L	NR_027028						2	124	+								A6NLY8|A8K1B7|Q969T8|Q9BUH2	Missense_Mutation	SNP	ENST00000607545.1	37	c.44C>T																																																																																					0.642	GUSBP1-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470546.1	NG_008324		10	49	0	0	0	0.010729	0	10	49				
PTGER4	5734	broad.mit.edu	37	5	40692192	40692192	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:40692192G>C	ENST00000302472.3	+	3	2203	c.1179G>C	c.(1177-1179)caG>caC	p.Q393H		NM_000958.2	NP_000949.1	P35408	PE2R4_HUMAN	prostaglandin E receptor 4 (subtype EP4)	393					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|bone development (GO:0060348)|cellular response to mechanical stimulus (GO:0071260)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|JNK cascade (GO:0007254)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of eosinophil extravasation (GO:2000420)|negative regulation of inflammatory response (GO:0050728)|negative regulation of integrin activation (GO:0033624)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|regulation of ossification (GO:0030278)|regulation of stress fiber assembly (GO:0051492)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|T-helper cell differentiation (GO:0042093)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)	p.Q393H(1)		breast(1)|endometrium(3)|liver(1)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23					Dinoprostone(DB00917)|Misoprostol(DB00929)	GTACATCTCAGACCCTCCTGC	0.572																																							uc003jlz.2		NA																	1	Substitution - Missense(1)		lung(1)	lung(2)	2						c.(1177-1179)CAG>CAC		prostaglandin E receptor 4, subtype EP4							65.0	61.0	62.0					5																	40692192		2203	4300	6503	SO:0001583	missense	5734				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity	g.chr5:40692192G>C	L28175	CCDS3930.1	5p13.1	2012-08-08			ENSG00000171522	ENSG00000171522		"""GPCR / Class A : Prostanoid receptors"""	9596	protein-coding gene	gene with protein product		601586				7759114, 8661119	Standard	NM_000958		Approved	EP4	uc003jlz.3	P35408	OTTHUMG00000094769	ENST00000302472.3:c.1179G>C	5.37:g.40692192G>C	ENSP00000302846:p.Gln393His						p.Q393H	NM_000958	NP_000949	P35408	PE2R4_HUMAN			3	1771	+			393			Cytoplasmic (Potential).		Q3MJ87	Missense_Mutation	SNP	ENST00000302472.3	37	c.1179G>C	CCDS3930.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764827	0.49574	.	.	ENSG00000171522	ENST00000302472	T	0.55052	0.54	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.68531	0.3011	M	0.68952	2.095	0.58432	D	0.999993	D	0.89917	1.0	D	0.68192	0.956	T	0.67369	-0.5688	10	0.44086	T	0.13	-16.5917	14.3985	0.67027	0.0725:0.0:0.9275:0.0	.	393	P35408	PE2R4_HUMAN	H	393	ENSP00000302846:Q393H	ENSP00000302846:Q393H	Q	+	3	2	PTGER4	40727949	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.349000	0.59385	2.746000	0.94184	0.655000	0.94253	CAG		0.572	PTGER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211578.2	NM_000958		4	61	0	0	0	0.009096	0	4	61				
DMXL1	1657	broad.mit.edu	37	5	118485852	118485852	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:118485852G>C	ENST00000311085.8	+	18	4410	c.4330G>C	c.(4330-4332)Gat>Cat	p.D1444H	DMXL1_ENST00000539542.1_Missense_Mutation_p.D1444H	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1444								p.D1444H(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AGAAAGTTATGATGAGCTTTT	0.338																																							uc003ksd.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(4330-4332)GAT>CAT		Dmx-like 1							65.0	66.0	65.0					5																	118485852		2202	4300	6502	SO:0001583	missense	1657							g.chr5:118485852G>C	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.4330G>C	5.37:g.118485852G>C	ENSP00000309690:p.Asp1444His					DMXL1_uc010jcl.1_Missense_Mutation_p.D1444H	p.D1444H	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)	18	4511	+		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)	1444						Missense_Mutation	SNP	ENST00000311085.8	37	c.4330G>C	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604636	0.46423	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.12879	2.64;2.64	5.42	4.53	0.55603	.	0.129279	0.64402	D	0.000002	T	0.33030	0.0849	M	0.68593	2.085	0.44880	D	0.997899	D;D	0.58268	0.973;0.982	P;D	0.62955	0.808;0.909	T	0.02444	-1.1158	10	0.72032	D	0.01	-23.4027	15.0687	0.72017	0.0719:0.0:0.9281:0.0	.	1444;1444	F5H269;Q9Y485	.;DMXL1_HUMAN	H	1444	ENSP00000309690:D1444H;ENSP00000439479:D1444H	ENSP00000309690:D1444H	D	+	1	0	DMXL1	118513751	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.132000	0.50523	2.705000	0.92388	0.557000	0.71058	GAT		0.338	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509		21	68	0	0	0	0.012319	0	21	68				
FAM71B	153745	broad.mit.edu	37	5	156589882	156589882	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:156589882G>T	ENST00000302938.4	-	2	1489	c.1394C>A	c.(1393-1395)tCt>tAt	p.S465Y		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	465						nucleus (GO:0005634)		p.S465Y(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCGGTGGGAAGACGCTTTCTG	0.512																																							uc003lwn.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|skin(1)	6						c.(1393-1395)TCT>TAT		family with sequence similarity 71, member B							201.0	189.0	193.0					5																	156589882		2203	4300	6503	SO:0001583	missense	153745					nucleus		g.chr5:156589882G>T		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1394C>A	5.37:g.156589882G>T	ENSP00000305596:p.Ser465Tyr						p.S465Y	NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		2	1494	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	465					Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	c.1394C>A	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692608	0.68271	.	.	ENSG00000170613	ENST00000302938	T	0.19250	2.16	4.64	4.64	0.57946	.	0.000000	0.40222	N	0.001152	T	0.43743	0.1261	M	0.77103	2.36	0.35575	D	0.805813	D	0.67145	0.996	P	0.61328	0.887	T	0.59279	-0.7484	10	0.87932	D	0	-15.593	13.7477	0.62885	0.0:0.0:1.0:0.0	.	465	Q8TC56	FA71B_HUMAN	Y	465	ENSP00000305596:S465Y	ENSP00000305596:S465Y	S	-	2	0	FAM71B	156522460	0.999000	0.42202	0.952000	0.39060	0.043000	0.13939	4.233000	0.58651	2.500000	0.84329	0.655000	0.94253	TCT		0.512	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		29	191	1	0	1.55811e-20	0.008361	1.94336e-20	29	191				
C5orf58	133874	broad.mit.edu	37	5	169661199	169661199	+	Missense_Mutation	SNP	A	A	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:169661199A>C	ENST00000521850.1	+	1	1749	c.60A>C	c.(58-60)ttA>ttC	p.L20F	C5orf58_ENST00000517575.1_Intron|C5orf58_ENST00000593851.1_Missense_Mutation_p.L20F			C9J3I9	CE058_HUMAN	chromosome 5 open reading frame 58	20								p.L20F(1)		large_intestine(1)|lung(4)|urinary_tract(1)	6						GGATTGACTTAAAGGTTAGTT	0.398																																							uc010jjn.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(58-60)TTA>TTC		hypothetical protein LOC133874							125.0	121.0	122.0					5																	169661199		1895	4122	6017	SO:0001583	missense	133874							g.chr5:169661199A>C	BC030767	CCDS47338.1	5q35.1	2009-09-30			ENSG00000234511	ENSG00000234511			37272	protein-coding gene	gene with protein product							Standard	NM_001102609		Approved		uc010jjn.3	C9J3I9	OTTHUMG00000163122	ENST00000521850.1:c.60A>C	5.37:g.169661199A>C	ENSP00000428956:p.Leu20Phe					C5orf58_uc003mal.2_RNA	p.L20F	NM_001102609	NP_001096079	C9J3I9	CE058_HUMAN			2	143	+			20						Missense_Mutation	SNP	ENST00000521850.1	37	c.60A>C	CCDS47338.1	.	.	.	.	.	.	.	.	.	.	A	10.63	1.405264	0.25378	.	.	ENSG00000234511	ENST00000521850	.	.	.	3.63	-4.09	0.03951	.	.	.	.	.	T	0.22898	0.0553	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.25467	-1.0131	8	0.87932	D	0	.	8.4136	0.32657	0.2761:0.6245:0.0994:0.0	.	20	C9J3I9	CE058_HUMAN	F	20	.	ENSP00000428956:L20F	L	+	3	2	C5orf58	169593777	0.340000	0.24792	0.001000	0.08648	0.030000	0.12068	0.066000	0.14489	-0.782000	0.04541	-0.313000	0.08912	TTA		0.398	C5orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371739.1	NM_001102609		24	45	0	0	0	0.021523	0	24	45				
NSD1	64324	broad.mit.edu	37	5	176636857	176636857	+	Missense_Mutation	SNP	C	C	G	rs575992870		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr5:176636857C>G	ENST00000439151.2	+	5	1502	c.1457C>G	c.(1456-1458)tCt>tGt	p.S486C	NSD1_ENST00000354179.4_Missense_Mutation_p.S217C|NSD1_ENST00000347982.4_Missense_Mutation_p.S217C|NSD1_ENST00000361032.4_Missense_Mutation_p.S383C	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	486					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.S486C(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCTGAACATTCTGCAGATGAG	0.408			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		17244	0.0		0.0	False		,,,				2504	0.0						uc003mfr.3		NA		Dom	yes		5	5q35	64324	T	nuclear receptor binding SET domain protein 1	yes	Sotos Syndrome	L	NUP98		AML		2	Substitution - Missense(2)		lung(2)	ovary(2)|kidney(1)	3						c.(1456-1458)TCT>TGT		nuclear receptor binding SET domain protein 1							93.0	92.0	92.0					5																	176636857		2203	4300	6503	SO:0001583	missense	64324	Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding	g.chr5:176636857C>G	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.1457C>G	5.37:g.176636857C>G	ENSP00000395929:p.Ser486Cys	HNSCC(47;0.14)				NSD1_uc003mft.3_Missense_Mutation_p.S217C|NSD1_uc003mfs.1_Missense_Mutation_p.S383C|NSD1_uc011dfx.1_Missense_Mutation_p.S134C	p.S486C	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)	5	1595	+	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	486					Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	c.1457C>G	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819775	0.50633	.	.	ENSG00000165671	ENST00000354179;ENST00000355783;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.94280	-3.29;-3.31;-3.29;-3.39	5.5	4.64	0.57946	.	0.098604	0.45867	D	0.000337	D	0.92815	0.7715	L	0.27053	0.805	0.28491	N	0.914459	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.74348	0.964;0.983;0.962	D	0.87163	0.2216	9	.	.	.	.	9.7452	0.40442	0.0:0.8388:0.0:0.1612	.	217;383;486	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	C	217;217;486;217;383	ENSP00000346111:S217C;ENSP00000395929:S486C;ENSP00000343209:S217C;ENSP00000354310:S383C	.	S	+	2	0	NSD1	176569463	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	1.391000	0.34475	1.324000	0.45282	0.591000	0.81541	TCT		0.408	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349		6	84	0	0	0	0.001984	0	6	84				
HIST1H2BO	8348	broad.mit.edu	37	6	27861501	27861501	+	Silent	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:27861501C>G	ENST00000303806.4	+	1	299	c.261C>G	c.(259-261)cgC>cgG	p.R87R	HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank|HIST1H3J_ENST00000479986.1_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	87					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R87R(1)									ACAACAAGCGCTCGACCATCA	0.627																																							uc003nkc.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(259-261)CGC>CGG		histone cluster 1, H2bo							83.0	82.0	82.0					6																	27861501		2203	4297	6500	SO:0001819	synonymous_variant	8348				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27861501C>G	X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.261C>G	6.37:g.27861501C>G						HIST1H3J_uc003nka.2_5'Flank|HIST1H2AM_uc003nkb.1_5'Flank	p.R87R	NM_003527	NP_003518	P23527	H2B1O_HUMAN			1	299	+			87					Q3KPI7|Q8TCV6	Silent	SNP	ENST00000303806.4	37	c.261C>G	CCDS4640.1																																																																																				0.627	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040161.1	NM_003527		5	117	0	0	0	0.001168	0	5	117				
C2	717	broad.mit.edu	37	6	31901414	31901414	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:31901414C>T	ENST00000299367.5	+	4	746	c.470C>T	c.(469-471)tCa>tTa	p.S157L	C2_ENST00000442278.2_Missense_Mutation_p.S25L|C2_ENST00000452323.2_Missense_Mutation_p.S34L|C2_ENST00000469372.1_5'UTR|CFB_ENST00000477310.1_Intron|CFB_ENST00000456570.1_Missense_Mutation_p.S95L|C2_ENST00000418949.2_Missense_Mutation_p.S157L|CFB_ENST00000556679.1_Missense_Mutation_p.S95L	NM_000063.4	NP_000054.2	P06681	CO2_HUMAN	complement component 2	157	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.S157L(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	27		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		CCAGGCATTTCACTGGGCGCA	0.627																																							uc011dor.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(283-285)TCA>TTA		complement factor B preproprotein							55.0	53.0	54.0					6																	31901414		1509	2709	4218	SO:0001583	missense	629				complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity	g.chr6:31901414C>T		CCDS4728.1, CCDS54991.1, CCDS56416.1, CCDS75427.1, CCDS75428.1	6p21.3	2014-09-17			ENSG00000166278	ENSG00000166278		"""Complement system"""	1248	protein-coding gene	gene with protein product		613927					Standard	NM_001145903		Approved		uc011hbs.1	P06681	OTTHUMG00000031190	ENST00000299367.5:c.470C>T	6.37:g.31901414C>T	ENSP00000299367:p.Ser157Leu					C2_uc003nyc.2_5'UTR|C2_uc011doo.1_5'UTR|C2_uc011dop.1_Missense_Mutation_p.S34L|C2_uc003nye.3_Missense_Mutation_p.S157L|C2_uc003nyf.2_Missense_Mutation_p.S157L|C2_uc010jtk.2_Missense_Mutation_p.S25L|C2_uc011doq.1_Missense_Mutation_p.S128L|C2_uc003nyg.2_Missense_Mutation_p.S25L	p.S95L	NM_001710	NP_001701	P00751	CFAB_HUMAN			3	548	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B4DPF3|B4DV20|E9PFN7|O19694|Q13904	Missense_Mutation	SNP	ENST00000299367.5	37	c.284C>T	CCDS4728.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.09|16.09	3.025247|3.025247	0.54683|0.54683	.|.	.|.	ENSG00000166278|ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000243649;ENSG00000244255	ENST00000383177|ENST00000452323;ENST00000452202;ENST00000299367;ENST00000442278;ENST00000447952;ENST00000418949;ENST00000494905;ENST00000556679;ENST00000456570	.|T;T;T;T;T;T;T;T;T	.|0.66099	.|-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	5.49|5.49	5.49|5.49	0.81192|0.81192	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.000000	.|0.31301	.|N	.|0.007882	T|T	0.54791|0.54791	0.1880|0.1880	N|N	0.12920|0.12920	0.275|0.275	0.09310|0.09310	N|N	1|1	.|B;P;B;P;D;B;D	.|0.89917	.|0.297;0.931;0.192;0.772;0.962;0.421;1.0	.|B;P;B;P;P;P;D	.|0.76575	.|0.142;0.816;0.142;0.685;0.832;0.481;0.988	T|T	0.58387|0.58387	-0.7645|-0.7645	5|10	.|0.87932	.|D	.|0	-0.8761|-0.8761	14.9441|14.9441	0.71016|0.71016	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|95;128;34;25;25;157;157	.|B4E1Z4;B4DV48;B4DPF3;E9PFN7;B4DV20;P06681;Q8N6L6	.|.;.;.;.;.;CO2_HUMAN;.	Y|L	22|34;34;157;25;95;157;16;95;95	.|ENSP00000392322:S34L;ENSP00000406121:S34L;ENSP00000299367:S157L;ENSP00000395683:S25L;ENSP00000391354:S95L;ENSP00000406190:S157L;ENSP00000419048:S16L;ENSP00000451848:S95L;ENSP00000410815:S95L	.|ENSP00000299367:S157L	H|S	+|+	1|2	0|0	C2|CFB;C2;XXbac-BPG116M5.17	32009393|32009393	0.093000|0.093000	0.21703|0.21703	0.006000|0.006000	0.13384|0.13384	0.025000|0.025000	0.11179|0.11179	4.416000|4.416000	0.59815|0.59815	2.595000|2.595000	0.87683|0.87683	0.558000|0.558000	0.71614|0.71614	CAC|TCA		0.627	C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076379.9			12	42	0	0	0	0.020292	0	12	42				
ITPR3	3710	broad.mit.edu	37	6	33655052	33655052	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:33655052C>T	ENST00000374316.5	+	46	7185	c.6125C>T	c.(6124-6126)tCg>tTg	p.S2042L	ITPR3_ENST00000605930.1_Missense_Mutation_p.S2042L			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2042					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.S2042L(2)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CGTGAGAACTCGGAGGTGAGC	0.602																																							uc011drk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						c.(6124-6126)TCG>TTG		inositol 1,4,5-triphosphate receptor, type 3							72.0	62.0	65.0					6																	33655052		2203	4300	6503	SO:0001583	missense	3710				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding	g.chr6:33655052C>T	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6125C>T	6.37:g.33655052C>T	ENSP00000363435:p.Ser2042Leu					ITPR3_uc003oey.2_Missense_Mutation_p.S129L	p.S2042L	NM_002224	NP_002215	Q14573	ITPR3_HUMAN			45	6344	+			2042			Cytoplasmic (Potential).		Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	c.6125C>T	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.267921	0.40095	.	.	ENSG00000096433	ENST00000374316	D	0.92048	-2.96	4.68	4.68	0.58851	.	0.730144	0.13196	N	0.406384	D	0.82554	0.5062	L	0.40543	1.245	0.35758	D	0.819923	B;B	0.28605	0.192;0.217	B;B	0.26517	0.07;0.038	T	0.77691	-0.2493	10	0.29301	T	0.29	-8.9435	13.6761	0.62454	0.0:0.8451:0.1549:0.0	.	2042;1712	Q14573;Q59ES2	ITPR3_HUMAN;.	L	2042	ENSP00000363435:S2042L	ENSP00000363435:S2042L	S	+	2	0	ITPR3	33763030	0.984000	0.35163	0.965000	0.40720	0.760000	0.43138	2.268000	0.43338	2.304000	0.77564	0.561000	0.74099	TCG		0.602	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224		10	21	0	0	0	0.016723	0	10	21				
DNAH8	1769	broad.mit.edu	37	6	38905910	38905910	+	Silent	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:38905910C>G	ENST00000359357.3	+	76	11327	c.11073C>G	c.(11071-11073)ctC>ctG	p.L3691L	DNAH8_ENST00000449981.2_Silent_p.L3908L|DNAH8_ENST00000441566.1_Silent_p.L3655L|RP1-207H1.3_ENST00000416948.1_RNA			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3691					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L3691L(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GAAGCATCCTCTACTTCCTCA	0.522																																							uc003ooe.1		NA																	2	Substitution - coding silent(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(11071-11073)CTC>CTG		dynein, axonemal, heavy polypeptide 8							115.0	96.0	102.0					6																	38905910		2203	4300	6503	SO:0001819	synonymous_variant	1769							g.chr6:38905910C>G	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11073C>G	6.37:g.38905910C>G						DNAH8_uc003oog.1_Silent_p.L140L|uc003oof.1_Intron	p.L3691L	NM_001371	NP_001362					76	11673	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37	c.11073C>G																																																																																					0.522	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		7	54	0	0	0	0.001984	0	7	54				
KIF6	221458	broad.mit.edu	37	6	39581035	39581035	+	Missense_Mutation	SNP	T	T	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:39581035T>A	ENST00000287152.7	-	6	663	c.569A>T	c.(568-570)cAt>cTt	p.H190L	KIF6_ENST00000538893.1_Missense_Mutation_p.H190L|KIF6_ENST00000373213.4_Missense_Mutation_p.H29L|KIF6_ENST00000373215.3_Missense_Mutation_p.H190L|KIF6_ENST00000373216.3_Missense_Mutation_p.H190L	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	190	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H190L(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GGTTGCCTGATGGAGAGTCAA	0.418																																							uc003oot.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)|central_nervous_system(1)	3						c.(568-570)CAT>CTT		kinesin family member 6							117.0	111.0	113.0					6																	39581035		2203	4300	6503	SO:0001583	missense	221458				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding	g.chr6:39581035T>A	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.569A>T	6.37:g.39581035T>A	ENSP00000287152:p.His190Leu					KIF6_uc010jxa.1_5'UTR|KIF6_uc011dua.1_Missense_Mutation_p.H190L|KIF6_uc010jxb.1_Missense_Mutation_p.H190L	p.H190L	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN			6	664	-			190			Kinesin-motor.		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	37	c.569A>T	CCDS4844.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.21|10.21	1.287915|1.287915	0.23478|0.23478	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215;ENST00000538893|ENST00000458470	T;T;T;T;T|.	0.71461|.	-0.57;-0.57;-0.57;-0.57;-0.57|.	5.29|5.29	5.29|5.29	0.74685|0.74685	Kinesin, motor domain (4);|.	.|.	.|.	.|.	.|.	T|T	0.46405|0.46405	0.1391|0.1391	L|L	0.45581|0.45581	1.43|1.43	0.80722|0.80722	D|D	1|1	B;B;B|.	0.19200|.	0.003;0.007;0.034|.	B;B;B|.	0.18561|.	0.009;0.017;0.022|.	T|T	0.47497|0.47497	-0.9113|-0.9113	9|5	0.19147|.	T|.	0.46|.	.|.	10.4516|10.4516	0.44526|0.44526	0.1453:0.0:0.0:0.8547|0.1453:0.0:0.0:0.8547	.|.	190;190;190|.	E7EUN7;F6VGH2;Q6ZMV9|.	.;.;KIF6_HUMAN|.	L|F	190;190;29;190;190|82	ENSP00000287152:H190L;ENSP00000362312:H190L;ENSP00000362309:H29L;ENSP00000362311:H190L;ENSP00000441435:H190L|.	ENSP00000287152:H190L|.	H|I	-|-	2|1	0|0	KIF6|KIF6	39689013|39689013	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.867000|0.867000	0.49689|0.49689	3.867000|3.867000	0.56047|0.56047	2.134000|2.134000	0.65973|0.65973	0.528000|0.528000	0.53228|0.53228	CAT|ATC		0.418	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027		5	72	0	0	0	0.001984	0	5	72				
YIPF3	25844	broad.mit.edu	37	6	43480052	43480052	+	Splice_Site	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:43480052C>T	ENST00000372422.2	-	9	1088	c.906G>A	c.(904-906)ggG>ggA	p.G302G	YIPF3_ENST00000506469.1_Splice_Site_p.G308G|LRRC73_ENST00000372441.1_5'Flank	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	302					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)		p.G302G(1)		large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			TGTCCAGGATCCCTGGAAGGA	0.612																																							uc003ovl.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(904-906)GGG>GGA		natural killer cell-specific antigen KLIP1							64.0	71.0	68.0					6																	43480052		2203	4300	6503	SO:0001630	splice_region_variant	25844				cell differentiation	integral to membrane|plasma membrane|transport vesicle		g.chr6:43480052C>T	AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.905-1G>A	6.37:g.43480052C>T						C6orf154_uc003ovk.1_5'Flank|YIPF3_uc011dvk.1_Silent_p.G267G|YIPF3_uc010jyr.1_Silent_p.G308G|YIPF3_uc010jys.1_Silent_p.G145G|YIPF3_uc003ovm.1_Silent_p.G176G|YIPF3_uc010jyt.1_Silent_p.G213G	p.G302G	NM_015388	NP_056203	Q9GZM5	YIPF3_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)		9	1063	-	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		302					Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Silent	SNP	ENST00000372422.2	37	c.906G>A	CCDS4899.1																																																																																				0.612	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388	Silent	21	63	0	0	0	0.010504	0	21	63				
MTO1	25821	broad.mit.edu	37	6	74189769	74189769	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:74189769C>G	ENST00000370300.4	+	6	1139	c.1049C>G	c.(1048-1050)tCt>tGt	p.S350C	AL603910.1_ENST00000580608.1_RNA|MTO1_ENST00000498286.1_Missense_Mutation_p.S350C|MTO1_ENST00000415954.2_Missense_Mutation_p.S350C|MTO1_ENST00000370305.1_Missense_Mutation_p.S276C	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	350					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)	p.S350C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						CAGGGGTTATCTATGACGCTA	0.428																																							uc003pgy.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|pancreas(1)	6						c.(1048-1050)TCT>TGT		mitochondrial translation optimization 1 homolog							105.0	97.0	100.0					6																	74189769		2203	4300	6503	SO:0001583	missense	25821				tRNA processing	mitochondrion	flavin adenine dinucleotide binding	g.chr6:74189769C>G	AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.1049C>G	6.37:g.74189769C>G	ENSP00000359323:p.Ser350Cys					MTO1_uc010kav.2_Missense_Mutation_p.S350C|MTO1_uc003pgz.3_Missense_Mutation_p.S350C|MTO1_uc003pha.3_Missense_Mutation_p.S12C|MTO1_uc003phb.3_Missense_Mutation_p.S276C|MTO1_uc010kaw.1_RNA	p.S350C	NM_133645	NP_598400	Q9Y2Z2	MTO1_HUMAN			6	1173	+			350					B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Missense_Mutation	SNP	ENST00000370300.4	37	c.1049C>G	CCDS4979.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.511305	0.64522	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000357845;ENST00000370305;ENST00000370300	T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.92548	0.7633	H	0.97103	3.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;1.0	D	0.94599	0.7794	10	0.87932	D	0	-20.1952	16.1022	0.81184	0.0:1.0:0.0:0.0	.	350;253;350;350	Q9Y2Z2-6;Q9Y2Z2-2;Q9Y2Z2-4;Q9Y2Z2	.;.;.;MTO1_HUMAN	C	350;350;253;276;350	ENSP00000402038:S350C;ENSP00000419561:S350C;ENSP00000359328:S276C;ENSP00000359323:S350C	ENSP00000350506:S253C	S	+	2	0	MTO1	74246490	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	6.835000	0.75344	2.556000	0.86216	0.591000	0.81541	TCT		0.428	MTO1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041215.2	NM_012123		10	45	0	0	0	0.006214	0	10	45				
UBE3D	90025	broad.mit.edu	37	6	83767714	83767714	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:83767714C>T	ENST00000369747.3	-	2	227	c.105G>A	c.(103-105)atG>atA	p.M35I		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	35					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)	p.M35I(1)									TGGAAATATTCATGGGCATAC	0.408											OREG0017549	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003pjp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(103-105)ATG>ATA		ubiquitin-conjugating enzyme E2C binding							61.0	58.0	59.0					6																	83767714		2203	4300	6503	SO:0001583	missense	90025					cytoplasm	ligase activity	g.chr6:83767714C>T	AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.105G>A	6.37:g.83767714C>T	ENSP00000358762:p.Met35Ile		OREG0017549	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1224	UBE2CBP_uc011dyx.1_RNA|UBE2CBP_uc003pjr.2_Missense_Mutation_p.M3I	p.M35I	NM_198920	NP_944602	Q7Z6J8	UB2CB_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0944)	2	213	-		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)	35					B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	ENST00000369747.3	37	c.105G>A	CCDS34491.1	.	.	.	.	.	.	.	.	.	.	C	11.42	1.634542	0.29068	.	.	ENSG00000118420	ENST00000369747	T	0.29397	1.57	5.31	4.44	0.53790	.	0.628418	0.17155	N	0.184914	T	0.12689	0.0308	L	0.44542	1.39	0.80722	D	1	B;B	0.14012	0.003;0.009	B;B	0.09377	0.004;0.004	T	0.04053	-1.0981	10	0.30078	T	0.28	-15.9251	11.1838	0.48644	0.0:0.9141:0.0:0.0859	.	35;35	D6RD24;Q7Z6J8	.;UB2CB_HUMAN	I	35	ENSP00000358762:M35I	ENSP00000358762:M35I	M	-	3	0	UBE2CBP	83824433	1.000000	0.71417	0.565000	0.28409	0.019000	0.09904	1.936000	0.40183	1.472000	0.48140	0.650000	0.86243	ATG		0.408	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041347.7	NM_198920		5	40	0	0	0	0.001168	0	5	40				
SNX14	57231	broad.mit.edu	37	6	86248583	86248583	+	Splice_Site	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:86248583C>G	ENST00000314673.3	-	16	1625		c.e16-1		SNX14_ENST00000346348.3_Intron|SNX14_ENST00000508980.1_Intron|SNX14_ENST00000513865.1_Intron|SNX14_ENST00000369627.2_Intron|SNX14_ENST00000505648.1_Splice_Site	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14						protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)	p.?(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TAGGCTACCTCTGCAATAACA	0.299																																							uc003pkr.2		NA																	1	Unknown(1)		lung(1)		0						c.e16-1		sorting nexin 14 isoform a							69.0	68.0	69.0					6																	86248583		2203	4298	6501	SO:0001630	splice_region_variant	57231				cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity	g.chr6:86248583C>G	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.1449-1G>C	6.37:g.86248583C>G						SNX14_uc003pkp.2_Splice_Site_p.R346_splice|SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Splice_Site_p.R431_splice|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	p.R483_splice	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0423)	16	1642	-		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)						B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Splice_Site	SNP	ENST00000314673.3	37	c.1449_splice	CCDS5004.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551594	0.65311	.	.	ENSG00000135317	ENST00000314673;ENST00000505648	.	.	.	5.86	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0779	0.72090	0.1431:0.8569:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SNX14	86305302	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.128000	0.77217	1.462000	0.47948	-0.311000	0.09066	.		0.299	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041393.2	NM_153816	Intron	3	55	0	0	0	0.009096	0	3	55				
SYNCRIP	10492	broad.mit.edu	37	6	86325015	86325015	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:86325015C>G	ENST00000369622.3	-	11	1831	c.1331G>C	c.(1330-1332)aGa>aCa	p.R444T	RP11-321N4.5_ENST00000503906.1_5'Flank|SYNCRIP_ENST00000355238.6_Missense_Mutation_p.R444T	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	444	Interaction with APOBEC1.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R444T(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		CCCTCGACCTCTTGTTGGAGG	0.348																																							uc003pla.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1330-1332)AGA>ACA		synaptotagmin binding, cytoplasmic RNA							22.0	24.0	23.0					6																	86325015		2200	4295	6495	SO:0001583	missense	10492				CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding	g.chr6:86325015C>G	AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.1331G>C	6.37:g.86325015C>G	ENSP00000358635:p.Arg444Thr					SYNCRIP_uc003pku.2_Missense_Mutation_p.R444T|SYNCRIP_uc003pkw.2_Missense_Mutation_p.R409T|SYNCRIP_uc003pky.2_Missense_Mutation_p.R346T|SYNCRIP_uc003pkv.2_Missense_Mutation_p.R444T|SYNCRIP_uc003pkx.2_Missense_Mutation_p.R292T|SYNCRIP_uc003pkz.2_Missense_Mutation_p.R409T	p.R444T	NM_006372	NP_006363	O60506	HNRPQ_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0389)	11	1872	-		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)	444			Interaction with APOBEC1.		E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	ENST00000369622.3	37	c.1331G>C	CCDS5005.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.569640	0.28003	.	.	ENSG00000135316	ENST00000355238;ENST00000369622	T;T	0.30182	1.56;1.54	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.27349	0.0671	M	0.80616	2.505	0.80722	D	1	P;P;P;P;P;P;P	0.46512	0.808;0.879;0.596;0.718;0.879;0.879;0.808	B;B;B;B;B;B;B	0.39660	0.161;0.306;0.099;0.201;0.306;0.306;0.161	T	0.16305	-1.0407	10	0.22706	T	0.39	.	19.5786	0.95455	0.0:1.0:0.0:0.0	.	444;409;346;292;409;444;444	O60506;O60506-2;B7Z645;O60506-5;O60506-4;O60506-3;B2R8Z8	HNRPQ_HUMAN;.;.;.;.;.;.	T	444	ENSP00000347380:R444T;ENSP00000358635:R444T	ENSP00000347380:R444T	R	-	2	0	SYNCRIP	86381734	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.631000	0.89168	0.563000	0.77884	AGA		0.348	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041396.1	NM_006372		7	36	0	0	0	0.006214	0	7	36				
MDN1	23195	broad.mit.edu	37	6	90449994	90449994	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:90449994G>A	ENST00000369393.3	-	32	4667	c.4552C>T	c.(4552-4554)Cta>Tta	p.L1518L	MDN1_ENST00000428876.1_Silent_p.L1518L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1518					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.L1518L(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ATGGTTGCTAGAATACGAAAT	0.413																																							uc003pnn.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(8)|skin(2)	10						c.(4552-4554)CTA>TTA		MDN1, midasin homolog							114.0	111.0	112.0					6																	90449994		2203	4300	6503	SO:0001819	synonymous_variant	23195				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding	g.chr6:90449994G>A	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4552C>T	6.37:g.90449994G>A							p.L1518L	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0193)	32	4668	-		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)	1518					O15019|Q5T794	Silent	SNP	ENST00000369393.3	37	c.4552C>T	CCDS5024.1																																																																																				0.413	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2			5	71	0	0	0	0.001168	0	5	71				
BVES	11149	broad.mit.edu	37	6	105581342	105581342	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:105581342C>G	ENST00000314641.5	-	2	327	c.111G>C	c.(109-111)tgG>tgC	p.W37C	BVES_ENST00000446408.2_Missense_Mutation_p.W37C|BVES-AS1_ENST00000580511.1_RNA|BVES_ENST00000336775.5_Missense_Mutation_p.W37C	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	37					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)	p.W37C(1)		NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				GTATCTCTCTCCAGTTTTCAC	0.393																																							uc003pqw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(109-111)TGG>TGC		blood vessel epicardial substance isoform 5							131.0	128.0	129.0					6																	105581342		2203	4300	6503	SO:0001583	missense	11149				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity	g.chr6:105581342C>G	AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.111G>C	6.37:g.105581342C>G	ENSP00000313172:p.Trp37Cys					BVES_uc003pqx.2_Missense_Mutation_p.W37C|BVES_uc003pqy.2_Missense_Mutation_p.W37C	p.W37C	NM_147147	NP_671488	Q8NE79	POPD1_HUMAN			2	268	-		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)	37			Extracellular (Potential).		A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	ENST00000314641.5	37	c.111G>C	CCDS5051.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999810	0.74818	.	.	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.23348	1.91;1.91;1.91	5.8	5.8	0.92144	.	0.056401	0.85682	D	0.000000	T	0.51041	0.1651	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.55736	-0.8094	10	0.87932	D	0	-10.9612	20.038	0.97570	0.0:1.0:0.0:0.0	.	37	Q8NE79	POPD1_HUMAN	C	37	ENSP00000313172:W37C;ENSP00000337259:W37C;ENSP00000397310:W37C	ENSP00000313172:W37C	W	-	3	0	BVES	105688035	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.544000	0.73878	2.737000	0.93849	0.557000	0.71058	TGG		0.393	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406075.1	NM_147147		10	87	0	0	0	0.006214	0	10	87				
STXBP5	134957	broad.mit.edu	37	6	147703982	147703982	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:147703982G>A	ENST00000321680.6	+	27	3262	c.3262G>A	c.(3262-3264)Gaa>Aaa	p.E1088K	STXBP5_ENST00000367480.3_Missense_Mutation_p.E1035K|STXBP5_ENST00000179882.6_Missense_Mutation_p.E743K|STXBP5_ENST00000367481.3_Missense_Mutation_p.E1052K	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	1088	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)	p.E1052K(1)|p.E1088K(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TGGTGGCATTGAAGGCGTAAA	0.488																																							uc003qlz.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(3262-3264)GAA>AAA		syntaxin binding protein 5 (tomosyn) isoform b							161.0	157.0	158.0					6																	147703982		2203	4300	6503	SO:0001583	missense	134957				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding	g.chr6:147703982G>A	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.3262G>A	6.37:g.147703982G>A	ENSP00000321826:p.Glu1088Lys					STXBP5_uc010khz.1_Missense_Mutation_p.E1052K|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.E743K	p.E1088K	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)	27	3423	+		Ovarian(120;0.0164)	1088			v-SNARE coiled-coil homology.		Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	37	c.3262G>A	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	36	5.666300	0.96745	.	.	ENSG00000164506	ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882	T;T;T;T	0.15718	2.47;2.4;2.59;3.05	5.41	5.41	0.78517	Synaptobrevin (1);	0.000000	0.85682	D	0.000000	T	0.40222	0.1108	M	0.81497	2.545	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.78314	0.991;0.986;0.986	T	0.34527	-0.9825	10	0.72032	D	0.01	.	19.554	0.95333	0.0:0.0:1.0:0.0	.	1052;1088;743	Q5T5C0-2;Q5T5C0;B3KXX0	.;STXB5_HUMAN;.	K	1052;1088;1035;743	ENSP00000356451:E1052K;ENSP00000321826:E1088K;ENSP00000356450:E1035K;ENSP00000179882:E743K	ENSP00000179882:E743K	E	+	1	0	STXBP5	147745675	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	9.813000	0.99286	2.702000	0.92279	0.585000	0.79938	GAA		0.488	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1			23	177	0	0	0	0.021523	0	23	177				
SYNE1	23345	broad.mit.edu	37	6	152746553	152746553	+	Missense_Mutation	SNP	C	C	T	rs540091060		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr6:152746553C>T	ENST00000367255.5	-	39	5831	c.5230G>A	c.(5230-5232)Gag>Aag	p.E1744K	SYNE1_ENST00000423061.1_Missense_Mutation_p.E1751K|SYNE1_ENST00000341594.5_Missense_Mutation_p.E1781K|SYNE1_ENST00000265368.4_Missense_Mutation_p.E1744K|SYNE1_ENST00000448038.1_Missense_Mutation_p.E1751K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1744					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E1744K(4)|p.E1751K(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCCATCTCTCATCCAACTGC	0.318										HNSCC(10;0.0054)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		18696	0.0		0.0	False		,,,				2504	0.0						uc010kiw.2		NA																	6	Substitution - Missense(6)		lung(6)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(5230-5232)GAG>AAG		spectrin repeat containing, nuclear envelope 1							158.0	152.0	154.0					6																	152746553		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152746553C>T	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5230G>A	6.37:g.152746553C>T	ENSP00000356224:p.Glu1744Lys	HNSCC(10;0.0054)				SYNE1_uc003qot.3_Missense_Mutation_p.E1751K|SYNE1_uc003qou.3_Missense_Mutation_p.E1744K|SYNE1_uc010kjb.1_Missense_Mutation_p.E1727K	p.E1744K	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	39	5832	-		Ovarian(120;0.0955)	1744			Spectrin 2.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.5230G>A	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471120	0.43942	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000007	T	0.22126	0.0533	L	0.43923	1.385	0.80722	D	1	D;P;P;B	0.54397	0.966;0.717;0.717;0.274	P;B;B;B	0.46144	0.505;0.227;0.227;0.112	T	0.02275	-1.1184	10	0.11485	T	0.65	.	16.1549	0.81657	0.0:0.8667:0.1333:0.0	.	1727;1744;1744;1751	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	1744;1751;1744;1751;1781	ENSP00000356224:E1744K;ENSP00000396024:E1751K;ENSP00000265368:E1744K;ENSP00000390975:E1751K;ENSP00000341887:E1781K	ENSP00000265368:E1744K	E	-	1	0	SYNE1	152788246	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.453000	0.35167	2.701000	0.92244	0.637000	0.83480	GAG		0.318	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		11	104	0	0	0	0.010729	0	11	104				
ZPBP	11055	broad.mit.edu	37	7	50070765	50070765	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:50070765G>C	ENST00000046087.2	-	5	698	c.629C>G	c.(628-630)tCc>tGc	p.S210C	ZPBP_ENST00000491129.1_Intron|ZPBP_ENST00000419417.1_Missense_Mutation_p.S209C	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	210					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)		p.S210C(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					CTTAAGTAAGGAAATTTCACA	0.333																																							uc003tou.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(628-630)TCC>TGC		zona pellucida binding protein isoform 1							74.0	79.0	77.0					7																	50070765		2203	4299	6502	SO:0001583	missense	11055				binding of sperm to zona pellucida	extracellular region		g.chr7:50070765G>C	D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.629C>G	7.37:g.50070765G>C	ENSP00000046087:p.Ser210Cys					ZPBP_uc011kci.1_Missense_Mutation_p.S136C|ZPBP_uc010kyw.2_Missense_Mutation_p.S209C	p.S210C	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN			5	699	-	Glioma(55;0.08)|all_neural(89;0.245)		210					A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Missense_Mutation	SNP	ENST00000046087.2	37	c.629C>G	CCDS5509.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.171250	0.57584	.	.	ENSG00000042813	ENST00000046087;ENST00000419417	T;T	0.54479	0.57;0.57	5.05	4.16	0.48862	.	0.376464	0.23032	N	0.052734	T	0.61751	0.2372	L	0.57536	1.79	0.36082	D	0.842822	D;D	0.62365	0.991;0.991	P;P	0.57548	0.823;0.823	T	0.68957	-0.5272	9	.	.	.	-5.9916	12.1221	0.53897	0.0821:0.0:0.9179:0.0	.	209;210	C9JPU1;Q9BS86	.;ZPBP1_HUMAN	C	210;209	ENSP00000046087:S210C;ENSP00000402071:S209C	.	S	-	2	0	ZPBP	50041311	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.329000	0.43876	1.246000	0.43901	0.655000	0.94253	TCC		0.333	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251374.1	NM_007009		10	142	0	0	0	0.010729	0	10	142				
PCLO	27445	broad.mit.edu	37	7	82578974	82578974	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:82578974C>T	ENST00000333891.9	-	6	11267	c.10930G>A	c.(10930-10932)Gaa>Aaa	p.E3644K	PCLO_ENST00000437081.1_Missense_Mutation_p.E364K|PCLO_ENST00000423517.2_Missense_Mutation_p.E3644K	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E3644K(2)|p.E3575K(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGGGGTTTTTCATAAGGTACA	0.488																																							uc003uhx.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(7)	7						c.(10930-10932)GAA>AAA		piccolo isoform 1							161.0	157.0	158.0					7																	82578974		1929	4126	6055	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82578974C>T	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10930G>A	7.37:g.82578974C>T	ENSP00000334319:p.Glu3644Lys					PCLO_uc003uhv.2_Missense_Mutation_p.E3644K|PCLO_uc010lec.2_Missense_Mutation_p.E609K	p.E3644K	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			6	11219	-			3575						Missense_Mutation	SNP	ENST00000333891.9	37	c.10930G>A	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.214355	0.79352	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.50548	1.38;0.74	5.7	5.7	0.88788	.	.	.	.	.	T	0.69878	0.3160	M	0.73217	2.22	0.58432	D	0.999997	D;D;D	0.89917	0.988;1.0;1.0	P;D;D	0.74023	0.76;0.982;0.982	T	0.71764	-0.4494	9	0.87932	D	0	.	19.8309	0.96634	0.0:1.0:0.0:0.0	.	3575;3644;3644	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	K	3575;3644;3644;364	ENSP00000334319:E3644K;ENSP00000388393:E3644K	ENSP00000334319:E3644K	E	-	1	0	PCLO	82416910	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.575000	0.82447	2.684000	0.91462	0.650000	0.86243	GAA		0.488	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		20	261	0	0	0	0.010504	0	20	261				
SEMA3A	10371	broad.mit.edu	37	7	83636683	83636683	+	Missense_Mutation	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:83636683G>T	ENST00000265362.4	-	10	1440	c.1126C>A	c.(1126-1128)Cca>Aca	p.P376T	SEMA3A_ENST00000436949.1_Missense_Mutation_p.P376T	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	376	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.P376T(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CCTGGCCGTGGATAGGGGACT	0.418																																							uc003uhz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(1)|kidney(1)	4						c.(1126-1128)CCA>ACA		semaphorin 3A precursor							138.0	127.0	131.0					7																	83636683		2203	4300	6503	SO:0001583	missense	10371				axon guidance	extracellular region|membrane	receptor activity	g.chr7:83636683G>T	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1126C>A	7.37:g.83636683G>T	ENSP00000265362:p.Pro376Thr						p.P376T	NM_006080	NP_006071	Q14563	SEM3A_HUMAN			10	1441	-			376			Sema.			Missense_Mutation	SNP	ENST00000265362.4	37	c.1126C>A	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324903	0.81580	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.19105	2.17;2.17	4.4	4.4	0.53042	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.59169	0.2174	M	0.94142	3.5	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74303	-0.3709	10	0.87932	D	0	.	17.3506	0.87322	0.0:0.0:1.0:0.0	.	376	Q14563	SEM3A_HUMAN	T	376	ENSP00000265362:P376T;ENSP00000415260:P376T	ENSP00000265362:P376T	P	-	1	0	SEMA3A	83474619	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.813000	0.99286	2.154000	0.67381	0.561000	0.74099	CCA		0.418	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080		73	108	1	0	9.35569e-46	0.01441	1.17334e-45	73	108				
AKAP9	10142	broad.mit.edu	37	7	91729097	91729097	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:91729097G>A	ENST00000359028.2	+	44	11047	c.10822G>A	c.(10822-10824)Gaa>Aaa	p.E3608K	AKAP9_ENST00000358100.2_Missense_Mutation_p.E3554K|AKAP9_ENST00000356239.3_Missense_Mutation_p.E3604K			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3608					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.E3604K(1)|p.E3608K(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCAACTGACTGAAGAGAAGAA	0.453			T	BRAF	papillary thyroid																																		uc003ulg.2		NA		Dom	yes		7	7q21-q22	10142	T	A kinase (PRKA) anchor protein (yotiao) 9			E	BRAF		papillary thyroid		2	Substitution - Missense(2)	p.S3604N(1)	lung(2)	breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26						c.(10810-10812)GAA>AAA		A-kinase anchor protein 9 isoform 2							156.0	141.0	146.0					7																	91729097		2203	4300	6503	SO:0001583	missense	10142				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding	g.chr7:91729097G>A	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.10822G>A	7.37:g.91729097G>A	ENSP00000351922:p.Glu3608Lys					AKAP9_uc003ulf.2_Missense_Mutation_p.E3596K|AKAP9_uc003uli.2_Missense_Mutation_p.E3227K|AKAP9_uc003ulj.2_Missense_Mutation_p.E1374K|AKAP9_uc003ull.2_Missense_Mutation_p.E500K	p.E3604K	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		44	11035	+	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		3608			Potential.		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37	c.10810G>A		.	.	.	.	.	.	.	.	.	.	G	16.57	3.159991	0.57368	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.04119	3.79;3.77;3.81;3.7	5.18	5.18	0.71444	.	0.000000	0.38663	N	0.001605	T	0.19087	0.0458	M	0.77616	2.38	0.58432	D	0.999993	P;D;P;D;D	0.59357	0.61;0.985;0.954;0.973;0.973	B;P;P;P;P	0.56612	0.163;0.802;0.476;0.676;0.676	T	0.00303	-1.1833	10	0.49607	T	0.09	.	19.0509	0.93043	0.0:0.0:1.0:0.0	.	879;3608;3608;3604;3596	B3KQF9;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	K	3604;3608;3554;3608;1450	ENSP00000348573:E3604K;ENSP00000351922:E3608K;ENSP00000350813:E3554K;ENSP00000378042:E1450K	ENSP00000348573:E3604K	E	+	1	0	AKAP9	91567033	1.000000	0.71417	0.958000	0.39756	0.995000	0.86356	7.555000	0.82223	2.575000	0.86900	0.591000	0.81541	GAA		0.453	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		17	135	0	0	0	0.004007	0	17	135				
ZKSCAN1	7586	broad.mit.edu	37	7	99621184	99621184	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:99621184G>A	ENST00000324306.6	+	2	289	c.55G>A	c.(55-57)Gag>Aag	p.E19K	ZKSCAN1_ENST00000535170.1_Intron|ZKSCAN1_ENST00000426572.1_5'UTR	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	19					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E19K(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GGCTGCACAGGAGAAGGATGG	0.557																																							uc003usk.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(55-57)GAG>AAG		zinc finger protein 36							92.0	83.0	86.0					7																	99621184		2203	4300	6503	SO:0001583	missense	7586				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:99621184G>A	X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.55G>A	7.37:g.99621184G>A	ENSP00000323148:p.Glu19Lys					ZKSCAN1_uc003usj.2_Missense_Mutation_p.E18K|ZKSCAN1_uc003usl.1_5'UTR|ZKSCAN1_uc003usm.1_Intron	p.E19K	NM_003439	NP_003430	P17029	ZKSC1_HUMAN	STAD - Stomach adenocarcinoma(171;0.129)		2	274	+	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		19					A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	ENST00000324306.6	37	c.55G>A	CCDS34698.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976960	0.74360	.	.	ENSG00000106261	ENST00000324306;ENST00000432317	T;T	0.08370	3.1;3.81	4.63	4.63	0.57726	.	0.121584	0.37178	N	0.002212	T	0.07728	0.0194	L	0.58810	1.83	0.80722	D	1	P	0.37781	0.608	B	0.26864	0.074	T	0.28364	-1.0046	10	0.14656	T	0.56	.	12.8515	0.57860	0.0:0.0:1.0:0.0	.	19	P17029	ZKSC1_HUMAN	K	19	ENSP00000323148:E19K;ENSP00000394445:E19K	ENSP00000323148:E19K	E	+	1	0	ZKSCAN1	99459120	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.045000	0.49838	2.398000	0.81561	0.484000	0.47621	GAG		0.557	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439		7	94	0	0	0	0.004482	0	7	94				
EPHB4	2050	broad.mit.edu	37	7	100405020	100405020	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:100405020C>T	ENST00000358173.3	-	13	2769	c.2301G>A	c.(2299-2301)gaG>gaA	p.E767E	EPHB4_ENST00000360620.3_Silent_p.E767E	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	767	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E767E(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CGGAAGAGTTCTCCTCCAGGA	0.562																																					GBM(200;2113 3072 25865 52728)	GBM(200;2113 3072 25865 52728)	uc003uwn.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15						c.(2299-2301)GAG>GAA		EPH receptor B4 precursor							143.0	116.0	125.0					7																	100405020		2203	4300	6503	SO:0001819	synonymous_variant	2050				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:100405020C>T	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2301G>A	7.37:g.100405020C>T						EPHB4_uc003uwm.1_Silent_p.E674E|EPHB4_uc010lhj.1_Silent_p.E767E	p.E767E	NM_004444	NP_004435	P54760	EPHB4_HUMAN			13	2792	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		767			Cytoplasmic (Potential).|Protein kinase.		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	37	c.2301G>A	CCDS5706.1																																																																																				0.562	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444		5	93	0	0	0	0.001984	0	5	93				
CDHR3	222256	broad.mit.edu	37	7	105662823	105662823	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:105662823G>C	ENST00000317716.9	+	14	2085	c.2005G>C	c.(2005-2007)Gag>Cag	p.E669Q	CDHR3_ENST00000470188.1_Intron|CDHR3_ENST00000343407.5_Intron|CDHR3_ENST00000478080.1_Missense_Mutation_p.E581Q|CDHR3_ENST00000542731.1_Missense_Mutation_p.E669Q	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	669	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E669Q(2)		breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						GGCTCTTGTTGAGACAGGAAC	0.488																																							uc003vdl.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2005-2007)GAG>CAG		hypothetical protein LOC222256 precursor							207.0	197.0	200.0					7																	105662823		1993	4172	6165	SO:0001583	missense	222256				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr7:105662823G>C	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2005G>C	7.37:g.105662823G>C	ENSP00000325954:p.Glu669Gln					CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Missense_Mutation_p.E656Q|CDHR3_uc011klt.1_Missense_Mutation_p.E581Q|CDHR3_uc003vdn.2_Intron	p.E669Q	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN			14	2113	+			669			Cadherin 6.|Extracellular (Potential).		Q8TCI7	Missense_Mutation	SNP	ENST00000317716.9	37	c.2005G>C	CCDS47684.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.942|6.942	0.543676|0.543676	0.13250|0.13250	.|.	.|.	ENSG00000128536|ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080|ENST00000468477	T;T;T|.	0.56444|.	0.53;0.53;0.46|.	5.39|5.39	3.57|3.57	0.40892|0.40892	Cadherin (2);Cadherin-like (1);|.	0.372540|.	0.28409|.	N|.	0.015450|.	T|T	0.60444|0.60444	0.2269|0.2269	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	B;B|.	0.18741|.	0.03;0.03|.	B;B|.	0.17433|.	0.018;0.018|.	T|T	0.55848|0.55848	-0.8076|-0.8076	10|5	0.18276|.	T|.	0.48|.	-11.0294|-11.0294	10.8517|10.8517	0.46773|0.46773	0.0772:0.5511:0.3717:0.0|0.0772:0.5511:0.3717:0.0	.|.	656;669|.	B3KYA0;Q6ZTQ4|.	.;CDHR3_HUMAN|.	Q|F	669;669;581|137	ENSP00000439766:E669Q;ENSP00000325954:E669Q;ENSP00000417771:E581Q|.	ENSP00000325954:E669Q|.	E|L	+|+	1|3	0|2	CDHR3|CDHR3	105450059|105450059	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.601000|0.601000	0.36947|0.36947	0.338000|0.338000	0.19858|0.19858	0.745000|0.745000	0.32763|0.32763	0.655000|0.655000	0.94253|0.94253	GAG|TTG		0.488	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750		4	200	0	0	0	0.009096	0	4	200				
CDHR3	222256	broad.mit.edu	37	7	105664964	105664964	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:105664964C>T	ENST00000317716.9	+	15	2294	c.2214C>T	c.(2212-2214)atC>atT	p.I738I	CDHR3_ENST00000470188.1_3'UTR|CDHR3_ENST00000343407.5_Missense_Mutation_p.P241S|CDHR3_ENST00000478080.1_Silent_p.I650I|CDHR3_ENST00000542731.1_Silent_p.I738I	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	738					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I738I(2)		breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						CCAAAGCCATCCACAGACACT	0.542																																							uc003vdl.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(2212-2214)ATC>ATT		hypothetical protein LOC222256 precursor							119.0	115.0	116.0					7																	105664964		2026	4198	6224	SO:0001819	synonymous_variant	222256				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr7:105664964C>T	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2214C>T	7.37:g.105664964C>T						CDHR3_uc003vdk.2_Missense_Mutation_p.P170S|CDHR3_uc003vdm.3_Silent_p.I725I|CDHR3_uc011klt.1_Silent_p.I650I|CDHR3_uc003vdn.2_Missense_Mutation_p.P239S	p.I738I	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN			15	2322	+			738			Cytoplasmic (Potential).		Q8TCI7	Silent	SNP	ENST00000317716.9	37	c.2214C>T	CCDS47684.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.231267	0.58777	.	.	ENSG00000128536	ENST00000343407;ENST00000466045	T;T	0.78481	-1.18;-0.55	5.83	4.03	0.46877	.	.	.	.	.	T	0.69468	0.3114	.	.	.	0.26818	N	0.968861	B	0.27351	0.176	B	0.23419	0.046	T	0.61936	-0.6960	8	0.62326	D	0.03	-23.9244	10.8978	0.47034	0.0:0.8543:0.0:0.1457	.	239	Q6ZTQ4-2	.	S	241;280	ENSP00000341510:P241S;ENSP00000419017:P280S	ENSP00000341510:P241S	P	+	1	0	CDHR3	105452200	0.807000	0.29009	0.961000	0.40146	0.404000	0.30871	1.313000	0.33585	0.810000	0.34279	0.655000	0.94253	CCA		0.542	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750		7	51	0	0	0	0.00308	0	7	51				
MET	4233	broad.mit.edu	37	7	116412044	116412044	+	Splice_Site	SNP	G	G	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:116412044G>T	ENST00000318493.6	+	14	3269		c.e14+1		MET_ENST00000397752.3_Splice_Site			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase						apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.982_1028del47(4)|p.?(3)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTCCAGAAGGTATATTTCAG	0.343			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														uc003vij.2		NA		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	Mis	met proto-oncogene (hepatocyte growth factor receptor)			E		papillary renal	papillary renal|head-neck squamous cell 		7	Unknown(5)|Deletion - In frame(2)	p.982_1028del47(4)|p.?(2)	lung(5)|stomach(2)	upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159						c.e14+1		met proto-oncogene isoform b precursor							62.0	57.0	59.0					7																	116412044		1829	4071	5900	SO:0001630	splice_region_variant	4233	Hereditary_Papillary_Renal_Carcinoma_(type_1)	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding	g.chr7:116412044G>T	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3082+1G>T	7.37:g.116412044G>T						MET_uc010lkh.2_Splice_Site_p.D1028_splice|MET_uc011knj.1_Splice_Site_p.D580_splice	p.D1010_splice	NM_000245	NP_000236	P08581	MET_HUMAN	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)		14	3215	+	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)						A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Splice_Site	SNP	ENST00000318493.6	37	c.3028_splice	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882481	0.72294	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1169	0.97940	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MET	116199280	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	9.238000	0.95380	2.835000	0.97688	0.591000	0.81541	.		0.343	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		Intron	22	46	1	0	2.27525e-19	0.021523	2.82231e-19	22	46				
CFTR	1080	broad.mit.edu	37	7	117234984	117234984	+	Splice_Site	SNP	G	G	C	rs397508387		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:117234984G>C	ENST00000003084.6	+	15	2623	c.2491G>C	c.(2491-2493)Gag>Cag	p.E831Q	CFTR_ENST00000454343.1_Splice_Site_p.E770Q	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	831					cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)	p.E831Q(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TTTTATTCAGGAGTGCTTTTT	0.313									Cystic Fibrosis																														uc003vjd.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|skin(2)|ovary(1)	5	GRCh37	CM960283	CFTR	M		c.(2491-2493)GAG>CAG		cystic fibrosis transmembrane conductance	Bumetanide(DB00887)|Glibenclamide(DB01016)						117.0	114.0	115.0					7																	117234984		2203	4300	6503	SO:0001630	splice_region_variant	1080	Cystic_Fibrosis	Familial Cancer Database	CF	respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding	g.chr7:117234984G>C	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.2491-1G>C	7.37:g.117234984G>C						CFTR_uc011knq.1_Missense_Mutation_p.E237Q	p.E831Q	NM_000492	NP_000483	P13569	CFTR_HUMAN	STAD - Stomach adenocarcinoma(10;0.000534)		15	2623	+	Lung NSC(10;0.00148)|all_lung(10;0.00171)		831			Cytoplasmic (Potential).		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	c.2491G>C	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408036	0.42715	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.95853	-3.83;-3.83;-3.83	5.34	5.34	0.76211	ABC transporter, transmembrane domain, type 1 (1);	0.203046	0.50627	D	0.000112	D	0.93828	0.8026	L	0.52573	1.65	0.80722	D	1	B	0.16166	0.016	B	0.24974	0.057	D	0.90312	0.4338	9	.	.	.	-9.7956	19.3921	0.94587	0.0:0.0:1.0:0.0	.	831	P13569	CFTR_HUMAN	Q	831;770;801	ENSP00000003084:E831Q;ENSP00000403677:E770Q;ENSP00000389119:E801Q	.	E	+	1	0	CFTR	117022220	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	6.584000	0.74057	2.652000	0.90054	0.591000	0.81541	GAG		0.313	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	Missense_Mutation	6	52	0	0	0	0.004482	0	6	52				
CFTR	1080	broad.mit.edu	37	7	117235031	117235031	+	Nonsense_Mutation	SNP	G	G	A	rs267606722		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:117235031G>A	ENST00000003084.6	+	15	2670	c.2538G>A	c.(2536-2538)tgG>tgA	p.W846*	CFTR_ENST00000454343.1_Nonsense_Mutation_p.W785*	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	846					cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)	p.W846*(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TGACTACATGGAACACATACC	0.358									Cystic Fibrosis																														uc003vjd.2		NA																	1	Substitution - Nonsense(1)		lung(1)	central_nervous_system(2)|skin(2)|ovary(1)	5	GRCh37	CM900059	CFTR	M		c.(2536-2538)TGG>TGA		cystic fibrosis transmembrane conductance	Bumetanide(DB00887)|Glibenclamide(DB01016)						172.0	160.0	164.0					7																	117235031		2203	4300	6503	SO:0001587	stop_gained	1080	Cystic_Fibrosis	Familial Cancer Database	CF	respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding	g.chr7:117235031G>A	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.2538G>A	7.37:g.117235031G>A	ENSP00000003084:p.Trp846*					CFTR_uc011knq.1_Nonsense_Mutation_p.W252*	p.W846*	NM_000492	NP_000483	P13569	CFTR_HUMAN	STAD - Stomach adenocarcinoma(10;0.000534)		15	2670	+	Lung NSC(10;0.00148)|all_lung(10;0.00171)		846			Cytoplasmic (Potential).		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Nonsense_Mutation	SNP	ENST00000003084.6	37	c.2538G>A	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	G	39	7.816633	0.98504	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.081	19.3921	0.94587	0.0:0.0:1.0:0.0	.	.	.	.	X	846;785;816	.	ENSP00000003084:W846X	W	+	3	0	CFTR	117022267	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.970000	0.93415	2.652000	0.90054	0.591000	0.81541	TGG		0.358	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492		6	67	0	0	0	0.001168	0	6	67				
PLXNA4	91584	broad.mit.edu	37	7	131849960	131849960	+	Splice_Site	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:131849960C>T	ENST00000359827.3	-	23	5249		c.e23-1		PLXNA4_ENST00000321063.4_Splice_Site			Q9HCM2	PLXA4_HUMAN	plexin A4						anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.?(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGACTCAGTCCTGTCAGCAGT	0.517																																							uc003vra.3		NA																	2	Unknown(2)		lung(2)	ovary(1)	1						c.e23-1		plexin A4 isoform 1							88.0	96.0	93.0					7																	131849960		2171	4276	6447	SO:0001630	splice_region_variant	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131849960C>T	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4287-1G>A	7.37:g.131849960C>T							p.R1429_splice	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN			23	4516	-								A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Splice_Site	SNP	ENST00000359827.3	37	c.4287_splice	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.238749	0.58995	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.063	0.97692	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLXNA4	131500500	1.000000	0.71417	0.944000	0.38274	0.198000	0.23893	7.818000	0.86416	2.735000	0.93741	0.655000	0.94253	.		0.517	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	Intron	11	110	0	0	0	0.008291	0	11	110				
ZC3HAV1	56829	broad.mit.edu	37	7	138764365	138764365	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:138764365G>A	ENST00000242351.5	-	4	1638	c.1322C>T	c.(1321-1323)tCt>tTt	p.S441F	ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.S441F|ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.S441F	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	441					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.S441F(1)		cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						GGATCTGGTAGAAGTTATATC	0.458																																							uc003vun.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1321-1323)TCT>TTT		zinc finger antiviral protein isoform 1							106.0	107.0	107.0					7																	138764365		2203	4300	6503	SO:0001583	missense	56829				response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding	g.chr7:138764365G>A	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.1322C>T	7.37:g.138764365G>A	ENSP00000242351:p.Ser441Phe					ZC3HAV1_uc003vuo.2_5'Flank|ZC3HAV1_uc003vup.2_Missense_Mutation_p.S441F	p.S441F	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN			4	1710	-			441					A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	37	c.1322C>T	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402009	0.42613	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652;ENST00000540247	T;T;T	0.23147	2.91;3.09;1.92	4.48	3.58	0.41010	.	0.764676	0.11607	N	0.547189	T	0.32763	0.0840	L	0.34521	1.04	0.09310	N	1	D;D	0.65815	0.995;0.978	P;P	0.58172	0.834;0.694	T	0.09773	-1.0659	10	0.41790	T	0.15	.	10.0436	0.42173	0.0:0.0:0.7999:0.2001	.	441;441	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	F	441;441;441;201	ENSP00000242351:S441F;ENSP00000418385:S441F;ENSP00000419855:S441F	ENSP00000242351:S441F	S	-	2	0	ZC3HAV1	138414905	0.010000	0.17322	0.004000	0.12327	0.004000	0.04260	1.470000	0.35354	1.197000	0.43143	0.655000	0.94253	TCT		0.458	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119		8	119	0	0	0	0.004482	0	8	119				
MGAM	8972	broad.mit.edu	37	7	141747587	141747587	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:141747587G>A	ENST00000549489.2	+	22	2596	c.2501G>A	c.(2500-2502)cGa>cAa	p.R834Q	MGAM_ENST00000475668.2_Missense_Mutation_p.R834Q	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	834	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R834Q(6)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCCCACAGTCGAAAGAACCCT	0.413																																							uc003vwy.2		NA																	6	Substitution - Missense(6)		lung(3)|endometrium(3)	ovary(2)	2						c.(2500-2502)CGA>CAA		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						75.0	66.0	69.0					7																	141747587		1902	4145	6047	SO:0001583	missense	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141747587G>A	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2501G>A	7.37:g.141747587G>A	ENSP00000447378:p.Arg834Gln						p.R834Q	NM_004668	NP_004659	O43451	MGA_HUMAN			22	2555	+	Melanoma(164;0.0272)		834			Lumenal (Potential).|Maltase.		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	c.2501G>A	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	37	6.253343	0.97417	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.91180	-2.8	5.37	5.37	0.77165	.	0.169950	0.28252	N	0.016029	D	0.96923	0.8995	H	0.95574	3.69	0.43673	D	0.996101	D	0.89917	1.0	D	0.97110	1.0	D	0.98008	1.0364	10	0.87932	D	0	.	17.8675	0.88800	0.0:0.0:1.0:0.0	.	834	O43451	MGA_HUMAN	Q	834;834;711	ENSP00000447378:R834Q	ENSP00000316431:R711Q	R	+	2	0	MGAM	141394056	1.000000	0.71417	0.404000	0.26397	0.887000	0.51463	8.365000	0.90108	2.528000	0.85240	0.650000	0.86243	CGA		0.413	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			6	56	0	0	0	0.00308	0	6	56				
TRPV5	56302	broad.mit.edu	37	7	142609675	142609675	+	Missense_Mutation	SNP	C	C	A	rs199538456		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:142609675C>A	ENST00000265310.1	-	13	2109	c.1761G>T	c.(1759-1761)caG>caT	p.Q587H		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	587					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.Q587H(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					CATCCCTCTCCTGGGCCACCC	0.502																																							uc003wby.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(1)	6						c.(1759-1761)CAG>CAT		transient receptor potential cation channel,							81.0	79.0	80.0					7																	142609675		2203	4300	6503	SO:0001583	missense	56302				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	g.chr7:142609675C>A	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1761G>T	7.37:g.142609675C>A	ENSP00000265310:p.Gln587His						p.Q587H	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN			13	2025	-	Melanoma(164;0.059)		587			Cytoplasmic (Potential).		A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	ENST00000265310.1	37	c.1761G>T	CCDS5875.1	.	.	.	.	.	.	.	.	.	.	C	5.209	0.224083	0.09863	.	.	ENSG00000127412	ENST00000265310;ENST00000439304	D;D	0.90900	-2.75;-2.75	5.58	-0.0287	0.13921	.	0.246454	0.42548	N	0.000700	T	0.71230	0.3315	N	0.03917	-0.325	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.51957	-0.8639	10	0.17832	T	0.49	-21.156	4.0914	0.09972	0.2362:0.5056:0.1642:0.094	.	587	Q9NQA5	TRPV5_HUMAN	H	587;532	ENSP00000265310:Q587H;ENSP00000406361:Q532H	ENSP00000265310:Q587H	Q	-	3	2	TRPV5	142319797	0.000000	0.05858	0.991000	0.47740	0.992000	0.81027	-1.607000	0.02070	0.027000	0.15297	0.650000	0.86243	CAG		0.502	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		8	98	1	0	3.86212e-05	0.008291	4.61422e-05	8	98				
OR2A25	392138	broad.mit.edu	37	7	143772003	143772003	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:143772003G>A	ENST00000408898.2	+	1	729	c.691G>A	c.(691-693)Gag>Aag	p.E231K		NM_001004488.1	NP_001004488.1	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A, member 25	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E231K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(16)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	24	Melanoma(164;0.0783)					CCAGTCAGGAGAGGGGTGCCA	0.488																																							uc011ktx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(691-693)GAG>AAG		olfactory receptor, family 2, subfamily A,							108.0	115.0	113.0					7																	143772003		2145	4288	6433	SO:0001583	missense	392138				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143772003G>A		CCDS43669.1	7q35	2012-08-09		2004-03-10	ENSG00000221933	ENSG00000221933		"""GPCR / Class A : Olfactory receptors"""	19562	protein-coding gene	gene with protein product				OR2A25P, OR2A27			Standard	NM_001004488		Approved		uc011ktx.2	A4D2G3	OTTHUMG00000158013	ENST00000408898.2:c.691G>A	7.37:g.143772003G>A	ENSP00000386167:p.Glu231Lys						p.E231K	NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN			1	691	+	Melanoma(164;0.0783)		231			Cytoplasmic (Potential).		B2RNC9	Missense_Mutation	SNP	ENST00000408898.2	37	c.691G>A	CCDS43669.1	.	.	.	.	.	.	.	.	.	.	G	4.975	0.181030	0.09443	.	.	ENSG00000221933	ENST00000408898	T	0.00174	8.62	4.69	0.597	0.17504	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	L	0.58510	1.815	0.09310	N	1	B	0.16603	0.018	B	0.21360	0.034	T	0.26538	-1.0100	9	0.54805	T	0.06	-3.2606	6.464	0.21971	0.1712:0.2893:0.5395:0.0	.	231	A4D2G3	O2A25_HUMAN	K	231	ENSP00000386167:E231K	ENSP00000386167:E231K	E	+	1	0	OR2A25	143402936	0.000000	0.05858	0.020000	0.16555	0.002000	0.02628	0.156000	0.16382	0.176000	0.19873	-0.300000	0.09419	GAG		0.488	OR2A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350000.1			33	151	0	0	0	0.009535	0	33	151				
ZNF398	57541	broad.mit.edu	37	7	148863295	148863295	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:148863295G>A	ENST00000475153.1	+	3	733	c.466G>A	c.(466-468)Gag>Aag	p.E156K	ZNF398_ENST00000540950.1_Missense_Mutation_p.E161K|ZNF398_ENST00000426851.2_5'UTR|ZNF398_ENST00000491174.1_5'UTR|ZNF398_ENST00000485111.1_3'UTR|ZNF398_ENST00000420008.2_5'UTR|ZNF398_ENST00000335901.4_5'UTR|ZNF398_ENST00000483892.1_5'UTR			Q8TD17	ZN398_HUMAN	zinc finger protein 398	156	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E156K(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			TTCCACTCCAGAGTGGGAAAA	0.408																																							uc003wfl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(466-468)GAG>AAG		zinc finger 398 isoform a							116.0	115.0	115.0					7																	148863295		2203	4300	6503	SO:0001583	missense	57541				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:148863295G>A	AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.466G>A	7.37:g.148863295G>A	ENSP00000420418:p.Glu156Lys					ZNF398_uc011kul.1_5'UTR|ZNF398_uc011kum.1_Missense_Mutation_p.E161K	p.E156K	NM_170686	NP_733787	Q8TD17	ZN398_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00143)		3	741	+	Melanoma(164;0.15)		156			KRAB.		A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Missense_Mutation	SNP	ENST00000475153.1	37	c.466G>A	CCDS5894.1	.	.	.	.	.	.	.	.	.	.	G	32	5.127844	0.94473	.	.	ENSG00000197024	ENST00000475153;ENST00000540950	T;T	0.12255	2.7;2.7	5.24	5.24	0.73138	Krueppel-associated box (4);	0.000000	0.43416	D	0.000572	T	0.54078	0.1836	H	0.97214	3.96	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.83275	0.992;0.996	T	0.71919	-0.4447	10	0.87932	D	0	-21.0208	16.328	0.82994	0.0:0.0:1.0:0.0	.	161;156	B4DXA9;Q8TD17	.;ZN398_HUMAN	K	156;161	ENSP00000420418:E156K;ENSP00000439340:E161K	ENSP00000420418:E156K	E	+	1	0	ZNF398	148494228	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.779000	0.68948	2.444000	0.82710	0.563000	0.77884	GAG		0.408	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352722.2			32	89	0	0	0	0.009535	0	32	89				
ZNF398	57541	broad.mit.edu	37	7	148876534	148876534	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr7:148876534G>C	ENST00000475153.1	+	6	1837	c.1570G>C	c.(1570-1572)Gag>Cag	p.E524Q	ZNF398_ENST00000540950.1_Missense_Mutation_p.E529Q|ZNF398_ENST00000426851.2_Missense_Mutation_p.E353Q|ZNF398_ENST00000491174.1_Missense_Mutation_p.E353Q|ZNF398_ENST00000420008.2_Missense_Mutation_p.E353Q|ZNF398_ENST00000335901.4_Missense_Mutation_p.E353Q|ZNF398_ENST00000483892.1_Missense_Mutation_p.E353Q			Q8TD17	ZN398_HUMAN	zinc finger protein 398	524					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E524Q(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			CATGCGCAAGGAGCACCTGCT	0.592																																							uc003wfl.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1570-1572)GAG>CAG		zinc finger 398 isoform a							73.0	63.0	66.0					7																	148876534		2203	4300	6503	SO:0001583	missense	57541				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:148876534G>C	AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.1570G>C	7.37:g.148876534G>C	ENSP00000420418:p.Glu524Gln					ZNF398_uc011kul.1_Missense_Mutation_p.E353Q|ZNF398_uc011kum.1_Missense_Mutation_p.E529Q	p.E524Q	NM_170686	NP_733787	Q8TD17	ZN398_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00143)		6	1845	+	Melanoma(164;0.15)		524			C2H2-type 7.		A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Missense_Mutation	SNP	ENST00000475153.1	37	c.1570G>C	CCDS5894.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102505	0.56183	.	.	ENSG00000197024	ENST00000426851;ENST00000420008;ENST00000475153;ENST00000483892;ENST00000491174;ENST00000540950;ENST00000335901	T;T;T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46;2.46;2.46	5.26	5.26	0.73747	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000091	T	0.17195	0.0413	N	0.16307	0.4	0.25394	N	0.988501	D;B	0.54601	0.967;0.369	P;B	0.52823	0.71;0.139	T	0.06516	-1.0822	10	0.66056	D	0.02	-25.0797	9.901	0.41348	0.0923:0.0:0.9077:0.0	.	529;524	B4DXA9;Q8TD17	.;ZN398_HUMAN	Q	353;353;524;353;353;529;353	ENSP00000389972:E353Q;ENSP00000416751:E353Q;ENSP00000420418:E524Q;ENSP00000418564:E353Q;ENSP00000419391:E353Q;ENSP00000439340:E529Q;ENSP00000338984:E353Q	ENSP00000338984:E353Q	E	+	1	0	ZNF398	148507467	0.000000	0.05858	1.000000	0.80357	0.993000	0.82548	0.081000	0.14823	2.458000	0.83093	0.655000	0.94253	GAG		0.592	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352722.2			4	68	0	0	0	0.009096	0	4	68				
KAT6A	7994	broad.mit.edu	37	8	41791408	41791408	+	Nonsense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:41791408G>A	ENST00000396930.3	-	18	4873	c.4330C>T	c.(4330-4332)Cag>Tag	p.Q1444*	KAT6A_ENST00000406337.1_Nonsense_Mutation_p.Q1444*|KAT6A_ENST00000265713.2_Nonsense_Mutation_p.Q1444*	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1444					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Q1444*(1)									TCACAGTCCTGGTAGGCGCCC	0.532																																							uc010lxb.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(4330-4332)CAG>TAG		MYST histone acetyltransferase (monocytic							120.0	111.0	114.0					8																	41791408		2203	4300	6503	SO:0001587	stop_gained	7994				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr8:41791408G>A	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.4330C>T	8.37:g.41791408G>A	ENSP00000380136:p.Gln1444*					MYST3_uc010lxc.2_Nonsense_Mutation_p.Q1444*|MYST3_uc003xon.3_Nonsense_Mutation_p.Q1444*	p.Q1444*	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)		18	4874	-	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	1444					Q76L81	Nonsense_Mutation	SNP	ENST00000396930.3	37	c.4330C>T	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	G	46	12.296128	0.99654	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	.	.	.	5.96	5.96	0.96718	.	0.152885	0.47093	D	0.000258	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-17.5095	15.8381	0.78814	0.0:0.135:0.865:0.0	.	.	.	.	X	1444	.	ENSP00000265713:Q1444X	Q	-	1	0	KAT6A	41910565	1.000000	0.71417	1.000000	0.80357	0.577000	0.36160	7.279000	0.78599	2.823000	0.97156	0.650000	0.86243	CAG		0.532	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766		8	117	0	0	0	0.006214	0	8	117				
IKBKB	3551	broad.mit.edu	37	8	42163879	42163879	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:42163879G>C	ENST00000520810.1	+	7	682	c.496G>C	c.(496-498)Gac>Cac	p.D166H	IKBKB_ENST00000520835.1_Missense_Mutation_p.D164H|IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000379708.3_Intron|IKBKB_ENST00000416505.2_Missense_Mutation_p.D107H|IKBKB_ENST00000519735.1_Missense_Mutation_p.D166H	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	166	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)	p.D166H(1)		breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CAAAATTATTGACCTAGGATA	0.463																																							uc003xow.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(2)|lung(1)|skin(1)	7						c.(496-498)GAC>CAC		inhibitor of nuclear factor kappa B kinase beta	Arsenic trioxide(DB01169)|Auranofin(DB00995)						103.0	95.0	98.0					8																	42163879		2203	4300	6503	SO:0001583	missense	3551				anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity	g.chr8:42163879G>C	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.496G>C	8.37:g.42163879G>C	ENSP00000430684:p.Asp166His					IKBKB_uc003xov.2_Missense_Mutation_p.D166H|IKBKB_uc010lxh.1_Missense_Mutation_p.D61H|IKBKB_uc011lco.1_RNA|IKBKB_uc010lxj.1_Intron|IKBKB_uc003xox.1_5'UTR|IKBKB_uc011lcp.1_RNA|IKBKB_uc011lcq.1_Missense_Mutation_p.D164H|IKBKB_uc010lxi.1_RNA|IKBKB_uc011lcr.1_Missense_Mutation_p.D107H	p.D166H	NM_001556	NP_001547	O14920	IKKB_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		7	673	+	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	166			Protein kinase.		B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	37	c.496G>C	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025898	0.93518	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000519735;ENST00000520835	D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16	5.12	5.12	0.69794	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98261	0.9424	H	0.98682	4.3	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.934;0.999;0.998;0.999;0.999	D	0.99723	1.1010	10	0.87932	D	0	-36.5057	18.9321	0.92570	0.0:0.0:1.0:0.0	.	107;164;117;166;166	B4E0U4;O14920-2;Q59GL9;O14920;Q32ND9	.;.;.;IKKB_HUMAN;.	H	166;107;166;164	ENSP00000430684:D166H;ENSP00000404920:D107H;ENSP00000430483:D166H;ENSP00000430868:D164H	ENSP00000404920:D107H	D	+	1	0	IKBKB	42283036	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.809000	0.99208	2.535000	0.85469	0.655000	0.94253	GAC		0.463	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1			4	47	0	0	0	0.009096	0	4	47				
FAM110B	90362	broad.mit.edu	37	8	59058927	59058927	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:59058927G>A	ENST00000361488.3	+	5	1018	c.138G>A	c.(136-138)aaG>aaA	p.K46K	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	46						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.K46K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				CCAACCCCAAGAGGCTCAGCG	0.672																																							uc003xtj.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(136-138)AAG>AAA		hypothetical protein LOC90362							34.0	37.0	36.0					8																	59058927		2203	4300	6503	SO:0001819	synonymous_variant	90362					microtubule organizing center|mitochondrion|nucleus		g.chr8:59058927G>A	U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.138G>A	8.37:g.59058927G>A							p.K46K	NM_147189	NP_671722	Q8TC76	F110B_HUMAN			5	1018	+		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)	46					Q5BM08|Q9Y4K2	Silent	SNP	ENST00000361488.3	37	c.138G>A	CCDS6170.1																																																																																				0.672	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378095.2	NM_147189		3	31	0	0	0	0.004672	0	3	31				
CHD7	55636	broad.mit.edu	37	8	61754493	61754493	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:61754493G>A	ENST00000423902.2	+	21	5211	c.4732G>A	c.(4732-4734)Gac>Aac	p.D1578N	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1578					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.D1578N(2)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGAGTTCTCAGACTTGGAAAG	0.463																																							uc003xue.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9						c.(4732-4734)GAC>AAC		chromodomain helicase DNA binding protein 7							73.0	72.0	72.0					8																	61754493		1928	4137	6065	SO:0001583	missense	55636				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	g.chr8:61754493G>A	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.4732G>A	8.37:g.61754493G>A	ENSP00000392028:p.Asp1578Asn						p.D1578N	NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.143)		21	5209	+		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	1578					D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	c.4732G>A	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	G	36	5.688247	0.96784	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.83837	-1.77	5.63	5.63	0.86233	.	0.057903	0.64402	D	0.000002	D	0.87845	0.6280	M	0.63843	1.955	0.80722	D	1	P	0.46656	0.882	P	0.52267	0.694	D	0.88178	0.2869	10	0.72032	D	0.01	-26.6288	20.054	0.97641	0.0:0.0:1.0:0.0	.	1578	Q9P2D1	CHD7_HUMAN	N	1578	ENSP00000392028:D1578N	ENSP00000307304:D1578N	D	+	1	0	CHD7	61917047	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.808000	0.96608	0.655000	0.94253	GAC		0.463	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762		4	23	0	0	0	0.009096	0	4	23				
ZFHX4	79776	broad.mit.edu	37	8	77616334	77616334	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:77616334G>A	ENST00000521891.2	+	2	459	c.11G>A	c.(10-12)tGt>tAt	p.C4Y	ZFHX4_ENST00000455469.2_Missense_Mutation_p.C4Y|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.C4Y|ZFHX4_ENST00000518282.1_Missense_Mutation_p.C4Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.C4Y(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATGGAAACCTGTGACTCCCCT	0.443										HNSCC(33;0.089)																													uc003yav.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(10-12)TGT>TAT		zinc finger homeodomain 4							41.0	40.0	40.0					8																	77616334		1950	4166	6116	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77616334G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.11G>A	8.37:g.77616334G>A	ENSP00000430497:p.Cys4Tyr	HNSCC(33;0.089)				ZFHX4_uc003yat.1_Missense_Mutation_p.C4Y|ZFHX4_uc003yau.1_Missense_Mutation_p.C4Y|ZFHX4_uc003yaw.1_Missense_Mutation_p.C4Y	p.C4Y	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		2	398	+			4					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.11G>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	14.46	2.542785	0.45280	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000520307;ENST00000523885;ENST00000517585;ENST00000523809;ENST00000518282	T;T;T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47;1.47;1.47	5.55	5.55	0.83447	.	0.000000	0.47455	U	0.000236	T	0.45296	0.1335	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.76494	0.996;0.998;0.998;0.999	P;D;D;D	0.83275	0.853;0.93;0.93;0.996	T	0.44159	-0.9346	10	0.87932	D	0	.	19.7069	0.96076	0.0:0.0:1.0:0.0	.	4;4;4;4	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	Y	4	ENSP00000430497:C4Y;ENSP00000399605:C4Y;ENSP00000050961:C4Y;ENSP00000428525:C4Y;ENSP00000429495:C4Y;ENSP00000427775:C4Y;ENSP00000427739:C4Y;ENSP00000430848:C4Y	ENSP00000050961:C4Y	C	+	2	0	ZFHX4	77778889	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.733000	0.84916	2.894000	0.99253	0.591000	0.81541	TGT		0.443	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		4	25	0	0	0	0.009096	0	4	25				
REXO1L1P	254958	broad.mit.edu	37	8	86567327	86567327	+	IGR	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:86567327G>A	ENST00000379010.2	-	0	7032					NM_172239.4	NP_758439.4														endometrium(1)|lung(4)	5						CGTCCACCACGGTGACGCGGG	0.577																																							uc003ydl.1		NA																	0					NA						c.(490-492)ACC>ACT		exonuclease GOR																																				SO:0001628	intergenic_variant	0							g.chr8:86567327G>A																													8.37:g.86567327G>A							p.T164T	NM_172239	NP_758439					1	579	-									Silent	SNP	ENST00000379010.2	37	c.492C>T																																																																																					0.577	REXO1L1-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000381106.1			13	127	0	0	0	0.013537	0	13	127				
VPS13B	157680	broad.mit.edu	37	8	100026130	100026130	+	Missense_Mutation	SNP	C	C	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr8:100026130C>A	ENST00000358544.2	+	2	225	c.114C>A	c.(112-114)agC>agA	p.S38R	VPS13B_ENST00000395996.1_Missense_Mutation_p.S38R|VPS13B_ENST00000441350.2_Missense_Mutation_p.S38R|VPS13B_ENST00000355155.1_Missense_Mutation_p.S38R|VPS13B_ENST00000357162.2_Missense_Mutation_p.S38R|RP11-410L14.2_ENST00000521696.1_lincRNA	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	38					protein transport (GO:0015031)			p.S38R(2)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGGTACTCAGCAAGCTCGAGT	0.408																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(112-114)AGC>AGA		vacuolar protein sorting 13B isoform 5							211.0	195.0	201.0					8																	100026130		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100026130C>A	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.114C>A	8.37:g.100026130C>A	ENSP00000351346:p.Ser38Arg					VPS13B_uc003yiw.2_Missense_Mutation_p.S38R|VPS13B_uc003yit.2_Missense_Mutation_p.S38R|VPS13B_uc003yiu.1_Missense_Mutation_p.S38R|VPS13B_uc003yis.2_Missense_Mutation_p.S38R|VPS13B_uc011lgy.1_5'UTR	p.S38R	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		2	225	+	Breast(36;3.73e-07)		38					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.114C>A	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845305	0.51164	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350	D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.70911	0.3278	N	0.02192	-0.645	0.52099	D	0.99994	D;D;P;D;B	0.76494	0.999;0.999;0.835;0.98;0.057	D;D;B;P;B	0.80764	0.994;0.984;0.212;0.78;0.113	T	0.67875	-0.5557	10	0.06625	T	0.88	.	12.0332	0.53410	0.0:0.9101:0.0:0.0899	.	38;38;38;38;38	Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4;Q7Z7G8-5	.;VP13B_HUMAN;.;.;.	R	38	ENSP00000347281:S38R;ENSP00000349685:S38R;ENSP00000351346:S38R;ENSP00000379318:S38R;ENSP00000398472:S38R	ENSP00000347281:S38R	S	+	3	2	VPS13B	100095306	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.060000	0.49955	2.507000	0.84556	0.557000	0.71058	AGC		0.408	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		30	138	1	0	9.65021e-13	0.010818	1.18411e-12	30	138				
FREM1	158326	broad.mit.edu	37	9	14819377	14819377	+	Silent	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:14819377G>A	ENST00000380880.3	-	14	3184	c.2401C>T	c.(2401-2403)Cta>Tta	p.L801L	FREM1_ENST00000422223.2_Silent_p.L801L|FREM1_ENST00000380881.4_Silent_p.L802L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	801					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.L802L(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TCAGAAATTAGAATGTGCTCT	0.463																																							uc003zlm.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(2)|pancreas(1)	5						c.(2401-2403)CTA>TTA		FRAS1 related extracellular matrix 1 precursor							115.0	109.0	111.0					9																	14819377		1949	4144	6093	SO:0001819	synonymous_variant	158326				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding	g.chr9:14819377G>A	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2401C>T	9.37:g.14819377G>A						FREM1_uc010mic.2_RNA	p.L801L	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN		GBM - Glioblastoma multiforme(50;3.53e-06)	14	2991	-			801			CSPG 5.		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	c.2401C>T	CCDS47952.1																																																																																				0.463	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		3	46	0	0	0	0.009096	0	3	46				
ADAMTSL1	92949	broad.mit.edu	37	9	18777140	18777140	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:18777140C>T	ENST00000380548.4	+	19	3252	c.2913C>T	c.(2911-2913)ccC>ccT	p.P971P		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	971						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P971P(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		TGGCCCGGCCCTTGAGCCCGA	0.647																																							uc003zne.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5						c.(2911-2913)CCC>CCT		ADAMTS-like 1 isoform 4 precursor							31.0	35.0	34.0					9																	18777140		1892	4096	5988	SO:0001819	synonymous_variant	92949					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding	g.chr9:18777140C>T	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2913C>T	9.37:g.18777140C>T							p.P971P	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN		GBM - Glioblastoma multiforme(50;1.29e-17)	19	3040	+			971					A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	ENST00000380548.4	37	c.2913C>T	CCDS47954.1																																																																																				0.647	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			10	52	0	0	0	0.010729	0	10	52				
IFNA2	3440	broad.mit.edu	37	9	21384775	21384775	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:21384775C>T	ENST00000380206.2	-	1	621	c.554G>A	c.(553-555)aGa>aAa	p.R185K		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	185					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)	p.R185K(1)		breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		TTCCTTACTTCTTAAACTTTC	0.368																																							uc003zpb.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(553-555)AGA>AAA		interferon, alpha 2 precursor	Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)						132.0	133.0	133.0					9																	21384775		2203	4300	6503	SO:0001583	missense	3440				blood coagulation|cell-cell signaling|induction of apoptosis|inflammatory response|negative regulation of interleukin-13 secretion|negative regulation of interleukin-5 secretion|negative regulation of T cell differentiation|negative regulation of T-helper 2 cell cytokine production|negative regulation of transcription, DNA-dependent|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding	g.chr9:21384775C>T		CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.554G>A	9.37:g.21384775C>T	ENSP00000369554:p.Arg185Lys						p.R185K	NM_000605	NP_000596	P01563	IFNA2_HUMAN		Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)	1	622	-			185					H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Missense_Mutation	SNP	ENST00000380206.2	37	c.554G>A	CCDS6506.1	.	.	.	.	.	.	.	.	.	.	C	9.692	1.152139	0.21371	.	.	ENSG00000188379	ENST00000380206	T	0.04119	3.7	3.3	2.4	0.29515	.	0.712700	0.13968	N	0.350346	T	0.04679	0.0127	L	0.39085	1.19	0.09310	N	1	B	0.09022	0.002	B	0.20955	0.032	T	0.36625	-0.9740	10	0.49607	T	0.09	.	6.0725	0.19897	0.0:0.8543:0.0:0.1457	.	185	Q6DJX8	.	K	185	ENSP00000369554:R185K	ENSP00000369554:R185K	R	-	2	0	IFNA2	21374775	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	-0.501000	0.06398	0.594000	0.29761	0.484000	0.47621	AGA		0.368	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051903.1	NM_000605		17	181	0	0	0	0.004007	0	17	181				
GBA2	57704	broad.mit.edu	37	9	35739760	35739760	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:35739760C>G	ENST00000378103.3	-	9	1970	c.1447G>C	c.(1447-1449)Gaa>Caa	p.E483Q	GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000545786.1_Missense_Mutation_p.E489Q|GBA2_ENST00000378094.4_Missense_Mutation_p.E483Q	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	483					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)	p.E483Q(1)		NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AAGTATAGTTCATTGAACAGC	0.522																																							uc003zxw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(1447-1449)GAA>CAA		bile acid beta-glucosidase							76.0	71.0	73.0					9																	35739760		2203	4300	6503	SO:0001583	missense	57704				bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity	g.chr9:35739760C>G	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1447G>C	9.37:g.35739760C>G	ENSP00000367343:p.Glu483Gln					GBA2_uc003zxx.1_5'Flank|GBA2_uc011lpb.1_Missense_Mutation_p.E483Q|GBA2_uc011lpc.1_Missense_Mutation_p.E483Q|GBA2_uc011lpd.1_Missense_Mutation_p.E489Q|GBA2_uc003zxy.1_Missense_Mutation_p.E196Q	p.E483Q	NM_020944	NP_065995	Q9HCG7	GBA2_HUMAN	Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		9	1971	-	all_epithelial(49;0.167)		483			Extracellular (Potential).		D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	c.1447G>C	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963551	0.92791	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	6.03	6.03	0.97812	Six-hairpin glycosidase-like (1);	0.098719	0.64402	D	0.000002	D	0.84065	0.5390	M	0.83774	2.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.982;0.996	T	0.82623	-0.0366	9	0.42905	T	0.14	-16.6419	20.1672	0.98154	0.0:1.0:0.0:0.0	.	489;483;483	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	Q	483;483;489	.	ENSP00000367334:E483Q	E	-	1	0	GBA2	35729760	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	7.647000	0.83462	2.861000	0.98227	0.655000	0.94253	GAA		0.522	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944		6	67	0	0	0	0.001168	0	6	67				
ZNF658	26149	broad.mit.edu	37	9	40772608	40772608	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:40772608C>T	ENST00000602553.1	-	5	2961	c.2667G>A	c.(2665-2667)aaG>aaA	p.K889K	ZNF658_ENST00000377626.3_Silent_p.K889K|ZNF658_ENST00000441795.1_Intron			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	889					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K889K(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TGGAGAAAGTCTTCCCACAGT	0.448																																							uc004abs.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2665-2667)AAG>AAA		zinc finger protein 658							29.0	28.0	28.0					9																	40772608		1506	3169	4675	SO:0001819	synonymous_variant	26149				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:40772608C>T	AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.2667G>A	9.37:g.40772608C>T						ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Silent_p.K889K	p.K889K	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN		GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)	5	2819	-			889			C2H2-type 19; degenerate.		Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Silent	SNP	ENST00000602553.1	37	c.2667G>A	CCDS35023.1																																																																																				0.448	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160		7	158	0	0	0	0.006214	0	7	158				
TRPM6	140803	broad.mit.edu	37	9	77377180	77377180	+	Silent	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:77377180C>T	ENST00000360774.1	-	26	4644	c.4407G>A	c.(4405-4407)aaG>aaA	p.K1469K	TRPM6_ENST00000449912.2_Silent_p.K1464K|TRPM6_ENST00000451710.3_Silent_p.K1469K|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Silent_p.K1469K|TRPM6_ENST00000361255.3_Silent_p.K1464K|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1469					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.K1469K(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GCCACTTTTTCTTGATGCTAA	0.488																																							uc004ajl.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						c.(4405-4407)AAG>AAA		transient receptor potential cation channel,							127.0	123.0	124.0					9																	77377180		2203	4300	6503	SO:0001819	synonymous_variant	140803				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr9:77377180C>T	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.4407G>A	9.37:g.77377180C>T						TRPM6_uc004ajk.1_Silent_p.K1464K|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Silent_p.K425K	p.K1469K	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN			26	4645	-			1469			Cytoplasmic (Potential).		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	37	c.4407G>A	CCDS6647.1																																																																																				0.488	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		4	145	0	0	0	0.014758	0	4	145				
FAM120A	23196	broad.mit.edu	37	9	96259777	96259777	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:96259777C>T	ENST00000277165.6	+	4	1023	c.829C>T	c.(829-831)Cca>Tca	p.P277S	FAM120A_ENST00000375389.3_Missense_Mutation_p.P277S|FAM120A_ENST00000340893.4_Missense_Mutation_p.P277S|FAM120A_ENST00000333936.5_Missense_Mutation_p.P277S	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	277						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.P277S(1)		endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GCTGGTCTTGCCACCTTGCGA	0.502																																							uc004atw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(829-831)CCA>TCA		oxidative stress-associated Src activator							157.0	134.0	141.0					9																	96259777		2203	4300	6503	SO:0001583	missense	23196					cytoplasm|plasma membrane	RNA binding	g.chr9:96259777C>T	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.829C>T	9.37:g.96259777C>T	ENSP00000277165:p.Pro277Ser					FAM120A_uc004atv.2_Missense_Mutation_p.P277S|FAM120A_uc004atx.2_Missense_Mutation_p.P59S|FAM120A_uc004aty.2_Missense_Mutation_p.P59S	p.P277S	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN			4	854	+			277					A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	ENST00000277165.6	37	c.829C>T	CCDS6706.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470112	0.84533	.	.	ENSG00000048828	ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	4.84	3.92	0.45320	.	0.089188	0.48286	D	0.000193	T	0.59972	0.2233	M	0.62723	1.935	0.58432	D	0.999994	D;B;P;D	0.89917	1.0;0.221;0.86;1.0	D;B;P;D	0.91635	0.998;0.187;0.453;0.999	T	0.59467	-0.7449	10	0.37606	T	0.19	-7.3832	14.3118	0.66422	0.1496:0.8504:0.0:0.0	.	277;277;277;277	Q9NZB2-6;Q9NZB2-5;Q9NZB2;Q9NZB2-2	.;.;F120A_HUMAN;.	S	277	ENSP00000364538:P277S;ENSP00000277165:P277S;ENSP00000334918:P277S;ENSP00000344698:P277S	ENSP00000277165:P277S	P	+	1	0	FAM120A	95299598	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.535000	0.82014	1.216000	0.43427	0.563000	0.77884	CCA		0.502	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053160.2	NM_014612		4	82	0	0	0	0.009096	0	4	82				
ZNF189	7743	broad.mit.edu	37	9	104171293	104171293	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:104171293C>G	ENST00000339664.2	+	3	1372	c.1243C>G	c.(1243-1245)Ctt>Gtt	p.L415V	ZNF189_ENST00000259395.4_Missense_Mutation_p.L373V|ZNF189_ENST00000374861.3_Missense_Mutation_p.L401V	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	415					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L415V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				AAGCTCAGGTCTTATTCAGCA	0.413																																							uc004bbh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(2)|kidney(1)|central_nervous_system(1)	6						c.(1243-1245)CTT>GTT		zinc finger protein 189 isoform 1							57.0	59.0	58.0					9																	104171293		2203	4300	6503	SO:0001583	missense	7743				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:104171293C>G	AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.1243C>G	9.37:g.104171293C>G	ENSP00000342019:p.Leu415Val					ZNF189_uc004bbg.1_Missense_Mutation_p.L373V|ZNF189_uc004bbi.1_Missense_Mutation_p.L401V|ZNF189_uc011lvk.1_Missense_Mutation_p.L400V	p.L415V	NM_003452	NP_003443	O75820	ZN189_HUMAN			3	1519	+		Acute lymphoblastic leukemia(62;0.0559)	415			C2H2-type 10.		O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Missense_Mutation	SNP	ENST00000339664.2	37	c.1243C>G	CCDS6754.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332319	0.41297	.	.	ENSG00000136870	ENST00000374861;ENST00000339664;ENST00000259395	T;T;T	0.26957	1.7;1.7;1.7	4.49	4.49	0.54785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42548	D	0.000692	T	0.47229	0.1434	M	0.78916	2.43	0.46586	D	0.999112	D;D;D	0.71674	0.998;0.998;0.998	D;D;P	0.70016	0.967;0.951;0.879	T	0.46317	-0.9200	10	0.87932	D	0	.	8.6664	0.34123	0.0:0.9002:0.0:0.0998	.	400;401;415	B7ZLK9;Q5T7D8;O75820	.;.;ZN189_HUMAN	V	401;415;373	ENSP00000363995:L401V;ENSP00000342019:L415V;ENSP00000259395:L373V	ENSP00000259395:L373V	L	+	1	0	ZNF189	103211114	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	3.141000	0.50593	2.785000	0.95823	0.655000	0.94253	CTT		0.413	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452		18	61	0	0	0	0.00499	0	18	61				
CNTRL	11064	broad.mit.edu	37	9	123917162	123917162	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:123917162G>A	ENST00000373855.1	+	27	4596	c.4336G>A	c.(4336-4338)Gag>Aag	p.E1446K	CNTRL_ENST00000373847.1_Missense_Mutation_p.E894K|CNTRL_ENST00000373844.1_5'Flank|CNTRL_ENST00000238341.5_Missense_Mutation_p.E1446K|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Missense_Mutation_p.E894K			Q7Z7A1	CNTRL_HUMAN	centriolin	1446					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.E1446K(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GGCAGAGGCTGAGAGTGAACT	0.463																																							uc004bkx.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(4336-4338)GAG>AAG		centrosomal protein 110kDa							205.0	185.0	192.0					9																	123917162		2203	4300	6503	SO:0001583	missense	11064				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding	g.chr9:123917162G>A	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.4336G>A	9.37:g.123917162G>A	ENSP00000362962:p.Glu1446Lys					CEP110_uc004bla.1_Missense_Mutation_p.E894K|CEP110_uc010mvo.1_Missense_Mutation_p.E115K|CEP110_uc004blb.1_Missense_Mutation_p.E115K|CEP110_uc010mvp.1_5'Flank	p.E1446K	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN			25	4367	+			1446			Potential.		A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	c.4336G>A	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002170	0.93227	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000373847;ENST00000431571;ENST00000373845	T;T;T;T;D	0.82167	0.8;0.8;0.8;0.8;-1.58	5.58	5.58	0.84498	.	.	.	.	.	D	0.85155	0.5632	M	0.61703	1.905	0.48830	D	0.999711	D	0.58620	0.983	P	0.51016	0.656	T	0.82843	-0.0257	9	0.27785	T	0.31	.	16.0216	0.80499	0.0:0.1342:0.8658:0.0	.	1446	Q7Z7A1	CNTRL_HUMAN	K	1446;1446;1446;202;894;894;115;115	ENSP00000362962:E1446K;ENSP00000238341:E1446K;ENSP00000362956:E894K;ENSP00000362953:E894K;ENSP00000413014:E115K	ENSP00000238341:E1446K	E	+	1	0	CNTRL	122956983	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.978000	0.70501	2.769000	0.95229	0.655000	0.94253	GAG		0.463	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018		11	91	0	0	0	0.016723	0	11	91				
GOLGA2	2801	broad.mit.edu	37	9	131028134	131028134	+	Silent	SNP	G	G	A	rs199686673		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:131028134G>A	ENST00000421699.2	-	10	690	c.678C>T	c.(676-678)ctC>ctT	p.L226L	GOLGA2_ENST00000609374.1_Silent_p.L214L	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	226					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						TCTCTGATACGAGGATCCCTA	0.502													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20587	0.0		0.0	False		,,,				2504	0.0						uc011maw.1		NA																	0				ovary(1)	1						c.(676-678)CTC>CTT		Golgi autoantigen, golgin subfamily a, 2							94.0	88.0	90.0					9																	131028134		2203	4300	6503	SO:0001819	synonymous_variant	2801					Golgi cisterna membrane	protein binding	g.chr9:131028134G>A	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.678C>T	9.37:g.131028134G>A						GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004bul.1_Silent_p.L127L|GOLGA2_uc004bum.1_Silent_p.L100L	p.L226L	NM_004486	NP_004477	Q08379	GOGA2_HUMAN			10	691	-			226			Potential.		Q6GRM9|Q9BRB0|Q9NYF9	Silent	SNP	ENST00000421699.2	37	c.678C>T	CCDS6896.2	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	g	0.037	-1.303018	0.01353	.	.	ENSG00000167110	ENST00000458730	.	.	.	5.31	-9.4	0.00616	.	.	.	.	.	T	0.32675	0.0837	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42498	-0.9448	4	.	.	.	.	1.8446	0.03157	0.2181:0.221:0.345:0.216	.	.	.	.	C	159	.	.	R	-	1	0	GOLGA2	130067955	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-4.917000	0.00170	-1.353000	0.02191	-0.340000	0.08031	CGT		0.502	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486		6	96	0	0	0	0.001168	0	6	96				
ODF2	4957	broad.mit.edu	37	9	131219695	131219695	+	Missense_Mutation	SNP	C	C	T			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:131219695C>T	ENST00000434106.3	+	2	374	c.11C>T	c.(10-12)tCa>tTa	p.S4L	ODF2_ENST00000372814.3_Intron|ODF2_ENST00000351030.3_Intron|ODF2_ENST00000604420.1_Missense_Mutation_p.S4L|ODF2_ENST00000393527.3_5'UTR|ODF2_ENST00000535026.1_Intron|ODF2_ENST00000448249.3_Intron|ODF2_ENST00000372791.3_Missense_Mutation_p.S4L|ODF2_ENST00000546203.1_Intron|ODF2_ENST00000393533.2_Intron	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	4					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)	p.S4L(1)		autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						ATGTCTGCCTCATCCTCAGGC	0.662																																							uc011mbd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(10-12)TCA>TTA		outer dense fiber of sperm tails 2 isoform 1							90.0	93.0	92.0					9																	131219695		2203	4300	6503	SO:0001583	missense	4957				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity	g.chr9:131219695C>T	AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.11C>T	9.37:g.131219695C>T	ENSP00000403453:p.Ser4Leu					ODF2_uc011maz.1_Intron|ODF2_uc011mba.1_Intron|ODF2_uc010myb.2_Intron|ODF2_uc011mbb.1_Intron|ODF2_uc011mbc.1_Intron|ODF2_uc004bva.2_Intron|ODF2_uc004bvb.2_5'UTR|ODF2_uc011mbe.1_Intron|ODF2_uc004bvc.2_Intron|ODF2_uc010myc.2_Intron|ODF2_uc011mbf.1_Intron|ODF2_uc004bvd.3_Missense_Mutation_p.S4L|ODF2_uc004bve.2_Missense_Mutation_p.S4L	p.S4L	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN			2	322	+			4					B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	ENST00000434106.3	37	c.11C>T	CCDS56588.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.682776	0.47991	.	.	ENSG00000136811	ENST00000372796;ENST00000434106;ENST00000446274;ENST00000432065;ENST00000372791	T;T;T	0.41758	1.8;1.8;0.99	3.84	3.84	0.44239	.	0.561492	0.16621	N	0.206492	T	0.36193	0.0958	N	0.08118	0	0.80722	D	1	P;P	0.51449	0.945;0.945	P;P	0.54965	0.765;0.765	T	0.35943	-0.9768	10	0.72032	D	0.01	-3.9417	11.5487	0.50708	0.0:1.0:0.0:0.0	.	4;4	Q5BJF6-5;Q5BJF6	.;ODFP2_HUMAN	L	4	ENSP00000361882:S4L;ENSP00000403453:S4L;ENSP00000361877:S4L	ENSP00000361877:S4L	S	+	2	0	ODF2	130259516	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.968000	0.49224	2.413000	0.81919	0.591000	0.81541	TCA		0.662	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3			13	149	0	0	0	0.003163	0	13	149				
FAM73B	84895	broad.mit.edu	37	9	131810777	131810777	+	Missense_Mutation	SNP	G	G	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr9:131810777G>C	ENST00000358369.4	+	4	605	c.379G>C	c.(379-381)Gag>Cag	p.E127Q	FAM73B_ENST00000277475.5_Missense_Mutation_p.E127Q|FAM73B_ENST00000406926.2_Missense_Mutation_p.E127Q	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B	127	Ser-rich.				bone development (GO:0060348)	integral component of membrane (GO:0016021)		p.E127Q(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						CTCTTCCATTGAGCCCAGCAA	0.642																																							uc004bxa.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(379-381)GAG>CAG		hypothetical protein LOC84895							101.0	91.0	95.0					9																	131810777		2203	4300	6503	SO:0001583	missense	84895					integral to membrane		g.chr9:131810777G>C	AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.379G>C	9.37:g.131810777G>C	ENSP00000351138:p.Glu127Gln					FAM73B_uc004bwy.2_RNA|FAM73B_uc004bwz.2_RNA|FAM73B_uc011mbn.1_Missense_Mutation_p.E127Q	p.E127Q	NM_032809	NP_116198	Q7L4E1	FA73B_HUMAN			4	565	+			127			Ser-rich.		Q8NBM3|Q8TEJ6|Q969E6	Missense_Mutation	SNP	ENST00000358369.4	37	c.379G>C	CCDS6917.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697846	0.88830	.	.	ENSG00000148343	ENST00000358369;ENST00000406926;ENST00000277475	T;T;T	0.23147	1.92;1.92;1.92	5.37	5.37	0.77165	.	0.098653	0.64402	D	0.000002	T	0.30135	0.0755	L	0.36672	1.1	0.49130	D	0.999759	P;B	0.48589	0.912;0.211	P;B	0.47891	0.56;0.249	T	0.00804	-1.1559	10	0.33141	T	0.24	-22.6342	18.454	0.90713	0.0:0.0:1.0:0.0	.	191;127	B4DZP8;Q7L4E1	.;FA73B_HUMAN	Q	127	ENSP00000351138:E127Q;ENSP00000384662:E127Q;ENSP00000277475:E127Q	ENSP00000277475:E127Q	E	+	1	0	FAM73B	130850598	1.000000	0.71417	0.997000	0.53966	0.915000	0.54546	8.793000	0.91862	2.666000	0.90696	0.561000	0.74099	GAG		0.642	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054542.7	NM_032809		7	83	0	0	0	0.00308	0	7	83				
NRK	203447	broad.mit.edu	37	X	105153377	105153377	+	Missense_Mutation	SNP	C	C	G			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chrX:105153377C>G	ENST00000243300.9	+	13	2047	c.1744C>G	c.(1744-1746)Cga>Gga	p.R582G	NRK_ENST00000428173.2_Missense_Mutation_p.R583G	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	582					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R583G(1)|p.R582G(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TGAGTCATTACGAGTAAATGC	0.537										HNSCC(51;0.14)																													uc004emd.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						c.(1744-1746)CGA>GGA		Nik related kinase							69.0	64.0	66.0					X																	105153377		2016	4161	6177	SO:0001583	missense	203447						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chrX:105153377C>G	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1744C>G	X.37:g.105153377C>G	ENSP00000434830:p.Arg582Gly	HNSCC(51;0.14)				NRK_uc010npc.1_Missense_Mutation_p.R250G	p.R582G	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN			13	2047	+			582					Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37	c.1744C>G		.	.	.	.	.	.	.	.	.	.	C	4.612	0.113759	0.08831	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.24538	1.85;1.85	4.12	2.22	0.28083	.	1.279530	0.05845	N	0.620172	T	0.20333	0.0489	N	0.24115	0.695	0.09310	N	0.999993	P;B	0.41748	0.761;0.451	B;B	0.40702	0.338;0.046	T	0.28138	-1.0053	10	0.29301	T	0.29	.	9.7909	0.40706	0.3692:0.6308:0.0:0.0	.	250;582	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	G	582;583	ENSP00000434830:R582G;ENSP00000438378:R583G	ENSP00000434830:R582G	R	+	1	2	NRK	105040033	0.000000	0.05858	0.000000	0.03702	0.287000	0.27160	0.220000	0.17660	0.445000	0.26639	0.513000	0.50165	CGA		0.537	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465		2	6	0	0	0	0.004672	0	2	6				
DCAF12L1	139170	broad.mit.edu	37	X	125686524	125686524	+	Missense_Mutation	SNP	G	G	A			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chrX:125686524G>A	ENST00000371126.1	-	1	310	c.68C>T	c.(67-69)tCg>tTg	p.S23L		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	23								p.S23L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						CTGCGACGGCGAGCTCTCGGC	0.711																																							uc004eul.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(67-69)TCG>TTG		DDB1 and CUL4 associated factor 12-like 1							17.0	21.0	20.0					X																	125686524		2059	4056	6115	SO:0001583	missense	139170							g.chrX:125686524G>A	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.68C>T	X.37:g.125686524G>A	ENSP00000360167:p.Ser23Leu						p.S23L	NM_178470	NP_848565	Q5VU92	DC121_HUMAN			1	319	-			23					Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	c.68C>T	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957547	0.53400	.	.	ENSG00000198889	ENST00000371126	T	0.19938	2.11	3.22	-1.1	0.09872	.	.	.	.	.	T	0.33059	0.0850	M	0.63428	1.95	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.23691	-1.0181	9	0.87932	D	0	.	0.383	0.00398	0.2686:0.1973:0.331:0.2031	.	23	Q5VU92	DC121_HUMAN	L	23	ENSP00000360167:S23L	ENSP00000360167:S23L	S	-	2	0	DCAF12L1	125514205	0.598000	0.26882	0.000000	0.03702	0.022000	0.10575	3.352000	0.52239	-0.407000	0.07576	0.506000	0.49869	TCG		0.711	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470		16	29	0	0	0	0.00499	0	16	29				
F8	2157	broad.mit.edu	37	X	154157942	154157942	+	Missense_Mutation	SNP	C	C	G	rs387906452		TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chrX:154157942C>G	ENST00000360256.4	-	14	4323	c.4123G>C	c.(4123-4125)Gac>Cac	p.D1375H		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1375	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.D1375H(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCATTGTAGTCTATCTGTGTG	0.438																																							uc004fmt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11						c.(4123-4125)GAC>CAC		coagulation factor VIII isoform a precursor	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						214.0	187.0	196.0					X																	154157942		2203	4300	6503	SO:0001583	missense	2157				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding	g.chrX:154157942C>G	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4123G>C	X.37:g.154157942C>G	ENSP00000353393:p.Asp1375His						p.D1375H	NM_000132	NP_000123	P00451	FA8_HUMAN			14	4294	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		1375			B.		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	c.4123G>C	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	c	9.359	1.067520	0.20067	.	.	ENSG00000185010	ENST00000360256	D	0.99304	-5.72	5.65	1.7	0.24286	.	0.621363	0.14997	N	0.286305	D	0.97739	0.9258	L	0.46157	1.445	0.09310	N	1	P	0.50710	0.938	P	0.47206	0.541	D	0.94758	0.7933	10	0.62326	D	0.03	-0.0229	5.4047	0.16314	0.0:0.5129:0.3054:0.1817	.	1375	P00451	FA8_HUMAN	H	1375	ENSP00000353393:D1375H	ENSP00000353393:D1375H	D	-	1	0	F8	153811136	0.005000	0.15991	0.004000	0.12327	0.023000	0.10783	0.808000	0.27154	0.178000	0.19917	0.597000	0.82753	GAC		0.438	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			10	149	0	0	0	0.008291	0	10	149				
HAS3	3038	broad.mit.edu	37	16	69148849	69148850	+	Frame_Shift_Ins	INS	-	-	C			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr16:69148849_69148850insC	ENST00000306560.1	+	4	1498_1499	c.1342_1343insC	c.(1342-1344)tccfs	p.S448fs	HAS3_ENST00000569188.1_Frame_Shift_Ins_p.S448fs|HAS3_ENST00000219322.3_Intron	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	448					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		CCTCTATATGTCCAGCCTTCTG	0.54																																							uc010cfh.2		NA																	0					0						c.(1342-1344)TCCfs		hyaluronan synthase 3 isoform a																																				SO:0001589	frameshift_variant	3038				carbohydrate metabolic process	integral to plasma membrane	hyaluronan synthase activity	g.chr16:69148849_69148850insC	BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1344dupC	16.37:g.69148851_69148851dupC	ENSP00000304440:p.Ser448fs					HAS3_uc002ewk.2_Intron|HAS3_uc002ewl.2_Frame_Shift_Ins_p.S448fs	p.S448fs	NM_005329	NP_005320	O00219	HAS3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0694)	4	1566_1567	+		Ovarian(137;0.101)	448			Helical; Name=5; (Potential).		A8K5T5|Q8WTZ0|Q9NYP0	Frame_Shift_Ins	INS	ENST00000306560.1	37	c.1342_1343insC	CCDS10871.1																																																																																				0.540	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	NM_138612		18	180	NA	NA	NA	NA	NA	18	180	---	---	---	---
MBNL1	4154	broad.mit.edu	37	3	152177135	152177136	+	Splice_Site	DEL	GT	GT	-			TCGA-49-6745-01A-11D-1855-08	TCGA-49-6745-11A-01D-1855-08	GT	GT	-	-	GT	GT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	bfb97048-977b-4722-be8f-3dd37370ba30	bb980a3a-b200-4f14-a8e0-f7a5ec5a42e7	g.chr3:152177135_152177136delGT	ENST00000463374.1	+	8	1696		c.e8+1		MBNL1_ENST00000324210.5_Splice_Site|MBNL1_ENST00000282488.7_Splice_Site|MBNL1_ENST00000357472.3_Splice_Site|MBNL1_ENST00000493459.1_Splice_Site|MBNL1_ENST00000282486.6_Splice_Site|MBNL1_ENST00000485910.1_Splice_Site|MBNL1_ENST00000324196.5_Splice_Site|MBNL1_ENST00000355460.2_Splice_Site|MBNL1_ENST00000498502.1_Splice_Site|MBNL1_ENST00000545754.1_Splice_Site|RP11-362A9.3_ENST00000463255.1_RNA	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1						alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TCACTAAACAGTAAGTTCATTA	0.292																																							uc003ezm.2		NA																	0				ovary(1)	1						c.e8+1		muscleblind-like 1 isoform c																																				SO:0001630	splice_region_variant	4154				embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding	g.chr3:152177135_152177136delGT	Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.1164+1GT>-	3.37:g.152177135_152177136delGT						MBNL1_uc003ezh.2_Splice_Site|MBNL1_uc003ezi.2_Splice_Site|MBNL1_uc003ezj.2_Splice_Site|MBNL1_uc003ezl.2_Splice_Site|MBNL1_uc003ezp.2_Splice_Site|MBNL1_uc003ezn.2_Splice_Site|MBNL1_uc003ezo.2_Splice_Site|MBNL1_uc010hvp.2_Splice_Site		NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		8	1974	+								E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Splice_Site	DEL	ENST00000463374.1	37	c.1185_splice	CCDS3165.1																																																																																				0.292	MBNL1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353604.1	NM_021038	Intron	7	27	NA	NA	NA	NA	NA	7	27	---	---	---	---
