#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
HES4	57801	broad.mit.edu	37	1	935105	935105	+	Silent	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:935105G>C	ENST00000304952.6	-	2	308	c.171C>G	c.(169-171)ctC>ctG	p.L57L	HES4_ENST00000484667.2_Intron|RP11-54O7.17_ENST00000606034.1_lincRNA|HES4_ENST00000428771.2_Silent_p.L83L			Q9HCC6	HES4_HUMAN	hes family bHLH transcription factor 4	57	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)	p.L57L(1)		lung(2)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;9.36e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.41e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00237)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGAGGGTTTTGAGCTGAGCGA	0.662																																							uc001aci.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(169-171)CTC>CTG		hairy and enhancer of split 4 isoform 2							33.0	38.0	37.0					1																	935105		2201	4295	6496	SO:0001819	synonymous_variant	57801				cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr1:935105G>C	BC012351	CCDS5.1, CCDS44034.1	1p36	2013-10-17	2013-10-17		ENSG00000188290	ENSG00000188290		"""Basic helix-loop-helix proteins"""	24149	protein-coding gene	gene with protein product		608060	"""hairy and enhancer of split 4 (Drosophila)"""			11260262, 15254753	Standard	NM_021170		Approved	bHLHb42	uc001aci.2	Q9HCC6	OTTHUMG00000040758	ENST00000304952.6:c.171C>G	1.37:g.935105G>C						HES4_uc010nyc.1_Silent_p.L83L	p.L57L	NM_021170	NP_066993	Q9HCC6	HES4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;9.36e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.41e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00237)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	2	370	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	57			Helix-loop-helix motif.		Q5SVA5	Silent	SNP	ENST00000304952.6	37	c.171C>G	CCDS5.1																																																																																				0.662	HES4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097944.1	NM_021170		6	47	0	0	0	0.001984	0	6	47				
VPS13D	55187	broad.mit.edu	37	1	12378268	12378268	+	Missense_Mutation	SNP	C	C	T	rs540082212		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:12378268C>T	ENST00000358136.3	+	31	7418	c.7288C>T	c.(7288-7290)Cgc>Tgc	p.R2430C	VPS13D_ENST00000356315.4_Missense_Mutation_p.R2430C	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.R2430C(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TACTCCTTCTCGCCACCGTAA	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		20979	0.0		0.0	False		,,,				2504	0.001						uc001atv.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)	5						c.(7288-7290)CGC>TGC		vacuolar protein sorting 13D isoform 1							146.0	140.0	142.0					1																	12378268		2203	4300	6503	SO:0001583	missense	55187				protein localization			g.chr1:12378268C>T	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7288C>T	1.37:g.12378268C>T	ENSP00000350854:p.Arg2430Cys					VPS13D_uc001atw.2_Missense_Mutation_p.R2430C|VPS13D_uc001atx.2_Missense_Mutation_p.R1618C|VPS13D_uc001aty.1_Missense_Mutation_p.R168C	p.R2430C	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)	31	7429	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	2430						Missense_Mutation	SNP	ENST00000358136.3	37	c.7288C>T	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	C	7.654	0.683436	0.14907	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.44482	0.92;0.92	5.39	4.47	0.54385	.	0.491742	0.22924	N	0.053986	T	0.28101	0.0693	N	0.22421	0.69	0.80722	D	1	B;B;B	0.19817	0.039;0.022;0.013	B;B;B	0.11329	0.005;0.006;0.003	T	0.09015	-1.0694	10	0.54805	T	0.06	.	9.5612	0.39371	0.0:0.7814:0.1435:0.0751	.	337;2430;2430	B1AJZ2;Q5THJ4-2;Q5THJ4	.;.;VP13D_HUMAN	C	2430	ENSP00000348666:R2430C;ENSP00000350854:R2430C	ENSP00000348666:R2430C	R	+	1	0	VPS13D	12300855	0.449000	0.25689	0.986000	0.45419	0.008000	0.06430	0.959000	0.29240	2.676000	0.91093	0.563000	0.77884	CGC		0.438	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		31	138	0	0	0	0.002836	0	31	138				
UBR4	23352	broad.mit.edu	37	1	19499493	19499493	+	Nonsense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:19499493G>C	ENST00000375254.3	-	25	3413	c.3386C>G	c.(3385-3387)tCa>tGa	p.S1129*	UBR4_ENST00000375267.2_Nonsense_Mutation_p.S1129*|UBR4_ENST00000375226.2_Nonsense_Mutation_p.S1129*|UBR4_ENST00000375217.2_Nonsense_Mutation_p.S1129*	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1129					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S1129*(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGGACCTTTGAGATCGCGGC	0.468																																							uc001bbi.2		NA																	1	Substitution - Nonsense(1)		lung(1)	kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25						c.(3385-3387)TCA>TGA		retinoblastoma-associated factor 600							86.0	79.0	81.0					1																	19499493		2203	4300	6503	SO:0001587	stop_gained	23352				interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:19499493G>C	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.3386C>G	1.37:g.19499493G>C	ENSP00000364403:p.Ser1129*					UBR4_uc001bbm.1_Nonsense_Mutation_p.S340*	p.S1129*	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)	25	3390	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)	1129					A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Nonsense_Mutation	SNP	ENST00000375254.3	37	c.3386C>G	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	36	5.842853	0.97016	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000419533	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	15.0824	0.72125	0.0:0.1415:0.8585:0.0	.	.	.	.	X	1129;1129;1129;1129;345	.	ENSP00000364365:S1129X	S	-	2	0	UBR4	19372080	1.000000	0.71417	0.974000	0.42286	0.981000	0.71138	7.513000	0.81739	2.719000	0.93026	0.655000	0.94253	TCA		0.468	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765		6	80	0	0	0	0.001984	0	6	80				
RNF19B	127544	broad.mit.edu	37	1	33402454	33402454	+	Missense_Mutation	SNP	C	C	T	rs371235809		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:33402454C>T	ENST00000373456.7	-	9	2151	c.2152G>A	c.(2152-2154)Gag>Aag	p.E718K	RNF19B_ENST00000356990.5_3'UTR|RNF19B_ENST00000235150.4_Missense_Mutation_p.E717K	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	718					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.E527K(1)		endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GTTTGTCCCTCGGCTAGGGCA	0.567																																							uc010oho.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2152-2154)GAG>AAG		ring finger protein 19B isoform a		C	,LYS/GLU	0,4406		0,0,2203	106.0	110.0	109.0		,2152	5.3	1.0	1		109	1,8599	1.2+/-3.3	0,1,4299	no	utr-3,missense	RNF19B	NM_001127361.1,NM_153341.2	,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,possibly-damaging	,718/733	33402454	1,13005	2203	4300	6503	SO:0001583	missense	127544					integral to membrane	ligase activity|protein binding|zinc ion binding	g.chr1:33402454C>T	AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.2152G>A	1.37:g.33402454C>T	ENSP00000362555:p.Glu718Lys					RNF19B_uc001bwm.3_3'UTR|RNF19B_uc010ohp.1_Missense_Mutation_p.E717K	p.E718K	NM_153341	NP_699172	Q6ZMZ0	RN19B_HUMAN			9	2152	-		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)	718					B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Missense_Mutation	SNP	ENST00000373456.7	37	c.2152G>A	CCDS372.2	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723993	0.68959	0.0	1.16E-4	ENSG00000116514	ENST00000373456;ENST00000235150	T;T	0.33438	1.41;1.41	5.34	5.34	0.76211	.	0.143814	0.47093	D	0.000256	T	0.25121	0.0610	N	0.19112	0.55	0.44937	D	0.997953	D;D	0.56287	0.975;0.957	B;B	0.42851	0.4;0.225	T	0.05784	-1.0864	10	0.87932	D	0	.	17.2048	0.86914	0.0:1.0:0.0:0.0	.	717;718	G3XA82;Q6ZMZ0	.;RN19B_HUMAN	K	718;717	ENSP00000362555:E718K;ENSP00000235150:E717K	ENSP00000235150:E717K	E	-	1	0	RNF19B	33175041	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.219000	0.51200	2.671000	0.90904	0.585000	0.79938	GAG		0.567	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011465.3	NM_153341		28	168	0	0	0	0.007291	0	28	168				
EPHA10	284656	broad.mit.edu	37	1	38227381	38227381	+	Silent	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:38227381C>T	ENST00000373048.4	-	3	545	c.546G>A	c.(544-546)ccG>ccA	p.P182P	EPHA10_ENST00000427468.2_Silent_p.P182P|EPHA10_ENST00000319637.6_Silent_p.P182P	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	182	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)	p.P182P(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCCGGCTGAGCGGTCCGATCT	0.657																																							uc009vvi.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(4)|stomach(3)|lung(1)	8						c.(544-546)CCG>CCA		EPH receptor A10 isofom 3							34.0	42.0	40.0					1																	38227381		2197	4299	6496	SO:0001819	synonymous_variant	284656					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity	g.chr1:38227381C>T	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.546G>A	1.37:g.38227381C>T						EPHA10_uc001cbw.3_Silent_p.P182P	p.P182P	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN			3	632	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	182			Extracellular (Potential).		A4FU89|J3KPB5|Q6NW42	Silent	SNP	ENST00000373048.4	37	c.546G>A	CCDS41305.1																																																																																				0.657	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641		5	32	0	0	0	0.001168	0	5	32				
SZT2	23334	broad.mit.edu	37	1	43893380	43893380	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:43893380C>T	ENST00000562955.1	+	25	3607	c.3607C>T	c.(3607-3609)Cag>Tag	p.Q1203*	SZT2_ENST00000372442.1_Nonsense_Mutation_p.Q361*	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1260					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.Q361*(2)|p.Q1203*(1)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GCAGCCCCCTCAGGCGCCCCG	0.582																																							uc001cjk.1		NA																	3	Substitution - Nonsense(3)		lung(3)		0						c.(1081-1083)CAG>TAG		hypothetical protein LOC23334							30.0	34.0	32.0					1																	43893380		2203	4300	6503	SO:0001587	stop_gained	23334					peroxisome		g.chr1:43893380C>T	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.3607C>T	1.37:g.43893380C>T	ENSP00000457168:p.Gln1203*						p.Q361*	NM_015284	NP_056099	Q5T011	SZT2_HUMAN			11	1543	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	1260					A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Nonsense_Mutation	SNP	ENST00000562955.1	37	c.1081C>T	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	C	38	7.245450	0.98161	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.26	4.29	0.51040	.	0.334934	0.27500	N	0.019091	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	15.7012	0.77544	0.1888:0.8112:0.0:0.0	.	.	.	.	X	361	.	ENSP00000361519:Q361X	Q	+	1	0	SZT2	43665967	0.709000	0.27886	0.978000	0.43139	0.711000	0.40976	2.498000	0.45363	2.733000	0.93635	0.655000	0.94253	CAG		0.582	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284		9	26	0	0	0	0.006214	0	9	26				
TM2D1	83941	broad.mit.edu	37	1	62175070	62175070	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:62175070G>C	ENST00000606498.1	-	3	298	c.278C>G	c.(277-279)tCc>tGc	p.S93C	TM2D1_ENST00000371177.2_Missense_Mutation_p.S93C|TM2D1_ENST00000472989.1_5'UTR|TM2D1_ENST00000371180.2_Missense_Mutation_p.S155C|TM2D1_ENST00000294613.5_Missense_Mutation_p.S93C			Q9BX74	TM2D1_HUMAN	TM2 domain containing 1	93					apoptotic signaling pathway (GO:0097190)	integral component of plasma membrane (GO:0005887)	beta-amyloid binding (GO:0001540)|G-protein coupled receptor activity (GO:0004930)	p.S155C(1)|p.S93C(1)		large_intestine(2)|lung(3)|ovary(1)	6						ATTGCCACTGGAATCCTTACA	0.348																																							uc001czz.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(277-279)TCC>TGC		beta-amyloid binding protein precursor							87.0	83.0	85.0					1																	62175070		1839	4090	5929	SO:0001583	missense	83941				apoptosis			g.chr1:62175070G>C	AF353990	CCDS65554.1	1p32.1	2008-02-05			ENSG00000162604	ENSG00000162604			24142	protein-coding gene	gene with protein product		610080				11278849, 12553667	Standard	NM_032027		Approved	BBP	uc001czz.1	Q9BX74	OTTHUMG00000008466	ENST00000606498.1:c.278C>G	1.37:g.62175070G>C	ENSP00000475700:p.Ser93Cys						p.S93C	NM_032027	NP_114416	Q9BX74	TM2D1_HUMAN			3	581	-			93					A6NDA8	Missense_Mutation	SNP	ENST00000606498.1	37	c.278C>G		.	.	.	.	.	.	.	.	.	.	G	11.02	1.516580	0.27123	.	.	ENSG00000162604	ENST00000371180;ENST00000294613;ENST00000371178;ENST00000371177	.	.	.	5.53	-2.32	0.06745	.	0.752816	0.12778	N	0.439900	T	0.20618	0.0496	N	0.24115	0.695	0.18873	N	0.999985	B	0.32425	0.371	B	0.35971	0.215	T	0.18053	-1.0349	9	0.39692	T	0.17	0.0021	4.7841	0.13217	0.3843:0.0:0.3712:0.2445	.	93	Q9BX74	TM2D1_HUMAN	C	155;93;93;93	.	ENSP00000294613:S93C	S	-	2	0	TM2D1	61947658	0.000000	0.05858	0.017000	0.16124	0.943000	0.58893	-0.752000	0.04797	-0.599000	0.05798	-0.302000	0.09304	TCC		0.348	TM2D1-012	KNOWN	non_canonical_U12|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470779.2	NM_032027		7	84	0	0	0	0.00308	0	7	84				
CCDC18	343099	broad.mit.edu	37	1	93722039	93722039	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:93722039G>A	ENST00000343253.7	+	25	3989	c.3487G>A	c.(3487-3489)Gaa>Aaa	p.E1163K	CCDC18_ENST00000401026.3_Missense_Mutation_p.E1164K|CCDC18_ENST00000557479.1_Missense_Mutation_p.E1282K|CCDC18_ENST00000338949.4_3'UTR|CCDC18_ENST00000334652.5_3'UTR			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	1163								p.E1282K(1)		breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		AGCACAGAGAGAAATAGAAAG	0.418																																							uc001dpq.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|breast(2)|pancreas(1)	5						c.(3844-3846)GAA>AAA		sarcoma antigen NY-SAR-41							96.0	96.0	96.0					1																	93722039		1884	4101	5985	SO:0001583	missense	343099							g.chr1:93722039G>A			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.3487G>A	1.37:g.93722039G>A	ENSP00000343377:p.Glu1163Lys					CCDC18_uc001dpr.1_Missense_Mutation_p.E77K	p.E1282K	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)	25	4012	+		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)	1163			Potential.		Q6ZU17	Missense_Mutation	SNP	ENST00000343253.7	37	c.3844G>A		.	.	.	.	.	.	.	.	.	.	G	29.2	4.983776	0.93044	.	.	ENSG00000122483	ENST00000343253;ENST00000401026;ENST00000557479	.	.	.	5.31	5.31	0.75309	.	0.054917	0.64402	D	0.000001	T	0.59555	0.2202	L	0.50333	1.59	0.80722	D	1	P;D	0.64830	0.908;0.994	B;P	0.61397	0.436;0.888	T	0.54282	-0.8317	9	0.27082	T	0.32	.	16.7566	0.85501	0.0:0.0:1.0:0.0	.	82;1282	Q5T9S4;G3V388	.;.	K	1163;1164;1282	.	ENSP00000343377:E1163K	E	+	1	0	CCDC18	93494627	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.222000	0.58580	2.492000	0.84095	0.655000	0.94253	GAA		0.418	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886		8	91	0	0	0	0.004482	0	8	91				
PTBP2	58155	broad.mit.edu	37	1	97278831	97278831	+	Splice_Site	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:97278831G>C	ENST00000426398.2	+	14	1509		c.e14-1		PTBP2_ENST00000370198.1_Splice_Site|PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000394184.3_Missense_Mutation_p.R506T|PTBP2_ENST00000541987.1_Splice_Site|PTBP2_ENST00000370197.1_Missense_Mutation_p.R495T|PTBP2_ENST00000609116.1_Missense_Mutation_p.R490T	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2						mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.?(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		TGTTTCAGAAGAGATCACAAA	0.323																																							uc001drq.2		NA																	1	Unknown(1)		lung(1)		0						c.e14-1		polypyrimidine tract binding protein 2							56.0	64.0	61.0					1																	97278831		2203	4300	6503	SO:0001630	splice_region_variant	58155						nucleotide binding	g.chr1:97278831G>C	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.1467-1G>C	1.37:g.97278831G>C						PTBP2_uc001drn.2_Missense_Mutation_p.R495T|PTBP2_uc001dro.2_Missense_Mutation_p.R490T|PTBP2_uc010otz.1_Missense_Mutation_p.R506T|PTBP2_uc001drp.2_RNA|PTBP2_uc009wdw.2_Missense_Mutation_p.R438T|PTBP2_uc001drr.2_Splice_Site_p.Q494_splice|PTBP2_uc010oua.1_Missense_Mutation_p.R498T|PTBP2_uc001dru.2_Splice_Site|PTBP2_uc001drs.1_Missense_Mutation_p.R109T|PTBP2_uc001drt.2_Splice_Site_p.Q108_splice	p.Q489_splice	NM_021190	NP_067013	Q9UKA9	PTBP2_HUMAN		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)	14	1713	+		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)						Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Splice_Site	SNP	ENST00000426398.2	37	c.1467_splice	CCDS754.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.91|18.91	3.724315|3.724315	0.68959|0.68959	.|.	.|.	ENSG00000117569|ENSG00000117569	ENST00000370198;ENST00000426398|ENST00000236228;ENST00000543738;ENST00000370197;ENST00000394184	.|T;T;T	.|0.07908	.|3.15;3.15;3.15	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	.|0.055638	.|0.64402	.|D	.|0.000001	.|T	.|0.08802	.|0.0218	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B	.|0.28378	.|0.026;0.068;0.009;0.048;0.209	.|B;B;B;B;B	.|0.36922	.|0.063;0.043;0.003;0.037;0.236	.|T	.|0.06391	.|-1.0829	.|9	.|0.87932	.|D	.|0	.|.	19.7532|19.7532	0.96277|0.96277	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|498;506;162;490;495	.|B4DSU5;B4DSS8;B4DSI2;Q9UKA9-2;Q9UKA9-3	.|.;.;.;.;.	.|T	-1|490;162;495;506	.|ENSP00000236228:R490T;ENSP00000359216:R495T;ENSP00000377738:R506T	.|ENSP00000236228:R490T	.|R	+|+	.|2	.|0	PTBP2|PTBP2	97051419|97051419	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.590000|6.590000	0.74085|0.74085	2.734000|2.734000	0.93682|0.93682	0.650000|0.650000	0.86243|0.86243	.|AGA		0.323	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1		Intron	11	98	0	0	0	0.000978	0	11	98				
HIST2H2AC	8338	broad.mit.edu	37	1	149858806	149858806	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:149858806G>A	ENST00000331380.2	+	1	282	c.282G>A	c.(280-282)ctG>ctA	p.L94L	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	94						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L94L(2)		NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			ACGAGGAACTGAACAAGCTGC	0.582																																							uc001etd.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(280-282)CTG>CTA		histone cluster 2, H2ac							71.0	71.0	71.0					1																	149858806		2203	4298	6501	SO:0001819	synonymous_variant	8338				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr1:149858806G>A	AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.282G>A	1.37:g.149858806G>A						HIST2H2BE_uc001etc.2_5'Flank	p.L94L	NM_003517	NP_003508	Q16777	H2A2C_HUMAN	STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)		1	282	+	Breast(34;0.0124)|all_hematologic(923;0.127)		94					Q6DRA7|Q8IUE5	Silent	SNP	ENST00000331380.2	37	c.282G>A	CCDS937.1																																																																																				0.582	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087128.1	NM_003517		21	121	0	0	0	0.001882	0	21	121				
DUSP27	92235	broad.mit.edu	37	1	167097145	167097145	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:167097145G>A	ENST00000361200.2	+	6	2943	c.2777G>A	c.(2776-2778)aGa>aAa	p.R926K	DUSP27_ENST00000271385.5_Missense_Mutation_p.R926K|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Missense_Mutation_p.R926K			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	926	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R926K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AGTGGCAGCAGAGTTGGCAAA	0.488																																							uc001geb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2776-2778)AGA>AAA		dual specificity phosphatase 27							61.0	55.0	57.0					1																	167097145		2203	4300	6503	SO:0001583	missense	92235				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity	g.chr1:167097145G>A	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2777G>A	1.37:g.167097145G>A	ENSP00000354483:p.Arg926Lys						p.R926K	NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN			5	2777	+			926			Ser-rich.		A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	c.2777G>A	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.703932	0.30232	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03065	4.06;4.06;4.06	4.45	3.45	0.39498	.	0.534882	0.17356	N	0.177217	T	0.01254	0.0041	L	0.51422	1.61	0.09310	N	0.999996	B	0.26672	0.156	B	0.22386	0.039	T	0.46762	-0.9168	10	0.46703	T	0.11	-9.1628	1.4127	0.02295	0.1422:0.1931:0.4308:0.2339	.	926	Q5VZP5	DUS27_HUMAN	K	926	ENSP00000354483:R926K;ENSP00000271385:R926K;ENSP00000404874:R926K	ENSP00000271385:R926K	R	+	2	0	DUSP27	165363769	0.039000	0.19947	0.911000	0.35937	0.974000	0.67602	2.387000	0.44389	2.280000	0.76307	0.643000	0.83706	AGA		0.488	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		4	50	0	0	0	0.000248	0	4	50				
DCAF6	55827	broad.mit.edu	37	1	167944145	167944145	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:167944145G>C	ENST00000312263.6	+	4	534	c.330G>C	c.(328-330)caG>caC	p.Q110H	DCAF6_ENST00000470919.1_3'UTR|DCAF6_ENST00000367840.3_Missense_Mutation_p.Q110H|DCAF6_ENST00000367843.3_Missense_Mutation_p.Q110H|DCAF6_ENST00000432587.2_Missense_Mutation_p.Q79H	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	110					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.Q110H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						ATGATAAACAGATTGTATCCT	0.373																																							uc001gew.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(328-330)CAG>CAC		IQ motif and WD repeats 1 isoform b							118.0	113.0	114.0					1																	167944145		2203	4300	6503	SO:0001583	missense	55827				positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity	g.chr1:167944145G>C	AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.330G>C	1.37:g.167944145G>C	ENSP00000311949:p.Gln110His					DCAF6_uc001gev.2_Missense_Mutation_p.Q110H|DCAF6_uc001gex.2_Missense_Mutation_p.Q110H|DCAF6_uc010plk.1_Missense_Mutation_p.Q79H|DCAF6_uc001gey.2_5'UTR	p.Q110H	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN			4	572	+			110			WD 2.		A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Missense_Mutation	SNP	ENST00000312263.6	37	c.330G>C	CCDS30933.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459568	0.63401	.	.	ENSG00000143164	ENST00000367843;ENST00000432587;ENST00000312263;ENST00000367840	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	4.92	0.97	0.19692	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.058805	0.64402	D	0.000001	T	0.69744	0.3145	N	0.19112	0.55	0.80722	D	1.000000	D;D;P;D	0.76494	0.999;0.999;0.526;0.996	D;D;B;P	0.71184	0.972;0.967;0.131;0.878	T	0.70339	-0.4899	9	0.44086	T	0.13	.	9.8397	0.40991	0.2742:0.0:0.7258:0.0	.	79;110;110;110	B4DNB8;Q58WW2-3;Q58WW2;Q58WW2-2	.;.;DCAF6_HUMAN;.	H	110;79;110;110	ENSP00000356817:Q110H;ENSP00000396238:Q79H;ENSP00000311949:Q110H;ENSP00000356814:Q110H	ENSP00000311949:Q110H	Q	+	3	2	DCAF6	166210769	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	2.839000	0.48207	-0.012000	0.14223	-0.234000	0.12200	CAG		0.373	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083661.2	NM_018442		15	82	0	0	0	0.004007	0	15	82				
F5	2153	broad.mit.edu	37	1	169487715	169487715	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:169487715C>G	ENST00000367797.3	-	23	6481	c.6280G>C	c.(6280-6282)Gat>Cat	p.D2094H	F5_ENST00000367796.3_Missense_Mutation_p.D2099H	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	2094	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.D2094H(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TCCCAGTAATCTCCCCACCAA	0.463																																							uc001ggg.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(6280-6282)GAT>CAT		coagulation factor V precursor	Drotrecogin alfa(DB00055)						149.0	147.0	148.0					1																	169487715		2203	4300	6503	SO:0001583	missense	2153				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity	g.chr1:169487715C>G	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.6280G>C	1.37:g.169487715C>G	ENSP00000356771:p.Asp2094His						p.D2094H	NM_000130	NP_000121	P12259	FA5_HUMAN			23	6425	-	all_hematologic(923;0.208)		2094			F5/8 type C 2.		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	c.6280G>C	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.822868	0.32237	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98234	-4.81;-4.81	5.67	-0.682	0.11339	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.464289	0.22950	N	0.053664	D	0.90380	0.6989	L	0.38649	1.16	0.27904	N	0.938872	B	0.26081	0.141	B	0.23150	0.044	T	0.81437	-0.0933	9	0.41790	T	0.15	-3.2759	5.5898	0.17295	0.0:0.3711:0.1403:0.4886	.	2094	P12259	FA5_HUMAN	H	2094;2099	ENSP00000356771:D2094H;ENSP00000356770:D2099H	ENSP00000356770:D2099H	D	-	1	0	F5	167754339	0.208000	0.23494	0.939000	0.37840	0.962000	0.63368	0.591000	0.23969	-0.148000	0.11234	0.591000	0.81541	GAT		0.463	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		9	71	0	0	0	0.006214	0	9	71				
MRPS14	63931	broad.mit.edu	37	1	174983875	174983875	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:174983875A>G	ENST00000476371.1	-	3	333	c.317T>C	c.(316-318)cTt>cCt	p.L106P	MRPS14_ENST00000498253.1_5'UTR	NM_022100.2	NP_071383.1			mitochondrial ribosomal protein S14									p.L106P(1)		large_intestine(2)|lung(5)|pancreas(1)|prostate(2)	10						TATACGACTAAGCCTCCAGCG	0.537																																							uc001gkk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(316-318)CTT>CCT		mitochondrial ribosomal protein S14							134.0	127.0	129.0					1																	174983875		2203	4300	6503	SO:0001583	missense	63931				translation	mitochondrial ribosome	protein binding|structural constituent of ribosome	g.chr1:174983875A>G	AB051350	CCDS1316.1	1q25.1	2012-09-13			ENSG00000120333	ENSG00000120333		"""Mitochondrial ribosomal proteins / small subunits"""	14049	protein-coding gene	gene with protein product		611978					Standard	NR_037606		Approved	HSMRPS14	uc001gkk.3	O60783	OTTHUMG00000034878	ENST00000476371.1:c.317T>C	1.37:g.174983875A>G	ENSP00000420714:p.Leu106Pro					MRPS14_uc009wwr.2_Missense_Mutation_p.L91P	p.L106P	NM_022100	NP_071383	O60783	RT14_HUMAN			3	334	-			106						Missense_Mutation	SNP	ENST00000476371.1	37	c.317T>C	CCDS1316.1	.	.	.	.	.	.	.	.	.	.	A	32	5.144570	0.94603	.	.	ENSG00000120333	ENST00000476371	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.87589	0.6215	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.91020	0.4856	9	0.87932	D	0	-17.0914	16.8222	0.85835	1.0:0.0:0.0:0.0	.	106	O60783	RT14_HUMAN	P	106	.	ENSP00000420714:L106P	L	-	2	0	MRPS14	173250498	1.000000	0.71417	0.967000	0.41034	0.982000	0.71751	9.109000	0.94291	2.371000	0.80710	0.533000	0.62120	CTT		0.537	MRPS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084416.2	NM_022100		6	107	0	0	0	0.001168	0	6	107				
CEP350	9857	broad.mit.edu	37	1	180062921	180062921	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:180062921C>G	ENST00000367607.3	+	34	8099	c.7681C>G	c.(7681-7683)Caa>Gaa	p.Q2561E	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2561					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.Q2561E(2)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TGCTCCTCCTCAAAAAATATC	0.343																																							uc001gnt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(7681-7683)CAA>GAA		centrosome-associated protein 350							59.0	66.0	64.0					1																	180062921		2203	4299	6502	SO:0001583	missense	9857					centrosome|nucleus|spindle		g.chr1:180062921C>G	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.7681C>G	1.37:g.180062921C>G	ENSP00000356579:p.Gln2561Glu					CEP350_uc009wxl.2_Missense_Mutation_p.Q2560E|CEP350_uc001gnv.2_Missense_Mutation_p.Q696E|CEP350_uc001gnw.1_Missense_Mutation_p.Q318E|CEP350_uc001gnx.1_Missense_Mutation_p.Q318E	p.Q2561E	NM_014810	NP_055625	Q5VT06	CE350_HUMAN			34	8064	+			2561					O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	c.7681C>G	CCDS1336.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.60|14.60	2.583694|2.583694	0.46006|0.46006	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000367607;ENST00000417046|ENST00000429851	T;T|.	0.73363|.	-0.74;-0.74|.	5.72|5.72	5.72|5.72	0.89469|0.89469	Cytoskeleton-associated protein, Gly-rich domain (3);|.	0.000000|.	0.47093|.	D|.	0.000255|.	T|.	0.50480|.	0.1618|.	N|N	0.12422|0.12422	0.21|0.21	0.44000|0.44000	D|D	0.996703|0.996703	P;P|.	0.45428|.	0.598;0.858|.	P;D|.	0.65684|.	0.545;0.937|.	T|.	0.44081|.	-0.9351|.	9|.	.|.	.|.	.|.	.|.	19.8548|19.8548	0.96752|0.96752	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2561;2561|.	E7EU22;Q5VT06|.	.;CE350_HUMAN|.	E|X	2561;25|735	ENSP00000356579:Q2561E;ENSP00000401608:Q25E|.	.|.	Q|S	+|+	1|2	0|0	CEP350|CEP350	178329544|178329544	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.700000|2.700000	0.47085|0.47085	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	CAA|TCA		0.343	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		16	90	0	0	0	0.004007	0	16	90				
YOD1	55432	broad.mit.edu	37	1	207222742	207222742	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:207222742C>T	ENST00000315927.4	-	2	716	c.670G>A	c.(670-672)Gag>Aag	p.E224K	PFKFB2_ENST00000411990.2_5'Flank|YOD1_ENST00000367084.1_Missense_Mutation_p.E180K|YOD1_ENST00000391927.1_Missense_Mutation_p.E180K	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	224	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.E224K(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					ATCGATATCTCTATTGCTCCT	0.403																																							uc001hfe.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)	1						c.(670-672)GAG>AAG		YOD1 OTU deubiquinating enzyme 1 homolog							191.0	189.0	190.0					1																	207222742		2203	4300	6503	SO:0001583	missense	55432				cellular amino acid metabolic process|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein K48-linked deubiquitination|protein K63-linked deubiquitination	intracellular	protein binding|ubiquitin-specific protease activity|zinc ion binding	g.chr1:207222742C>T		CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.670G>A	1.37:g.207222742C>T	ENSP00000326813:p.Glu224Lys					PFKFB2_uc010psc.1_Intron|YOD1_uc001hff.1_Missense_Mutation_p.E180K	p.E224K	NM_018566	NP_061036	Q5VVQ6	OTU1_HUMAN			2	717	-	Prostate(682;0.19)		224			OTU.		B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Missense_Mutation	SNP	ENST00000315927.4	37	c.670G>A	CCDS31002.1	.	.	.	.	.	.	.	.	.	.	C	29.4	4.998956	0.93227	.	.	ENSG00000180667	ENST00000367084;ENST00000315927;ENST00000391927	T;T;T	0.35789	1.29;1.29;1.29	5.71	5.71	0.89125	Ovarian tumour, otubain (2);	0.046947	0.85682	D	0.000000	T	0.71542	0.3352	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.79110	-0.1938	10	0.87932	D	0	-0.6158	18.846	0.92208	0.0:1.0:0.0:0.0	.	180;224	Q5VVQ6-2;Q5VVQ6	.;OTU1_HUMAN	K	180;224;180	ENSP00000356051:E180K;ENSP00000326813:E224K;ENSP00000375793:E180K	ENSP00000326813:E224K	E	-	1	0	YOD1	205289365	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.653000	0.83643	2.687000	0.91594	0.655000	0.94253	GAG		0.403	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087837.1	NM_018566		44	179	0	0	0	0.00361	0	44	179				
CENPF	1063	broad.mit.edu	37	1	214816089	214816089	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:214816089G>C	ENST00000366955.3	+	12	4576	c.4408G>C	c.(4408-4410)Gag>Cag	p.E1470Q		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1566	2 X 96 AA approximate tandem repeats.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.E1470Q(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GGGCTTGGAGGAGGGGCTCGT	0.478																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(4408-4410)GAG>CAG		centromere protein F							70.0	69.0	70.0					1																	214816089		2203	4300	6503	SO:0001583	missense	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214816089G>C	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4408G>C	1.37:g.214816089G>C	ENSP00000355922:p.Glu1470Gln						p.E1470Q	NM_016343	NP_057427	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	12	4582	+			1566		Missing.	1-2.|2 X 96 AA approximate tandem repeats.		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	c.4408G>C	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	8.064	0.768826	0.15983	.	.	ENSG00000117724	ENST00000366955	T	0.33654	1.4	4.73	4.73	0.59995	.	0.704021	0.11656	N	0.542353	T	0.24736	0.0600	L	0.29908	0.895	0.09310	N	1	P	0.49185	0.92	B	0.41036	0.346	T	0.02713	-1.1120	10	0.15499	T	0.54	.	8.6306	0.33917	0.0:0.1518:0.6681:0.1801	.	1470	P49454	CENPF_HUMAN	Q	1470	ENSP00000355922:E1470Q	ENSP00000355922:E1470Q	E	+	1	0	CENPF	212882712	0.014000	0.17966	0.059000	0.19551	0.022000	0.10575	0.585000	0.23879	2.334000	0.79466	0.655000	0.94253	GAG		0.478	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		23	51	0	0	0	0.00278	0	23	51				
PYCR2	29920	broad.mit.edu	37	1	226109325	226109325	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:226109325G>A	ENST00000343818.6	-	5	708	c.560C>T	c.(559-561)gCa>gTa	p.A187V	RP4-559A3.7_ENST00000432920.2_Missense_Mutation_p.A113V|PYCR2_ENST00000478402.1_5'UTR	NM_013328.2	NP_037460.2	Q96C36	P5CR2_HUMAN	pyrroline-5-carboxylate reductase family, member 2	187					L-proline biosynthetic process (GO:0055129)	cytoplasm (GO:0005737)	pyrroline-5-carboxylate reductase activity (GO:0004735)	p.A187V(1)		kidney(1)|lung(3)	4	Breast(184;0.197)				L-Proline(DB00172)	ATCAGCCAATGCGTCCAGAGC	0.562																																							uc010pvj.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(337-339)GCA>GTA		SubName: Full=cDNA FLJ54750, moderately similar to Pyrroline-5-carboxylate reductase 2 (EC 1.5.1.2);							84.0	82.0	83.0					1																	226109325		2203	4300	6503	SO:0001583	missense	10637				cell growth|multicellular organismal development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity|transforming growth factor beta receptor binding	g.chr1:226109325G>A	AF151351	CCDS31043.1, CCDS73039.1	1q42.13	2008-02-05			ENSG00000143811	ENSG00000143811			30262	protein-coding gene	gene with protein product						12477932	Standard	NM_013328		Approved	P5CR2	uc001hpq.4	Q96C36	OTTHUMG00000037506	ENST00000343818.6:c.560C>T	1.37:g.226109325G>A	ENSP00000342502:p.Ala187Val					PYCR2_uc001hpp.2_Intron|PYCR2_uc001hpq.2_Missense_Mutation_p.A187V|PYCR2_uc001hpr.2_Missense_Mutation_p.A140V	p.A113V			O75610	LFTY1_HUMAN			4	493	-	Breast(184;0.197)		Error:Variant_position_missing_in_O75610_after_alignment					A8K798|Q7Z515|Q9Y5J4	Missense_Mutation	SNP	ENST00000343818.6	37	c.338C>T	CCDS31043.1	.	.	.	.	.	.	.	.	.	.	g	15.50	2.852255	0.51270	.	.	ENSG00000255835;ENSG00000143811;ENSG00000143811	ENST00000432920;ENST00000343818;ENST00000316940	D;D	0.87650	-2.28;-2.28	4.83	3.92	0.45320	6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	D	0.92120	0.7502	M	0.88105	2.93	0.58432	D	0.999999	D;D	0.69078	0.978;0.997	B;P	0.56278	0.225;0.795	D	0.92946	0.6376	10	0.87932	D	0	-22.047	11.2003	0.48736	0.0899:0.0:0.9101:0.0	.	113;187	E7EUD8;Q96C36	.;P5CR2_HUMAN	V	113;187;186	ENSP00000414068:A113V;ENSP00000342502:A187V	ENSP00000321781:A186V	A	-	2	0	PYCR2;RP4-559A3.7	224175948	1.000000	0.71417	0.014000	0.15608	0.020000	0.10135	9.547000	0.98100	1.392000	0.46585	-0.140000	0.14226	GCA		0.562	PYCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091314.1	NM_013328		10	58	0	0	0	0.000978	0	10	58				
TBCE	6905	broad.mit.edu	37	1	235577809	235577809	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:235577809A>G	ENST00000366601.3	+	4	423	c.247A>G	c.(247-249)Act>Gct	p.T83A	TBCE_ENST00000543662.1_Missense_Mutation_p.T83A|TBCE_ENST00000472011.1_3'UTR|TBCE_ENST00000406207.1_Missense_Mutation_p.T83A			Q15813	TBCE_HUMAN	tubulin folding cofactor E	83					'de novo' posttranslational protein folding (GO:0051084)|adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|microtubule cytoskeleton organization (GO:0000226)|muscle atrophy (GO:0014889)|peripheral nervous system neuron axonogenesis (GO:0048936)|post-chaperonin tubulin folding pathway (GO:0007023)|post-embryonic development (GO:0009791)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	chaperone binding (GO:0051087)			NS(1)|endometrium(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	14	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			AGACTTTCTTACTGCAATTAA	0.388																																							uc001hwz.1		NA																	0					0						c.(247-249)ACT>GCT		beta-tubulin cofactor E							115.0	118.0	117.0					1																	235577809		2203	4300	6503	SO:0001583	missense	6905				'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding	g.chr1:235577809A>G	U61232	CCDS1605.1, CCDS73052.1	1q42.3	2014-02-04	2006-11-21		ENSG00000116957	ENSG00000116957			11582	protein-coding gene	gene with protein product		604934	"""tubulin-specific chaperone e"", ""Kenny-Caffey syndrome"", ""hypoparathyroidism, growth and mental retardation, and dysmorphism"""	KCS, HRD		8706133, 9806825, 12389028	Standard	NM_001079515		Approved	KCS1, pac2	uc001hxa.1	Q15813	OTTHUMG00000039987	ENST00000366601.3:c.247A>G	1.37:g.235577809A>G	ENSP00000355560:p.Thr83Ala					TBCE_uc010pxq.1_RNA|TBCE_uc001hxa.1_Missense_Mutation_p.T83A|TBCE_uc010pxr.1_Missense_Mutation_p.T83A|TBCE_uc001hxb.1_5'UTR	p.T83A	NM_003193	NP_003184	Q15813	TBCE_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)		4	370	+	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	83					A8K8C2|B7Z3P1	Missense_Mutation	SNP	ENST00000366601.3	37	c.247A>G	CCDS1605.1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.420207	0.42918	.	.	ENSG00000116957	ENST00000366601;ENST00000406207;ENST00000543662	T;T;T	0.40756	1.02;1.02;1.02	5.48	5.48	0.80851	Cytoskeleton-associated protein, Gly-rich domain (2);	0.044333	0.85682	D	0.000000	T	0.35278	0.0926	L	0.46614	1.455	0.48452	D	0.999658	B;B	0.20459	0.045;0.002	B;B	0.17098	0.017;0.004	T	0.13791	-1.0496	10	0.31617	T	0.26	-24.9549	10.5665	0.45175	0.8554:0.0:0.0:0.1446	.	83;83	B7Z3P1;Q15813	.;TBCE_HUMAN	A	83	ENSP00000355560:T83A;ENSP00000384571:T83A;ENSP00000439170:T83A	ENSP00000355560:T83A	T	+	1	0	TBCE	233644432	0.998000	0.40836	0.998000	0.56505	0.925000	0.55904	3.850000	0.55918	2.202000	0.70862	0.477000	0.44152	ACT		0.388	TBCE-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096458.3	NM_003193		3	122	0	0	0	0.000248	0	3	122				
OR2W5	441932	broad.mit.edu	37	1	247655099	247655099	+	RNA	SNP	C	C	T	rs201670897		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:247655099C>T	ENST00000522351.1	+	0	730							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R224C(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TGATTGCAGCCGCGGTGCTGA	0.567																																							uc001icz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)|skin(1)	3						c.(670-672)CGC>TGC		olfactory receptor, family 2, subfamily W,							117.0	113.0	114.0					1																	247655099		2203	4300	6503			441932				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247655099C>T			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655099C>T							p.R224C	NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)		1	670	+	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	224					B9EH85	Missense_Mutation	SNP	ENST00000522351.1	37	c.670C>T																																																																																					0.567	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698		21	85	0	0	0	0.008871	0	21	85				
OR11L1	391189	broad.mit.edu	37	1	248004717	248004717	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr1:248004717A>G	ENST00000355784.2	-	1	537	c.482T>C	c.(481-483)cTg>cCg	p.L161P		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	161						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L161P(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGAAATCATCAGGGAAGGCAG	0.557																																							uc001idn.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(481-483)CTG>CCG		olfactory receptor, family 11, subfamily L,							88.0	87.0	87.0					1																	248004717		2203	4300	6503	SO:0001583	missense	391189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248004717A>G	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.482T>C	1.37:g.248004717A>G	ENSP00000348033:p.Leu161Pro						p.L161P	NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		1	482	-	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		161			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000355784.2	37	c.482T>C	CCDS31098.1	.	.	.	.	.	.	.	.	.	.	A	13.46	2.244959	0.39697	.	.	ENSG00000197591	ENST00000355784	T	0.42513	0.97	4.42	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.000000	0.29908	U	0.010899	T	0.48978	0.1530	L	0.43701	1.375	0.09310	N	0.999997	D	0.64830	0.994	D	0.67725	0.953	T	0.34576	-0.9823	10	0.45353	T	0.12	.	6.074	0.19905	0.7452:0.1665:0.0883:0.0	.	161	Q8NGX0	O11L1_HUMAN	P	161	ENSP00000348033:L161P	ENSP00000348033:L161P	L	-	2	0	OR11L1	246071340	0.000000	0.05858	0.951000	0.38953	0.741000	0.42261	1.042000	0.30303	1.983000	0.57843	0.443000	0.29094	CTG		0.557	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959		4	132	0	0	0	0.000248	0	4	132				
MARCH8	220972	broad.mit.edu	37	10	45956749	45956749	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr10:45956749G>A	ENST00000319836.3	-	5	1102	c.353C>T	c.(352-354)tCc>tTc	p.S118F	MARCH8_ENST00000395769.2_Missense_Mutation_p.S118F|MARCH8_ENST00000453424.2_Missense_Mutation_p.S400F|MARCH8_ENST00000395771.3_Missense_Mutation_p.S118F|MARCH8_ENST00000476962.1_5'UTR	NM_145021.4	NP_659458.2	Q5T0T0	MARH8_HUMAN	membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase	118					immune system process (GO:0002376)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S118F(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	12						GCGCGTGTCGGAGCTCTTGAT	0.572																																					NSCLC(102;658 1594 2173 16344 34808)	NSCLC(102;658 1594 2173 16344 34808)	uc001jci.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(352-354)TCC>TTC		cellular modulator of immune recognition isoform							72.0	68.0	69.0					10																	45956749		2203	4300	6503	SO:0001583	missense	220972					cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding	g.chr10:45956749G>A	AL833316	CCDS7213.1, CCDS60519.1	10q11.22	2013-01-09	2012-02-23	2005-01-27	ENSG00000165406	ENSG00000165406		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	23356	protein-coding gene	gene with protein product		613335	"""c-mir, cellular modulator of immune recognition"", ""membrane-associated ring finger (C3HC4) 8"""	MIR		12582153, 14722266	Standard	XM_005271804		Approved	c-MIR, MARCH-VIII, RNF178	uc001jch.2	Q5T0T0	OTTHUMG00000019345	ENST00000319836.3:c.353C>T	10.37:g.45956749G>A	ENSP00000317087:p.Ser118Phe					MARCH8_uc001jch.2_Missense_Mutation_p.S400F|MARCH8_uc001jcj.1_Missense_Mutation_p.S118F|MARCH8_uc001jck.1_Missense_Mutation_p.S118F|MARCH8_uc001jcg.1_5'UTR	p.S118F	NM_001002266	NP_001002266	Q5T0T0	MARH8_HUMAN			5	592	-			118			RING-CH-type.		B2R8E7|H0Y7C6|Q5T0S8|Q8TC72	Missense_Mutation	SNP	ENST00000319836.3	37	c.353C>T	CCDS7213.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.830629	0.91036	.	.	ENSG00000165406	ENST00000395771;ENST00000319836;ENST00000395769	T;T;T	0.48201	0.82;0.82;0.82	5.72	5.72	0.89469	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-CH-type (2);	0.000000	0.85682	D	0.000000	T	0.80160	0.4572	H	0.96604	3.85	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.989	D	0.86101	0.1556	10	0.87932	D	0	-34.5056	17.7332	0.88384	0.0:0.0:1.0:0.0	.	118;282	Q5T0T0;Q5JQ16	MARH8_HUMAN;.	F	118	ENSP00000379118:S118F;ENSP00000317087:S118F;ENSP00000379116:S118F	ENSP00000317087:S118F	S	-	2	0	MARCH8	45276755	1.000000	0.71417	0.971000	0.41717	0.724000	0.41520	9.813000	0.99286	2.865000	0.98341	0.655000	0.94253	TCC		0.572	MARCH8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051217.1	NM_145021		11	63	0	0	0	0.001855	0	11	63				
ELOVL3	83401	broad.mit.edu	37	10	103988655	103988655	+	Silent	SNP	C	C	G	rs200491455	byFrequency	TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr10:103988655C>G	ENST00000370005.3	+	4	680	c.459C>G	c.(457-459)ctC>ctG	p.L153L		NM_152310.1	NP_689523.1	Q9HB03	ELOV3_HUMAN	ELOVL fatty acid elongase 3	153					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.L153L(1)		breast(2)|lung(10)|ovary(2)|prostate(1)|skin(1)	16		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		GCACAGTGCTCGTGTACACAA	0.498																																							uc001kut.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(457-459)CTC>CTG		elongation of very long chain fatty acids like							149.0	137.0	141.0					10																	103988655		2203	4300	6503	SO:0001819	synonymous_variant	83401				fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding	g.chr10:103988655C>G	AF292387	CCDS7531.1	10q24	2011-05-25	2011-05-25		ENSG00000119915	ENSG00000119915			18047	protein-coding gene	gene with protein product		611815	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3"""				Standard	NM_152310		Approved	CIG-30	uc001kut.3	Q9HB03	OTTHUMG00000018951	ENST00000370005.3:c.459C>G	10.37:g.103988655C>G							p.L153L	NM_152310	NP_689523	Q9HB03	ELOV3_HUMAN		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)	4	622	+		Colorectal(252;0.207)	153					Q5VZL3|Q8N180	Silent	SNP	ENST00000370005.3	37	c.459C>G	CCDS7531.1																																																																																				0.498	ELOVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050030.1	NM_152310		17	118	0	0	0	0.007413	0	17	118				
DCLRE1A	9937	broad.mit.edu	37	10	115609962	115609962	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr10:115609962G>C	ENST00000361384.2	-	2	1819	c.902C>G	c.(901-903)tCt>tGt	p.S301C	DCLRE1A_ENST00000369305.1_Missense_Mutation_p.S301C	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	301					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)		p.S301C(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		TTGAAGTGGAGAATAGGAGAT	0.403								Other identified genes with known or suspected DNA repair function																															uc001law.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(901-903)TCT>TGT	Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function	DNA cross-link repair 1A							134.0	126.0	128.0					10																	115609962		2203	4300	6503	SO:0001583	missense	9937				cell division|mitosis	nucleus	hydrolase activity	g.chr10:115609962G>C		CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.902C>G	10.37:g.115609962G>C	ENSP00000355185:p.Ser301Cys						p.S301C	NM_014881	NP_055696	Q6PJP8	DCR1A_HUMAN		Epithelial(162;0.0157)|all cancers(201;0.0171)	2	1820	-			301					D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Missense_Mutation	SNP	ENST00000361384.2	37	c.902C>G	CCDS7584.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468374	0.84533	.	.	ENSG00000198924	ENST00000361384;ENST00000369305	T;T	0.78364	-1.17;-1.17	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.88440	0.6437	M	0.76574	2.34	0.50039	D	0.99984	D	0.89917	1.0	D	0.87578	0.998	D	0.88629	0.3168	10	0.87932	D	0	-23.2022	18.7178	0.91682	0.0:0.0:1.0:0.0	.	301	Q6PJP8	DCR1A_HUMAN	C	301	ENSP00000355185:S301C;ENSP00000358311:S301C	ENSP00000355185:S301C	S	-	2	0	DCLRE1A	115599952	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.256000	0.78350	2.857000	0.98124	0.650000	0.86243	TCT		0.403	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1	NM_014881		16	115	0	0	0	0.003163	0	16	115				
CFAP46	54777	broad.mit.edu	37	10	134647588	134647588	+	Silent	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr10:134647588C>T	ENST00000368586.5	-	49	7006	c.6906G>A	c.(6904-6906)tcG>tcA	p.S2302S	TTC40_ENST00000263170.5_Silent_p.S463S	NM_001200049.2	NP_001186978.2												p.S463S(1)|p.S2302S(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CTTTGCCCTTCGACTTCCCTG	0.522																																							uc010qux.1		NA																	2	Substitution - coding silent(2)		lung(2)		NA						c.(6082-6084)TCG>TCA		Homo sapiens cDNA, FLJ17989.							210.0	191.0	197.0					10																	134647588		2203	4300	6503	SO:0001819	synonymous_variant	0							g.chr10:134647588C>T																												ENST00000368586.5:c.6906G>A	10.37:g.134647588C>T							p.S2028S	NM_017609	NP_060079					41	6084	-									Silent	SNP	ENST00000368586.5	37	c.6084G>A	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	C	4.879	0.163397	0.09287	.	.	ENSG00000171811	ENST00000448925	.	.	.	3.98	-6.72	0.01755	.	.	.	.	.	T	0.31796	0.0808	.	.	.	0.31285	N	0.690186	.	.	.	.	.	.	T	0.39035	-0.9633	4	.	.	.	.	6.3015	0.21115	0.1127:0.1001:0.6291:0.1582	.	.	.	.	Q	71	.	.	R	-	2	0	C10orf93	134497578	0.001000	0.12720	0.012000	0.15200	0.085000	0.17905	-0.437000	0.06914	-1.383000	0.02106	-1.631000	0.00782	CGA		0.522	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3			14	120	0	0	0	0.004007	0	14	120				
MUC15	143662	broad.mit.edu	37	11	26584813	26584813	+	Splice_Site	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr11:26584813C>G	ENST00000455601.2	-	3	813		c.e3-1		MUC15_ENST00000527569.1_Intron|ANO3_ENST00000537978.1_Intron|MUC15_ENST00000529533.1_Splice_Site|ANO3_ENST00000525139.1_Intron|MUC15_ENST00000436318.2_Splice_Site|MUC15_ENST00000281268.8_Intron|ANO3_ENST00000256737.3_Intron|ANO3_ENST00000531568.1_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						TTTCTATTTTCTACAGGACaa	0.318																																							uc001mqx.2		NA																	1	Unknown(1)		lung(1)	ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.e3-1		mucin 15 isoform b							54.0	57.0	56.0					11																	26584813		2203	4299	6502	SO:0001630	splice_region_variant	143662					extracellular region|integral to membrane|plasma membrane		g.chr11:26584813C>G	AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.695-1G>C	11.37:g.26584813C>G						ANO3_uc010rdr.1_Intron|ANO3_uc001mqt.3_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Splice_Site_p.E259_splice|MUC15_uc001mqy.2_Intron	p.E232_splice	NM_145650	NP_663625	Q8N387	MUC15_HUMAN			3	961	-								B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Splice_Site	SNP	ENST00000455601.2	37	c.695_splice	CCDS7859.1	.	.	.	.	.	.	.	.	.	.	C	7.932	0.740876	0.15642	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000529533	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0384	0.53438	0.0:0.8249:0.1751:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MUC15	26541389	1.000000	0.71417	0.924000	0.36721	0.188000	0.23474	2.871000	0.48459	2.132000	0.65825	0.555000	0.69702	.		0.318	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387866.1	NM_145650	Intron	9	58	0	0	0	0.004482	0	9	58				
HIPK3	10114	broad.mit.edu	37	11	33374837	33374837	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr11:33374837C>T	ENST00000303296.4	+	17	3676	c.3371C>T	c.(3370-3372)tCa>tTa	p.S1124L	HIPK3_ENST00000456517.1_Missense_Mutation_p.S1103L|AL122015.1_ENST00000411202.1_RNA|HIPK3_ENST00000525975.1_Missense_Mutation_p.S1103L|HIPK3_ENST00000379016.3_Missense_Mutation_p.S1103L	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	1124					apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S1124L(1)		endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						TACCCATCATCAGCCACCCTC	0.517																																							uc001mul.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						c.(3370-3372)TCA>TTA		homeodomain interacting protein kinase 3 isoform							225.0	185.0	199.0					11																	33374837		2202	4298	6500	SO:0001583	missense	10114				anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity	g.chr11:33374837C>T	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.3371C>T	11.37:g.33374837C>T	ENSP00000304226:p.Ser1124Leu					HIPK3_uc001mum.1_Missense_Mutation_p.S1103L|HIPK3_uc009yjv.1_Missense_Mutation_p.S1103L	p.S1124L	NM_005734	NP_005725	Q9H422	HIPK3_HUMAN			17	3641	+			1124					O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	37	c.3371C>T	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	C	16.06	3.015360	0.54468	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.54675	0.58;0.56;0.58;0.58	6.16	6.16	0.99307	.	0.130230	0.35067	N	0.003465	T	0.57577	0.2063	L	0.55481	1.735	0.80722	D	1	B;B	0.34147	0.438;0.311	B;B	0.38985	0.287;0.15	T	0.54036	-0.8353	10	0.49607	T	0.09	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	1103;1124	Q9H422-2;Q9H422	.;HIPK3_HUMAN	L	1103;1124;1103;1103	ENSP00000431710:S1103L;ENSP00000304226:S1124L;ENSP00000368301:S1103L;ENSP00000398241:S1103L	ENSP00000304226:S1124L	S	+	2	0	HIPK3	33331413	1.000000	0.71417	1.000000	0.80357	0.114000	0.19823	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	TCA		0.517	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734		11	143	0	0	0	0.000978	0	11	143				
RNF169	254225	broad.mit.edu	37	11	74546756	74546756	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr11:74546756G>C	ENST00000299563.4	+	6	1121	c.1108G>C	c.(1108-1110)Gag>Cag	p.E370Q		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	370					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)	p.E370Q(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						TGTCAGCCCTGAGAGCAATGA	0.532																																							uc001ovl.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1108-1110)GAG>CAG		ring finger protein 169							148.0	153.0	151.0					11																	74546756		2054	4205	6259	SO:0001583	missense	254225						zinc ion binding	g.chr11:74546756G>C	AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.1108G>C	11.37:g.74546756G>C	ENSP00000299563:p.Glu370Gln					XRRA1_uc001ovm.2_Intron	p.E370Q	NM_001098638	NP_001092108	Q8NCN4	RN169_HUMAN			6	1121	+			370					Q6N015	Missense_Mutation	SNP	ENST00000299563.4	37	c.1108G>C	CCDS41691.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591389	0.86851	.	.	ENSG00000166439	ENST00000299563	T	0.57595	0.39	6.05	6.05	0.98169	.	0.044001	0.85682	D	0.000000	T	0.74458	0.3719	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.75944	-0.3139	10	0.87932	D	0	-15.5235	18.0951	0.89487	0.0:0.0:1.0:0.0	.	370	Q8NCN4	RN169_HUMAN	Q	370	ENSP00000299563:E370Q	ENSP00000299563:E370Q	E	+	1	0	RNF169	74224404	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.230000	0.95299	2.878000	0.98634	0.650000	0.86243	GAG		0.532	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384741.1	XM_495886		11	134	0	0	0	0.001368	0	11	134				
C2CD2L	9854	broad.mit.edu	37	11	118986936	118986936	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr11:118986936G>A	ENST00000336702.3	+	14	2453	c.2094G>A	c.(2092-2094)aaG>aaA	p.K698K	C2CD2L_ENST00000528586.1_3'UTR	NM_014807.3	NP_055622.3	O14523	C2C2L_HUMAN	C2CD2-like	697						integral component of membrane (GO:0016021)		p.K698K(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						CCAAACCCAAGGCCAATGGTA	0.587																																							uc001pvo.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2089-2091)AAG>AAA		transmembrane protein 24							78.0	79.0	79.0					11																	118986936		2200	4295	6495	SO:0001819	synonymous_variant	9854					integral to membrane		g.chr11:118986936G>A	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000336702.3:c.2094G>A	11.37:g.118986936G>A						C2CD2L_uc001pvn.2_Silent_p.K698K	p.K697K	NM_014807	NP_055622	O14523	C2C2L_HUMAN			14	2450	+			697					Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Silent	SNP	ENST00000336702.3	37	c.2091G>A	CCDS8413.1																																																																																				0.587	C2CD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388197.2	NM_014807		4	54	0	0	0	0.000602	0	4	54				
GLB1L2	89944	broad.mit.edu	37	11	134240907	134240907	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr11:134240907C>G	ENST00000535456.2	+	13	1409	c.1221C>G	c.(1219-1221)atC>atG	p.I407M	GLB1L2_ENST00000339772.7_Missense_Mutation_p.I407M|GLB1L2_ENST00000389881.3_Missense_Mutation_p.I407M|GLB1L2_ENST00000529077.1_3'UTR	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	407					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)	p.I407M(3)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		CGCAGCCAATCAAGTCTGAAA	0.567																																							uc001qhp.2		NA																	3	Substitution - Missense(3)		lung(3)	ovary(1)|pancreas(1)|skin(1)	3						c.(1219-1221)ATC>ATG		galactosidase, beta 1-like 2 precursor							125.0	129.0	127.0					11																	134240907		2201	4297	6498	SO:0001583	missense	89944				carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds	g.chr11:134240907C>G		CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.1221C>G	11.37:g.134240907C>G	ENSP00000444628:p.Ile407Met					GLB1L2_uc009zdg.1_RNA	p.I407M	NM_138342	NP_612351	Q8IW92	GLBL2_HUMAN		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)	13	1409	+	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)	407					A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	ENST00000535456.2	37	c.1221C>G	CCDS31724.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.00|14.00	2.405868|2.405868	0.42715|0.42715	.|.	.|.	ENSG00000149328|ENSG00000149328	ENST00000339772;ENST00000535456;ENST00000389881|ENST00000525089	D;D;D|.	0.94497|.	-3.44;-3.44;-3.44|.	5.77|5.77	2.8|2.8	0.32819|0.32819	.|.	0.568090|.	0.19812|.	N|.	0.105503|.	T|T	0.50973|0.50973	0.1647|0.1647	M|M	0.82517|0.82517	2.595|2.595	0.09310|0.09310	N|N	1|1	P|.	0.40376|.	0.715|.	B|.	0.41691|.	0.364|.	T|T	0.48103|0.48103	-0.9064|-0.9064	10|5	0.66056|.	D|.	0.02|.	-9.4308|-9.4308	4.1701|4.1701	0.10326|0.10326	0.1385:0.5899:0.1348:0.1368|0.1385:0.5899:0.1348:0.1368	.|.	407|.	Q8IW92|.	GLBL2_HUMAN|.	M|E	407|346	ENSP00000344659:I407M;ENSP00000444628:I407M;ENSP00000374531:I407M|.	ENSP00000344659:I407M|.	I|Q	+|+	3|1	3|0	GLB1L2|GLB1L2	133746117|133746117	0.002000|0.002000	0.14202|0.14202	0.007000|0.007000	0.13788|0.13788	0.058000|0.058000	0.15608|0.15608	0.052000|0.052000	0.14163|0.14163	0.856000|0.856000	0.35383|0.35383	0.655000|0.655000	0.94253|0.94253	ATC|CAA		0.567	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393629.2	NM_138342		19	124	0	0	0	0.002299	0	19	124				
TAS2R7	50837	broad.mit.edu	37	12	10954612	10954612	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr12:10954612G>A	ENST00000240687.2	-	1	614	c.558C>T	c.(556-558)ctC>ctT	p.L186L		NM_023919.2	NP_076408.1	Q9NYW3	TA2R7_HUMAN	taste receptor, type 2, member 7	186					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.L186L(1)		kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(3)	10						TTGCCAGGTTGAGAAATAACT	0.448																																							uc001qyv.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(556-558)CTC>CTT		taste receptor, type 2, member 7							179.0	169.0	172.0					12																	10954612		2203	4300	6503	SO:0001819	synonymous_variant	50837				sensory perception of taste	integral to membrane	taste receptor activity	g.chr12:10954612G>A	AF227133	CCDS8631.1	12p13	2012-08-22			ENSG00000121377	ENSG00000121377		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14913	protein-coding gene	gene with protein product		604793				10761934, 10766242	Standard	NM_023919		Approved	T2R7, TRB4	uc001qyv.3	Q9NYW3	OTTHUMG00000168505	ENST00000240687.2:c.558C>T	12.37:g.10954612G>A							p.L186L	NM_023919	NP_076408	Q9NYW3	TA2R7_HUMAN			1	615	-			186			Extracellular (Potential).		Q645Y1	Silent	SNP	ENST00000240687.2	37	c.558C>T	CCDS8631.1																																																																																				0.448	TAS2R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399931.1			4	24	0	0	0	0.000248	0	4	24				
HOXC6	3223	broad.mit.edu	37	12	54422532	54422532	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr12:54422532C>G	ENST00000243108.4	+	1	391	c.227C>G	c.(226-228)tCc>tGc	p.S76C	RP11-834C11.12_ENST00000513209.1_Intron|HOXC4_ENST00000303406.4_Intron|HOXC6_ENST00000394331.3_5'UTR|RP11-834C11.14_ENST00000512206.1_RNA	NM_004503.3	NP_004494.1	P09630	HXC6_HUMAN	homeobox C6	76					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S76Y(1)|p.S76C(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGATCTAATTCCTTTTACCAG	0.493																																							uc001sev.2		NA																	2	Substitution - Missense(2)	p.S76Y(1)	ovary(1)|lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(226-228)TCC>TGC		homeobox C6 isoform 1							111.0	105.0	107.0					12																	54422532		2203	4300	6503	SO:0001583	missense	3223				regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr12:54422532C>G		CCDS8871.1, CCDS41792.1	12q13.13	2011-06-20	2005-12-22		ENSG00000197757	ENSG00000197757		"""Homeoboxes / ANTP class : HOXL subclass"""	5128	protein-coding gene	gene with protein product		142972	"""homeo box C6"""	HOX3C, HOX3		1973146, 1358459	Standard	NM_153693		Approved		uc001sev.3	P09630	OTTHUMG00000160027	ENST00000243108.4:c.227C>G	12.37:g.54422532C>G	ENSP00000243108:p.Ser76Cys					HOXC6_uc001ses.2_5'UTR|HOXC5_uc001set.2_Intron|HOXC4_uc001seu.2_Intron	p.S76C	NM_004503	NP_004494	P09630	HXC6_HUMAN			1	339	+			76					B2RBV2|Q6DK09	Missense_Mutation	SNP	ENST00000243108.4	37	c.227C>G	CCDS8871.1	.	.	.	.	.	.	.	.	.	.	C	5.531	0.282920	0.10458	.	.	ENSG00000197757	ENST00000243108	D	0.92348	-3.02	5.54	5.54	0.83059	.	0.111569	0.64402	D	0.000011	D	0.86460	0.5938	N	0.05124	-0.11	0.80722	D	1	P	0.44816	0.844	P	0.46026	0.501	D	0.86691	0.1923	10	0.33940	T	0.23	.	18.4191	0.90582	0.0:1.0:0.0:0.0	.	76	P09630	HXC6_HUMAN	C	76	ENSP00000243108:S76C	ENSP00000243108:S76C	S	+	2	0	HOXC6	52708799	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.357000	0.44125	2.884000	0.98904	0.655000	0.94253	TCC		0.493	HOXC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358943.2			15	86	0	0	0	0.003163	0	15	86				
TIMELESS	8914	broad.mit.edu	37	12	56826270	56826270	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr12:56826270G>A	ENST00000553532.1	-	7	720	c.570C>T	c.(568-570)ctC>ctT	p.L190L	TIMELESS_ENST00000554616.1_Silent_p.L190L|TIMELESS_ENST00000229201.4_Silent_p.L189L					timeless circadian clock									p.L190L(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						GAATCGCCCAGAGGAGCTGGT	0.557																																							uc001slf.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(5)|breast(2)|pancreas(1)	8						c.(568-570)CTC>CTT		timeless homolog							107.0	105.0	105.0					12																	56826270		2203	4300	6503	SO:0001819	synonymous_variant	8914				cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin		g.chr12:56826270G>A	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.570C>T	12.37:g.56826270G>A						TIMELESS_uc001slg.2_Silent_p.L189L	p.L190L	NM_003920	NP_003911	Q9UNS1	TIM_HUMAN			7	738	-			190						Silent	SNP	ENST00000553532.1	37	c.570C>T	CCDS8918.1																																																																																				0.557	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920		11	88	0	0	0	0.001855	0	11	88				
TMTC3	160418	broad.mit.edu	37	12	88568455	88568455	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr12:88568455G>A	ENST00000266712.6	+	9	1491	c.1271G>A	c.(1270-1272)aGa>aAa	p.R424K		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	424					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)		p.R424K(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						ACATTCCACAGAAATTGGGAT	0.343																																							uc001tau.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1270-1272)AGA>AAA		transmembrane and tetratricopeptide repeat							129.0	118.0	122.0					12																	88568455		2203	4299	6502	SO:0001583	missense	160418					integral to membrane	binding	g.chr12:88568455G>A		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.1271G>A	12.37:g.88568455G>A	ENSP00000266712:p.Arg424Lys					TMTC3_uc009zsm.2_RNA	p.R424K	NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN			9	1491	+			424			TPR 1.		Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	ENST00000266712.6	37	c.1271G>A	CCDS9032.1	.	.	.	.	.	.	.	.	.	.	G	35	5.581759	0.96565	.	.	ENSG00000139324	ENST00000266712	T	0.40756	1.02	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.76601	0.4010	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82319	-0.0516	10	0.54805	T	0.06	-22.4958	19.8576	0.96767	0.0:0.0:1.0:0.0	.	424	Q6ZXV5-2	.	K	424	ENSP00000266712:R424K	ENSP00000266712:R424K	R	+	2	0	TMTC3	87092586	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.297000	0.96120	2.696000	0.92011	0.655000	0.94253	AGA		0.343	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1	NM_181783		13	117	0	0	0	0.001855	0	13	117				
APAF1	317	broad.mit.edu	37	12	99056294	99056294	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr12:99056294G>A	ENST00000551964.1	+	6	1507	c.771G>A	c.(769-771)caG>caA	p.Q257Q	APAF1_ENST00000339433.3_Silent_p.Q257Q|APAF1_ENST00000547045.1_Silent_p.Q257Q|APAF1_ENST00000550527.1_Silent_p.Q246Q|APAF1_ENST00000359972.2_Silent_p.Q246Q|APAF1_ENST00000552268.1_Silent_p.Q257Q|APAF1_ENST00000333991.1_Silent_p.Q257Q|APAF1_ENST00000357310.1_Silent_p.Q257Q|APAF1_ENST00000549007.1_Silent_p.Q257Q	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	257	NB-ARC.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)	p.Q257Q(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	TTGACAGTCAGTGTCAGATTC	0.308																																							uc001tfz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|lung(1)	3						c.(769-771)CAG>CAA		apoptotic peptidase activating factor 1 isoform	Adenosine triphosphate(DB00171)						111.0	110.0	111.0					12																	99056294		2203	4299	6502	SO:0001819	synonymous_variant	317				activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding	g.chr12:99056294G>A	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.771G>A	12.37:g.99056294G>A						APAF1_uc001tfy.2_Silent_p.Q246Q|APAF1_uc001tga.2_Silent_p.Q246Q|APAF1_uc001tgb.2_Silent_p.Q257Q|APAF1_uc001tgc.2_Silent_p.Q257Q	p.Q257Q	NM_181861	NP_863651	O14727	APAF_HUMAN			6	1348	+			257			NB-ARC.		B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Silent	SNP	ENST00000551964.1	37	c.771G>A	CCDS9069.1																																																																																				0.308	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1		16	91	0	0	0	0.008871	0	16	91				
ACTR6	64431	broad.mit.edu	37	12	100617685	100617685	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr12:100617685G>C	ENST00000188312.2	+	11	1948	c.1183G>C	c.(1183-1185)Gat>Cat	p.D395H	ACTR6_ENST00000546902.1_Missense_Mutation_p.D313H|ACTR6_ENST00000552376.1_Missense_Mutation_p.D375H|ACTR6_ENST00000551617.1_Missense_Mutation_p.D293H	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	395						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.D395H(1)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						AGAGAAATTTGATATTTAAGC	0.318																																							uc001thb.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1183-1185)GAT>CAT		ARP6 actin-related protein 6 homolog							97.0	98.0	98.0					12																	100617685		2203	4299	6502	SO:0001583	missense	64431					cytoplasm|cytoskeleton		g.chr12:100617685G>C	AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.1183G>C	12.37:g.100617685G>C	ENSP00000188312:p.Asp395His					ACTR6_uc001thc.1_Missense_Mutation_p.D287H|ACTR6_uc001thd.1_Missense_Mutation_p.D375H|ACTR6_uc009ztu.1_Intron|ACTR6_uc001the.1_Missense_Mutation_p.D313H|ACTR6_uc001thf.1_Missense_Mutation_p.D293H|uc001thg.1_5'Flank	p.D395H	NM_022496	NP_071941	Q9GZN1	ARP6_HUMAN			11	1239	+			395					B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	ENST00000188312.2	37	c.1183G>C	CCDS9074.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957235	0.92726	.	.	ENSG00000075089	ENST00000188312;ENST00000546902;ENST00000552376;ENST00000551617	D;D;D;D	0.96232	-3.94;-3.85;-3.95;-3.89	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.97763	0.9266	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.992;0.995;0.997	D	0.98119	1.0424	10	0.87932	D	0	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	293;375;395	F8VSD1;F8W057;Q9GZN1	.;.;ARP6_HUMAN	H	395;313;375;293	ENSP00000188312:D395H;ENSP00000448669:D313H;ENSP00000447237:D375H;ENSP00000448356:D293H	ENSP00000188312:D395H	D	+	1	0	ACTR6	99141816	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.260000	0.95568	2.824000	0.97209	0.655000	0.94253	GAT		0.318	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408159.1	NM_022496		7	86	0	0	0	0.001984	0	7	86				
UTP20	27340	broad.mit.edu	37	12	101761655	101761655	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr12:101761655G>A	ENST00000261637.4	+	48	6459	c.6285G>A	c.(6283-6285)ctG>ctA	p.L2095L		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2095					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.L2095L(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						ATCTGAGTCTGAAGACTTCCA	0.438																																							uc001tia.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|breast(2)	4						c.(6283-6285)CTG>CTA		down-regulated in metastasis							225.0	202.0	210.0					12																	101761655		2203	4300	6503	SO:0001819	synonymous_variant	27340				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding	g.chr12:101761655G>A	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.6285G>A	12.37:g.101761655G>A							p.L2095L	NM_014503	NP_055318	O75691	UTP20_HUMAN			48	6441	+			2095					Q9H3H4	Silent	SNP	ENST00000261637.4	37	c.6285G>A	CCDS9081.1																																																																																				0.438	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503		12	161	0	0	0	0.003163	0	12	161				
MPHOSPH9	10198	broad.mit.edu	37	12	123687489	123687489	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr12:123687489G>A	ENST00000606320.1	-	10	1669	c.1463C>T	c.(1462-1464)tCt>tTt	p.S488F	MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.S336F|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.S336F|MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.S458F			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	488						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.S336F(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		GTCTATGTCAGAGGGACTAGA	0.458																																							uc001uel.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1006-1008)TCT>TTT		M-phase phosphoprotein 9							116.0	122.0	120.0					12																	123687489		2203	4300	6503	SO:0001583	missense	10198				M phase of mitotic cell cycle	centriole|Golgi membrane		g.chr12:123687489G>A	X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.1463C>T	12.37:g.123687489G>A	ENSP00000475489:p.Ser488Phe					MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_RNA|MPHOSPH9_uc001uem.2_Intron	p.S336F	NM_022782	NP_073619	Q99550	MPP9_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)	6	1114	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		336					A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	ENST00000606320.1	37	c.1007C>T		.	.	.	.	.	.	.	.	.	.	G	14.57	2.575111	0.45902	.	.	ENSG00000051825	ENST00000302349;ENST00000541076	T;T	0.33865	1.39;1.4	6.03	6.03	0.97812	.	0.265632	0.37761	N	0.001958	T	0.52075	0.1712	M	0.64997	1.995	0.37411	D	0.91325	D	0.69078	0.997	D	0.65987	0.94	T	0.50792	-0.8786	10	0.23891	T	0.37	-9.7265	11.9525	0.52962	0.0:0.1378:0.7351:0.1271	.	336	Q99550	MPP9_HUMAN	F	336	ENSP00000303597:S336F;ENSP00000445859:S336F	ENSP00000303597:S336F	S	-	2	0	MPHOSPH9	122253442	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.227000	0.42972	2.868000	0.98415	0.557000	0.71058	TCT		0.458	MPHOSPH9-030	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000471390.2			13	123	0	0	0	0.001855	0	13	123				
LATS2	26524	broad.mit.edu	37	13	21549028	21549028	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr13:21549028C>T	ENST00000382592.4	-	8	3653	c.3248G>A	c.(3247-3249)tGc>tAc	p.C1083Y	LATS2_ENST00000542899.1_Missense_Mutation_p.C1083Y	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2									p.C1083Y(2)		breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CACAGGCTGGCAGCCTTCAGT	0.602																																							uc009zzs.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10						c.(3247-3249)TGC>TAC		LATS, large tumor suppressor, homolog 2							36.0	41.0	39.0					13																	21549028		2203	4300	6503	SO:0001583	missense	26524				cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr13:21549028C>T	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.3248G>A	13.37:g.21549028C>T	ENSP00000372035:p.Cys1083Tyr					LATS2_uc001unr.3_Missense_Mutation_p.C1083Y	p.C1083Y	NM_014572	NP_055387	Q9NRM7	LATS2_HUMAN		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)	8	3613	-		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)	1083						Missense_Mutation	SNP	ENST00000382592.4	37	c.3248G>A	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721185	0.48728	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.61158	0.13;0.13	6.07	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.55768	0.1941	L	0.59436	1.845	0.53688	D	0.999979	B	0.10296	0.003	B	0.11329	0.006	T	0.52815	-0.8525	10	0.44086	T	0.13	.	15.381	0.74654	0.0:0.9336:0.0:0.0664	.	1083	Q9NRM7	LATS2_HUMAN	Y	1083	ENSP00000372035:C1083Y;ENSP00000441817:C1083Y	ENSP00000372035:C1083Y	C	-	2	0	LATS2	20447028	1.000000	0.71417	1.000000	0.80357	0.180000	0.23129	5.262000	0.65501	1.583000	0.49898	0.655000	0.94253	TGC		0.602	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1			11	41	0	0	0	0.000978	0	11	41				
MTUS2	23281	broad.mit.edu	37	13	30075296	30075296	+	Silent	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr13:30075296C>G	ENST00000380808.2	+	8	1014	c.798C>G	c.(796-798)ctC>ctG	p.L266L	MTUS2_ENST00000400542.3_3'UTR|MTUS2_ENST00000431530.3_Silent_p.L1297L|MTUS2_ENST00000542829.1_Silent_p.L176L	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1287						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.L1297L(1)|p.L266L(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						ACGAAGACCTCAAAGCAAGGA	0.443																																							uc001usl.3		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(3889-3891)CTC>CTG		hypothetical protein LOC23281 isoform a							114.0	112.0	113.0					13																	30075296		1922	4122	6044	SO:0001819	synonymous_variant	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:30075296C>G	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.798C>G	13.37:g.30075296C>G						MTUS2_uc001usm.3_Silent_p.L266L|MTUS2_uc010aau.2_Silent_p.L176L|MTUS2_uc010tdq.1_Silent_p.L49L	p.L1297L	NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN			13	3949	+			1287			Potential.		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000380808.2	37	c.3891C>G	CCDS41874.1																																																																																				0.443	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044335.2	XM_166270		12	69	0	0	0	0.001855	0	12	69				
TM9SF2	9375	broad.mit.edu	37	13	100153956	100153956	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr13:100153956G>A	ENST00000376387.4	+	1	286	c.96G>A	c.(94-96)cgG>cgA	p.R32R	LINC00449_ENST00000366259.2_RNA	NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	32					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.R32R(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					GCCCGCGCCGGAGCGGCGCTT	0.667																																							uc001voj.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(94-96)CGG>CGA		transmembrane 9 superfamily member 2 precursor							38.0	46.0	43.0					13																	100153956		2200	4298	6498	SO:0001819	synonymous_variant	9375				transport	endosome membrane|integral to plasma membrane		g.chr13:100153956G>A	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.96G>A	13.37:g.100153956G>A						TM9SF2_uc010afz.1_Silent_p.R32R	p.R32R	NM_004800	NP_004791	Q99805	TM9S2_HUMAN			1	229	+	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)		32			Lumenal (Potential).		A8K399|Q2TAY5	Silent	SNP	ENST00000376387.4	37	c.96G>A	CCDS9493.1																																																																																				0.667	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3			7	61	0	0	0	0.001984	0	7	61				
NALCN	259232	broad.mit.edu	37	13	101997671	101997671	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr13:101997671C>G	ENST00000251127.6	-	7	826	c.745G>C	c.(745-747)Gaa>Caa	p.E249Q	NALCN_ENST00000376196.3_Missense_Mutation_p.E249Q|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	249					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.E249Q(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CCCAGATCTTCAAGGTCCATG	0.433																																							uc001vox.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(745-747)GAA>CAA		voltage gated channel like 1							180.0	164.0	170.0					13																	101997671		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101997671C>G	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.745G>C	13.37:g.101997671C>G	ENSP00000251127:p.Glu249Gln					NALCN_uc001voy.2_5'UTR|NALCN_uc001voz.2_Missense_Mutation_p.E249Q|NALCN_uc001vpa.2_Missense_Mutation_p.E249Q	p.E249Q	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			7	934	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		249			Extracellular (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.745G>C	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.824984	0.32237	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98437	-4.57;-4.93	5.9	5.05	0.67936	Ion transport (1);	0.046948	0.85682	D	0.000000	D	0.94925	0.8359	L	0.35542	1.07	0.80722	D	1	B;B	0.15473	0.013;0.001	B;B	0.13407	0.009;0.003	D	0.91079	0.4898	10	0.16420	T	0.52	.	11.5913	0.50947	0.0:0.8637:0.0:0.1362	.	249;249	F2Z323;Q8IZF0	.;NALCN_HUMAN	Q	249	ENSP00000251127:E249Q;ENSP00000365367:E249Q	ENSP00000251127:E249Q	E	-	1	0	NALCN	100795672	0.998000	0.40836	0.970000	0.41538	0.997000	0.91878	3.832000	0.55783	2.788000	0.95919	0.650000	0.86243	GAA		0.433	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		14	133	0	0	0	0.00245	0	14	133				
FAM155A	728215	broad.mit.edu	37	13	108518943	108518943	+	Start_Codon_SNP	SNP	A	A	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr13:108518943A>G	ENST00000375915.2	-	1	140	c.2T>C	c.(1-3)aTg>aCg	p.M1T		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	1						integral component of membrane (GO:0016021)		p.M1T(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						ACCCCTGGTCATATTTTGGGA	0.532																																							uc001vql.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1-3)ATG>ACG		family with sequence similarity 155, member A							66.0	68.0	68.0					13																	108518943		2203	4300	6503	SO:0001582	initiator_codon_variant	728215					integral to membrane	binding	g.chr13:108518943A>G	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.2T>C	13.37:g.108518943A>G	ENSP00000365080:p.Met1Thr						p.M1T	NM_001080396	NP_001073865	B1AL88	F155A_HUMAN			1	518	-			1					B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	37	c.2T>C	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	A	17.39	3.376510	0.61735	.	.	ENSG00000204442	ENST00000375915	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.69949	0.3168	.	.	.	0.31323	N	0.685816	P	0.50443	0.935	D	0.63381	0.914	T	0.76016	-0.3113	8	0.87932	D	0	.	13.9384	0.64039	1.0:0.0:0.0:0.0	.	1	B1AL88	F155A_HUMAN	T	1	.	ENSP00000365080:M1T	M	-	2	0	FAM155A	107316944	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.587000	0.90810	1.890000	0.54733	0.528000	0.53228	ATG		0.532	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	Missense_Mutation	9	77	0	0	0	0.004482	0	9	77				
SLC7A7	9056	broad.mit.edu	37	14	23242848	23242848	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr14:23242848G>C	ENST00000397532.3	-	10	2032	c.1507C>G	c.(1507-1509)Ccc>Gcc	p.P503A	SLC7A7_ENST00000397529.2_Missense_Mutation_p.P503A|SLC7A7_ENST00000397528.4_Missense_Mutation_p.P503A|SLC7A7_ENST00000554517.1_Missense_Mutation_p.P237A|SLC7A7_ENST00000555702.1_Missense_Mutation_p.P503A|SLC7A7_ENST00000285850.7_Missense_Mutation_p.P503A|SLC7A7_ENST00000554061.1_5'UTR			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	503					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)	p.P503A(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		CGTTGCTTGGGCATCTCTCCT	0.473																																							uc001wgr.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1507-1509)CCC>GCC		solute carrier family 7 member 7							161.0	134.0	143.0					14																	23242848		2203	4300	6503	SO:0001583	missense	9056				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity	g.chr14:23242848G>C	AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.1507C>G	14.37:g.23242848G>C	ENSP00000380666:p.Pro503Ala					SLC7A7_uc001wgs.3_Missense_Mutation_p.P503A|SLC7A7_uc001wgt.3_Missense_Mutation_p.P503A|SLC7A7_uc001wgu.3_Missense_Mutation_p.P503A|SLC7A7_uc001wgv.3_Missense_Mutation_p.P503A	p.P503A	NM_003982	NP_003973	Q9UM01	YLAT1_HUMAN		GBM - Glioblastoma multiforme(265;0.00741)	10	1645	-	all_cancers(95;8.44e-05)		503					B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Missense_Mutation	SNP	ENST00000397532.3	37	c.1507C>G	CCDS9574.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.564|6.564	0.472323|0.472323	0.12461|0.12461	.|.	.|.	ENSG00000155465|ENSG00000155465	ENST00000556350|ENST00000285850;ENST00000555702;ENST00000397532;ENST00000404278;ENST00000397529;ENST00000397528;ENST00000554517	.|D;D;D;D;D;D	.|0.90324	.|-2.54;-2.54;-2.54;-2.54;-2.54;-2.65	5.0|5.0	-0.0636|-0.0636	0.13776|0.13776	.|.	.|1.198010	.|0.06489	.|U	.|0.734215	T|T	0.81702|0.81702	0.4878|0.4878	N|N	0.22421|0.22421	0.69|0.69	0.22511|0.22511	N|N	0.999037|0.999037	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.63296|0.63296	-0.6669|-0.6669	5|10	.|0.13108	.|T	.|0.6	.|.	7.7666|7.7666	0.28982|0.28982	0.4525:0.0:0.5475:0.0|0.4525:0.0:0.5475:0.0	.|.	.|503	.|Q9UM01	.|YLAT1_HUMAN	W|A	167|503;503;503;476;503;503;237	.|ENSP00000285850:P503A;ENSP00000451881:P503A;ENSP00000380666:P503A;ENSP00000380663:P503A;ENSP00000380662:P503A;ENSP00000452083:P237A	.|ENSP00000285850:P503A	C|P	-|-	3|1	2|0	SLC7A7|SLC7A7	22312688|22312688	0.030000|0.030000	0.19436|0.19436	0.175000|0.175000	0.22980|0.22980	0.228000|0.228000	0.25075|0.25075	-0.057000|-0.057000	0.11768|0.11768	-0.187000|-0.187000	0.10516|0.10516	0.563000|0.563000	0.77884|0.77884	TGC|CCC		0.473	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3			7	62	0	0	0	0.001984	0	7	62				
MYH6	4624	broad.mit.edu	37	14	23868018	23868018	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr14:23868018C>G	ENST00000356287.3	-	14	1839	c.1810G>C	c.(1810-1812)Gag>Cag	p.E604Q	MYH6_ENST00000405093.3_Missense_Mutation_p.E604Q			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	604	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.E604Q(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		ACAACAGTCTCGTTGAGAGGA	0.567																																							uc001wjv.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|skin(1)	4						c.(1810-1812)GAG>CAG		myosin heavy chain 6							185.0	160.0	168.0					14																	23868018		2203	4300	6503	SO:0001583	missense	4624				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle	g.chr14:23868018C>G	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1810G>C	14.37:g.23868018C>G	ENSP00000348634:p.Glu604Gln						p.E604Q	NM_002471	NP_002462	P13533	MYH6_HUMAN		GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)	15	1877	-	all_cancers(95;2.54e-05)		604			Myosin head-like.		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	c.1810G>C	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	.	25.1	4.600267	0.87055	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.71934	-0.61;-0.61	4.61	4.61	0.57282	Myosin head, motor domain (2);	.	.	.	.	D	0.82783	0.5112	M	0.74647	2.275	0.80722	D	1	D	0.54047	0.964	D	0.64144	0.922	D	0.85567	0.1231	9	0.87932	D	0	.	16.776	0.85550	0.0:1.0:0.0:0.0	.	604	P13533	MYH6_HUMAN	Q	604	ENSP00000386041:E604Q;ENSP00000348634:E604Q	ENSP00000348634:E604Q	E	-	1	0	MYH6	22937858	1.000000	0.71417	0.974000	0.42286	0.699000	0.40488	7.484000	0.81180	2.284000	0.76573	0.655000	0.94253	GAG		0.567	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3			6	63	0	0	0	0.001168	0	6	63				
RNF31	55072	broad.mit.edu	37	14	24619469	24619469	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr14:24619469G>C	ENST00000324103.6	+	7	1329	c.1009G>C	c.(1009-1011)Gag>Cag	p.E337Q	RP11-468E2.4_ENST00000558468.1_5'Flank|RNF31_ENST00000382687.3_Missense_Mutation_p.E186Q|RNF31_ENST00000559275.1_Missense_Mutation_p.E186Q	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	337	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E337Q(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		GTTGGGAACTGAGGGTCCCCA	0.602																																							uc001wmn.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(1)|ovary(1)	2						c.(1009-1011)GAG>CAG		ring finger protein 31							65.0	72.0	69.0					14																	24619469		1995	4180	6175	SO:0001583	missense	55072				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:24619469G>C	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.1009G>C	14.37:g.24619469G>C	ENSP00000315112:p.Glu337Gln					RNF31_uc001wml.1_Missense_Mutation_p.E186Q|RNF31_uc001wmm.1_Intron|RNF31_uc010alg.1_Missense_Mutation_p.E152Q|RNF31_uc001wmo.1_5'Flank|RNF31_uc001wmp.2_5'Flank	p.E337Q	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN		GBM - Glioblastoma multiforme(265;0.00861)	7	1258	+			337			Polyubiquitin-binding.		A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	37	c.1009G>C	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	G	4.600	0.111593	0.08831	.	.	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.46063	0.89;0.88	4.99	4.09	0.47781	.	0.249907	0.37095	N	0.002254	T	0.39410	0.1077	L	0.44542	1.39	0.09310	N	0.999999	P;B;B	0.39717	0.684;0.247;0.361	B;B;B	0.42343	0.166;0.14;0.384	T	0.27872	-1.0061	10	0.48119	T	0.1	1.6785	12.6595	0.56806	0.0:0.1667:0.8333:0.0	.	152;337;186	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	Q	337;186	ENSP00000315112:E337Q;ENSP00000372134:E186Q	ENSP00000315112:E337Q	E	+	1	0	RNF31	23689309	0.771000	0.28555	0.044000	0.18714	0.003000	0.03518	2.984000	0.49353	1.306000	0.44926	-0.175000	0.13238	GAG		0.602	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999		3	35	0	0	0	0.004672	0	3	35				
HECTD1	25831	broad.mit.edu	37	14	31576369	31576369	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr14:31576369C>T	ENST00000399332.1	-	38	7197	c.6709G>A	c.(6709-6711)Gag>Aag	p.E2237K	HECTD1_ENST00000553700.1_Missense_Mutation_p.E2237K	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	2237	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)	p.E2237K(1)		breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CTTTCAAGCTCATCACTATCC	0.393																																							uc001wrc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|lung(1)	5						c.(6709-6711)GAG>AAG		HECT domain containing 1							96.0	90.0	92.0					14																	31576369		1909	4131	6040	SO:0001583	missense	25831				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity	g.chr14:31576369C>T	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.6709G>A	14.37:g.31576369C>T	ENSP00000382269:p.Glu2237Lys					HECTD1_uc001wra.1_Missense_Mutation_p.E363K|HECTD1_uc001wrb.1_Missense_Mutation_p.E363K	p.E2237K	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)	38	7198	-	Hepatocellular(127;0.0877)|Breast(36;0.176)		2237			HECT.		D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	c.6709G>A	CCDS41939.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.28|11.28	1.591680|1.591680	0.28357|0.28357	.|.	.|.	ENSG00000092148|ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332|ENST00000554882	T;T|.	0.56444|.	0.46;0.46|.	6.06|6.06	6.06|6.06	0.98353|0.98353	HECT (4);|.	0.146541|.	0.44097|.	U|.	0.000489|.	T|T	0.57359|0.57359	0.2048|0.2048	N|N	0.25789|0.25789	0.76|0.76	0.80722|0.80722	D|D	1|1	D|.	0.57257|.	0.979|.	D|.	0.71414|.	0.973|.	T|T	0.48990|0.48990	-0.8985|-0.8985	10|5	0.15499|.	T|.	0.54|.	-9.309|-9.309	18.8088|18.8088	0.92050|0.92050	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2237|.	Q9ULT8|.	HECD1_HUMAN|.	K|I	2237;2239;2237|602	ENSP00000450697:E2237K;ENSP00000382269:E2237K|.	ENSP00000261312:E2239K|.	E|M	-|-	1|3	0|0	HECTD1|HECTD1	30646120|30646120	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.484000|7.484000	0.81180|0.81180	2.871000|2.871000	0.98454|0.98454	0.655000|0.655000	0.94253|0.94253	GAG|ATG		0.393	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1			7	62	0	0	0	0.001984	0	7	62				
AKAP6	9472	broad.mit.edu	37	14	33242896	33242896	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr14:33242896G>T	ENST00000280979.4	+	12	3555	c.3385G>T	c.(3385-3387)Gaa>Taa	p.E1129*	AKAP6_ENST00000557272.1_Nonsense_Mutation_p.E1129*	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1129					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.E1129*(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CCTCTGTCGTGAAATCAAGCA	0.458																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	1	Substitution - Nonsense(1)		lung(1)	breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(3385-3387)GAA>TAA		A-kinase anchor protein 6							131.0	123.0	126.0					14																	33242896		2203	4300	6503	SO:0001587	stop_gained	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33242896G>T	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3385G>T	14.37:g.33242896G>T	ENSP00000280979:p.Glu1129*					uc001wrr.2_5'Flank	p.E1129*	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	12	3555	+	Breast(36;0.0388)|Prostate(35;0.15)		1129			Spectrin 2.		A7E242|A7E2D4|O15028	Nonsense_Mutation	SNP	ENST00000280979.4	37	c.3385G>T	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.993092	0.35131	.	.	ENSG00000151320	ENST00000280979;ENST00000557272	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-17.0159	19.2688	0.94000	0.0:0.0:1.0:0.0	.	.	.	.	X	1129	.	ENSP00000280979:E1129X	E	+	1	0	AKAP6	32312647	1.000000	0.71417	0.986000	0.45419	0.139000	0.21198	7.068000	0.76748	2.639000	0.89480	0.591000	0.81541	GAA		0.458	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		21	145	1	0	1.77063e-15	0.005443	2.437e-15	21	145				
SYNE2	23224	broad.mit.edu	37	14	64630120	64630120	+	Splice_Site	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr14:64630120G>C	ENST00000344113.4	+	89	16512	c.16300G>C	c.(16300-16302)Gag>Cag	p.E5434Q	SYNE2_ENST00000555002.1_Splice_Site_p.E2068Q|SYNE2_ENST00000554584.1_Splice_Site_p.E5351Q|SYNE2_ENST00000358025.3_Splice_Site_p.E5434Q|SYNE2_ENST00000394768.2_Splice_Site_p.E1819Q|SYNE2_ENST00000357395.3_Splice_Site_p.E1819Q|ESR2_ENST00000542956.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5434					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.E5434Q(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCTTCTGCAGGAGCTGCAGCA	0.493																																							uc001xgm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(16300-16302)GAG>CAG		spectrin repeat containing, nuclear envelope 2							60.0	63.0	62.0					14																	64630120		2203	4300	6503	SO:0001630	splice_region_variant	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64630120G>C	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.16300-1G>C	14.37:g.64630120G>C						SYNE2_uc001xgl.2_Missense_Mutation_p.E5434Q|SYNE2_uc010apy.2_Missense_Mutation_p.E1819Q|SYNE2_uc001xgn.2_Missense_Mutation_p.E396Q|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_5'UTR	p.E5434Q	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	89	16530	+			5434			Potential.|Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.16300G>C	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860556	0.71834	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.58652	0.76;4.06;0.76;0.32;4.11;4.06	6.07	5.01	0.66863	.	0.219310	0.31784	N	0.007061	T	0.62024	0.2394	L	0.59436	1.845	0.80722	D	1	P;P;P;P	0.47034	0.889;0.763;0.682;0.787	P;P;B;P	0.53450	0.726;0.447;0.184;0.544	T	0.60094	-0.7330	9	.	.	.	.	8.2489	0.31706	0.1561:0.0:0.8439:0.0	.	1819;5351;5434;5434	Q8WXH0-7;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	Q	5434;1819;5434;5351;5357;2068;1819	ENSP00000350719:E5434Q;ENSP00000349969:E1819Q;ENSP00000341781:E5434Q;ENSP00000452570:E5351Q;ENSP00000450831:E2068Q;ENSP00000378249:E1819Q	.	E	+	1	0	SYNE2	63699873	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	3.200000	0.51051	2.885000	0.99019	0.650000	0.86243	GAG		0.493	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	Missense_Mutation	8	47	0	0	0	0.004482	0	8	47				
DCAF5	8816	broad.mit.edu	37	14	69520961	69520961	+	Silent	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr14:69520961C>T	ENST00000341516.5	-	9	2589	c.2442G>A	c.(2440-2442)agG>agA	p.R814R	DCAF5_ENST00000554215.1_Silent_p.R732R|DCAF5_ENST00000556847.1_Silent_p.R732R|DCAF5_ENST00000557386.1_Silent_p.R813R|DCAF5_ENST00000553293.1_5'Flank	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	814					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)		p.R814R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						CAGACTGGGTCCTGGGACAGT	0.592																																							uc001xkp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2440-2442)AGG>AGA		WD repeat domain 22							88.0	89.0	89.0					14																	69520961		2203	4300	6503	SO:0001819	synonymous_variant	8816					CUL4 RING ubiquitin ligase complex		g.chr14:69520961C>T	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2442G>A	14.37:g.69520961C>T						DCAF5_uc001xkq.2_Silent_p.R813R	p.R814R	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN			9	2661	-			814					B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Silent	SNP	ENST00000341516.5	37	c.2442G>A	CCDS32106.1																																																																																				0.592	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861		4	36	0	0	0	0.000248	0	4	36				
TUBGCP5	114791	broad.mit.edu	37	15	22840267	22840267	+	Silent	SNP	G	G	C	rs200466901		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr15:22840267G>C	ENST00000283645.4	+	4	463	c.333G>C	c.(331-333)ctG>ctC	p.L111L	TUBGCP5_ENST00000453949.2_Silent_p.L111L	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	111					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.L111L(1)		breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		ATTCCATACTGTCACTTCTTC	0.363																																							uc001yur.3		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(331-333)CTG>CTC		tubulin, gamma complex associated protein 5							117.0	113.0	114.0					15																	22840267		2203	4300	6503	SO:0001819	synonymous_variant	114791				G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding	g.chr15:22840267G>C	AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.333G>C	15.37:g.22840267G>C						TUBGCP5_uc001yuq.2_Silent_p.L111L	p.L111L	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)	4	463	+		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)	111					E9PB12|Q6IQ52|Q96PY8	Silent	SNP	ENST00000283645.4	37	c.333G>C	CCDS10008.1																																																																																				0.363	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250998.2	NM_052903		15	118	0	0	0	0.006122	0	15	118				
ZNF609	23060	broad.mit.edu	37	15	64792238	64792238	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr15:64792238G>A	ENST00000326648.3	+	1	748	c.620G>A	c.(619-621)gGa>gAa	p.G207E	ZNF609_ENST00000416172.1_Missense_Mutation_p.G207E	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	207						nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.G207E(3)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GTGGATACAGGAGCTGTGGAG	0.572																																							uc002ann.2		NA																	3	Substitution - Missense(3)		lung(3)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(619-621)GGA>GAA		zinc finger protein 609							84.0	74.0	77.0					15																	64792238		2203	4299	6502	SO:0001583	missense	23060					nucleus	zinc ion binding	g.chr15:64792238G>A	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.620G>A	15.37:g.64792238G>A	ENSP00000316527:p.Gly207Glu					ZNF609_uc010bgy.2_Missense_Mutation_p.G207E	p.G207E	NM_015042	NP_055857	O15014	ZN609_HUMAN			1	620	+			207					Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	c.620G>A	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	.	13.54	2.266525	0.40095	.	.	ENSG00000180357	ENST00000416172;ENST00000326648	T	0.51817	0.69	5.5	5.5	0.81552	.	0.189937	0.45606	D	0.000357	T	0.47783	0.1464	N	0.08118	0	0.40416	D	0.979797	D;P	0.76494	0.999;0.835	D;P	0.65987	0.94;0.553	T	0.55958	-0.8058	10	0.51188	T	0.08	-19.3741	15.6068	0.76679	0.0:0.1755:0.8245:0.0	.	207;207	E7ERY8;O15014	.;ZN609_HUMAN	E	207	ENSP00000316527:G207E	ENSP00000316527:G207E	G	+	2	0	ZNF609	62579291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.740000	0.55082	2.747000	0.94245	0.651000	0.88453	GGA		0.572	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833		4	38	0	0	0	0.000248	0	4	38				
IL16	3603	broad.mit.edu	37	15	81589336	81589336	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr15:81589336C>T	ENST00000302987.4	+	12	1970	c.1970C>T	c.(1969-1971)tCt>tTt	p.S657F	IL16_ENST00000560230.1_3'UTR|IL16_ENST00000394652.2_5'UTR|IL16_ENST00000394660.2_Missense_Mutation_p.S657F			Q14005	IL16_HUMAN	interleukin 16	657					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S611F(1)|p.S657F(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CCTAGTGCCTCTGCCGGCTGC	0.592																																							uc002bgh.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|lung(1)|skin(1)	4						c.(1969-1971)TCT>TTT		interleukin 16 isoform 2							35.0	40.0	38.0					15																	81589336		1962	4163	6125	SO:0001583	missense	3603				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity	g.chr15:81589336C>T	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.1970C>T	15.37:g.81589336C>T	ENSP00000302935:p.Ser657Phe					IL16_uc010blq.1_Missense_Mutation_p.S611F|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.S699F|IL16_uc002bgg.2_Missense_Mutation_p.S657F|IL16_uc002bgi.1_Missense_Mutation_p.S47F|IL16_uc002bgj.2_Missense_Mutation_p.S151F|IL16_uc002bgk.2_5'UTR|IL16_uc002bgl.1_5'UTR|IL16_uc010unq.1_5'Flank	p.S657F	NM_172217	NP_757366	Q14005	IL16_HUMAN			13	2346	+			657					A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	c.1970C>T	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.407563	0.25378	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000329842;ENST00000394653	T;T	0.11821	2.74;2.74	4.7	-5.15	0.02866	.	2.893680	0.01486	N	0.016873	T	0.07098	0.0180	N	0.22421	0.69	0.20307	N	0.999913	B;B;B;B;B	0.34181	0.0;0.0;0.0;0.44;0.04	B;B;B;B;B	0.24701	0.0;0.0;0.001;0.055;0.038	T	0.18147	-1.0346	10	0.62326	D	0.03	.	1.7128	0.02895	0.116:0.2211:0.2326:0.4302	.	151;194;47;657;657	Q6ZTT5;B7Z8M3;B3KY62;Q14005;Q14005-2	.;.;.;IL16_HUMAN;.	F	657;489;657;194;47	ENSP00000378155:S657F;ENSP00000302935:S657F	ENSP00000302935:S657F	S	+	2	0	IL16	79376391	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.827000	0.04424	-0.981000	0.03520	0.655000	0.94253	TCT		0.592	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217		6	22	0	0	0	0.001168	0	6	22				
HOMER2	9455	broad.mit.edu	37	15	83520967	83520967	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr15:83520967C>T	ENST00000304231.8	-	7	914	c.722G>A	c.(721-723)aGa>aAa	p.R241K	HOMER2_ENST00000426485.1_Missense_Mutation_p.R186K|HOMER2_ENST00000399166.2_Missense_Mutation_p.R175K|HOMER2_ENST00000450735.2_Missense_Mutation_p.R230K	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	241					behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.R304K(1)|p.R241K(1)		cervix(1)|endometrium(2)|lung(6)	9						CTCCTTCTCTCTGTTGATCTC	0.502																																							uc002bjg.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(721-723)AGA>AAA		homer 2 isoform 2							160.0	154.0	156.0					15																	83520967		2076	4223	6299	SO:0001583	missense	9455				metabotropic glutamate receptor signaling pathway	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane		g.chr15:83520967C>T	AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.722G>A	15.37:g.83520967C>T	ENSP00000305632:p.Arg241Lys					HOMER2_uc002bjh.2_Missense_Mutation_p.R230K|HOMER2_uc002bjj.2_Missense_Mutation_p.R175K|HOMER2_uc002bji.2_Missense_Mutation_p.R186K	p.R241K	NM_199330	NP_955362	Q9NSB8	HOME2_HUMAN			7	908	-			241			Potential.		O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Missense_Mutation	SNP	ENST00000304231.8	37	c.722G>A	CCDS45334.1	.	.	.	.	.	.	.	.	.	.	C	7.207	0.594562	0.13875	.	.	ENSG00000103942	ENST00000304231;ENST00000450735;ENST00000426485;ENST00000399166	T;T;T;T	0.78924	2.24;-1.22;2.24;2.24	5.84	1.35	0.21983	.	0.259844	0.43747	N	0.000533	T	0.36826	0.0981	N	0.00483	-1.445	0.22989	N	0.998466	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.44050	-0.9353	10	0.06494	T	0.89	.	6.2842	0.21023	0.0:0.4874:0.0:0.5126	.	175;186;230;241	F8W826;E9PAZ1;Q9NSB8-2;Q9NSB8	.;.;.;HOME2_HUMAN	K	241;230;186;175	ENSP00000305632:R241K;ENSP00000407634:R230K;ENSP00000394293:R186K;ENSP00000382119:R175K	ENSP00000305632:R241K	R	-	2	0	HOMER2	81318021	0.934000	0.31675	0.835000	0.33067	0.900000	0.52787	0.647000	0.24812	0.382000	0.24878	-0.140000	0.14226	AGA		0.502	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418689.1			3	55	0	0	0	0.004672	0	3	55				
FANCI	55215	broad.mit.edu	37	15	89836071	89836071	+	Missense_Mutation	SNP	G	G	C	rs371068301		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr15:89836071G>C	ENST00000310775.7	+	21	2231	c.2145G>C	c.(2143-2145)aaG>aaC	p.K715N	FANCI_ENST00000300027.8_Missense_Mutation_p.K715N	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	715					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.K715N(2)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					GAATGATTAAGAGTGAGCTGG	0.388								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc010bnp.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(2143-2145)AAG>AAC	Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group I isoform							138.0	140.0	140.0					15																	89836071		2200	4299	6499	SO:0001583	missense	55215	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	cell cycle|DNA repair	nucleoplasm	protein binding	g.chr15:89836071G>C	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.2145G>C	15.37:g.89836071G>C	ENSP00000310842:p.Lys715Asn					FANCI_uc002bnm.1_Missense_Mutation_p.K715N|FANCI_uc002bnn.1_RNA|FANCI_uc002bnp.1_Missense_Mutation_p.K536N|FANCI_uc002bnq.1_Missense_Mutation_p.K128N	p.K715N	NM_001113378	NP_001106849	Q9NVI1	FANCI_HUMAN			21	2235	+	Lung NSC(78;0.0472)|all_lung(78;0.089)		715					A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	c.2145G>C	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701821	0.68501	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.35421	1.31;1.31;1.31	5.83	5.83	0.93111	.	0.088640	0.85682	D	0.000000	T	0.58495	0.2126	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.81914	0.977;0.987;0.995	T	0.55541	-0.8125	10	0.37606	T	0.19	-18.5216	13.3292	0.60477	0.0718:0.0:0.9282:0.0	.	715;715;715	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	N	715	ENSP00000300027:K715N;ENSP00000310842:K715N;ENSP00000413249:K715N	ENSP00000300027:K715N	K	+	3	2	FANCI	87637075	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.029000	0.64121	2.756000	0.94617	0.655000	0.94253	AAG		0.388	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193		10	111	0	0	0	0.008291	0	10	111				
BLM	641	broad.mit.edu	37	15	91310173	91310173	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr15:91310173G>A	ENST00000355112.3	+	10	2345	c.2227G>A	c.(2227-2229)Gac>Aac	p.D743N	BLM_ENST00000560509.1_Missense_Mutation_p.D743N|BLM_ENST00000560136.1_3'UTR	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	743	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.D743N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TGATAAGACTGACTCAGAAGC	0.289			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																														uc002bpr.2		NA	yes	Rec		Bloom Syndrome	15	15q26.1	641	Mis|N|F	Bloom Syndrome			"""L, E"""		leukemia|lymphoma|skin squamous cell |other cancers			1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|breast(1)	6						c.(2227-2229)GAC>AAC	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom syndrome protein							54.0	58.0	57.0					15																	91310173		2198	4280	6478	SO:0001583	missense	641	Bloom_syndrome	Familial Cancer Database		double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding	g.chr15:91310173G>A	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.2227G>A	15.37:g.91310173G>A	ENSP00000347232:p.Asp743Asn					BLM_uc010uqh.1_Missense_Mutation_p.D743N|BLM_uc010uqi.1_Missense_Mutation_p.D368N|BLM_uc010bnx.2_Missense_Mutation_p.D743N|BLM_uc002bps.1_Missense_Mutation_p.D305N	p.D743N	NM_000057	NP_000048	P54132	BLM_HUMAN	Lung(145;0.189)		10	2324	+	Lung NSC(78;0.0875)|all_lung(78;0.109)		743			Helicase ATP-binding.		Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	c.2227G>A	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.924117	0.73213	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	T	0.76709	-1.04	5.74	5.74	0.90152	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.74635	0.3742	N	0.21194	0.64	0.80722	D	1	B;B;B	0.31485	0.325;0.153;0.325	B;B;B	0.42653	0.394;0.246;0.394	T	0.74203	-0.3741	10	0.51188	T	0.08	-17.6803	17.4221	0.87517	0.0:0.0:1.0:0.0	.	743;368;743	B2RAN0;B7ZKN7;P54132	.;.;BLM_HUMAN	N	743;396	ENSP00000347232:D743N	ENSP00000347232:D743N	D	+	1	0	BLM	89111177	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.977000	0.93446	2.708000	0.92522	0.585000	0.79938	GAC		0.289	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1			9	74	0	0	0	0.008291	0	9	74				
TARSL2	123283	broad.mit.edu	37	15	102211689	102211689	+	Splice_Site	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr15:102211689C>T	ENST00000335968.3	-	15	2183	c.1967G>A	c.(1966-1968)aGt>aAt	p.S656N		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	656					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)	p.S656N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AATCACTCACCTAACATATGT	0.299																																							uc002bxm.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1966-1968)AGT>AAT		threonyl-tRNA synthetase-like 2							96.0	94.0	94.0					15																	102211689		2203	4300	6503	SO:0001630	splice_region_variant	123283				threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity	g.chr15:102211689C>T	AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1967+1G>A	15.37:g.102211689C>T						TARSL2_uc002bxl.2_Missense_Mutation_p.S201N|TARSL2_uc010usi.1_RNA	p.S656N	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		15	2022	-	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		656					B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Missense_Mutation	SNP	ENST00000335968.3	37	c.1967G>A	CCDS10394.1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.355714	0.41700	.	.	ENSG00000185418	ENST00000335968;ENST00000333018;ENST00000539112	.	.	.	5.25	5.25	0.73442	Aminoacyl-tRNA synthetase, class II (1);	0.089181	0.85682	D	0.000000	T	0.43986	0.1272	N	0.21373	0.66	0.45239	D	0.998241	B;B	0.23185	0.017;0.081	B;B	0.21360	0.022;0.034	T	0.29671	-1.0004	8	.	.	.	-19.9666	16.3435	0.83110	0.0:1.0:0.0:0.0	.	656;561	A2RTX5;A2RTX5-2	SYTC2_HUMAN;.	N	656;561;656	.	.	S	-	2	0	TARSL2	100029212	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	5.593000	0.67550	2.460000	0.83146	0.591000	0.81541	AGT		0.299	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313619.3	NM_152334	Missense_Mutation	15	102	0	0	0	0.00245	0	15	102				
ECI1	1632	broad.mit.edu	37	16	2296868	2296868	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:2296868G>A	ENST00000301729.4	-	3	333	c.286C>T	c.(286-288)Ctg>Ttg	p.L96L	ECI1_ENST00000562238.1_Silent_p.L96L|ECI1_ENST00000570258.1_Silent_p.L37L	NM_001919.3	NP_001910.2	P42126	ECI1_HUMAN	enoyl-CoA delta isomerase 1	96					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|intramolecular oxidoreductase activity (GO:0016860)	p.L96L(1)		endometrium(1)|large_intestine(2)|lung(6)	9						ACCGAGGTCAGAATGACACCG	0.572																																							uc002cpr.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(286-288)CTG>TTG		dodecenoyl-Coenzyme A delta isomerase precursor							81.0	77.0	78.0					16																	2296868		2198	4300	6498	SO:0001819	synonymous_variant	1632				fatty acid beta-oxidation	mitochondrial matrix	dodecenoyl-CoA delta-isomerase activity	g.chr16:2296868G>A		CCDS10464.1, CCDS58410.1	16p13.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000167969	ENSG00000167969	5.3.3.8		2703	protein-coding gene	gene with protein product	"""3,2 trans-enoyl-CoA isomerase"""	600305	"""dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)"", ""dodecenoyl-CoA isomerase"""	DCI		7829074	Standard	NM_001178029		Approved		uc002cpr.3	P42126	OTTHUMG00000128830	ENST00000301729.4:c.286C>T	16.37:g.2296868G>A						DCI_uc002cps.2_Silent_p.L96L	p.L96L	NM_001919	NP_001910	P42126	ECI1_HUMAN			3	322	-			96					A8K512|Q13290|Q7Z2L6|Q7Z2L7|Q9BUB8|Q9BW05|Q9UDG6	Silent	SNP	ENST00000301729.4	37	c.286C>T	CCDS10464.1																																																																																				0.572	ECI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250768.1			12	64	0	0	0	0.001368	0	12	64				
ABCA3	21	broad.mit.edu	37	16	2331082	2331082	+	Silent	SNP	G	G	C	rs199852776		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:2331082G>C	ENST00000301732.5	-	28	5005	c.4305C>G	c.(4303-4305)ctC>ctG	p.L1435L	ABCA3_ENST00000382381.3_Silent_p.L1377L	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1435	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.L1435L(1)		breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CCCCAGAAGTGAGGCTCTCCT	0.602																																							uc002cpy.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16						c.(4303-4305)CTC>CTG		ATP-binding cassette, sub-family A member 3							125.0	110.0	115.0					16																	2331082		2198	4300	6498	SO:0001819	synonymous_variant	21				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:2331082G>C	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.4305C>G	16.37:g.2331082G>C						ABCA3_uc010bsk.1_Silent_p.L1377L	p.L1435L	NM_001089	NP_001080	Q99758	ABCA3_HUMAN			28	5017	-		Ovarian(90;0.17)	1435			ABC transporter 2.		B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	37	c.4305C>G	CCDS10466.1																																																																																				0.602	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089		3	51	0	0	0	0.004672	0	3	51				
TFAP4	7023	broad.mit.edu	37	16	4312331	4312331	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:4312331G>A	ENST00000204517.6	-	3	676	c.348C>T	c.(346-348)ttC>ttT	p.F116F		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	116	Leucine-zipper 1.				cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)	p.F116F(1)		NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						GCACCTGGATGAAGCGCTTGA	0.622																																							uc010uxg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(346-348)TTC>TTT		transcription factor AP-4 (activating enhancer							125.0	114.0	117.0					16																	4312331		2197	4300	6497	SO:0001819	synonymous_variant	7023				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation by host of viral transcription|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|regulation of S phase of mitotic cell cycle	transcriptional repressor complex	E-box binding|histone deacetylase binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr16:4312331G>A	X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.348C>T	16.37:g.4312331G>A							p.F116F	NM_003223	NP_003214	Q01664	TFAP4_HUMAN			3	602	-			116			Leucine-zipper 1.		O60409	Silent	SNP	ENST00000204517.6	37	c.348C>T	CCDS10510.1																																																																																				0.622	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251595.2	NM_003223		11	77	0	0	0	0.001368	0	11	77				
TFAP4	7023	broad.mit.edu	37	16	4312570	4312570	+	Silent	SNP	G	G	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:4312570G>T	ENST00000204517.6	-	2	550	c.222C>A	c.(220-222)ctC>ctA	p.L74L		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	74	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)	p.L74L(1)		NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						TGTGGGGGATGAGGGTCTTGA	0.637																																							uc010uxg.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(220-222)CTC>CTA		transcription factor AP-4 (activating enhancer							113.0	108.0	110.0					16																	4312570		2197	4300	6497	SO:0001819	synonymous_variant	7023				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation by host of viral transcription|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|regulation of S phase of mitotic cell cycle	transcriptional repressor complex	E-box binding|histone deacetylase binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr16:4312570G>T	X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.222C>A	16.37:g.4312570G>T							p.L74L	NM_003223	NP_003214	Q01664	TFAP4_HUMAN			2	476	-			74			Helix-loop-helix motif.		O60409	Silent	SNP	ENST00000204517.6	37	c.222C>A	CCDS10510.1																																																																																				0.637	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251595.2	NM_003223		11	94	1	0	3.07112e-06	0.000978	4.18195e-06	11	94				
MGRN1	23295	broad.mit.edu	37	16	4715113	4715113	+	Silent	SNP	G	G	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:4715113G>T	ENST00000399577.5	+	7	732	c.639G>T	c.(637-639)gtG>gtT	p.V213V	MGRN1_ENST00000588994.1_Silent_p.V213V|MGRN1_ENST00000415496.1_Silent_p.V214V|MGRN1_ENST00000262370.7_Silent_p.V213V|MGRN1_ENST00000586183.1_Silent_p.V213V	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	213					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V213V(2)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						TGGTGGAAGTGACTGGCCACG	0.652																																							uc002cwz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|skin(1)	2						c.(637-639)GTG>GTT		mahogunin, ring finger 1 isoform 3							52.0	60.0	57.0					16																	4715113		2105	4225	6330	SO:0001819	synonymous_variant	23295				endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:4715113G>T	AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.639G>T	16.37:g.4715113G>T						MGRN1_uc002cxa.2_Silent_p.V213V|MGRN1_uc010btx.2_Silent_p.V214V|MGRN1_uc010btw.2_Silent_p.V214V|MGRN1_uc002cxb.2_Silent_p.V213V|MGRN1_uc010uxo.1_Silent_p.V213V|MGRN1_uc010uxp.1_Silent_p.V213V|MGRN1_uc010uxq.1_RNA	p.V213V	NM_001142290	NP_001135762	O60291	MGRN1_HUMAN			7	775	+			213					A4URL3|A4URL4|Q86W76	Silent	SNP	ENST00000399577.5	37	c.639G>T	CCDS45402.1																																																																																				0.652	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2			5	50	1	0	5.18039e-06	0.00308	7.01683e-06	5	50				
SEC14L5	9717	broad.mit.edu	37	16	5056047	5056047	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:5056047G>T	ENST00000251170.7	+	12	1615	c.1435G>T	c.(1435-1437)Gtg>Ttg	p.V479L		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	479	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)	p.V479L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						GGGAGAGAGTGTGGTGAGGCT	0.602																																							uc002cye.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1435-1437)GTG>TTG		SEC14-like 5							53.0	57.0	56.0					16																	5056047		2012	4172	6184	SO:0001583	missense	9717					integral to membrane|intracellular	transporter activity	g.chr16:5056047G>T	AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.1435G>T	16.37:g.5056047G>T	ENSP00000251170:p.Val479Leu						p.V479L	NM_014692	NP_055507	O43304	S14L5_HUMAN			12	1615	+			479			CRAL-TRIO.			Missense_Mutation	SNP	ENST00000251170.7	37	c.1435G>T	CCDS45403.1	.	.	.	.	.	.	.	.	.	.	G	5.372	0.253943	0.10185	.	.	ENSG00000103184	ENST00000251170	T	0.59772	0.24	3.95	-6.59	0.01830	Cellular retinaldehyde-binding/triple function, C-terminal (4);	1.049810	0.07569	N	0.918286	T	0.30230	0.0758	N	0.16266	0.395	0.21841	N	0.999512	B	0.02656	0.0	B	0.04013	0.001	T	0.14172	-1.0482	10	0.25106	T	0.35	-15.9611	2.9339	0.05808	0.164:0.2253:0.4238:0.1869	.	479	O43304	S14L5_HUMAN	L	479	ENSP00000251170:V479L	ENSP00000251170:V479L	V	+	1	0	SEC14L5	4996048	0.003000	0.15002	0.032000	0.17829	0.098000	0.18820	0.018000	0.13422	-0.744000	0.04778	-0.324000	0.08512	GTG		0.602	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434379.1			5	38	1	0	1.23904e-05	0.000602	1.6607e-05	5	38				
UMOD	7369	broad.mit.edu	37	16	20348643	20348643	+	Silent	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:20348643G>C	ENST00000570689.1	-	8	1856	c.1710C>G	c.(1708-1710)ctC>ctG	p.L570L	UMOD_ENST00000424589.1_Silent_p.L603L|UMOD_ENST00000570331.1_5'UTR|UMOD_ENST00000396142.2_Silent_p.L570L|UMOD_ENST00000302509.4_Silent_p.L570L|UMOD_ENST00000396138.4_Silent_p.L619L|UMOD_ENST00000396134.2_Silent_p.L603L			P07911	UROM_HUMAN	uromodulin	570	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.L570L(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TGGTGTCACAGAGATAGACTT	0.493																																							uc002dgz.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(1708-1710)CTC>CTG		uromodulin precursor							91.0	84.0	86.0					16																	20348643		2203	4300	6503	SO:0001819	synonymous_variant	7369				cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding	g.chr16:20348643G>C	M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1710C>G	16.37:g.20348643G>C						UMOD_uc002dha.2_Silent_p.L570L|UMOD_uc002dhb.2_Silent_p.L603L	p.L570L	NM_003361	NP_003352	P07911	UROM_HUMAN			8	1839	-			570			ZP.		B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Silent	SNP	ENST00000570689.1	37	c.1710C>G	CCDS10583.1																																																																																				0.493	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1			7	38	0	0	0	0.00308	0	7	38				
SLC5A11	115584	broad.mit.edu	37	16	24902236	24902236	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:24902236C>G	ENST00000347898.3	+	9	1333	c.711C>G	c.(709-711)ttC>ttG	p.F237L	SLC5A11_ENST00000449109.2_Intron|SLC5A11_ENST00000545376.1_Missense_Mutation_p.F167L|SLC5A11_ENST00000567758.1_Missense_Mutation_p.F202L|SLC5A11_ENST00000539472.1_Missense_Mutation_p.F173L|SLC5A11_ENST00000569071.1_Intron|SLC5A11_ENST00000424767.2_Missense_Mutation_p.F202L|SLC5A11_ENST00000565769.1_Missense_Mutation_p.F173L|SLC5A11_ENST00000568579.1_Missense_Mutation_p.F167L	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11									p.F237L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		AGAAGTACTTCTTGGCCCTGG	0.542																																							uc002dmu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(709-711)TTC>TTG		solute carrier family 5 (sodium/glucose							137.0	139.0	138.0					16																	24902236		2197	4300	6497	SO:0001583	missense	115584				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity	g.chr16:24902236C>G	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.711C>G	16.37:g.24902236C>G	ENSP00000289932:p.Phe237Leu					SLC5A11_uc002dms.2_Missense_Mutation_p.F173L|SLC5A11_uc010vcd.1_Missense_Mutation_p.F202L|SLC5A11_uc002dmt.2_Intron|SLC5A11_uc010vce.1_Missense_Mutation_p.F167L|SLC5A11_uc010bxt.2_Missense_Mutation_p.F173L	p.F237L	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN		GBM - Glioblastoma multiforme(48;0.0365)	9	943	+			237			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000347898.3	37	c.711C>G	CCDS10625.1	.	.	.	.	.	.	.	.	.	.	C	12.41	1.929572	0.34096	.	.	ENSG00000158865	ENST00000347898;ENST00000424767;ENST00000545376;ENST00000539472	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	5.71	1.63	0.23807	.	0.401465	0.30277	N	0.009994	T	0.76758	0.4032	N	0.26130	0.795	0.25494	N	0.987611	B;B;B	0.13594	0.005;0.008;0.006	B;B;B	0.16289	0.01;0.015;0.009	T	0.65084	-0.6254	10	0.36615	T	0.2	.	9.5903	0.39541	0.0:0.7233:0.0:0.2767	.	167;202;237	B7Z329;Q8WWX8-2;Q8WWX8	.;.;SC5AB_HUMAN	L	237;202;167;173	ENSP00000289932:F237L;ENSP00000416782:F202L;ENSP00000441384:F167L;ENSP00000441018:F173L	ENSP00000289932:F237L	F	+	3	2	SLC5A11	24809737	0.001000	0.12720	0.998000	0.56505	0.996000	0.88848	-0.116000	0.10724	0.786000	0.33708	0.650000	0.86243	TTC		0.542	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	NM_052944		27	170	0	0	0	0.004656	0	27	170				
ITGAX	3687	broad.mit.edu	37	16	31374654	31374654	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:31374654C>T	ENST00000268296.4	+	14	1790	c.1669C>T	c.(1669-1671)Cac>Tac	p.H557Y	ITGAX_ENST00000562522.1_Missense_Mutation_p.H557Y	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	557					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.H557Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CTACCTGTTTCACGGAGTCTT	0.612																																							uc002ebu.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1669-1671)CAC>TAC		integrin alpha X precursor							103.0	105.0	105.0					16																	31374654		2197	4300	6497	SO:0001583	missense	3687				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity	g.chr16:31374654C>T	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1669C>T	16.37:g.31374654C>T	ENSP00000268296:p.His557Tyr					ITGAX_uc002ebt.2_Missense_Mutation_p.H557Y|ITGAX_uc010vfk.1_Missense_Mutation_p.H207Y	p.H557Y	NM_000887	NP_000878	P20702	ITAX_HUMAN			14	1736	+			557			Extracellular (Potential).|FG-GAP 6.		Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	c.1669C>T	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.627035	0.46840	.	.	ENSG00000140678	ENST00000268296	T	0.11169	2.8	4.14	4.14	0.48551	.	.	.	.	.	T	0.31199	0.0789	M	0.76170	2.325	0.44136	D	0.996922	D	0.89917	1.0	D	0.72075	0.976	T	0.04467	-1.0949	9	0.51188	T	0.08	.	13.6863	0.62517	0.0:1.0:0.0:0.0	.	557	P20702	ITAX_HUMAN	Y	557	ENSP00000268296:H557Y	ENSP00000268296:H557Y	H	+	1	0	ITGAX	31282155	0.997000	0.39634	0.995000	0.50966	0.138000	0.21146	3.571000	0.53841	2.012000	0.59069	0.460000	0.39030	CAC		0.612	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887		12	158	0	0	0	0.001855	0	12	158				
ACD	65057	broad.mit.edu	37	16	67691946	67691946	+	Silent	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:67691946C>T	ENST00000393919.4	-	10	1671	c.1407G>A	c.(1405-1407)cgG>cgA	p.R469R	PARD6A_ENST00000458121.2_5'Flank|PARD6A_ENST00000219255.3_5'Flank|ACD_ENST00000219251.8_Silent_p.R466R|PARD6A_ENST00000602551.1_5'Flank			Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog (mouse)	469					intracellular protein transport (GO:0006886)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of single-stranded telomeric DNA binding (GO:0060381)|positive regulation of telomerase activity (GO:0051973)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.R466R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		GAAAAGGCGGCCGATTCTTGC	0.612																																							uc002etq.3		NA																	1	Substitution - coding silent(1)		lung(1)	pancreas(1)	1						c.(1405-1407)CGG>CGA		adrenocortical dysplasia homolog isoform 1							46.0	52.0	50.0					16																	67691946		2198	4298	6496	SO:0001819	synonymous_variant	65057				intracellular protein transport|negative regulation of telomere maintenance via telomerase|positive regulation of single-stranded telomeric DNA binding|positive regulation of telomerase activity|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|telomere assembly	nuclear telomere cap complex|nucleoplasm	DNA binding|DNA polymerase binding	g.chr16:67691946C>T	AF070535	CCDS10842.1, CCDS42181.1	16q22	2012-08-23			ENSG00000102977	ENSG00000102977			25070	protein-coding gene	gene with protein product	"""TIN2 interacting protein 1"", ""POT1 and TIN2 organizing protein"""	609377				15231715, 15181449	Standard	NM_001082486		Approved	Ptop, Pip1, Tpp1, Tint1	uc002etq.4	Q96AP0	OTTHUMG00000137547	ENST00000393919.4:c.1407G>A	16.37:g.67691946C>T						ACD_uc002etp.3_Silent_p.R466R|ACD_uc002etr.3_Silent_p.R466R|ACD_uc010vjt.1_3'UTR|PARD6A_uc002ets.2_5'Flank|PARD6A_uc002ett.2_5'Flank	p.R469R	NM_001082486	NP_001075955	Q96AP0	ACD_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)	10	1744	-		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)	469					Q562H5|Q9H8F9	Silent	SNP	ENST00000393919.4	37	c.1407G>A	CCDS42181.1																																																																																				0.612	ACD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268880.1	NM_022914		6	59	0	0	0	0.001168	0	6	59				
ATMIN	23300	broad.mit.edu	37	16	81078195	81078195	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr16:81078195G>A	ENST00000299575.4	+	4	2116	c.2092G>A	c.(2092-2094)Gag>Aag	p.E698K	ATMIN_ENST00000564241.1_Missense_Mutation_p.E542K|ATMIN_ENST00000539819.1_3'UTR|ATMIN_ENST00000566488.1_Missense_Mutation_p.E542K	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	698					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)	p.E698K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						CTTAGGCCTTGAGATGTTTGA	0.453																																							uc002ffz.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2092-2094)GAG>AAG		ATM interactor							142.0	149.0	146.0					16																	81078195		2202	4300	6502	SO:0001583	missense	23300				response to DNA damage stimulus	nucleus	zinc ion binding	g.chr16:81078195G>A	BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.2092G>A	16.37:g.81078195G>A	ENSP00000299575:p.Glu698Lys					ATMIN_uc002fga.2_Missense_Mutation_p.E540K|ATMIN_uc010vnn.1_Missense_Mutation_p.E469K|ATMIN_uc002fgb.1_Missense_Mutation_p.E540K	p.E698K	NM_015251	NP_056066	O43313	ATMIN_HUMAN			4	2110	+			698					A8K4H8|Q68DC9	Missense_Mutation	SNP	ENST00000299575.4	37	c.2092G>A	CCDS32494.1	.	.	.	.	.	.	.	.	.	.	G	33	5.218555	0.95104	.	.	ENSG00000166454	ENST00000299575;ENST00000539819	T	0.57436	0.4	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.75796	0.3898	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.76556	-0.2916	10	0.87932	D	0	-29.4582	20.5407	0.99260	0.0:0.0:1.0:0.0	.	698	O43313	ATMIN_HUMAN	K	698;469	ENSP00000299575:E698K	ENSP00000299575:E698K	E	+	1	0	ATMIN	79635696	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.691000	0.98679	2.865000	0.98341	0.655000	0.94253	GAG		0.453	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432140.1	NM_015251		25	217	0	0	0	0.00632	0	25	217				
WDR81	124997	broad.mit.edu	37	17	1640965	1640965	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:1640965C>T	ENST00000409644.1	+	10	5812	c.5812C>T	c.(5812-5814)Cgc>Tgc	p.R1938C	WDR81_ENST00000437219.2_Missense_Mutation_p.R735C|WDR81_ENST00000446363.1_Missense_Mutation_p.R577C|WDR81_ENST00000309182.5_Missense_Mutation_p.R887C|WDR81_ENST00000419248.1_Missense_Mutation_p.R711C|WDR81_ENST00000545662.1_Missense_Mutation_p.R569C|RP11-961A15.1_ENST00000576540.1_RNA	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1938					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.R887C(1)|p.R1938C(1)|p.R735C(1)		cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CGGGGTTATCCGCCTCCTGGC	0.642																																							uc002fti.2		NA																	3	Substitution - Missense(3)		lung(3)	skin(1)	1						c.(2131-2133)CGC>TGC		WD repeat domain 81 isoform 4							48.0	40.0	43.0					17																	1640965		2199	4294	6493	SO:0001583	missense	124997							g.chr17:1640965C>T	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.5812C>T	17.37:g.1640965C>T	ENSP00000386609:p.Arg1938Cys					WDR81_uc002fth.2_Missense_Mutation_p.R887C|WDR81_uc010vqp.1_Missense_Mutation_p.R735C|WDR81_uc002ftj.2_Missense_Mutation_p.R1938C|WDR81_uc010vqq.1_Missense_Mutation_p.R569C	p.R711C	NM_001163811	NP_001157283	Q562E7	WDR81_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	10	2392	+			711					B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	ENST00000409644.1	37	c.2131C>T	CCDS54062.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.958667	0.74016	.	.	ENSG00000167716	ENST00000437219;ENST00000309182;ENST00000446363;ENST00000419248;ENST00000409644;ENST00000354680;ENST00000545662	T;T;T;T;T;T	0.01516	4.81;4.81;4.81;4.81;4.81;4.81	4.8	4.8	0.61643	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	U	0.000014	T	0.08935	0.0221	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.67103	0.945;0.948;0.949	T	0.02588	-1.1137	10	0.87932	D	0	.	17.8609	0.88780	0.0:1.0:0.0:0.0	.	569;735;887	B7Z6V3;B7Z579;Q562E7	.;.;WDR81_HUMAN	C	735;887;577;711;1938;689;569	ENSP00000391074:R735C;ENSP00000312074:R887C;ENSP00000401560:R577C;ENSP00000407845:R711C;ENSP00000386609:R1938C;ENSP00000442726:R569C	ENSP00000312074:R887C	R	+	1	0	WDR81	1587715	0.999000	0.42202	1.000000	0.80357	0.850000	0.48378	2.722000	0.47269	2.212000	0.71576	0.655000	0.94253	CGC		0.642	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348		4	25	0	0	0	0.000248	0	4	25				
ALOX15B	247	broad.mit.edu	37	17	7942594	7942594	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:7942594C>T	ENST00000380183.4	+	1	260	c.121C>T	c.(121-123)Ctc>Ttc	p.L41F	ALOX15B_ENST00000380173.2_Missense_Mutation_p.L41F|ALOX15B_ENST00000572022.1_Missense_Mutation_p.L41F|ALOX15B_ENST00000573359.1_Missense_Mutation_p.L41F	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	41	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)	p.L41F(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						CCTGGACAATCTCGGCAAGGA	0.652																																							uc002gju.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(121-123)CTC>TTC		arachidonate 15-lipoxygenase, second type							54.0	62.0	59.0					17																	7942594		2203	4300	6503	SO:0001583	missense	247				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity	g.chr17:7942594C>T	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.121C>T	17.37:g.7942594C>T	ENSP00000369530:p.Leu41Phe					ALOX15B_uc002gjv.2_Missense_Mutation_p.L41F|ALOX15B_uc002gjw.2_Missense_Mutation_p.L41F|ALOX15B_uc010vun.1_Missense_Mutation_p.L41F|ALOX15B_uc010cnp.2_5'UTR	p.L41F	NM_001141	NP_001132	O15296	LX15B_HUMAN			1	237	+			41			PLAT.		D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	37	c.121C>T	CCDS11128.1	.	.	.	.	.	.	.	.	.	.	C	0.205	-1.041030	0.02013	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	T;T	0.22336	1.96;1.96	4.28	-3.5	0.04710	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	1.630200	0.03355	N	0.196780	T	0.13457	0.0326	N	0.21583	0.68	0.09310	N	1	B;B;B;B	0.09022	0.002;0.002;0.002;0.002	B;B;B;B	0.15484	0.013;0.008;0.003;0.006	T	0.33624	-0.9861	10	0.08837	T	0.75	-8.7828	11.2447	0.48990	0.0:0.2015:0.0:0.7985	.	41;41;41;41	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	F	41	ENSP00000369520:L41F;ENSP00000369530:L41F	ENSP00000344337:L41F	L	+	1	0	ALOX15B	7883319	0.000000	0.05858	0.008000	0.14137	0.691000	0.40173	-1.451000	0.02387	-0.474000	0.06862	-0.218000	0.12543	CTC		0.652	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2			13	56	0	0	0	0.00499	0	13	56				
SUPT6H	6830	broad.mit.edu	37	17	27016441	27016441	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:27016441G>A	ENST00000314616.6	+	25	3487	c.3204G>A	c.(3202-3204)aaG>aaA	p.K1068K	SUPT6H_ENST00000347486.4_Silent_p.K1068K	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1068	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K1068K(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GGGCTAGGAAGATGGCAGTGG	0.498																																							uc002hby.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(3202-3204)AAG>AAA		suppressor of Ty 6 homolog							118.0	103.0	108.0					17																	27016441		2203	4300	6503	SO:0001819	synonymous_variant	6830				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:27016441G>A	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3204G>A	17.37:g.27016441G>A						SUPT6H_uc010crt.2_Silent_p.K1068K|SUPT6H_uc002hbz.1_5'UTR	p.K1068K	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN			25	3294	+	Lung NSC(42;0.00431)		1068					A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	37	c.3204G>A	CCDS32596.1																																																																																				0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		7	75	0	0	0	0.001984	0	7	75				
PCGF2	7703	broad.mit.edu	37	17	36895840	36895840	+	Splice_Site	SNP	T	T	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:36895840T>A	ENST00000580830.1	-	5	909	c.208A>T	c.(208-210)Agg>Tgg	p.R70W	PCGF2_ENST00000579882.1_Splice_Site_p.R70W|PCGF2_ENST00000585100.1_Splice_Site_p.R70W|PCGF2_ENST00000578109.1_Splice_Site_p.R16W|PCGF2_ENST00000581345.1_Splice_Site_p.R70W|PCGF2_ENST00000360797.2_Splice_Site_p.R70W			P35227	PCGF2_HUMAN	polycomb group ring finger 2	70					anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R70W(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					CAAGCCCACCTGATGCTCAGC	0.622																																							uc002hqp.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(208-210)AGG>TGG		ring finger protein 110							127.0	103.0	111.0					17																	36895840		2203	4300	6503	SO:0001630	splice_region_variant	7703				negative regulation of transcription from RNA polymerase II promoter	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr17:36895840T>A	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.209+1A>T	17.37:g.36895840T>A						PCGF2_uc002hqn.1_Missense_Mutation_p.R70W|PCGF2_uc002hqo.1_Missense_Mutation_p.R70W|PCGF2_uc010cvo.1_5'UTR|PCGF2_uc002hqq.1_Missense_Mutation_p.R70W	p.R70W	NM_007144	NP_009075	P35227	PCGF2_HUMAN			4	451	-	Breast(7;9.07e-22)		70					A6NGD8	Missense_Mutation	SNP	ENST00000580830.1	37	c.208A>T	CCDS32638.1	.	.	.	.	.	.	.	.	.	.	T	12.54	1.967579	0.34754	.	.	ENSG00000056661	ENST00000360797	T	0.38722	1.12	4.56	4.56	0.56223	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.67449	0.2894	M	0.91612	3.225	0.52501	D	0.999956	D	0.64830	0.994	D	0.63381	0.914	T	0.75519	-0.3289	10	0.87932	D	0	-13.7456	11.9094	0.52731	0.0:0.0:0.0:1.0	.	70	P35227	PCGF2_HUMAN	W	70	ENSP00000354033:R70W	ENSP00000354033:R70W	R	-	1	2	PCGF2	34149366	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	2.944000	0.49034	1.916000	0.55485	0.402000	0.26972	AGG		0.622	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144	Missense_Mutation	8	82	0	0	0	0.004482	0	8	82				
PCGF2	7703	broad.mit.edu	37	17	36895846	36895846	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:36895846T>C	ENST00000580830.1	-	5	903	c.202A>G	c.(202-204)Agc>Ggc	p.S68G	PCGF2_ENST00000579882.1_Missense_Mutation_p.S68G|PCGF2_ENST00000585100.1_Missense_Mutation_p.S68G|PCGF2_ENST00000578109.1_Missense_Mutation_p.S14G|PCGF2_ENST00000581345.1_Missense_Mutation_p.S68G|PCGF2_ENST00000360797.2_Missense_Mutation_p.S68G			P35227	PCGF2_HUMAN	polycomb group ring finger 2	68					anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S68G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					CACCTGATGCTCAGCAGCGGC	0.627																																							uc002hqp.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(202-204)AGC>GGC		ring finger protein 110							132.0	107.0	115.0					17																	36895846		2203	4300	6503	SO:0001583	missense	7703				negative regulation of transcription from RNA polymerase II promoter	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr17:36895846T>C	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.202A>G	17.37:g.36895846T>C	ENSP00000461961:p.Ser68Gly					PCGF2_uc002hqn.1_Missense_Mutation_p.S68G|PCGF2_uc002hqo.1_Missense_Mutation_p.S68G|PCGF2_uc010cvo.1_5'UTR|PCGF2_uc002hqq.1_Missense_Mutation_p.S68G	p.S68G	NM_007144	NP_009075	P35227	PCGF2_HUMAN			4	445	-	Breast(7;9.07e-22)		68					A6NGD8	Missense_Mutation	SNP	ENST00000580830.1	37	c.202A>G	CCDS32638.1	.	.	.	.	.	.	.	.	.	.	T	13.01	2.110874	0.37242	.	.	ENSG00000056661	ENST00000360797	T	0.42131	0.98	4.56	3.48	0.39840	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	L	0.47716	1.5	0.42689	D	0.993575	P	0.41710	0.76	B	0.37239	0.244	T	0.10683	-1.0619	10	0.54805	T	0.06	-19.5651	8.2714	0.31846	0.0:0.0956:0.0:0.9044	.	68	P35227	PCGF2_HUMAN	G	68	ENSP00000354033:S68G	ENSP00000354033:S68G	S	-	1	0	PCGF2	34149372	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.567000	0.82357	0.781000	0.33589	0.402000	0.26972	AGC		0.627	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144		7	91	0	0	0	0.00308	0	7	91				
KRT28	162605	broad.mit.edu	37	17	38953259	38953259	+	Nonsense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:38953259G>C	ENST00000306658.7	-	5	952	c.887C>G	c.(886-888)tCa>tGa	p.S296*		NM_181535.3	NP_853513.2			keratin 28									p.S296*(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				GGCTGCGCCTGAGTCGTGGGA	0.662																																					Melanoma(19;789 869 15380 26882 39836)	Melanoma(19;789 869 15380 26882 39836)	uc002hvh.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(886-888)TCA>TGA		keratin 25D							46.0	52.0	50.0					17																	38953259		2203	4300	6503	SO:0001587	stop_gained	162605					cytoplasm|intermediate filament	structural molecule activity	g.chr17:38953259G>C	AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.887C>G	17.37:g.38953259G>C	ENSP00000305263:p.Ser296*						p.S296*	NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN			5	953	-		Breast(137;0.000301)	296			Rod.|Coil 2.			Nonsense_Mutation	SNP	ENST00000306658.7	37	c.887C>G	CCDS11376.1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.487963	0.64074	.	.	ENSG00000173908	ENST00000306658	.	.	.	5.0	2.99	0.34606	.	0.573594	0.15488	N	0.259728	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	8.168	0.31239	0.1877:0.0:0.8123:0.0	.	.	.	.	X	296	.	ENSP00000305263:S296X	S	-	2	0	KRT28	36206785	0.002000	0.14202	0.298000	0.25002	0.205000	0.24178	1.074000	0.30703	0.602000	0.29896	0.591000	0.81541	TCA		0.662	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257201.2	NM_181535		8	53	0	0	0	0.00308	0	8	53				
KRT13	3860	broad.mit.edu	37	17	39658760	39658760	+	Silent	SNP	G	G	A	rs147022064		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:39658760G>A	ENST00000246635.3	-	6	1156	c.1110C>T	c.(1108-1110)atC>atT	p.I370I	KRT13_ENST00000587118.1_5'Flank|KRT13_ENST00000336861.3_Silent_p.I370I|AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Silent_p.I370I	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	370	Coil 2.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.I370I(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				GCTGGGCCTCGATGCTGCTGA	0.602																																							uc002hwu.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(2)|pancreas(1)	5						c.(1108-1110)ATC>ATT		keratin 13 isoform a							152.0	128.0	136.0					17																	39658760		2203	4300	6503	SO:0001819	synonymous_variant	3860				epidermis development	intermediate filament	structural molecule activity	g.chr17:39658760G>A		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.1110C>T	17.37:g.39658760G>A						KRT13_uc002hwv.1_Silent_p.I370I|KRT13_uc002hww.2_Silent_p.I263I|KRT13_uc010wfr.1_Silent_p.I263I|KRT13_uc010cxo.2_Silent_p.I370I|KRT13_uc002hwx.1_Silent_p.I358I	p.I370I	NM_153490	NP_705694	P13646	K1C13_HUMAN			6	1173	-		Breast(137;0.000286)	370			Rod.|Coil 2.		Q53G54|Q6AZK5|Q8N240	Silent	SNP	ENST00000246635.3	37	c.1110C>T	CCDS11396.1	.	.	.	.	.	.	.	.	.	.	G	9.837	1.190118	0.21954	.	.	ENSG00000171401	ENST00000157775	.	.	.	4.45	-1.25	0.09405	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	7.4566	0.27270	0.2321:0.4076:0.3603:0.0	.	.	.	.	X	347	.	ENSP00000157775:R347X	R	-	1	2	KRT13	36912286	0.002000	0.14202	0.994000	0.49952	0.935000	0.57460	-1.284000	0.02793	-0.035000	0.13691	0.478000	0.44815	CGA		0.602	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490		14	102	0	0	0	0.00245	0	14	102				
LEPREL4	10609	broad.mit.edu	37	17	39967121	39967121	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:39967121T>A	ENST00000355468.3	-	4	1247	c.781A>T	c.(781-783)Ata>Tta	p.I261L	LEPREL4_ENST00000393928.1_Missense_Mutation_p.I261L|FKBP10_ENST00000321562.4_5'Flank			Q92791	SC65_HUMAN	leprecan-like 4	261					synaptonemal complex assembly (GO:0007130)	condensed nuclear chromosome (GO:0000794)|nucleolus (GO:0005730)|synaptonemal complex (GO:0000795)		p.I261L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8						ATACCTGCTATGGCCGGGTAG	0.637																																							uc002hxt.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(781-783)ATA>TTA		synaptonemal complex protein SC65							57.0	58.0	58.0					17																	39967121		2203	4300	6503	SO:0001583	missense	10609				synaptonemal complex assembly	nucleolus|synaptonemal complex	binding	g.chr17:39967121T>A	BC001047	CCDS11408.1	17q12	2013-05-03	2002-08-29		ENSG00000141696	ENSG00000141696			16946	protein-coding gene	gene with protein product			"""nucleolar autoantigen (55kD)"", ""rat synaptonemal complex protein"""			8862517	Standard	NM_006455		Approved	SC65, NO55	uc002hxt.3	Q92791	OTTHUMG00000133501	ENST00000355468.3:c.781A>T	17.37:g.39967121T>A	ENSP00000347649:p.Ile261Leu					FKBP10_uc002hxv.2_5'Flank|SC65_uc002hxu.2_Missense_Mutation_p.I352L	p.I261L	NM_006455	NP_006446	Q92791	SC65_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.149)	3	1065	-		Breast(137;0.000162)	261					Q53GI6|Q9H4F6	Missense_Mutation	SNP	ENST00000355468.3	37	c.781A>T	CCDS11408.1	.	.	.	.	.	.	.	.	.	.	T	16.41	3.115436	0.56505	.	.	ENSG00000141696	ENST00000355468;ENST00000393928;ENST00000545545	T;T	0.33865	1.39;1.39	5.68	5.68	0.88126	.	0.111526	0.64402	D	0.000010	T	0.24928	0.0605	N	0.26042	0.785	0.35213	D	0.77533	B;B	0.26081	0.141;0.009	B;B	0.22753	0.041;0.013	T	0.29579	-1.0007	10	0.42905	T	0.14	-11.1721	9.3019	0.37851	0.0:0.0808:0.0:0.9192	.	250;261	B4DVZ5;Q92791	.;SC65_HUMAN	L	261;261;250	ENSP00000347649:I261L;ENSP00000377505:I261L	ENSP00000347649:I261L	I	-	1	0	LEPREL4	37220647	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.865000	0.27940	2.158000	0.67659	0.533000	0.62120	ATA		0.637	LEPREL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257439.2			4	23	0	0	0	0.000248	0	4	23				
AMZ2	51321	broad.mit.edu	37	17	66250612	66250612	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:66250612G>A	ENST00000359904.3	+	5	1786	c.654G>A	c.(652-654)gtG>gtA	p.V218V	AMZ2_ENST00000577866.1_Silent_p.V218V|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000392720.2_Silent_p.V218V|AMZ2_ENST00000359783.4_Silent_p.V160V|AMZ2_ENST00000577273.1_Intron|AMZ2_ENST00000580753.1_Silent_p.V218V|AMZ2_ENST00000577985.1_Silent_p.V218V	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	218							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V160V(1)|p.V218V(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			AAGGCAAAGTGAAGAAGCTCA	0.358																																							uc002jgs.1		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(652-654)GTG>GTA		archaemetzincins-2 isoform 1							102.0	96.0	98.0					17																	66250612		2203	4300	6503	SO:0001819	synonymous_variant	51321						metallopeptidase activity|zinc ion binding	g.chr17:66250612G>A	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.654G>A	17.37:g.66250612G>A						AMZ2_uc002jgr.1_Silent_p.V218V|AMZ2_uc002jgt.1_Silent_p.V218V|AMZ2_uc002jgu.1_Silent_p.V218V|AMZ2_uc002jgv.1_Silent_p.V218V|AMZ2_uc002jgw.1_Silent_p.V160V|AMZ2_uc002jgy.1_Silent_p.V218V	p.V218V	NM_001033572	NP_001028744	Q86W34	AMZ2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		6	771	+	all_cancers(12;1.12e-09)		218					A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Silent	SNP	ENST00000359904.3	37	c.654G>A	CCDS11674.1																																																																																				0.358	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448261.1	NM_016627		10	62	0	0	0	0.008291	0	10	62				
SLC16A5	9121	broad.mit.edu	37	17	73089889	73089889	+	Missense_Mutation	SNP	C	C	G	rs375442826		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:73089889C>G	ENST00000450736.2	+	2	573	c.158C>G	c.(157-159)tCt>tGt	p.S53C	SLC16A5_ENST00000538213.2_Missense_Mutation_p.S93C|SLC16A5_ENST00000580123.1_Missense_Mutation_p.S53C|SLC16A5_ENST00000329783.4_Missense_Mutation_p.S53C|SLC16A5_ENST00000585293.1_3'UTR			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	53					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.S53C(2)		central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	AGCGAGACCTCTTGGTTCCCC	0.607																																							uc002jmr.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(157-159)TCT>TGT		solute carrier family 16, member 5	Pyruvic acid(DB00119)						145.0	126.0	132.0					17																	73089889		2203	4300	6503	SO:0001583	missense	9121				organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity	g.chr17:73089889C>G	U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.158C>G	17.37:g.73089889C>G	ENSP00000390564:p.Ser53Cys					SLC16A5_uc002jms.1_Missense_Mutation_p.S53C|SLC16A5_uc002jmt.2_Missense_Mutation_p.S53C|SLC16A5_uc002jmu.2_Missense_Mutation_p.S53C|SLC16A5_uc010wrt.1_Missense_Mutation_p.S93C	p.S53C	NM_004695	NP_004686	O15375	MOT6_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		3	530	+	all_lung(278;0.226)		53			Extracellular (Potential).		B4E288	Missense_Mutation	SNP	ENST00000450736.2	37	c.158C>G	CCDS11713.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.518476	0.44763	.	.	ENSG00000170190	ENST00000329783;ENST00000450736;ENST00000538213	T;T;T	0.61627	0.09;0.09;0.09	4.85	4.85	0.62838	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.82070	0.4957	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86859	0.2028	10	0.87932	D	0	.	18.1759	0.89761	0.0:1.0:0.0:0.0	.	93;53	B4E288;O15375	.;MOT6_HUMAN	C	53;53;93	ENSP00000330141:S53C;ENSP00000390564:S53C;ENSP00000440212:S93C	ENSP00000330141:S53C	S	+	2	0	SLC16A5	70601484	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	7.651000	0.83577	2.523000	0.85059	0.591000	0.81541	TCT		0.607	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445547.1	NM_004695		7	137	0	0	0	0.001855	0	7	137				
SLC16A5	9121	broad.mit.edu	37	17	73089908	73089908	+	Silent	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:73089908C>T	ENST00000450736.2	+	2	592	c.177C>T	c.(175-177)ctC>ctT	p.L59L	SLC16A5_ENST00000538213.2_Silent_p.L99L|SLC16A5_ENST00000580123.1_Silent_p.L59L|SLC16A5_ENST00000329783.4_Silent_p.L59L|SLC16A5_ENST00000585293.1_3'UTR			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	59					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.L59L(2)		central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	CCTCCATCCTCACGGCTGTGC	0.597																																							uc002jmr.2		NA																	2	Substitution - coding silent(2)		lung(2)	central_nervous_system(1)	1						c.(175-177)CTC>CTT		solute carrier family 16, member 5	Pyruvic acid(DB00119)						127.0	112.0	117.0					17																	73089908		2203	4300	6503	SO:0001819	synonymous_variant	9121				organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity	g.chr17:73089908C>T	U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.177C>T	17.37:g.73089908C>T						SLC16A5_uc002jms.1_Silent_p.L59L|SLC16A5_uc002jmt.2_Silent_p.L59L|SLC16A5_uc002jmu.2_Silent_p.L59L|SLC16A5_uc010wrt.1_Silent_p.L99L	p.L59L	NM_004695	NP_004686	O15375	MOT6_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		3	549	+	all_lung(278;0.226)		59			Helical; (Potential).		B4E288	Silent	SNP	ENST00000450736.2	37	c.177C>T	CCDS11713.1																																																																																				0.597	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445547.1	NM_004695		7	132	0	0	0	0.008291	0	7	132				
MTCL1	23255	broad.mit.edu	37	18	8806923	8806923	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr18:8806923C>G	ENST00000306329.11	+	9	3426	c.3426C>G	c.(3424-3426)ttC>ttG	p.F1142L	SOGA2_ENST00000518815.1_Missense_Mutation_p.F138L|SOGA2_ENST00000400050.3_Missense_Mutation_p.F782L|SOGA2_ENST00000306285.7_Missense_Mutation_p.F138L|SOGA2_ENST00000359865.3_Missense_Mutation_p.F823L|SOGA2_ENST00000517570.1_Missense_Mutation_p.F782L														p.F823L(1)									TCAGCGCCTTCAAGGCCTTGC	0.597																																							uc002knr.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2467-2469)TTC>TTG		hypothetical protein LOC23255							70.0	61.0	64.0					18																	8806923		2203	4300	6503	SO:0001583	missense	23255							g.chr18:8806923C>G																												ENST00000306329.11:c.3426C>G	18.37:g.8806923C>G	ENSP00000305027:p.Phe1142Leu					KIAA0802_uc002knq.2_Missense_Mutation_p.F782L|KIAA0802_uc002kns.2_Missense_Mutation_p.F153L	p.F823L	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN			11	2611	+			1133						Missense_Mutation	SNP	ENST00000306329.11	37	c.2469C>G		.	.	.	.	.	.	.	.	.	.	C	0.296	-0.976779	0.02215	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.54	-3.64	0.04515	.	0.145473	0.32444	N	0.006085	T	0.04048	0.0113	N	0.00621	-1.32	0.22171	N	0.999313	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.40384	-0.9566	10	0.02654	T	1	-19.4729	11.5093	0.50484	0.0:0.1521:0.5945:0.2534	.	1133;823	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	L	844;782;823;782;138	ENSP00000429556:F782L;ENSP00000352927:F823L;ENSP00000382924:F782L;ENSP00000303670:F138L	ENSP00000303670:F138L	F	+	3	2	CCDC165	8796923	0.998000	0.40836	0.022000	0.16811	0.185000	0.23345	0.411000	0.21115	-0.391000	0.07763	-0.176000	0.13171	TTC		0.597	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1			5	26	0	0	0	0.000602	0	5	26				
GRP	2922	broad.mit.edu	37	18	56897691	56897691	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr18:56897691C>G	ENST00000256857.2	+	3	536	c.438C>G	c.(436-438)aaC>aaG	p.N146K	GRP_ENST00000420468.2_Missense_Mutation_p.N139K|GRP_ENST00000529320.2_3'UTR	NM_001012512.1|NM_002091.3	NP_001012530.1|NP_002082.2	P07492	GRP_HUMAN	gastrin-releasing peptide	146					neuropeptide signaling pathway (GO:0007218)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)	p.N146K(1)		large_intestine(1)|lung(3)	4		Colorectal(73;0.0946)				CCCAGCTGAACCAGCAATGAT	0.438																																							uc002lhv.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(436-438)AAC>AAG		gastrin-releasing peptide isoform 1							78.0	77.0	77.0					18																	56897691		2203	4300	6503	SO:0001583	missense	2922				neuropeptide signaling pathway	extracellular space	neuropeptide hormone activity	g.chr18:56897691C>G		CCDS11971.1, CCDS45877.1, CCDS45878.1	18q21.1-q21.32	2013-02-26			ENSG00000134443	ENSG00000134443		"""Endogenous ligands"""	4605	protein-coding gene	gene with protein product	"""bombesin"", ""neuromedin C"", ""prepro-GRP"""	137260					Standard	NM_002091		Approved		uc002lhv.3	P07492	OTTHUMG00000132760	ENST00000256857.2:c.438C>G	18.37:g.56897691C>G	ENSP00000256857:p.Asn146Lys					GRP_uc002lhu.2_3'UTR|GRP_uc002lhw.2_Missense_Mutation_p.N139K	p.N146K	NM_002091	NP_002082	P07492	GRP_HUMAN			3	536	+		Colorectal(73;0.0946)	146					P07491|P81553|Q14454|Q53YA0|Q9BSY7	Missense_Mutation	SNP	ENST00000256857.2	37	c.438C>G	CCDS11971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.784|2.784	-0.252849|-0.252849	0.05829|0.05829	.|.	.|.	ENSG00000134443|ENSG00000134443	ENST00000256857;ENST00000420468|ENST00000530323	T;T|.	0.33654|.	1.4;1.4|.	5.39|5.39	-7.75|-7.75	0.01236|0.01236	.|.	0.594081|.	0.14164|.	N|.	0.337122|.	T|T	0.26159|0.26159	0.0638|0.0638	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B|.	0.16802|.	0.019;0.011|.	B;B|.	0.19391|.	0.025;0.011|.	T|T	0.27191|0.27191	-1.0081|-1.0081	10|5	0.87932|.	D|.	0|.	0.1961|0.1961	7.7257|7.7257	0.28759|0.28759	0.0:0.2432:0.2154:0.5414|0.0:0.2432:0.2154:0.5414	.|.	139;146|.	P07492-3;P07492|.	.;GRP_HUMAN|.	K|S	146;139|33	ENSP00000256857:N146K;ENSP00000389696:N139K|.	ENSP00000256857:N146K|.	N|T	+|+	3|2	2|0	GRP|GRP	55048671|55048671	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-1.207000|-1.207000	0.03008|0.03008	-2.003000|-2.003000	0.00962|0.00962	-0.345000|-0.345000	0.07892|0.07892	AAC|ACC		0.438	GRP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256131.2	NM_002091		11	102	0	0	0	0.000978	0	11	102				
CDH19	28513	broad.mit.edu	37	18	64172164	64172164	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr18:64172164G>A	ENST00000262150.2	-	12	2496	c.2204C>T	c.(2203-2205)tCc>tTc	p.S735F		NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	3149	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S735F(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TGATTCTAAGGAGCTCAGGGA	0.463																																							uc002lkc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(2203-2205)TCC>TTC		cadherin 19, type 2 preproprotein							92.0	85.0	87.0					18																	64172164		2203	4300	6503	SO:0001583	missense	28513				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:64172164G>A	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.2204C>T	18.37:g.64172164G>A	ENSP00000262150:p.Ser735Phe					CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_3'UTR	p.S735F	NM_021153	NP_066976	Q9H159	CAD19_HUMAN			12	2342	-		Esophageal squamous(42;0.0132)	735			Cytoplasmic (Potential).		O15098	Missense_Mutation	SNP	ENST00000262150.2	37	c.2204C>T	CCDS11994.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566385	0.86439	.	.	ENSG00000071991	ENST00000262150	D	0.83250	-1.7	5.1	5.1	0.69264	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.93605	0.7958	H	0.94771	3.58	0.80722	D	1	D	0.71674	0.998	D	0.68483	0.958	D	0.95237	0.8348	10	0.87932	D	0	.	18.8816	0.92357	0.0:0.0:1.0:0.0	.	735	Q9H159	CAD19_HUMAN	F	735	ENSP00000262150:S735F	ENSP00000262150:S735F	S	-	2	0	CDH19	62323144	1.000000	0.71417	0.974000	0.42286	0.832000	0.47134	7.358000	0.79466	2.521000	0.84997	0.591000	0.81541	TCC		0.463	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256219.1	NM_021153		10	63	0	0	0	0.006214	0	10	63				
LONP1	9361	broad.mit.edu	37	19	5696170	5696170	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr19:5696170G>C	ENST00000360614.3	-	13	2065	c.1908C>G	c.(1906-1908)atC>atG	p.I636M	LONP1_ENST00000540670.2_Missense_Mutation_p.I440M|LONP1_ENST00000590729.1_Missense_Mutation_p.I506M|LONP1_ENST00000585374.1_Missense_Mutation_p.I522M|LONP1_ENST00000593119.1_Missense_Mutation_p.I572M	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial									p.I636M(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGGCCGTGCAGATGAACAGCA	0.662																																							uc002mcx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1906-1908)ATC>ATG		mitochondrial lon peptidase 1 precursor							59.0	57.0	58.0					19																	5696170		2203	4300	6503	SO:0001583	missense	9361				cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding	g.chr19:5696170G>C	U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1908C>G	19.37:g.5696170G>C	ENSP00000353826:p.Ile636Met					LONP1_uc002mcy.2_Missense_Mutation_p.I572M|LONP1_uc010duh.2_Missense_Mutation_p.I377M|LONP1_uc010dui.2_Missense_Mutation_p.I620M|LONP1_uc002mcz.2_Missense_Mutation_p.I440M	p.I636M	NM_004793	NP_004784	P36776	LONM_HUMAN			13	1941	-			636						Missense_Mutation	SNP	ENST00000360614.3	37	c.1908C>G	CCDS12148.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248185	0.80024	.	.	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	D;D	0.95980	-3.87;-3.87	4.67	4.67	0.58626	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.096640	0.64402	D	0.000007	D	0.97841	0.9291	M	0.88979	2.995	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.72338	0.977;0.966;0.977	D	0.98824	1.0748	10	0.87932	D	0	-24.6272	15.0606	0.71951	0.0:0.0:1.0:0.0	.	636;572;636	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	M	636;600;440	ENSP00000353826:I636M;ENSP00000441523:I440M	ENSP00000351177:I600M	I	-	3	3	LONP1	5647170	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	2.854000	0.48325	2.145000	0.66743	0.491000	0.48974	ATC		0.662	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451662.1	NM_004793		5	96	0	0	0	0.001168	0	5	96				
MCOLN1	57192	broad.mit.edu	37	19	7593840	7593840	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr19:7593840T>C	ENST00000264079.6	+	9	1243	c.1118T>C	c.(1117-1119)aTc>aCc	p.I373T		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	373					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)	p.I373T(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						ATCATGAAGATCGGCATCGAG	0.632																																							uc002mgo.2		NA																	1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(1117-1119)ATC>ACC		mucolipin 1							90.0	77.0	82.0					19																	7593840		2203	4300	6503	SO:0001583	missense	57192				calcium ion transport|cellular iron ion homeostasis|transferrin transport	integral to plasma membrane|late endosome membrane|lysosomal membrane	cation channel activity|iron ion transmembrane transporter activity	g.chr19:7593840T>C	AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.1118T>C	19.37:g.7593840T>C	ENSP00000264079:p.Ile373Thr					MCOLN1_uc002mgp.2_Missense_Mutation_p.I338T	p.I373T	NM_020533	NP_065394	Q9GZU1	MCLN1_HUMAN			9	1243	+			373					D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Missense_Mutation	SNP	ENST00000264079.6	37	c.1118T>C	CCDS12180.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.086974	0.76642	.	.	ENSG00000090674	ENST00000264079;ENST00000394321	D	0.85088	-1.94	5.71	5.71	0.89125	.	0.048247	0.85682	D	0.000000	D	0.91375	0.7279	M	0.79258	2.445	0.80722	D	1	D;D	0.61697	0.99;0.985	D;P	0.66979	0.948;0.811	D	0.91328	0.5087	10	0.45353	T	0.12	.	13.9256	0.63961	0.0:0.0:0.0:1.0	.	338;373	Q9GZU1-2;Q9GZU1	.;MCLN1_HUMAN	T	373;338	ENSP00000264079:I373T	ENSP00000264079:I373T	I	+	2	0	MCOLN1	7499840	1.000000	0.71417	0.982000	0.44146	0.771000	0.43674	7.698000	0.84413	2.165000	0.68154	0.533000	0.62120	ATC		0.632	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458974.2	NM_020533		4	41	0	0	0	0.001984	0	4	41				
MUC16	94025	broad.mit.edu	37	19	9074892	9074892	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr19:9074892G>A	ENST00000397910.4	-	3	12757	c.12554C>T	c.(12553-12555)tCt>tTt	p.S4185F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4187	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S4185F(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGTGGAGTAGAGGAGGGACT	0.502																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(12553-12555)TCT>TTT		mucin 16							132.0	125.0	128.0					19																	9074892		1993	4162	6155	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9074892G>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12554C>T	19.37:g.9074892G>A	ENSP00000381008:p.Ser4185Phe						p.S4185F	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	12758	-			4187			Thr-rich.|Extracellular (Potential).|Ser-rich.		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.12554C>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.439	-0.114383	0.06881	.	.	ENSG00000181143	ENST00000397910	T	0.46819	0.86	1.31	0.202	0.15190	.	.	.	.	.	T	0.29588	0.0738	L	0.43152	1.355	.	.	.	P	0.39624	0.681	B	0.26416	0.069	T	0.28650	-1.0037	8	0.87932	D	0	.	4.6513	0.12596	0.0:0.0:0.6301:0.3699	.	4185	B5ME49	.	F	4185	ENSP00000381008:S4185F	ENSP00000381008:S4185F	S	-	2	0	MUC16	8935892	0.000000	0.05858	0.000000	0.03702	0.346000	0.29079	-0.110000	0.10824	0.110000	0.17919	-0.823000	0.03104	TCT		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		9	85	0	0	0	0.006214	0	9	85				
PRDX2	7001	broad.mit.edu	37	19	12911999	12911999	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr19:12911999T>A	ENST00000301522.2	-	2	205	c.77A>T	c.(76-78)aAa>aTa	p.K26I	PRDX2_ENST00000435703.1_Missense_Mutation_p.K26I|PRDX2_ENST00000334482.5_Missense_Mutation_p.K26I|CTD-2659N19.10_ENST00000585496.1_RNA	NM_005809.4	NP_005800.3	P32119	PRDX2_HUMAN	peroxiredoxin 2	26	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular response to oxidative stress (GO:0034599)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of apoptotic process (GO:0042981)|removal of superoxide radicals (GO:0019430)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)|thioredoxin peroxidase activity (GO:0008379)	p.K26I(2)		endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						CTTCACCTCTTTGAAGGCGCC	0.637																																							uc002mvd.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(76-78)AAA>ATA		peroxiredoxin 2 isoform a							34.0	34.0	34.0					19																	12911999		2203	4300	6503	SO:0001583	missense	7001				anti-apoptosis|cell redox homeostasis|hydrogen peroxide catabolic process|removal of superoxide radicals		thioredoxin peroxidase activity	g.chr19:12911999T>A		CCDS12281.1	19p13.2	2008-07-17			ENSG00000167815	ENSG00000167815			9353	protein-coding gene	gene with protein product	"""thioredoxin-dependent peroxide reductase 1"", ""thiol-specific antioxidant 1"", ""natural killer-enhancing factor B"", ""thioredoxin peroxidase 1"", ""torin"""	600538		TDPX1		7607688	Standard	NM_005809		Approved	PRP, NKEFB, TSA, PRXII, PRX2, MGC4104	uc002mvd.4	P32119	OTTHUMG00000134285	ENST00000301522.2:c.77A>T	19.37:g.12911999T>A	ENSP00000301522:p.Lys26Ile					PRDX2_uc002mve.1_Missense_Mutation_p.K26I	p.K26I	NM_005809	NP_005800	P32119	PRDX2_HUMAN			2	227	-			26			Thioredoxin.		A8K0C0|P31945|P32118|P35701|Q6FHG4|Q92763|Q9UC23	Missense_Mutation	SNP	ENST00000301522.2	37	c.77A>T	CCDS12281.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.792316	0.50102	.	.	ENSG00000167815	ENST00000334482;ENST00000301522;ENST00000435703	T;T;T	0.33654	1.4;1.4;1.4	5.18	3.04	0.35103	Alkyl hydroperoxide reductase subunit C/ Thiol specific antioxidant (1);Thioredoxin-like fold (3);	0.184499	0.35179	N	0.003386	T	0.52645	0.1747	M	0.78637	2.42	0.54753	D	0.999982	D;B	0.67145	0.996;0.001	P;B	0.62014	0.897;0.014	T	0.50329	-0.8841	10	0.66056	D	0.02	-42.5093	7.1157	0.25414	0.0:0.0797:0.1479:0.7724	.	26;26	A8K0C0;P32119	.;PRDX2_HUMAN	I	26	ENSP00000334063:K26I;ENSP00000301522:K26I;ENSP00000408905:K26I	ENSP00000301522:K26I	K	-	2	0	PRDX2	12772999	1.000000	0.71417	0.563000	0.28383	0.396000	0.30629	4.675000	0.61619	0.283000	0.22279	0.374000	0.22700	AAA		0.637	PRDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258950.2	NM_005809		5	18	0	0	0	0.001984	0	5	18				
IL27RA	9466	broad.mit.edu	37	19	14143202	14143202	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr19:14143202C>A	ENST00000263379.2	+	2	230	c.105C>A	c.(103-105)agC>agA	p.S35R	CTB-55O6.4_ENST00000590528.1_RNA	NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	35					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)	p.S35R(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						CTCCAGGCAGCGCCGGGCCAC	0.632																																					Colon(164;1849 1896 4443 37792 47834)	Colon(164;1849 1896 4443 37792 47834)	uc002mxx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(103-105)AGC>AGA		class I cytokine receptor precursor							72.0	79.0	77.0					19																	14143202		2203	4300	6503	SO:0001583	missense	9466				cell surface receptor linked signaling pathway|immune response	integral to plasma membrane	transmembrane receptor activity	g.chr19:14143202C>A	AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.105C>A	19.37:g.14143202C>A	ENSP00000263379:p.Ser35Arg						p.S35R	NM_004843	NP_004834	Q6UWB1	I27RA_HUMAN			2	528	+			35			Extracellular (Potential).		A0N0L1|O60624	Missense_Mutation	SNP	ENST00000263379.2	37	c.105C>A	CCDS12303.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515205	0.85389	.	.	ENSG00000104998	ENST00000263379	T	0.61627	0.09	3.82	-1.02	0.10135	.	0.581112	0.14366	N	0.324115	T	0.38108	0.1028	L	0.32530	0.975	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.17501	-1.0367	10	0.40728	T	0.16	-0.2696	4.0276	0.09695	0.0:0.4628:0.1855:0.3517	.	35	Q6UWB1	I27RA_HUMAN	R	35	ENSP00000263379:S35R	ENSP00000263379:S35R	S	+	3	2	IL27RA	14004202	0.001000	0.12720	0.015000	0.15790	0.902000	0.53008	0.093000	0.15086	-0.049000	0.13379	0.491000	0.48974	AGC		0.632	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843		8	103	1	0	0.00621372	0.006214	0.00815749	8	103				
ZNF253	56242	broad.mit.edu	37	19	20002899	20002899	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr19:20002899G>C	ENST00000589717.1	+	4	935	c.843G>C	c.(841-843)gaG>gaC	p.E281D	AC011477.1_ENST00000578823.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.E205D|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	281				Missing (in Ref. 1; AAC26844). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E281D(2)		endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATACTGGAGAGAAACCCTACA	0.413																																							uc002noj.2		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(841-843)GAG>GAC		zinc finger protein 253							53.0	57.0	56.0					19																	20002899		2168	4285	6453	SO:0001583	missense	56242				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:20002899G>C	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.843G>C	19.37:g.20002899G>C	ENSP00000468720:p.Glu281Asp					ZNF253_uc002nok.2_Missense_Mutation_p.E205D|ZNF253_uc002nol.2_RNA	p.E281D	NM_021047	NP_066385	O75346	ZN253_HUMAN			4	935	+			281	Missing (in Ref. 1; AAC26844).				A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	37	c.843G>C	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	g	9.995	1.231946	0.22626	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.876	0.876	0.19138	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44829	0.1312	M	0.62154	1.92	0.23762	N	0.996915	B	0.21606	0.058	B	0.33121	0.158	T	0.44081	-0.9351	7	.	.	.	.	7.1488	0.25597	0.0:0.0:1.0:0.0	.	281	O75346	ZN253_HUMAN	D	281	.	.	E	+	3	2	ZNF253	19863899	0.982000	0.34865	0.292000	0.24919	0.293000	0.27360	0.450000	0.21762	0.293000	0.22520	0.298000	0.19748	GAG		0.413	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047		7	75	0	0	0	0.001984	0	7	75				
KLK2	3817	broad.mit.edu	37	19	51378047	51378047	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr19:51378047G>T	ENST00000325321.3	+	2	342	c.117G>T	c.(115-117)caG>caT	p.Q39H	KLK2_ENST00000358049.4_Missense_Mutation_p.Q39H|KLK2_ENST00000391810.2_Intron|AC037199.1_ENST00000594218.1_5'Flank|KLK2_ENST00000597509.1_3'UTR			P20151	KLK2_HUMAN	kallikrein-related peptidase 2	39	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)	p.Q39H(2)	KLK2/ETV1(3)|KLK2/ETV4(2)	large_intestine(3)|lung(6)|ovary(1)|skin(1)	11		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		AACCCTGGCAGGTGGCTGTGT	0.617			T	ETV4	prostate																																		uc002ptv.2		NA		Dom	yes		19	19q13.41	3817	T	kallikrein-related peptidase 2			E	ETV4		prostate		2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(115-117)CAG>CAT		kallikrein 2, prostatic isoform 1							90.0	72.0	78.0					19																	51378047		2203	4300	6503	SO:0001583	missense	3817				proteolysis		serine-type endopeptidase activity	g.chr19:51378047G>T	M18157	CCDS12808.1, CCDS42597.1, CCDS58675.1	19q13.33	2008-02-05	2006-10-27				3.4.21.35	"""Kallikreins"""	6363	protein-coding gene	gene with protein product		147960	"""kallikrein 2, prostatic"""			2468530, 16800724, 16800723	Standard	NM_005551		Approved		uc002ptv.3	P20151		ENST00000325321.3:c.117G>T	19.37:g.51378047G>T	ENSP00000313581:p.Gln39His					KLK2_uc010eog.2_Intron|KLK2_uc010yck.1_Missense_Mutation_p.Q39H|KLK2_uc002ptu.2_Missense_Mutation_p.Q39H|KLK2_uc002ptt.2_RNA|KLK2_uc010ycl.1_Translation_Start_Site|KLK2_uc010ycm.1_Intron|KLK2_uc010eoh.2_5'Flank	p.Q39H	NM_005551	NP_005542	P20151	KLK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)	2	158	+		all_neural(266;0.026)	39			Peptidase S1.		B4DU93|B4DUB0|F5H8L3|Q15946|Q9UJZ9	Missense_Mutation	SNP	ENST00000325321.3	37	c.117G>T	CCDS12808.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.625583	0.46840	.	.	ENSG00000167751	ENST00000325321;ENST00000358049	D;D	0.90900	-2.75;-2.75	2.64	2.64	0.31445	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.272597	0.19863	N	0.104397	D	0.91686	0.7372	M	0.85041	2.73	0.80722	D	1	P;P	0.51240	0.875;0.943	B;P	0.50314	0.405;0.637	D	0.90241	0.4286	10	0.49607	T	0.09	.	6.0178	0.19613	0.1603:0.0:0.8397:0.0	.	39;39	P20151-2;P20151	.;KLK2_HUMAN	H	39	ENSP00000313581:Q39H;ENSP00000350748:Q39H	ENSP00000313581:Q39H	Q	+	3	2	KLK2	56069859	1.000000	0.71417	0.877000	0.34402	0.039000	0.13416	2.726000	0.47302	1.423000	0.47198	0.455000	0.32223	CAG		0.617	KLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464438.3	NM_005551.3		13	43	1	0	1.49906e-05	0.00245	1.99875e-05	13	43				
TMEM190	147744	broad.mit.edu	37	19	55889060	55889060	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr19:55889060G>C	ENST00000291934.3	+	3	212	c.194G>C	c.(193-195)gGg>gCg	p.G65A	CTD-2105E13.15_ENST00000595064.1_RNA	NM_139172.1	NP_631911.1	Q8WZ59	TM190_HUMAN	transmembrane protein 190	65	P-type.				hematopoietic progenitor cell differentiation (GO:0002244)	inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.G65A(1)		large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	5	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		TACCGCAATGGGGTCTGCTAC	0.692																																							uc002qkt.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(193-195)GGG>GCG		transmembrane protein 190 precursor							63.0	68.0	66.0					19																	55889060		2203	4299	6502	SO:0001583	missense	147744					integral to membrane		g.chr19:55889060G>C	AF442729	CCDS33113.1	19q13.42	2011-09-28				ENSG00000160472			29632	protein-coding gene	gene with protein product						21273369	Standard	NM_139172		Approved	MDAC1	uc002qkt.1	Q8WZ59		ENST00000291934.3:c.194G>C	19.37:g.55889060G>C	ENSP00000291934:p.Gly65Ala						p.G65A	NM_139172	NP_631911	Q8WZ59	TM190_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)	3	212	+	Breast(117;0.191)		65			P-type.|Extracellular (Potential).		A6NJL5	Missense_Mutation	SNP	ENST00000291934.3	37	c.194G>C	CCDS33113.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657044	0.47467	.	.	ENSG00000160472	ENST00000291934	.	.	.	3.84	3.84	0.44239	P-type trefoil (2);	0.000000	0.42294	D	0.000726	T	0.49047	0.1534	L	0.27053	0.805	0.29244	N	0.87244	D	0.76494	0.999	D	0.83275	0.996	T	0.45659	-0.9246	9	0.87932	D	0	.	11.5926	0.50953	0.0:0.0:1.0:0.0	.	65	Q8WZ59	TM190_HUMAN	A	65	.	ENSP00000291934:G65A	G	+	2	0	TMEM190	60580872	0.636000	0.27207	0.893000	0.35052	0.102000	0.19082	2.887000	0.48586	1.869000	0.54173	0.313000	0.20887	GGG		0.692	TMEM190-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453042.1	NM_139172		8	56	0	0	0	0.00308	0	8	56				
DDX1	1653	broad.mit.edu	37	2	15758387	15758387	+	Missense_Mutation	SNP	G	G	C	rs146515867	byFrequency	TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr2:15758387G>C	ENST00000381341.2	+	17	1588	c.1199G>C	c.(1198-1200)aGa>aCa	p.R400T	DDX1_ENST00000233084.3_Missense_Mutation_p.R400T			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	400	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)	p.R400T(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		GATGGAAAAAGACTTCAGGTA	0.368																																							uc002rce.2		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4						c.(1198-1200)AGA>ACA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 1		G	THR/ARG	0,4406		0,0,2203	104.0	118.0	113.0		1199	6.2	1.0	2	dbSNP_134	113	3,8591	3.0+/-9.4	0,3,4294	yes	missense	DDX1	NM_004939.1	71	0,3,6497	CC,CG,GG		0.0349,0.0,0.0231	probably-damaging	400/741	15758387	3,12997	2203	4297	6500	SO:0001583	missense	1653				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity	g.chr2:15758387G>C	X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1199G>C	2.37:g.15758387G>C	ENSP00000370745:p.Arg400Thr					DDX1_uc010yjq.1_Missense_Mutation_p.R308T	p.R400T	NM_004939	NP_004930	Q92499	DDX1_HUMAN	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)	16	1487	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	400			Necessary for interaction with RELA.|Helicase ATP-binding.		B4DME8|B4DPN6	Missense_Mutation	SNP	ENST00000381341.2	37	c.1199G>C	CCDS1686.1	.	.	.	.	.	.	.	.	.	.	G	32	5.118730	0.94385	0.0	3.49E-4	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	T;T	0.04758	3.56;3.56	6.17	6.17	0.99709	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.18383	0.0441	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00013	-1.2421	10	0.72032	D	0.01	-28.9133	20.8794	0.99867	0.0:0.0:1.0:0.0	.	400	Q92499	DDX1_HUMAN	T	400;400;384	ENSP00000370745:R400T;ENSP00000233084:R400T	ENSP00000233084:R400T	R	+	2	0	DDX1	15675838	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.448000	0.97600	2.941000	0.99782	0.655000	0.94253	AGA		0.368	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2	NM_004939		21	245	0	0	0	0.00278	0	21	245				
SLC8A1	6546	broad.mit.edu	37	2	40655752	40655752	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr2:40655752C>G	ENST00000403092.1	-	2	1702	c.1669G>C	c.(1669-1671)Gag>Cag	p.E557Q	SLC8A1_ENST00000405269.1_Missense_Mutation_p.E557Q|SLC8A1_ENST00000406785.2_Missense_Mutation_p.E557Q|SLC8A1_ENST00000408028.2_Missense_Mutation_p.E557Q|SLC8A1_ENST00000405901.3_Missense_Mutation_p.E557Q|SLC8A1_ENST00000542024.1_Missense_Mutation_p.E557Q|SLC8A1_ENST00000542756.1_Missense_Mutation_p.E557Q|SLC8A1_ENST00000332839.4_Missense_Mutation_p.E557Q|SLC8A1_ENST00000406391.2_Missense_Mutation_p.E557Q|SLC8A1_ENST00000402441.1_Missense_Mutation_p.E557Q			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	557	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.E557Q(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	ACTTTCACCTCCATGATGCCA	0.458																																							uc002rrx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1669-1671)GAG>CAG		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						142.0	145.0	144.0					2																	40655752		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40655752C>G		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1669G>C	2.37:g.40655752C>G	ENSP00000384763:p.Glu557Gln					SLC8A1_uc002rry.2_Missense_Mutation_p.E557Q|SLC8A1_uc002rrz.2_Missense_Mutation_p.E557Q|SLC8A1_uc002rsa.2_Missense_Mutation_p.E557Q|SLC8A1_uc002rsd.3_Missense_Mutation_p.E557Q|SLC8A1_uc002rsb.1_Missense_Mutation_p.E557Q|SLC8A1_uc010fan.1_Missense_Mutation_p.E557Q|SLC8A1_uc002rsc.1_Missense_Mutation_p.E557Q	p.E557Q	NM_021097	NP_066920	P32418	NAC1_HUMAN			1	1693	-			557			Calx-beta 2.|Cytoplasmic (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.1669G>C	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729344	0.48833	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5	6.17	6.17	0.99709	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.54127	0.1839	M	0.71581	2.175	0.80722	D	1	B;D;P;P;P	0.54772	0.214;0.968;0.698;0.753;0.47	B;P;B;B;B	0.61477	0.042;0.889;0.161;0.288;0.178	T	0.45934	-0.9227	10	0.48119	T	0.1	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	557;557;557;557;557	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	Q	557	ENSP00000383886:E557Q;ENSP00000440727:E557Q;ENSP00000384763:E557Q;ENSP00000385678:E557Q;ENSP00000385188:E557Q;ENSP00000385535:E557Q;ENSP00000332931:E557Q;ENSP00000384908:E557Q;ENSP00000385811:E557Q;ENSP00000443515:E557Q	ENSP00000332931:E557Q	E	-	1	0	SLC8A1	40509256	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.663000	0.83820	2.941000	0.99782	0.655000	0.94253	GAG		0.458	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		14	166	0	0	0	0.004007	0	14	166				
MTIF2	4528	broad.mit.edu	37	2	55463886	55463886	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr2:55463886G>A	ENST00000263629.4	-	16	2397	c.2082C>T	c.(2080-2082)ctC>ctT	p.L694L	MTIF2_ENST00000403721.1_Silent_p.L694L|MTIF2_ENST00000394600.3_Silent_p.L694L	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	694					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.L694L(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CATCTAAACTGAGACCACAAT	0.333																																							uc002ryn.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(2080-2082)CTC>CTT		mitochondrial translational initiation factor 2							98.0	93.0	94.0					2																	55463886		2203	4299	6502	SO:0001819	synonymous_variant	4528				regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity	g.chr2:55463886G>A	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.2082C>T	2.37:g.55463886G>A						MTIF2_uc010yox.1_Silent_p.L363L|MTIF2_uc002ryo.2_Silent_p.L694L	p.L694L	NM_001005369	NP_001005369	P46199	IF2M_HUMAN			17	2819	-			694					D6W5D0	Silent	SNP	ENST00000263629.4	37	c.2082C>T	CCDS1853.1																																																																																				0.333	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453		5	52	0	0	0	0.000602	0	5	52				
SMYD1	150572	broad.mit.edu	37	2	88402637	88402637	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr2:88402637G>A	ENST00000419482.2	+	7	1034	c.949G>A	c.(949-951)Gac>Aac	p.D317N	SMYD1_ENST00000444564.2_Missense_Mutation_p.D304N|SMYD1_ENST00000438570.1_Intron	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	317					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.D317N(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						GGAAAAGATAGACAAGGCTCG	0.458																																							uc002ssr.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|skin(1)	4						c.(949-951)GAC>AAC		SET and MYND domain containing 1							106.0	101.0	103.0					2																	88402637		2203	4300	6503	SO:0001583	missense	150572				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr2:88402637G>A	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.949G>A	2.37:g.88402637G>A	ENSP00000393453:p.Asp317Asn					SMYD1_uc002ssq.1_Intron|SMYD1_uc002sss.2_Missense_Mutation_p.D13N	p.D317N	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN			7	951	+			317					A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	37	c.949G>A	CCDS33240.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533901	0.45073	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000295833	T;T	0.22945	1.94;1.93	5.32	4.43	0.53597	.	0.274240	0.41938	D	0.000786	T	0.15392	0.0371	N	0.19112	0.55	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.06445	-1.0826	10	0.32370	T	0.25	-26.1491	8.7166	0.34414	0.0875:0.1557:0.7568:0.0	.	317	Q8NB12	SMYD1_HUMAN	N	317;304;138	ENSP00000393453:D317N;ENSP00000407888:D304N	ENSP00000295833:D138N	D	+	1	0	SMYD1	88183752	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	4.303000	0.59098	1.233000	0.43693	0.644000	0.83932	GAC		0.458	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915		6	63	0	0	0	0.001984	0	6	63				
RGPD4	285190	broad.mit.edu	37	2	108487524	108487524	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr2:108487524G>C	ENST00000408999.3	+	20	3141	c.3064G>C	c.(3064-3066)Gag>Cag	p.E1022Q	RGPD4_ENST00000354986.4_Missense_Mutation_p.E1022Q	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1022					protein targeting to Golgi (GO:0000042)			p.E1022Q(1)		breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						CGGTGACTTTGAGAAAGATGA	0.388																																							uc010ywk.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(3064-3066)GAG>CAG		RANBP2-like and GRIP domain containing 4							1.0	2.0	2.0					2																	108487524		278	802	1080	SO:0001583	missense	285190				intracellular transport		binding	g.chr2:108487524G>C	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3064G>C	2.37:g.108487524G>C	ENSP00000386810:p.Glu1022Gln					RGPD4_uc002tdu.2_Missense_Mutation_p.E209Q|RGPD4_uc010ywl.1_RNA	p.E1022Q	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN			20	3146	+			1022					B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	c.3064G>C	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	13.10	2.136811	0.37728	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.48201	0.82;0.82	2.33	2.33	0.28932	.	.	.	.	.	T	0.64768	0.2628	M	0.81341	2.54	0.33678	D	0.611723	D	0.57257	0.979	P	0.62184	0.899	T	0.75133	-0.3425	9	0.51188	T	0.08	-29.7867	11.5771	0.50869	0.0:0.0:1.0:0.0	.	1022	Q7Z3J3	RGPD4_HUMAN	Q	1022;1022;780	ENSP00000347081:E1022Q;ENSP00000386810:E1022Q	ENSP00000347081:E1022Q	E	+	1	0	RGPD4	107853956	1.000000	0.71417	0.927000	0.36925	0.403000	0.30841	6.896000	0.75665	1.303000	0.44873	0.162000	0.16502	GAG		0.388	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581		46	390	0	0	0	0.00361	0	46	390				
PLCL1	5334	broad.mit.edu	37	2	198948761	198948761	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr2:198948761A>C	ENST00000428675.1	+	2	918	c.520A>C	c.(520-522)Aca>Cca	p.T174P	PLCL1_ENST00000437704.2_Missense_Mutation_p.T76P	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	174	Interaction with PPP1C.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.T76P(1)|p.T174P(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	AAACACGGAAACATTTAGAAA	0.458																																							uc010fsp.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)|skin(1)	2						c.(520-522)ACA>CCA		RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	Quinacrine(DB01103)						119.0	125.0	123.0					2																	198948761		2203	4300	6503	SO:0001583	missense	5334				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr2:198948761A>C	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.520A>C	2.37:g.198948761A>C	ENSP00000402861:p.Thr174Pro					PLCL1_uc002uuv.3_Missense_Mutation_p.T95P	p.T174P	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN			2	811	+			174			PH.|Interaction with PPP1C.		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	c.520A>C	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	A	19.98	3.927628	0.73327	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.17213	2.29;2.29	5.67	5.67	0.87782	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000001	T	0.33235	0.0856	L	0.60455	1.87	0.80722	D	1	D;D	0.65815	0.995;0.995	P;P	0.56788	0.806;0.806	T	0.01413	-1.1361	9	.	.	.	.	16.215	0.82206	1.0:0.0:0.0:0.0	.	174;100	Q15111;B4DYZ4	PLCL1_HUMAN;.	P	174;76	ENSP00000402861:T174P;ENSP00000414138:T76P	.	T	+	1	0	PLCL1	198657006	1.000000	0.71417	0.912000	0.35992	0.700000	0.40528	9.275000	0.95738	2.288000	0.76882	0.533000	0.62120	ACA		0.458	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226		4	153	0	0	0	0.000248	0	4	153				
CYP27A1	1593	broad.mit.edu	37	2	219677453	219677453	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr2:219677453G>T	ENST00000258415.4	+	4	1252	c.825G>T	c.(823-825)tgG>tgT	p.W275C		NM_000784.3	NP_000775.1	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A, polypeptide 1	275					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cholestanetriol 26-monooxygenase activity (GO:0047749)|cholesterol 26-hydroxylase activity (GO:0031073)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)|vitamin D3 25-hydroxylase activity (GO:0030343)	p.W275C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(3)|urinary_tract(1)	26		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Chenodeoxycholic acid(DB06777)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Pegvisomant(DB00082)	TGGATGGTTGGAATGCCATCT	0.567																																							uc002viz.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(823-825)TGG>TGT		cytochrome P450, family 27, subfamily A,	Cholecalciferol(DB00169)						184.0	182.0	183.0					2																	219677453		2203	4300	6503	SO:0001583	missense	1593				bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding	g.chr2:219677453G>T	BC017044	CCDS2423.1	2q35	2013-09-19	2003-01-14		ENSG00000135929	ENSG00000135929		"""Cytochrome P450s"""	2605	protein-coding gene	gene with protein product	"""cerebrotendinous xanthomatosis"""	606530	"""cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1"""	CYP27		2019602	Standard	NM_000784		Approved	CTX, CP27	uc002viz.4	Q02318	OTTHUMG00000048238	ENST00000258415.4:c.825G>T	2.37:g.219677453G>T	ENSP00000258415:p.Trp275Cys						p.W275C	NM_000784	NP_000775	Q02318	CP27A_HUMAN		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	4	1259	+		Renal(207;0.0474)	275					A8K303|Q6LDB4|Q86YQ6	Missense_Mutation	SNP	ENST00000258415.4	37	c.825G>T	CCDS2423.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.440350	0.83993	.	.	ENSG00000135929	ENST00000258415;ENST00000411688	T;T	0.68025	-0.3;-0.3	6.15	6.15	0.99193	.	0.000000	0.85682	D	0.000000	D	0.84866	0.5567	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85673	0.1296	10	0.87932	D	0	-17.4729	19.8268	0.96621	0.0:0.0:1.0:0.0	.	275	Q02318	CP27A_HUMAN	C	275;181	ENSP00000258415:W275C;ENSP00000392671:W181C	ENSP00000258415:W275C	W	+	3	0	CYP27A1	219385697	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	9.807000	0.99171	2.932000	0.99384	0.643000	0.83706	TGG		0.567	CYP27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109734.4			30	199	1	0	3.80469e-20	0.001786	5.29349e-20	30	199				
BPIFB2	80341	broad.mit.edu	37	20	31609588	31609588	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr20:31609588G>C	ENST00000170150.3	+	15	1513	c.1318G>C	c.(1318-1320)Gag>Cag	p.E440Q		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	440						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)	p.E440Q(1)									TGTCGCCCCTGAGATCTTTGT	0.587																																							uc002wyj.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(1318-1320)GAG>CAG		bactericidal/permeability-increasing							152.0	138.0	143.0					20																	31609588		2203	4300	6503	SO:0001583	missense	80341					extracellular region	lipid binding	g.chr20:31609588G>C	AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.1318G>C	20.37:g.31609588G>C	ENSP00000170150:p.Glu440Gln						p.E440Q	NM_025227	NP_079503	Q8N4F0	BPIL1_HUMAN			15	1512	+			440					Q6UWN3|Q6ZME0|Q8NFQ7	Missense_Mutation	SNP	ENST00000170150.3	37	c.1318G>C	CCDS13210.1	.	.	.	.	.	.	.	.	.	.	G	0.028	-1.356027	0.01245	.	.	ENSG00000078898	ENST00000170150	T	0.08720	3.06	4.49	2.42	0.29668	.	0.431335	0.19555	N	0.111478	T	0.05502	0.0145	N	0.20986	0.625	0.29496	N	0.855242	B	0.29085	0.232	B	0.33890	0.172	T	0.37820	-0.9689	10	0.13853	T	0.58	-14.0439	6.794	0.23715	0.101:0.178:0.721:0.0	.	440	Q8N4F0	BPIB2_HUMAN	Q	440	ENSP00000170150:E440Q	ENSP00000170150:E440Q	E	+	1	0	BPIFB2	31073249	0.656000	0.27385	0.315000	0.25238	0.159000	0.22180	0.863000	0.27913	0.544000	0.28883	0.557000	0.71058	GAG		0.587	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078652.2	NM_025227		9	82	0	0	0	0.008291	0	9	82				
ITCH	83737	broad.mit.edu	37	20	33068500	33068500	+	Missense_Mutation	SNP	A	A	G	rs139633287		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr20:33068500A>G	ENST00000262650.6	+	20	2174	c.2038A>G	c.(2038-2040)Att>Gtt	p.I680V	ITCH_ENST00000483727.1_3'UTR|ITCH_ENST00000535650.1_Missense_Mutation_p.I529V|ITCH_ENST00000374864.4_Missense_Mutation_p.I639V			Q96J02	ITCH_HUMAN	itchy E3 ubiquitin protein ligase	680	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of defense response to virus (GO:0050687)|negative regulation of JNK cascade (GO:0046329)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cell growth (GO:0001558)|regulation of protein deubiquitination (GO:0090085)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	CXCR chemokine receptor binding (GO:0045236)|ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)	p.I639V(1)		NS(1)|breast(9)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(13)|skin(1)|upper_aerodigestive_tract(1)	36						TTTAGAATCTATTGATCCAGA	0.323																																							uc010geu.1		NA																	1	Substitution - Missense(1)		lung(1)	breast(4)|lung(1)|central_nervous_system(1)	6						c.(2038-2040)ATT>GTT		itchy homolog E3 ubiquitin protein ligase		A	VAL/ILE	1,4403	2.1+/-5.4	0,1,2201	83.0	86.0	85.0		1915	4.7	1.0	20	dbSNP_134	85	0,8598		0,0,4299	no	missense	ITCH	NM_031483.4	29	0,1,6500	GG,GA,AA		0.0,0.0227,0.0077	benign	639/863	33068500	1,13001	2202	4299	6501	SO:0001583	missense	83737				apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity	g.chr20:33068500A>G	AF095745	CCDS13234.1, CCDS58768.1, CCDS58769.1	20q11.22	2014-09-17	2012-02-23		ENSG00000078747	ENSG00000078747			13890	protein-coding gene	gene with protein product		606409	"""itchy (mouse homolog) E3 ubiquitin protein ligase"", ""itchy E3 ubiquitin protein ligase homolog (mouse)"""			11318614	Standard	NM_001257137		Approved	AIP4	uc010geu.2	Q96J02	OTTHUMG00000032300	ENST00000262650.6:c.2038A>G	20.37:g.33068500A>G	ENSP00000262650:p.Ile680Val					ITCH_uc002xak.2_Missense_Mutation_p.I639V|ITCH_uc010zuj.1_Missense_Mutation_p.I529V	p.I680V	NM_031483	NP_113671	Q96J02	ITCH_HUMAN			20	2230	+			680			HECT.		A6NEW4|B4E234|E1P5P3|F5H217|O43584|Q5QP37|Q5TEL0|Q96F66|Q9BY75|Q9H451|Q9H4U5	Missense_Mutation	SNP	ENST00000262650.6	37	c.2038A>G	CCDS58768.1	.	.	.	.	.	.	.	.	.	.	A	8.176	0.792732	0.16327	2.27E-4	0.0	ENSG00000078747	ENST00000374864;ENST00000535650;ENST00000262650	T;T;T	0.58210	0.35;0.35;0.35	5.82	4.73	0.59995	HECT (4);	0.100403	0.64402	D	0.000002	T	0.21387	0.0515	N	0.01679	-0.765	0.53005	D	0.999967	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.04840	-1.0923	10	0.18710	T	0.47	.	6.8203	0.23852	0.726:0.0:0.274:0.0	.	591;680;639	B4DN85;Q96J02;Q5QP37	.;ITCH_HUMAN;.	V	639;529;680	ENSP00000363998:I639V;ENSP00000445608:I529V;ENSP00000262650:I680V	ENSP00000262650:I680V	I	+	1	0	ITCH	32532161	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.458000	0.60095	1.030000	0.39839	0.528000	0.53228	ATT		0.323	ITCH-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078783.2			16	116	0	0	0	0.00499	0	16	116				
GSS	2937	broad.mit.edu	37	20	33519152	33519152	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr20:33519152C>G	ENST00000216951.2	-	11	1196	c.1098G>C	c.(1096-1098)caG>caC	p.Q366H	GSS_ENST00000451957.2_Missense_Mutation_p.Q255H|GSS_ENST00000541098.1_Missense_Mutation_p.Q238H	NM_000178.2	NP_000169.1	P48637	GSHB_HUMAN	glutathione synthetase	366					aging (GO:0007568)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|nervous system development (GO:0007399)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to nutrient levels (GO:0031667)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|glutathione binding (GO:0043295)|glutathione synthase activity (GO:0004363)|glycine binding (GO:0016594)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.Q366H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(18;0.035)		Acetylcysteine(DB06151)|Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	CACCCTCTCTCTGGGGCTTTA	0.587																																							uc002xbg.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(1096-1098)CAG>CAC		glutathione synthetase	Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)						70.0	57.0	62.0					20																	33519152		2203	4300	6503	SO:0001583	missense	2937				nervous system development|response to oxidative stress|xenobiotic metabolic process	cytosol	ATP binding|glutathione binding|glutathione synthase activity|magnesium ion binding|protein homodimerization activity	g.chr20:33519152C>G		CCDS13245.1	20q11.2	1996-06-18			ENSG00000100983	ENSG00000100983	6.3.2.3		4624	protein-coding gene	gene with protein product		601002				8825653	Standard	NM_000178		Approved		uc002xbg.3	P48637	OTTHUMG00000032315	ENST00000216951.2:c.1098G>C	20.37:g.33519152C>G	ENSP00000216951:p.Gln366His					GSS_uc010zun.1_Missense_Mutation_p.Q238H|GSS_uc010zuo.1_Missense_Mutation_p.Q255H|GSS_uc010zup.1_Missense_Mutation_p.Q297H|GSS_uc002xbh.2_RNA|GSS_uc010gez.1_Missense_Mutation_p.Q96H	p.Q366H	NM_000178	NP_000169	P48637	GSHB_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.035)		11	1178	-			366			ATP.		B2R697|B6F210|E1P5P9|Q4TTD9	Missense_Mutation	SNP	ENST00000216951.2	37	c.1098G>C	CCDS13245.1	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609317	0.66558	.	.	ENSG00000100983	ENST00000216951;ENST00000541098;ENST00000451957	D;D;D	0.95001	-3.58;-3.58;-3.58	5.29	-0.259	0.12971	.	0.054435	0.85682	D	0.000000	D	0.97331	0.9127	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.987;1.0	D	0.96616	0.9456	10	0.87932	D	0	-12.1778	11.0888	0.48104	0.0:0.5821:0.0:0.4179	.	255;366	B6F210;P48637	.;GSHB_HUMAN	H	366;238;255	ENSP00000216951:Q366H;ENSP00000439744:Q238H;ENSP00000407517:Q255H	ENSP00000216951:Q366H	Q	-	3	2	GSS	32982813	0.998000	0.40836	0.998000	0.56505	0.992000	0.81027	0.571000	0.23669	0.103000	0.17682	0.655000	0.94253	CAG		0.587	GSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078821.2			5	51	0	0	0	0.000602	0	5	51				
DDX27	55661	broad.mit.edu	37	20	47841720	47841720	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr20:47841720C>T	ENST00000371764.4	+	6	686	c.677C>T	c.(676-678)tCc>tTc	p.S226F	DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	226						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.S226F(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ATGAACCTTTCCCGCCCTCTT	0.428																																							uc002xuh.2		NA																	1	Substitution - Missense(1)		lung(1)	kidney(2)	2						c.(676-678)TCC>TTC		DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							118.0	118.0	118.0					20																	47841720		2203	4300	6503	SO:0001583	missense	55661					nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr20:47841720C>T	AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.677C>T	20.37:g.47841720C>T	ENSP00000360828:p.Ser226Phe						p.S226F	NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		6	738	+			226			Q motif.		A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	ENST00000371764.4	37	c.677C>T	CCDS13416.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731761	0.89390	.	.	ENSG00000124228	ENST00000371764	T	0.48201	0.82	5.93	5.93	0.95920	RNA helicase, DEAD-box type, Q motif (1);	0.047681	0.85682	D	0.000000	T	0.75428	0.3848	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.79813	-0.1645	10	0.87932	D	0	-21.5673	17.8347	0.88692	0.0:1.0:0.0:0.0	.	226	Q96GQ7	DDX27_HUMAN	F	226	ENSP00000360828:S226F	ENSP00000360828:S226F	S	+	2	0	DDX27	47275127	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.412000	0.80091	2.814000	0.96858	0.655000	0.94253	TCC		0.428	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080485.1			18	119	0	0	0	0.001523	0	18	119				
ADNP	23394	broad.mit.edu	37	20	49510947	49510947	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr20:49510947C>G	ENST00000396029.3	-	5	871	c.304G>C	c.(304-306)Gaa>Caa	p.E102Q	ADNP_ENST00000396032.3_Missense_Mutation_p.E102Q|ADNP_ENST00000371602.4_Missense_Mutation_p.E102Q|ADNP_ENST00000349014.3_Missense_Mutation_p.E102Q	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	102					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E102Q(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						ATCCTATTTTCAAAGTCTTCA	0.413																																							uc002xvt.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(304-306)GAA>CAA		activity-dependent neuroprotector							88.0	90.0	89.0					20																	49510947		2203	4300	6503	SO:0001583	missense	23394					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:49510947C>G	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.304G>C	20.37:g.49510947C>G	ENSP00000379346:p.Glu102Gln					ADNP_uc002xvu.1_Missense_Mutation_p.E102Q	p.E102Q	NM_015339	NP_056154	Q9H2P0	ADNP_HUMAN			5	649	-			102					E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	37	c.304G>C	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783490	0.70222	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032;ENST00000534467	T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.84252	0.5431	L	0.54323	1.7	0.58432	D	0.999999	D	0.71674	0.998	D	0.75484	0.986	D	0.84299	0.0504	10	0.56958	D	0.05	-23.7965	19.5864	0.95492	0.0:1.0:0.0:0.0	.	102	Q9H2P0	ADNP_HUMAN	Q	102	ENSP00000360662:E102Q;ENSP00000342905:E102Q;ENSP00000379346:E102Q;ENSP00000379349:E102Q;ENSP00000436181:E102Q	ENSP00000342905:E102Q	E	-	1	0	ADNP	48944354	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.705000	0.92388	0.655000	0.94253	GAA		0.413	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442		11	79	0	0	0	0.001368	0	11	79				
RTEL1	51750	broad.mit.edu	37	20	62324308	62324308	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr20:62324308C>T	ENST00000360203.5	+	29	3128	c.2803C>T	c.(2803-2805)Ctc>Ttc	p.L935F	RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.L935F|RTEL1_ENST00000318100.4_Missense_Mutation_p.L935F|RTEL1_ENST00000370003.1_Missense_Mutation_p.L180F|RTEL1_ENST00000508582.2_Missense_Mutation_p.L959F|RTEL1_ENST00000370018.3_Missense_Mutation_p.L935F					regulator of telomere elongation helicase 1									p.L935F(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GGCCGCCTGTCTCGGCCCCCT	0.652																																							uc002yfu.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2803-2805)CTC>TTC		regulator of telomere elongation helicase 1							104.0	117.0	112.0					20																	62324308		2198	4293	6491	SO:0001583	missense	51750				DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding	g.chr20:62324308C>T	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.2803C>T	20.37:g.62324308C>T	ENSP00000353332:p.Leu935Phe					RTEL1_uc011abc.1_RNA|RTEL1_uc002yft.1_Missense_Mutation_p.L935F|RTEL1_uc011abd.1_Missense_Mutation_p.L959F|RTEL1_uc011abe.1_Missense_Mutation_p.L712F|RTEL1_uc002yfw.2_RNA|RTEL1_uc002yfx.1_Missense_Mutation_p.L180F|TNFRSF6B_uc002yfy.2_5'Flank	p.L935F	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)		29	3146	+	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		935						Missense_Mutation	SNP	ENST00000360203.5	37	c.2803C>T		.	.	.	.	.	.	.	.	.	.	C	11.88	1.769595	0.31320	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000370003	T;T;T;T;T	0.10860	2.83;2.83;2.83;2.83;2.83	4.83	3.81	0.43845	.	0.470953	0.22550	N	0.058613	T	0.28134	0.0694	M	0.64997	1.995	0.09310	N	0.999999	D;D;D;D	0.89917	0.965;1.0;0.984;0.983	D;D;D;D	0.91635	0.918;0.999;0.924;0.918	T	0.01202	-1.1420	10	0.72032	D	0.01	-33.6126	11.9665	0.53038	0.2559:0.7441:0.0:0.0	.	959;180;935;935	Q9NZ71-7;Q9NZ71-5;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	F	935;935;959;935;180	ENSP00000359035:L935F;ENSP00000322287:L935F;ENSP00000424307:L959F;ENSP00000353332:L935F;ENSP00000359020:L180F	ENSP00000353332:L935F	L	+	1	0	AL353715.1	61794752	0.000000	0.05858	0.052000	0.19188	0.096000	0.18686	-0.043000	0.12043	2.388000	0.81334	0.442000	0.29010	CTC		0.652	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957		13	140	0	0	0	0.003163	0	13	140				
PKNOX1	5316	broad.mit.edu	37	21	44445025	44445025	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr21:44445025G>A	ENST00000291547.5	+	9	1105	c.894G>A	c.(892-894)caG>caA	p.Q298Q	PKNOX1_ENST00000432907.2_Silent_p.Q181Q|PKNOX1_ENST00000607150.1_3'UTR	NM_004571.3	NP_004562.2	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	298					angiogenesis (GO:0001525)|camera-type eye development (GO:0043010)|erythrocyte differentiation (GO:0030218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q298Q(1)		cervix(3)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|prostate(1)	22						TTGCTGCTCAGACAAATTTGA	0.438																																							uc002zcq.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)	2						c.(892-894)CAG>CAA		PBX/knotted 1 homeobox 1							165.0	141.0	149.0					21																	44445025		2203	4300	6503	SO:0001819	synonymous_variant	5316						sequence-specific DNA binding	g.chr21:44445025G>A		CCDS13692.1, CCDS68211.1	21q22.3	2011-06-20			ENSG00000160199	ENSG00000160199		"""Homeoboxes / TALE class"""	9022	protein-coding gene	gene with protein product		602100				9479508	Standard	NM_001286258		Approved	PREP1	uc002zcq.1	P55347	OTTHUMG00000086833	ENST00000291547.5:c.894G>A	21.37:g.44445025G>A						PKNOX1_uc002zcp.1_Silent_p.Q298Q|PKNOX1_uc011aex.1_Silent_p.Q181Q	p.Q298Q	NM_004571	NP_004562	P55347	PKNX1_HUMAN			9	1082	+			298			Homeobox; TALE-type.		O00528|Q8IWT7	Silent	SNP	ENST00000291547.5	37	c.894G>A	CCDS13692.1																																																																																				0.438	PKNOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195520.3			9	45	0	0	0	0.008291	0	9	45				
CCT8L2	150160	broad.mit.edu	37	22	17072712	17072712	+	Silent	SNP	G	G	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr22:17072712G>T	ENST00000359963.3	-	1	988	c.729C>A	c.(727-729)ctC>ctA	p.L243L		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	243					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GGCAAGCAAAGAGAGCCACCC	0.542																																							uc002zlp.1		NA																	0				ovary(1)	1						c.(727-729)CTC>CTA		T-complex protein 1							88.0	82.0	84.0					22																	17072712		2203	4300	6503	SO:0001819	synonymous_variant	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17072712G>T	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.729C>A	22.37:g.17072712G>T							p.L243L	NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN			1	989	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	243					A4QPH3|Q9UJS3	Silent	SNP	ENST00000359963.3	37	c.729C>A	CCDS13738.1																																																																																				0.542	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			14	86	1	0	9.31168e-06	0.001855	1.25463e-05	14	86				
LGALS2	3957	broad.mit.edu	37	22	37966318	37966318	+	Silent	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr22:37966318C>T	ENST00000215886.4	-	4	525	c.351G>A	c.(349-351)ctG>ctA	p.L117L		NM_006498.2	NP_006489.1	P05162	LEG2_HUMAN	lectin, galactoside-binding, soluble, 2	117	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)|galactoside binding (GO:0016936)	p.L117L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)	11	Melanoma(58;0.0574)					CCCTTACGCTCAGGTAGCTCA	0.502																																					GBM(193;1840 2185 13711 20676 24505)	GBM(193;1840 2185 13711 20676 24505)	uc003ata.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|skin(1)	2						c.(349-351)CTG>CTA		lectin, galactoside-binding, soluble, 2							91.0	94.0	93.0					22																	37966318		2203	4300	6503	SO:0001819	synonymous_variant	3957							g.chr22:37966318C>T		CCDS13950.1	22q13.1	2011-08-04	2007-02-01		ENSG00000100079	ENSG00000100079		"""Lectins, galactoside-binding"""	6562	protein-coding gene	gene with protein product	"""galectin 2"""	150571				1988031, 15356130	Standard	NM_006498		Approved	HL14	uc003ata.3	P05162	OTTHUMG00000150590	ENST00000215886.4:c.351G>A	22.37:g.37966318C>T							p.L117L	NM_006498	NP_006489	P05162	LEG2_HUMAN			4	463	-	Melanoma(58;0.0574)		117			Galectin.		Q6FGY4	Silent	SNP	ENST00000215886.4	37	c.351G>A	CCDS13950.1																																																																																				0.502	LGALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318991.1	NM_006498		16	118	0	0	0	0.006122	0	16	118				
ACAA1	30	broad.mit.edu	37	3	38180462	38180462	+	5'Flank	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr3:38180462G>C	ENST00000333167.8	-	0	0				ACAA1_ENST00000450296.1_5'Flank|ACAA1_ENST00000301810.7_5'Flank|ACAA1_ENST00000444607.2_5'Flank|MYD88_ENST00000396334.3_Missense_Mutation_p.E104Q|MYD88_ENST00000424893.1_Missense_Mutation_p.E104Q|MYD88_ENST00000495303.1_Missense_Mutation_p.E104Q|ACAA1_ENST00000544624.1_5'Flank|MYD88_ENST00000417037.2_Missense_Mutation_p.E104Q|MYD88_ENST00000443433.2_Missense_Mutation_p.E104Q	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)	p.E104Q(1)		endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		CCGACTGCTCGAGCTGCTTAC	0.667																																							uc003chx.2		NA								Mis 							ABC-DLBCL		1	Substitution - Missense(1)		lung(1)	haematopoietic_and_lymphoid_tissue(93)|breast(1)	94						c.(310-312)GAG>CAG		myeloid differentiation primary response gene							35.0	41.0	39.0					3																	38180462		2203	4298	6501	SO:0001631	upstream_gene_variant	4615				3'-UTR-mediated mRNA stabilization|anti-apoptosis|cellular response to mechanical stimulus|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-17 production|positive regulation of interleukin-23 production|positive regulation of interleukin-6 production|regulation of inflammatory response|response to interleukin-1|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|intrinsic to membrane|plasma membrane	death receptor binding|TIR domain binding|transmembrane receptor activity	g.chr3:38180462G>C	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087		3.37:g.38180462G>C	Exception_encountered					ACAA1_uc003cht.2_5'Flank|ACAA1_uc003chu.2_5'Flank|ACAA1_uc010hgy.2_5'Flank|ACAA1_uc010hgz.2_5'Flank|ACAA1_uc003chv.2_5'Flank|MYD88_uc011ayh.1_Missense_Mutation_p.E104Q|MYD88_uc011ayi.1_Missense_Mutation_p.E104Q|MYD88_uc011ayj.1_Missense_Mutation_p.E104Q|MYD88_uc011ayk.1_Missense_Mutation_p.E104Q|MYD88_uc011ayl.1_Missense_Mutation_p.E104Q	p.E104Q	NM_002468	NP_002459	Q99836	MYD88_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)	1	494	+			91			Death.		G5E935|Q96CA6	Missense_Mutation	SNP	ENST00000333167.8	37	c.310G>C	CCDS2673.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.975325	0.53720	.	.	ENSG00000172936	ENST00000417037;ENST00000396334;ENST00000424893;ENST00000495303;ENST00000443433;ENST00000421571;ENST00000421516;ENST00000415158	T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.15	4.15	3.25	0.37280	Death (3);DEATH-like (2);	0.135807	0.49305	D	0.000144	T	0.72455	0.3462	M	0.77820	2.39	0.39835	D	0.973027	D;D;D;P;D;P	0.89917	0.963;1.0;1.0;0.805;1.0;0.511	P;D;D;P;D;B	0.79108	0.758;0.992;0.991;0.505;0.991;0.128	T	0.72214	-0.4358	10	0.24483	T	0.36	-6.8951	12.4969	0.55933	0.0:0.0:0.8318:0.1682	.	91;104;104;91;91;80	Q99836-2;B4DQ60;B4DQ72;Q99836;B4DU08;B4E3D6	.;.;.;MYD88_HUMAN;.;.	Q	104;104;104;104;104;91;103;80	ENSP00000401399:E104Q;ENSP00000379625:E104Q;ENSP00000389979:E104Q;ENSP00000417848:E104Q;ENSP00000390565:E104Q;ENSP00000391753:E103Q	ENSP00000379625:E104Q	E	+	1	0	MYD88	38155466	0.729000	0.28090	0.769000	0.31535	0.222000	0.24845	3.490000	0.53245	1.053000	0.40415	0.561000	0.74099	GAG		0.667	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607		4	47	0	0	0	0.000248	0	4	47				
NKTR	4820	broad.mit.edu	37	3	42679413	42679413	+	Silent	SNP	T	T	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr3:42679413T>C	ENST00000232978.8	+	13	2405	c.2217T>C	c.(2215-2217)agT>agC	p.S739S	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	739	Arg/Ser-rich.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.S739S(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		CACAGTGTAGTAGATCATCTT	0.378																																							uc003clo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|skin(1)	3						c.(2215-2217)AGT>AGC		natural killer-tumor recognition sequence							97.0	91.0	93.0					3																	42679413		2203	4300	6503	SO:0001819	synonymous_variant	4820				protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity	g.chr3:42679413T>C		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.2217T>C	3.37:g.42679413T>C						NKTR_uc003clm.1_Silent_p.S486S|NKTR_uc003clp.2_Silent_p.S486S|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Silent_p.S629S|NKTR_uc003clr.1_Silent_p.S486S|NKTR_uc003cls.2_Silent_p.S439S	p.S739S	NM_005385	NP_005376	P30414	NKTR_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.24)	13	2364	+			739			Arg/Ser-rich.			Silent	SNP	ENST00000232978.8	37	c.2217T>C	CCDS2702.1																																																																																				0.378	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385		3	59	0	0	0	0.004672	0	3	59				
FAM208A	23272	broad.mit.edu	37	3	56667420	56667420	+	Silent	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr3:56667420G>C	ENST00000493960.2	-	18	3409	c.3399C>G	c.(3397-3399)ctC>ctG	p.L1133L	FAM208A_ENST00000431842.2_Silent_p.L696L|FAM208A_ENST00000355628.5_Silent_p.L1072L	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1133							poly(A) RNA binding (GO:0044822)	p.L696L(2)|p.L1072L(2)		NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						GTGGCTCAAGGAGATGTTTAT	0.438																																							uc003did.3		NA																	4	Substitution - coding silent(4)		large_intestine(2)|lung(2)	ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(3214-3216)CTC>CTG		retinoblastoma-associated protein 140 isoform b							143.0	137.0	139.0					3																	56667420		2203	4300	6503	SO:0001819	synonymous_variant	23272							g.chr3:56667420G>C	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3399C>G	3.37:g.56667420G>C						C3orf63_uc003dib.3_Silent_p.L191L|C3orf63_uc003dic.3_Silent_p.L696L|C3orf63_uc003die.3_Silent_p.L1133L	p.L1072L	NM_015224	NP_056039	Q9UK61	CC063_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)	17	3317	-			1133					A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Silent	SNP	ENST00000493960.2	37	c.3216C>G	CCDS46853.1																																																																																				0.438	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224		11	124	0	0	0	0.000978	0	11	124				
ZNF717	100131827	broad.mit.edu	37	3	75790798	75790798	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr3:75790798G>A	ENST00000478296.1	-	0	273				ZNF717_ENST00000477374.1_Silent_p.D49D|ZNF717_ENST00000491507.1_5'UTR|ZNF717_ENST00000400845.3_Silent_p.D42D|ZNF717_ENST00000422325.1_Silent_p.D49D			Q9BY31	ZN717_HUMAN	zinc finger protein 717						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						CCAGCATCACGTCCCTGTACA	0.502																																							uc011bgi.1		NA																	0					0						c.(145-147)GAC>GAT		zinc finger protein 717							18.0	14.0	15.0					3																	75790798		450	1250	1700			100131827				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr3:75790798G>A	AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.-4C>T	3.37:g.75790798G>A						ZNF717_uc003dpw.3_RNA	p.D49D	NM_001128223	NP_001121695	C9JSV9	C9JSV9_HUMAN			3	470	-			49						Silent	SNP	ENST00000478296.1	37	c.147C>T																																																																																					0.502	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000352764.2	NM_001128223		5	0	0	0	0	0.001168	0	5	0				
ADCY5	111	broad.mit.edu	37	3	123005609	123005609	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr3:123005609G>A	ENST00000462833.1	-	20	4792	c.3580C>T	c.(3580-3582)Cct>Tct	p.P1194S	ADCY5_ENST00000309879.5_Missense_Mutation_p.P844S|ADCY5_ENST00000491190.1_Missense_Mutation_p.P852S|RP11-797D24.4_ENST00000608436.1_RNA	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1194	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.P1194S(1)|p.P1194T(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		TCGTACTGAGGCTTTCGTGCC	0.622											OREG0015741	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003egh.1		NA																	2	Substitution - Missense(2)	p.P1194T(1)	ovary(1)|lung(1)	ovary(4)	4						c.(3580-3582)CCT>TCT		adenylate cyclase 5							167.0	114.0	132.0					3																	123005609		2203	4300	6503	SO:0001583	missense	111				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding	g.chr3:123005609G>A	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3580C>T	3.37:g.123005609G>A	ENSP00000419361:p.Pro1194Ser		OREG0015741	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1523	ADCY5_uc003egg.1_Missense_Mutation_p.P852S	p.P1194S	NM_183357	NP_899200	O95622	ADCY5_HUMAN		GBM - Glioblastoma multiforme(114;0.0342)	20	3580	-			1194			Cytoplasmic (Potential).|Guanylate cyclase 2.		B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	c.3580C>T	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	G	35	5.582708	0.96578	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879	T;T;T	0.33438	1.41;1.41;1.41	4.99	4.99	0.66335	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000001	T	0.68081	0.2962	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.985;0.999	T	0.78254	-0.2275	10	0.72032	D	0.01	.	18.4657	0.90753	0.0:0.0:1.0:0.0	.	1194;852	O95622;B3KWA8	ADCY5_HUMAN;.	S	1194;852;844	ENSP00000419361:P1194S;ENSP00000418537:P852S;ENSP00000308685:P844S	ENSP00000308685:P844S	P	-	1	0	ADCY5	124488299	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.657000	0.98554	2.595000	0.87683	0.563000	0.77884	CCT		0.622	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048		6	41	0	0	0	0.001984	0	6	41				
MCM2	4171	broad.mit.edu	37	3	127339966	127339966	+	Silent	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr3:127339966C>G	ENST00000265056.7	+	15	2743	c.2499C>G	c.(2497-2499)ctC>ctG	p.L833L	MCM2_ENST00000468414.1_3'UTR	NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	833					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)	p.L833L(1)		ovary(3)|skin(2)|stomach(1)	6						AGCTGTTGCTCTTCATACTGA	0.542																																							uc003ejp.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|skin(1)	4						c.(2497-2499)CTC>CTG		minichromosome maintenance complex component 2							121.0	116.0	118.0					3																	127339966		2203	4300	6503	SO:0001819	synonymous_variant	4171				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding	g.chr3:127339966C>G	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.2499C>G	3.37:g.127339966C>G						MCM2_uc011bkm.1_Silent_p.L703L|MCM2_uc010hsl.2_RNA|MCM2_uc011bkn.1_Silent_p.L786L	p.L833L	NM_004526	NP_004517	P49736	MCM2_HUMAN			15	2556	+			833					Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Silent	SNP	ENST00000265056.7	37	c.2499C>G	CCDS3043.1	.	.	.	.	.	.	.	.	.	.	C	9.612	1.131580	0.21041	.	.	ENSG00000073111	ENST00000491422	.	.	.	5.65	1.81	0.25067	.	.	.	.	.	T	0.58133	0.2101	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49688	-0.8913	4	.	.	.	-37.5535	9.4818	0.38906	0.0:0.4656:0.3992:0.1352	.	.	.	.	C	765	.	.	S	+	2	0	MCM2	128822656	0.989000	0.36119	0.998000	0.56505	0.998000	0.95712	0.164000	0.16542	0.048000	0.15891	0.591000	0.81541	TCT		0.542	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1			13	145	0	0	0	0.001368	0	13	145				
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		555	Substitution - Missense(555)	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1624-1626)GAA>AAA		phosphoinositide-3-kinase, catalytic, alpha							56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178936082G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)					p.E542K	NM_006218	NP_006209	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		10	1781	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		542		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).	PI3K helical.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1624G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			10	74	0	0	0	0.000978	0	10	74				
ABLIM2	84448	broad.mit.edu	37	4	8082509	8082509	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:8082509C>T	ENST00000341937.5	-	5	539	c.475G>A	c.(475-477)Gaa>Aaa	p.E159K	ABLIM2_ENST00000361737.5_Missense_Mutation_p.E159K|ABLIM2_ENST00000428004.2_Missense_Mutation_p.E159K|ABLIM2_ENST00000407564.3_Missense_Mutation_p.E159K|ABLIM2_ENST00000318888.4_5'UTR|ABLIM2_ENST00000447017.2_Missense_Mutation_p.E159K|ABLIM2_ENST00000546334.1_Missense_Mutation_p.E159K|ABLIM2_ENST00000505872.1_Missense_Mutation_p.E159K|ABLIM2_ENST00000545242.1_Missense_Mutation_p.E159K|ABLIM2_ENST00000361581.5_Missense_Mutation_p.E159K|ABLIM2_ENST00000296372.8_Missense_Mutation_p.E159K	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	159	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)	p.E159K(1)		NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						TTCTTGATTTCTGTGCCGCAG	0.557																																							uc003gko.2		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(3)	3						c.(475-477)GAA>AAA		actin binding LIM protein family, member 2							70.0	74.0	72.0					4																	8082509		1941	4144	6085	SO:0001583	missense	84448				axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding	g.chr4:8082509C>T	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.475G>A	4.37:g.8082509C>T	ENSP00000342813:p.Glu159Lys					ABLIM2_uc003gkj.3_Missense_Mutation_p.E159K|ABLIM2_uc003gkm.3_Missense_Mutation_p.E159K|ABLIM2_uc003gkp.2_Missense_Mutation_p.E159K|ABLIM2_uc003gkq.2_Missense_Mutation_p.E159K|ABLIM2_uc003gkr.2_Missense_Mutation_p.E159K|ABLIM2_uc003gks.3_Missense_Mutation_p.E159K|ABLIM2_uc011bwl.1_Missense_Mutation_p.E164K	p.E159K	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN			5	618	-			159			LIM zinc-binding 3.		E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Missense_Mutation	SNP	ENST00000341937.5	37	c.475G>A	CCDS47013.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626875	0.87560	.	.	ENSG00000163995	ENST00000361737;ENST00000400045;ENST00000296372;ENST00000545242;ENST00000546334;ENST00000447017;ENST00000341937;ENST00000361581;ENST00000407564;ENST00000505872;ENST00000428004	D;D;D;D;D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	3.84	3.84	0.44239	Zinc finger, LIM-type (5);	0.056932	0.64402	D	0.000001	D	0.88980	0.6585	L	0.28192	0.835	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.998;0.997;1.0;1.0;0.999;0.973;0.993;1.0	D;D;D;D;D;P;P;D	0.97110	0.935;0.968;0.996;0.999;0.996;0.867;0.906;1.0	D	0.90464	0.4448	10	0.59425	D	0.04	.	15.9556	0.79886	0.0:1.0:0.0:0.0	.	164;159;159;159;159;159;159;159	B7Z6W4;Q6H8Q1-6;Q08E71;Q6H8Q1-2;Q6H8Q1-3;Q6H8Q1;Q19VH0;E9PF39	.;.;.;.;.;ABLM2_HUMAN;.;.	K	159	ENSP00000354887:E159K;ENSP00000296372:E159K;ENSP00000441255:E159K;ENSP00000444365:E159K;ENSP00000393511:E159K;ENSP00000342813:E159K;ENSP00000355003:E159K;ENSP00000384658:E159K;ENSP00000421283:E159K;ENSP00000389410:E159K	ENSP00000296372:E159K	E	-	1	0	ABLIM2	8133409	1.000000	0.71417	0.024000	0.17045	0.882000	0.50991	7.035000	0.76517	1.982000	0.57802	0.455000	0.32223	GAA		0.557	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358862.2	NM_001130083		6	33	0	0	0	0.00308	0	6	33				
CC2D2A	57545	broad.mit.edu	37	4	15539654	15539654	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:15539654G>C	ENST00000503292.1	+	17	2077	c.1897G>C	c.(1897-1899)Gag>Cag	p.E633Q	CC2D2A_ENST00000413206.1_Missense_Mutation_p.E633Q|CC2D2A_ENST00000389652.5_Missense_Mutation_p.E584Q|CC2D2A_ENST00000424120.1_Missense_Mutation_p.E633Q|CC2D2A_ENST00000513811.1_3'UTR	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	633					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)		p.E633Q(1)|p.E584Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						GATAGAGCAGGAGGTGAGGGA	0.612																																							uc010idv.2		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(2)|ovary(1)	3						c.(1897-1899)GAG>CAG		coiled-coil and C2 domain containing 2A isoform							41.0	50.0	47.0					4																	15539654		2148	4262	6410	SO:0001583	missense	57545				cell projection organization	cilium|microtubule basal body		g.chr4:15539654G>C	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.1897G>C	4.37:g.15539654G>C	ENSP00000421809:p.Glu633Gln					CC2D2A_uc003gnx.2_Missense_Mutation_p.E584Q|CC2D2A_uc003gnz.1_RNA|CC2D2A_uc003goa.1_RNA	p.E633Q	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN			17	2142	+			633					A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	37	c.1897G>C	CCDS47026.1	.	.	.	.	.	.	.	.	.	.	G	0.050	-1.252708	0.01469	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000503292;ENST00000389652	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.74	5.39	2.69	0.31865	.	0.260084	0.39083	N	0.001474	T	0.52158	0.1717	N	0.00750	-1.22	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.09377	0.003;0.004	T	0.51252	-0.8729	10	0.05833	T	0.94	.	11.8561	0.52437	0.1254:0.6158:0.2588:0.0	.	633;584	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	Q	633;633;584;584;633;584	ENSP00000403465:E633Q;ENSP00000398391:E633Q;ENSP00000421809:E633Q;ENSP00000374303:E584Q	ENSP00000374303:E584Q	E	+	1	0	CC2D2A	15148752	0.978000	0.34361	0.491000	0.27477	0.165000	0.22458	1.321000	0.33678	0.239000	0.21243	-0.499000	0.04595	GAG		0.612	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522		3	12	0	0	0	0.004672	0	3	12				
PROM1	8842	broad.mit.edu	37	4	16019964	16019964	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:16019964G>A	ENST00000510224.1	-	9	1232	c.984C>T	c.(982-984)agC>agT	p.S328S	PROM1_ENST00000502943.1_5'UTR|PROM1_ENST00000539194.1_Silent_p.S328S|PROM1_ENST00000543373.1_Silent_p.S319S|PROM1_ENST00000540805.1_Silent_p.S328S|PROM1_ENST00000505450.1_Silent_p.S319S|PROM1_ENST00000447510.2_Silent_p.S328S|PROM1_ENST00000508167.1_Silent_p.S319S			O43490	PROM1_HUMAN	prominin 1	328					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)	p.S327S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						GTTCAGGGTTGCTATTCAGCT	0.547																																							uc003goo.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						c.(982-984)AGC>AGT		prominin 1 isoform 1							88.0	83.0	85.0					4																	16019964		2091	4241	6332	SO:0001819	synonymous_variant	8842				camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding	g.chr4:16019964G>A	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.984C>T	4.37:g.16019964G>A						PROM1_uc003gor.2_Silent_p.S328S|PROM1_uc003gos.2_Silent_p.S319S|PROM1_uc003got.2_Silent_p.S328S|PROM1_uc003gou.2_Silent_p.S319S|PROM1_uc003gop.2_Silent_p.S319S|PROM1_uc003goq.3_Silent_p.S319S|PROM1_uc010iec.1_Silent_p.S206S	p.S328S	NM_006017	NP_006008	O43490	PROM1_HUMAN			8	1196	-			328			Extracellular (Potential).		Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Silent	SNP	ENST00000510224.1	37	c.984C>T	CCDS47029.1																																																																																				0.547	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017		7	36	0	0	0	0.004482	0	7	36				
STIM2	57620	broad.mit.edu	37	4	27004688	27004688	+	Silent	SNP	T	T	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:27004688T>C	ENST00000467011.1	+	7	1368	c.943T>C	c.(943-945)Ttg>Ctg	p.L315L	STIM2_ENST00000237364.5_Silent_p.L402L|STIM2_ENST00000382009.3_Silent_p.L402L|STIM2_ENST00000465503.1_Silent_p.L315L|STIM2_ENST00000467087.1_Silent_p.L315L|STIM2_ENST00000412829.2_Silent_p.L402L	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	315					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)	p.L402L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				TGAATGTGAATTGAGTAGACG	0.398																																							uc003gsh.3		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(1204-1206)TTG>CTG		stromal interaction molecule 2							122.0	120.0	121.0					4																	27004688		2203	4300	6503	SO:0001819	synonymous_variant	57620				activation of store-operated calcium channel activity|calcium ion transport|cellular calcium ion homeostasis|negative regulation of calcium ion transport via store-operated calcium channel activity	endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel regulator activity|calcium ion binding|protein binding	g.chr4:27004688T>C	AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.943T>C	4.37:g.27004688T>C						STIM2_uc003gsg.3_Silent_p.L402L|STIM2_uc010iex.2_Silent_p.L402L|STIM2_uc010iey.2_Silent_p.L26L	p.L402L	NM_020860	NP_065911	Q9P246	STIM2_HUMAN			7	1420	+		Breast(46;0.0503)	315			Cytoplasmic (Potential).|Potential.		A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Silent	SNP	ENST00000467011.1	37	c.1204T>C	CCDS54752.1																																																																																				0.398	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000356861.1	NM_020860		7	59	0	0	0	0.001984	0	7	59				
UBA6	55236	broad.mit.edu	37	4	68499189	68499189	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:68499189C>G	ENST00000322244.5	-	23	2075	c.2016G>C	c.(2014-2016)aaG>aaC	p.K672N		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	672					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)	p.K672N(1)		central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						CACTCTGTATCTTCTAGAATG	0.348																																							uc003hdg.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2014-2016)AAG>AAC		ubiquitin-activating enzyme E1-like 2							71.0	74.0	73.0					4																	68499189		2203	4299	6502	SO:0001583	missense	55236				protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding	g.chr4:68499189C>G	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.2016G>C	4.37:g.68499189C>G	ENSP00000313454:p.Lys672Asn						p.K672N	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN			23	2068	-			672					A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	ENST00000322244.5	37	c.2016G>C	CCDS3516.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.116899	0.37339	.	.	ENSG00000033178	ENST00000322244	T	0.41758	0.99	5.47	3.75	0.43078	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.044204	0.85682	D	0.000000	T	0.29028	0.0721	L	0.39898	1.24	0.80722	D	1	B	0.14012	0.009	B	0.15870	0.014	T	0.06734	-1.0810	10	0.16896	T	0.51	-8.8425	6.9368	0.24470	0.0:0.6141:0.0:0.3859	.	672	A0AVT1	UBA6_HUMAN	N	672	ENSP00000313454:K672N	ENSP00000313454:K672N	K	-	3	2	UBA6	68181784	0.593000	0.26840	1.000000	0.80357	0.974000	0.67602	-0.252000	0.08806	0.686000	0.31488	0.585000	0.79938	AAG		0.348	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227		10	80	0	0	0	0.006214	0	10	80				
FRAS1	80144	broad.mit.edu	37	4	79373458	79373458	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:79373458G>C	ENST00000264895.6	+	47	7153	c.6713G>C	c.(6712-6714)aGa>aCa	p.R2238T		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2238					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.R2239T(1)|p.R2238T(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TTGATCTACAGAATCACCAGA	0.458																																							uc003hlb.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(5)	5						c.(6712-6714)AGA>ACA		Fraser syndrome 1							57.0	59.0	58.0					4																	79373458		1977	4165	6142	SO:0001583	missense	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79373458G>C	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.6713G>C	4.37:g.79373458G>C	ENSP00000264895:p.Arg2238Thr						p.R2238T	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN			47	7153	+			2237			CSPG 10.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	c.6713G>C	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.066|0.066	-1.212384|-1.212384	0.01555|0.01555	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000512123|ENST00000264895	.|T	.|0.39787	.|1.06	5.95|5.95	5.1|5.1	0.69264|0.69264	.|.	.|0.164213	.|0.52532	.|D	.|0.000078	T|T	0.16085|0.16085	0.0387|0.0387	N|N	0.02842|0.02842	-0.48|-0.48	0.80722|0.80722	D|D	1|1	.|B	.|0.09022	.|0.002	.|B	.|0.04013	.|0.001	T|T	0.11641|0.11641	-1.0579|-1.0579	5|10	.|0.06099	.|T	.|0.92	.|.	9.0576|9.0576	0.36414|0.36414	0.2303:0.0:0.7697:0.0|0.2303:0.0:0.7697:0.0	.|.	.|2238	.|E9PHH6	.|.	H|T	466|2238	.|ENSP00000264895:R2238T	.|ENSP00000264895:R2238T	Q|R	+|+	3|2	2|0	FRAS1|FRAS1	79592482|79592482	0.821000|0.821000	0.29204|0.29204	0.989000|0.989000	0.46669|0.46669	0.089000|0.089000	0.18198|0.18198	1.477000|1.477000	0.35431|0.35431	1.508000|1.508000	0.48769|0.48769	0.655000|0.655000	0.94253|0.94253	CAG|AGA		0.458	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				9	42	0	0	0	0.004482	0	9	42				
METTL14	57721	broad.mit.edu	37	4	119631267	119631267	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:119631267G>C	ENST00000388822.5	+	11	1348	c.1181G>C	c.(1180-1182)aGa>aCa	p.R394T	METTL14_ENST00000506780.1_Missense_Mutation_p.R356T			Q9HCE5	MET14_HUMAN	methyltransferase like 14	394					mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)	p.R394T(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)	16						GAAATTGAGAGACTTCGACCA	0.478																																							uc003icf.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1180-1182)AGA>ACA		methyltransferase like 14							85.0	86.0	86.0					4																	119631267		2203	4300	6503	SO:0001583	missense	57721					nucleus	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity	g.chr4:119631267G>C	AB046847	CCDS34053.1	4q26	2009-02-24			ENSG00000145388	ENSG00000145388			29330	protein-coding gene	gene with protein product						10997877	Standard	NM_020961		Approved	KIAA1627	uc003icf.3	Q9HCE5	OTTHUMG00000161167	ENST00000388822.5:c.1181G>C	4.37:g.119631267G>C	ENSP00000373474:p.Arg394Thr					METTL14_uc003icg.2_Missense_Mutation_p.R356T	p.R394T	NM_020961	NP_066012	Q9HCE5	MTL14_HUMAN			11	1297	+			394					A6NIG1|Q969V2	Missense_Mutation	SNP	ENST00000388822.5	37	c.1181G>C	CCDS34053.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.618532	0.46736	.	.	ENSG00000145388	ENST00000388822;ENST00000506780	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.59074	0.2167	M	0.63428	1.95	0.80722	D	1	B;B	0.28880	0.205;0.226	B;B	0.19148	0.013;0.024	T	0.56691	-0.7937	9	0.15952	T	0.53	-0.6427	19.69	0.95996	0.0:0.0:1.0:0.0	.	356;394	D6RBL4;Q9HCE5	.;MTL14_HUMAN	T	394;356	.	ENSP00000373474:R394T	R	+	2	0	METTL14	119850715	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.461000	0.97646	2.648000	0.89879	0.650000	0.86243	AGA		0.478	METTL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364034.3	NM_020961		8	70	0	0	0	0.00308	0	8	70				
FGB	2244	broad.mit.edu	37	4	155491675	155491675	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:155491675G>A	ENST00000302068.4	+	8	1412	c.1349G>A	c.(1348-1350)gGa>gAa	p.G450E	FGB_ENST00000509493.1_Missense_Mutation_p.G231E|FGB_ENST00000502545.1_3'UTR	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	450	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)	p.G450E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TACTGGGGTGGACAGTACACC	0.463																																					NSCLC(106;1133 1613 21870 46110 52656)	NSCLC(106;1133 1613 21870 46110 52656)	uc003ioa.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(1348-1350)GGA>GAA		fibrinogen, beta chain preproprotein	Sucralfate(DB00364)						204.0	171.0	182.0					4																	155491675		2203	4300	6503	SO:0001583	missense	2244				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding	g.chr4:155491675G>A		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.1349G>A	4.37:g.155491675G>A	ENSP00000306099:p.Gly450Glu					FGB_uc003iob.3_3'UTR|FGB_uc010ipv.2_Missense_Mutation_p.G388E|FGB_uc010ipw.2_3'UTR|FGB_uc003ioc.3_Missense_Mutation_p.G231E	p.G450E	NM_005141	NP_005132	P02675	FIBB_HUMAN			8	1388	+	all_hematologic(180;0.215)	Renal(120;0.0458)	450			Fibrinogen C-terminal.		A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	ENST00000302068.4	37	c.1349G>A	CCDS3786.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359863	0.82353	.	.	ENSG00000171564	ENST00000302068;ENST00000537843;ENST00000509493	D;D	0.82711	-1.64;-1.64	5.38	5.38	0.77491	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.90086	0.6903	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;0.961	D;P	0.97110	1.0;0.842	D	0.90542	0.4503	10	0.87932	D	0	.	19.4997	0.95089	0.0:0.0:1.0:0.0	.	433;450	B4E1D3;P02675	.;FIBB_HUMAN	E	450;433;231	ENSP00000306099:G450E;ENSP00000426757:G231E	ENSP00000306099:G450E	G	+	2	0	FGB	155711125	1.000000	0.71417	0.931000	0.37212	0.601000	0.36947	9.740000	0.98839	2.702000	0.92279	0.655000	0.94253	GGA		0.463	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1	NM_005141		7	87	0	0	0	0.001984	0	7	87				
IRF2	3660	broad.mit.edu	37	4	185320141	185320141	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:185320141C>T	ENST00000393593.3	-	7	829	c.622G>A	c.(622-624)Gag>Aag	p.E208K		NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	208					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		TCGTCGCTCTCAGTGGTCACC	0.552																																							uc003iwf.3		NA																	0				ovary(1)	1						c.(622-624)GAG>AAG		interferon regulatory factor 2							129.0	111.0	117.0					4																	185320141		2203	4300	6503	SO:0001583	missense	3660				blood coagulation|cell proliferation|interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	focal adhesion|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr4:185320141C>T		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.622G>A	4.37:g.185320141C>T	ENSP00000377218:p.Glu208Lys						p.E208K	NM_002199	NP_002190	P14316	IRF2_HUMAN		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)	7	822	-		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)	208					D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	37	c.622G>A	CCDS3835.1	.	.	.	.	.	.	.	.	.	.	C	33	5.207332	0.95033	.	.	ENSG00000168310	ENST00000393593;ENST00000502750	D;D	0.84223	-1.82;-1.82	6.02	6.02	0.97574	.	0.122077	0.53938	D	0.000046	D	0.91948	0.7450	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.91423	0.5160	10	0.66056	D	0.02	-14.8333	20.5407	0.99260	0.0:1.0:0.0:0.0	.	208	P14316	IRF2_HUMAN	K	208;65	ENSP00000377218:E208K;ENSP00000423074:E65K	ENSP00000377218:E208K	E	-	1	0	IRF2	185557135	1.000000	0.71417	0.968000	0.41197	0.789000	0.44602	6.300000	0.72776	2.865000	0.98341	0.655000	0.94253	GAG		0.552	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1			6	68	0	0	0	0.00308	0	6	68				
FAT1	2195	broad.mit.edu	37	4	187519168	187519168	+	Missense_Mutation	SNP	C	C	T	rs367812758		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr4:187519168C>T	ENST00000441802.2	-	23	12424	c.12215G>A	c.(12214-12216)gGa>gAa	p.G4072E	FAT1_ENST00000512347.1_5'UTR	NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	4072	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G4072V(1)|p.G4075V(1)|p.G4075E(1)|p.G4072E(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AACAAAGCCTCCGTTGTCGAC	0.413										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	4	Substitution - Missense(4)		lung(4)	ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(12214-12216)GGA>GAA		FAT tumor suppressor 1 precursor							68.0	65.0	66.0					4																	187519168		1886	4123	6009	SO:0001583	missense	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187519168C>T	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.12215G>A	4.37:g.187519168C>T	ENSP00000406229:p.Gly4072Glu	HNSCC(5;0.00058)				FAT1_uc010isn.2_5'Flank|FAT1_uc003ize.2_5'Flank	p.G4072E	NM_005245	NP_005236	Q14517	FAT1_HUMAN			23	12403	-			4072			Extracellular (Potential).|EGF-like 3.			Missense_Mutation	SNP	ENST00000441802.2	37	c.12215G>A	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	4.622	0.115591	0.08831	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000507105	D	0.99764	-6.68	5.31	5.31	0.75309	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.262703	0.41396	D	0.000885	D	0.98661	0.9551	M	0.64676	1.99	0.45129	D	0.998145	B	0.12013	0.005	B	0.11329	0.006	D	0.95265	0.8372	10	0.06365	T	0.9	.	6.366	0.21455	0.0:0.7918:0.0:0.2082	.	4072	Q14517	FAT1_HUMAN	E	4072;4074;4	ENSP00000406229:G4072E	ENSP00000260147:G4074E	G	-	2	0	FAT1	187756162	0.984000	0.35163	0.995000	0.50966	0.260000	0.26232	2.389000	0.44407	2.779000	0.95612	0.655000	0.94253	GGA		0.413	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		4	73	0	0	0	0.001168	0	4	73				
C5orf42	65250	broad.mit.edu	37	5	37169148	37169148	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:37169148C>G	ENST00000508244.1	-	33	7071	c.6978G>C	c.(6976-6978)ttG>ttC	p.L2326F	C5orf42_ENST00000274258.7_Missense_Mutation_p.L1206F|C5orf42_ENST00000425232.2_Missense_Mutation_p.L2326F			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2326						integral component of membrane (GO:0016021)		p.L1206F(1)|p.L2326F(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GTTGAGGTGTCAAATTTTCTT	0.383																																							uc011cpa.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(2)|skin(1)	7						c.(6976-6978)TTG>TTC		hypothetical protein LOC65250							141.0	146.0	145.0					5																	37169148		2203	4300	6503	SO:0001583	missense	65250							g.chr5:37169148C>G		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.6978G>C	5.37:g.37169148C>G	ENSP00000421690:p.Leu2326Phe					C5orf42_uc011coy.1_Missense_Mutation_p.L826F|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.L1401F|C5orf42_uc003jkr.1_Missense_Mutation_p.L359F	p.L2326F	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)		34	7209	-	all_lung(31;0.000616)		2326					A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	c.6978G>C	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	C	12.22	1.873714	0.33069	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.24723	1.85;1.85;1.84;1.85	5.21	2.2	0.27929	.	1.092650	0.07166	N	0.851631	T	0.24084	0.0583	L	0.50333	1.59	0.09310	N	1	B;B	0.21452	0.009;0.056	B;B	0.23150	0.01;0.044	T	0.29912	-0.9996	10	0.38643	T	0.18	.	6.1575	0.20346	0.331:0.58:0.0:0.089	.	2326;1206	E9PH94;Q9H799	.;CE042_HUMAN	F	2326;2326;1206;1374;1206	ENSP00000421690:L2326F;ENSP00000389014:L2326F;ENSP00000274258:L1206F;ENSP00000424223:L1374F	ENSP00000274258:L1206F	L	-	3	2	C5orf42	37204905	0.000000	0.05858	0.007000	0.13788	0.015000	0.08874	0.217000	0.17603	0.543000	0.28864	0.655000	0.94253	TTG		0.383	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073		22	151	0	0	0	0.002299	0	22	151				
MROH2B	133558	broad.mit.edu	37	5	41019038	41019038	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:41019038G>C	ENST00000399564.4	-	25	2974	c.2524C>G	c.(2524-2526)Ctg>Gtg	p.L842V	MROH2B_ENST00000506092.2_Missense_Mutation_p.L397V	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	842								p.L842V(1)									AGATTTTCCAGAGGTGGAAGG	0.483																																							uc003jmj.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|central_nervous_system(2)	8						c.(2524-2526)CTG>GTG		HEAT repeat family member 7B2							96.0	92.0	94.0					5																	41019038		1964	4151	6115	SO:0001583	missense	133558						binding	g.chr5:41019038G>C		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2524C>G	5.37:g.41019038G>C	ENSP00000382476:p.Leu842Val					HEATR7B2_uc003jmi.3_Missense_Mutation_p.L397V	p.L842V	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN			25	3014	-			842					Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	c.2524C>G	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	9.263	1.043715	0.19748	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.05717	3.4;3.4	6.02	2.95	0.34219	Armadillo-type fold (1);	0.000000	0.45606	D	0.000359	T	0.03651	0.0104	N	0.02539	-0.55	0.27772	N	0.943465	D	0.65815	0.995	P	0.57152	0.814	T	0.38564	-0.9655	10	0.08837	T	0.75	.	4.0202	0.09662	0.193:0.0:0.6185:0.1884	.	842	Q7Z745	HTRB2_HUMAN	V	397;547;842	ENSP00000441504:L397V;ENSP00000382476:L842V	ENSP00000296803:L547V	L	-	1	2	HEATR7B2	41054795	0.976000	0.34144	0.998000	0.56505	0.938000	0.57974	0.187000	0.16998	1.569000	0.49696	0.655000	0.94253	CTG		0.483	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		5	42	0	0	0	0.000602	0	5	42				
SKIV2L2	23517	broad.mit.edu	37	5	54603853	54603853	+	Silent	SNP	A	A	G	rs145515923		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:54603853A>G	ENST00000230640.5	+	1	266	c.12A>G	c.(10-12)gcA>gcG	p.A4A	SKIV2L2_ENST00000545714.1_5'UTR|SKIV2L2_ENST00000504388.1_3'UTR|DHX29_ENST00000251636.5_5'Flank	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	4					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.A4A(1)		NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TGGCGGACGCATTCGGAGATG	0.577																																					Melanoma(2;92 134 23744 29976 33782)	Melanoma(2;92 134 23744 29976 33782)	uc003jpy.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(10-12)GCA>GCG		superkiller viralicidic activity 2-like 2							98.0	89.0	92.0					5																	54603853		2203	4300	6503	SO:0001819	synonymous_variant	23517				maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr5:54603853A>G	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.12A>G	5.37:g.54603853A>G						SKIV2L2_uc011cqi.1_5'UTR|DHX29_uc003jpx.2_5'Flank|DHX29_uc010ivw.2_5'Flank	p.A4A	NM_015360	NP_056175	P42285	SK2L2_HUMAN			1	278	+		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)	4					Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Silent	SNP	ENST00000230640.5	37	c.12A>G	CCDS3967.1																																																																																				0.577	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1			7	75	0	0	0	0.004482	0	7	75				
BHMT	635	broad.mit.edu	37	5	78417047	78417047	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:78417047G>C	ENST00000274353.5	+	5	591	c.484G>C	c.(484-486)Gaa>Caa	p.E162Q	BHMT_ENST00000524080.1_Intron|DMGDH_ENST00000520388.1_5'UTR	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	162	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.E162Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	CCAGTATTTTGAACACGTTGA	0.413																																							uc003kfu.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(484-486)GAA>CAA		betaine-homocysteine methyltransferase	L-Methionine(DB00134)						131.0	124.0	126.0					5																	78417047		2203	4300	6503	SO:0001583	missense	635				protein methylation|regulation of homocysteine metabolic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding	g.chr5:78417047G>C	BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.484G>C	5.37:g.78417047G>C	ENSP00000274353:p.Glu162Gln					BHMT_uc011cti.1_Intron	p.E162Q	NM_001713	NP_001704	Q93088	BHMT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	5	589	+		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)	162			Hcy-binding.		Q9UNI9	Missense_Mutation	SNP	ENST00000274353.5	37	c.484G>C	CCDS4046.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038877	0.75617	.	.	ENSG00000145692	ENST00000274353	T	0.12361	2.69	5.33	5.33	0.75918	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.40247	0.1109	M	0.86651	2.83	0.80722	D	1	D	0.63880	0.993	P	0.59703	0.862	T	0.27640	-1.0068	10	0.29301	T	0.29	-1.2877	19.3886	0.94570	0.0:0.0:1.0:0.0	.	162	Q93088	BHMT1_HUMAN	Q	162	ENSP00000274353:E162Q	ENSP00000274353:E162Q	E	+	1	0	BHMT	78452803	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.223000	0.95203	2.642000	0.89623	0.655000	0.94253	GAA		0.413	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226961.1	NM_001713		5	66	0	0	0	0.001984	0	5	66				
GPR98	84059	broad.mit.edu	37	5	90020705	90020705	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:90020705G>C	ENST00000405460.2	+	46	9901	c.9805G>C	c.(9805-9807)Ggc>Cgc	p.G3269R		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3269					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.G3269R(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATCAGCTTCTGGCTGGTGTTT	0.333																																							uc003kju.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(11)|central_nervous_system(3)|pancreas(2)	16						c.(9805-9807)GGC>CGC		G protein-coupled receptor 98 precursor							133.0	127.0	129.0					5																	90020705		1809	4064	5873	SO:0001583	missense	84059				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr5:90020705G>C	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.9805G>C	5.37:g.90020705G>C	ENSP00000384582:p.Gly3269Arg					GPR98_uc003kjt.2_Missense_Mutation_p.G975R|GPR98_uc003kjv.2_Missense_Mutation_p.G869R	p.G3269R	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)	46	9901	+		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)	3269			Extracellular (Potential).		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	c.9805G>C	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.377285	0.42105	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.26957	1.7	5.64	3.63	0.41609	.	0.494037	0.25017	N	0.033788	T	0.19967	0.0480	L	0.54323	1.7	0.80722	D	1	B;P	0.34780	0.306;0.468	B;B	0.29267	0.054;0.1	T	0.04373	-1.0956	10	0.41790	T	0.15	.	6.5944	0.22664	0.3931:0.0:0.6069:0.0	.	3269;3269	E7ETI5;Q8WXG9	.;GPR98_HUMAN	R	3269	ENSP00000384582:G3269R	ENSP00000296619:G3269R	G	+	1	0	GPR98	90056461	1.000000	0.71417	0.978000	0.43139	0.980000	0.70556	1.806000	0.38892	1.394000	0.46624	0.650000	0.86243	GGC		0.333	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		15	173	0	0	0	0.006122	0	15	173				
KCTD16	57528	broad.mit.edu	37	5	143853393	143853393	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:143853393C>T	ENST00000507359.3	+	3	2094	c.1003C>T	c.(1003-1005)Cgc>Tgc	p.R335C	KCTD16_ENST00000512467.1_Missense_Mutation_p.R335C	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	335					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)		p.R335C(1)		large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			TCCCGTGACACGCCAGACCAA	0.597																																							uc003lnm.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(1)|skin(1)	4						c.(1003-1005)CGC>TGC		potassium channel tetramerisation domain							88.0	82.0	84.0					5																	143853393		2203	4300	6503	SO:0001583	missense	57528					cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr5:143853393C>T	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1003C>T	5.37:g.143853393C>T	ENSP00000426548:p.Arg335Cys					KCTD16_uc003lnn.1_Missense_Mutation_p.R335C	p.R335C	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		4	1632	+		all_hematologic(541;0.118)	335					Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	37	c.1003C>T	CCDS34260.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.032570	0.93575	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.50813	0.73;0.73	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.56140	0.1965	N	0.14661	0.345	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.61262	-0.7098	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	335	Q68DU8	KCD16_HUMAN	C	335	ENSP00000424151:R335C;ENSP00000426548:R335C	ENSP00000426548:R335C	R	+	1	0	KCTD16	143833586	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.400000	0.79949	2.941000	0.99782	0.655000	0.94253	CGC		0.597	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368		17	58	0	0	0	0.00499	0	17	58				
FBXO38	81545	broad.mit.edu	37	5	147819233	147819233	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:147819233G>A	ENST00000340253.5	+	19	3216	c.3048G>A	c.(3046-3048)caG>caA	p.Q1016Q	FBXO38_ENST00000296701.6_Silent_p.Q771Q|FBXO38_ENST00000394370.3_Silent_p.Q941Q|FBXO38_ENST00000513826.1_Silent_p.Q771Q			Q6PIJ6	FBX38_HUMAN	F-box protein 38	1016					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q1016Q(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGGAGCAGAAGCTATTTA	0.448																																							uc003lpf.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)	6						c.(3046-3048)CAG>CAA		F-box protein 38 isoform b							116.0	109.0	111.0					5																	147819233		2203	4300	6503	SO:0001819	synonymous_variant	81545					cytoplasm|nucleus		g.chr5:147819233G>A	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.3048G>A	5.37:g.147819233G>A						FBXO38_uc003lpg.1_Silent_p.Q941Q|FBXO38_uc003lph.2_Silent_p.Q771Q	p.Q1016Q	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		19	3168	+			1016					Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Silent	SNP	ENST00000340253.5	37	c.3048G>A																																																																																					0.448	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793		9	102	0	0	0	0.008291	0	9	102				
ABLIM3	22885	broad.mit.edu	37	5	148624548	148624548	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:148624548G>A	ENST00000506113.1	+	15	1938	c.1456G>A	c.(1456-1458)Gag>Aag	p.E486K	RP11-331K21.1_ENST00000522685.1_RNA|ABLIM3_ENST00000309868.7_Missense_Mutation_p.E486K|ABLIM3_ENST00000504238.1_Missense_Mutation_p.E375K|ABLIM3_ENST00000356541.3_Missense_Mutation_p.E375K|AC012613.2_ENST00000523176.1_RNA|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000508983.1_Missense_Mutation_p.E453K|ABLIM3_ENST00000326685.7_Missense_Mutation_p.E391K|ABLIM3_ENST00000517451.1_5'UTR			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	486					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)	p.E486K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCGGAGTCTGAGTACTGGAC	0.542																																							uc003lpy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1456-1458)GAG>AAG		actin binding LIM protein family, member 3							106.0	96.0	100.0					5																	148624548		2203	4300	6503	SO:0001583	missense	22885				axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding	g.chr5:148624548G>A	AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1456G>A	5.37:g.148624548G>A	ENSP00000425394:p.Glu486Lys					ABLIM3_uc003lpz.1_Missense_Mutation_p.E486K|ABLIM3_uc003lqa.1_Missense_Mutation_p.E383K|ABLIM3_uc003lqb.2_Missense_Mutation_p.E375K|ABLIM3_uc003lqc.1_Missense_Mutation_p.E453K|ABLIM3_uc003lqd.1_Missense_Mutation_p.E391K|ABLIM3_uc003lqf.2_Missense_Mutation_p.E375K|ABLIM3_uc003lqe.1_Missense_Mutation_p.E375K	p.E486K	NM_014945	NP_055760	O94929	ABLM3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		16	1707	+			486					A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	ENST00000506113.1	37	c.1456G>A	CCDS4294.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989914	0.74589	.	.	ENSG00000173210	ENST00000326685;ENST00000356541;ENST00000309868;ENST00000506113;ENST00000504238;ENST00000508983	T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28	5.07	5.07	0.68467	.	0.158934	0.56097	D	0.000033	T	0.32102	0.0818	L	0.39898	1.24	0.58432	D	0.999998	B;B;P	0.36315	0.223;0.223;0.547	B;B;B	0.32928	0.049;0.049;0.155	T	0.10776	-1.0615	10	0.41790	T	0.15	.	18.4502	0.90700	0.0:0.0:1.0:0.0	.	391;375;486	O94929-3;O94929-2;O94929	.;.;ABLM3_HUMAN	K	391;375;486;486;375;453	ENSP00000315841:E391K;ENSP00000348938:E375K;ENSP00000310309:E486K;ENSP00000425394:E486K;ENSP00000421183:E375K;ENSP00000420855:E453K	ENSP00000310309:E486K	E	+	1	0	ABLIM3	148604741	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.602000	0.90868	2.368000	0.80403	0.467000	0.42956	GAG		0.542	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373435.1	NM_014945		5	70	0	0	0	0.000602	0	5	70				
CD74	972	broad.mit.edu	37	5	149782841	149782841	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:149782841G>A	ENST00000009530.7	-	7	661	c.660C>T	c.(658-660)atC>atT	p.I220I	CD74_ENST00000353334.6_Intron|CD74_ENST00000377795.3_Intron|CD74_ENST00000524315.1_Intron			P04233	HG2A_HUMAN	CD74 molecule, major histocompatibility complex, class II invariant chain	220	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				activation of MAPK activity (GO:0000187)|antigen processing and presentation of endogenous antigen (GO:0019883)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|chaperone mediated protein folding requiring cofactor (GO:0051085)|defense response (GO:0006952)|immunoglobulin mediated immune response (GO:0016064)|intracellular protein transport (GO:0006886)|macrophage migration inhibitory factor signaling pathway (GO:0035691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of peptide secretion (GO:0002792)|negative regulation of T cell differentiation (GO:0045581)|negative thymic T cell selection (GO:0045060)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of type 2 immune response (GO:0002830)|positive thymic T cell selection (GO:0045059)|prostaglandin biosynthetic process (GO:0001516)|protein complex assembly (GO:0006461)|regulation of macrophage activation (GO:0043030)|signal transduction (GO:0007165)|T cell selection (GO:0045058)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|macrophage migration inhibitory factor receptor complex (GO:0035692)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|NOS2-CD74 complex (GO:0035693)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)|vacuole (GO:0005773)	beta-amyloid binding (GO:0001540)|cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|macrophage migration inhibitory factor binding (GO:0035718)|MHC class II protein binding (GO:0042289)|MHC class II protein binding, via antigen binding groove (GO:0042658)|MHC class II protein complex binding (GO:0023026)|protein binding involved in protein folding (GO:0044183)	p.I220I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)	5		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGACAGCAGGGATGTGGCTGA	0.572			T	ROS1	NSCLC																																		uc003lsc.2		NA		Dom	yes		5	5q32	972	T	"""CD74 molecule, major histocompatibility complex, class II invariant chain"""			E	ROS1		NSCLC		1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(658-660)ATC>ATT		CD74 antigen isoform a							193.0	202.0	199.0					5																	149782841		2170	4269	6439	SO:0001819	synonymous_variant	972				antigen processing and presentation of endogenous antigen|cell proliferation|immunoglobulin mediated immune response|intracellular protein transport|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of peptide secretion|positive regulation of B cell proliferation|positive regulation of chemokine (C-X-C motif) ligand 2 production|positive regulation of cytokine-mediated signaling pathway|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of macrophage cytokine production|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation|prostaglandin biosynthetic process|protein complex assembly|regulation of macrophage activation	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|lysosome|receptor complex	beta-amyloid binding|cytokine receptor activity|identical protein binding|MHC class II protein binding	g.chr5:149782841G>A		CCDS34276.1, CCDS47308.1, CCDS47309.1	5q32	2012-09-20	2006-03-28		ENSG00000019582	ENSG00000019582		"""CD molecules"""	1697	protein-coding gene	gene with protein product	"""HLA-DR-gamma"", ""Ia-associated invariant chain"", ""gamma chain of class II antigens"", ""MHC HLA-DR gamma chain"""	142790	"""CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)"""	DHLAG		6324166, 3001652	Standard	NM_004355		Approved		uc003lsc.3	P04233	OTTHUMG00000163559	ENST00000009530.7:c.660C>T	5.37:g.149782841G>A						CD74_uc003lsb.2_Intron|CD74_uc003lse.2_Intron|CD74_uc003lsd.2_Intron|CD74_uc003lsf.1_Silent_p.I220I	p.I220I	NM_001025159	NP_001020330	P04233	HG2A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		7	671	-		all_hematologic(541;0.224)	220			Thyroglobulin type-1.|Extracellular (Potential).		A8K7R1|B4DNE8|D3DQG3|D3DQG4|Q14597|Q29832|Q5U0J8|Q8SNA0|Q8WLP6	Silent	SNP	ENST00000009530.7	37	c.660C>T	CCDS47309.1	.	.	.	.	.	.	.	.	.	.	G	7.328	0.618302	0.14129	.	.	ENSG00000019582	ENST00000518797	.	.	.	5.61	2.43	0.29744	.	.	.	.	.	T	0.57198	0.2037	.	.	.	0.35830	D	0.825222	.	.	.	.	.	.	T	0.61163	-0.7118	4	.	.	.	-24.963	9.8062	0.40795	0.3105:0.0:0.6895:0.0	.	.	.	.	S	215	.	.	P	-	1	0	CD74	149763034	1.000000	0.71417	0.998000	0.56505	0.661000	0.39034	1.488000	0.35551	0.725000	0.32318	0.561000	0.74099	CCC		0.572	CD74-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374178.1	NM_004355		14	151	0	0	0	0.00245	0	14	151				
G3BP1	10146	broad.mit.edu	37	5	151183593	151183593	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:151183593G>A	ENST00000394123.3	+	12	1487	c.1342G>A	c.(1342-1344)Gga>Aga	p.G448R	G3BP1_ENST00000356245.3_Missense_Mutation_p.G448R|G3BP1_ENST00000543466.1_Missense_Mutation_p.G266R			Q13283	G3BP1_HUMAN	GTPase activating protein (SH3 domain) binding protein 1	448	Gly-rich.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Ras protein signal transduction (GO:0007265)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.G448R(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|skin(3)|urinary_tract(2)	29		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			CCCTCCCCGTGGAGGCATGGT	0.612																																							uc003lun.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|ovary(1)	4						c.(1342-1344)GGA>AGA		Ras-GTPase-activating protein SH3-domain-binding							84.0	88.0	86.0					5																	151183593		2203	4300	6503	SO:0001583	missense	10146				Ras protein signal transduction|transport	cytosol|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|endonuclease activity|protein binding|RNA binding	g.chr5:151183593G>A	BC006997	CCDS4319.1	5q33.1	2013-02-12	2006-11-01		ENSG00000145907	ENSG00000145907		"""RNA binding motif (RRM) containing"""	30292	protein-coding gene	gene with protein product	"""Ras-GTPase-activating protein SH3-domain-binding protein"""	608431				8649363, 9889278	Standard	NM_005754		Approved	HDH-VIII, G3BP	uc003lum.3	Q13283	OTTHUMG00000130123	ENST00000394123.3:c.1342G>A	5.37:g.151183593G>A	ENSP00000377681:p.Gly448Arg					G3BP1_uc003lum.2_Missense_Mutation_p.G448R|G3BP1_uc011dcu.1_Missense_Mutation_p.G266R|G3BP1_uc010jhz.2_Missense_Mutation_p.G266R|G3BP1_uc003luq.2_Missense_Mutation_p.G116R	p.G448R	NM_005754	NP_005745	Q13283	G3BP1_HUMAN	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		12	1513	+		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	448			Gly-rich.		Q5HYE9	Missense_Mutation	SNP	ENST00000394123.3	37	c.1342G>A	CCDS4319.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600855	0.87055	.	.	ENSG00000145907	ENST00000394123;ENST00000543466;ENST00000356245;ENST00000274596	T;T;T	0.80653	-1.21;-1.4;-1.21	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.88991	0.6588	M	0.68952	2.095	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	D	0.89628	0.3853	10	0.87932	D	0	-0.0067	19.4633	0.94927	0.0:0.0:1.0:0.0	.	448	Q13283	G3BP1_HUMAN	R	448;266;448;290	ENSP00000377681:G448R;ENSP00000445035:G266R;ENSP00000348578:G448R	ENSP00000274596:G290R	G	+	1	0	G3BP1	151163786	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	8.939000	0.92951	2.666000	0.90696	0.655000	0.94253	GGA		0.612	G3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252431.1	NM_005754		11	107	0	0	0	0.008291	0	11	107				
FABP6	2172	broad.mit.edu	37	5	159640748	159640748	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:159640748G>A	ENST00000393980.4	+	3	203	c.57G>A	c.(55-57)ctG>ctA	p.L19L	FABP6_ENST00000393982.1_Silent_p.L19L	NM_001130958.1	NP_001124430.1	P51161	FABP6_HUMAN	fatty acid binding protein 6, ileal	0					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.L19L(1)		breast(1)|kidney(1)|large_intestine(1)|lung(2)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCAGGTTCTGAGAGCTGTGT	0.507																																					Colon(29;562 677 12756 16385 20992)	Colon(29;562 677 12756 16385 20992)	uc003lxx.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(55-57)CTG>CTA		gastrotropin isoform 1							138.0	143.0	141.0					5																	159640748		2059	4226	6285	SO:0001819	synonymous_variant	2172				bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity	g.chr5:159640748G>A	U19869	CCDS4349.1, CCDS43393.1	5q23-q35	2013-03-01	2008-08-01		ENSG00000170231	ENSG00000170231		"""Fatty acid binding protein family"""	3561	protein-coding gene	gene with protein product	"""illeal lipid-binding protein"", ""ileal bile acid binding protein"", ""gastrotropin"""	600422				7894165, 7619861	Standard	NM_001130958		Approved	I-15P, ILLBP, I-BAP, ILBP3, I-BABP, ILBP, I-BALB	uc003lxx.1	P51161	OTTHUMG00000130329	ENST00000393980.4:c.57G>A	5.37:g.159640748G>A						FABP6_uc003lxz.1_Silent_p.L19L	p.L19L	NM_001130958	NP_001124430	P51161	FABP6_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		3	203	+	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Error:Variant_position_missing_in_P51161_after_alignment					Q07DR7|Q8TBI3|Q9UGI7	Silent	SNP	ENST00000393980.4	37	c.57G>A	CCDS43393.1																																																																																				0.507	FABP6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252678.4	NM_001040442		15	116	0	0	0	0.00499	0	15	116				
MAT2B	27430	broad.mit.edu	37	5	162943529	162943529	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr5:162943529G>C	ENST00000321757.6	+	5	671	c.532G>C	c.(532-534)Gct>Cct	p.A178P	MAT2B_ENST00000518095.1_Missense_Mutation_p.A178P|MAT2B_ENST00000280969.5_Missense_Mutation_p.A167P	NM_013283.3	NP_037415.1	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta	178					cellular nitrogen compound metabolic process (GO:0034641)|extracellular polysaccharide biosynthetic process (GO:0045226)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|regulation of catalytic activity (GO:0050790)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|methionine adenosyltransferase complex (GO:0048269)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dTDP-4-dehydrorhamnose reductase activity (GO:0008831)|enzyme binding (GO:0019899)|methionine adenosyltransferase regulator activity (GO:0048270)	p.A167P(1)		endometrium(3)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	14	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)	TCTAGGAGCTGCTGTTTTGAG	0.348																																							uc003lzk.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(532-534)GCT>CCT		methionine adenosyltransferase II, beta isoform	L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)						74.0	75.0	75.0					5																	162943529		2203	4300	6503	SO:0001583	missense	27430				extracellular polysaccharide biosynthetic process|methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol|methionine adenosyltransferase complex|nucleus	dTDP-4-dehydrorhamnose reductase activity|methionine adenosyltransferase regulator activity|protein binding	g.chr5:162943529G>C	AF182814	CCDS4364.1, CCDS4365.1	5q34-q35	2011-09-14			ENSG00000038274	ENSG00000038274		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	6905	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 23E, member 1"""	605527				9055605, 10644686, 19027726	Standard	NM_182796		Approved	MATIIbeta, SDR23E1	uc003lzk.4	Q9NZL9	OTTHUMG00000130379	ENST00000321757.6:c.532G>C	5.37:g.162943529G>C	ENSP00000325425:p.Ala178Pro					MAT2B_uc003lzj.2_Missense_Mutation_p.A167P|MAT2B_uc003lzl.1_Missense_Mutation_p.A178P|MAT2B_uc003lzm.2_5'Flank	p.A178P	NM_013283	NP_037415	Q9NZL9	MAT2B_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	5	640	+	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	178					B2R5Y6|Q1WAI7|Q27J92|Q3LIE8|Q567T7|Q6NYC7|Q9BS89|Q9H3E1|Q9UJ54	Missense_Mutation	SNP	ENST00000321757.6	37	c.532G>C	CCDS4365.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988856	0.93106	.	.	ENSG00000038274	ENST00000280969;ENST00000321757;ENST00000421814;ENST00000518095;ENST00000415433	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.32	5.32	0.75619	NAD(P)-binding domain (1);	0.051491	0.85682	D	0.000000	T	0.68081	0.2962	M	0.84683	2.71	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;P	0.63957	0.92;0.92;0.885	T	0.71909	-0.4450	10	0.54805	T	0.06	.	19.3661	0.94461	0.0:0.0:1.0:0.0	.	178;178;167	Q9NZL9-3;Q9NZL9;Q9NZL9-2	.;MAT2B_HUMAN;.	P	167;178;113;178;72	ENSP00000280969:A167P;ENSP00000325425:A178P;ENSP00000397371:A113P;ENSP00000428046:A178P	ENSP00000280969:A167P	A	+	1	0	MAT2B	162876107	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.888000	0.92464	2.661000	0.90470	0.650000	0.86243	GCT		0.348	MAT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252749.2	NM_013283		15	54	0	0	0	0.003163	0	15	54				
RANBP9	10048	broad.mit.edu	37	6	13644815	13644815	+	Silent	SNP	G	G	A	rs186966416	byFrequency	TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr6:13644815G>A	ENST00000011619.3	-	6	1132	c.1074C>T	c.(1072-1074)atC>atT	p.I358I	RANBP9_ENST00000539980.1_Silent_p.I129I	NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	358					axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)	p.I358I(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			CTCGATCTCCGATAGGAAATC	0.378													G|||	2	0.000399361	0.0	0.0029	5008	,	,		15180	0.0		0.0	False		,,,				2504	0.0						uc003nbb.2		NA																	1	Substitution - coding silent(1)		lung(1)	lung(1)|skin(1)	2						c.(1072-1074)ATC>ATT		RAN binding protein 9							152.0	145.0	147.0					6																	13644815		2203	4300	6503	SO:0001819	synonymous_variant	10048				axon guidance|microtubule nucleation|protein complex assembly	cytosol|microtubule associated complex|nucleus	Ran GTPase binding	g.chr6:13644815G>A	AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.1074C>T	6.37:g.13644815G>A						RANBP9_uc003nba.2_Silent_p.I17I	p.I358I	NM_005493	NP_005484	Q96S59	RANB9_HUMAN	Epithelial(50;0.223)		6	1133	-	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	358					A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Silent	SNP	ENST00000011619.3	37	c.1074C>T	CCDS4529.1																																																																																				0.378	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1			14	142	0	0	0	0.004007	0	14	142				
NRSN1	140767	broad.mit.edu	37	6	24134591	24134591	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr6:24134591G>A	ENST00000378491.4	+	3	337	c.36G>A	c.(34-36)caG>caA	p.Q12Q	NRSN1_ENST00000378478.1_Silent_p.Q12Q|NRSN1_ENST00000378475.1_Silent_p.Q12Q	NM_080723.4	NP_542454.3			neurensin 1									p.Q12H(1)|p.Q12Q(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	22						GGTCCAGGCAGGCACAGGCTG	0.532																																							uc010jpq.1		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)		0						c.(34-36)CAG>CAA		neurensin 1							120.0	112.0	115.0					6																	24134591		2203	4300	6503	SO:0001819	synonymous_variant	140767				nervous system development	growth cone|integral to membrane|neuronal cell body|transport vesicle		g.chr6:24134591G>A	AF418980	CCDS4549.1	6p22.1	2008-02-05	2006-07-04	2006-07-04	ENSG00000152954	ENSG00000152954			17881	protein-coding gene	gene with protein product			"""vesicular membrane protein p24"""	VMP		12463420	Standard	NM_080723		Approved	p24	uc010jpq.1	Q8IZ57	OTTHUMG00000016406	ENST00000378491.4:c.36G>A	6.37:g.24134591G>A							p.Q12Q	NM_080723	NP_542454	Q8IZ57	NRSN1_HUMAN			3	273	+			12						Silent	SNP	ENST00000378491.4	37	c.36G>A	CCDS4549.1																																																																																				0.532	NRSN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043866.1	NM_080723		7	40	0	0	0	0.00308	0	7	40				
ZNF391	346157	broad.mit.edu	37	6	27368615	27368615	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr6:27368615C>G	ENST00000244576.4	+	3	1011	c.466C>G	c.(466-468)Caa>Gaa	p.Q156E		NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q156E(2)		endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						TATTGAACATCAAAGAACTCA	0.403																																							uc003njf.1		NA																	2	Substitution - Missense(2)		lung(2)	pancreas(2)|skin(1)	3						c.(466-468)CAA>GAA		zinc finger protein 391							89.0	96.0	94.0					6																	27368615		2195	4297	6492	SO:0001583	missense	346157				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:27368615C>G	BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.466C>G	6.37:g.27368615C>G	ENSP00000244576:p.Gln156Glu						p.Q156E	NM_001076781	NP_001070249	Q9UJN7	ZN391_HUMAN			3	984	+			156			C2H2-type 2.		B4DH77	Missense_Mutation	SNP	ENST00000244576.4	37	c.466C>G	CCDS43429.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088723	0.36855	.	.	ENSG00000124613	ENST00000244576	T	0.07327	3.2	4.16	4.16	0.48862	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07188	0.0182	L	0.28694	0.88	0.23831	N	0.996726	D	0.69078	0.997	P	0.55999	0.789	T	0.16630	-1.0396	9	0.66056	D	0.02	.	13.971	0.64240	0.0:1.0:0.0:0.0	.	156	Q9UJN7	ZN391_HUMAN	E	156	ENSP00000244576:Q156E	ENSP00000244576:Q156E	Q	+	1	0	ZNF391	27476594	0.001000	0.12720	0.998000	0.56505	0.918000	0.54935	0.069000	0.14552	1.850000	0.53721	0.563000	0.77884	CAA		0.403	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040145.2	NM_001076781		10	99	0	0	0	0.001855	0	10	99				
CLIC1	1192	broad.mit.edu	37	6	31701437	31701437	+	Silent	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr6:31701437C>T	ENST00000375780.2	-	5	860	c.288G>A	c.(286-288)ctG>ctA	p.L96L	CLIC1_ENST00000395892.1_Silent_p.L96L|CLIC1_ENST00000375779.2_Silent_p.L96L|CLIC1_ENST00000375784.3_Silent_p.L96L			O00299	CLIC1_HUMAN	chloride intracellular channel 1	96	GST C-terminal.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|platelet aggregation (GO:0070527)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of mitochondrial membrane potential (GO:0051881)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|brush border (GO:0005903)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.L96L(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)|skin(1)	7						TCAGAGCTGCCAGCTTGGGGT	0.512																																							uc003nwr.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(286-288)CTG>CTA		chloride intracellular channel 1							55.0	63.0	60.0					6																	31701437		1511	2709	4220	SO:0001819	synonymous_variant	1192				signal transduction	brush border|chloride channel complex|cytoplasm|membrane fraction|nuclear membrane|plasma membrane|soluble fraction	protein binding|voltage-gated chloride channel activity	g.chr6:31701437C>T	U93205	CCDS4719.1	6p21.3	2012-09-26			ENSG00000213719	ENSG00000213719		"""Ion channels / Chloride channels : Intracellular"""	2062	protein-coding gene	gene with protein product		602872				9139710	Standard	NM_001288		Approved	NCC27, p64CLCP	uc003nwr.3	O00299	OTTHUMG00000031103	ENST00000375780.2:c.288G>A	6.37:g.31701437C>T						CLIC1_uc003rje.2_Silent_p.L96L	p.L96L	NM_001288	NP_001279	O00299	CLIC1_HUMAN			4	552	-			96			GST C-terminal.		Q15089|Q502X1	Silent	SNP	ENST00000375780.2	37	c.288G>A	CCDS4719.1																																																																																				0.512	CLIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076167.3	NM_001288		8	55	0	0	0	0.006214	0	8	55				
CENPQ	55166	broad.mit.edu	37	6	49456172	49456172	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr6:49456172G>C	ENST00000335783.3	+	7	679	c.585G>C	c.(583-585)gaG>gaC	p.E195D		NM_018132.3	NP_060602.2	Q7L2Z9	CENPQ_HUMAN	centromere protein Q	195					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.E195D(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(4)|ovary(2)|prostate(1)	11	Lung NSC(77;0.0128)					AAGAAGAGGAGAGAGTAAAAC	0.308																																							uc003ozh.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(583-585)GAG>GAC		centromere protein Q							63.0	65.0	64.0					6																	49456172		2203	4298	6501	SO:0001583	missense	55166				CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm		g.chr6:49456172G>C	AK001407	CCDS4925.1	6p12.3	2013-11-05	2006-06-15	2006-06-15	ENSG00000031691	ENSG00000031691			21347	protein-coding gene	gene with protein product		611506	"""chromosome 6 open reading frame 139"""	C6orf139		16622420, 16622419	Standard	NM_018132		Approved	FLJ10545, CENP-Q	uc003ozh.1	Q7L2Z9	OTTHUMG00000014815	ENST00000335783.3:c.585G>C	6.37:g.49456172G>C	ENSP00000337289:p.Glu195Asp						p.E195D	NM_018132	NP_060602	Q7L2Z9	CENPQ_HUMAN			7	674	+	Lung NSC(77;0.0128)		195			Potential.		A8KAF1|Q6IN61|Q9NVS5	Missense_Mutation	SNP	ENST00000335783.3	37	c.585G>C	CCDS4925.1	.	.	.	.	.	.	.	.	.	.	G	4.482	0.089297	0.08632	.	.	ENSG00000031691	ENST00000335783;ENST00000371200	T	0.50001	0.76	5.64	2.73	0.32206	.	0.529823	0.20191	N	0.097311	T	0.18551	0.0445	L	0.45581	1.43	0.09310	N	1	B	0.25351	0.124	B	0.27076	0.076	T	0.06862	-1.0803	10	0.36615	T	0.2	-0.0481	4.8443	0.13505	0.1857:0.178:0.6362:0.0	.	195	Q7L2Z9	CENPQ_HUMAN	D	195	ENSP00000337289:E195D	ENSP00000337289:E195D	E	+	3	2	CENPQ	49564131	0.008000	0.16893	0.077000	0.20336	0.032000	0.12392	-0.021000	0.12504	1.530000	0.49136	0.644000	0.83932	GAG		0.308	CENPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040855.2	NM_018132		5	95	0	0	0	0.001168	0	5	95				
AKAP12	9590	broad.mit.edu	37	6	151670162	151670162	+	Silent	SNP	T	T	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr6:151670162T>G	ENST00000253332.1	+	3	825	c.636T>G	c.(634-636)gcT>gcG	p.A212A	AKAP12_ENST00000359755.5_Silent_p.A107A|AKAP12_ENST00000354675.6_Silent_p.A114A|snoU13_ENST00000458767.1_RNA|AKAP12_ENST00000490177.1_3'UTR|AKAP12_ENST00000402676.2_Silent_p.A212A			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	212					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.A212A(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CAGCAGGGGCTGGCGACCACA	0.517																																					Melanoma(141;1616 1805 10049 24534 51979)	Melanoma(141;1616 1805 10049 24534 51979)	uc011eep.1		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8						c.(634-636)GCT>GCG		A kinase (PRKA) anchor protein 12 isoform 1							57.0	62.0	60.0					6																	151670162		2203	4300	6503	SO:0001819	synonymous_variant	9590				G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding	g.chr6:151670162T>G	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.636T>G	6.37:g.151670162T>G						AKAP12_uc003qoe.2_Silent_p.A212A|AKAP12_uc003qof.2_Silent_p.A114A|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Silent_p.A107A	p.A212A	NM_005100	NP_005091	Q02952	AKA12_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)	4	876	+		Ovarian(120;0.125)	212					O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	37	c.636T>G	CCDS5229.1																																																																																				0.517	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1			7	73	0	0	0	0.006214	0	7	73				
SYNE1	23345	broad.mit.edu	37	6	152560670	152560670	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr6:152560670C>G	ENST00000367255.5	-	108	20666	c.20065G>C	c.(20065-20067)Gag>Cag	p.E6689Q	SYNE1_ENST00000265368.4_Missense_Mutation_p.E6689Q|SYNE1_ENST00000341594.5_Missense_Mutation_p.E6301Q|SYNE1_ENST00000448038.1_Missense_Mutation_p.E6618Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.E6618Q|SYNE1_ENST00000356820.4_Missense_Mutation_p.E1213Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6689					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E6689Q(2)|p.E6618Q(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGTCTCACCTCTAGAATGTAC	0.463										HNSCC(10;0.0054)																													uc010kiw.2		NA																	3	Substitution - Missense(3)		lung(3)	central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(20065-20067)GAG>CAG		spectrin repeat containing, nuclear envelope 1							139.0	110.0	120.0					6																	152560670		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152560670C>G	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20065G>C	6.37:g.152560670C>G	ENSP00000356224:p.Glu6689Gln	HNSCC(10;0.0054)				SYNE1_uc010kiv.2_Missense_Mutation_p.E1213Q|SYNE1_uc003qos.3_Missense_Mutation_p.E1213Q|SYNE1_uc003qot.3_Missense_Mutation_p.E6618Q|SYNE1_uc003qou.3_Missense_Mutation_p.E6689Q	p.E6689Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	108	20667	-		Ovarian(120;0.0955)	6689			Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.20065G>C	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854882	0.51376	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.54479	0.66;0.65;0.57;0.65;0.75;2.76	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000007	T	0.59293	0.2183	L	0.37800	1.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.57734	-0.7760	10	0.46703	T	0.11	.	19.8351	0.96655	0.0:1.0:0.0:0.0	.	6689;6689;6618	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	Q	6689;6618;6689;6618;6301;1213	ENSP00000356224:E6689Q;ENSP00000396024:E6618Q;ENSP00000265368:E6689Q;ENSP00000390975:E6618Q;ENSP00000341887:E6301Q;ENSP00000349276:E1213Q	ENSP00000265368:E6689Q	E	-	1	0	SYNE1	152602363	1.000000	0.71417	0.987000	0.45799	0.903000	0.53119	7.487000	0.81328	2.687000	0.91594	0.655000	0.94253	GAG		0.463	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		8	64	0	0	0	0.008291	0	8	64				
EIF3B	8662	broad.mit.edu	37	7	2409165	2409165	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr7:2409165G>C	ENST00000360876.4	+	10	1518	c.1462G>C	c.(1462-1464)Gat>Cat	p.D488H	EIF3B_ENST00000397011.2_Missense_Mutation_p.D488H	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B									p.D488H(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		TGAAGACAAAGATATTCCAGC	0.478																																							uc003slx.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1462-1464)GAT>CAT		eukaryotic translation initiation factor 3,							191.0	195.0	194.0					7																	2409165		2203	4300	6503	SO:0001583	missense	8662				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity	g.chr7:2409165G>C	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1462G>C	7.37:g.2409165G>C	ENSP00000354125:p.Asp488His					EIF3B_uc003sly.2_Missense_Mutation_p.D488H|EIF3B_uc003sma.2_Missense_Mutation_p.D216H	p.D488H	NM_003751	NP_003742	P55884	EIF3B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)	10	1545	+		Ovarian(82;0.0253)	488						Missense_Mutation	SNP	ENST00000360876.4	37	c.1462G>C	CCDS5332.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.813408	0.70912	.	.	ENSG00000106263	ENST00000314800;ENST00000360876;ENST00000397011;ENST00000489558	T;T	0.05649	3.41;3.41	5.77	5.77	0.91146	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.11239	0.0274	L	0.56280	1.765	0.80722	D	1	B	0.23806	0.091	B	0.23852	0.049	T	0.04509	-1.0946	10	0.56958	D	0.05	-36.211	20.3473	0.98799	0.0:0.0:1.0:0.0	.	488	P55884	EIF3B_HUMAN	H	488;488;488;412	ENSP00000354125:D488H;ENSP00000380206:D488H	ENSP00000316638:D488H	D	+	1	0	EIF3B	2375691	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.559000	0.98135	2.884000	0.98904	0.655000	0.94253	GAT		0.478	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1			16	226	0	0	0	0.004007	0	16	226				
CCDC129	223075	broad.mit.edu	37	7	31683040	31683040	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr7:31683040C>T	ENST00000407970.3	+	11	2094	c.2056C>T	c.(2056-2058)Cag>Tag	p.Q686*	CCDC129_ENST00000319386.3_Nonsense_Mutation_p.Q538*|CCDC129_ENST00000409210.1_Nonsense_Mutation_p.Q594*|CCDC129_ENST00000451887.2_Nonsense_Mutation_p.Q712*	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	686								p.Q538*(1)|p.Q686*(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						TACTTTGGGTCAGATACTACC	0.512																																							uc003tcj.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(2056-2058)CAG>TAG		coiled-coil domain containing 129							75.0	72.0	73.0					7																	31683040		2203	4300	6503	SO:0001587	stop_gained	223075							g.chr7:31683040C>T	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2056C>T	7.37:g.31683040C>T	ENSP00000384416:p.Gln686*					CCDC129_uc011kad.1_Nonsense_Mutation_p.Q696*|CCDC129_uc003tci.1_Nonsense_Mutation_p.Q537*|CCDC129_uc011kae.1_Nonsense_Mutation_p.Q712*|CCDC129_uc003tck.1_Nonsense_Mutation_p.Q594*	p.Q686*	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN			11	3049	+			686					A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Nonsense_Mutation	SNP	ENST00000407970.3	37	c.2056C>T	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	C	36	5.855276	0.97030	.	.	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	.	.	.	4.89	2.82	0.32997	.	0.745404	0.11454	N	0.562519	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-16.7377	5.9263	0.19114	0.2562:0.5397:0.204:0.0	.	.	.	.	X	538;686;712;696;594	.	ENSP00000313062:Q538X	Q	+	1	0	CCDC129	31649565	0.027000	0.19231	0.240000	0.24138	0.469000	0.32828	0.603000	0.24149	1.018000	0.39521	0.655000	0.94253	CAG		0.512	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300		12	47	0	0	0	0.000978	0	12	47				
DDC	1644	broad.mit.edu	37	7	50531022	50531022	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr7:50531022G>A	ENST00000444124.2	-	14	1550	c.1350C>T	c.(1348-1350)atC>atT	p.I450I	DDC_ENST00000426377.1_Silent_p.I372I|DDC_ENST00000357936.5_Silent_p.I450I|DDC_ENST00000431062.1_Silent_p.I357I	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	450					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)	p.I450I(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	TGCGAGAACAGATGGCAAAGC	0.522																																							uc003tpf.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1348-1350)ATC>ATT		dopa decarboxylase (aromatic L-amino acid	Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)						137.0	121.0	126.0					7																	50531022		2203	4300	6503	SO:0001819	synonymous_variant	1644				cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding	g.chr7:50531022G>A		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.1350C>T	7.37:g.50531022G>A						DDC_uc010kza.2_Silent_p.I365I|DDC_uc003tpg.3_Silent_p.I450I	p.I450I	NM_000790	NP_000781	P20711	DDC_HUMAN			14	1436	-	Glioma(55;0.08)|all_neural(89;0.245)		450					C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Silent	SNP	ENST00000444124.2	37	c.1350C>T	CCDS5511.1	.	.	.	.	.	.	.	.	.	.	G	4.190	0.033980	0.08101	.	.	ENSG00000132437	ENST00000430300	.	.	.	5.44	1.55	0.23275	.	.	.	.	.	T	0.52805	0.1757	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37865	-0.9687	4	.	.	.	-19.8801	5.4893	0.16767	0.3702:0.1429:0.4869:0.0	.	.	.	.	F	331	.	.	S	-	2	0	DDC	50498516	1.000000	0.71417	0.993000	0.49108	0.352000	0.29268	1.511000	0.35801	0.004000	0.14682	0.655000	0.94253	TCT		0.522	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1			6	46	0	0	0	0.001168	0	6	46				
HIP1	3092	broad.mit.edu	37	7	75178196	75178196	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr7:75178196C>T	ENST00000336926.6	-	23	2425	c.2399G>A	c.(2398-2400)aGa>aAa	p.R800K	HIP1_ENST00000434438.2_Missense_Mutation_p.R800K	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	800	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.R802K(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TACCTCTATTCTGGCCGTGGC	0.547			T	PDGFRB	CMML																																		uc003uds.1		NA		Dom	yes		7	7q11.23	3092	T	huntingtin interacting protein 1			L	PDGFRB		CMML		1	Substitution - Missense(1)		lung(1)	lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						c.(2398-2400)AGA>AAA		huntingtin interacting protein 1							209.0	199.0	202.0					7																	75178196		2203	4300	6503	SO:0001583	missense	3092				activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton	g.chr7:75178196C>T	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2399G>A	7.37:g.75178196C>T	ENSP00000336747:p.Arg800Lys					HIP1_uc011kfz.1_Missense_Mutation_p.R677K	p.R800K	NM_005338	NP_005329	O00291	HIP1_HUMAN			23	2440	-			800			I/LWEQ.		B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	c.2399G>A	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	c	26.7	4.764673	0.90020	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.27890	1.64;1.64	4.91	4.91	0.64330	I/LWEQ (1);	0.043766	0.85682	D	0.000000	T	0.42359	0.1199	L	0.39514	1.22	0.50171	D	0.999852	P;B	0.46064	0.872;0.321	P;B	0.61397	0.888;0.087	T	0.08106	-1.0738	10	0.11485	T	0.65	-22.09	16.6608	0.85240	0.0:1.0:0.0:0.0	.	800;800	E7ES17;O00291	.;HIP1_HUMAN	K	800	ENSP00000336747:R800K;ENSP00000410300:R800K	ENSP00000336747:R800K	R	-	2	0	HIP1	75016132	1.000000	0.71417	0.998000	0.56505	0.807000	0.45602	7.375000	0.79646	2.290000	0.77057	0.561000	0.74099	AGA		0.547	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338		20	198	0	0	0	0.001882	0	20	198				
ZNF655	79027	broad.mit.edu	37	7	99170993	99170993	+	Missense_Mutation	SNP	C	C	T	rs141925358		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr7:99170993C>T	ENST00000394163.2	+	3	1445	c.1262C>T	c.(1261-1263)tCa>tTa	p.S421L	ZNF655_ENST00000425063.1_3'UTR|ZNF655_ENST00000424881.1_Missense_Mutation_p.S456L|ZNF655_ENST00000419215.2_3'UTR|GS1-259H13.10_ENST00000455905.1_Intron|GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000252713.4_Missense_Mutation_p.S421L|ZNF655_ENST00000493277.1_Missense_Mutation_p.S456L	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	421					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S456L(1)|p.S421L(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					AGTCAAACCTCATGCCTTATT	0.373																																							uc003urh.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(1261-1263)TCA>TTA		zinc finger protein 655 isoform a		C	LEU/SER,LEU/SER,LEU/SER,LEU/SER	1,4405	2.1+/-5.4	0,1,2202	96.0	93.0	94.0		1262,1367,1367,1262	4.2	0.9	7	dbSNP_134	94	0,8600		0,0,4300	no	missense,missense,missense,missense	ZNF655	NM_001009960.1,NM_001083956.1,NM_001085368.1,NM_138494.2	145,145,145,145	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	421/492,456/527,456/527,421/492	99170993	1,13005	2203	4300	6503	SO:0001583	missense	79027				G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding	g.chr7:99170993C>T	AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.1262C>T	7.37:g.99170993C>T	ENSP00000377718:p.Ser421Leu					ZNF655_uc010lga.2_Missense_Mutation_p.S456L|ZNF655_uc010lgc.2_Missense_Mutation_p.S456L|ZNF655_uc003urj.2_Missense_Mutation_p.S421L|ZNF655_uc003urk.2_Missense_Mutation_p.S258L|ZNF655_uc010lgd.2_Missense_Mutation_p.S258L	p.S421L	NM_138494	NP_612503	Q8N720	ZN655_HUMAN			3	1655	+	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)		421			C2H2-type 6.		A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Missense_Mutation	SNP	ENST00000394163.2	37	c.1262C>T	CCDS5669.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092308	0.36952	2.27E-4	0.0	ENSG00000197343	ENST00000252713;ENST00000493277;ENST00000424881;ENST00000394163	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.08	4.19	0.49359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.472585	0.15898	N	0.239196	T	0.29061	0.0722	L	0.52011	1.625	0.21950	N	0.999452	B;B	0.23316	0.081;0.083	B;B	0.21917	0.037;0.016	T	0.15838	-1.0423	10	0.72032	D	0.01	-3.0231	10.9229	0.47176	0.0:0.9088:0.0:0.0912	.	456;421	Q8N720-3;Q8N720	.;ZN655_HUMAN	L	421;456;456;421	ENSP00000252713:S421L;ENSP00000419135:S456L;ENSP00000393876:S456L;ENSP00000377718:S421L	ENSP00000252713:S421L	S	+	2	0	ZNF655	99008929	0.000000	0.05858	0.942000	0.38095	0.977000	0.68977	0.003000	0.13083	2.736000	0.93811	0.655000	0.94253	TCA		0.373	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000344929.1	NM_138494		10	64	0	0	0	0.006214	0	10	64				
EPHB4	2050	broad.mit.edu	37	7	100420177	100420177	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr7:100420177T>C	ENST00000358173.3	-	4	992	c.524A>G	c.(523-525)tAc>tGc	p.Y175C	EPHB4_ENST00000477446.1_5'UTR|EPHB4_ENST00000360620.3_Missense_Mutation_p.Y175C|RN7SL750P_ENST00000582814.1_RNA	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	175	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Y175C(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					GAAGGCCAGGTAGAAGCCAGC	0.637																																					GBM(200;2113 3072 25865 52728)	GBM(200;2113 3072 25865 52728)	uc003uwn.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15						c.(523-525)TAC>TGC		EPH receptor B4 precursor							47.0	47.0	47.0					7																	100420177		2203	4300	6503	SO:0001583	missense	2050				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:100420177T>C	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.524A>G	7.37:g.100420177T>C	ENSP00000350896:p.Tyr175Cys					EPHB4_uc003uwm.1_Missense_Mutation_p.Y82C|EPHB4_uc010lhj.1_Missense_Mutation_p.Y175C|EPHB4_uc011kkf.1_Missense_Mutation_p.Y175C|EPHB4_uc011kkg.1_Missense_Mutation_p.Y175C|EPHB4_uc011kkh.1_Missense_Mutation_p.Y175C	p.Y175C	NM_004444	NP_004435	P54760	EPHB4_HUMAN			4	1015	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		175			Extracellular (Potential).		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	ENST00000358173.3	37	c.524A>G	CCDS5706.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.437041	0.83885	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.06849	3.25;3.25	5.66	5.66	0.87406	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.49305	D	0.000151	T	0.33933	0.0880	M	0.87758	2.905	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	T	0.21177	-1.0253	10	0.87932	D	0	.	13.8246	0.63343	0.0:0.0:0.0:1.0	.	175;175;175;175;175	B5A972;B5A971;B5A970;Q96L35;P54760	.;.;.;.;EPHB4_HUMAN	C	175	ENSP00000353833:Y175C;ENSP00000350896:Y175C	ENSP00000350896:Y175C	Y	-	2	0	EPHB4	100258113	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.155000	0.67459	0.533000	0.62120	TAC		0.637	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444		6	35	0	0	0	0.00308	0	6	35				
PNPLA8	50640	broad.mit.edu	37	7	108119701	108119701	+	Silent	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr7:108119701C>G	ENST00000422087.1	-	11	2407	c.2001G>C	c.(1999-2001)gtG>gtC	p.V667V	PNPLA8_ENST00000453144.1_Silent_p.V567V|PNPLA8_ENST00000388728.5_Silent_p.V605V|PNPLA8_ENST00000257694.8_Silent_p.V667V|PNPLA8_ENST00000436062.1_Silent_p.V667V|PNPLA8_ENST00000426128.2_Silent_p.V605V	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	667					arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)	p.V667V(1)		breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						CCGTGTTTCTCACATCACTCT	0.408																																							uc003vff.1		NA																	1	Substitution - coding silent(1)		lung(1)	breast(2)	2						c.(1999-2001)GTG>GTC		patatin-like phospholipase domain containing 8							211.0	174.0	187.0					7																	108119701		2203	4300	6503	SO:0001819	synonymous_variant	50640				fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity	g.chr7:108119701C>G	AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.2001G>C	7.37:g.108119701C>G						PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Silent_p.V667V|PNPLA8_uc003vfi.1_Silent_p.V567V|PNPLA8_uc003vfj.1_Silent_p.V667V|PNPLA8_uc003vfk.1_Silent_p.V567V	p.V667V	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN			11	2408	-			667					A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	Silent	SNP	ENST00000422087.1	37	c.2001G>C	CCDS34733.1																																																																																				0.408	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337475.1	NM_015723		11	124	0	0	0	0.001368	0	11	124				
BRAF	673	broad.mit.edu	37	7	140453155	140453155	+	Missense_Mutation	SNP	C	C	G	rs397516896		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr7:140453155C>G	ENST00000288602.6	-	15	1840	c.1780G>C	c.(1780-1782)Gat>Cat	p.D594H		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	594	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> G (in NHL). {ECO:0000269|PubMed:14612909}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D594N(9)|p.D594H(2)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	AGACCAAAATCACCTATTTTT	0.378		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3		61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	11	Substitution - Missense(11)	p.D594G(27)|p.D594N(7)|p.D594K(3)|p.D594V(2)|p.D594_T599del(1)|p.D594E(1)	skin(6)|large_intestine(2)|lung(2)|haematopoietic_and_lymphoid_tissue(1)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.(1780-1782)GAT>CAT		B-Raf	Sorafenib(DB00398)						106.0	100.0	102.0					7																	140453155		2203	4300	6503	SO:0001583	missense	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140453155C>G	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1780G>C	7.37:g.140453155C>G	ENSP00000288602:p.Asp594His						p.D594H	NM_004333	NP_004324	P15056	BRAF_HUMAN			15	1841	-	Melanoma(164;0.00956)		594		D -> G (in NHL).	Protein kinase.		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	c.1780G>C	CCDS5863.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.950393	0.92660	.	.	ENSG00000157764	ENST00000288602	D	0.99856	-7.21	5.65	5.65	0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99930	0.9968	H	0.99182	4.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96062	0.9039	10	0.87932	D	0	.	19.7917	0.96461	0.0:1.0:0.0:0.0	.	594	P15056	BRAF_HUMAN	H	594	ENSP00000288602:D594H	ENSP00000288602:D594H	D	-	1	0	BRAF	140099624	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.702000	0.84576	2.686000	0.91538	0.650000	0.86243	GAT		0.378	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333		7	67	0	0	0	0.004482	0	7	67				
PSD3	23362	broad.mit.edu	37	8	18662370	18662370	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr8:18662370G>C	ENST00000327040.8	-	5	1775	c.1673C>G	c.(1672-1674)tCt>tGt	p.S558C	PSD3_ENST00000286485.8_Missense_Mutation_p.S24C|PSD3_ENST00000523619.1_Missense_Mutation_p.S493C|PSD3_ENST00000440756.2_Missense_Mutation_p.S558C	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	558	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.S24C(1)|p.S558C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		CCCCATTTCAGAATGAGCTTC	0.393																																							uc003wza.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(1672-1674)TCT>TGT		ADP-ribosylation factor guanine nucleotide							153.0	158.0	156.0					8																	18662370		2203	4300	6503	SO:0001583	missense	23362				regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity	g.chr8:18662370G>C	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.1673C>G	8.37:g.18662370G>C	ENSP00000324127:p.Ser558Cys					PSD3_uc003wyy.2_Missense_Mutation_p.S24C|PSD3_uc003wyz.2_5'UTR	p.S558C	NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN		Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)	5	1776	-			558			SEC7.		A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	ENST00000327040.8	37	c.1673C>G	CCDS43720.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.30|10.30	1.311923|1.311923	0.23821|0.23821	.|.	.|.	ENSG00000156011|ENSG00000156011	ENST00000521027|ENST00000327040;ENST00000440756;ENST00000286485;ENST00000523619	.|T;T;T;T	.|0.20881	.|2.72;2.72;2.04;2.72	6.07|6.07	4.2|4.2	0.49525|0.49525	.|.	.|0.632224	.|0.14562	.|N	.|0.311979	T|T	0.15565|0.15565	0.0375|0.0375	N|N	0.25890|0.25890	0.77|0.77	0.34481|0.34481	D|D	0.703851|0.703851	.|B;B	.|0.21309	.|0.054;0.011	.|B;B	.|0.27262	.|0.078;0.059	T|T	0.09100|0.09100	-1.0690|-1.0690	5|10	.|0.54805	.|T	.|0.06	.|.	7.6569|7.6569	0.28381|0.28381	0.0889:0.2583:0.6528:0.0|0.0889:0.2583:0.6528:0.0	.|.	.|558;24	.|E9KL50;Q9NYI0-3	.|.;.	L|C	5|558;558;24;493	.|ENSP00000324127:S558C;ENSP00000401704:S558C;ENSP00000286485:S24C;ENSP00000430640:S493C	.|ENSP00000286485:S24C	F|S	-|-	3|2	2|0	PSD3|PSD3	18706650|18706650	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.272000|0.272000	0.26649|0.26649	1.697000|1.697000	0.37784|0.37784	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	TTC|TCT		0.393	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310		19	225	0	0	0	0.008871	0	19	225				
VPS13B	157680	broad.mit.edu	37	8	100155244	100155244	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr8:100155244A>T	ENST00000358544.2	+	13	1805	c.1694A>T	c.(1693-1695)gAt>gTt	p.D565V	VPS13B_ENST00000357162.2_Missense_Mutation_p.D565V|VPS13B_ENST00000395996.1_Missense_Mutation_p.D565V|VPS13B_ENST00000355155.1_Missense_Mutation_p.D565V	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	565					protein transport (GO:0015031)			p.D565V(2)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAAAGTGAAGATTTGGGAACA	0.343																																					Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(1693-1695)GAT>GTT		vacuolar protein sorting 13B isoform 5							82.0	79.0	80.0					8																	100155244		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100155244A>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1694A>T	8.37:g.100155244A>T	ENSP00000351346:p.Asp565Val					VPS13B_uc003yiw.2_Missense_Mutation_p.D565V|VPS13B_uc003yit.2_Missense_Mutation_p.D565V|VPS13B_uc003yiu.1_Missense_Mutation_p.D565V|VPS13B_uc003yix.1_Missense_Mutation_p.D36V	p.D565V	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		13	1805	+	Breast(36;3.73e-07)		565					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.1694A>T	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.337766	0.81911	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996	T;T;T;T	0.79845	-1.31;-0.59;-0.59;-0.3	5.43	5.43	0.79202	.	0.165855	0.42053	D	0.000774	T	0.81293	0.4792	N	0.24115	0.695	0.80722	D	1	D;D;D;D;D	0.67145	0.979;0.996;0.993;0.979;0.989	P;P;P;P;P	0.59546	0.714;0.859;0.726;0.714;0.714	D	0.84221	0.0461	10	0.72032	D	0.01	.	15.4781	0.75501	1.0:0.0:0.0:0.0	.	565;565;565;565;565	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4	.;.;VP13B_HUMAN;.;.	V	565	ENSP00000347281:D565V;ENSP00000349685:D565V;ENSP00000351346:D565V;ENSP00000379318:D565V	ENSP00000347281:D565V	D	+	2	0	VPS13B	100224420	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	8.133000	0.89605	2.047000	0.60756	0.482000	0.46254	GAT		0.343	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		6	47	0	0	0	0.001984	0	6	47				
TBC1D31	93594	broad.mit.edu	37	8	124109655	124109655	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr8:124109655G>C	ENST00000287380.1	+	6	895	c.805G>C	c.(805-807)Gat>Cat	p.D269H	TBC1D31_ENST00000521676.1_Missense_Mutation_p.D164H|TBC1D31_ENST00000327098.5_Missense_Mutation_p.D269H|TBC1D31_ENST00000378080.2_Missense_Mutation_p.D164H|TBC1D31_ENST00000522420.1_Missense_Mutation_p.D164H|TBC1D31_ENST00000309336.3_Missense_Mutation_p.D269H	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	269						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)	p.D269H(1)									ATTTCTTCCTGATAGTTTTGA	0.398																																							uc003ypp.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(805-807)GAT>CAT		WD repeat domain 67 isoform 1							105.0	94.0	98.0					8																	124109655		2203	4300	6503	SO:0001583	missense	93594					centrosome	Rab GTPase activator activity	g.chr8:124109655G>C	AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.805G>C	8.37:g.124109655G>C	ENSP00000287380:p.Asp269His					WDR67_uc011lig.1_Missense_Mutation_p.D269H|WDR67_uc011lih.1_Missense_Mutation_p.D159H|WDR67_uc003ypq.1_RNA|WDR67_uc003ypo.1_Missense_Mutation_p.D269H|WDR67_uc003ypr.2_RNA	p.D269H	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	STAD - Stomach adenocarcinoma(47;0.00527)		6	895	+	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		269					B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	ENST00000287380.1	37	c.805G>C	CCDS6338.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314597	0.81358	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000543408;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000378080	T;T;T;T;T;T	0.72282	-0.64;-0.58;-0.54;1.1;1.1;1.1	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.099118	0.64402	D	0.000002	T	0.82171	0.4979	M	0.81802	2.56	0.54753	D	0.999989	P;P;D	0.56521	0.846;0.952;0.976	P;P;P	0.53988	0.451;0.681;0.739	D	0.84609	0.0677	10	0.87932	D	0	-31.2921	19.6559	0.95842	0.0:0.0:1.0:0.0	.	269;269;269	B7ZL19;Q96DN5;Q3KRB0	.;WDR67_HUMAN;.	H	269;269;148;269;164;164;164	ENSP00000287380:D269H;ENSP00000308358:D269H;ENSP00000312701:D269H;ENSP00000429334:D164H;ENSP00000430628:D164H;ENSP00000367320:D164H	ENSP00000287380:D269H	D	+	1	0	WDR67	124178836	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.341000	0.79300	2.657000	0.90304	0.491000	0.48974	GAT		0.398	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381721.1	NM_145647		8	63	0	0	0	0.004482	0	8	63				
ST3GAL1	6482	broad.mit.edu	37	8	134475673	134475673	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr8:134475673C>G	ENST00000319914.5	-	7	1740	c.713G>C	c.(712-714)aGa>aCa	p.R238T	ST3GAL1_ENST00000522652.1_Missense_Mutation_p.R238T|ST3GAL1_ENST00000521180.1_Missense_Mutation_p.R238T|ST3GAL1_ENST00000399640.2_Missense_Mutation_p.R238T			Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 1	238					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein phosphorylation (GO:0006468)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)	p.R238T(1)		endometrium(3)|large_intestine(2)|lung(11)|prostate(1)	17	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			CTGTTTCACTCTGATCTTTGC	0.547																																							uc003yuk.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(712-714)AGA>ACA		ST3 beta-galactoside alpha-2,3-sialyltransferase							115.0	103.0	107.0					8																	134475673		2203	4300	6503	SO:0001583	missense	6482				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity	g.chr8:134475673C>G	L29555	CCDS6373.1	8q24.22	2013-03-01	2003-01-14	2005-02-07	ENSG00000008513	ENSG00000008513	2.4.99.4	"""Sialyltransferases"""	10862	protein-coding gene	gene with protein product	"""ST3Gal I"""	607187	"""sialyltransferase 4A (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4A		10504389, 7655169	Standard	NM_003033		Approved	ST3O, SIATFL, ST3GalA.1	uc003yuk.2	Q11201	OTTHUMG00000164534	ENST00000319914.5:c.713G>C	8.37:g.134475673C>G	ENSP00000318445:p.Arg238Thr					ST3GAL1_uc003yum.2_Missense_Mutation_p.R238T	p.R238T	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.00721)		8	1542	-	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		238			Lumenal (Potential).		O60677|Q9UN51	Missense_Mutation	SNP	ENST00000319914.5	37	c.713G>C	CCDS6373.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592770	0.28357	.	.	ENSG00000008513	ENST00000319914;ENST00000399640;ENST00000521180;ENST00000522652	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.39	3.05	0.35203	.	0.395144	0.32401	N	0.006159	T	0.19127	0.0459	N	0.26092	0.79	0.27414	N	0.954492	B	0.18741	0.03	B	0.19946	0.027	T	0.15752	-1.0426	10	0.30854	T	0.27	-17.9114	7.421	0.27071	0.0:0.1725:0.0:0.8275	.	238	Q11201	SIA4A_HUMAN	T	238	ENSP00000318445:R238T;ENSP00000414073:R238T;ENSP00000428540:R238T;ENSP00000430515:R238T	ENSP00000318445:R238T	R	-	2	0	ST3GAL1	134544855	0.996000	0.38824	0.987000	0.45799	0.415000	0.31203	1.809000	0.38922	0.458000	0.26988	-0.367000	0.07326	AGA		0.547	ST3GAL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379132.1	NM_003033		6	86	0	0	0	0.001984	0	6	86				
CBWD1	55871	broad.mit.edu	37	9	164038	164038	+	Splice_Site	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr9:164038C>G	ENST00000356521.4	-	5	519		c.e5-1		CBWD1_ENST00000377400.4_Splice_Site|CBWD1_ENST00000382447.4_Splice_Site|CBWD1_ENST00000314367.10_Splice_Site|CBWD1_ENST00000377447.3_Splice_Site|CBWD1_ENST00000431099.2_Splice_Site	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1								ATP binding (GO:0005524)	p.?(2)		kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GCCACTGCACCTGAAAATATA	0.284																																							uc003zga.3		NA																	2	Unknown(2)		lung(2)	ovary(1)	1						c.e5-1		COBW domain containing 1 isoform 1							44.0	70.0	61.0					9																	164038		1423	2635	4058	SO:0001630	splice_region_variant	55871						ATP binding|protein binding	g.chr9:164038C>G	AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.431-1G>C	9.37:g.164038C>G						CBWD1_uc010mgs.2_Splice_Site|CBWD1_uc003zgb.3_Splice_Site_p.G108_splice|CBWD1_uc003zgc.3_Splice_Site_p.G144_splice|CBWD1_uc011llr.1_Splice_Site_p.G108_splice	p.G144_splice	NM_018491	NP_060961	Q9BRT8	CBWD1_HUMAN	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)	5	537	-	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)						A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	Splice_Site	SNP	ENST00000356521.4	37	c.431_splice	CCDS6438.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.304448	0.60305	.	.	ENSG00000172785	ENST00000356521;ENST00000377400;ENST00000382447;ENST00000314367;ENST00000377447;ENST00000431099;ENST00000377347	.	.	.	3.71	3.71	0.42584	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6706	0.77270	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CBWD1	154038	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.833000	0.75334	2.049000	0.60858	0.549000	0.68633	.		0.284	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051463.1	NM_018491	Intron	6	268	0	0	0	0.001168	0	6	268				
NAA35	60560	broad.mit.edu	37	9	88557126	88557126	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr9:88557126A>G	ENST00000361671.5	+	2	185	c.52A>G	c.(52-54)Atg>Gtg	p.M18V	NAA35_ENST00000376040.1_Missense_Mutation_p.M18V	NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit	18					negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)		p.M18V(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						GGAGCTCAGTATGCCAGAAAA	0.388																																							uc004aoi.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|central_nervous_system(1)	3						c.(52-54)ATG>GTG		corneal wound healing-related protein							140.0	129.0	132.0					9																	88557126		2203	4300	6503	SO:0001583	missense	60560				smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane		g.chr9:88557126A>G	AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.52A>G	9.37:g.88557126A>G	ENSP00000354972:p.Met18Val					NAA35_uc004aoj.3_Missense_Mutation_p.M18V|NAA35_uc004aok.1_Missense_Mutation_p.M18V	p.M18V	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN			2	189	+			18					Q5VZE6|Q9H631|Q9H703	Missense_Mutation	SNP	ENST00000361671.5	37	c.52A>G	CCDS6673.1	.	.	.	.	.	.	.	.	.	.	A	1.379	-0.584039	0.03827	.	.	ENSG00000135040	ENST00000361671;ENST00000416045;ENST00000376040	.	.	.	5.11	2.43	0.29744	.	0.355741	0.32244	N	0.006377	T	0.23451	0.0567	N	0.14661	0.345	0.34574	D	0.713767	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17653	-1.0362	9	0.12430	T	0.62	-1.3009	5.6502	0.17612	0.5902:0.3049:0.1048:0.0	.	18;18	Q5VZE6;Q5VZE5	.;NAA35_HUMAN	V	18	.	ENSP00000354972:M18V	M	+	1	0	NAA35	87746946	0.960000	0.32886	0.991000	0.47740	0.962000	0.63368	0.612000	0.24283	0.297000	0.22615	0.456000	0.33151	ATG		0.388	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052906.1	NM_024635		4	86	0	0	0	0.000248	0	4	86				
GADD45G	10912	broad.mit.edu	37	9	92220654	92220654	+	Silent	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr9:92220654C>T	ENST00000252506.6	+	3	337	c.228C>T	c.(226-228)atC>atT	p.I76I	GADD45G_ENST00000375769.1_Silent_p.I58I|GADD45G_ENST00000494726.1_Intron	NM_006705.3	NP_006696.1	O95257	GA45G_HUMAN	growth arrest and DNA-damage-inducible, gamma	76	Homodimerization.				activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I76I(1)		lung(2)	2						CGCTGCAGATCCATTTTACGC	0.647																																					Colon(131;320 2336 18973 23919)	Colon(131;320 2336 18973 23919)	uc004aqq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(226-228)ATC>ATT		growth arrest and DNA-damage-inducible, gamma							78.0	61.0	67.0					9																	92220654		2203	4300	6503	SO:0001819	synonymous_variant	10912				activation of MAPKKK activity|apoptosis|cell differentiation|DNA repair|multicellular organismal development		protein binding	g.chr9:92220654C>T	D83023	CCDS6686.1	9q22.1-q22.2	2008-07-21			ENSG00000130222	ENSG00000130222			4097	protein-coding gene	gene with protein product	"""gadd-related protein, 17 kD"", ""growth arrest and DNA-damage-inducible gamma"""	604949				9827804, 10496071	Standard	NM_006705		Approved	DDIT2, GADD45gamma, GRP17, CR6	uc004aqq.3	O95257	OTTHUMG00000020187	ENST00000252506.6:c.228C>T	9.37:g.92220654C>T						GADD45G_uc004aqr.2_Silent_p.I58I	p.I76I	NM_006705	NP_006696	O95257	GA45G_HUMAN			3	338	+			76					Q5VZ87|Q9C076	Silent	SNP	ENST00000252506.6	37	c.228C>T	CCDS6686.1																																																																																				0.647	GADD45G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053000.1	NM_006705		6	34	0	0	0	0.001168	0	6	34				
GRIN3A	116443	broad.mit.edu	37	9	104390585	104390585	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr9:104390585C>G	ENST00000361820.3	-	4	3051	c.2451G>C	c.(2449-2451)atG>atC	p.M817I		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	817					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.M817I(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TGTACCTTCTCATATATTCAT	0.428																																							uc004bbp.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7						c.(2449-2451)ATG>ATC		glutamate receptor, ionotropic,	Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)						141.0	126.0	131.0					9																	104390585		2203	4300	6503	SO:0001583	missense	116443				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding	g.chr9:104390585C>G		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2451G>C	9.37:g.104390585C>G	ENSP00000355155:p.Met817Ile					GRIN3A_uc004bbq.1_Missense_Mutation_p.M817I	p.M817I	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN			4	3052	-		Acute lymphoblastic leukemia(62;0.0568)	817			Extracellular (Potential).		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	c.2451G>C	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784263	0.90282	.	.	ENSG00000198785	ENST00000361820	T	0.23950	1.88	5.76	5.76	0.90799	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.53318	0.1789	M	0.64170	1.965	0.80722	D	1	B	0.32128	0.357	P	0.56278	0.795	T	0.50734	-0.8793	10	0.87932	D	0	.	19.9658	0.97266	0.0:1.0:0.0:0.0	.	817	Q8TCU5	NMD3A_HUMAN	I	817	ENSP00000355155:M817I	ENSP00000355155:M817I	M	-	3	0	GRIN3A	103430406	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.487000	0.81328	2.721000	0.93114	0.591000	0.81541	ATG		0.428	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			5	57	0	0	0	0.001984	0	5	57				
OR2K2	26248	broad.mit.edu	37	9	114090198	114090198	+	Silent	SNP	G	G	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr9:114090198G>A	ENST00000374428.1	-	1	602	c.603C>T	c.(601-603)ctC>ctT	p.L201L	OR2K2_ENST00000302681.1_Silent_p.L172L			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L201L(1)|p.L172L(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						AGTGATCGATGAGATTCCCAC	0.537																																							uc011lwp.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(514-516)CTC>CTT		olfactory receptor, family 2, subfamily K,							76.0	70.0	72.0					9																	114090198		2203	4300	6503	SO:0001819	synonymous_variant	26248				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:114090198G>A	X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.603C>T	9.37:g.114090198G>A							p.L172L	NM_205859	NP_995581	Q8NGT1	OR2K2_HUMAN			1	516	-			201			Extracellular (Potential).		Q2TA61|Q5VYK4|Q6IFI5	Silent	SNP	ENST00000374428.1	37	c.516C>T																																																																																					0.537	OR2K2-201	KNOWN	basic	protein_coding	protein_coding		NM_205859		5	59	0	0	0	0.001168	0	5	59				
NUP188	23511	broad.mit.edu	37	9	131761475	131761475	+	Silent	SNP	C	C	A			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr9:131761475C>A	ENST00000372577.2	+	33	3561	c.3540C>A	c.(3538-3540)atC>atA	p.I1180I		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1180					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.I1180I(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						TGGATGAAATCCTTGGACCCT	0.547											OREG0003925	type=REGULATORY REGION|Gene=AK025292|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc004bws.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						c.(3538-3540)ATC>ATA		nucleoporin 188kDa							85.0	76.0	79.0					9																	131761475		2203	4300	6503	SO:0001819	synonymous_variant	23511				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr9:131761475C>A	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.3540C>A	9.37:g.131761475C>A			OREG0003925	type=REGULATORY REGION|Gene=AK025292|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1590	NUP188_uc004bwu.2_Silent_p.I523I	p.I1180I	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN			33	3562	+			1180					Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Silent	SNP	ENST00000372577.2	37	c.3540C>A	CCDS35156.1																																																																																				0.547	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			12	57	1	0	2.68362e-12	0.001368	3.67383e-12	12	57				
NUP214	8021	broad.mit.edu	37	9	134006218	134006218	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr9:134006218C>T	ENST00000359428.5	+	5	802	c.658C>T	c.(658-660)Ctt>Ttt	p.L220F	RP11-544A12.4_ENST00000587408.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.L220F|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000587264.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.L220F|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	220	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)	p.L220F(1)		NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GGTCCAGTATCTTCCTGTAAG	0.403			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	Pancreas(4;24 48 25510 30394 32571)	uc004cag.2		NA		Dom	yes		9	9q34.1	8021	T	nucleoporin 214kDa (CAN)			L	DEK|SET|ABL1		AML|T-ALL		1	Substitution - Missense(1)		lung(1)	breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16						c.(658-660)CTT>TTT		nucleoporin 214kDa							98.0	101.0	100.0					9																	134006218		2203	4300	6503	SO:0001583	missense	8021				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding	g.chr9:134006218C>T	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.658C>T	9.37:g.134006218C>T	ENSP00000352400:p.Leu220Phe					NUP214_uc004cah.2_Missense_Mutation_p.L220F|NUP214_uc004caf.1_Missense_Mutation_p.L220F	p.L220F	NM_005085	NP_005076	P35658	NU214_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)	5	769	+	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)	220					A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	c.658C>T	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546006	0.86022	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375	D;D;D	0.94457	-3.43;-3.43;-3.43	5.87	5.87	0.94306	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.37095	N	0.002252	D	0.95357	0.8493	L	0.44542	1.39	0.42656	D	0.99346	D;D	0.89917	1.0;1.0	D;D	0.70487	0.969;0.969	D	0.94567	0.7767	10	0.51188	T	0.08	-20.7507	12.8356	0.57771	0.0:0.926:0.0:0.074	.	220;220	P35658-4;P35658	.;NU214_HUMAN	F	220	ENSP00000352400:L220F;ENSP00000396576:L220F;ENSP00000405014:L220F	ENSP00000352400:L220F	L	+	1	0	NUP214	132996039	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.593000	0.54001	2.941000	0.99782	0.655000	0.94253	CTT		0.403	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085		7	55	0	0	0	0.001984	0	7	55				
TUBBP5	643224	broad.mit.edu	37	9	141070886	141070886	+	RNA	SNP	A	A	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr9:141070886A>G	ENST00000503395.1	+	0	1661									tubulin, beta pseudogene 5																		CACATTCAGCATCCTGCCCTC	0.577																																							uc004com.2		NA																	0					0						c.(289-291)ATC>GTC		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141070886A>G	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070886A>G						TUBBP5_uc010ncq.2_3'UTR	p.I97V							4	550	+									Missense_Mutation	SNP	ENST00000503395.1	37	c.289A>G																																																																																					0.577	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		4	38	0	0	0	0.003163	0	4	38				
TUBBP5	643224	broad.mit.edu	37	9	141070915	141070915	+	RNA	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr9:141070915C>T	ENST00000503395.1	+	0	1690									tubulin, beta pseudogene 5									p.T178T(1)									TGTCAGACACCGTGGTGGAGC	0.522																																							uc004com.2		NA																	1	Substitution - coding silent(1)		prostate(1)		0						c.(316-318)ACC>ACT		RecName: Full=Putative tubulin beta-4q chain;																																						643224							g.chr9:141070915C>T	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070915C>T						TUBBP5_uc010ncq.2_3'UTR	p.T106T							4	579	+									Silent	SNP	ENST00000503395.1	37	c.318C>T																																																																																					0.522	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156		4	50	0	0	0	0.000978	0	4	50				
IL3RA	3563	broad.mit.edu	37	X	1464320	1464320	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chrX:1464320C>T	ENST00000331035.4	+	3	525	c.176C>T	c.(175-177)tCt>tTt	p.S59F	IL3RA_ENST00000381469.2_Intron	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	59					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)	p.S59F(1)		lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GCCGACTATTCTATGCCGGTA	0.348																																							uc004cps.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|lung(1)	3						c.(175-177)TCT>TTT		interleukin 3 receptor, alpha precursor	Sargramostim(DB00020)						234.0	219.0	224.0					X																	1464320		2200	4296	6496	SO:0001583	missense	3563					integral to membrane|plasma membrane	interleukin-3 receptor activity	g.chrX:1464320C>T	M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.176C>T	X.37:g.1464320C>T	ENSP00000327890:p.Ser59Phe					IL3RA_uc011mhd.1_Intron	p.S59F	NM_002183	NP_002174	P26951	IL3RA_HUMAN			3	525	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	59			Extracellular (Potential).		A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Missense_Mutation	SNP	ENST00000331035.4	37	c.176C>T	CCDS14113.1	.	.	.	.	.	.	.	.	.	.	.	0.892	-0.725080	0.03158	.	.	ENSG00000185291	ENST00000331035	T	0.31247	1.5	1.01	-0.482	0.12078	.	69.455400	0.01067	N	0.004753	T	0.16300	0.0392	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14587	-1.0467	10	0.40728	T	0.16	-17.6818	3.6717	0.08276	0.0:0.658:0.0:0.342	.	59	P26951	IL3RA_HUMAN	F	59	ENSP00000327890:S59F	ENSP00000327890:S59F	S	+	2	0	IL3RA	1424320	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.872000	0.04219	-0.434000	0.07275	0.172000	0.16884	TCT		0.348	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055600.3			15	208	0	0	0	0.003163	0	15	208				
EGFL6	25975	broad.mit.edu	37	X	13636018	13636018	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chrX:13636018C>G	ENST00000361306.1	+	8	1205	c.948C>G	c.(946-948)ttC>ttG	p.F316L	EGFL6_ENST00000380602.3_Missense_Mutation_p.F316L	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	316					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.F316L(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						TGCAGCCCTTCAACTATGAAG	0.433																																							uc004cvi.2		NA																	2	Substitution - Missense(2)		lung(2)	breast(2)	2						c.(946-948)TTC>TTG		epidermal growth factor-like protein 6							68.0	70.0	69.0					X																	13636018		2203	4300	6503	SO:0001583	missense	25975				cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding	g.chrX:13636018C>G	AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.948C>G	X.37:g.13636018C>G	ENSP00000355126:p.Phe316Leu					EGFL6_uc004cvj.2_Missense_Mutation_p.F316L|EGFL6_uc011mik.1_Missense_Mutation_p.F217L	p.F316L	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN			8	1188	+			316					B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Missense_Mutation	SNP	ENST00000361306.1	37	c.948C>G	CCDS14155.1	.	.	.	.	.	.	.	.	.	.	C	0.525	-0.860447	0.02610	.	.	ENSG00000198759	ENST00000361306;ENST00000380602	T;T	0.69561	-0.41;-0.29	5.52	3.75	0.43078	.	0.393437	0.30277	N	0.009990	T	0.43656	0.1257	N	0.21373	0.66	0.09310	N	0.999991	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.001	T	0.16748	-1.0392	10	0.11485	T	0.65	.	4.6694	0.12682	0.0:0.498:0.2318:0.2702	.	316;316	Q8IUX8-2;Q8IUX8	.;EGFL6_HUMAN	L	316	ENSP00000355126:F316L;ENSP00000369976:F316L	ENSP00000355126:F316L	F	+	3	2	EGFL6	13545939	1.000000	0.71417	0.002000	0.10522	0.020000	0.10135	0.652000	0.24888	1.118000	0.41863	0.589000	0.80489	TTC		0.433	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055800.1	NM_015507		7	99	0	0	0	0.004482	0	7	99				
ZC4H2	55906	broad.mit.edu	37	X	64141841	64141841	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chrX:64141841G>C	ENST00000374839.3	-	2	187	c.81C>G	c.(79-81)atC>atG	p.I27M	ZC4H2_ENST00000545618.1_Missense_Mutation_p.I22M|ZC4H2_ENST00000447788.2_Missense_Mutation_p.I27M|ZC4H2_ENST00000337990.2_Missense_Mutation_p.I4M|ZC4H2_ENST00000488608.1_5'UTR	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	27				I -> V (in Ref. 4; BAG53957). {ECO:0000305}.	nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)	p.I27M(2)		endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						AACGAGCCTTGATCTTCTCCA	0.468																																							uc004dvu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(79-81)ATC>ATG		zinc finger, C4H2 domain containing							111.0	83.0	93.0					X																	64141841		2203	4300	6503	SO:0001583	missense	55906						metal ion binding|protein binding	g.chrX:64141841G>C	AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.81C>G	X.37:g.64141841G>C	ENSP00000363972:p.Ile27Met					ZC4H2_uc004dvv.2_Missense_Mutation_p.I4M|ZC4H2_uc011mov.1_Missense_Mutation_p.I4M|ZC4H2_uc011mow.1_Missense_Mutation_p.I27M|ZC4H2_uc004dvw.1_Missense_Mutation_p.I27M	p.I27M	NM_018684	NP_061154	Q9NQZ6	ZC4H2_HUMAN			2	169	-			27			Potential.		B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	Missense_Mutation	SNP	ENST00000374839.3	37	c.81C>G	CCDS14380.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022860	0.54683	.	.	ENSG00000126970	ENST00000447788;ENST00000545618;ENST00000374839;ENST00000337990	.	.	.	5.34	3.59	0.41128	.	0.000000	0.85682	D	0.000000	T	0.49081	0.1536	N	0.19112	0.55	0.53688	D	0.999979	D;P	0.59357	0.985;0.94	D;P	0.63877	0.919;0.559	T	0.45934	-0.9227	9	0.41790	T	0.15	.	4.8543	0.13552	0.1841:0.0:0.6471:0.1689	.	27;27	B4DED0;Q9NQZ6	.;ZC4H2_HUMAN	M	27;22;27;4	.	ENSP00000338650:I4M	I	-	3	3	ZC4H2	64058566	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.888000	0.28268	0.573000	0.29400	0.529000	0.55759	ATC		0.468	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056958.1	NM_018684		4	52	0	0	0	0.000248	0	4	52				
FAM155B	27112	broad.mit.edu	37	X	68749637	68749637	+	Silent	SNP	G	G	T	rs201574515		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chrX:68749637G>T	ENST00000252338.4	+	3	1299	c.1257G>T	c.(1255-1257)ccG>ccT	p.P419P		NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	420						integral component of membrane (GO:0016021)		p.P419P(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						CCCTGCTGCCGGTCTCTGGGG	0.612																																							uc004dxk.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(1255-1257)CCG>CCT		transmembrane protein 28							95.0	70.0	79.0					X																	68749637		2203	4300	6503	SO:0001819	synonymous_variant	27112					integral to membrane		g.chrX:68749637G>T	AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.1257G>T	X.37:g.68749637G>T							p.P419P	NM_015686	NP_056501	O75949	F155B_HUMAN			3	1305	+			420					B1ALV6|B9EGK1|D3DVU1	Silent	SNP	ENST00000252338.4	37	c.1257G>T	CCDS35317.1																																																																																				0.612	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686		5	50	1	0	0.000602214	0.000602	0.000794675	5	50				
AFF2	2334	broad.mit.edu	37	X	147743947	147743947	+	Silent	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chrX:147743947C>T	ENST00000370460.2	+	3	1178	c.699C>T	c.(697-699)atC>atT	p.I233I	AFF2_ENST00000370457.5_Silent_p.I229I|AFF2_ENST00000342251.3_Silent_p.I229I|AFF2_ENST00000370458.1_Silent_p.I229I	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	233					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.I233I(2)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TCAAAGAAATCTTTCAATCCA	0.473																																							uc004fcp.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(3)|pancreas(2)	5						c.(697-699)ATC>ATT		fragile X mental retardation 2							139.0	144.0	142.0					X																	147743947		2203	4300	6503	SO:0001819	synonymous_variant	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:147743947C>T	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.699C>T	X.37:g.147743947C>T						AFF2_uc004fco.2_Silent_p.I229I|AFF2_uc004fcq.2_Silent_p.I229I|AFF2_uc004fcr.2_Silent_p.I229I|AFF2_uc011mxb.1_Silent_p.I233I|AFF2_uc004fcs.2_Silent_p.I229I	p.I233I	NM_002025	NP_002016	P51816	AFF2_HUMAN			3	1178	+	Acute lymphoblastic leukemia(192;6.56e-05)		233					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	c.699C>T	CCDS14684.1																																																																																				0.473	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		33	234	0	0	0	0.004289	0	33	234				
WASH6P	653440	broad.mit.edu	37	X	155252691	155252691	+	RNA	SNP	C	C	T			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chrX:155252691C>T	ENST00000461007.1	+	0	1699				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CAGAGAACTACTTCTATGTGC	0.577																																							uc004fnw.1		NA																	0					NA						c.(733-735)TAC>TAT		WAS protein family homolog 1																																						0							g.chrX:155252691C>T	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252691C>T						uc004fnx.3_Silent_p.Y31Y	p.Y245Y	NM_182905	NP_878908					6	1394	+								A6NGF1|Q8N305	Silent	SNP	ENST00000461007.1	37	c.735C>T																																																																																					0.577	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1	NG_008380		5	11	0	0	0	0.001168	0	5	11				
C11orf74	119710	broad.mit.edu	37	11	36669602	36669620	+	Frame_Shift_Del	DEL	TAAGCACCAGCATTCCTTC	TAAGCACCAGCATTCCTTC	-	rs148376199|rs550895322		TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	TAAGCACCAGCATTCCTTC	TAAGCACCAGCATTCCTTC	-	-	TAAGCACCAGCATTCCTTC	TAAGCACCAGCATTCCTTC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr11:36669602_36669620delTAAGCACCAGCATTCCTTC	ENST00000334307.5	+	5	510_528	c.395_413delTAAGCACCAGCATTCCTTC	c.(394-414)gtaagcaccagcattccttccfs	p.VSTSIPS132fs	C11orf74_ENST00000534635.1_Frame_Shift_Del_p.VSTSIPS58fs|C11orf74_ENST00000446510.2_Frame_Shift_Del_p.VSTSIPS132fs|C11orf74_ENST00000347206.4_Frame_Shift_Del_p.VSTSIPS58fs	NM_138787.2	NP_620142.2	Q86VG3	CK074_HUMAN	chromosome 11 open reading frame 74	132										breast(1)|kidney(1)|large_intestine(1)|lung(5)	8	all_lung(20;0.226)	all_hematologic(20;0.0118)				GAGCAGGATGTAAGCACCAGCATTCCTTCCTGTATCCCT	0.452																																							uc001mwy.1		NA																	0					0						c.(394-414)GTAAGCACCAGCATTCCTTCCfs		hypothetical protein LOC119710																																				SO:0001589	frameshift_variant	119710							g.chr11:36669602_36669620delTAAGCACCAGCATTCCTTC	AK095997, BC009561	CCDS7904.1, CCDS60762.1	11p12	2012-08-10			ENSG00000166352	ENSG00000166352			25142	protein-coding gene	gene with protein product						12477932	Standard	NM_001276722		Approved	FLJ38678, HEPIS	uc031pzr.1	Q86VG3	OTTHUMG00000166397	ENST00000334307.5:c.395_413delTAAGCACCAGCATTCCTTC	11.37:g.36669602_36669620delTAAGCACCAGCATTCCTTC	ENSP00000334848:p.Val132fs					C11orf74_uc010rfd.1_RNA|C11orf74_uc001mww.1_Frame_Shift_Del_p.V58fs|C11orf74_uc001mwx.1_RNA|C11orf74_uc001mwz.1_Frame_Shift_Del_p.V58fs|C11orf74_uc010rfe.1_RNA	p.V132fs	NM_138787	NP_620142	Q86VG3	CK074_HUMAN			5	468_486	+	all_lung(20;0.226)	all_hematologic(20;0.0118)	132_138					D3DR18|Q96DD6	Frame_Shift_Del	DEL	ENST00000334307.5	37	c.395_413delTAAGCACCAGCATTCCTTC	CCDS7904.1																																																																																				0.452	C11orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389567.1	NM_138787		9	133	NA	NA	NA	NA	NA	9	133	---	---	---	---
RAD51C	5889	broad.mit.edu	37	17	56774132	56774132	+	Frame_Shift_Del	DEL	G	G	-			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr17:56774132delG	ENST00000337432.4	+	3	554	c.483delG	c.(481-483)gagfs	p.E161fs	RAD51C_ENST00000487921.1_3'UTR|RAD51C_ENST00000583539.1_Frame_Shift_Del_p.E161fs	NM_058216.1	NP_478123.1	O43502	RA51C_HUMAN	RAD51 paralog C	161					blood coagulation (GO:0007596)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|female meiosis sister chromatid cohesion (GO:0007066)|male meiosis I (GO:0007141)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|reciprocal meiotic recombination (GO:0007131)|sister chromatid cohesion (GO:0007062)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			upper_aerodigestive_tract(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTGATACAGAGGGAAGTTTTA	0.423								Homologous recombination	Hereditary Breast-Ovarian Cancer, non-BRCA1/2																														uc002iwu.2		NA																	0					0						c.(481-483)GAGfs	Homologous_recombination	RAD51 homolog C isoform 1							217.0	198.0	204.0					17																	56774132		2203	4300	6503	SO:0001589	frameshift_variant	5889	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2	Familial Cancer Database	BRCAX	blood coagulation|DNA repair	mitochondrion|nucleoplasm|perinuclear region of cytoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity	g.chr17:56774132delG	AF029670	CCDS11611.1, CCDS45745.1	17q25.1	2014-09-17	2013-07-02		ENSG00000108384	ENSG00000108384		"""Fanconi anemia, complementation groups"""	9820	protein-coding gene	gene with protein product		602774	"""RAD51 (S. cerevisiae) homolog C"", ""RAD51 homolog C (S. cerevisiae)"""			9469824, 22167183	Standard	NM_058216		Approved	RAD51L2, FANCO	uc002iwu.3	O43502	OTTHUMG00000141292	ENST00000337432.4:c.483delG	17.37:g.56774132delG	ENSP00000336701:p.Glu161fs					RAD51C_uc010woa.1_Frame_Shift_Del_p.E161fs|RAD51C_uc010ddc.2_RNA|RAD51C_uc002iwv.2_Intron|RAD51C_uc002iww.2_Intron|RAD51C_uc010wob.1_RNA	p.E161fs	NM_058216	NP_478123	O43502	RA51C_HUMAN			3	525	+	Medulloblastoma(34;0.127)|all_neural(34;0.237)		161					O43503|Q3B783	Frame_Shift_Del	DEL	ENST00000337432.4	37	c.483delG	CCDS11611.1																																																																																				0.423	RAD51C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280540.2	NM_058216		11	90	NA	NA	NA	NA	NA	11	90	---	---	---	---
ATP8B3	148229	broad.mit.edu	37	19	1805421	1805421	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr19:1805421delC	ENST00000310127.6	-	10	1094	c.856delG	c.(856-858)gtcfs	p.V286fs	ATP8B3_ENST00000539485.1_Frame_Shift_Del_p.V286fs|ATP8B3_ENST00000525591.1_Frame_Shift_Del_p.V233fs|ATP8B3_ENST00000526092.2_Frame_Shift_Del_p.V233fs	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	286					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGTGGGTGACCATCAGGGCC	0.527																																							uc002ltw.2		NA																	0					0						c.(856-858)GTCfs		ATPase, class I, type 8B, member 3							77.0	74.0	75.0					19																	1805421		1967	4137	6104	SO:0001589	frameshift_variant	148229				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr19:1805421delC	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.856delG	19.37:g.1805421delC	ENSP00000311336:p.Val286fs					ATP8B3_uc002ltv.2_Frame_Shift_Del_p.V233fs|ATP8B3_uc002ltx.2_RNA|ATP8B3_uc002lty.1_Frame_Shift_Del_p.V34fs|ATP8B3_uc002ltz.1_Frame_Shift_Del_p.V233fs	p.V286fs	NM_138813	NP_620168	O60423	AT8B3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	10	1090	-		Hepatocellular(1079;0.137)	286			Cytoplasmic (Potential).		Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Frame_Shift_Del	DEL	ENST00000310127.6	37	c.856delG	CCDS45901.1																																																																																				0.527	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
MAPK12	6300	broad.mit.edu	37	22	50699715	50699715	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5044-01A-21D-1855-08	TCGA-50-5044-10A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	ec034986-4bf7-4554-b635-ca6d9c30da28	27f19543-1a9f-4521-a46a-f4c470a4a5b0	g.chr22:50699715delC	ENST00000215659.8	-	2	451	c.136delG	c.(136-138)gacfs	p.D46fs	MAPK12_ENST00000395780.1_5'UTR|MAPK12_ENST00000497036.1_5'Flank|MAPK12_ENST00000395778.3_Frame_Shift_Del_p.D46fs	NM_002969.3	NP_002960.2	P53778	MK12_HUMAN	mitogen-activated protein kinase 12	46	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle arrest (GO:0007050)|DNA damage induced protein phosphorylation (GO:0006975)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of peptidase activity (GO:0010952)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GTGCGGCCGTCCACGGCCGAG	0.756																																							uc003bkm.1		NA																	0					0						c.(136-138)GACfs		mitogen-activated protein kinase 12							8.0	7.0	8.0					22																	50699715		2134	4208	6342	SO:0001589	frameshift_variant	6300				cell cycle arrest|DNA damage induced protein phosphorylation|muscle organ development|myoblast differentiation|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|Ras protein signal transduction	mitochondrion|nucleoplasm	ATP binding|magnesium ion binding|MAP kinase activity|protein binding	g.chr22:50699715delC	U66243	CCDS14089.1	22q13.3	2012-05-08			ENSG00000188130	ENSG00000188130	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6874	protein-coding gene	gene with protein product		602399		SAPK3		9169156	Standard	NM_002969		Approved	ERK6, PRKM12, p38gamma, SAPK-3	uc003bkm.1	P53778	OTTHUMG00000030145	ENST00000215659.8:c.136delG	22.37:g.50699715delC	ENSP00000215659:p.Asp46fs					MAPK12_uc003bkn.2_5'UTR|MAPK12_uc003bko.2_5'UTR|MAPK12_uc003bkl.1_Frame_Shift_Del_p.D46fs|MAPK12_uc003bkq.2_5'UTR|MAPK12_uc010haw.2_Frame_Shift_Del_p.D46fs	p.D46fs	NM_002969	NP_002960	P53778	MK12_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	2	287	-		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	46			Protein kinase.		Q14260|Q6IC53|Q99588|Q99672	Frame_Shift_Del	DEL	ENST00000215659.8	37	c.136delG	CCDS14089.1																																																																																				0.756	MAPK12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074999.2	NM_002969		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
